Anda di halaman 1dari 15

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.

com
1 dari 8

LAPORAN MUTASI ONLINE

SALL4 penghapusan adalah penyebab umum dari Okihiro dan Acrosindrom ginjal-mata dan mengkonfirmasi haploinsufisiensi sebagai mekanisme patogenik
W Borozdin, D Boehm, M Leipoldt, C Wilhelm, W Reardon, J Clayton Smith, K Becker, H Muhlendyck, R Musim Dingin, O Giray, F Silan, J Kohlhase
J Med Genet 2004; 41: E113 (http://www.jmedgenet.com/cgi/content/full/41/9/e113). doi: 10.1136/jmg.2004.019901

dia SALL gen, mirip dengan Drosophila gen Spalt,1 manusia, empat gen tersebut telah diidentifikasi sampai saat ini. Mutasi di SALL1 pada kromosom 16q12.1 telah

mungkin mengkodekan faktor transkripsi zinc-finger. Di

terkait dengan sindrom Townes-Brocks dan terkait phenotypes, 2 3 dan mutasi pada SALL4 telah terbukti penyebab pada pasien dengan Okihiro / Duane-radial ray synDrome (OMIM ada 607.323) .4 5 SALL26 dan SALL37 belum telah dikaitkan dengan penyakit manusia. Kami sebelumnya melaporkan frameshift dan omong kosong mutasi di SALL4 di lima dari delapan keluarga pemisahan Okihiro Sindrom phenotype.5 Sebuah report4 lanjut mengidentifikasi dua mutasi frameshift dan satu mutasi nonsense dalam tiga kindreds terkena dampak, termasuk keluarga dilansir Okihiro et al.8 Dalam sebuah penelitian terbaru tentang pasien dengan diagnosis klinis Sindrom Holt-Oram (OMIM ada 142.900), salah satu tambahan frameshift mutasi dilaporkan dari keluarga yang ternyata memiliki sindrom Okihiro daripada Holt-Oram syndrome.9 Selain itu, kami melaporkan tiga novel dan satu sudah diidentifikasi SALL4 mutasi pada pasien awalnya didiagnosis baik sebagai sindrom Holt-Oram (kemudian direvisi Sindrom Okihiro atas dasar pengamatan dari Duane anomali dalam setidaknya salah satu anggota keluarga yang terkena dampak dalam setiap keluarga), sindrom Acro-ginjal-okular (OMIM ada 102.490), dan sindrom Holt-Oram dibandingkan thalidomide embryopathy.10
Berbeda dengan laporan Al-Baradie

SALL4 mutasi pada tiga dari delapan keluarga dengan jelas Okihiro sindrom, diagnosis yang didasarkan pada adanya malformasi ray radial dalam kombinasi dengan Duane anomali. Temuan ini menyebabkan asumsi bahwa baik mutasi lain lokus belum teridentifikasi bertanggung jawab untuk fenotipe dalam keluarga-keluarga, atau bahwa mutasi dalam itu SALL4 gen yang hadir tapi luar daerah dianalisis (Yaitu, mereka adalah mutasi promotor atau intronic). SALL1 mutasi menyebabkan sindrom Townes-Brocks dan SALL4 mutasi pada Okihiro dan sindrom terkait menunjukkan distribusi sangat berbeda. Dibandingkan dengan mutasi spektrum SALL1 mutasi, 3 yang sebagian besar berada di ekson 2, 59 daerah pengkodean ganda pertama seng-jari domain, SALL4 mutasi terdeteksi tampak begitu jauh untuk menjadi merata selama gene.4 5 9 10 Ini belum mungkin untuk mengkorelasikan tingkat keparahan fenotip dengan posisi yang SALL4 mutasi. Telah berspekulasi bahwa keparahan fenotipik berbeda dalam dua keluarga dengan sama mutasi c.2593CRT adalah hasil dari epigenetik factors.10 The sifat semua dikenal SALL4 mutasi, yang semuanya truncating, disarankan haploinsufisiensi sebagai patogenik mechanism.10 ini konsisten dengan pengamatan bahwa penghapusan interstitial 20q kromosom, mungkin encommelewati SALL4 lokus, yang berhubungan dengan fenotipe mirip dengan Okihiro syndrome.11 12

et al,4 kami tidak menemukan

Poin kunci

N N N N N

Mutasi titik SALL4 lokus, diperkirakan hasil dalam pemotongan protein, menyebabkan sindrom Okihiro dan sindrom Acro-ginjal-okular pada heterozigot individuals. Namun, beberapa pasien dan keluarga dengan

fenotipe ini tidak memiliki diidentifikasi SALL4 mutasi. Analisis Pemisahan intragenic nukleotida tunggal polimorfisme dilakukan untuk mendeteksi hilangnya heterozigositas, konsisten dengan penghapusan intragenic, dalam keluarga di mana ada mutasi titik dapat diidentifikasi. Heterozigot SALL4 penghapusan setidaknya ekson 2 adalah disarankan dalam empat dari enam keluarga dengan metode ini. Time polymerase chain reaction kuantitatif nyata dilakukan untuk mengkonfirmasi dan memetakan dele-intragenic tions. Dua keluarga menunjukkan penghapusan keempat ekson. Dua keluarga memiliki penghapusan ekson 1-3, satu keluarga adalah heterozigot untuk penghapusan ekson 4, dan lebih lanjut keluarga, penghapusan 8,9 kb termasuk ekson 1 adalah ditemukan. Ini penghapusan terjadi de novo dalam dua kasus sporadis, dan dipisahkan dengan fenotip dalam keluarga yang tersisa. Data ini mengkonfirmasi bahwa, berbeda dengan kemungkinan Tindakan dominan-negatif SALL1 mutasi menyebabkan Sindrom Townes-Brocks, Okihiro dan Acro-ginjalsindrom mata jelas hasil SALL4 haploinsufisiensi.

Berdasarkan fakta bahwa SALL1 knock-out menunjukkan tikus hanya cacat ginjal tetapi tidak ada fenotipe TBS-seperti, 13 keraguan yang dibangkitkan sehubungan dengan hipotesis SALL1 haploinsuffiefisiensi menyebabkan TBS. Sebagai penjelasan alternatif itu diasumsikan bahwa truncating SALL1 mutasi bisa menyebabkan TBS fenotipe dengan tindakan negatif yang dominan, dengan protein terpotong mengganggu transportasi nuklir wild type proteins.14 ini kemungkinan besar akan dihasilkan dari dimerisation tipe liar dan protein mutan dimediasi oleh yang evolusi sangat kekal domain glutamin kaya dalam bagian aminoterminal dari semua yang dikenal SAL-seperti proteins.1 6 15-22 Juli McLeskey Kiefer dkk menciptakan tikus transgenik pelabuhaning'' khas'' TBS mutasi dalam Sall1 gen untuk
Singkatan: IKAN, fluoresensi dalam hibridisasi in situ, OMIM, online Mendel Warisan di Man, SNP, polimorfisme nukleotida tunggal www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


2 dari 8 Laporan mutasi online Gambar 1 Silsilah keluarga dianalisis dan hasil analisis segregasi dari intragenic polimorfisme nukleotida tunggal (SNP) c.1056GRA, c.1520TRG, c.1860ARG (semua ekson 2), dan c.2640GRC (ekson 3) SALL4. Lihat tabel 2 untuk rincian klinis. (A) Keluarga 1 dengan Okihiro syndrome24 menunjukkan bahwa anggota keluarga yang terkena II.1 dan II.3 hanya mewarisi satu ayah SALL4 alel (sehubungan dengan ekson 2 dan 3) tapi tidak ada alel dari ibu mereka yang terkena dampak. II.4 dan III.1 tidak tersedia untuk penelitian. Perhatikan bahwa dalam keluarga lain, SNP c.2640GRC hanya genotipe dalam semua anggota keluarga tersedia jika ekson 2 SNP tidak informatif. (B) Dalam keluarga 225 diagnosis adalah sindrom Acro-ginjal-okular. The terkena Gadis II.1 hanya mewarisi satu ibu SALL4 alel (sehubungan dengan ekson 2) tetapi tidak satu SALL4 alel dari ayah yang terkena nya. (C) Dalam keluarga 3 diagnosis adalah sindrom Okihiro. Gadis yang terkena II.3 hanya mewarisi satu ayah SALL4 alel (sehubungan dengan ekson 2) tetapi tidak satu SALL4 alel darinya mempengaruhi ibu. (D) Keluarga 4, menunjukkan de novo penghapusan satu SALL4 alel pada pasien dengan sindrom sporadis Okihiro. Anak itu hanya mewarisi satu ayah SALL4 alel (sehubungan dengan ekson 2) tapi tidak ada ibu SALL4 alel. (E) Dalam keluarga 5 (diagnosis Okihiro sindrom), indeks pasien II.2 adalah ditemukan heterozigot untuk SNP c.1520TRC dan c.1860ARG. Jadi ada analisis segregasi dilakukan. (F) Dalam keluarga 6 (diagnosis, Okihiro syndrome), analisis segregasi dilakukan tapi tidak informatif untuk semua SNP dianalisis.

meniru cacat molekul pada pasien manusia. Memang, mereka bisa menunjukkan bahwa tikus heterozigot untuk tampilan ini mutasi fenotip yang sama dengan TBS dan bahwa ini adalah mungkin mengakibatkan dari aksi dominan-negatif terpotong Sall1 proteins.23 Berdasarkan hasil tersebut, penulis berasumsi bahwa mekanisme yang sama untuk SALL4 mutasi harus menjelaskan patogenesis sindrom Okihiro. Namun, dalam kami melihat berbeda distribusi SALL1 dan SALL4 mutasi menyarankan bahwa tindakan patogen yang berbeda masih harus dipertimbangkan. Untuk menjawab pertanyaan ini, kami mencari lebih lanjut klarifikasi untuk peran SALL4 dalam enam keluarga di mana anggota yang terkena didiagnosis memiliki Okihiro synDrome atau sindrom Acro-ginjal-mata tetapi ditemukan negatif untuk SALL4 mutasi.

METODE

Pasien Pasien dari enam keluarga yang berbeda dianalisis dalam belajar atas dasar adanya kriteria klinis yang khas untuk Okihiro atau Acro-ginjal-okular sindrom. Dua ini keluarga telah dilaporkan previously.24 25 Tiga keluarga tanpa mutasi disebutkan dalam pertama report.5 kami Darah vena dikumpulkan dari pasien dan tidak terpengaruh kerabat setelah mendapat persetujuan mereka. Analisis genetik DNA genom dipersiapkan dari limfosit perifer oleh prosedur rutin. Analisis Mutasi SALL4 ekson 1-4 (Wilayah coding lengkap) dilakukan sebagai described.5
www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


Laporan mutasi online 3 dari 8

Tabel 1 Primer yang digunakan untuk time polymerase chain reaction nyata kuantitatif SALL4 gen serta wilayah genom 100 kb 59 sampai ATG dan 100 kb 39 sampai berhenti kodon.
Cat dasar nama 10F 10R 16F 16R 41f 41R 49F 49r 65F 65R 81F 81R EX1-F EX1-R 104F 104R 111F 111R Ex2-F Ex2-R Ex3-F Ex3-R Ex4-F Ex4-R 135F 135R 146F 146R 161F 161R 172F 172R 175F 175R 194F 194R 217F 217R Posisi 10.656-10.682 10.885-10.860 16.234-16.257 16.396-16.373 41.734-41.760 41.883-41.857 48.877-48.901 49.037-49.011 65.489-65.513 65.601-65.579 81.354-81.376 81.586-81.563 101935-101958 102118-102141 104044-104069 104218-104194 111150-111175 111300-111274 113309-113330 113543-113563 115957-115980 116178-116201 120368-120392 120594-120618 134925-134952 135067-135042 146514-146540 146678-146652 161653-161679 161830-161805 172750-172775 172948-172923 175123-175149 175221-175195 194058-194082 194341-194316 217607-217633 217902-217879 Urutan 59-39 CCTTTTCCAACACCCATCATCCCAGCA CCAAGTCACCCTCACTCTCCTCACCA CATGGGGGTGGAGGAGGCTGGAGA AGGGGGTGGAGGGAAGGAGAAAGA GCCCAGGGACCTACTTCCGTCTTGCCA TTCTGAGCCCCTCGCTTTCTCACTGCC AAGGTGTGGGGGGGCAGTGGAGCAG TGGAGAGAATGAGGCAGCCAGTGGGGG GGCACAGTGGAAAGTCTCCCCCAAC GCTAGGCGGTGGCTCACACACAA TCCCCAGTCCCCCAAATCCCACA GGGGAGGAGGAGCAGAAGCAGTGA GAGTTGAGATGGGTGGGAGGGCTG GATGTCCACCAGCCGAGAAGGGAG GGGGTTTCCCGAGAAGACGGTCGCCA AAACGCCCAGCCATCCCCTCCGTCA TCCCCTGACCCACCCCCAGCCTACAC ACTTTTGACAGCACAGTCCACCCACGG GGCAGGGGCCGACACTCTGAAG GGAAGCAAAGCGCTCGGGAGG GTTCCTGGCACATTTGTGGGACCC GCTGAAAGCCCACACAAACCCACC CACACGGGGCGAACAATAACTCAGC CAAGGAAACCGGGAGGGTAGGAACC GGTGGCTCCATCCTGTGTGACAGCAAA TCACCAGAAGCCTTTCCCTGCTCCC GGTTTTTGGAGGCAAGGCATGGAACCG CCCAACCCCTCCACCCCTTCAAAGGCA TCTTGCAGCCCATCTCCCCAGCCTGTC TGCCCCAGGGTTCCAGAGGAGCAGTG

TGAGGTGAGCGGTCCAGCGAGGGACG ACCCCCACTCCCAGGTCACCCTCCCA GGCACCCCGAGAAGAGAGACCAGAGGT CCCTGCCTGCACGTACCCCAGGAAGAA GCAACCAACAAAAGCCCCATCGGAG GCCGCAAAGAGAGACCCACAAAGGAA GCAAGGAGAGGGAATGAAGCAGCACAA GGAAAGTGGCAAGGAGGGGCAGGA Amplikon panjangnya 230 163 150 161 113 233 206 175 150 254 244 250 142 164 178 199 100 284 296 ekson 1 ekson 1 intron 1 intron 1 intron 1 intron 1 ekson 2 ekson 2 ekson 3 ekson 3 ekson 4 ekson 4 Posisi nomor mengacu pada 220 kawasan kb seperti yang dijelaskan dalam Metode.

Sequencing reaksi dianalisis pada Megabace 500 sequencer otomatis (Amersham Biosciences, Amersham, Buckinghamshire, Inggris). Analisis pemisahan dilakukan dengan analisis urutan untuk SALL4 nukleotida tunggal polimorphisms (SNP) c.1056GRA, c.1520TRC, c.1860ARG, 2037CRT (semua ekson 2, dianalisis dalam semua keluarga) dan c.2640GRC (ekson 3, dianalisis dalam keluarga 1 dan 6). PCR kuantitatif Penghapusan deteksi dan pemetaan halus dari penghapusan itu dilakukan dengan menggunakan polymerase chain reaction kuantitatif (PCR) pendekatan dengan SYBR Hijau I-deteksi (Boehm et al, 2004). Kami merancang primer untuk amplifikasi kecil amplikon dalam setiap SALL4 coding ekson (tabel 1). Empat amplikon pemetaan untuk daerah subtelomeric dari 3p26.3, 2q24.2, 4p16, dan 4q35.2 digunakan sebagai reference.26 The SALL4 urutan genom termasuk 100 kb hulu dan downaliran daerah pengkode dari database NCBI (http:// www.ncbi.nlm.nih.gov/) yang bertopeng untuk mengulangi, dan 15 pasangan primer yang dirancang untuk memperkuat fragmen 100-300 pasangan basa (bp) menggunakan program PRIME (Komputer Genetik Group, Madison, Wisconsin, USA) (tabel 1). Amplikon yang dipetakan relatif terhadap SALL4 daerah pengkode (lihat gambar 2). Itu wilayah genomik diselidiki terdiri dari sekitar 220 kb, sekitar 100 kb pada 5 sisi dan 100 kb pada 3 sisi SALL4 gen (102-120 kb). Lokasi fisik Wilayah ini 50987000-51206999 bp untuk lengkap urutan (tepatnya 222 000 kb), dan 51.086.226-51.104.369 bp untuk SALL4 wilayah ditambah intron, dihitung dari coding telomer dari p-lengan kromosom 20. Sebagai SALL4 adalah ditranskripsi dari telomer ke sentromer pada q-lengan, yang startpoint dari urutan dianalisis (bp 0 = bp 51.206.999) adalah lebih telomeric, dan akhirnya (bp 220 bp 000 = 50.987.000) lebih centromeric. Kami menggunakan ABI Prism 7900 sistem (PE Terapan Biosystems, Norwalk, Connecticut, USA) dan berwarna putih Piring 384-baik (ABgene, Hamburg, Jerman) untuk real time deteksi. Reaksi yang terkandung 0,25 mM primer masing-masing dan 5 ml dari QuantiTect SYBRH Hijau PCR Master Mix (Qiagen) dalam Sebanyak 10 ml. Tes DNA termasuk standar di final konsentrasi 5.0, 2.5, 1,25, atau 0,625 ng / ml, no-template kontrol, atau 2,5 ng / ml DNA pasien dalam ulangan (n = 6). Kondisi bersepeda adalah 50 selama dua menit, 95 untuk 15cc menit, dan 40 siklus 94 (15 detik), 58 (15cc Cseconds), dan 72 (satu menit). Untuk semua amplikon sama kondisi yang diterapkan. Untuk menghindari generasi produk non-spesifik, yang analisis kurva leleh produk secara rutin dilakukan setelah amplifikasi. Sebuah kurva standar adalah constructed untuk setiap amplikon dengan memplot jumlah siklus (ct), di mana jumlah target dalam pengenceran standar mencapai ambang batas tetap, terhadap log dari jumlah awal sasaran. Kuantifikasi mutlak dari amplikon target di pasien itu kemudian dilakukan oleh interpolasi dari ambang Jumlah siklus (Ct) terhadap kurva standar yang sesuai. Data kuantitatif lebih lanjut dinormalisasi terhadap normal

www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


4 dari 8 Laporan mutasi online

Tabel 2 Fitur fenotipik anggota keluarga berpartisipasi


Pasien Keluarga 1 I.1 II.1 II.3 III.1 Keluarga 2 I.2 II.1 Mata N Bilat DA Bilat DA NR Senjata Bilat AT, HPLH L, AR L, HPLR +HPLU R Bilat AT, AR, HPLU Bilat AT + AR, HPLU, HPLH, HPL deltoid otot Bilat cacat ray radial Telinga N N N NR Pendengaran N N N NR Ginjal N N N NR Kaki NR NR NR NR Hati NR N N NR Putih hairlock, hiper / patch kulit depigmentasi Lain DA R, struct anom DA L, struct anom Bilat AT +AR, HPLU AT L +HPLT R N N NR Bilat CHL N PC dilat L, Vur NR NR NR NR Thalidomide paparan ibu Keluarga 3 I.1 II.1 II.3 Bilat DA N Bilat DA Bilat AR, AU +AT Bilat AT R: HPLT, HPL metacarp Saya+tenar L: AT N N N N N N Pelvic L ginjal NRNR HS kidneyNR NR NR NR Sendi temporo mandibularketidakstabilan Keluarga 4 II.1 Bilat DA L: AT, R: HPLT, bilat HPLR N N HPLK R Talipes Bilat NR Bilat lipatan epicanthic, hypertelorism, rendah hCG (PSS) Keluarga 5 II.2 III.2 III.3 Bilat DA Bilat DA Bilat DA Bilat AT +HPLR Bilat AT +HPLR

Bilat AT +HPLR N N NR NR Mild HL L NR NR Ginjal panggul R, HN L NR NR NR Tibialis hemimelia NR N NR Hip dislokasi Subluxated pinggul L, bahu disloc, lumbo-sacral meningocele Keluarga 6 II.2 Bilat DA Bilat HPLR, PRPD L Bilat dyspl Bilat HPS NR NR NR Anomali mata struktural dalam keluarga 2 bilateral hipoplasia disc tersegmentasi (I.2) dan coloboma retina di sebelah kiri, dan kanan disk displastik dengan nystagmus bilateral (II.1). Referensi: family 1, MacDermot K, Musim Dingin R. Am J Med Genet 1987; 27:313-19, keluarga 2, Becker K, et al, J Med Genet 2002; 39:68-71. AR, absen radius / jari-jari, AT, ibu jari tidak ada (s), Bilat, bilateral, CHL, gangguan pendengaran konduktif, DA, anomali Duane, dilat, dilatasi, disloc, dislokasi, HL, mendengar kerugian, HN, hidronefrosis, HPL, hipoplasia, HPLH, humerus hipoplasia, HPLK, ginjal hipoplasia, HPLR, radius hipoplasia, HPLU, ulna hipoplasia, HPLT, ibu jari hipoplasia, HS, tapal kuda, L, kiri, N, normal, NR, tidak ada kelainan dilaporkan; PC, pelvicalceal, PRPD, polydactyly preaxial, PSS, skrining prenatal serum, R, benar; HPS, sensorineural hearing loss, struct anom, anomali struktural.

diploid referensi genom dengan menghitung rasio relatif terhadap jumlah rata-rata amplikon referensi untuk masing-masing amplikon. Dengan cara ini nilai rasio 1,0 menunjukkan Situasi diploid, dan nilai-nilai dari 0,5 atau 1,5 mengindikasikan parsial haploidy atau parsial triploidy, masing-masing (lihat tabel 3). Breakpoint kloning Sebuah primer maju tambahan (92F, 59 CTTTCGTGTT TCCAT CCCATCCTAGCC 39) dirancang pada posisi 92.309-92.335 bp untuk amplifikasi daerah mencakup breakpoint di keluarga 6 dengan panjang PCR enzim campuran (Fermentas, Vilnius, Lithuania). Reaksi terkandung 0,2 mg DNA genom, 5ml Panjang PCR buffer dengan MgCl2, 5 ml dNTP (0,2 mM masing-masing), 10 pmol primer masing-masing (92F dan 104R), dan 2,5 unit Panjang Enzim PCR campuran untuk total volume 50 ml. Sebuah awal Cdenaturation langkah pada 94 selama tiga menit diikuti oleh 10 siklus 94 selama 15 detik dan 68 selama 10 menit. TheCC 25 siklus berikutnya dilakukan pada kondisi yang sama dengan 10 interval waktu detik per siklus selama langkah elongasi. Reaksi the diakhiri dengan langkah pemanjangan akhir pada 72 selama 10 menit. Produk PCR subcloned ke pGEM-T Mudah vektor (Promega, Madison, Wisconsin, USA) untuk lebih lanjut Tabel 3 Hasil SALL4 time polymerase chain reaction nyata diterapkan pada sampel DNA pasien enam keluarga dengan Okihiro / DRR atau sindrom acro-ginjal-okular
Rasio dinormalisasi (SALL4 amplikon / amplikon referensi) diberikan. Nilai diartikan sebagai situasi haploid (penghapusan) berkisar 0,46-0,57, sedangkan situasi diploid diasumsikan untuk nilai 0,95-1,06. Amplikon exonic dicetak dalam huruf tebal, shading abu-abu menunjukkan wilayah dihapus. Posisi angka mengacu pada 220 kawasan kb seperti yang dijelaskan dalam Metode www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


Laporan mutasi online 5 dari 8 Gambar 2 (A) Skema diagram SALL4 wilayah genomik pada kromosom 20q13.13-13.2 dengan posisi penghapusan terdeteksi dalam enam keluarga dianalisis, 220 kb urutan DNA genom (baris) yang terdiri dari SALL4 gen ditambah 100 kb urutan mengapit di setiap sisi dianalisis dengan waktu reaksi kuantitatif real polymerase chain (PCR) untuk penghapusan. Angka-angka menunjukkan posisi amplikon. Kotak hitam di atas baris menunjukkan SALL4 ekson diperbesar di bawah ini. Perhatikan perbedaan ukuran besar dari penghapusan serta dianggap daerah breakpoint umum. (B) Urutan (terbalik gratis) dari breakpoint mencakup jarak jauh fragmen PCR yang diperoleh dari pasien indeks dalam keluarga 6. Garis putus-putus menunjukkan bagian dari elemen AluY 7,6 kb hulu SALL4 ATG di mana istirahat 59 terjadi. Tidak ada elemen Alu ditemukan di dekat 39 breakpoint diposisikan dalam intron 1 dari SALL4 gen.

analisis. Plasmid diisolasi dari koloni bakteri dengan metode rutin dan sequencing menggunakan T7 dan SP6 primer, masing-masing. Fluoresensi dalam hibridisasi in situ Menyebar metafase dari limfosit darah perifer yang disiapkan oleh prosedur rutin. Sebelum fluoresensi dalam in situ hibridisasi (IKAN), slide diobati dengan RNase diikuti oleh pepsin digestion.27 IKAN dasarnya mengikuti metode sebelumnya described.28 Kromosom dalam penekanan in situ diaplikasikan pada probe berikut. Sebagai gen penyelidikan tertentu, 5,1 kb hasil PCR produk SALL4 mencakup bagian dari intron 1 serta ekson 2 dan 35 dipilih dan subcloned ke PCRHII-TOPOH(Invitrogen, San Diego, California, USA). Sebagai penanda untuk menandai kromosom 20 kita menggunakan PAC (kromosom buatan P1) klon manusia berasal dari sumur yang sama dari Human Genome Pria PAC perpustakaan (RPCI1, 3, 4, 5) 29 sebagai kromosom Y clone spesifik RP4529G14.30 klon ini bercampur terus-menerus untuk kromosom 20p11.2 dengan sinyal tunggal (Wimmer R, personal komunitasnication). Setelah IKAN, slide counterstained dengan DAPI (0,14 mg / ml) dan dipasang di Vectashield (Vector Laboratorium, Burlingame, California, USA). Database informasi elektronik Nomor aksesi dan URL untuk data dalam artikel ini adalah sebagai berikut: GenBank (http://www.ncbi.nlm.nih.gov) aksesi nomor: NM_020436 (SALL4 urutan cDNA), NT_01132 (Contig genomik termasuk SALL4). Online Mendel Warisan di Man (OMIM; http://www.ncbi.nlm.nih.gov/ OMIM): untuk Okihiro / Duane Radial Ray sindrom, OMIM 607.323, karena SALL4, OMIM 607.343, karena Acro-ginjal-okular sindrom, OMIM 102.490. Ulangi-masker di EMBL: http:// www.woody.embl-heidelberg.de

HASIL

SALL4 analisis mutasi mengungkapkan tidak ada heterozigot SALL4 mutasi dan tidak ada heterozigot SNP pada pasien indeks lima keluarga dengan diagnosis klinis sindrom Okihiro, antara ini menjadi sebuah keluarga dengan sindrom Okihiro dilaporkan sebelumnya, 24 dan satu keluarga dilaporkan sebagai Acro-ginjal-okular syndrome25 (gambar 1). Gambaran klinis dari keluarga yang terkena dampak
Gambar 3 Analisis IKAN pada pasien indeks keluarga 4. A SALL4 spesifik Probe (hijau) dan PAC clone hybridising ke kromosom 20p11.2 (Red) mendeteksi kedua kromosom 20 tetapi hanya satu SALL4 alel, sehingga mengkonfirmasikan penghapusan. www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


6 dari 8 Laporan mutasi online

anggota diringkas dalam tabel 2. Dalam keluarga pertama (Gambar 1A), tiga terpengaruh dan dua mata pelajaran terpengaruh (I.1, 2; II.1, 2, 3) yang tersedia untuk penelitian. Dalam kedua (keluarga 2; ara 1B), baik ayah yang terkena dampak dan putri terkena (I.2, II.1) dianalisis. Dalam keluarga jauh (keluarga 3; ara 1C), ibu, anak, dan seorang putri yang terpengaruh. Sampel tersedia dari ibu dan anak. Dalam keluarga 4 (gambar 1D), sebuah anak yang terkena lahir dari orang tua tidak terpengaruh. Keluarga 6 (gambar 1F) adalah kasus sporadis lain dengan orangtua yang sehat dan saudara tidak terpengaruh. Dalam keluarga 5 (gambar 1E), tidak ada mutasi adalah ditemukan pada pasien indeks (II.2), tapi ia heterozigot untuk SNP c.1520TRC dan c.1860ARG dalam ekson 2. Sampel yang tersedia dari ayah dan anak yang terkena dampak. Dalam keluarga 1, analisis segregasi dilakukan dengan analisis ekson 2 dan 3 di semua anggota keluarga tersedia dan informatif untuk SNP c.1056GRA, c.1520TRG, c.1860ARG (Semua ekson 2), dan c.2640GRC (ekson 3), menunjukkan penghapusan heterozigot minimal ekson 2 dan 3 (gambar 1A). Selanjutnya, analisis pemisahan dilakukan untuk ekson 2 SNP dalam keluarga lain dilaporkan di sini, c.2640GRC (ekson 3) hanya dianalisis dalam keluarga tersisa jika ekson 2 SNP tidak informatif. Dalam keluarga 2 (gambar 1B), hasilnya informatif untuk SNP c.1520TRG dan c.1860ARG, menyarankaning bahwa setidaknya ekson 2 telah dihapus di kedua pasien. Dalam keluarga 3, sampel yang tersedia dari ibu dan anak terpengaruh. Analisis segregasi lagi informatif untuk SNP c.1520TRG dan c.1860ARG, menyarankan heterozigot penghapusan setidaknya ekson 2 dari SALL4. Dalam keluarga 4 (gambar 1D), Analisis segregasi adalah informatif untuk SNP c.1056GRA, c.1520TRG, dan c.1860ARG, menunjukkan SALL4 de novo penghapusan yang pasti terjadi pada maternal mewarisi kromosom 20. Dalam keluarga 5 (gambar 1E), segregasi analisis tidak dilakukan karena SNP c.1520TRG dan c.1860ARG ditemukan menjadi heterozigot dalam indeks pasien II.2. Dalam keluarga 6, indeks pasien tidak menunjukkan heterozigot SNP ekson 2 atau 3 tetapi analisis segregasi adalah tidak informatif untuk semua SNP (gambar 1F). Untuk mengkonfirmasi penghapusan dicurigai dan untuk menentukan mereka ukuran, pasangan primer (tabel 1) yang dirancang untuk semua empat dari ekson SALL4 yang akan digunakan untuk kuantitatif PCR real time. Dalam hal ini analisis, semua enam keluarga yang disertakan. Real time kuantitatif PCR dikonfirmasi semua penghapusan exonic diprediksi oleh SNP genotip (tabel 3). Selain itu, mengungkapkan heterozigot penghapusan (lihat Metode untuk rincian) dari semua ekson dalam indeks pasien keluarga 2 dan 4, sedangkan pada pasien indeks keluarga 1 dan 3, penghapusan diamati hanya untuk ekson 1-3 tetapi tidak untuk ekson 4. Menariknya, pada pasien indeks keluarga 5 ekson 1-3 diamplifikasi normal, sedangkan ekson 4 ditemukan untuk dihapus pada satu alel. Sebaliknya, hanya ekson 1 produk amplifikasi berkurang pada pasien indeks keluarga 6. Prosedur ini diulang tiga kali, sekarang termasuk semua yang terpengaruh tersedia serta keluarga tidak terpengaruh anggota, dan hasilnya sepenuhnya dipisahkan dengan fenotip dalam semua keluarga (data tidak ditampilkan) atau terbukti de novo terjadinya dari penghapusan dalam kasus sporadis. Untuk memetakan ukuran penghapusan, pasangan primer tambahan dirancang untuk amplifikasi daerah non-berulang hulu dan hilir SALL4 daerah pengkode (Tabel 1 dan 3; gbr 2). Hasil PCR real time (tabel 3) disarankan ukuran penghapusan minimum mulai dari kirakira 0,2-24 kb dalam keluarga 6 sampai lebih dari 135 kb dalam keluarga 2 (Gambar 2). Tanpa diduga, analisis keluarga 3 menunjukkan bahwa, sementara ekson 4 dipertahankan, amplikon berikut pada 135 kb adalah lagi dihapus. Hasil ini dikonfirmasi oleh tiga tambahan pengulangan. Untuk menguatkan hasil kami dengan metode ketiga, kami menerapkan Ikan untuk mendeteksi penghapusan pada kromosom in situ. Berdasarkan pada ukuran penghapusan, keluarga 1-4 tampaknya cocok untuk penerapan metode ini, tetapi sel-sel yang tersedia hanya dari keluarganya 4. Sebagai klon kosmid harus terletak sepenuhnya dalam dihapus daerah untuk memungkinkan deteksi ambigu penghapusan, kami memilih untuk menggunakan subloned SALL4 Fragmen PCR mencakup ekson 2, intron 2, dan 3 ekson sebagai probe tertentu. Memang, penyelidikan ini secara konsisten terdeteksi hanya satu kromosom sekitar 20 dalam semua metaphases diperiksa (gambar 3). Dalam rangka untuk menentukan ukuran yang tepat dari penghapusan di keluarga 1 dan 3-6, kisaran panjang PCR dilakukan dengan maju dan reverse primer dari amplikon yang terletak di daerah non-dihapus tetangga penghapusan, tetapi tanpa sukses. Dalam keluarga 6, real time PCR hasil meramalkan diharapkan 39 breakpoint di intron 1 dalam wilayah sekitar 2 kb 39 ekson 1. Dengan menggunakan maju 92F primer dan 104R primer terbalik dalam keluarga 6 dengan

terkecil diprediksi penghapusan, kita bisa memperkuat penghapusan mencakup fragmen sekitar 3 kb (diharapkan tipe liar ukuran 11,8 kb) dari pasien indeks keluarga 6. Sequencing dari subcloned PCR fragmen (gambar 2B) dengan mengapit primer mengungkapkan ukuran penghapusan 8888 bp, yang terdiri dari 1139 bp dari intron 1, 130 bp ekson 1 urutan coding, dan 7619 bp urutan hulu ATG tersebut. 59 breakpoint berada dalam sebuah elemen AluY tetapi 39 breakpoint tidak berbohong dalam ulangi diprediksi.

PEMBAHASAN

Data kami menunjukkan untuk pertama kalinya bahwa sindrom Okihiro mungkin juga disebabkan oleh penghapusan heterozigot baik dari seluruh SALL4 daerah pengkode atau ekson tunggal. Dalam empat dari enam keluarga dianalisis, di antaranya adalah tiga mutasi negatif keluarga laporan awal kami pada SALL4 mutasi, 5 kami mampu membuktikan penghapusan oleh dua independen metodeanalisis pemisahan intragenic SNP, dan real kuantitatif time PCR. Dalam satu keluarga, metode ketiga, IKAN, diaplikasikan untuk mengkonfirmasi dan menggambarkan hasil. Dalam keluarga 1-3, baik Analisis segregasi SNP dan real time PCR dikonfirmasi pemisahan fenotip dengan penghapusan. Dalam keluarga 5, pemisahan penghapusan dan secara de novo kejadian dalam pasien indeks dibuktikan dengan waktu hanya PCR nyata, dan di keluarga 4 dan 6 penghapusan terjadi de novo seperti yang diharapkan untuk kasus-kasus sporadis. Oleh karena itu, tidak diragukan lagi bahwa tetap penghapusan bersifat patogen. PCR real time terbukti menjadi alat yang berharga untuk menentukan ukuran perkiraan penghapusan. Sebagian besar penghapusan ini akan lolos strategi menggunakan IKAN konvensional Probe untuk deteksi-yaitu, klon genomik lebih besar dari SALL4 daerah. Oleh karena itu, diterapkan PCR real time tampaknya menjadi metode pilihan untuk tujuan diagnostik. Itu penghapusan berkisar dari 8,9 kb dalam keluarga 6 hingga lebih dari 135 kb dalam keluarga 2. Melihat breakpoints awal (Gambar 2), tampaknya ada daerah hotspot untuk breakpoints dekat dengan SALL4 gen. Empat dari enam penghapusan (keluarga 2-5) end antara 135 dan 146 kb, masing-masing. Tiga dari enam penghapusan (keluarga 3, 4, 6) mulai antara 81 kb dan ekson 1. Mungkin, breakpoint antara ekson 3 dan 4 dibagi oleh keluarga 1, 3, dan 5. Kloning dari breakpoint dalam keluarga 6 menunjukkan bahwa elemen AluY kontribusi untuk istirahat pada 59 sisi. Pada 39 sisi, ada unsur Alu yang terlibat. Kloning Breakpoints lain diperlukan untuk menyelidiki apakah breakpoints masing memang dibagi oleh berbagai penghapusan dan jika ada rekombinasi khusus yang terkait motifs31 hadir di situs tersebut. Bagaimana penghapusan muncul? Analisis diselidiki 220 kb wilayah-yaitu, SALL4 coding daerah dengan tambahan 100 urutan genom kb pada kedua ujung-by ulangi masker mengungkapkan bahwa 314 elemen Alu hadir dalam wilayah, berkontribusi 38,58% dari seluruh urutan. Itu jumlah total mengulangi diselingi membuat untuk 59% dari berurutan. Melihat wilayah sekitar umum breaktitik wilayah 39 ke SALL4 gen-yaitu, 11 000 bp dari
www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


Laporan mutasi online 7 dari 8

135-146 kb-wilayah ini berisi 13 elemen Alu (35,02% dari urutan), dan sekuens berulang dari semua jenis membuat untuk 54,96% dari wilayah ini. Jadi Alu dimediasi recombination mungkin bertanggung jawab setidaknya untuk beberapa penghapusan, 32 33 dan kekayaan dalam elemen Alu dan lainnya daerah berulang-ulang bisa membuat SALL4 gen terutama rentan terhadap penghapusan. Breakpoint dalam keluarga 6, bagaimanapun, menunjukkan bahwa elemen Alu terlibat pada satu tapi tidak pada sisi lain penghapusan, dan proses menuju penghapusan masih belum jelas. Hasil penelitian kami menunjukkan untuk pertama kalinya bahwa Okihiro dan Acrosindrom ginjal-okular tidak hanya disebabkan oleh truncating SALL4 mutasi seperti yang ditunjukkan previously4 5 9 10 34 tetapi juga oleh penghapusan baik seluruh gen atau ekson tunggal, semua yang coding. Sementara tampak jelas bahwa penghapusan menghapus daerah pengkode utuh (seperti yang diamati dalam keluarga 2 dan 4), atau sebagian besar daerah pengkode (ekson 1 sampai 3 dihapus) termasuk daerah pengkodean jari seng ganda domain (dalam keluarga 1 dan 3), menghasilkan non-fungsional alel, penghapusan dalam keluarga 5 dan 6 hapus ekson yang menyimpan awal dan kodon stop, masing-masing. Itu Tampaknya ini tidak dapat dikompensasikan dengan alternatif splicing atau dengan menggunakan ATGs alternatif atau kodon stop. Tak satu pun dari kemungkinan tersebut dikenal untuk SALL4 gen atau homolog murine nya Sall4.35 Namun demikian, ada kemungkinan bahwa 8,9 kb penghapusan penampungan ekson 1 tidak hanya dihapus ATG ini tetapi juga bagian jika tidak semua SALL4 urutan promotor. Itu gambaran klinis serupa di antara keluarga yang berbeda dan ukuran penghapusan diduga kuat mengindikasikan bahwa semua penghapusan menghasilkan SALL4 haploinsufisiensi. Sebagai fenotipe disebabkan oleh penghapusan tidak berbeda dari yang disebabkan oleh SALL4 mutasi titik, kami berspekulasi bahwa truncating SALL4 mutasi titik memiliki sama efek patogen. Dalam semua keluarga dilaporkan di sini, setidaknya satu anggota yang terkena mengalami malformasi ekstremitas khas untuk Okihiro / Sindrom PRB dalam kombinasi dengan anomali Duane. Ginjal anomali yang hadir dalam empat dari enam keluarga (keluarga 2 5), menunjukkan bahwa sindrom Acro-ginjal-mata juga bisa memiliki didiagnosis dalam keluarga 3-5. Kehilangan pendengaran sensorineural dan telinga displastik seperti dalam keluarga 6, mata struktural malformasitions seperti dalam keluarga 2, dan malformasi kaki dan wajah fitur seperti dalam keluarga 4 juga telah terlihat pada keluarga dengan SALL4 Titik mutations.4 5 9 10 34 Menariknya, I.2 pasien keluarga 2 merupakan contoh lain dari seorang pasien yang thalidomide embryopathy awalnya dibahas. Satu-satunya perbedaan dalam fitur fenotipik antara pasien dengan mutasi titik dan penghapusan yang lebih besar tampaknya menjadi tingkat cacat jantung bawaan. Dalam penelitian terbaru kami, kami menemukan 34 cacat jantung bawaan dalam tiga dari 13 pembawa mutasi (Tiga dari lima keluarga), dan mantan studi, dua dari tujuh pasien (dua dari empat keluarga) memiliki cacat jantung bawaan. Analisis kasus penghapusan lanjut akan menunjukkan apakah ini mewakili perbedaan sejati antara dua kelompok.
D Boehm, Institut bulu Humangenetik, Universitat Gottingen, Gttingen, Jerman W Reardon, Pusat Nasional untuk Genetika Kedokteran, Rumah Sakit Bunda Maria for Sick Children, Crumlin, Dublin, Republik Irlandia J Clayton Smith, Departemen Genetika Klinis, Rumah Sakit St Mary, Manchester, UK K Becker, Kennedy-Galton Centre, Rumah Sakit Taman Northwick, Harrow, Inggris H Muhlendyck, Departemen Neuro-oftalmologi, Universitas Gttingen, Gttingen, Jerman R Musim Dingin, Institut Kesehatan Anak, University College London Medis Sekolah, London, UK O Giray, Departemen Pediatri, Divisi Genetika, Dokuz Eylul University, Izmir, Turki F Silan, Biologi Kedokteran dan Departemen Genetika, Abant Izzet Baysal University Medical School, Duzce, Turki Konflik kepentingan: none menyatakan Korespondensi: Dr J Kohlhase, Institut fur Humangenetik und Anthropologie, Universitat Freiburg, Breisacher Str 33, D-79106 Freiburg, Jerman; jkohlha@ukl.uni-freiburg.de

REFERENSI

1 Kuhnlein RP, Frommer G, Friedrich M, Gonzalez-Gaitan M, Weber A, Wagner-Bernholz JF, Gehring W, JACKlE H, Schuh R. Spalt mengkodekan evolusi dilestarikan seng protein jari struktur novel yang menyediakan fungsi gen homeotik di wilayah kepala dan ekor dari embrio Drosophila. EMBO J 1994; 13:168-79. 2 Kohlhase J, Wischermann A, Reichenbach H, Froster U, Engel W. Mutasi di SALL1 diduga faktor transkripsi gen penyebab Townes-Brocks sindrom. Nat Genet 1998; 18:81-3. 3 Kohlhase J. SALL1 mutasi pada sindrom Townes-Brocks dan terkait gangguan. Hum Mutat 2000; 16:460-6. 4 Al-Baradie R, Yamada K, St Hilaire C, Chan WM, Andrews C, N McIntosh, Nakano M, Martonyi EJ, Raymond WR, Okumura S, Okihiro MM, Engle EC. Duane Radial Ray Syndrome (sindrom Okihiro) peta ke 20q13 dan hasil dari mutasi pada SALL4, anggota baru dari keluarga SAL. Am J Hum Genet 2002; 71:1195-9. 5 Kohlhase J, Heinrich M, L Schubert, Liebers M, Kispert A, Laccone F, Turnpenny P, Musim Dingin RM, Reardon W. Okihiro sindrom disebabkan oleh SALL4

mutasi. Hum Mol Genet 2002; 11:2979-87. 6 Kohlhase J, Schuh R, G Dowe, Kuhnlein RP, JACKlE H, Schroeder B, Schulz- Schaeffer W, Kretzschmar HA, Kohler A, Muller U, Raab-Vetter M, Burkhardt E, Engel W, Tongkat R. Isolasi, karakterisasi, dan organ-spesifik ekspresi dua gen jari seng manusia baru yang terkait dengan Drosophila Spalt gen. Genomics 1996; 38:291-8. 7 Kohlhase J, Hausmann S, Stojmenovic G, Dixkens C, K Bink, SchulzSchaeffer W, M Altmann, Engel W. SALL3, anggota baru dari manusia Spaltseperti keluarga gen, peta ke 18q23. Genomics 1999; 62:216-22. 8 Okihiro MM, Tasaki T, Nakano KK, Bennett BK. Duane dan sindrom bawaan atas ekstremitas anomali. Sebuah kejadian familial. Arch Neurol 1977; 34:174-9. 9 Brassington AM, Sung SS, Toydemir RM, Le T, Roeder AD, Rutherford AE, Whitby FG, Jorde LB, Bamshad MJ. Ekspresivitas sindrom Holt-Oram tidak diprediksi oleh TBX5 genotipe. Am J Hum Genet 2003; 73:74-85. 10 Kohlhase J, Schubert L, M Liebers, Rauch A, K Becker, Mohammed SN, Newbury-Ecob R, Reardon W. Mutasi di SALL4 lokus pada kromosom 20 hasil dalam berbagai klinis tumpang tindih fenotipe, termasuk Okihiro sindrom, sindrom Holt-Oram, sindrom Acro-ginjal-okular, dan pasien dilaporkan sebelumnya untuk mewakili embryopathy thalidomide. J Med Genet 2003; 40:473-8. 11 Fraisse J, Bertheas MF, Frere F, Laura B, Rolland MO, Brizard CP. Un nouveau sindrom: del (20) (P13-qter). Lokalisasi segmentaire de gen de ` l'ade'nosine deaminase (ADA). Ann Genet 1981; 24:216-19 '. 12 Shabtai F, Ben-Sasson E, Arieli S, Grinblat J. Kromosom 20 lengan panjang penghapusan pada seorang pria cacat tua. J Med Genet 1993; 30:171-3. 13 Nishinakamura R, Matsumoto Y, K Nakao, Nakamura K, Sato A, Copeland NG, Gilbert DJ, Jenkins NA, Scully S, Lacey DL, Katsuki M, Asashima M, Yokota T. homolog murine dari SALL1 sangat penting untuk ureter bud invasi dalam pengembangan ginjal. Pembangunan 2001; 128:3105-15. 14 Sweetman D, Smith T, Farrell ER, Chantry A, Munsterberg A. dilestarikan daerah yang kaya glutamin dari ayam csal1 dan csal3 menengahi interaksi protein dengan anggota keluarga Spalt lainnya. Implikasi untuk sindrom Townes-Brocks. J Biol Chem 2003; 278:6560-6. 15 Hollemann T, Schuh R, Pieler T, Tongkat R. Xenopus Xsal-1, sebuah homolog vertebrata dari wilayah tertentu Spalt gen homeotik Drosophila. Mech Dev 1996; 55:19-32. 16 Ott T, Kaestner KH, Monaghan AP, Schutz G. tikus homolog wilayah tertentu Spalt gen homeotik Drosophila dinyatakan dalam mengembangkan sistem saraf dan dalam struktur mesoderm yang diturunkan. Mech Dev 1996; 56:117-28. 17 Koster R, Tongkat R, Loosli F, Wittbrodt J. Medaka Spalt bertindak sebagai target gen landak sinyal. Pembangunan 1997; 124:3147-56.

UCAPAN TERIMA KASIH

Kami berterima kasih kepada semua pasien dan keluarga mereka yang berpartisipasi dalam penelitian ini untuk kerjasama dan kesabaran mereka. Kami lebih ingin mengucapkan terima kasih kepada Franco Laccone, Derya Ercal, dan Elcin Bora untuk diskusi kasus dan metode, Rainer Wimmer dan Stefan Kirsch untuk clone PAC digunakan untuk menandai kromosom 20, Sabine Herold, Manuela Liebers, dan Martina Pilz untuk bantuan teknis ahli, dan Gerd Scherer untuk kritis membaca naskah. Karya ini didukung oleh WilhelmSander-Stiftung (hibah No 98.0175.2 JK). WR ingin mendorong adanya dukungan edge dari Medis Anak dan Research Foundation di Our Lady Hospital for Sick Children, Dublin. .....................

Afiliasi Penulis '

W Borozdin, M Leipoldt, C Wilhelm, J Kohlhase, Institut bulu Humangenetik und Anthropologie, Universitat Freiburg, Freiburg, Jerman www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com


8 dari 8 Laporan mutasi online
18 Onuma Y, Nishinakamura R, Takahashi S, T Yokota, Asashima M. Molekuler kloning dari novel Xenopus Spalt gen (Xsal-3). Biochem Biophys Res Commun 1999; 264:151-6. 19 Buck A, Archangelo L, Dixkens C, Kohlhase J. Molekuler kloning, lokalisasi kromosom, dan ekspresi murine SALL1 ortolog Sall1. Cytogenet your Genet 2000; 89:150-3. 20 Kohlhase J, Altmann M, L Archangelo, Dixkens C, Engel W. Genomic kloning, pemetaan kromosom, dan ekspresi analisis Msal-2. Mamm Genom 2000; 11:64-8. 21 Farrell ER, Munsterberg AE. csal1 dikendalikan oleh kombinasi dari FGF dan Sinyal Wnt dalam mengembangkan tunas anggota tubuh. Dev Biol 2000; 225:447-58. 22 Farrell ER, Tosh G, Gereja E, Munsterberg AE. Kloning dan ekspresi CSAL2, anggota baru dari keluarga gen Spalt dalam ayam. Mech Dev 2001; 102:227-30. 23 McLeskey Kiefer S, Ohlemiller KK, Yang J, McDill BW, Kohlhase J, Rauchman M. Ekspresi terpotong Sall1 represor transkripsi adalah bertanggung jawab untuk Townes-Brocks sindrom cacat lahir. Hum Mol Genet 2003; 12:2221-7. 24 MacDermot K, Musim Dingin R. Radial ray cacat dan anomali duane: laporan dari keluarga dengan autosomal dominan transmisi. Am J Med Genet 1987; 27:313-19. 25 Becker K, Beales PL, Calver DM, Matthijs G, Mohammed SN. Okihiro syndrome dan sindrom Acro-ginjal-okular: tumpang tindih klinis, perluasan fenotipe, dan tidak adanya PAX2 mutasi pada dua keluarga baru. J Med Genet 2002; 39:68-71. 26 Boehm D, Herold S, Kuechler A, Liehr T, Laccone F. deteksi Cepat subtelomeric penghapusan / duplikasi oleh Novel real-time PCR kuantitatif menggunakan Dye SYBR-hijau. Hum Mutat 2004; 23:368-78. 27 Ried T, Lengauer C, T Cremer, Wiegant J, RAAP A, van der Ploeg M, Groitl P, Lipp M. metafase khusus dan deteksi interfase wilayah breakpoint 28 29 30 31 32 33 34 35 di 8q24 sel limfoma Burkitt oleh tiga-warna fluorescent in situ hibridisasi. Gen Kanker chrom 1992; 4:69-74. Schempp W, Binkele A, Arnemann J, B Glaser, Ma K, Taylor K, Toder R, Wolfe J, S Zeitler, Chandley A. pemetaan Perbandingan YRRM-dan-TSPY kosmid terkait pada manusia dan kera hominoid. Chrom Res 1995; 3:227-34. Ioannou PA, Amemiya CT, Garnes J, Kroisel PM, Shizuya H, Chen C, Batzer MA, de Jong PJ. Sebuah bakteriofag vektor P1 yang diturunkan baru untuk perbanyakan fragmen besar DNA manusia. Nat Genet 1994; 6:84-9. Wimmer R, Kirsch S, A Weber, Rappold G, Schempp W. Azoospermia The Wilayah AZFa: pandangan evolusi. Cytogenet Genome Res 2002; 99:146-50. Abeysinghe SS, Chuzhanova N, Krawczak M, Bola EV, Cooper DN. Translokasi dan breakpoints penghapusan kotor penyakit warisan manusia dan Kanker I: Komposisi Nukleotida dan motif rekombinasi terkait. Dengung Mutat 2003; 22:229-44. Jeffs AR, Benjes SM, Smith TL, Sowerby SJ, Morris CM. Gen BCR recombines istimewa dengan elemen Alu di kompleks BCR-ABL translokasi dari leukemia myeloid kronis. Hum Mol Genet 1998; 7:767-76. Kolomietz E, Meyn MS, Pandita A, Squire JA. Peran cluster berulang Alu sebagai mediator dari penyimpangan kromosom berulang pada tumor. Gen Chrom Cancer 2002; 35:97-112. Borozdin W, Wright MJ, Hennekam RCM, Hannibal MC, Gagak YJ, Neumann TE, Kohlhase J. mutasi pada gen Novel SALL4 memberikan tambahan bukti untuk sindrom Acro-ginjal-mata dan Okihiro menjadi entitas alelik, dan memperluas spektrum fenotip. J Med Genet (In press). Kohlhase J, Heinrich M, Liebers M, Froehlich Archangelo L, Reardon W, Kispert A. Kloning dan analisis ekspresi Sall4, homolog murine gen bermutasi dalam sindrom Okihiro. Cytogenet Genome Res 2002; 98:274-7.

www.jmedgenet.com

Download dari jmg.bmj.com pada 23 Mei 2013 - Diterbitkan oleh group.bmj.com

SALL4 penghapusan adalah penyebab umum dari Okihiro dan sindrom Acro-ginjal-mata dan mengkonfirmasi haploinsufisiensi sebagai patogenik mekanisme
W Borozdin, D Boehm, M Leipoldt, et al. J Med Genet 2004 41: E113

doi: 10.1136/jmg.2004.019901
Diperbarui informasi dan layanan dapat ditemukan di:
http://jmg.bmj.com/content/41/9/e113.full.html

Ini termasuk:

Referensi

Artikel ini mengutip 32 artikel, 8 di antaranya dapat diakses secara gratis di:
http://jmg.bmj.com/content/41/9/e113.full.html # ref-daftar-1

Artikel dikutip dalam:

http://jmg.bmj.com/content/41/9/e113.full.html # terkait-url

Email mengingatkan layanan Tema Koleksi

Menerima pemberitahuan email gratis ketika artikel baru mengutip artikel ini. Daftar di kotak di sudut kanan atas dari artikel online.

Artikel tentang topik yang sama dapat ditemukan dalam koleksi berikut Genetik skrining / konseling (753 artikel) Molekuler genetika (1114 artikel) Tes diagnostik klinis (321 artikel) Imunologi (termasuk alergi) (514 artikel) JMG laporan mutasi online (167 artikel) Catatan Untuk meminta izin pergi ke:
http://group.bmj.com/group/rights-licensing/permissions

Untuk memesan cetak ulang pergi ke:


http://journals.bmj.com/cgi/reprintform http://group.bmj.com/subscribe/

Untuk berlangganan BMJ pergi ke: