Anda di halaman 1dari 45

YONA OKTA SARI 1010413008 BIOTEKNOLOGI

Dosen Pembimbing : Prof.DR SUMARYATI SYUKUR

Defenisi Kloning
Cloning pengertian secara sederhana nya adalah cangkok; yaitu penggabungan unsurunsur hayati dua atau lebih untuk memperoleh manfaat tertentu Klon berasal dari kata kln (yunani), yang artinya tunas.Kloning adalah tindakan menggandakan atau mendapatkan keturunan jasad hidup tanpa fertilisasi, berasal dari induk yang sama, mempunyai susunan (jumlah dan gen) yang sama dan kemungkinan besar mempunyai fenotib yang sama.

Tujuan
Menentukan urutan basa nukleotida penyusun gen tersebut Menganalisis atau mengidentifikasi urutan basa nukleotida pengendali gen tersebut Mempelajari fungsi RNA / protein/enzim yang disandi gen tersebut Mengidentifikasi mutasi yang terjadi pada kecacatan gen yang mengakibatkan penyakit bawaan Merekayasa organisme untuk tujuan tertentu, misalnya memproduksi insulin, ketahanan terhadap hama, dll.

Bagian terpenting yang selalu digunakan dalam rekayasa genetika


1. Enzym Selluler Ada beberapa enzim yang dipakai dalam memanipulasi DNA, diantaranya adalah : - RNA polimerisasi yang berfungsi untuk membaca sekuen DNA dan mengsintesis molekul RNA komplementer.

- Enzim Endonuklease, yaitu enzim yang mengenali batasbatas sekuen nukleotida spesifik dan berfungsi dalam proses restriction.

- DNA polimerisasi, yaitu enzim yang biasa dipakai untuk meng-copy DNA. Enzim ini mengsintesis DNA dari sel induknya dan membentuk DNA yang sama persis ke sel induk barunya.

Enzim DNA ligase merupakan suatu enzim yang berfungsi untuk menyambungkan suatu bahan genetik dengan bahan genetik yang lain. Contohnya saja, enzim DNA ligase ini dapat bergabung dengan DNA (atau RNA) dan membentuk ikatan phosphodiester baru antara DNA (atau RNA) yang satu dengan lainnya.

enzim reverse transcriptases yang berfungsi membentuk blue-print dari molekul RNA membentuk cDNA (DNA komplementer). Enzim ini dibuat dari virus RNA yang mengubah genom RNA menjadi DNA ketika menginfeksi inangnya

2. Natural Vector/ Vector Alami


Sebagai salah satu cara untuk memanipulasi DNA di luar sel, para ilmuwan bioteknologi harus bisa membuat suatu tempat yang keadaannya stabil dan cocok dengan tempat DNA yang dimanipulasi. Vektor disini bisa diartikan sebagai alat yang membawa DNA ke dalam sel induk barunya serta dapat mengadakan replikasi untuk menghasilkan kopi dalam jumlah besar.

a. Plasmid
Plasmid, merupakan molekul DNA sirkuler yang terdapat dalam bakteri dan berbagai organisme lain. Plasmid dapat melakukan replikasi dengan tidak tergantung pada kromosom sel tuan rumah.

KROMOMOSOM

b. Kromosom Virus
Kromosom virus, terutama bakteriofage, yaitu virus yang harus menginfeksi bakteri pada waktu infeksi molekul DNA bakteriofage diinfeksikan ke dalam sel tuan rumah, dankemudian DNA ini mengalami replikasi.

The Process Of Cloning

1.Isolasi DNA
Isolasi DNA diawali dengan mempersiapkan dua jenis DNA yaitu plasmid bakteri yang akan digunakan sebagai vektor dan DNA yang mengandung gen yang diinginkan. Kemudian dilakukan perusakan dan atau pembuangan dinding sel, langkah selanjutnya adalah lisis sel Setelah sel mengalami lisis, remukan-remukan sel harus dibuang. Biasanya pembuangan remukan sel dilakukan dengan sentrifugasi.

2. Pemotongan Molekul DNA


Tahap kedua dalam kloning gen adalah pemotongan molekul DNA, baik genomik maupun plasmid. Perkembangan teknik pemotongan DNA berawal dari saat ditemukannya enzim restriksi dan modifikasi DNA pada bakteri E. coli, yang berkaitan dengan infeksi virus atau bakteriofag (faga temperat) yang akan menghasilkan fragmen-fragmen dengan ujung 5 yang runcing karena masing-masing untai tunggalnya menjadi tidak sama panjang. Dua fragmen DNA dengan ujung yang runcing akan mudah disambungkan satu sama lain sehingga ujung

3.Ligasi molekulmolekul DNA


Pemotongan DNA genomik dan DNA vektor menggunakan enzim restriksi harus menghasilkan ujung-ujung potongan yang kompatibel. Artinya, fragmen-fragmen DNA genomik nantinya harus dapat disambungkan (diligasi) dengan DNA vektor yang sudah berbentuk linier.

4.Transformasi Sel Inang


Tahap berikutnya menggunakan teknik elektroforesis untuk menganalisis hasil pemotongan DNA genomik dan DNA vektor. Jika hasil elektroforesis menunjukkan bahwa fragmen-fragmen DNA genomik telah terligasi dengan baik pada DNA vektor sehingga terbentuk molekul DNA rekombinan, selain terdapat molekul DNA rekombinan, juga ada sejumlah fragmen DNA genomik dan DNA plasmid yang tidak terligasi satu sama lain. Tahap memasukkan campuran reaksi ligasi ke dalam sel inang ini dinamakan transformasi karena sel inang diharapkan akan mengalami perubahan sifat tertentu setelah dimasuki molekul DNA rekombinan.

5.Pengklonaan sel dan gen asing


Bakteri hasil transformasi ditempatkan pada medium nutrient padat yang mengandung amphisilin dan gula yang disebut X-gal. Amphisilin dalam medium yang akan memastikan bahwa hanya bakteri yang mengandung plasmid yang dapat tumbuh. Sedangkan X-gal akan memudahkan identifikasi koloni bakteri yang mengandung gen asing yang disisipkan

6. Identifikasi klon sel yang membawa gen yang diinginkan


Setelah tumbuh membentuk koloni, bakteri yang mengandung DNA rekombinan diidentifikasi menggunakan metode hibridisasi asam nukleat. Untuk mengkarakterisasi atau mengidentifikasi DNA target, maka pada membran ditambahkan molekul DNA dan RNA untai tunggal yang disebut probe dan didalam larutan buffer. Setelah mengidentifikasi klon sel yang diinginkan, kemudian ditumbuhkan dalam kultur cair dalam tangki besar dan selanjutnya dengan mudah mengisolasi gen tersebut dalam jumlah besar.

Terdapat beberapa metode yang dapat digunakan dalam pengklonaan sel, diantaranya:

1. PCR (Polymerase Chain Reaction) PCR adalah suatu metode untuk mengamplifikasi/disalin beberapa kali sekuens gen (urutan DNA) target secara eksponensial in vitro. Prinsip dasar dari teknik PCR tersebut merupakan adanya enzim DNA polimerase yang digunakan untuk membuat cetakan dari segmen DNA yang diinginkan

Proses PCR terdiri dari 3 tahapan, yaitu:


1. Denaturasi adalah proses penguraian materi genetik (DNA/RNA) dari bentuk heliksnya yang dipisahkan dengan suhu 90-96oC.

2. Annealing (pelekatan) atau hibridisasi adalah suatu proses penempelan primer ke DNA template yang sekarang hanya dalam satu untai. 3. Polimerisasi (sintesis) adalah suatu proses pemanjangan rantai DNA baru yang dimulai dari primer

2. Elekroforesis
Elektroforesis adalah suatu teknik yang mengukur laju perpindahan atau pergerakan partikel-partikel bermuatan dalam suatu medan listrik. Elektroforesis adalah suatu teknik yang menggunakan medan listrik untuk memisahkan molekul berdasarkan ukuran. Elektroforesis digunakan untuk

3.

Sekuens DNA

Penentuan urutan (sekuensing) basa DNA pada prinsipnya melibatkan produksi seperangkat molekul/fragmen DNA yang berbeda-beda ukurannya tetapi salah satu ujungnya selalu sama. Selanjutnya, fragmenfragmen ini dimigrasikan/dipisahkan menggunakan elektroforesis gel poliakrilamid atau polyacrylamide gel electrophoresis (PAGE) agar pembacaan sekuens dapat dilakukan.

Isolation and cloning of IGF-1R gene in bovine

Abstract
We isolated and cloned the IGF-1 R gene from DNA by subjecting DNA with one pair of restriction enzyme (EcoRI + HindIII) and followed by ligation and transformation with the suitable vector. The pair of restriction enzymes (EcoRI + HindIII) which subjected to DNA template before the ligation process was the only pair which had success to liberate IGF-1R fragment from the transformed vector rather than other two pairs of restriction enzymes (EcoRI + XhoI) or (HindIII + XhoI) although this two pair of restriction enzymes have recognition sites in the vector. Moreover we have studied the effect of DNA template size on the action of the restriction enzymes. Where less DNA size, more efficient of the restriction enzyme action. This study is rapid and useful new technology for isolation, cloning and sequencing the gene of interest to be ready for further investigations as gene transfection and/ or transfer.

Primer dari gen IGF-1R : Primer sequence (5' to 3') (Left: CCTGCGCAATGGAATAAAGT and Right: ATTGGGTTGGAAGACTGCTG (SEQUENCE SIZE: 556 bp DNA linear and accession number U33122). Reagen : Enzim yang digunakan : Bakteri yang digunakan : Plasmid : PMD18T Buffer yang digunakan :

1. Rapid Isolation mammalian DNA (20-50 kb)


Bovine Blood
Ekstraksi DNA

300 L aliquots of bovine blood


+ 900 L of 20 mM tris HCl, mix. -Incubated at 250C for 10 min - Centrifuge 20 s Supernatant + 3 L protinase K + 3 L of 4 mg/ml Dnase-free Rnase - Incubate for 1 hours at 370C + 200 L CH3COOK solution mix for 20 s - Centrifuge for 3 min at 40C -Transfer to fresh tube + 600 L of 70% ethanol - Mix well DNA precipitate - Centrifuge at 100 rpm for 1 min at 250C Pellet of DNA in 100L of TE (pH 7.6) - Stored at 200C - Anallyzed

2. Salting Out Method (100 kb DNA)


DNA + 10 mL pellet dissolved in EDTA + cell lysis buffer TE centrifugation at 10000 rpm for 15 min at 40C + NaCl solution - Incubating - Centrifuge Supernatant - Dissolved in ice cold absolute ethanol - Centrifuge DNA in 200 L TE - Stored at 200C - Anallyzed

3. DNA digestion and PCR program


10 L DNA -Incubated with 0.75 L EcoR - Incubated 0.75 L Hindlll, 2 L , 2 L buffers of 2 enzyms - 1.5 L dd water at 320C for 3 h - Anallyzed with PCR program

DNA sequencing
- Take 25 L PCR product in an eppendorf tube + 25 ng of genomic DNA - Denaturation with Parkin Elmer 9700 cetus thermal, carried out. - cooled the sample 40C Amplified DNA fragments - Separated DNA +2% agarose gel + ethidium bromida as stained DNA patern - Visualized on a UV transiluminator

4. Cloning of IGF-1R
PCR product

- 25 L PCR product in mixture (+ use ice box, 1


L PMD18-T vector, + 1.5 L DNA fragments, + 3.5 L dd water + 5 L solution (ligation mixture) - Incubated at 160C least 1 h - Transformation for the ligated gene occurred by using LB medium for overnight followed by plasmid extraction

Transformation ligated gene - Define the main pair of restriction enzymes


which can liberate our gene of interest - Divided the extract plasmid into three groups according type of restriction enzymes
EcoRI + Hindlll EcoRI + XhoI Hindlll + XhoI

- Carried out all tubes

5. Sequencing of both IGF-1R fragment and sequence analysis


Isolate our gene of interest from the plasmid
- Choose the plasmid which have IGF-1R

gene - Sent the sequencer - Compare with the gene bank

RESULT

Showing the DNA after random digestion with the restriction enzymes (EcoRI and Hindlll) lanes 1 and 2 are small DNA (20-20 kb) and lane 3 is large DNA (100kb) and M is 5000 bp marker

Pembahasan
Sistem Insulin-like growth factor (IGF), terdiri dari : 1. dua faktor pertumbuhan yaitu - IGF-I - IGF-II 2. dua IGF penerima IGF-1R dan manose IGF-2R/cationindependent 6-fosfat reseptor, M6P-R dan enam IGF mengikat protein (IGFBP1-6), telah ditandai sebagai sistem regulator penting untuk mengendalikan pertumbuhan jaringan dan pembangunan spesies vertebrata untuk merangsang produksi embrio IFN-invitro dan kemungkinan bahwa IGF-I dan II-memainkan peran penting dalam pengembangan embrio dan rahim selama awal kehamilan.

Pengaruh ukuran DNA dan tindakan pada proses kloning. Ditemukan bahwa ukuran kecil DNA (20 - 50 kb) mudah dicerna, terisolasi dan kloning untuk member kita fragmen IGF-1 R murni dari ukuran besar ( 100 kb DNA) (Gambar 1, 2 dan 3). Selain itu, kami mempelajari efek dari pembatasan jenis enzim dan perannya dalam kloning. Pasangan dari pembatasan enzim (EcoRI dan HindIII) yang digunakan untuk menggali-estion acak template DNA sebelum proses ligasi dan trans-formasi adalah sepasang satunya pembatasan enzim yang membebaskan fragmen IGF-1R setelah ligasi dan transformasi dengan vektor yang sesuai

Identifikasi dilakukan dengan teknik kloning molekuler dan sequencing, sebagian dari gen IGF-I sapi Kon-ponding ke daerah pengkode dan seluruh sequencing. Hasilnya menunjukkan homologi yang tinggi (> 95%) dengan yang di bank gen (556 bp DNA linier dan nomor aksesi U33122).

Dampak Positif dan Negatif Kloning


Dampak Positif
Jika tanaman induk mempunyai sifat-sifat unggul, maka dapat dipastikan keturunannya akan mempunyai sifat unggul dari induknya. Konservasi tumbuhan langka Meningkatkan agrobisnis Terapi kloning ex : untuk penderita gagal ginjal Mempermudah penyediaan organ tubuh untuk di cangkokan.

Dampak Negatif
Kloning pada tanaman akan menghasilkan keturunan yang sama dengan induknya, akibatnya akan menurunkan keanekaragaman tanaman. Kloning pada hewan dan manusia masih banyak dipertentangkan. ex : resiko kesehatan pada hasil clone Bertentangan dengan nilai kemanusiaan.

Bidang Pertanian dan Peternakan dimanfaatkan terutama untuk memberikan karakter atau sifat baru pada berbagai jenis tanaman. Bidang Perkebunan, Kehutanan, dan Florikultur merupakan ilmu yang mempelajari bagaimana cara budidaya bunga

What is the application of Genetic Engineering??


Bidang Farmasi dan Industri terbukti mampu menghasilkan berbagai jenis obat dengan kualitas yang lebih baik Lingkungan Bidang Hukum dan Forensik