Anda di halaman 1dari 4

Dwi Agus Nurhidayati

Flu Singapore (HFMD)


Definisi Istilah Flu Singapore Muncul karena saat itu banyak terjadi kasus dan kematian akibat penyakit ini di Singapura. Karena gejala penyakit ini mirip dengan penyakit flu, maka kemudian muncullah sebutan penyakit Flu Singapore. Banyak pula orang yang mengatakan bahwa penyakit ini disebabkan karena penyakit kuku-mulut dari hewan yang menular kepada manusia Penyakit ini sangat menular dan sering terjadi dalam musim panas. HFMD adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu-5 tahun Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena. Penularan Penularannya melalui jalur fekal-oral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (carrier) seperti lalat dan kecoa. Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2-5 hari. Virus RNA yang masuk dalam famili Picornaviridae , genus Enterovirus, terutama virus Coxsackie Grup A, khususnya tipe A16. Di dalam famili Picornaviridae , terbagi menjadi genus Enterovirus dan Rhinovirus. Di dalam genus Enterovirus, terdiri dari Poliovirus, tipe 1-3 Coxsackie virus kelompok A, tipe 1-24 (tidak ada tipe 23) Coxsackievirus kelompok B, tipe 1-6 Echovirus, tipe 1-34 (tidak ada tipe 10 dan tipe 28) Enterovirus, tipe 68-71. Enterovirus adalah penghuni sementara saluran pencernaan manusia dan dapat diisolasi dari tenggorokan atau usus bawah. Enterovirus yang bersifat sitopatogenik (Poliovirus, Echovirus, dan beberapa Coxsackievirus), pertumbuhannya dapat segera terjadi pada suhu 3637C dalam biakan primer sel ginjal manusia dan monyet. Coxsackievirus yang termasuk dalam genus Enterovirus, terbagi menjadi kelompok A dan B. Coxsackievirus kelompok A serotipe tertentu menyebabkan penyakit herpangina HFMD dan konjungtivitas hemoragik akut. Coxsackievirus kelompok B dapat menyebabkan penyakit pleurodinia, miokarditis, perikarditis, dan meningoensefalitis.

Epidemiologi

Etiologi

Dwi Agus Nurhidayati

Gejala

Penyebab HFMD : Yang paling sering pada pasien rawat jalan adalah Coxsackievirus A16 Yang memerlukan perawatan karena keadaannya lebih berat atau timbul komplikasi sampai menyebabkan pasien meninggal disebabkan oleh Enterovirus 71. Masa prodromal Ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1-2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada PTKM. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadi bula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas. Mula-mula demam tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti flu pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah, gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit. Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit. Gejala yang cukup berat tersebut antara lain: - Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C. - Demam tidak turun-turun - Takikardia (nadi menjadi cepat) - Takipneu, yaitu napas jadi cepat dan sesak - Malas makan, muntah, atau diare berulang dengan dehidrasi. - Letargi, lemas, dan mengantuk terus - Nyeri pada leher, lengan, dan kaki.

Dwi Agus Nurhidayati

Diagnosis

Terapi

- Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial - Keringat dingin - Fotofobia (tidak tahan melihat sinar) - Ketegangan pada daerah perut -Halusinasi atau gangguan kesehatan Diagnosa Laboratorium adalah sebagai berikut : 1. Deteksi virus: - Immuno histochemistry (in situ) - Imunofluoresensi antibodi (indirek) - Isolasi dan identifikasi virus. Pada sel Vero RD L20B Uji netralisasi terhadap intersekting pools Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum. 2. Deteksi RNA: RT-PCR Primer : 5 CTACTTTGGGTGTCCGTGTT 3 5 GGGAACTTCGATTACCATCC 3 Partial DNA sekuensing (PCR Product) 3. Serodiagnosis: Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji elisa sedang dikembangkan. Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71. Istirahat yang cukup Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada Dapat diberikan: Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus Penyakit ini adalah self limiting diseases, yaitu Extracorporeal membrane oxygenation. dapat sembuh dengan sendirinya, dalam 7-10 hari, Pengobatan simptomatik: pasien perlu istirahat karena daya tahan tubuh Antiseptik di daerah mulut menurun. Pasien yang dirawat adalah yang dengan Analgesik, misalnya parasetamol gejala berat dan komplikasi tersebut diatas. Cairan cukup untuk dehidrasi yang disebabkan sulit minum karena demam Pengobatan suportif lainnya (misalnya gizi)

Dwi Agus Nurhidayati