Anda di halaman 1dari 36

REFERAT ILMU KEDOKTERAN FORENSIK

TES DNA DALAM ILMU KEDOKTERAN FORENSIK

Diajukan Untuk Memenuhi Tugas dan Melengkapi Syarat dalam Menempuh Program Pendidikan Profesi Dokter

Disusun oleh : Irfan Rohot Uli Manik Nyoman Adhydeva Purusanti Liona Christy Pattinasarany 0561050095 0861050094 0861050097 FK UKI FK UKI FK UKI FK UKI FK UKI

Wella Sinta Marintan Manurung 0861050099 Yudhistira Herlambang 0861050100

Dosen Pembimbing : dr. Gatot Suharto, S.H, Sp.F, MHKes

KEPANITERAAN KLINIK BAGIAN ILMU KEDOKTERAN FORENSIK DAN MEDIKOLEGAL FAKULTAS KEDOKTERAN UNIVERSITAS DIPONEGORO RSUP DR. KARIADI SEMARANG PERIODE 14 MEI 10 JUNI 2012

HALAMAN PENGESAHAN

Telah disetujui oleh dosen pembimbing, referat dari : Nama / NIM : 1. Irfan Rohot Uli Manik 2. Nyoman Adhydeva Purusanti 3. Liona Christy Pattinasarany 0561050095 0861050094 0861050097 FK UKI FK UKI FK UKI FK UKI FK UKI

4. Wella Sinta Marintan Manurung 0861050099 5. Yudhistira Herlambang 0861050100

Fakultas Universitas Bagian Judul Dosen Pembimbing

: Kedokteran Umum : Universitas Kristen Indonesia : Ilmu Kedokteran Forensik : Tes DNA Dalam Ilmu Kedokteran Forensik :dr. Gatot Suharto, S.H, Sp.F, MHKes

Residen Pembimbing : dr. Bianti Diajukan guna melengkapi tugas kepaniteraan Ilmu Kedokteran Forensik Fakultas Kedokteran Universitas Diponegoro Semarang

Semarang, 21 Mei 2012 Dosen Pembimbing

dr.Gatot Suharto, S.H, Sp.F , MHKes

KATA PENGANTAR

Puji syukur kami panjatkan kepada Tuhan Yang Maha Esa karena atas rahmatnya kami dapat menyelesaikan pembuatan refrat yang berjudul Tes DNA Dalam Ilmu Kedokteran Forensik.Kami mengucapkan terima kasih kepada dosen pembimbing kami yang telah membimbing kami sehingga kami telah mengerti tentang referat ini.Terima kasih juga kepada orang tua dan teman-teman yang senantiasa mendukung kami dalam pembuatan refrerat ini. Denga kerendahan hati kami menyadari bahwa penulisan referat ini masih jauh dari sempurna karena keterbatasan kami, karena itu kami mengharapkan masukan untuk perbaikan referat ini di masa yang akan datang. Referat ini dibuat untuk mengetahui lebih jauh tentang bagaimana aplikasi dan kegunaan tes DNA dalam ilmu kedokteran forensik khususnya di Indonesia sehingga kami harapkan referat ini dapat menambah pengetahuan kami dan teman-teman sejawat untuk dapat kami pergunakan di kemudian hari.

Semarang, Mei 2012

Penyusun

DAFTAR ISI

HALAMAN PENGESAHAN ................................................................................................... i KATA PENGANTAR ..............................................................................................................ii DAFTAR ISI ............................................................................................................................iii BAB 1 PENDAHULUAN ....................................................................................................... BAB 2 TINJAUAN PUSTAKA .............................................................................................. BAB 3 KESIMPULAN DAN SARAN ................................................................................... DAFTAR PUSTAKA .............................................................................................................

BAB I PENDAHULUAN 1.1.LATAR BELAKANG


Dalam beberapa tahun terakhir, kita banyak dikejutkan oleh terjadinya bencana massal yang menyebabkan kematian banyak orang.Selain itu kasus kejahatan yang memakan banyak korban jiwa juga cenderung tidak berkurang dari waktu ke waktu.Pada kasus-kasus seperti ini tidak jarang kita jumpai korban jiwa yang tidak dikenal sehingga perlu diidentifikasi, dan salah satu cara mengidentifikasi korban adalah dengan identifikasi DNA. Identifikasi tersebut penting sekali dilakukan terhadap korban meninggal massal karena merupakan perwujudan HAM dan penghormatan terhadap orang yang sudah meninggal, serta untuk menentukan seseorang secara hukum apakah masih hidup atau sudah meninggal.Selain itu juga berkaitan dengan masalah pemberian santunan, warisan, asuransi, pensiun, maupun pengurusan pernikahan kembali bagi pasangan yang ditinggalkan. Identifikasi DNA sendiri merupakan ukuran identifikasi primer (primary identifiers). Selain DNA, identifikasi primer lainnya adalah sidik jari dan gigi geligi. Sedang visual, antropomeri dan pemeriksaan medis merupakan ukuran identifikasi sekunder (secondary identifiers). Wilayah Negara Kesatuan Republik Indonesia secara geografis terletak pada wilayah yang rawan terhadap bencana alam baik yang berupa tanah longsor, gempa bumi, letusan gunung berapi, tsunami, banjir dan lain-lain, yang dapat memakan banyak korban, dan salah satu cara mengidentifikasi korban adalah dengan metode identifikasi DNA. Setiap sarana pelayanan kesehatan sudah selayaknya menyiapkan diri untuk mengantisipasi kejadian bencana di wilayahnya, atau membantu pelayanan kesehatan di wilayah lain yang terkena bencana. Oleh karena itu DNA forensik sangat penting dipahami peranannya dalam menangani korban bencana massal.Atas dasar itu, pada referat ini kami mengambil judul Tes DNA dalam Ilmu Kedokteran Forensik.

1.2.RUMUSAN MASALAH

a. Apakah struktur dan pengertian DNA? Dan apakah hubungannya dengan ilmu kedokteran forensik? b. Bagaimana cara melakukan pengambilan sampel untuk tes DNA? c. Bagaimana cara melakukan persiapan tes DNA? d. Apa saja teknik untuk melakukan tes DNA? e. Bagaimana menentukan analisis hasil tes DNA?

1.3.TUJUAN PEMBAHASAN 1.3.1. Tujuan Umum Tujuan umum dari pembuatan refarat ini adalah memberikan pengetahuan mengenai tes DNA dalam ilmu kedokteran forensik

1.3.2. Tujuan Khusus a. Mengetahui pengertian DNA dan hubungannya dengan ilmu kedokteran forensik b. Mengetahui cara melakukan pengambilan sampel untuk tes DNA c. Mengetahui cara melakukan persiapan tes DNA d. Mengetahui teknik-teknik untuk melakukan tes DNA e. Mengetahui cara menentukan analisis hasil tes DNA

1.4.MANFAAT PEMBAHASAN 1.4.1. Bagi Mahasiswa/mahasiswi Mendapatkan pengetahuan mengenai tes identifikasi DNA dalam ilmu kedokteran forensik

1.4.2. Bagi institusi pendidikan - Bentuk kontribusi pemikiran kepada masyarakat terkait kasus Ilmu Kedokteran Forensik dan Medikolegal - Sebagai materi tinjauan pustaka yang diharapkan dapat melengkapi tinjauan ilmiah yang sudah ada

1.4.3. Bagi institusi penegak keadilan Memberikan informasi mengenai pentingnya penerapan tes DNA dalam identifikasi korban yang ditangani secara hukum

BAB II 2.1. DNA 2.1.1. STRUKTUR DAN PENGERTIAN DNA DNA (deoxyribonucleic acid) adalah suatu struktur molekul yang mengandung materi genetik di dalam nukleus yang ada pada hampir semua sel tubuh kita.Informasi DNA disimpan sebagai kode yang disusun oleh empat basa kimia yang terdiri dari adenine (A), guanine (G), cytosine (C), and thymine (T). DNA manusia terdiri dari kira-kira 3 milyar basa kimia dan lebih dari 99 persen manusia memiliki basa kimia yang sama. Urutan dari basa kimia itulah yang menentukan informasi yang tersedia untuk pertumbuhan dan pembangunan suatu organism. Basa DNA berpasangan satu sama lain, A berpasangan dengan T, sedangkan C dengan G. Setiap basa juga berikatan dengan molekul gula dan molekul fosfat, dan ikatan ini dinamakan nukleotida. Nukleotida disusun sebagai dua untai membentuk heliks ganda spiral. Heliks ganda berbentuk menyerupai tangga, pasangan basa kimia membentuk anak tangga, sedangakan molekul gula dan fosfat membentuk pinggiran vertical tangga.Sepotong DNA terdiri dari jutaan pasangan basa, dengan komponen protein yang dikenal dengan kromosom.DNA dapat berreplikasi sendiri, setiap untai DNA dapat menyajikan diri untuk menduplikasi deretan basa. Hal ini penting saat sel membelah diri karena setiap sel baru harus memiliki salinan DNA yang serupa dengan DNA pada sel yang lama 2.1.2. KROMOSOM Di dalam nukleus sel, molekul DNA terdapat dalam struktur yang menyerupai benang yang disebut kromosom. Setiap kromosom dibagi menjadi lokus yang menandai posisi gen setiap kromosom. Sel tubuh manusia memiliki 23 pasang kromosom yang terdiri dari 22 pasang kromosom autosomal dan satu pasang kromosom seks.Pada wanita kromosom sexnya XX dan pada pria kromosom sexnya XY.Kromosom Y mengandung SRY ( Sex Determining Region Y ) yang berperan menentukan kelelakian seseorang dengan peranannya mengatur terbentuknnya hormon testosterone. Kromosom Y yang bersifat unik karena setiap

kromosom Y pada seorang pria akan diturunkannya secara langsung hanya kepada anak laki-lakinya dan kemudian diteruskan oleh anak laki-lakinnya kepada cucunya hingga keturunan laki-laki selanjutnnya. Peran penting kromosom Y dalam DNA typing antara lain untuk kriminologi dan analisis forensic,analisis orang hilang, kasus warisan yang melibatkan keterkaitan genetic antara anggota keluarga laki-laki,kasus imigrasi untuk menentukan kerabatan genetic, dan kepentingan antropologi (salah satu cabang ilmu sosial yang mempelajari tentang budaya masyarakat suatu etnis tertentu ) 2.1.3. GEN Gen adalah salah satu komponen DNA dan terdiri dari informasi untuk membuat molekul-molekul protein. Setiap protein memberikan fungsi yang spesifik di dalam tubuh.Setiap orang memiliki dua salinan dari setiap gen, masing-masing diwariskan dari kedua orangtuanya. Kebanyakan gen sama pada orang, namun beberapa gen berbeda untuk memberikan atribut fisik yang spesifik pada setiap orang. 2.2. TES DNA 2.2.1. PENGERTIAN TES DNA Tes DNA adalah satu teknik biologi molekuler penanda genetik yang dipakai untuk pengujian terhadap materi profil DNA, yaitu sehimpunan data yang menggambarkan susunan DNA yang dianggap khas untuk individu yang menjadi sampelnya.Hanya sebagian kecil berkas DNA yang dipakai untuk pengujian, seperti bagian DNA yang berisi pengulangan urutan basa (variable number tandam repeats/ VNRT). Tes DNA ini sangat dipercaya dan sudah diakui keabsahannya dapat mengidentifikasi seseorang dengan keakuratan mencapai 100%, sehingga banyak dimanfaatkan dalam analisis, pihak kepolisian maupun pengadilan khususnya untuk membantu mengungkap suatu perkara. Adanya kesalahan bahwa kemiripan pola DNA bisa terjadi secara random (kebetulan) sangat kecil kemungkinannya, yaitu dengan peluang satu diantara satu juta.Jikapun terdapat kesalahan itu disebabkan oleh faktor human error terutama pada kesalahan interpretasi fragmen-fragmen DNA oleh operator (manusia).

DNA yang biasa digunakan dalam tes adalah c-DNA dan mt-DNA.Sampel DNA yang paling akurat digunakan dalam tes adalah c-DNA, karena inti sel tidak bisa berubah.Sementara mt-DNA dapat berubah karena berasal dari garis keturunan ibu yang dapat berubah seiring dengan perkawinan keturunannya.Namun, keunikan dari pola pewarisan mt-DNA tersebut sekaligus menjadi kelebihannya, sehingga mtDNA dapat dijadikan sebagai marker (penanda) untuk tes DNA dalam upaya mengidentifikasi hubungan kekerabatan secara maternal.

2.2.2. TUJUAN TES DNA Tes DNA pada umumnya digunakan untuk 2 tujuan yaitu (1) tujuan pribadi sebagai penentuan pewalian anak atau penentuan orang tua dari anak (Tes Paternitas); dan (2) tujuan hukum, yang meliputi masalah forensik, seperti identifikasi korban yang telah hancur maupun untuk pembuktian kasus kejahatan semisal kasus permerkosaan atau pembunuhan.

2.2.3. SAMPEL DAN PENYIAPAN SAMPEL UNTUK TES DNA


Hampir semua sampel biologis tubuh seperti darah dan bercak darah, seminal, cairan vaginal, dan bercak kering, rambut (baik rambut lengkap dengan akarnya atau hanya batang rambut), epitel bibir (misal pada puntung rokok), sel buccal, tulang, gigi, saliva dengan nucleus (pada amplop, perangko, cangkir), urine, feces, kerokan kuku, jaringan otot, ketombe, sidik jari, atau pada peralatan pribadi dapat digunakan untuk sampel tes DNA. Tetapi yang paling sering digunakan untuk tes DNA adalah darah, rambut, usapan mulut pada pipi bagian dalam (buccal swab), dan kuku. Untuk kasus-kasus forensik, sampel sperma, daging, tulang, kulit, air liur atau sampel biologislain yang ditemukan di tempat kejadian perkara (TKP) dapat dijadikan sampel tes DNA. Tahap pengambilan dan penyimpanan bahan atau sampel merupakan tahapan yang vital, dan harus dilakukan dengan prinsip-prinsip di bawah ini: 1. Hindari tempat yang terkontaminasi DNA dengan tidak menyentuh objek secara langsung dengan tangan, tidak bersin atau batuk di dekat barang bukti.

2. Menggunakan sarung tangan bersih untuk pengumpulan barang bukti. Sarung tangan harus diganti untuk setiap penanganan barang bukti yang berbeda. 3. Setiap barang bukti harus disimpan terpisah 4. Bercak darah, bercak sperma, dan bercak lainnya harus dikeringan dahulu sebelum disimpan 5. Sampel harus disimpan pada amplop atau kertas setelah dikeringkan. Jangan menggunakan bahan plastik karena plastik dapat mempercepat degradasi molekul DNA. Setiap amplop harus ditandai nomor kasus, nomor bukti, waktu pengumpulan 6. Bercak pada permukaan meja atau lantai dapat diambil dengan swab kapas steril dan alcohol. Keringkan kapas tersebut sebelum dibawa. 7. Di laboratorium, sampel DNA disimpan dalam kulkas bersuhu 40C atau dalam freezer bersuhu -200C. Sampel yang akan digunakan dalam waktu yang lama, dapat disimpan dalam suhu -700C. Secara umum DNA dapat rusak akibat pengaruh lingkungan seperti paparan sinar matahari, terkena panas, bahan kimia, air dan akibat kerja enzim DNAase yang terdapat dalam jaringan sendiri. Untuk itu terhadap berbagai bahan sampel tersebut harus diberi perlakuan sebagai berikut: 1. Jaringan, organ, dan tulang Bila masih segar, ambil tiap bagian dengan pinset lalu masukkan masingmasing bagian ke dalam wadah tersendiri. Beri label yang jelas dan tanggal pembagian sampel, simpan di pendingin lalu kirim ke laboratorium. Namun bila sampel tidak lagi segar (busuk), ambil sampel, bungkus dengan kertas alumunium, dan bekukan pada suhu -200C. Beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium. 2. Darah dan bercak darah (seperti darah pada pakaian, karpet, tempat tidur, perban) Darah o Darah cair dari seseorang Ambil dengan menggunakan semprit Masukkan ke dalam tabung yang diberikan pengawet EDTA 1 mL darah Beri label yang jelas dan tanggal pengambilan sampel, simpan dalam termos es, lemari es, atau kirim ke laboratorium o Darah cair di TKP Ambil dengan menggunakan semprit, pipet, atau kain

Masukkan ke dalam tabung yang berisikan pengawet EDTA. Bila membeku, ambil dengan menggunakan spaltel

Beri label yang jelas dan tanggal pengambilan sampel, simpan dalam termos es, lemari es, atau kirim ke laboratorium

Darah cair dalam air/salju/es Sesegera mungkin, ambil secukupnya, masukkan ke dalam botol Hindari kontaminasi, beri label yang jelas dan tanggal pengambilan laboratorium sampel, simpan atau kirim ke

Bercak darah basah o Ditemukan pada pakaian o Pakaian dengan noda ditempatkan pada permukaan bersih dan keringkan Setelah kering, masukkan kantong kertas atau amplop Beri label yang jelas dan tanggal pengambilan sampel, kirim ke laboratorium Ditemukan pada benda Bila benda kecil, biarkan kering, tetapi pada benda besar, hisap bercak tersebut dengan kain katun dan keringkan o Masukkan amplop, beri label yang jelas dan tanggal pengambilan sampel, dan kirim ke laboratorium Ditemukan pada karpet atau benda yang dapat dipotong o Potong bagian yang ada nodanya Tiap potongan diberi label yang jelas, sertakan potongan yang tidak ada nodanya sebagai control Kirim ke laboratorium

Percikan darah kering Gunakan celotape, tempelkan pada percikan noda Masukan celotape tersebut ke dalam kantong plastic Beri label yang jelas dan tanggal pengambilan sampel, kirim ke laboratorium

3. Sperma dan bercak sperma - Sperma cair a. Hisap dengan semprit, masukkan ke dalam tabung b. Atau dengan kapas, keringkan c. Beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium - Bercak sperma pada benda yang dipindah (misalnya pada celana) a. b. Bila masih basah, keringkan Bila kering, potong pada bagian nodanya, dan masukkan ke dalam amplop c. Beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium Bercak sperma pada benda besar yang bisa dipotong (misalnya pada karpet) a. Potong pada bagian yang bernoda b. Masukkan ke dalam amplop c. Beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium Bercak pada benda yang tidak dapat dipindah dan tidak menyerap (misal: lantai) a. Kerok bercaknya, lalu masukkan kertas b. Lipat kertas hingga membungkus kerokan, masukkan ke dalam amplop c. Beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium 4. Urine, saliva, dan cairan tubuh yang lain Sampel cair a. Urine atau saliva dimasukkan ke dalam tempat steril b. Simpan di pendingin, beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium Bercak urine, saliva a. Dugaan noda dikerok atau potong, lalu kumpulkan b. Simpan di pendingin, beri label yang jelas dan tanggal pengambilan sampel, lalu kirim ke laboratorium 5. Rambut dan gigi Rambut a. cabut beberapa helai rambut (10-15 helai) dengan akarnya. Hati-hati bila tercampur dengan darah

b. Tempatkan pada wadah, beri label yang jelas dan tanggal pengambilan sampel. Kirim ke laboratorium. Pulpa Gigi a. Cabut gigi yang masih utuh. Sampel gigi sebaiknya tidak dirusak oleh endodontia b. Masukkan ke dalam kantong plastik, beri label yang jelas dan tanggal pengambilan sampel

Cara pengambilan bahan untuk pemeriksaan DNA : Swab pipi : merupakan cara yang paling sederhana dan tanpa rasa sakit dalam mengumpulkan sampel DNA. Dilakukan dengan menggunakan stick swab sepanjang pipi kiri dan kanan bagian dalam.

Pengambilan darah untuk tes DNA. Dapat dipakai untuk tes fraternitas dan hanya boleh dilakukan oleh kalangan profesional medis seperti dokter dan perawat. Pengambilabn beberapa helai contoh rambut orang yang akan diperiksa DNA

2.2.3. MACAM TES DNA 2.2.3.1 TES PATERNITAS Tes paternitas adalah tes yang dilakukan untuk menetapkan apakah seseorang itu merupakan ayah biologis dari seorang anak.Dalam hal ilmu forensik, tes paternitas sering digunakan pada situasi kriminalitas seperti perkosaan atau persetubuhan dengan saudara sedarah dimana dari hubungan tersebut terjadi hasil konsepsi.Selain itu, tes paternitas dan tes-tes lain yang berguna untuk membuktikan hubungan keluarga dapat digunakan untuk mengidentifikasi korban yang hilang atau tersangka melalui anggota keluarganya yang ada untuk di tes (Arizona, 2009). Walaupun tes paternitas lebih sering dailakukan daripada tes maternitas, ada beberapa keadaan dimana ibu biologis anak tersebut tidak jelas.Contohnya

pada anak yang diadopsi yang ingin bertemu kembali dengan ibu kandungnya, bayi yang tertukar di rumah sakit, dan fertilisasi in-vitro dimana laboratorium dapat mengimplantasi embrio yang tidak berhubungan dengan ibu tersebut di dalam rahimnya. Setiap anak akan menerima setengah pasang kromosom lainnya dari ibu sehingga setiap individu membawa sifat yang diturunkan dengan baik dari ibu maupun ayah. Sedangkan DNA yang berada pada mitokondria hanya diturunkan dari ibu kepada anak-anaknnya.Keunikan pola pewarisan DNA mitokondria menyebabkan DNA mitokondria dapat digunakan sebagai marka untuk mengidentifikasi hubungan kekerabatan secara maternal.Kedua pola penurunan materi genetik dapat diilustrasikan seperti gambar sebelumnnya. Dengan perkembangan teknologi, pemeriksaan DNA dapat digunakan untuk mengidentifikasi dan membedakan individu yang satu dengan individu yang lain. (Arizina,2009) Identifikasi DNA untuk tes paternitas dilakukan dengan menganalisa pola DNA menggunakan marka STR (short tandem repeat).STR adalah lokus DNA yan tersusun atas pengulungan 2-6 basa.Dalam genom manusia dapat ditemukan pengulangan basa yang bervariasi jumlah dan jenisnnya. Identifikasi DNA dengan penanda STR memiliki tingkat variasi yang tinggi baik antar lokus STR maupun antar individu (Hawab,2004)

2.2.3.2. TES MATERNITAS Tes maternitas adalah salah satu bentuk tes DNA yang digunakan untuk menentukan apakah seorang wanita adalah ibu biologis dari seorang anak.Seperti pada tes paternitas, tes ini membandingkan pola DNA anak dengan terduga ibu untuk menentukan kecocokan DNA anak yang diwariskan dari terduga.Umumnya tes maternitas dilakukan pada kasus-kasus khusus, seperti kasus terduga tertukarnya bayi, kasus bayi tabung, kasus anak angkat dan lain-lain (Sentausa, 2008). Tes yang digunakan adalah tes mtDNA (mintokondria DNA).Dimana pada tes mtDNA ini penurunan maternal digunakan untuk menentukan apakah dua atau lebih individu mempunyai hubungan keluarga melalui ibu mereka (secara maternal/garis ibu).Tes ini sering digunakan untuk memberikan bukti tambahan pada kasus maternitas yang sulit dimana terduga ibu tidak dapat

dites.Hasil dari tes ini juga dapat digunakan untuk konfirmasi hubungan biologis dari anak angkat dalam tes mtDNA yang diturunkan secara maternal, identifikasi DNA dilakukan dengan membandingkan mtDNA ibu dengan mtDNA anak. Pada tes ini, karena DNA mitokondria hanya diwariskan secara maternal pada anaknya, bila pola mtDNA seorang ibu sama dengan pola mtDNA anak maka dikatakan bahwa kedua individu tersebut memiliki garis keturunan maternal yang sama (singer, 1997). DNA mitokondria berlokasi di luar nucleus pada sel mitokondria penghasil energy.Keuntungan dari tipe DNA ini adalah terdapat banyak sekali mitokondria pada setiap selnya.Sebuah akar rambut telah berhasil digolongkan dengan menggunakan analisis mitokondria.Informasi DNA disandikan dalam satu kesatuan yang berhubungan dengan garis-garis dari nukleotida.Kode genetik terdiri dari triplet nukleotida dimana dapat dimasukan dalam transkripsi dan translasi menjadi asam amino untuk membentuk protein. Kemudian pada akhirnya, adalah sangat beralasan untuk mengharapkan bahwa informasi tentang rangkaian DNA akan digunakan oleh ahli forensic. Sekarang ini, DNA mitokondria telah digunakan untuk kepentingan forensic, karena masing-masing sel memiliki beberapa mitokondria telah digunakan untuk kepentingan forensic, karena masing-masing sel memiliki beberapa

mitokondria: DNA mitokondria (mtDNA) merupakan molekul yang relative kecil dan beberapa daerah dari molekul tersebut sangat polimorfik. Saat rangkaian DNA dibandingkan, para ahli mengamati untuk mencari tanda-tanda khas atau perbedaan yang ada pada contoh di bawah ini, rangkaian dalam (a) tanda-tanda khas untuk identitas (b) sebagai sumber mutasi dari masingmasing, (c). Tidak cocok dengan identitas, (d) membandingkan rangkaian yang mungkin diyakini dari seseorang. (a)TTGCAGCTTAGCCCGATTCGATCGA (b)TTGCAGCTTAGCCCAATTCGATCGA (c)TTGCAGCTTAGCCCGATTCGATCGA

Keseluruhan mitokondria anak diturunkan dari ibu karena hanya sel telur yang membawa mitokondria saat melebur dengan sperma.Sel telur memiliki 100.000 mitokondria, sedangkan sperma hanya 50-100 di ekor sperma.Ekor sperma merupakan alat gerak yang membutuhkan energy tinggi

dari mitokondria. Pada proses masuknya sel sperma ke sel telur, ekor sperma akan terlepas sehingga mitokondria tidak ikut masuk. Beberapa mitokondria ayah yang mungkin masuk dalam sel telur akan diencerkan selama proses mitosis sehingga sangat tidak berarti jumlahnya atau dianggap seperti benda asing sehingga dihancurkan system sel. Sebagai pelacak, ketiadaan mitokondria ayah pada keturunannya mempermudah analisis penurunan mtDNA. Genom mitokondria diturunkan selama ratusan ribu tahun tanpa ada persilangan dengan genom mtDNA ayah.Dengan demikian, mutasi yang diwariskan dapat dilacak pada satu garis keturunan maternal.Karakteristik ini memungkinkan mtDNA sebagai alat untuk mengetahui hubungan maternal antar individu, mempelajari antropologi, serta biologi evolusi berbagai makhluk hidup (singer, 1997).

Keunggulan mtDNA Selain DNA inti, DNA mitokondria (mtDNA) telah digunakan dalam forensik dan menjadi barang bukti di pengadilan Amerika dan

Eropa.Kelebihan utama penggunaan mtDNA adalah jumlah molekulnya yang mencapai ribuan dalam satu sel sehingga memungkinkan dilakukan analisis dari sampel yang sangat sedikit, misalnya cairan tubuh, akar atau batang rambut bahkan tulang dan fosil tulang.

Kelemahan mtDNA Kelemahan menggunakan mtDNA adalah kemungkinan menemukan kesamaan antar individu yang relative tinggi, terutama individu yang terkait hubungan keluarga segaris ibu.Kelemahan ini jadi menguntungkan bila yang dilakukan adalah perunutan hubungan keluarga.Perunutan hubungan keluarga dengan mtDNA didasarkan pada pola pewarisan maternal yang haploid dan hipervariabilitas daerah D-loop.Secara teknis D-loop dibagi dalam dua daerah hipervariabel yaitu HV1 (15.971 16.414) dan HV2 (15 389). Individu yang terkait hubungan maternal akan memiliki urutan sekuen yang sama dan yang tidak terkait hubungan maternal ini akan berbeda. Terdapat kemungkinan dua individu yang tidak memiliki catatan hubungan maternal akan memiliki sekuen dengan urutan basa yang sama. Bila silsilah keluarga hanya diketahui

beberapa generasi keatas, sementara kecepatan mutasi adalah satu titik dalam 33 generasi maka kemungkinan terjadinya kasus homologi dua individu yang merasa tidak memiliki hubungan maternal relative tinggi. Hal ini menyebabkan mtDNA tidak dapat menjadi alat bukti tunggal atau yang utama dakam pengadilan (Robert, 1999). Perunutan hubungan keluarga untuk mengidentifikasi korban bencana massal telah beberapa kali dilakukan atau identifikasi DNA dilakukan bila korban tidak dapat lagi dikenali secara fisik ataupun untuk menguatkan dugaan pengenalan secara fisik (Sentausa, 2008)

2.2.3.3. DNA FINGERPRINT Di Indonesia DNA fingerprint mencuat namanya di Indonesia sebagai cara identifikasi kejahatan dan korban yang telah hancur setelah terjadi peristiwa peledakan bom ditanah air seperti kasus bom Bali, bom Marriot dan peledakan bom didepan Kedutaan Besar Australia-Jakarta. DNA fingerprint asam dioksiribonukleat, adalah salah satu jenis asam nukleat. Asam nukleat merupakan senyawa-senyawa polimer yang menyimpan semua informasi tentang genetika. Penemuan teknik polymerase Chain Reaction ( PCR ) menyebabkan perubahan yang cukup revolusioner diberbagai bidang. Hasil aplikasi dari teknik PCR ini disebut dengan DNA fingerprint yang merupakan gambaran pola potongan DNA dari setap individu. Karena setiap individu mempunyai DNA fingerprint yang berbeda (Albert, 1982) Metode Analisis DNA Fingerprint Sistematika analisis DNA Fingerprint sama dengan metode analisis ilmiah yang biasa dilakukan dilaboratorium kimia. Setelah didapat sampel dari bagian tubuh tertentu, maka dilakukan isolasi untuk mendapatkan sampel DNA.Bahan kimia yang digunakan untuk isolasi adalah Phenolchloroform dan Chilex.Phenolchloroform biasa digunakan untuk isolasi darah yang terbentuk cairan, sedangkan Chilex digunakan untuk mengisolasi barang bukti yang berupa rambut.Tahapan selanjutnya adalah sampel DNA dimasukkan kedalam mesin PCR. Langkah dasar penyusunan DNA fingerprint dengan PCR yaitu dengan sebuah amplifikasi (pembesaran) sebuah zat potongan DNA yang

urutannya belum diketahui, prosedur ini dimulai dengan mencampurkan sebuah primer amplifikasi dengan sampel genomic DNA. Satu nanogram DNA yang sudah cukup untuk membuat pleat reaksi. Kemudan primer amplifikasi tersebut digunakan untuk penjiplakan untuk sampel DNA yang mempunyai urutan bahas yang cocok.Hasil akhirnnya berupa kopi urutan DNA lengkap hasil amplifikasi dari DNA sampel. Selanjutnya kopi urutan DNA akan dikarakterisasi dengan elektroforesis untuk melihat pola pitanya. Karena urutan DNA setiap orang berbeda maka jumlah dan lokasi pita DNA (pola elektroforosis) setiap individu juga berbeda. Pola pita inilah yang disebut DNA fingerprint. Kekurangan DNA Fingerprint : 1. Tes DNA yang dilakukan di Indonesia tergolong sangat lama diperkirakan memerlukan sampai waktu sampai 12 hari kerja atau sampai hamper 2 minggu karena sangat terbatasnnya instansi yang dapat melayani tes DNA. 2. Dana yang dibutuhkan sangat mahal. Kelebihan DNA Fingerprint : 1. Adannya kesalahan bahwa kemiripan pola pita bias terjadi secara random (kebetulan) sangat kecil kemungkinannya. 2. Kemampuanya ahli forensik dalam mengendus jejak kejahatan melalui metode analisis DNA fingerprint merupakan suatu langkah maju dalam proses pengungkapan kejahatan di Indonesia. 3. Keakuratan hasil yang mencapai hasil hampir 100 % menjadikan metode DNA Fingerprint selangkah lebih maju dibandingkan proses biometri (identifikasi menggunakan sidik jari, retina mata, susunan gigi, bentuk tengkorak kepala serta bagian tubuh lainnya )

2.2.5. TEKNIK ANALISA DNA Tes DNA memiliki beberapa kelebihan dibandingkan dengan pemeriksaan konvensional lainnya yaitu: Ketepatan yang lebih tinggi

Sebagai contoh hasil pemeriksaan terhadap bercak darah dengan teknik pemeriksaan DNA akan memberikan hasil yang nyaris sempurna dalam menentukan siapa sumber bercak darah dibandingkan dengan pemeriksaan golongan darah konvensional Pilihan sampel luas

Penyebaran DNA pada hampir seluruh bagian tubuh membuat sampel untuk tes DNA dapat diambil dari berbagai bagian tubuh Dapat memecahkan kasus sulit

Tes DNA merupakan satu-satunya tes yang dapat dipakai untuk memecahkan kasus sulit yang tidak dapat dipecahkan dengan metode biasa Sensitifitas yang amat tinggi

Sensitifitas tes ini mencapai 99,9 % Kestabilan yang tinggi

Pada kasus dimana bukti sebagai sampel sudah membusuk maka hanya tes ini yang dpat dilakukan karena DNA bersifat tahan pembusukan dibandingkan protein 2.2.5.1. Teknik Sidik Jari DNA / RFLP

RFLP (Restriction Fragment Length Polymorphisms) adalah sebuah metode yang digunakan oleh ahli biologi molekuler untuk mengikuti urutan tertentu DNA seperti yang disampaikan kepada sel-sel lain Sebuah RFLP adalah urutan DNA yang memiliki pembatasan situs pada setiap ujungnya

dengan "target" urutan di antara keduanya. Sebuah sekuens target adalah setiap segmen DNA yang mengikat untuk suatu penyelidikan dengan membentuk pasangan basa komplementer.

Sebuah probe urutan DNA beruntai tunggal yang telah ditandai dengan radioaktivitas atau enzim sehingga probe dapat dideteksi. Ketika pasangan basa probe ke target, penyelidik dapat mendeteksi mengikat ini dan tahu di mana urutan target adalah karena probe terdeteksi. Sebagai contoh, mari kita ikuti RFLP tertentu yang ditetapkan oleh enzim restriksi EcoR I dan urutan target sebesar 20 basis

GCATGCATGCATGCATGCAT

EcoR aku mengikat kepada pengakuan seuqence GAATTC dan memotong DNA beruntai ganda. Probe DNA di gunakan dalam analisis polimorfisme pembatasan panjang fragmen (RFLP-Restriction Fragment Length Polymorphisms), yang menjadi semakin berharga berbagai dalam ukuran prosedur fragmen

medis,mengandalkan

pada

pendeteksian

(Polymorphisms) yang di hasilkan ketika potongan DNA genomik yang mengandung suatu gen tertentu dan daerah analog yang mengandung alel mutan nya di belah oleh suatu enzim pembatas.

Elektroforesis gel, autoradiografi, dan probe DNA berlabel radio digunakan untuk mendeteksi dua fragmen berbeda. Protokol diagnostik ini sekarang di gunakan dengan berhasil untuk diagnosis prenatal dari anemia sel sabit, Fibrosis kistik, Korea Huntington, Distrofi Muskular Duchenne, dan penyakit ginjal polikistik dewasa. Karena tidak ada dua genom manusia yang memiliki rangkaian basa yang identik. Maka RFLP dewasa ini di gunakan oleh pengetahuan kedokteran kehakiman untuk mendapatkan sidik jari DNA manusia, dimana tidak ada dua sidik jari yang sama. Dengan demikian,karena setiap sidik jari DNA manusia adalah unik,maka RFLP terbukti merupakan alat penyelidikan yang kuat untuk membantu petugas hukum dalam menyelesaikan masalah kejahatan.

Untuk menghitung jarak genetik antara untuk lokus, Anda harus mampu mengamati rekombinasi. Secara tradisional, ini dilakukan dengan mengamati fenotipe, tetapi dengan analisis RFLP, adalah mungkin untuk mengukur jarak genetis antara dua lokus RFLP apakah mereka merupakan bagian dari gen atau tidak.

Deteksi RFLP dilakukan berdasarkan pada adanya kemungkinan untuk membandingkan profil pita-pita yang di hasilkan setelah di lakukan pemotongan dengan enzim restriksi terhadap DNA target atau dari individu yang berbeda. Berbagai mutasi yang terjadi pada suatu organisme mempengaruhi molekul DNA dengan berbagai cara,menghasilkan fragmen-fragmen dengan panjang yang berbeda.

Aplikasi tekhnik RFLP biasa di gunakan untuk mendeteksi diversitas genetic,hubungan kekerabatan,sejarah domestikasi,asal dan evolusi suatu spesies,genetic drift dan seleksi,pemetaan keseluruhan genom,tagging

gen,mengisolasi gen-gen yang berguna dari spesies liar, mengkonstruksi perpustakaan DNA. Restriction Fragment Length polymorphism (RFLP) merupakan penanda molekul yang pertama kali ditemukan dan

digunakan.Penggunaannya dimungkinkan semenjak orang menemukan enzim endonuklease restriksi (RE), suatu kelas enzim yang mampu mengenal dan memotong seurutan pendek basa DNA (biasanya 4-6 urutan basa).Enzim ini

dihasilkan oleh bakteri dan dinamakan menurut spesies bakteri yang menghasilkannya.

RFLP bersifat kodominan dan cukup berlimpah serta polimorfik.Penanda ini juga mudah dipetakan dalam peta genetik dan bersifat stabil.Kelemahannya, penanda ini memerlukan DNA dalam jumlah besar, lama (memerlukan waktu tiga hari), serta melibatkan penggunaan pelabelan isotop radioaktif (meskipun kini telah ditemukan teknik tanpa radioaktif).

Analisis Restriction fragment length polymorphism (RFLP) adalah salah satu teknik pertama yang secara luas digunakan untuk mendeteksi variasi pada tingkat sekuen DNA.Deteksi RFLP dilakukan berdasar pada adanya

kemungkinan untuk membandingkan profil pitapita Yang dihasilkan setelah dilakukan pemotongan dengan enzim restriksi terhadap DNA target/dari individu yang berbeda.Berbagai mutasi yang terjadi pada suatu organism mempengaruhi molekul DNA dengan berbagai cara, menghasilkan fragmenfragmen dengan panjang yang berbeda.Perbedaan panjang fragmen ini dapat dilihat

setelahdilakukan elektroforesis pada gel, hibridisasi dan visualisasi.

Aplikasi teknik RFLP biasa digunakan untuk mendeteksi diversitas genetic, hubungan kekerabatan, sejarah domestikasi, asal dan evolusi suatu spesies, genetic drift dan seleksi, pemetaan keseluruhan genom, tagging gen, mengisolasi gengen yang berguna dari spesies liar,mengkonstruksi perpustakaan DNA.

Prosedur Teknik RFLP Teknik ini diawali dengan mengekstrasi sekuens DNA dari sel. Selanjutnya untaian DNA hasil ekstrasi dipotong potong dengan

menggunakan enzim restriksi. Potongan DNA ini diproses pada gel agarose dengan menggunakan teknik elektroforesis untuk memisahkan fragmen DNA berdasarkan berat molekulnya dengan menggunakan arus listrik. Gel hasil elektroforesis selanjutnya ditransfer ke membran nilon dengan menggunakanteknik bloting.Selanjutnya radioaktif probe ditambahkan untuk

menggandeng potongan DNA yang sesuai dan memindahkannya ke membran nilon. Dengan melakukan pemotretan membran (membubuhkan bahan pewarna atau unsurradioaktif) pola garis-garis sidik jari DNA yang terbentuk dapat divisualisasikan dan dianalisakecocokannya.

2.2.5.2. Teknik PCR (Polimerase Chain Reaction)

Mesin PCR

PCR tube yang berisi masing-masing 100 mikroliter campuran reaksi PCR merupakan proses yang berlangsung secara in vitro dalam tabung reaksi sebesar 200 l ini mampu menggandakan atau mengkopi DNA hingga miliaran kali jumlah semula. Maka pantes aja dengan berbekal DNA yang

terkandung dalam sampel yang cuma secuil itu bisa diperoleh banyak sekali informasi sesuai kebutuhan kita.Reaksi PCR meniru reaksi penggandaan atau replikasi DNA yang terjadi dalam makhluk hidup.Secara sederhana PCR merupakan reaksi penggandaan daerah tertentu dari DNA cetakan (template) dengan batuan enzim DNA polymerase.PCR terdiri atas beberapa siklus yang berulang-ulang, biasanya 20 sampai 40 siklus.

Komponen PCR
Selain DNA template yang akan digandakan dan enzim DNA polymerase, komponen lain yang dibutuhkan adalah: Primer Primer adalah sepasang DNA utas tunggal atau oligonukleotida pendek yang menginisiasi sekaligus membatasi reaksi pemanjangan rantai atau polimerisasi DNA.Jadi jangan membayangkan kalau PCR mampu

menggandakan seluruh DNA bakteri E. coli yang panjangnya kira-kira 3 juta bp itu. PCR hanya mampu menggandakan DNA pada daerah tertentu sepanjang maksimum 10000 bp saja, dan dengan teknik tertentu bisa sampai 40000 bp. Primer dirancang untuk memiliki sekuen yang komplemen dengan DNA template, jadi dirancang agar menempel mengapit daerah tertentu yang kita inginkan. dNTP (deoxynucleoside triphosphate)

dNTP alias building blocks sebagai batu bata penyusun DNA yang baru. dNTP terdiri atas 4 macam sesuai dengan basa penyusun DNA, yaitu dATP, dCTP, dGTP dan dTTP. Buffer Buffer yang biasanya terdiri atas bahan-bahan kimia untuk mengkondisikan reaksi agar berjalan optimum dan menstabilkan enzim DNA polymerase. Ion Logam o Ion logam bivalen, umumnya Mg++, fungsinya sebagai kofaktor bagi enzim DNA polymerase. Tanpa ion ini enzim DNA polymerase tidak dapat bekerja. o Ion logam monovalen, kalsium (K+).

Tahapan Reaksi

Setiap siklus reaksi PCR terdiri atas tiga tahap, yaitu: Denaturasi Denaturasi dilakukan dengan pemanasan hingga 96oC selama 30-60 detik. Pada suhu ini DNA utas ganda akan memisah menjadi utas tunggal. Annealing Setelah DNA menjadi utas tunggal, suhu diturukan ke kisaran 40-60oC selama 20-40 detik untuk memberikan kesempatan bagi primer untuk menempel pada DNA template di tempat yang komplemen dengan sekuen primer. Ekstensi/elongasi Dilakukan dengan menaikkan suhu ke kisaran suhu kerja optimum enzim DNA polymerase, biasanya 70-72oC. Pada tahap ini DNA polymerase akan memasangkan dNTP yang sesuai pada pasangannya, jika basa pada template adalah A, maka akan dipasang dNTP, begitu seterusnya (ingat pasangan A adalah T, dan C dengan G, begitu pula sebaliknya). Enzim akan memperpanjang rantai baru ini hingga ke ujung. Lamanya waktu ekstensi bergantung pada panjang daerah yang akan diamplifikasi, secara kasarnya adalah 1 menit untuk setiap 1000 bp. Selain ketiga proses tersebut biasanya PCR didahului dan diakhiri oleh tahapan berikut: Pra-denaturasi Dilakukan selama 1-9 menit di awal reaksi untuk memastikan kesempurnaan denaturasi dan mengaktifasi DNA Polymerase (jenis hot-start alias baru aktif kalau dipanaskan terlebih dahulu).

Final Elongasi Biasanya dilakukan pada suhu optimum enzim (70-72oC) selama 5-15 menit untuk memastikan bahwa setiap utas tunggal yang tersisa sudah diperpanjang secara sempurna. Proses ini dilakukan setelah siklus PCR terakhir. PCR dilakukan dengan menggunakan mesin Thermal Cycler yang dapat menaikkan dan menurunkan suhu dalam waktu cepat sesuai kebutuhan siklus PCR. Pada awalnya orang menggunakan tiga penangas air (water bath) untuk melakukan denaturasi, annealing dan ekstensi secara manual, berpindah dari satu suhu ke suhu lainnya menggunakan tangan. Tapi syukurlah sekarang mesin Thermal Cycler sudah terotomatisasi dan dapat diprogram sesuai kebutuhan. Keunggulan PCR dibandingkan RFLP adalah : o Simpel dan mudah dilaksanakan di laboratorium o Hasil diperoleh dalam waktu singkat o Memungkinkan analisa DNA dalam jumlah sedikit Kekurangan PCR adalah : o Mudah terkontaminasi Jika ada DNA bakteri tercampur maka akan diperbanyak hingga jutaan kali sehingga bisa terjadi salah kesimpulan terhadap hasil pemeriksaan o Lokus dalam PCR memiliki alel lebih sedikit dibanding RFLP 2.2.5.3. Short Tandem Repeats Merupakan penggambaran dari urutan DNA pendek yang diulang dimana panjang pengulangan ini berbeda-beda tergantung individu dan diwariskan kepada generasi berikutnya.Mutasi dapat terjadi terhadap banyaknya pengulangan sehingga dapat muncul variasi panjang

pengulangan.Variasi ini membuat teknik ini dapat digunakan sebagai penanda genetik.Metode ini dapat memeriksa sampel DNA yang rusak karena hanya sedikit pasangan basa fragmen DNA yang diperbanyak.Teknik ini memiliki

kelemahan dimana teknik ini membutuhkan tiga belas lokus sedangkan DNA inti sendiri hanya memiliki dua salinan molekul dalam setiap sel. 2.2.5.4. Y-Short Tandem Repeats Merupakan STRs pada kromosom Y dan hanya dapat digunakan untuk menyaring informasi genetik yang spesifik dari pria yang menjadi sampel.Pemeriksaan ini dapat digunakan untuk memriksa sampel tanpa sperma yang bercampur antara sampel laki-laki dan sampel perempuan seperti sampel darah yang diambil dari korban kasus perkosaan. Teknik pemeriksaan ini juga berguna untuk menyelesaikan kasus disputed paternity pada anak lakilaki karena kromosom Y diturunkan oleh ayah kepada anak laki-laki. 2.2.5.5. Mitochondrial DNA (mt-DNA) Mitokondria adalah partikel intraselular yang terdapat dalam sitoplasma sel dan mengandung DNA kecil berupa molekul berbentuk sirkular.Ciri khas mt-DNA adalah pola penurunannya dimana mt-DNA hanya mengandung DNA ibu.Mt-DNA bersifat seperti kromosom Y yang tidak mempunyai homolog pada genom manusia sehingga kedianya diturunkan secara spesifik.Dari mt-DNA dapat diketahui garis ibu pada anak laki-laki.MtDNA adalah marker sitoplasmik yang diturunkan ibu kepada semua anaknya. 2.2.5.6. CODIS (Combined DNA Index System) Merupakan analisis DNA yang baru dikembangkan FBI.FBI memilih tiga belas lokus utama standar dan meningkatkan pengembangan kemampuan laboratorium untuk melakukan pemeriksaan pada lokus tersebut.

Pengumpulan tiga belas lokus utama ini akan meningkatkan kemampuan diskriminasi. CODIS menggunakan dua indeks atau petunjuk untuk melakukan pemeriksaan pada kasus kriminal dengan analisis DNA. Kedua indeks tersebut adalah Convicted Offender Index yang mengandung profil narapidana yang melakukan tindakan kriminal dan The Forensik Index yang mengandung profil DNA dari fakta yang didapatkan pada kasus kriminal.

2.3.ANALISIS HASIL TES DNA Analisis DNA untuk meliputi beberapa tahap yaitu tahap pengambilan specimen, tahap proses laboratorium, tahap perhitungan statistic dan pengambilan kesimpulan. Untuk metode tes DNA di Indonesia, masih memanfaatkan metode elektroforesis DNA. Interpretasi hasilnnya adalah detngan cara menganalisa pola DNA menggunakan marka STR ( short tandem repeats ). STR adalah lokus DNA yang tersusun atas pengulangan 2-6 basa.Dalam genom manusia dapat ditemukan pengulangan basa yang bervariasi jumlah dan jenisnya.Dengan menganalisa STR ini, maka DNA tersebut dapat diprofilkan dan dibandingkan dengan sampel DNA terduga lainnya. Beberapa tahapan tes DNA yaitu : 1. Tahapan preparasi sampel yang meliputi pengambilan sampel DNA (isolasi) dan pemurnian DNA. Dalam tahap ini diperlukan kesterilan alatalat yang digunakan. Untuk sampel darah dalam isolasinnya dapat digunakan. Untuk sampel darah dalam isolasinnya dapat digunakan bahan kimia phenolchloroform sedangkan untuk sampel rambut dapat digunakan bahan kimia Chilex. Selanjutnnya DNA dimurnikan dari kotoran-kotoran seperti protein, sel debris dan lain-lain. Untuk metode pemurnian biasannya digunakan teknik sentrifugasi dan metode filtrasi vakum. Tetapi berbagai ilmuwan telah banyak meninggalkan cara tersebut dan beralih keproduk-produk pemurnian yang telah dipasarkan seperti produk butir magnet yang memanfaatkan silica-coated

paramagnetic resin yang memungkinkan metode pemisahan DNA yang lebih sederhana dan cepat. 2. Tahapan selanjutnnya adalah memasukkan sampel DNA yang telah dimurnikan kedalam mesin PCR (polymerase chain reaction) sebagai tahapan ampifikasi. Hasil akhir dari tahapan amplifikasi ini adalah berupa kopi urutan DNA lengkap dari DNA sampel. Selanjutnnya kopi urutan DNA ini akan dikarakterisasi dengan elektroforesis untuk melihat pola pitannya. Karena urutan DNA setiap orang berbeda maka jumlah dan lokasi pita DNA (pola elektroforesis) setiap individu juga berbeda. Pola pita inilah yang disebut DNA sidik jari ( finger print ) yang akan

dianalisa pola STR nya. Tahap terakhir adalah DNA berada dalam tahapan typing, proses ini dimaksudkan untuk memperoleh tipe DNA. Mesin PCR akan membaca data-data DNA dan menampilkannnya dalam bentuk angka-angka dan gambar-gambar identifikasi DNA. Finishing dari tes DNA adalah mencocokkan tipe-tipe DNA yaitu DNA korban dengan DNA pihak yang dicurigai atau dengan tipe DNA yang telah tersedia dalam database. Jika dalam pembacaan diperoleh homolog

melebihi ambang yang ditetapkan (missal 90%) maka dapat dipastikan korban adalah kerabat pihak yang dicurigai. 3. Hasil analisis laboratorium atau profil DNA akan terlihat berupa pitapita DNA yang terdapat pada gel polakrilamid. Pita DNA anak kemudian dibandingkan dengan pita DNA ayah dan ibunnya. Dapat dilihat bahwa masing-masing orang memilki dua pita sebagai representasi dua alel yang menggambarkan DNA pada satu pasang kromosom. Salah satu pita pada kolom DNA anak sama tinggi dengan salah satu pita ibu yang menunjukkan alel tersebut berasal dari ibu, artinya pita anak yang

kedua berasal dari pihak ayah terlihat bahwa salah satu pita ayah sama tinggi dengan pita kedua anak. Kemudian dilakukan perhitungan statistic sehingga dapat diambil kesimpulan bahwa pria dan wanita tersebut kemungkinan besar adalah orangtua dengan kemungkinan sekian persen dibandingan dengan orang lain dalam ras yang sama.

2.4. KASUS Kasus Pemboman J.W. Mariot dan Ritz Carlton Setelah pemboman hotel JW Marriot dan Ritz Carlton beberapa hari yang lalu, beberapa diantaranya diperkirakan pelaku bom bunuh diri. Pada kasus bom semacam ini hal penting yang harus dilakukan adalah pemeriksaan terhadap korban meninggal secara kedokteran forensik.Terhadap semua korban meninggal harus dilakukan autopsi, untuk menentukan jenis perlukaan dan kekerasan penyebabnya, pencarian penyebab dan mekanisme kematian, saat kematian dan yang tak kalah pentingnya adalah identifikasi korban.Korban pemboman secara kedokteran forensik dicirikan oleh adanya perlukaan akibat

ledakan, luka bakar, keracunan CO dan luka akibat serpihan yang mengenai tubuh.

Pemeriksaan Korban Bom Korban meninggal akibat bom dapat dikenali dari keadaannya yang umumnya hancur tercerai berai untuk korban yang berada dekat dengan pusat ledakan. Ledakan bom terhadap korban yang dekat dari pusat ledakan secara langsung akan mengakibatkan luka-luka ledakan berupa tubuh yang hancur berkeping, dan amputasi pada berbagai bagian tubuh. Korban yang berada dekat dengan pusat ledakan juga akan menunjukkan adanya luka bakar, dari yang ringan sampai berat tergantung posisinya dari lokasi yang terbakar. Dari pola luka bakar yang terjadi dokter forensik kemungkinan juga dapat memperkirakan posisi korban dan kemana korban menghadap ketika terjadi kebakaran pasca ledakan.Pada beberapa korban bom mungkin pula terjadi luka sekunder, misalnya luka akibat tertimpa kaca atau bahan bangunan yang hancur akibat ledakan atau luka akibat terinjak-injak saat semua orang panik pasca ledakan. Identifikasi Personal Identifikasi korban pemboman perlu dilakukan karena korban sulit dikenali lagi, akibat hancurnya tubuh akibat ledakan. Pada kasus ledakan Bom di hotel JW Marriote dan Ritz Carlton, dari TKP penyidik mendapatkan beberapa batang tubuh, dua kepala dan banyak serpihan bagian tubuh manusia. Identifikasi korban secara forensik pada prinsipnya adalah pembandingan data sebelum meninggal (ante mortem) dan data setelah meninggal (postmortem). Semakin banyak data yang cocok, maka akan semakin yakin kita bahwa korban adalah benar Tuan X. Sebaliknya, jika ditemukan ada ketidaksesuaian, maka kita juga yakin bahwa korban adalan bukan Tuan X. Data postmortem diperoleh melalui pemeriksaan terhadap korban atau serpihan tubuh korban oleh dokter forensic. Data antemortem diperoleh oleh tim lainnya, yang melakukan pengumpulan data tersangka korban dari keluarga, kerabat, data medis, data gigi dan sebagainya. Selanjutnya dilakukan pembandingan antara

data postmortem dan data antemortem, untuk mencari adanya kesesuaian antara keduanya.Secara umum dapat dikatakan bahwa semakin banyak data yang sesuai antara keduanya semakin meyakinkan bahwa korban adalah tersangka korban. Dengan demikian tugas kedua tim ini adalah mencari data sebanyak mungkin dari serpihan tubuh korban dan keluarga tersangka korban. Data yang dikumpulkan meliputi data visual (gambaran profil atau bagian tubuh), pakaian, perhiasan, dokumen, data medis (ras, umur, jenis kelamin, ciri khusus, DNA), serologi (golongan darah), sidik jari, dan data gigi. Dari semua data tersebut diatas, pemeriksaan gigi, sidik jari DNA merupakan 3 data penentu identitas, yang dikenal sebagai data identifikasi primer, sementara data lainnya disebut sebagai data identikasi sekunder yang hanya bersifat mengarahkan dan memperkuat data identifikasi primer. Data sidik jari pada kasus pemboman biasanya sulit didapat karena ujung jari sulit ditemukan, tidak lengkap, sudah rusak atau

terbakar.Data gigi amat membantu pada identifikasi korban yang berasal dari luar negeri, karena data antemortem giginya biasanya lengkap dan mudah diperoleh. Identifikasi orang Indonesia melalui pemeriksaan gigi biasanya sulit dilakukan karena data antemortem gigi sulit diperoleh karena jarangnya kunjungan ke dokter gigi dan kurang baiknya dental record di kalangan dokter gigi praktek di Indonesia.Atas dasar itu maka untuk korban yang sulit diidentikasi dengan cara lain, maka pemeriksaan DNA merupakan pemeriksaan yang paling dapat diandalkan untuk pemastian identitas. Pemeriksaan DNA DNA merupakan materi keturunan yang dipunyai setiap orang dan merupakan blueprint setiap individu.Setiap orang memiliki banyak sekali DNA dalam sel tubuhnya, dimana separuhnya berasal dari ibunya (DNA maternal) dan separuhnya berasal dari ayahnya (DNA paternal). Sesuai dengan rekomendasi dari FBI pada tahun 1990, maka untuk kasus identifikasi forensik, pada saat ini yang direkomendasikan untuk diperiksa adalah 13 lokus (daerah) DNA yang ukurannya pendekpendek, yang dikenal sebagai Short Tandem Repeats (STR). Anjuran

pemeriksaan terhadap panel 13 lokus STR ini (dikenal sebagai CODIS 13) dilakukan karena terbukti merupakan panel pemeriksaan yang sangat akurat dan sebagai standarisasi yang sifatnya internasional, agar data pemeriksaan DNA yang dilakukan oleh berbagai laboratorium DNA forensik di dunia seragam dan dapat dibandingkan satu sama lain Pada kasus identifikasi korban bom ada dua tahapan pemeriksaan DNA yang dapat dilakukan. Tahapan pertama adalah penggolongan serpihan atau potongan tubuh melalui matching analysis.Pada analisis ini berbagai potongan tubuh manusia diperiksa profil DNA nya. Karena pada setiap lokus STR setiap individu punya dua pita DNA, maka pada setiap lokus STR yang diperiksa akan didapatkan kombinasi 2 angka yang menunjukkan panjangnya DNA. Dengan demikian, jika dilakukan pemeriksaan DNA pada 13 lokus, akan dihasilkan kombinasi 26 angka, yang menunjukkan profil spesifik setiap individu. Karena setiap bagian tubuh manusia yang sama memiliki pola DNA yang sama, maka potongan tubuh manusia yang sama profil DNAnya pastilah berasal dari individu yang sama. Hasil dari matching analysis ini adalah

penggolongan potongan berdasarkan individunya.

BAB III PENUTUP 3.1. KESIMPULAN 1. Tes yang digunakan dalam identifikasi DNA adalah tes maternitas, tes paternitas, dan DNA fingerprint 2. Sumber isolasi DNA dapat diperoleh dari sampel biologis tubuh seperti darah dan bercak darah,seminal, cairan vaginal, dan bercak kering, rambut,epitel bibir, sel buccal,tulang,gigi,saliva dengan nucleus,urine,feces,kerokan kuku,jaringan otot,hingga ketombe 3. Ada bermacam-macam teknik tes DNA bergantung pada kebutuhan dan ketersediaan alat dan bahannya pada saat itu. Namun yang paling banyak diterapkan adalah metode PCR 3.2. SARAN Tinjauan tentang identifikasi forensik dan kasus medikolegal bisa menjadi lebih menarik bila disertai dengan contoh konkrit hasil analisis yang dilakukan atas kasus yang menarik perhatian masyarakat. Kerjasama universitas,rumah sakit dan puslabfor mungkin perlu dirintis demi memberikan akses mengenai data informasi genetik yang diperlukan

DAFTAR PUSTAKA
1. Andrea Petrophylla. Tes DNA. URL: http://www.ripiu.com/article/read/klik4orofit-tes-dna 2. Anonim. Mengenal PCR (Polymerase Chain Reaction) URL : http://sciencebiotech.net/mengenal-pcr-polymerase-chain-reaction/ 3. Anonim. DNA Genetik Testing-Paternity and Forensik Use. URL: http://www.genetics.edu.au 4. Anonim. Pengumpulan Sampel, Ekstraksi DNA, dan Kuantifikasi DNA. URL: http://www.freewebs.com/pengumpulansampeldna.htm 5. Curran Thomas. Forensik DNA Analisys : Technology and Application. Avaibable at : http://www.denverda.org/DNA/Forensik_DNA_Article.htm 6. Eijkman Institute For Molekuler Biologi. 2008. Identifikasi DNA. Situs Web Eijkman Institute. 7. Guyton and Hall. 1997. Buku Ajar Fisiologi Kedokteran. Dalam Sel dan Fungsinya. Edisi 9. EGC. Jakarta. Hal 33-46. 8. M. Gunawan Abdillah. Tahapan Tes DNA. URL: http://www.klikp21.com 9. M. Singer and P Berg, Genes and Genomes (University Science Books) Mill Valley, CA, 1997. 10. Norah Rudin & Keith Inman. Introduction to Forensik DNA Analysis. 2nd ed. London New York Washington DC: CRC Press LLC, 2002. 11. Short Tandem Repeats (STRs); diunduh dari: http://www.forensicdnacenter.com/dna-str.html 12. Tuner L. DNA paternity testing: public perceptions and the influence of gender. AJETS. 2003; 1 (1): 21-37

Anda mungkin juga menyukai