Anda di halaman 1dari 13


clulas que forme un ser vivo, estos pueden ser: UNICELULARES o PLURICELULARES. FUNCION DE NUTRICIN: Es el conjunto de funciones orgnicas mediante las cuales los alimentos son transformados en sustancias aptas para el crecimiento y la actividad de los seres vivos. Las clulas encargadas de estas funciones se llaman SOMATICAS y estn en todos los tejidos pero son diferentes a los de los rganos reproductores. FUNCIN DE REPRODUCCIN: Es la funcin que realizan los seres vivos para producir seres iguales (clones) o al menos semejantes a ellos, con el fin de asegurar la supervivencia de las especies, las clulas que llevan a cabo la reproduccin en los seres pluricelulares se llaman germinales o gametos; son eucariotas y su funcin la determina el ncleo. En toda clula la estructura fundamental para la reproduccin y transmisin de caracteres es el ncleo celular, centro de control de la clula. En el ncleo estn los cromosomas, si este se destruye, la clula muere. Actividad: Establece un cuadro comparativo de las clulas, los organelos celulares, su posicin y funcin y completando con una buena ilustracin. Los cromosomas se encuentran localizados en el ncleo de la clula y si esta no se esta dividiendo, aparece como material difuso llamado cromatina. Recuerda que los cromosomas estn formados por muchos genes y que su composicin qumica es de ADN y protenas. Los genes tienen toda a informacin del individuo, as como las instrucciones para preparar sustancias que necesita, por eso es importante conocer toda la estructura molecular del material gentico y la forma como funciona y como codifica la informacin. El ciclo celular comprende el conjunto de procesos que una clula debe realizar para cumplir la replicacin exacta del ADN y la segregacin (separacin o divisin) de los cromosomas replicados en dos clulas distintas .son muchos los procesos reproductivos que puede realizar los organismos vivos, divisin binaria, gemacin, esporulacin que son procesos amitticos, mitosis, meiosis, reproduccin vegetativa, la reproduccin meitica es un proceso exclusivo de las clulas sexuales por eso mencionaremos la gametognesis. Espermatognesis Se realiza en los testculos Ocurre a partir de la espermatogonia Cada espermatogonia da origen a cuatro espermatozoides

Establece la forma como se lleva a cabo el intercambio de relaciones entre el ambiente y los seres vivos. Determina el nivel evolutivo y reproductivo de los seres vivos Analiza y explica los trabajos de Mendel en el desarrollo de la gentica. Participa crtica y responsablemente en los trabajos individuales y grupales propios del desarrollo de la asignatura Realiza investigacin sociolgica para conocer su historia familiar, elabora su rbol genealgico

INDICADORES DE LOGROS Analiza la importancia de la reproduccin en la conservacin de las especies Justifica la importancia de la gentica en el mejoramiento de las especies Analiza y explica las Leyes de Mendel. Realiza correctamente ejercicios sobre las Leyes de Mendel Conoce la importancia de la recombinacin gentica. Realiza un rbol genealgico de su familia. Comprende el cdigo gentico en la formacin de protenas. Realiza correctamente una figura representativa de la molcula de la doble hlice del ADN. Realiza eficientemente ejercicios sobre trascripcin y traduccin del cdigo gentico. Comprende cmo afectan las mutaciones la sntesis de protenas. FUNDAMENTACIN LA GENETICA La reproduccin es el proceso mediante el cual los seres vivos originan otros seres semejantes para conservar la especie. La reproduccin puede ser asexual o sexual; la asexual se realiza dsin la intervencin de gametos, y la sexual por medio de gametos masculinos y femeninos maduros. Los seres vivos estn constituidos por unidades estructurales, las clulas. Segn el nmero de

En la meiosis el material se divide equitativamente Los espermatozoides se producen durante toda su vida Se produce en el hombre De un espermatocito I, se forman 4 espermatozoides funcionales. Ovognesis Se realiza en los ovarios Ocurre a partir de la ovogonia Cada ovogonia da origen a un ovocito II el cual slo en el caso de ser fecundado pasar a llamarse vulo y a 2 cuerpos polares I y a un cuerpo polar II (slo en caso de fecundacin). En meiosis I no se divide el citoplasma por igual, quedando una clula hija (ovocito II) con casi todo el citoplasma La mujer nace con un nmero determinado de Folculos, aproximadamente 400.000 Se produce en la mujer De un ovocito I, se forma un vulo funcional. SEMEJANZAS ENTRE ESPERMATOGNESIS Y OVOGNESIS Ambos son sub-procesos de la gametognesis Los 2 producen gametos En ambos se produce la meiosis Los 2 son procesos de la reproduccin sexual en mamferos Ambos procesos se producen dentro de las gnadas Los 2 inician sus fases a partir de la meiosis

Meiosis Exceptuando los cromosomas que determinan el sexo (cromosomas sexuales), cada ncleo diploide contiene dos versiones muy semejantes de cada uno de los otros cromosomas (autosomas), una de las cuales procede del padre y otra de la madre. Ambas versiones se llaman cromosomas homlogos. En el caso del ser humano, existen 23 parejas de cromosomas homlogos. Cada pareja se diferencia de las dems en su forma, tamao, tincin, etc. Todos los cromosomas autosmicos son casi idnticos y se nombran del 1 al 22, mientras que los cromosomas sexuales son diferentes y se nombran Y y X. En la imagen podis ver el mapa cromosmico (conjunto de cromosomas organizados por parejas homlogas) del ser humano. Esquema del mapa cromosmico humano Las nicas clulas diploides que pueden realizar la meiosis se encuentran en los rganos reproductores masculino y femenino, y como resultado originan las clulas reproductoras o gametos, que son haploides. El proceso de formacin de las clulas reproductoras se denomina gametognesis. La gametognesis de espermatozoides se denomina espermatognesis, y la de vulos, ovognesis u ovognesis.

El ADN y ARN es el material gentico que est presente en el ncleo de las clulas, se representa mediante las siguientes molculas qumicas, en las cuales el ADN acido desoxirribonucleico se visualiza como una doble cadena de nucletidos conformados por: fosfato, base nitrogenada que puede ser Adenina(A), Timina (T), Citosina (C) , Guanina(G) y un azcar tipo pentosa llamado Desoxirribosa, y con polaridad que lo ubica para la lectura desde el extremo 3 a 5, ubicados como una escalera en espiral, la clula lo sintetiza para copiar el mensaje recibido y esto lo hace colocando las bases nitrogenadas en los peldaos de dicha escalera de tal forma que se aparea as: A-T y C- G, y el fosfato con el azcar permanecen constantes , semejndose a la estructura rgida de la escalera. ACTIVIDAD Consulta el modelo de WATSON Y CRICK Estructura de doble espiral del ADN.

por una cadena sencilla de nucletidos en los cuales las bases nitrogenadas son Adenina(A), Uracilo(U), Citosina (C) y Guanina(G);un fosfato y un azcar tipo pentosa que en este caso se denomina Ribosa, las bases nitrogenadas se aparean as: A-U y C-G, al igual que el ADN tiene polaridad 3 a 5 y lo ms importante es que el ARN se forma a partir del ADN es decir por cada cadena de ADN se forma un ARN diferente, el cual traduce el mensaje y lo enva para ser codificado por medio de los diferentes ARNs Como se llaman los diferentes ARN y que funcin cumplen? y solo as se lee el mensaje cuando se ha codificado una serie de aminocidos y se halla recibido los mensajes de iniciar la lectura (AUG) que codifica la seal de inicio pero que tambin se lee como Metionina y as se lee cada tres bases nitrogenadas, lo que se conoce como codn hasta cuando se d nuevamente el mensaje para terminar de hacerlo,(UAA, UAG o UGA) que traducen pare. A continuacin estudiaremos la forma de leer los mensajes del ADN mensajero y realizaremos ejercicios de duplicacin de la cadena de ADN y la codificacin del ARN, utilizando los nucletidos y la siguiente tabla: ejemplo

sintesis de proteinas. ARN El ARN Tambin es material gentico presente en los cromosomas de la clula, est conformado


e. Que diferencias existen entre los azucares del ADN y el ARN f. Por qu se dice que el ADN est al servicio de la justicia y las ciencias forenses, justifique su respuesta Selecciona la respuesta adecuada 4. La mitosis difiere de la meiosis en que: a.. la mitosis da origen a dos clulas hijas y la meiosis da origen a cuatro clulas hijas b. en la mitosis hay apareamiento de cromosomas homlogos y en la meiosis no.

ACTIVIDAD: 1. DEFINA LOS SIGUIENTES TERMINOS: Mitosis, meiosis cromosomas, genes, cdigo gentico, aminocido, mutaciones, genoma humano, manipulacin gentica, clonacin, codn, nucletido, base nitrogenada, ADN, ARN, ARNt, ARNr, ARNm. 2. Dibuje un fragmento del ADN, e identifique las partes que lo conforman 3. Realice los siguientes ejercicios a. Del siguiente fragmento de una cadena de ADN complete, La cadena complementaria de ADN, las cadenas de ARN, seale la polaridad y trate de encontrar el mensaje que traduce cada uno de los codones encontrados, no olvide utilizar la tabla del cdigo gentico. 3 TACCGATTACGTGGCTAGTCACGTAGC TCAGCTCAGCGCTCAGGAGTCGTAGG CTAGGGTGGGGGTTTAAACCCCTGGC CCAAATATCGGTACGTCAGTCGATCGT TGACTGCAGTGTCAGCCCTTAAA 5 b. De la siguiente secuencia de amino acidos obtenga: el ARN, ADN correspondiente Fen-leu-ser-ser-tyr-hisala-ala-met-lis-gly-ser-val trp-ser-glu-Asn-pro-leu-tir-tir-val-fen- his pare. c. Identifique los codn que se forma : 3AUCUUUACUAUGGUCACUUUGAGCGUC ACUGCUACGUACGUACGUUGCAAUGCCG GUAAUGCUGCAUGUCGAUUCGCAUCGCA UU5 d. Como se puede presentar las mutaciones en el cdigo gentico?

c. la mitosis es la divisin de las clulas sexuales y la meiosis de las clulas somticas. d. la mitosis genera variabilidad gentica y la meiosis produce clulas idnticas a la madre. 5. Cual fue el aporte de Watson y Crick en el estudio de la gentica. 6. consulta y comparte con tus compaeros sobre la utilizacin del ADN en la deteccin de enfermedades, los cultivos y la biodiversidad. GUIA GENETICA SEGUNDA PARTE FUNDAMENTACIN GENETICA: Es la rama de las ciencias que estudia la herencia y la trasmisin de las caractersticas hereditarias de un individuo a otro de la misma especie. Durante el siglo XIX se establecieron los fundamentos de la gentica, aunque se desarroll completamente en el siglo XX. Esta rama de las ciencias naturales estudia la transmisin, de las semejanzas y las diferencias entre los individuos con ascendencia comn. Usa conocimientos de botnica, zoologa, bioqumica, estadstica. La aplicacin de la gentica en el campo agropecuario ha permitido seleccionar variedades de plantas y animales de mayor produccin que sus antecesores. En el campo industrial, los procedimientos biotecnolgicos, aplican la gentica para obtener hormonas,

vacunas, cidos orgnicos, interfern, y muchos otros productos. La evolucin de las especies vivientes se aplica en parte, por la aparicin gradual de variantes genticas a causa de las mutaciones. LEYES DE MENDEL Desde los albores de la civilizacin humana fue evidente que los miembros de una misma familia presentaran rasgos fsicos semejantes. Este fenmeno se observaba tambin en los linajes de animales domsticos y en las plantas que se reproducan mediante semillas. Sobre la naturaleza de la transmisin de los caracteres de una generacin a otra formularon diversas teoras. Hacia la misma poca en que Darwin escribi el origen de las especies, Gregory Mendel (1822-1884), u sacerdote agustino de nacionalidad austraca, realizo una serie de experimentos que habran de conducir a un nuevo concepto sobre los mecanismos de herencia. La gran contribucin de Mendel, seala el comienzo de la gentica. La gran contribucin de Mendel consisti en demostrar que las caractersticas hereditarias se transmiten de una generacin a otra a travs de factores y sus trabajos se realizaron con plantas de guisantes razn por la cual debemos repasar la reproduccin en los vegetales.(rganos reproductores, reproduccin vegetativa y relacionarla con la transmisin de caractersticas de una planta a otra)

ACTIVIDAD INDIVIDUAL: Para entender el tema de la gentica es necesario que aprendamos los trminos claves y as se puede trabajar con los clculos matemticos propios del tema a los que llamaremos probabilidades genticas Consulta los siguientes trminos: Herencia, genes, generacin parental, alelos, cariotipo, hbridos, primera generacin, segunda generacin, fenotipo, genotipo, cruces genticos, homocigoto, heterocigoto, especie, filial, generacin, dominancia, recesibilidad, semilla ACTIVIDADES GRUPALES 1. A partir del grafico anterior describa las caractersticas que tuvo en cuenta Mendel con las plantas de guisantes 2. Enuncie las leyes de Mendel, pero analiza las grficas para tratar de deducirlas antes de consultarlas

Caractersticas de las plantas que tuvo en cuenta Mendel para sus estudios genticos.

3. Explica en el grafico cul de las leyes de Mendel se est expresando, y los genotipos y fenotipos de padres e hijos

aspectos fsicos que son comunes para varios miembros o aquellos que aparecen espordicamente en algunos como por ejemplo a. OJOS, color, tamao, parpados, las pestaas, las cejas , entre otros

b. CABELLO, color, forma c. NARIZ, tamao, forma d. LENGUA, en U, en W, tamao e. OREJAS, tamao, forma f. MENTON, forma, tamao, partido

g. ESTATURA, 4. como se llama la segunda ley de Mendel y como explicas en el grafico la aparicin de un ratn caf 5. Escribe el fenotipo y el genotipo representado en los graficos 6. Cmo son los padres y que caractersticas presentan los hijos en el cruce que representa la tercera ley de Mendel Tambin se podr tener en cuenta enfermedades, mutaciones o sndromes que puedan aparecer, Slo cuando tratamos de conocer nuestros ancestros podremos saber la frecuencia en que aparece dichas caractersticas; ahora recopila fotografa, escucha historias y arma tu propia historia la cual podrs tener en el medio virtual como lo es la pagina en la cual colocaras tus datos y realizaras tu rbol genealgico, cuentale a los miembros de tu familia en que consiste el trabajo para que ellos tambin formen parte de la investigacin y recopilacin de imgenes. En clase te daremos las indicaciones pertinentes para que inicies tu trabajo, manos a la obra y buena suerte futuro investigador. RECUERDA QUE ES IMPORTANTE CONOCER LOS ENUNCIADOS E LAS LEYES DE MENDEL, PERO LO MAS IMPORTANTE ES SABER INTERPRETARLOS Y APLICARLOS A NUESTRO PROPIO ESTUDIO Leyes de Mendel 7. describe el Fenotipo y el Genotipo que se representan en el grfico anterior, resaltando las caractersticas dominantes y recesivas que se encuentran en estos cruces genticos. LAS LEYES DE MENDEL SE APLICAN A TODOS LOS SERES VIVOS Y SUS DESCENDIENTE Ahora miremos en cada una de nuestras familias las caractersticas genticas que son dominantes y cuales son recesivas, como podremos analizar 1. Primera ley de Mendel LEY DE LA UNIFORMIDAD Cuando dos individuos de raza pura se crucen todos sus hijos 100% sern iguales entre s, heterocigotos 2. Segunda ley de Mendel LEY DE LA SEGREGACION O DISTRIBUCIN DE CARACTERES Cuando dos individuos se cruzan, sus genes se separan para ser entregados en forma independiente En este caso se

puede encontrar 16 posibilidades de aparicin de las carcteristicas 3. Tercera ley de Mendel LEY DE LA INDEPENDENCIA DE CARACTERES O RECOMBINACIN INDEPENDIENTE Cuando se cruzan individuos que difieren en dos o ms caractersticas, un determinado carcter se transmitir de generacin en generacin en forma independiente a los dems. APLICACIN MENDEL DE LAS LEYES DE

homocigotos o heterocigotos las caractersticas parentales. Gentica humana gentica humana describe el estudio de la herencia biolgica en los seres humanos. La gentica humana abarca una variedad de campos incluidos: la gentica clsica, citogentica, gentica molecular, biologa molecular, genmica, gentica de poblaciones, gentica del desarrollo, gentica mdica y el asesoramiento gentico. El estudio de la gentica humana puede ser til ya que puede responder preguntas acerca de la naturaleza humana, comprender el desarrollo eficaz para el tratamiento de enfermedades y la gentica de la vida humana. Grupo sanguneo

A. CRUCES MONOHIBRIOS: en este tipo de cruces slo se tiene en cuenta una caracterstica para ser analizado: se cruzan plantas de flores rojas homocigotas RR con flores blancas homocigotas rr, como sern sus descendientes? Da como resultado 4 posibilidades diferentes, dependiendo si son heterocigotos, pero con padres homocigotos todos los hijos sern iguales entre s B. CRUCES DIHIBRIDOS en ellos se tienen en cuenta dos caractersticas como por ejemplo Cabello forma y color, diferentes para los padres y se analiza la probabilidad de aparicin en los hijos. En este caso se puede encontrar 64 posibilidades de aparicin de las caractersticas C. Ejercicios y elaboracin de cuadros de Punnet

El tipo de sangre es determinado, en parte, por los antgenos de los grupos sanguneos A, B, O presentes en los glbulos rojos y blancos, inclusive. Un grupo sanguneo es una clasificacin de la sangre de acuerdo con las caractersticas presentes o no en la superficie de los glbulos rojos y en el suero de la sangre. Las dos clasificaciones ms importantes para describir grupos sanguneos en humanos son los antgenos (el sistema ABO) y el factor Rh. El sistema ABO fue descubierto por Karl Landsteiner en 1901, convirtindolo en el primer grupo sanguneo conocido; su nombre proviene de los tres tipos de grupos que se identifican: los de antgeno A, de antgeno B, y "O". Las transfusiones de sangre entre grupos incompatibles pueden provocar una reaccin inmunolgica que puede desembocar en hemlisis, anemia, fallo renal, shock y muerte. En los grupos sanguneos se maneja codominancia, razn por la cual representamos las dos letras maysculas. PADRES OxO HIJOS POSIBLES O HIJOS NO POSIBLES A-B- AB

Se cruzan un caballo negro y uno blanco, ambos homocigotos, tienen todos sus descendientes negros heterocigotos, dos de estos caballos se cruzan, que descendientes pueden tener? Indica para el ejercicio anterior los porcentajes que son posibles en la descendencia, el genotipo y el fenotipo Mi tipo de sangre es___, averiguo el tipo de sangre de mi pap y de mi mam y elaboro el cruce gentico en un cuadro de Punnet, puedo tener en cuenta el de mis hermanos para predecir si son




-----O AB

O x AB A x AB B x AB AB x AB

Los cuadros de los grupos sanguneos entre padres y sus descendientes, son tiles en casos de medicina legal, pero no en todos donde se discuta la paternidad responsable. HERENCIA DEL FACTOR Rh En 1940, el Dr. Landsteiner descubri otro grupo de antgenos que se denominaron factores Rhesus (factores Rh), porque fueron descubiertos durante unos experimentos con monos Rhesus. Las personas con factores Rhesus en su sangre se clasifican como Rh positivas; mientras que aquellas sin los factores se clasifican Rh negativas. Las personas Rh negativas forman anticuerpos contra el factor Rh, si estn expuestas a sangre Rh positiva. Los antgenos del sistema Rh son de naturaleza proteica. El antgeno D posee la mayor capacidad antignica. Antgeno. Son molculas capaces de desencadenar una respuesta inmunitaria por parte del organismo. El principal problema es que cuando se posee un antgeno, se poseen anticuerpos contra el resto de antgenos. Todo ser humano posee para el grupo sanguneo y para el Rh dos alelos, luego todos los genotipos y sus fenotipos posibles son los siguientes:

Cromosomas sexuales XX y XY no solo definen el sexo de la descendencia. HERENCIA LIGADA AL SEXO El estudio de la herencia humana se ha dificultado por varios factores entre los que podemos destacar Reducido nmero de hijos Largo periodo de gestacin Tiempo largo para llegar a ser fecundables ( a partir de la madurez sexual) Por lo tanto se estudia las historias familiares o el rbol genealgico y se ha logrado establecer el cumplimiento de las leyes de Mendel.

Otras caractersticas que podemos tener en cuenta para nuestro estudio genealgico que son dominantes son enrollamiento de la lengua, lbulos de la oreja separados, presencia de vellos en las falanges, dedo anular ms grande que el ndice; ahora miremos algunas de estas caractersticas entre los compaeros del

grupo, cules de ellas sern dominantes y cuales recesivas, explica tu respuesta. COMO SE PUEDE DETERMINAR EL SEXO EN EL SER HUMANO La especie humana posee 46 cromosomas dispuestos en 23 pares, de esos 23 pares 22 son somticos o autosomas (heredan caracteres no sexuales) y uno es una pareja de cromosomas sexuales (llamados tambin heterocromosomas o gonosomas), identificados como XX en las mujeres y como XY en los hombres. Esta pareja de cromosomas sexuales no solo llevan los genes que determinan el sexo, sino que tambin llevan otros que influyen sobre ciertos caracteres hereditarios no relacionados con el sexo. Al realizarse la fecundacin existe la probabilidad de un 50% que sea hombre y un 50% que sea mujer GEMELOS Tambin llamados Univitelinos por que se forma a partir de un solo huevo o cigoto formado por la fecundacin de un ovulo y un espermatozoide, tendrn los mismos genes, el mismo sexo y se parecer uno al otro, pero puede ocurrir que la separacin no sea completa y quede entre ellos puntos de unin formndose as los siameses, que son gemelos al nacer y estarn unidos por alguna parte del cuerpo, los avaces cientficos han permitido separalos siempre y cuando no se comprometa rganos o tejidos vitales .

HERENCIA LIGADA AL SEXO EN EL SER HUMANO Herencia ligada al cromosoma X. La herencia ligada al cromosoma X quiere decir que el gen que causa el rasgo o el trastorno se localiza en el cromosoma X . Cabe recordar que las mujeres poseen dos cromosomas X mientras que los hombres poseen un cromosoma X y un cromosoma Y. Los genes del cromosoma X pueden ser recesivos o dominantes, y su expresin en las mujeres y en los hombres no es la misma debido a que los genes del cromosoma Y no van apareados exactamente con los genes del X. Los genes recesivos ligados al cromosoma X se expresan en las mujeres nicamente si existen dos copias del gen (una en cada cromosoma X). Sin embargo, en los varones slo debe haber una copia de un gen recesivo ligado al cromosoma X para que el rasgo o el trastorno se exprese. A. Por ejemplo, una mujer puede ser portadora de un gen recesivo en uno de sus cromosomas X sin saberlo y transmitrselo a su hijo, que expresar el rasgo o el trastorno. Herencia ligada a X y ligada a Y Los genes ligados a X se encuentran en el cromosoma sexual X y, tal como los genes autosmicos, tienen tipos recesivos y dominantes. Los desrdenes recesivos ligados a X raramente son vistos en mujeres y usualmente afectan nicamente a hombres. Esto es debido a que los hombres heredan su cromosoma X (y todos los genes ligados a X) de su madre. Los padres nicamente pasan su cromosoma Y a sus hijos varones, as que ningn rasgo ligado a X es pasado de padre a hijo. Las mujeres expresan desrdenes ligados a X cuando son homocigotas para el mismo y se convierten en portadoras cuando son heterocigotos. Un desorden ligado a X es la Hemofilia A. La hemofilia es un desorden en el cual la sangre no coagula eficientemente debido a una deficiencia en el factor de coagulacin VIII.

MELLIZOS: Se forma cuando una mujer es muy frtil y produce dos o ms vulos y estos son fecundados, cada uno por un espermatozoide diferente, pueden ser con caracteres diferentes y podrn ser de diferente sexo

Entre los ejemplos de trastornos recesivos ligados al cromosoma X se destacan los casos del daltonismo y la hemofilia, miopa, enfermedades provocadas por un gen recesivo situado precisamente en el segmento diferencial del cromosoma X. Recalcamos que, debido a su ubicacin, para que una mujer padezca la enfermedad debe ser homocigota recesiva (tener el gen recesivo en ambos cromosomas X), mientras que en los hombres basta con que el gen recesivo se encuentre en el nico cromosoma X que tienen. Daltonismo Esta enfermedad, determinada por un gen recesivo del cromosoma X, es una anomala que consiste en la incapacidad de distinguir los colores rojo y verde. Se suele llamar tambin ceguera para los colores, y hay muchos tipos. La enfermedad fue descrita por una persona afectada, el qumico ingls John Dalton, en 1794. El nombre de esta alteracin hace referencia, precisamente, a este cientfico. Como ya dijimos, el gen responsable de la enfermedad es recesivo y su presencia origina el daltonismo en el hombre, mientras que la mujer que lo posee es portadora y no lo manifiesta. Para que una mujer sea daltnica es necesario que tenga genes del daltonismo en los dos cromosomas X (homocigota) , lo cual es bastante poco frecuente EJEMPLOS: 1. Madre normal (XNXN) y padre normal (XNY): XN XN Y XNXN X NY XN XNXN X NY

Todas las hijas portadoras (100 por ciento) y todos los hijos hijos normales (100 por ciento). Hemofilia La hemofilia A es un trastorno en el cual la sangre no coagula adecuadamente debido a una insuficiencia del factor de coagulacin llamado Factor VIII. El resultado es un sangrado abundante anormal que no se detiene, aun en el caso de una cortadura pequea. A las personas con hemofilia A les aparecen moretones con facilidad y pueden tener hemorragias internas dentro de las articulaciones y los msculos. La hemofilia A ocurre en uno de cada 10.000 varones recin nacidos.

ACTIVIDAD Considere los siguientes casos transmisin de estas enfermedades: Hombre enfermo con mujer normal Hombre normal con mujer portadora Hombre enfermo y mujer portadora Realice los cruces, haga los cuadros, analice resultados, saque conclusiones y los ms importante sustente. Consiga lminas o fotografas de gemelos, mellizos, siameses y haga un mapa conceptual con semejanzas y diferencias entre ellos. En caso de accidente por qu se debe atender rpidamente a los hemoflicos y que deben llevar para identificarlos. Explique los trminos Donante universal y Receptor universal en cuanto a los grupos sanguneos Como influye el factor Rh en los grupos sanguneos. para

Ninguno de sus hijos (hombres y mujeres) ser daltnico ni portador. 2. Madre normal (XNXN) y padre daltnico (XdY): XN Xd Y XdXN X NY XN XdXN X NY

MALFORMACIONES CROMOSOMICAS Los procesos de mitosis y meiosis son tan perfectos que en muy pocas ocasiones ocurren malformaciones; sin embargo entre ellas podemos considerar los sndromes de Down, Turner y Klinefelter en los cuales se presenta monosomias, trisomas o delecciones LAS MUTACIONES son cambios repentinos en la estructura del ADN, algunas consideradas variaciones genticas pero otras solo son alteraciones en el nmero total de los cromosomas; algunas de las mutaciones pueden darse de manera natural (o al azar ) o inducida provocada por agentes mutagnicos como los son las radiaciones alfa, beta gama, x, contacto con agentes qumicos, alcohol, drogas, sustancias del ambiente entre otros. Ejemplos de autosmicos: rasgo dominante y los trastornos son la enfermedad de Huntington y la acondroplastia. Herencia autosmicos recesiva. El carcter autosmicos recesivo es un patrn de herencia de un rasgo, enfermedad o trastorno que se transmite a travs de las familias. Para que un rasgo o enfermedad recesiva se manifieste, dos copias del gen (o los genes) responsable de la aparicin de ese rasgo o desorden tienen que estar presentes en el genoma del individuo Debido al hecho de que se necesitan dos copias de un gen para expresar la caracterstica, muchas personas pueden, sin saberlo, ser portadores de una enfermedad. De un aspecto evolutivo, una enfermedad o rasgo recesivo puede permanecer oculto durante varias generaciones antes de mostrar el fenotipo. Ejemplos de trastornos autosmica recesiva son albinismo, fibrosis qustica, enfermedad de TaySachs B. . En personas con desrdenes como trisoma X, en la cual el genotipo presenta tres cromosomas X, la inactivacin de X desactivar todos los cromosomas X hasta que slo quede uno activo. La inactivacin de X no slo se limita a las mujeres: hombres con el sndrome de Klinefelter, que tienen un cromosoma X extra, tambin sufrirn inactivacin de X para tener slo un cromosoma X completamente activo. La herencia ligada a Y ocurre cuando un gen, rasgo o desorden se transfiere a travs del cromosoma Y. Como los cromosomas Y slo se encuentran en hombres, los rasgos ligados a Y slo son transmitidos de padre a hijo. El factor determinante de testculos, que est localizado

en el cromosoma Y, determina la masculinidad de los individuos Cariotipo Un cariotipo es una herramienta muy til en citogentica. Un cariotipo es la imagen de todos los cromosomas en la etapa de metafase organizado en funcin de la longitud y la posicin del centrmero. Un cariotipo puede ser til tambin en gentica clnica, debido a su capacidad para diagnosticar trastornos genticos. En un cariotipo normal, la aneuploida puede ser detectada con claridad por la posibilidad de observar cualquier cromosoma faltante o adicional.1 C. Trastornos genticos.

Los seres humanos tienen varias enfermedades genticas, a menudo causadas por genes recesivos. Algunos ejemplos de enfermedades genticas humanas son: el sndrome de Turner, la enfermedad de Huntington, el cncer, el autismo y la anemia de clulas falciformes.

Sndrome del maullido del gato- Un trastorno causado por una deleccin en el brazo corto del cromosoma 5. Esta supresin se traduce en un fenotipo de retraso mental, problemas de comportamiento, y un llanto parecido al maullido de un gato. Aproximadamente uno de cada 50.000 nacimientos tendr el sndrome.4 Enfermedad de Huntington- Un trastorno neurolgico causado por una secuencia repetitiva de un trinucletido. Huntingtons es un rasgo autosmico dominante. La mayora de los individuos con la enfermedad muestran el fenotipo por primera vez alrededor de los 40 aos de edad. Los sntomas son movimientos incontrolables, retraso mental y problemas de comportamiento.5 Sndrome de Turner- Es una enfermedad gentica rara caracterizada por presencia de un solo cromosoma X. Fenotpicamente son mujeres (por ausencia de cromosoma Y). A las mujeres con sndrome de Turner les falta parte o todo un cromosoma X. La falta de cromosoma Y determina el sexo femenino de todos los individuos afectados, y la ausencia del segundo cromosoma X, la falta de desarrollo de los caracteres sexuales primarios y secundarios. Esto confiere a las mujeres que padecen el sndrome de Turner un aspecto infantil e

infertilidad de por vida. Su incidencia es de alrededor de 1 de cada 2.500 nias.

glucosa que puede producir diabetes, cansancio excesivo, amenorrea en mujeres, y euforia u otros sntomas sicolgicos. ACTIVIDAD FINAL DE GENETICA NO OLVIDE SUSTENTAR SUS RESPUESTAS, NO BASTA CON SEALAR, DEMOSTREMOS QUE SE CUMPLI CON EL OBJETIVO DE TRABAJAR CON GUIAS Completa los espacios en blanco 1. La apariencia externa de un organismo se llama_________ 2. El fenotipo esta determinado por la dotacin gentica llamada___________adquirida en la reproduccin de sus progenitores 3. Los genes se localizan en pares en ____________ 4. Un gen puede presentarse en dos formas llamadas________ y cada una es capaz de determinar una caracterstica contraria( alto, bajo) 5. Los alelos se nombran con letras maysculas si se trata d un gen que se manifiesta sobre otro y se llama____________ 6. Si los alelos de un par de genes son iguales el organismo es_________con especto a dicho par ( AA- aa) 7. Si los genes son diferentes, el organismo es:_____________ 8. El cientfico considerado el padre de la genetia es_______________________ 9. Cuando en un cruce no aparece caracteres de ningn progenitor sino que se presenta un intermedio entre ellos debido a la dominancia incompleta de los caracteres se llama_________ 10. El ser humano viene determinado por los cromosomas ___________que adems de portar los genes para determinar el sexo, contiene otros genes responsables de otras carcteristicas. 11. La hemofilia es una enfermedad recesiva ligada al cromosoma_ y solo la padecen los________; como justificas t el hecho que las mujeres portemos la enfermedad pero no seamos enfermas?

Sndrome de Klinefelter- Un trastorno en los hombres provocado por la presencia de un cromosoma X adicional. Estas personas tienen un genotipo de 47 XXY en vez del normal XY. Los sntomas de este sndrome son los senos agrandados, testculos pequeos, y la esterilidad

Sndrome de Down: antes llamado mongolismo, malformacin congnita causada por una alteracin del cromosoma 21 que se acompaa de retraso mental moderado o grave. Los enfermos con sndrome de Down presentan estatura baja, cabeza redondeada, frente alta y aplanada, y lengua y labios secos y fisurados. Presentan epicanto, pliegue de piel en la esquina interna de los ojos. Las palmas de las manos muestran un nico pliegue transversal, y las plantas de los pies presentan un pliegue desde el taln hasta el primer espacio interdigital (entre los dos primeros dedos). En muchos casos padecen cardiopatas congnitas y tienden a desarrollar leucemia. El cociente de inteligencia (CI) vara desde 20 hasta 60 (una inteligencia media alcanza el valor 100), pero con procedimientos educativos especficos y precoces, algunos enfermos consiguen valores ms altos. La incidencia global del sndrome de Down se aproxima a uno de cada 700 nacimientos, pero el riesgo vara con la edad de la madre. La incidencia en madres de 25 aos es de 1 por 2000 nacidos vivos, mientras que en madres de 35 aos es de 1 por cada 200 nacimientos y de 1 por cada 40 en las mujeres mayores de 40 aos. La anomala cromosmica causante de la mayora de los casos de sndrome de Down es la trisoma del 21, presencia de tres copias de este cromosoma. Por tanto, los pacientes presentan 47 cromosomas en vez de 46.

Sndrome de Cushing: grupo de trastornos similares descritos por primera vez por Harvey Williams Cushing en 1932 y producido por niveles elevados de glucocorticoides circulantes, en particular de cortisol. Los sntomas que se presentan son: enrojecimiento de las mejillas, obesidad en el tronco, aumento del apetito, cara de luna llena, piel fina que se lesiona con facilidad, mala cicatrizacin de las heridas, aumento de la susceptibilidad a las infecciones, debilidad y atrofia de los msculos proximales, hipertensin, acn, osteoporosis, intolerancia a la

12. La herencia de los grupos sanguneos est determinada por un par de alelos mltiples, siendo el A y B___________ el AB es una herencia_________y el grupo O es recesivo 13. El factor Rh es tambin una caracterstica heredada, la presencia de la protena en el plasma es una caracterstica dominante Rh + pero su ausencia est determinada en forma recesiva o____________ 14. Los cambios inesperados o errores genticos que se suceden en la transmisin de los caracteres hereditarios se llaman__________________ 15. En la siguiente sopa de letras encuentras los nombres de autores de teoras sobre la evolucin y trminos empleados en gentica A L E L O L O C U S F E O A M A B C R S E N A M O R G D M G N P K A P K E N E E O D A R W I N O N N T N B C K O M P D O I A T K M N I K E T P R O I N B P R L I O S H I B R I D O P D O M I N A N T E O

Autor de la teora de selccin natural Autor de la teora de caracteres adquiridos Individuo resultante del cruce de dos especies

17. Realiza los cruces genticos del libro contextos naturales 9 paginas 14, 15, 23 18. A que se refiere el termino dominancia incompleta, de 2 ejemplos. 19. Lee la gua con atencin y seala las palabras de difcil comprensin, consltalas en el diccionario. 20. Elabora un crucigrama con treinta conceptos empleados en la temtica de gentica 21. Elabora un mapa conceptual con la temtica expuesta en la gua de gentica y sustntala. 22. Solicita al docente los cuadernillos de pruebas saber, para que puedas resolver estos cuestionarios con mucha responsabilidad y sobre todo aclara dudas en la forma como se plantean las pruebas de estado.

16. Utiliza las pistas dadas a continuacin y recorre la sopa de letras en forma horizontal y vertical nicamente colocando en frente la palabra que le corresponde Gen de una pareja que controla una misma caracterstica Acido nucleico que interviene en la herencia Lugar donde se localiza un gen Autor de las leyes sobre la herencia Carcter que predomina sobre otro Unidad hereditaria localizada en el cromosoma Apariencia externa de un individuo Suma total de genes heredados