Chapter 12: Molecular Biology

Vocabulary: Bacteriophage DNA Double Helix Antiparallel Nucleosome Nucleotides Griffith experiment Hershey-Chase Rosaline Franklin Watson and Crick Be able to: Leading strand Lagging strand Okazaki fragments Semiconservative Template

Name _________________________ Hour___

Amino acid Anticodon/Codon Exon/Intron Protein RNA Ribosome The Central Dogma Transcription Transfer RNA Translation

Deletion Frameshift Insertion Gene regulation Missense Mutagen Mutation Silent Substitution

Summarize the experiments leading to the discovery of DNA as genetic material Draw and label the basic structure of DNA Describe the basic structure of a nucleotide, DNA, and a chromosome Understand the importance of enzymes DNA replication Explain how leading and lagging strands are synthesized differently Determine the sequence of a template strand if given the nontemplate strand sequence Explain how mRNA, rRNA, and tRNA are involved in transcription and translation Summarize the synthesis of messenger RNA Describe how the code of DNA is transcribed into messenger RNA and used to synthesize a protein Summarize transcription and translation including their results and where they take place Understand the role of the ribosome in translation. Differentiate between DNA structure/replication, and RNA synthesis in eukaryotes vs. prokaryotes. Summarize the types and effects of mutations.

MN State Standards: Describe the basic molecular structures and the primary functions of carbohydrates, lipids, proteins and nucleic acids. Recognize that the work of the cell is carried out primarily by proteins, most of which are enzymes, and that protein function depends on the amino acid sequence and the shape it takes as a consequence of the interactions between those amino acids. Explain the function and importance of cell organelles for prokaryotic and/or eukaryotic cells as related to the basic cell process of protein synthesis. Explain the relationships among DNA, genes and chromosomes. Describe the process of DNA replication and the role of DNA and RNA in assembling protein molecules. Explain how mutations like deletions, insertions, rearrangements or substitutions of DNA segments in gametes may have no effect, may harm, or rarely may be beneficial, and can result in genetic variation within a species.

A Brief History of DNA Discoveries (p326-330)

1928 Frederick Griffith Pneumonia bacteria (Streptococcus pneumoniae) Something was causing bacteria to go from rough to smooth Information transferred between 2 strains

What is this information? 1952 Alfred Hershey and Martha Chase Labeled parts of a bacteriophage: DNA labeled with 32P isotope Protein labeled with 35P isotope DNA was injected into bacteria and replicated

What is DNAs structure? 2

1951 Rosalind Franklin

Took X-ray diffraction picture of DNA Suggested the double helix shape

What is DNAs exact structure? 1953 Watson, Crick, and Wilkins Inspired by Franklins picture Determined exactly how DNA fits together Built a 3D model

1958 (Nobel prize)

How does DNA replicate?

Nucleotide Structure (p329)

Adenine <==> Thymine Guanine <==> Cytosine

DNA Structure (p329-331)

The sides of the DNA ladder are alternating phosphate and deoxyribose (sugar) held together by phosphate bonds The inside of the helix contains the bases. One side: Other side: A T A T C A T G C

The DNA backbones run in opposite directions. How is this described? Analogies:

DNA-The Double Helix

In this game, your job is to first make exact copies of a double-stranded DNA molecule by correctly matching base pairs to each strand, and to then determine which organism the DNA belongs to. Go to http://www.nobelprize.org/educational/medicine/dna_double_helix/dnahelix.html . Click Play the Double Helix Game. 1. What are the rungs of the DNA ladder called?

2. What are the four types of these rungs in DNA? (give the full name and the abbreviation)

There will be three rounds in this game. Record your results in the data table below: Round Number of DNA Number of Number of Base Strands Number of Genes Chromosomes Pairs Successfully Made 1

Organism Name

Total points earned: _____ Label the DNA diagram using the following terms: Adenine Guanine Thymine Cytosine Base Pair Sugar-Phosphate backbone

DNA Replication (p333-335)

Enzyme Name DNA helicase Role in DNA Replication

DNA ligase

DNA polymerase

RNA primase

Why do we say that DNA replication is semiconservative?

Draw a DNA replication fork below. Label the 5 and 3 ends of both strands. Also label Okasaki fragments, leading strand, lagging strand, DNA helicase, DNA ligase, DNA polymerase, and RNA primase.

Prokaryotes vs. Eukaryotes

DNA Extraction Lab

First, you need to find something that contains DNA. Since DNA is the blueprint for life, everything living contains DNA. For this experiment, we will be using wheat germ and pork liver. What is wheat germ? This is the source of DNA in this lab. Wheat germ comes from wheat seeds. The germ is the embryo (the part of the seed that can grow into a new wheat plant. When wheat seeds are milled into white flour, the wheat germ and wheat bran are removed, leaving only starch. Wheat germ contains many nutrients, while wheat bran consists of fiber. Whole-wheat flour contains all parts of the wheat seed, which is why it is more nutritious than white flour and provides more fiber. Other Materials: 2 Large test tubes 2 glass stirring rods Pipette Detergent/salt/meat tenderizer solution (50-60o C) Pork liver solution Cold ethanol Warm tap water (50-60o C) Wheat Germ Procedure: 1. 2. 3. 4. 5. 6. 7. Into a large test tube, add 1 small scoop of wheat germ and 10 ml warm water (50-60o C). Stir gently with a glass rod for 3 minutes. Add 0.5 ml ivory detergent Stir for 2 minutes. Add 5.0 ml of cold ethanol. Let sit for 2 minutes. Use a clean glass rod and dip it into the DNA layer. Try to spool it on to the glass rod and lift it out of the liquid to observe the DNA.

Pork Liver Procedure: 1. Into a large test tube, add 3.0 ml liver and 2.0 ml warm detergent/salt solution (50-60o C). 2. Stir gently with a glass rod for 3 minutes. 3. Add 2.0 ml of cold ethanol. Slowly pipette this on top of the liver detergent layer. DNA will precipitate at the place where these two layers meet. It will look like white slime. You will also see some gas bubbles at this site. 4. Let sit for 2 minutes. 5. Use a clean glass rod and dip it into the DNA layer. Try to spool it on to the glass rod and lift it out of the liquid to observe the DNA. You have just completed DNA extractions!

Why warm water? Heat softens the phospholipids (fats) in the membranes that surround the cell and the nucleus, releasing the DNA. Why meat tenderizer? Enzymes in meat tenderizer break down the nuclear membrane and release the DNA within. Why detergent? Every cell is surrounded by a lipid bilayer (the cell membrane). DNA is found inside a second lipid bilayer (the nucleus) within each cell. To see the DNA, we have to break open these two membranes. We do this with detergent. Think about why you use soap to wash dishes or your hands. To remove grease (lipids) and dirt, right? Soap molecules and grease (lipid) molecules are made of two parts: Hydrophilic heads, which like water. Hydrophobic tails, which hate water. Both soap and grease (lipid) molecules organize themselves in bubbles (spheres) with their heads outside to face the water and their tails inside to hide from the water.

When soap comes close to grease, their similar structures cause them to combine, forming a greasy soapy ball. A cell's membranes have two layers of lipid (fat) molecules with proteins going through them. When detergent comes close to the cell, it captures the lipids and proteins. Why ethanol? Ethanol is a type of alcohol. It is less dense than water, so it floats on top. Look for clumps of white stringy stuff where the water and ethanol layers meet. DNA is a long, stringy molecule. The salt that you added in step one helps it stick together. So what you see are clumps of tangled DNA molecules! DNA normally stays dissolved in water, but when salty DNA is exposed to ethanol, it becomes undissolved. This is called precipitation. Colder temperatures also make substances more likely to precipitate. The physical force of the DNA clumping together as it precipitates pulls more strands along with it as it rises into the ethanol.

10

DNA Extraction Lab Questions

1. What is wheat germ?

2. What is the purpose of using warm water?

4. What does the detergent do to the cells?

5. Explain what meat tenderizer does to the protein in pork liver.

6. What does the alcohol do to the cells and DNA?

7. Compare and contrast the appearance of plant DNA and animal DNA.

11

RNA (p. 336-340)

DNA Full Name Adenine pairs with? Structure Function Location(s) Types

RNA

Types of RNA
Full Name mRNA Function

rRNA

tRNA

12

The Central Dogma (p336-340)

DNA----------------------- RNA--------------------- Protein

Transcription

Translation

13

The Central Dogma-Practice Below are two partial sequences of DNA bases (shown for only one strand of DNA). Sequence 1 is from a human and sequence 2 is from a cow. In both humans and cows, this sequence is part of a set of instructions for controlling a bodily function. In this case, the sequences below contain the gene to make the protein insulin. Insulin is necessary for the uptake of sugar from the blood. Without insulin, a person cannot digest sugars the same way others can, and they have a disease called diabetes.

Directions: 1. Using the DNA sequence, write the complimentary RNA strand from both the human and the cow. Write the RNA sequence directly below the DNA strand (remember to substitute U's for T's in RNA). 2. Then use the codon table to determine what amino acids are assembled to make the insulin protein in both the cow and the human. Write your amino acid chain directly below the RNA sequence. Sequence 1 - Human CCATAGCACGTTACAACGTGAAGGTAA RNA : Amino Acids: Sequence 2 - Cow CCGTAGCATGTTACAACGCGAAGGCAC RNA: Amino Acids:

Analysis Questions 1. Comparing the human gene to the cow gene, how many of the codons are exactly the same? ___________ 2. How many of the amino acids in the sequence are exactly the same? ________ 3. Two humans (or two cows) could have some differences in their DNA sequences for insulin, yet still make the exact same insulin proteins. Explain how this is possible.

14

4. Find ALL of the codons that can code for the amino acid leucine and list them.

5. Diabetes is a disease characterized by the inability to break down sugars. Often a person with diabetes has a defective DNA sequence that codes for the making of the insulin protein. Suppose a person has a mutation in their DNA and the first triplet for the insulin gene reads T A T. The normal gene reads T A G. What amino acid does the mutant DNA and the normal DNA code for and will the person with this mutation be diabetic?

6. Another mutation changes the insulin gene to read T C T (instead of the normal T A G). Will this person be diabetic? Explain.

7. DNA sequences are often used to determine relationships between organisms. DNA sequences that code for a particular gene can vary, though organisms that are closely related will have very similar sequences. This table shows the amino acid sequences of 4 organisms. Human: Pig: CCA CCA TAG TGT CAC AAA CTA CGA Chimpanzee: Cricket: CCA CCT TAA AAA CAC GGG CTA ACG

Based on these sequences, which two organisms are most closely related? ________________________

8. An unknown organism is found in the forest and the gene is sequenced as follows: Unknown: C C A T G G A A T C G A What kind of an animal do you think this is? _______________________________

15

Mutations (p345-349)
Students will: Demonstrate how the RNA molecule translates into a chain of amino acids (protein) and explore how changes (mutations) in the genetic code can affect cellular activities. Background information: The sequence (order) of information in the RNA molecule indicates which cell parts, i.e., protein, should be made. Mutations or errors in the DNA and/or RNA sequences may produce defective cell parts, disease, or even death. Not all mutations cause diseases because the code is redundant (many sequences code for the same amino acid). Mutations can result from errors in copying the DNA (which may be transferred to the RNA) or mutagens such as ultraviolet light and hazardous chemicals. (These can damage DNA or RNA directly.) Before you begin: Identify the amino acid piece that corresponds with each codon (3 base-pair sequence) below using the Amino Acid Code. Write the amino acid abbreviations (3 letters) beneath the corresponding codon (3 base pair sequence). AUG codes for Start or the amino acid methionine. Methionine or Start always leads off the amino acid chain. Each of these amino acids is bonded to the previous one via peptide bonds to create a protein (or amino acid chain). One it is completed, the protein will become part of the cell or perform metabolic functions for the cell. 1 RNA codon Amino Acids Scenario #1 Substitution (Missense) Mutation A mutation has occurred! A DNA replication error or DNA transcription error produced a mutation in this RNA sequence. This individual has sickle cell anemia, a blood disorder in which red blood cells are sickle or half moon shaped instead of round (the normal condition). Sickle-shaped red blood cells are not as efficient in transporting oxygen throughout the body as normal red blood cells. Mutations can result from random errors in replication/transcription/translation. Mutations can also result mutagens such as chemicals and/or ultraviolet radiation from the sun. Some mutations are inherited in the genetic code of an individual and are passed along from parent to offspring following patterns of inheritance. This individuals amino acid sequence is: 1 Amino Acids Start 2 Val 3 His 4 Leu 5 Glu 6 Glu 7 Glu 8 His 9 Val 10 Glu 11 His 12 Stop
16

2 GUU

3 CAU

4 CUG

5 GUG

6 GAA

7 GAG

8 CAC

9 GUA

10 GAA

11 CAC

12 UAG

AUG

Use the Amino Acid Code to identify the codon number(s) with the mutation: _____________ How many base pairs are involved in this mutation? ________ Scenario #2 Deletion (Frameshift) Mutation Starting with the normal condition, explore what happens when a letter is deleted accidentally. Remove the guanine (G) from the first base pair position of codon #9. Shift all the other bases to the left. Use the Amino Acid Code to decode the new amino acid sequence for each codon (3 base pairs). 1 2 3 4 5 6 7 8 9 10 11 12 Original RNA codon New RNA codon New Amino Acids What happens to the amino acid sequence? Scenario #3 Substitution (Silent) Mutation Another mutation has occurred! Either a mistake in replication, transcription, or translation, or an outside environmental factor (ultraviolet radiation or chemical) caused a change in the genetic code. Substitute a cytosine (C) for a uracil (U), in the third base pair position of codon #2. 1 Original RNA codon New RNA codon New Amino Acids What happens? Does the mutation alter the amino acid sequence? Scenario #4 Insertion (Frameshift) Mutation An error occurred as DNA was transcribed into RNA! A small piece of DNA was inserted into the base pair sequence. Starting with the normal condition, add a guanine (G) to the genetic sequence after codon #10. 1 2 3 4 5 6 7 8 9 10 11 12 Original RNA codon New RNA codon New Amino Acids What happens? Does the mutation alter the amino acid sequence?
17

AUG

GUU CAU

CUG

GUG GAA

GAG

CAC

GUA

GAA

CAC

UAG

4 CUG

7 GAG

8 CAC

9 GUA

10 GAA

11 CAC

12 UAG

AUG

GUU CAU

GUG GAA

AUG

GUU CAU

CUG

GUG GAA

GAG

CAC

GUA

GAA

CAC

UAG

Analysis Questions: 1) Describe the four types of mutations that you observed in the scenarios.

2) Which mutations were the most dangerous? The least dangerous? Explain

3) Examine the Amino Acid Code for redundancy (more than one triplet codon codes for the same amino acid). Why is this characteristic of the genetic code advantageous to organisms? Which amino acids have greater redundancy? Why?

4) Explain why only one triplet codon codes for methionine (Met) or the start signal.

5) What surprised you the most about the genetic code? Why?

18

The Amino Acid Code

19

Todays Date:

Bellringer response:

20