Anda di halaman 1dari 64

BAB I PENDAHULUAN 1.

1 Latar Belakang Rabies atau penyakit anjing gila adalah penyakit hewan yang bersifat zoonosis (menular ke manusia). Lebih dari 55.000 kasus rabies pada manusia dilaporkan setiap tahun di dunia (Rupprecht et al., 2001; Wilde et al., 2008; Bourhy et al., 2008). Rabies disebabkan oleh virus rabies, dari genus Lyssavirus, famili Rhabdoviridae (OIE, 2008). Virus rabies termasuk virus yang memiliki genom RNA untai tunggal berpolaritas negatif (ss-RNA virus), memiliki ukuran diameter 75 nm dan panjang 180 nm. Virus rabies memiliki lima jenis partikel protein yang berbeda yakni glikoprotein (G), matrik protein (M), RNA polymerase (L), nukleoprotein (N), dan phosphoprotein (P) (Coll, 1995). Virus rabies dikeluarkan bersama air liur hewan yang terinfeksi dan ditularkan melalui gigitan, cakaran atau melalui kulit yang terluka (Bingham, 2005; Kang et al., 2007). Kasus klinis rabies pada hewan maupun manusia selalu berakhir dengan kematian. Penyakit Rabies menimbulkan dampak psikologis seperti kepanikan, kegelisahan, kekhawatiran, kesakitan dan ketidaknyamanan pada orang-orang yang terpapar. Kerugian ekonomi yang ditimbulkan pada daerah tertular terjadi karena biaya penyidikan, pengendalian yang tinggi, serta tingginya biaya postexposure treatment. Disamping itu, kerugian akibat pembatalan kunjungan

wisatawan, terutama di daerah yang menjadi tujuan wisata penting di dunia, seperti Bali, dapat saja terjadi jika tingkat kejadian rabies sangat tinggi.

Rabies telah ada di Indonesia sejak abad ke-19 dan telah tersebar di sebagian besar wilayah. Rabies dilaporkan pertama kali oleh Stchorl pada tahun 1884, yaitu pada seekor kuda di Bekasi, Jawa Barat. Selanjutnya kasus rabies pada kerbau dilaporkan pada tahun 1889, kemudian rabies pada anjing dilaporkan oleh Penning tahun 1890 di Tangerang. Kasus rabies pada manusia dilaporkan oleh Eilerts de Haan pada seorang anak di Desa Palimanan, Cirebon tahun 1894. Selanjutnya rabies dilaporkan semakin menyebar kebeberapa wilayah di Indonesia, yaitu Sumatra Barat, Jawa Tengah dan Jawa Timur tahun 1953, Sulawesi Selatan tahun 1959, Lampung 1969, Aceh tahun 1970, Jambi dan DI Yogyakarta tahun 1971. Rabies di Bengkulu, DKI Jakarta, dan Sulawesi Tengah di laporkan tahun 1972, Kalimantan Timur tahun 1974 dan Riau tahun 1975. Pada dekade 1990-an dan 2000-an rabies masih terus menjalar ke wilayah yang sebelumnya bebas historis menjadi tertular, yaitu Pulau Flores tahun 1998, Pulau Ambon dan Pulau Seram tahun 2003, Halmahera dan Morotai tahun 2005, Ketapang tahun 2005, serta Pulau Buru tahun 2006. Kemudian Pulau Bali

dilaporkan tertular rabies tahun 2008, Pulau Bengkalis dan Pulau Rupat di Propinsi Riau tahun 2009 (Direktorat Kesehatan Hewan, 2006; Kepmentan, 2008). Bali merupakan propinsi terbaru tertular rabies di Indonesia dan Bali dinyatakan tertular secara resmi berdasarkan Keputusan Menteri Pertanian No.:1637.1/2008 tertanggal 1 Desember 2008. Secara laboratorium rabies pada anjing di Bali didiagnosis pertama kali pada tanggal 27 Nopember 2008 yaitu pada satu ekor anjing asal Kelurahan Kedonganan. Dengan mengkaji kasus pada

manusia dan hewan serta masa inkubasi rabies, rabies diduga masuk ke Semenanjung Bukit, Kabupaten Badung, Propinsi Bali sekitar bulan April 2008 (Putra et al., 2009). Selanjutnya dalam beberapa bulan rabies sudah ditemukan menyebar kebeberapa wilayah antara lain di Kota Denpasar pada 19 Desember 2008. Pada pertengahan tahun 2009 wabah sudah menyebar ke Kabupaten Tabanan, Kabupaten Karangasem, Kabupaten Buleleng, Kabupaten Bangli dan Kabupaten Gianyar. Kabupaten Klungkung tertular akhir Maret 2010, dan

akhirnya bulan Juni 2010 Kabupaten Jembrana dinyatakan tertular rabies. Dengan demikian, saat ini, semua kabupaten/kota di Propinsi Bali sudah tertular rabies. Pengendalian penyakit rabies umumnya dilakukan dengan vaksinasi dan eliminasi anjing liar/diliarkan, disamping program sosialisasi, dan pengawasan lalu lintas hewan penular rabies (HPR). Vaksinasi massal merupakan cara yang efektif untuk pencegahan dan pengendalian rabies. Di Kabupaten Badung, Propinsi Bali, vaksinasi rabies pada anjing, sudah dilakukan sejak tanggal 4 Desember 2008, yang dilanjutkan dengan vaksinasi massal pada tanggal 21sampai 22 Desember 2008. Vaksinasi massal terus dilakukan sampai saat ini (Juni 2011) di seluruh Bali. Vaksin rabies yang digunakan adalah vaksin Rabivet Supra92 dan Rabisin. Upaya untuk mengendalikan rabies dengan vaksinasi dan eliminasi anjing yang tidak optimal tidak banyak memberikan hasil. Di daerah-daerah tertentu, kasus rabies bahkan semakin meningkat (Adjid et al., 2005). Demikian juga halnya yang terjadi di Bali. Itu terbukti dengan semakin luasnya wilayah yang terkena rabies. Hal ini mungkin disebabkan karena cakupan vaksinasi yang tidak

memadai.

Cakupan vaksinasi merupakan salah satu hal yang sangat penting

dalam pengendalian suatu penyakit, disamping kualitas vaksin, teknik aplikasi dan waktu pelaksanaan vaksinasi (Rahman dan Maharis, 2008; Touihri et al.,2011). Berdasarkan data yang ada di Balai Besar Veteriner Denpasar (BBVet Denpasar), 3 ekor anjing yang didiagnosis positif rabies ternyata sudah pernah mendapatkan vaksinasi rabies. Hal yang hampir sama juga dilaporkan oleh Wilde dan Tepsumethanon (2010), bahwa 3 sampai 6% kasus anjing rabies di Thailand memiliki sejarah sudah pernah divaksinasi. Hal ini menimbulkan kecurigaan bahwa kasus-kasus tersebut

kemungkinan disebabkan oleh virus isolat vaksin itu sendiri. Penyebab lainnya yang perlu dikaji antara lain rentang waktu kekebalan yang ditimbulkan oleh vaksin yang dipakai terlalu singkat, penanganan vaksin yang tidak baik (misalnya rantai dingin yang tidak terpenuhi), salah aplikasi, ataukah terjadi perbedaan struktural gen pada glikoprotein virus rabies yang ada di Bali. Yang disebut terakhir itu dapat menyebabkan vaksin yang diberikan tidak mampu lagi memberikan protektivitas pada anjing yang divaksin. Seperti

diketahui bahwa glikoprotein virus rabies merupakan protein yang berperan dalam menginduksi produksi antibodi netralisasi yang bersifat protektif setelah

vaksinasi. Glikoprotein juga sebagai faktor penting dalam patogenisitas virus rabies (Benmansour et al., 1991; Susetya, 2005; Nagarajan et al., 2006; Maillard dan Gaudin, 2002).

Masalah-masalah tersebut dapat diatasi dengan melakukan surveilans serologis untuk deteksi antibodi pasca vaksinasi dan analisis genetika terhadap gen penyandi glikoprotein virus rabies yang ada di Bali. Deteksi antibodi rabies sangat penting dilakukan untuk mengetahui efektivitas vaksin rabies. Jenis vaksin tampaknya menghasilkan respon imun yang berbeda. Hasil penelitian Minke et al. (2009) menunjukkan bahwa vaksin Rabisin menginduksi respon kebal tertinggi pada hari 14 setelah vaksinasi yaitu 87%. Vaksin yang lain, yaitu Nobivac, disebutkan menginduksi kekebalan yang lebih seragam yang mencapai 100% (Minke et al. 2009). Penelitian yang

dilakukan di Nigeria (Ohore et al. 2007) menunjukkan bahwa titer antibodi tertinggi dicapai antara 3 sampai 6 bulan pasca vaksinasi (PV) dan terendah antara 9 sampai 12 bulan PV. Metode uji untuk deteksi antibodi terhadap rabies yang sering digunakan adalah serum netralisasi (SN), yaitu Rapid Fluorscent Focus Inhibition Test (RFFIT) dan Fluorscent Antibodi Virus Neutralisation (FAVN) (OIE, 2008). Kedua metode uji tersebut menggunakan virus rabies hidup, sehingga pengerjaannya memerlukan laboratorium dengan fasilitas biosekuriti yang memadai dan staf yang telah terlatih baik serta sudah divaksinasi. Enzym Linked Immunosorbent Assay (ELISA) untuk deteksi antibodi pada serum hewan dan manusia sudah dikembangkan di beberapa negara. Kit ELISA untuk deteksi antibodi pada hewan telah diterima oleh OIE untuk uji sekrining atau uji alternatif dari FAVN. Kelebihan dari uji ELISA adalah dapat dilakukan dalam waktu empat jam, tidak menggunakan virus hidup, tidak memerlukan laboratorium

dengan fasilitas biosekuriti yang tinggi, dan dapat dilakukan dalam jumlah sampel yang lebih banyak. Hal ini terbalik dengan FAVN yang memerlukan waktu pengujian selama 4 hari (McElhinney et al., 2008). Pada penelitian ini metode ELISA digunakan untuk mendeteksi adanya antibodi terhadap rabies pada anjing setelah divaksinasi dengan vaksin Rabivet Supra92 dan vaksin Rabisin. Kit ELISA yang digunakan adalah produksi Pusat Veterinaria Farma (Pusvetma) Surabaya, merupakan produksi dalam negeri, lebih murah dibandingkan dengan Kit produksi luar negeri. Sejauh ini belum ada informasi tentang kualitas Kit ELISA rabies produksi Pusvetma tersebut. Untuk itu perlu dipelajari akurasi Kit yang digunakan, dengan membandingkan Kit ELISA produksi Pusvetma (lokal) dengan Kit ELISA yang sudah divalidasi oleh OIE (Platelia II rabies KIT produksi Bio-rad).

1.2

Rumusan Masalah 1. Berapa lamakah vaksin rabies Rabivet Supra92 dan vaksin Rabisin yang digunakan di Bali bisa memberikan kekebalan pada anjing?. 2. Bagaimanakah agreement between test (Kappa) KIT ELISA rabies produksi Pusvetma Surabaya dengan Kit PlateliaII rabies produksi Bio-Rad?. 3. Apakah sekuen gen penyandi glikoprotein virus rabies isolat Bali mempunyai kesamaan dengan isolat lainnya di Indonesia atau negara lain?.

1.3

Tujuan Penelitian 1. Untuk mengetahui rentang waktu kekebalan anjing yang divaksinasi rabies dengan vaksin Rabivet Supra92 dan vaksin Rabisin di Bali. 2. Untuk mengetahui agreement between test (Kappa) KIT ELISA rabies produksi Pusvetma Surabaya (lokal) dengan melakukan uji banding dengan KIT ELISA yang sudah divalidasi oleh OIE (Platelia rabies II produksi Bio-Rad) sebagai standard. 3. Untuk mengetahui sekuen gen penyandi glikoprotein virus rabies isolat Bali dan disepadankan dengan sekuen isolat lainnya di Indonesia atau negara lain.

1.4

Manfaat Penelitian Hasil penelitian ini diharapkan bermanfaat untuk mengetahui berapa lama

vaksin rabies yang digunakan bisa memberikan kekebalan pada anjing, serta agreement between test (Kappa) KIT ELISA Rabies produksi Indonesia (Pusvetma Surabaya). Dari hasil analisis gen penyandi glikoprotein yang didapat diharapkan dapat diketahui kekerabatan (jarak genetik) virus rabies isolat Bali.

BAB II KAJIAN PUSTAKA 2.1 Rabies Rabies (penyakit anjing gila) adalah penyakit hewan yang dapat menular ke manusia (bersifat zoonosis) (WHO, 2010). Rabies disebabkan oleh virus rabies dari genus Lyssavirus, famili Rhabdoviridae (Jallet et al., 1999). Virus rabies di keluarkan bersama air liur hewan terinfeksi dan ditularkan melalui luka gigitan atau jilatan. Rabies sangat penting artinya bagi kesehatan masyarakat, karena apabila penyakit tersebut menyerang manusia dan tidak sempat mendapat

perawatan medis akan mengakibatkan kematian dengan gejala klinis yang mengharukan dan bersifat fatal (Adjid, et al., 2005; Bingham, 2005; Dietzschold et al., 2005; Miah et al., 2005; Rupprecht et al., 2001).

2.1.1

Masa inkubasi dan gejala klinis rabies Masa inkubasi dan gejala klinis rabies bervariasi pada spesies satu dengan

lainnya. Menurut Hiswani (2003), masa inkubasi rabies pada anjing dan kucing berkisar antara 10 hari sampai 8 minggu. Pada sapi, kambing, kuda, dan babi berkisar antara 1 sampai 3 bulan. Peneliti lain mengemukan bahwa massa

inkubasi anjing penderita rabies kurang dari 10 hari (Tepsumethanon et al., 2004; 2008). Masa inkubasi rabies pada manusia juga bervariasi. Masa inkubasi rabies pada manusia kurang dari 30 hari ditemukan sebanyak 25%, 30 hari sampai 90 hari sebanyak 50%, 90 hari sampai 1 tahun sebanyak 20%, dan lebih dari 1 tahun

sebanyak 5% (Transfuzion, 2009). Peneliti lain mengemukakan bahwa masa inkubasi rabies pada manusia berkisar antara 30 hari sampai 90 hari, namun ada yang 4 hari sampai beberapa tahun, dan cendrung lebih singkat pada gigitan di muka dari pada di tungkai (WHO., 2010). Gejala klinis rabies pada anjing dan kucing hampir sama. Triakoso

(2007), mengemukakan bahwa Gejala klinis rabies dikenal dalam dua bentuk yaitu bentuk ganas dan bentuk diam. Pada rabies bentuk ganas (furious rabies) masa eksitasi panjang, kebanyakan akan mati dalam dua sampai lima hari setelah tanda-tanda rabies terlihat. Sedangkan pada rabies bentuk diam atau dungu (dumb rabies) terjadi kelumpuhan (paralisa) sangat cepat menjalar keseluruh anggota tubuh dan masa eksitasi pendek. Perjalanan penyakit rabies pada anjing dan kucing dibagi dalam tiga tahap/phase (Triakoso, 2007; CIVAS., 2010) yaitu phase prodormal, dilanjutkan ke phase eksitasi, dan phase paralisa. Pada phase prodormal hewan mencari tempat dingin dan menyendiri, tetapi dapat menjadi lebih agresif dan nervus, pupil mata melebar, dan sikap tubuh kaku (tegang). Phase ini berlangsung selama satu sampai tiga hari. Pada phase eksitasi hewan menjadi ganas dan menyerang siapa saja yang ada di sekitarnya dan memakan barang yang aneh-aneh. Selanjutnya mata menjadi keruh dan selalu terbuka serta tubuh gemetaran, kemudian masuk ke phase paralisa. Pada phase paralisa hewan mengalami kelumpuhan pada semua bagian tubuh dan berakhir dengan kematian. Gejala klinis rabies pada hewan pemamah biak adalah gelisah, liar, adanya rasa gatal pada seluruh tubuh, kelumpuhan pada kaki belakang, dan akhirnya

hewan mati.

Pada hari pertama atau kedua gejala klinis biasanya tempratur

normal, anorexia, ekspresi wajah berubah dari biasanya, dan sering menguak (Hiswani, 2003).

2.1.2

Karakteristik virus rabies Virus rabies merupakan virus RNA, termasuk dalam ordo

Mononegavirales, famili Rhabdoviridae (CDC., 2007).

Genus virus yang

termasuk dalam famili Rhabdoviridae antara lain genus Lyssavirus, genus Ephemerovirus, genus Vesiculovirus, genus Cytorhabdovirus, genus

Dichorhabdovirus, genus Novirhabdovirus, dan genus Nucleorhabdovirus. Virus yang termasuk dalam Genus Lyssavirus adalah virus rabies, lagos bat virus, mokola virus, Duvenhage virus, European bat virus 1 & 2 dan Australian bat virus (Gould et al., 1998; Guyat et al., 2003; Sissoe et al., 2005; CDC., 2007; Metlin et al.,2007; Zee et al., 2004; Triakoso, 2007). Virus rabies memiliki bentuk seperti batang peluru (silindris) dengan salah satu ujungnya berbentuk kerucut (Gambar 2.1). Virus rabies berukuran diameter 75 nm dan panjang 180 nm, memiliki panjang genom sekitar 12 kilo base (CDC, 2010; Suwarno, 2005; Bourhy et al., 2008). Peneliti lain mengemukakan ukuran virus rabies mempunyai diameter 45nm sampai 100nm, panjang 100nm sampai 430nm, dan panjang genom 11,9 kb (Tranfuzion, 2009). Virus rabies memiliki lima jenis protein yang berbeda, yaitu dua protein berada pada amplop yakni glikoprotein (G) dan matrik protein (M), tiga pada nukleokapsid yakni nukleoprotein (N), phospoprotein (P), dan RNA-dependent

10

RNA polymerase (RdRp, L) (Metlin et al.,2007). Berat molekul masing-masing protein adalah glikoprotein 64 kD sampai 68 kD, matrik protein 24 kD sampai 25 kD, nukleoprotein 60 kD, phospoprotein 40 kD sampai 45 kD dan RNA-dependent RNA polymerase 190 kD. Panjang nukleotida (nt) masing-masing protein adalah glikoprotein 1575 nt, matrik protein 805 nt, nukleoprotein 1424 nt, phospoprotein 991 nt dan RNA-dependent RNA polymerase 6475 nt (Coll, 1995; Nagarajan et al., 2006; Nagaraja et al., 2008; Swarno, 2005; Ren, 2010; Tomar et al.,2010; Warrell, 2009) (Gambar 2.2).

Gambar 2.1. Struktur Virus Rabies Sumber: http://expasy.org/viralzone/all_by_species/2.html

11

Gambar 2.2. Genom virus rabies Genom virus rabies adalah RNA untai tunggal, polaritas negatif, tidak bersegmen, dan mempunyai panjang sekitar 12 kb. Genom mempunyai leader-sequence (LDR) sepanjang 50 nukleotida yang diikuti oleh gen N, P, M, G, dan L (Sumber: http://www.cdc.gov/rabies/transmission/virus.html)

2.1.3

Glikoprotein virus rabies Glikoprotein virus rabies merupakan protein penyusun permukaan virus

yang berbentuk spike atau duri (berjumlah kurang lebih 400 duri) (CDC, 2010), dengan berat molekul sekitar 64 kD sampai 68 kD (Suwarno, 2005). Peneliti lain menyebutkan 65 kD (Sissoe et al.,2005). Glikoprotein virus rabies merupakan protein yang berperan dalam proses masuknya virus ke dalam sel inang dan merupakan protein yang menginduksi produksi antibodi netralisasi yang bersifat protektif (Benmansour et al., 1991; Langevin dan Tuffereau, 2002; Susetya, 2005; Nagarajan et al., 2006; Maillard dan Gaudin, 2002; Gupta et al., 2005; Sissoe et al.,2005). Glikoprotein juga sebagai faktor penting dalam patogenisitas virus rabies, terutama asam amino arginin pada posisi 333 (Ito et al.,2001; Susan et al.,2010).

12

Beberapa jenis vaksin virus rabies yang mengandung asam aspartat (Asp) atau asam glumaic (Glu), bukan sebuah arginin (Arg) pada posisi 333 dari glikoprotein virus rabies tidak patogen untuk tikus (Faber et al., 2005). Namun demikian peneliti lain mengemukakan bahwa patogenisitas strain virus rabies tidak hanya ditentukan oleh substitusi pada posisi G333. Substitusi lain dalam protein G, seperti N194K, juga mempengaruhi patogenisitas virus pada tikus (Tau et al., 2010). Hasil analisis genetika gen penyandi glikoprotein virus rabies Indonesia terhadap satu isolat asal Sumatra Barat, menunjukkan bahwa isolat tersebut mempunyai kekerabatan yang lebih dekat dengan isolat virus rabies asal China dibandingkan dengan isolat asal Thailand dan Malaysia (Susetya, 2005; Susetya et al., 2005).

2.2

Program Pengendalian dan Pemberantasan Rabies Strategi pengendalian dan pemberantasan rabies pada hewan umumnya

dilakukan melalui program vaksinasi massal. Rabies dapat diberantas dengan cakupan vaksinasi yang memadai pada anjing berpemilik dan pengendalian populasi anjing jalanan (stray dog). Jepang berhasil bebas dari rabies sejak tahun 1957 dengan melakukan kontrol legislasi yang kuat, termasuk sistem karantina dan vaksinasi pada anjing setiap tahun (Inoue, 2003). Kunci utama dalam menangani rabies adalah mencegah pada sumbernya yaitu hewan. Sesuai dengan pedoman pengendalian rabies terpadu, metoda

pemberantasan rabies dilakukan dengan a) vaksinasi dan eliminasi dilakukan pada anjing, kucing, dan kera dengan fokus utama pada anjing, b) vaksinasi dilakukan

13

terhadap anjing dan kera berpemilik, dan c) eliminasi dilakukan terhadap anjing tidak berpemilik dan anjing berpemilik yang tidak divaksinasi/diliarkan (Direktorat Kesehatan Hewan, 2006). Upaya untuk mengendalikan rabies dengan vaksinasi dan eliminasi anjing yang tidak optimal tidak banyak memberikan hasil, bahkan didaerah-daerah tertentu kasus rabies semakin meningkat (Adjid et al., 2005). Demikian juga halnya yang terjadi di Bali, terbukti dengan semakin luasnya wilayah yang terkena rabies. Secara laboratorium seluruh kabupaten/kota di Propinsi Bali sudah tertular rabies sejak Juni 2010. Hal ini mungkin disebabkan karena cakupan vaksinasi yang rendah (kurang dari 70%) atau vaksin yang digunakan hanya mampu memberikan kekebalan dalam waktu yang relatif singkat. Cakupan vaksinasi minimal 70% telah dibuktikan di banyak negara berhasil mencegah terjadinya wabah. Namun demikian pemberantasan rabies tidak hanya tergantung pada masalah anjing, tetapi juga menyangkut masalah manusia. Pada dasarnya

keberhasilan pengendalian dan pemberantasan rabies bergantung kepada tingkat kesadaran masyarakat. Perlu ada perubahan perilaku yang membuat masyarakat dapat menerima dan mematuhi berbagai kewajiban sesuai aturan yang berlaku. Kewajiban yang dimaksud antara lain mengandangkan atau mengikat anjing yang dimiliki, merawat dan menjaga kesehatannya, serta memvaksinnya secara rutin. Hal ini akan membantu petugas pengendali rabies menjadi lebih mudah mengatasi keadaan.

14

2.3

Vaksin Rabies Vaksin rabies sudah mengalami beberapa tahap perubahan dalam proses

pembuatannya. Sejarah vaksin rabies diawali oleh Louis Pasteur yang membuat attenuated live vaccine pada tahun 1980-an. Seiring dengan berjalannya waktu vaksin rabies terus mengalami modifikasi. Pada tahun 1908 Enrico Fermi berhasil membuat killed vaccine yang pertama, menggunakan phenol untuk

menginaktivasi virus (Wilde, 2009). Peneliti lain, Hiswani (2003) mengemukakan bahwa vaksin rabies telah dikenal sejak tahun 1879, dibuat pertama kali oleh Victor Galtier. Kemudian pada tahun 1958 Kissling membiakkan virus rabies

challenge virus standar (CVS) pada biakan sel ginjal anak hamster. Selanjutnya pada tahun 1963 Kissling dan Reese berhasil membuat vaksin rabies inaktif menggunakan virus rabies yang dibiakkan pada sel ginjal anak hamster (BHK). Di Indonesia vaksin rabies untuk hewan telah diproduksi sejak tahun 1967 oleh Pusat Veterinaria Farma (Pusvetma) Surabaya, menggunakan fixed virus rabies. Sebagai media untuk membiakkan virus rabies digunakan otak Vaksin yang dihasilkan diberi nama paten

kambing/domba umur 3 bulan.

Rasivet. Aplikasi vaksin tersebut melalui suntikan dibawah kulit dengan dosis 4 ml. Masa kebal vaksin Rasivet relatif pendek yaitu 6 bulan (Hiswani, 2003). Lebih lanjut dikemukakan bahwa sejak tahun 1983 pembuatan vaksin rabies di Pusvetma menggunakan biakan sel sebagai media pertumbuhan virus rabies. Setelah melalui rangkaian percobaan maka pada tahun 1984, Pusvetma telah mengeluarkan vaksin rabies yang menggunakan biakan sel sebagai tempat

15

pembiakan virus yaitu vaksin Rabivet. Namun vaksin ini menimbulkan masalah dilapangan yaitu beberapa daerah melaporkan adanya endapan warna hitam pada dasar vial. Selanjutnya Pusvetma memproduksi vaksin rabies yang diberi nama Rabivet Supra92. Dibandingkan dengan vaksin Rabivet maka vaksin Rabivet Supra92 mempunyai kandungan protein yang jauh lebih rendah yaitu 2 mg/ml. Dengan turunnya kandungan protein diharapkan tidak terjadi reaksi anafilaksis dan tidak menimbulkan rasa sakit pada suntikan. PH vaksin juga menunjukkan kestabilan yaitu kurang lebih 7 sesuai dengan pH tubuh (Hiswani, 2003).

2.4

Antibodi Antibodi juga dikenal sebagai immunoglobulin, sering disingkat dengan

Ig.

Antibodi dipergunakan oleh sistem imun untuk identifikasi dan netralisasi Antibodi merupakan protein plasma

agen asing, seperti bakteri dan virus.

globular dengan berat sekitar 150 kD. Berdasarkan isotipenya antibodi pada mamalia dapat dibedakan menjadi IgA, IgD, IgE, IgG, dan IgM. Unit Fungsional dari setiap antibodi adalah immunoglobulin (Ig). Bentuk monomer dari antibodi berisi hanya satu unit Ig seperti IgD, IgE, dan IgG. Antibodi juga bisa dalam bentuk dimerik dengan dua unit Ig seperti IgA, bentuk tetramerik dengan empat unit Ig seperti IgM pada ikan, atau pentamerik dengan lima unit Ig seperti IgM pada mamalia (Tizard, 2004, Roitt et al., 2000).

16

2.5

Diagnosa Serologis Rabies Beberapa metode uji telah dikembangkan untuk diagnosa rabies secara

serologis.

Metode uji untuk deteksi antibodi terhadap rabies yang sering

digunakan adalah serum netralisasi (SN), yaitu Rapid Fluorscent Focus Inhibition Test (RFFIT) dan Fluorscent Antibodi Virus Neutralisation (FAVN) (OIE, 2008). SN merupakan uji gold standard dalam pemeriksaan antibodi netralisasi terhadap rabies (Moore dan Hanion, 2010). Metode uji tersebut menggunakan virus rabies hidup, sehingga pengerjaannya memerlukan laboratorium dengan fasilitas biosekuriti yang memadai dan staf yang telah terlatih baik serta sudah divaksinasi. Complement fixation test dengan glikoprotein sebagai antigen juga dapat digunakan untuk deteksi antibodi netralisasi terhadap virus rabies (Cox et al., 1977). Enzym Linked Immunosorbent assay (ELISA) juga merupakan salah satu metode yang digunakan untuk deteksi antibodi pada serum hewan (anjing dan kucing) serta pada serum manusia. ELISA juga digunakan untuk deteksi antibodi pada hewan untuk uji sekrining atau uji alternatif dari FAVN (Cliquet et.al., 2004; Meslin dan Kaplan, 1996; OIE, 2008; Shanker, 2009). Kelebihan dari uji ELISA adalah dapat dilakukan dalam empat jam, tidak menggunakan virus hidup, tidak memerlukan laboratorium dengan fasilitas biosekuriti yang tinggi. Hal ini terbalik dengan FAVN yang memerlukan waktu pengujian selama 4 hari (McElhinney et al., 2008). ELISA sudah banyak digunakan untuk deteksi antibodi rabies pada program vaksinasi di beberapa negara antara lain Nigeria, dengan hasil prevalensi

17

antibodi tertinggi 87,5% ditemukan pada periode 3 sampai 6 bulan PV (Ohoe et al., 2007), di Botswana 54% (148/276) sampel yang diuji mempunyai antibodi protektif (Sebunya, 2007), di Bangkok, Tanzania, dan negara lain (Adriana et al., 1999: Cleaveland et al., 1999; Kasempimolporn, 2006; Salina et al., 1992;

Cliquet et al., 2000; 2003; Servat and Cliquet, 2006; Servat et al., 2006, 2007). Kit ELISA untuk deteksi antibodi terhadap rabies sudah tersedia di Indonesia yang diproduksi oleh Pusat Veterinaria Farma Surabaya. Enzym Linked Immunosorbent Assay (ELISA) merupakan reaksi pengikatan antara antigen dengan antibodi dengan bantuan enzyme sebagai penanda. ELISA merupakan teknik laboratorium yang digunakan untuk mendeteksi adanya antibodi atau antigen dalam sampel. Secara umum teknik ELISA yang digunakan untuk mendeteksi adanya antibodi adalah indirect ELISA, sedangkan sandwich ELISA untuk deteksi antigen. Dalam indirect ELISA untuk deteksi antibodi, microplate 96-wells yang berbahan polystirene dilapisi dengan antigen dan diinkubasikan sebelum dicuci. Serum yang diuji ditambahkan ke microplate sehingga antibodi dalam serum dapat berikatan dengan antigen. setelah inkubasi dan pencucian untuk menghilangkan antibodi yang tidak terikat, kehadiran dari setiap antibodi terikat terdeteksi dengan penambahan antiglobulin kimia terkait dengan enzim (konjugat). Komplek ini mengikat antibodi, setelah inkubasi dan pencucian, dapat dideteksi dan diukur dengan penambahan substrat. Intensitas warna yang berkembang sebanding dengan jumlah antibodi yang hadir dalam serum yang diuji. Intensitas warna dapat diperkirakan secara visual atau

18

dengan spektrofotometri (Tizard, 2000). Secara singkat prinsip uji ELISA di sajikan pada gambar 2.3.

Gambar 2.3.
Indirect ELISA and Sandwich ELISA. A) Dalam indirect ELISA, kepekatan warna mengindikasikan jumlah antibodi yang berikatan dengan antigen. (B) Dalam sandwich ELISA, kepekatan warna mengindikasikan kuantitas antigen (Sumber : http://www.ncbi.nlm.nih.gov/books/NBK22420/)

2.6

Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Reverse transcription-polymerase chain reaction (RT-PCR), merupakan

suatu metode yang sensitif untuk mendeteksi kadar ekspresi mRNA. RT-PCR tradisional melibatkan dua langkah yaitu reaksi RT dan amplifikasi PCR. RNA pertama direverse transkripsi menjadi DNA complement (complementary DNA, atau cDNA) menggunakan enzym reverse transcriptase. cDNA yang dihasilkan digunakan sebagai template untuk amplifikasi PCR selanjutnya menggunakan primer spesifik untuk satu atau lebih gen. RT-PCR juga dapat dilakukan dalam 19

satu langkah RT-PCR (one-step PCR). Pada satu langkah RT-PCR semua komponen reaksi dicampur dalam satu tabung sebelum memulai reaksi (Protocolonline.org., 2011; McPherson and Moller, 2000).

2.7

Validasi Metode Validasi metode uji laboratorium sangat penting dilakukan sebelum

digunakan di laboratorium. Menurut Putra (2009), validasi metode adalah suatu proses yang dilakukan untuk membuktikan bahwa suatu metode uji layak digunakan di laboratorium. Ada dua jenis validasi metode yaitu a) validasi primer dilakukan jika laboratorium menggunakan metode baru hasil pengembangan atau metode yang dimodifikasi terhadap suatu metode standard dan b) validasi sekunder dilakukan untuk verifikasi, jika laboratorium menggunakan atau mengadopsi metode yang telah divalidasi. Pelaksanaan validasi metode tergantung dari karakter yang dapat dideteksi oleh suatu metode uji. Beberapa kriteria yang dapat digunakan sebagai pedoman dalam melakukan validasi suatu metode uji yaitu limit deteksi, selektivitas/spesivisitas, metode/ketidak linearitas mantapan dan rentang,

kekuatan/robustness,

ketangguhan

(ruggedness),

presisi/keseksamaan, dan akurasi/kecermatan (Harmita, 2004; Wahyuriadi, 2009).

20

BAB III KERANGKA KONSEP DAN HIPOTESIS PENELITIAN

3.1 Kerangka Konsep Rabies merupakan penyakit hewan menular yang bersifat zoonosis, disebabkan oleh virus rabies. Virus rabies memiliki lima jenis partikel protein yang berbeda yaitu glikoprotein (G), matrik protein (M), RNA polymerase (L), Nukleoprotein (N), dan phosphoprotein (P). Protein ini berperan dalam penularan dan keganasan virus Rabies. Upaya pengendalian dan pemberantasan rabies dilakukan dengan melakukan vaksinasi pada anjing, kucing dan kera, serta eliminasi terhadap anjing liar dan anjing yang tidak berpemilik. Untuk mengetahui keberhasilan program vaksinasi yang telah dilaksanakan, perlu dilakukan evaluasi dengan monitoring antibodi pasca vaksinasi. Dari hasil monitoring tersebut dapat diketahui profil immun respon dari HPR yang di vaksinasi. Profil respon imun pasca vaksinasi akan memberikan gambaran jangka waktu kekebalan yang ditimbulkan oleh vaksin. Metode uji yang sering dipakai untuk mendeteksi adanya antibodi pada serum adalah serum netralisasi (SN) dan enzym linked immunosorbent assay (ELISA). Uji SN merupakan uji standard, tetapi uji ini sangat beresiko karena menggunakan virus hidup. Untuk dapat

dilaksanakan uji SN memerlukan pasilitas laboratorium dengan biosekuriti yang memadai, staf yang telah terlatih serta sudah divaksinasi, memerlukan waktu sekitar 4 hari. ELISA merupakan uji yang lebih sederhana, lebih murah, tidak

21

menggunakan virus hidup sehingga keamanan pekerjanya lebih terjamin, lebih cepat (hanya memerlukan waktu sekitar 4 jam), dan saat ini sudah tersedia KIT secara komersial, baik produksi lokal maupun luar negeri. Namun demikian, untuk mengetahui sensitivitas dan spesivisitas kit yang diproduksi oleh Pusvetma Surabaya (produksi lokal Indonesia), supaya mendapatkan hasil yang valid,

maka perlu dilakukan uji banding dengan kit yang sudah divalidasi. Berdasarkan data yang ada di laboratorium Balai Besar Veteriner Denpasar diketahui bahwa, beberapa kasus klinis rabies pada anjing adalah berasal dari anjing yang sudah mendapatkan vaksinasi rabies. Hal ini mungkin disebabkan oleh beberapa faktor antara lain mungkin strain virus vaksin yang digunakan tidak cocok dengan strain virus yang ada di Bali, handling vaksin yang tidak baik misalnya rantai dingin yang tidak terpenuhi, kemungkinan aplikasi vaksin yang tidak tepat, dan anjing dalam masa inkubasi. Adanya kasus positif rabies pada anjing yang sudah divaksinasi, menimbulkan pertanyaan apakah hal ini disebabkan oleh virus dari vaksin yang dipakai, ataukah ada perbedaan struktural gen penyandi glikoprotein rabies di Bali sehingga vaksin yang digunakan tidak mampu lagi memberikan proktektivitas pada anjing yang divaksin. Salah satu komponen virus rabies yang berperanan dalam pembentukan antibodi setelah vaksinasi adalah glikoprotein. Untuk itulah maka perlu dilakukan analisis genetika terhadap gen penyandi glikoprotein virus rabies isolat Bali. Secara singkat kerangka konsep dari usulan penelitian ini disampaikan pada Gambar 3.1.

22

3.2 Hipotesis Penelitian Berdasarkan rumusan masalah di atas maka dapat dirumuskan hipotesis sebagai berikut : a. Tidak ada perbedaan kekebalan anjing yang divaksinasi dengan vaksin Rabisin dengan anjing yang divaksinasi dengan vaksin Rabivet Supra92. b. Tidak ada perbedaan kualitas/akurasi KIT ELISA Rabies produksi Pusvetma dengan KIT PLATELIA II Rabies produksi Bio-rad. c. Tidak terjadi perbedaan sekuen gen penyandi glikoprotein virus rabies isolat Bali dengan isolat Indonesia lainnya.

23

Program pengendalian & pemberantasan rabies di Bali

Eliminasi

Vaksinasi

Pengendalian lalin HPR.

Evaluasi program vaksinasi

Respon kekebalan pada anjing perlu diketahui Metode Uji untuk deteksi antibodi

Laporan kasus rabies pada anjing pasca vaksinasi / kegagalan vaksinasi Faktor Penyebab kegagalan

SN

ELISA
Handling vaksin dan atau aplikasi valksin tidak baik Strain vaksin yang dipakai tidak sesuai Aplikasi vaksin kurang tepat

Lebih murah, cepat, aman, dan tersedia kit komersial

Uji banding kit perlu dilakukan kualitas kit diketahui sehingga hasil uji valid

pengujian sampel serum anjing pasca vaksinasi profil imun respon anjing diketahui

Glikoprotein virus rabies berperanan dalam menginduksi antibodi Analisis gen penyandi glikoprotein virus rabies isolat Bali perlu dilakukan sekuen gen penyandi glikoprotein virus rabies isolat Bali diketahui

Gambar 3.1. Diagram Alir Kerangka Konsep Penelitian

24

BAB IV METODE PENELITIAN 4.1 Lokasi Penelitian Pengambilan sampel serum untuk penelitian profil imun respon terhadap rabies dilakukan di beberapa kabupaten/kota di Provinsi Bali. Uji ELISA

dilakukan di Balai Besar Veteriner (BBVet) Denpasar. Pengujian sampel untuk isolasi RNA dan RT-PCR dilakukan di Laboratorium Biomedik Fakultas Kedokteran Hewan, Universitas Udayana. Sekuensing dilakukan di Eikjman Institute Jakarta. 4.2 Jenis dan Sumber Data Sampel otak positif rabies untuk analisis gen penyandi glikoprotein diambil dari arsif sampel di laboratorium BBVet Denpasar. Data primer berupa data sampel dari lapangan dan data hasil pengujian sampel di laboratorium. Data sekunder berupa data sekuen asam amino/susunan nukleotida gen penyandi glikoprotein virus rabies yang tersedia di Genbank. 4.3 Intrumen Penelitian Peralatan utama yang digunakan dalam penelitian ini antara lain tabung venoject, spuit, mesin pembaca ELISA (Reader 250 biomeureuck, Franch), mesin pencuci ELISA (Biomeureux, Franch), Mikropipet berbagai volume (0,5- 5l, 5 sampai 25 l, 20 l sampai 200 l, 200 l sampai 1000 l), multicannel pipet

volume 20 l sampai 250 l, (effendorf), inkubator 37oC (B&T), Micro centrifuge (Thermo), Waterbath (B&T), tips pipet, PCR mesin (termocycle, programable

25

termal controler, MJ-Research ink, PTC-100), gel elektrophoresis (Bio-rad), camera, dan mesin sekuenser. Bahan yang digunakan antara lain serum sampel, sampel otak anjing positif rabies, serum reference rabies positif (Antirabies reference serum of dog origin, batch number 2010-1, Maret 2010, titer 3UI/ml, produksi ANSES, Nancy laboratory for rabies and wild life, France, OIE reference laboratory for rabies), serum reference rabies negatif (Dog serum naive for rabies virus, batch number SR-07, 24/12/09, produksi ANSES, Nancy laboratory for rabies and wild life, France), kit ELISA rabies produksi bio-rad (Platelia Rabies II KiT Ref.: 3550180), dan kit ELISA Produksi pusvetma Surabaya tahun 2010, Trizol (Invitrogen), primer, RNA isolation kit (Invitrogen), PCR reaktion kit

(Invitrogen), enzym taq (Super Scrip III, One step RT-PCR mix Platinum Taq. Cat No.12574-026 Invitrogen), PCR Kit, Chlorofom, alkohol (Merck), 1% Agarose gel (UltrapureTM agarose gel, Invitrogen, USA), TAE buffer (Invitrogen), 100 bp DNA ladder (Invitrogen), dan ethidium bromide solution (Promega Corp., Madison, USA).

4.4 Metode Penelitian 4.4.1 Profil imun respon antibodi rabies pada anjing Sampel serum diambil dari anjing yang belum dan sudah mendapatkan vaksinasi rabies. Serum anjing diambil pada saat akan dilakukan vaksinasi atau booster vaksinasi menggunakan metode convenient sampling. Serum

dikelompokkan berdasarkan status vaksinasinya yaitu belum divaksinasi

26

(pravaksinasi), satu bulan sampai dengan tiga bulan pasca vaksinasi, lebih dari tiga bulan sampai dengan enam bulan pasca vaksinasi, lebih dari enam bulan sampai dengan sembilan bulan pasca vaksinasi, dan lebih dari sembilan bulan sampai dengan dua belas bulan pasca vaksinasi. Selanjutnya semua sampel serum diuji menggunakan Kit ELISA produksi Pusvetma. 4.4.2 Uji banding kit ELISA Sampel serum yang diambil dari anjing yang sudah divaksinasi dengan vaksin rabies dan serum reference rabies positif dan negatif (produksi ANSES France, OIE reference laboratory for rabies) yang sudah diencerkan, diuji dengan Kit produksi Pusvetma Surabaya dan Platelia II rabies Kit produksi Bio-Rad, dengan prosedur yang sudah tersedia didalam Kit sebagai berikut: A. Prosedur uji ELISA Kit Rabies Pusvetma Surabaya Serum sampel di inaktivasi dengan memanaskan dalam penangas air dengan suhu 56oC selama 30 menit, kemudian diencerkan 1:50 dengan

menambahkan 5l sampel serum dengan 245 l pelarut. Selanjutnya diencerkan serum kontrol positif (sediaan 25 kali) dan serum kontrol negatif secara serial dari 50 kali, 100 kali, 200 kali dan 400 kali. Serum sampel dan kontrol dimasukkan pada lubang mikroplate masingmasing 100l dan dua lubang dibiarkan tanpa serum sebagai kontrol konjugat. Kemudian mikroplate ditutup dengan plastik penutup dan diinkubasikan pada suhu 37oC selama 45 sampai dengan 60 menit. Selanjutnya cairan serum pada mikroplate uji dibuang dan dilakukan pencucian sebanyak minimal 5 kali. Cairan pencuci yang tersisa dalam jumlah kecil dalam mikroplat dikeringkan dengan cara

27

membalikkan mikroplat di atas kertas tissue tebal. Kemudian tambahkan konjugat yang telah diencerkan sebanyak 100l per lubang. Mikroplat ditutup kembali dan diinkubasikan pada suhu 37oC selama 45 sampai dengan 60 menit. Selanjutnya cairan dibuang dan dilakukan pencucian sebanyak minimal 5 kali dan ditambahkan substrat ABTS sebanyak 100l pada setiap lubang. Plate

diinkubasikan pada suhu kamar, dalam kondisi gelap selama 30 menit. Terakhir ditambahkan 100l stop solution pada setiap lubang. Pembacaan densitas optik (OD = Optical Density) pada pembaca (Reader) dengan panjang gelombang 405nm. Selanjutnya dihitung Equivalent Unit (EU) dari masing-masing OD sampel dengan menggunakan rumus yang sudah disediakan dalam KIT. Titer serum 0,5 EU atau lebih dianggap protektif.

B. Prosedur uji ELISA KIT Platelia II Kit Rabies Bio-Rad (Platelia Rabies II KiT Ref.: 355-0180) Mikroplate dikeluarkan dari kemasan, kemudian serum sampel, serum kontrol positif (R4a 0,5EU) dan kontrol negatif (R3) diencerkan dengan perbandingan 1: 100 dalam larutan pengencer (R6). Sedangkan serum kontrol positif standar (R4b), diencerkan 1:100 (sebagai S6 dengan titer 4EU) dalam larutan pengencer (R6), selanjutnya dari S6 tersebut diencerkan secara serial dua kali (500l S6 ditambah 500l R6) menjadi S5 (2EU), demikian seterusnya dengan cara yang sama menjadi S4(1EU), S3(0,5EU), S2(0,25EU) dan S1 (0,125EU).

28

Kemudian masing-masing serum sampel dan serum kontrol, dimasukkan 100l ke dalam lubang mikroplate. Mikroplate ditutup dan diinkubasikan pada suhu 37oC selama 1 jam. Mikroplate dicuci sebanyak 3 kali. Kemudian

ditambahkan 100l conjugate yang telah diencerkan pada semua lubang. Tutup mikroplate dan diinkubasikan 1 jam pada suhu 37oC. Mikroplate dicuci sebanyak 5 kali. Kemudian ditambahkan 100l substrat pada semua lubang, dan

diinkubasikan pada suhu kamar selama 30 menit dalam kondisi gelap. Kemudian ditambahkan 100 l stop solution pada semua lubang. Setelah 30 menit, dilakukan pembacaan optical density pada panjang gelombang 450nm sampai 620nm. Penghitungan dilakukan ke dalam EU dari masing-masing OD sampel dengan menggunakan rumus yang sudah disediakan dalam KIT. Titer 0,5 EU atau lebih dianggap protektif.

4.4.3

Analisis gen penyandi glikoprotein Sampel otak anjing diambil dari arsip sampel positif rabies (telah diuji

FAT/ biologis) yang ada di laboratorium patologi Balai Besar Veteriner (BBVet) Denpasar. Isolasi RNA dilakukan dengan melakukan ektraksi sampel otak dengan menggnunakan trizol (Invitrogen). Selanjutnya dilakukan uji Reverse

transcription- polymerase chain reaction (RT-PCR) pada single-step reaction, dengan total volume 25 l, menggunakan primer yang didisain oleh IGNK Mahardika dengan sofware primer 3, berdasarkan sekuen nukleotida glikoprotein (protein G) virus rabies yang tersedia di GenBank. Produk PCR divisualisasikan secara elektrophoresis dalam 1% agarose dengan ethidium bromide. Band DNA

29

hasil amplifikasi diobservasi dalam ruangan gelap menggunakan

UV

transluminator. Setelah produk PCR difurifikasi, selanjutnya dilakukan sekuen. Analisis sekuen nukleotida dari glikoprotein virus rabies isolat Bali dibandingkan dengan sekuen virus rabies isolat lain di Indonesia atau isolat negara lain. Data sekunder diperoleh dari GenBank. Data primer dan data sekunder disepadankan dan dianalisis dengan program Mega4. Parameter yang dianalisis adalah

filogenetik dan jarak genetik. Prosedur inaktivasi virus, isolasi RNA dan reverse transcription-polymerase chain reaction (RT-PCR) adalah sebagai berikut :

A. Inaktivasi virus Organ positif rabies dicuci dengan phospate buffer saline (PBS) pH 7,2 sebanyak tiga kali dan dimasukkan ke dalam tabung, kemudian digerus sampai halus. Selajutnya ditambahkan PBS sampai volume 500 l dan ditambahkan 50 l sodium dodecyl sulfate (SDS) 10% (dalam aquadest) sehingga konsentrasi SDS menjadi 1%. Selanjutnya divortex sebentar untuk mencampur, kemudian ditutup dan diselotip serta di desinfektan, terakhir disimpan pada suhu minus 20oC sebelum dipakai. B. Isolasi RNA Sebanyak 250 l suspensi sampel yang telah diinaktivasi ditambah 750 l trizol, kemudian divortex selama 1 menit dan diinkubasikan pada suhu kamar selama 5 menit. Selanjutnya ditambahkan 200 l Chloroform, kemudian divortex selama 15 detik dan di inkubasikan pada suhu kamar selama 15 menit. Selanjutnya disentrifuge 13.000 rcf (12.700 rpm) selama 15 menit. Kemudian

30

dipisahkan supernatan ke tabung steril (yakinkan bahwa trizol tidak ikut terambil karena mempengaruhi Band menjadi tidak bersih) dan ditambahkan Isopropil alkohol (2 propanol) 500 l. Selanjutnya diinkubasikan pada suhu kamar 10 menit, kemudian disentrifuge 13.000 rcf selama 10 menit dan supernatannya dibuang, ditambahkan alkohol 70% (Pro analisis) sebanyak 1000 l, dan dihomogenkan dengan tangan dengan cara membentuk angka 8. Kemudian

disentrifuge 7500 rcf selama 5 menit dan supernatannya dibuang, kemudian dikeringkan (air dry) 5-10 menit pada inkubator dengan suhu 55oC. Selanjutnya ditambahkan Treaded water (Aquadest injeksi/ nuklease free water) 20l. Kemudian disimpan dalam lemari es selama 1 malam, selanjutnya disimpan dalam freezer sampai digunakan. C. Primer design Primer dirancang sendiri oleh IGNK Mahardika, menggunakan program Primer 3 (http://biotool.umassmed.edu/bioapps/Primer3-www.cgi). Primer

dirancang berdasarkan susunan nukelotida dari glikoprotein (protein G) virus rabies yang tersedia di GenBank. Primer dirancang khusus untuk

mengamplifikasi sekitar 751bp, yaitu dari nukleotida nomor 688 sampai 1439 berdasarkan ORF protein G virus rabies 03003INDO-G/Padang

Pariaman/Sumatera Barat/2003/acession number EU086151. Primer tersebut adalah: BPRG : 5CAACATGTCATTAGGAAAATTATCAACA 3 G688F : 5GATGAAAGAGGATTGTAGAAGTC 3

31

D. Reverse transcription-polymerase chain reaction (RT-PCR) Reverse transcription-polymerase chain reaction (RT-PCR) dilakukan pada single-step reaction, dengan total volume 25 l yang mengandung PCR mix 12,5 l, RNA sampel 2,5 l, forward primer 1,5 l, reverse primer 1,5 l, enzym taq polymerase (Super ScripTM III One-Step RT-PCR System with Platinum Taq DNA Polymerase Kit, Invitrogen, Carlsbad, CA, USA ) 0,5 l dan 6,5 l akuades dalam micro tube (PCR tube), kemudian dihomogenkan, selanjutnya di masukkan kedalam mesin PCR (Thermal cycler) untuk sintesis cDNA yang diikuti dengan amplifikasi PCR, dengan program sebagai berikut: satu siklus untuk sintesis cDNA pada suhu 50oC selama 1 jam, satu siklus denaturasi pada suhu 95oC selama 45 detik , kemudian diikuti dengan 40 siklus yang terdiri atas denaturasi pada suhu 94oC selama 45 detik, anneling pada suhu 52oC selama 45 detik dan ekstensi pada suhu 72oC selama 1 menit. Setelah 40 siklus selanjutnya step terakhir adalah ekstensi pada suhu 72oC selama 5 menit dan terakhir diinkubasi pada suhu 22oC.

E. Visualisasi produk PCR Produk PCR yang diperoleh divisualisasikan dengan elektrophoresis menggunakan 1% agarose (0,5 gram Ultrapure TM agarose gel, Invitrogen, dalam 50 ml TAE 1x buffer dan 5 l ethidium bromide ). Kemudian pada setiap lubang agar gel diisi 3 l campuran terdiri dari 1 l Blue joice (loading day) dan 2 l produk PCR. Running gel dalam waktu 30 menit, voltase 100 volt dan ampere

32

400mA. Pada setiap gel pada salah satu lubangnya diisi marker 100bp DNA lader (Invitrogen).

F. Sekuensing Sekuensing dilakukan di Eijkman Institute Jakarta. Produk PCR dikirim bersama-sama dengan primernya.

4.5 Analisis data 1. Data hasil uji titer antibodi protektif dianalisis secara statistik dengan logistik regresi dan data parametrik (titer EU) dianalisis dengan analisis of variance (ANOVA), menggunakan program Epi Info version 3.5.1 (CDC, 2009). 2. Data hasil uji banding 2 kit ELISA dianalisis berdasarkan agreement between test (kappa) (Viera dan Garrett, 2005, Robertson, 2008) dengan rumus sebagai berikut: (Po Pe) Kappa = (1 Pe) Keterangan : Po (Observed agreement) = (a+d)/n Pe (expected agreement) = [(a+c/n) x (a+b/n)] + [(b+d/n) x (c+d/n)] a = Jumlah hasil positif dengan kit PlateliaII dan kit Pusvetma, b = Jumlah Hasil positif dengan kit Pusvetma dan negatif dengan kit PlateliaII, c = Jumlah hasil uji positif dengan PlateliaII dan negatif dengan kit Pusvetma, d = Jumlah hasil uji negatif dengan kit

33

PlateliaII dan kit Pusvetma, dan n = Jumlah keseluruhan sampel yang diuji (a+b+c+d), secara ringkas disajikan pada Tabel 4.1.

Tabel 4.1. Tabulasi hasil uji banding 2 kit ELISA rabies Hasil uji Kit Platelia II Kit Platelia II Total Positif Negatif ________________________________________________________ Kit Pusvetma a b a+b Positif Kit Pusvetma Negatif c d c+d ________________________________________________________ Total a+c b+d n(a+b+c+d)

Interpretasi nilai Kappa adalah seperti berikut : >0,8 1,0 = 0,6 0,8 = 0,4 0,6 = 0,2 0,4 = 0,0 0,2 = 0,0 = -1 0 = Excelent agreement Substantial agreement Moderate agreement Fair agreement Slight agreement Poor agreement Disagreement

3.

Data primer hasil sekuensing fragmen gen penyandi glikoprotein

virus rabies (3 isolat Bali, 1 isolat Flores dan 1 isolat Sulawesi) dan data sekunder hasil sekuensing gen penyandi glikoprotein virus rabies yang ada di genbank (lampiran C1), disepadankan dan dianalisis dengan program MEGA4 (Tamura et al., 2007). adalah filogenetik dan jarak genetik. Parameter yang dianalisis

34

BAB V HASIL PENELITIAN 5.1 Profil imun respon. Hasil pengujian antibodi terhadap rabies dari kelompok anjing yang divaksinasi Rabivet Supra92 yang diambil pada periode pasca vaksinasi (PV) yang berbeda ditampilkan pada Tabel 5.1. Tabel tersebut menunjukkan bahwa persentase anjing yang mempunyai kekebalan protektif tertinggi (75,83%) ditemukan pada kelompok anjing yang diambil 3 bulan sampai dengan 6 bulan PV. Persentase pada kelompok periode 3 minggu sampai dengan 3 bulan PV, >6 bulan sampai dengan 9 bulan, dan kelompok >9 bulan sampai dengan 12 bulan PV berturut-turut adalah 40,35%, 25,24%, dan 35,29%. Persentase kekebalan tersebut tidak dipengaruhi oleh jenis kelamin, status kastrasi, jenis anjing, dan kondisi anjing. Pengujian statistik dari pengaruh faktor tersebut ditampilkan pada Tabel 5.2.

Tabel 5.1. Hasil uji antibodi terhadap rabies pada sampel serum anjing yang divaksinasi Rabivet Supra92 dengan kit ELISA Pusvetma.
Periode Vaksinasi 3 mg 3 bln PV >3 s/d 6 bln PV >6 s/d 9 bln PV >9 s/d 12 bln PV Total Jumlah Persentase Protektif 40,35% 25,24%
a

Rata-rata titer (EU) 0,5434 0,4726 1,0789


a

Standard Deviasi 0,306 1,443 0,415 2,229

Sampel Protektif 57 269 103 34 23 204 26 12

75,83%b
c ac

1,2236a
a a

35,29%

Keterangan: Nilai dengan hurup yang berbeda pada kolom yang sama menunjukkan perbedaan yang nyata (P<0,05), sedangkan nilai dengan hurup yang sama pada kolom yang sama menunjukkan tidak berbeda nyata (P>0,05).

35

Tabel 5.2. Hasil uji statistik pengaruh status kastrasi, kondisi anjing, jenis anjing

dan jenis kelamin terhadap antibodi protektif pada sampel serum anjing PV Rabivet Supra92 yang diuji dengan kit ELISA Pusvertma.
_____________________________________________________________________________________

Variabel Status Kastrasi Jenis Anjing Jenis Kelamin

Odds Ratio 1,9127 1,2686 0,7594

95% CI 0,7583 4,8244 0,4693 1,0277 0,9475 1,6985 0,5099 1,1312

Coefficient 0,6485 -0,3648 0,2379 -0,2752

SE 0,4720 0,1998 0,1489 0,2033

Z- Statistik P-Value 1,3739 0,1695 -1,8259 1,5980 -1,3537 0,0679 0,1100 0,1758

________________________________________________________________________ Kondisi Anjing 0,6943

Hasil pengujian terhadap serum anjing yang divaksin dengan vaksin Rabisin ditampilkan pada Tabel 5.3. Hasil tersebut menunjukkan bahwa persentase antibodi protektif pada kelompok periode 3 minggu sampai dengan 3 bulan, >3bulan-6 bulan, >6-9 bulan, dan >9 bulan-12 bulan berturut-turut adalah 64,91%, 72,64%, 45,28%, dan 37,25%. Persentase tersebut juga tidak dipengaruhi oleh jenis

kelamin, status kastrasi, jenis anjing dan kondisi anjing (P>0.05) seperti ditampilkan pada Tabel 5.4. Tabel 5.3. Hasil uji antibodi terhadap rabies pada sampel serum anjing yang divaksinasi Rabisin yang diuji dengan Kit Pusvetma.
Periode Vaksinasi 3 mg 3 bln PV >3 s/d 6 bln PV >6 s/d 9 bln PV >9 s/d 12 bln PV Total Sampel 57 106 53 51 Jumlah Protektif 37 77 24 19 Persentase Protektif 64,91% 72,64%
a b b a

Rata-rata EU 2,6530 4,7898


a a a a

Standard Deviasi 5,4790 7,8728 2,6114 0,8422

45,28%

1,3349 0,6195

37,25%

Keterangan: Nilai dengan hurup yang berbeda pada kolom yang sama menunjukkan perbedaan yang nyata (P<0,05), sedangkan nilai dengan hurup yang sama pada kolom yang sama menunjukkan tidak berbeda nyata (P>0,05). 36

Tabel 5.4. Hasil Analisis Statistik pengaruh status kastrasi, kondisi anjing, jenis anjing dan jenis kelamin terhadap antibodi protektif pada sampel serum anjing yang divaksinasi Rabisin yang di uji dengan Kit Pusvetma.
___________________________________________________________________________ Variabel Odds 95% CI Coefficient SE Z- Statistik P-Value Ratio __________________________________________________________________________ Status Kastrasi 0,5095 0,2194 -0,6743 0,4299 -1,5684 0,1168 Kondisi Anjing 1,3663 Jenis Anjing Jenis Kelamin 0,9553 0,6139 0,8444 0,5704 0,3638 0,3121 -0,0458 -0,4879 0,2456 0,2631 0,2670 1,2710 -0,1739 -1,8271 0,2037 0,8619 0,0677

Perbandingan titer antibodi terhadap rabies dan persentase antibodi protektif terhadap rabies pada anjing yang divaksinasi Rabisin dan Rabivet Supra92 ditampilkan pada Tabel 5.5. Data tersebut menunjukkan bahwa titer antibodi yang diinduksi oleh vaksin Rabisin sangat nyata lebih tinggi dibandingkan dengan titer antibodi yang diinduksi oleh vaksin Rabivet

Supra92 (P<0.01). Sedangkan persentase kekebalan menunjukkan hasil yang tidak bebeda nyata antara anjing yang divaksin dengan Rabisin dan Rabivet Supra92 (P>0,05). Perbandingan persentase antibodi protektif pada berbagai kelompok anjing berdasarkan waktu pengambilan serum pasca vaksinasi ditampilkan pada Tabel 5.6. Data tersebut menunjukkan bahwa persentase antibodi protektif yang diinduksi oleh vaksin Rabisin pada periode >3 minnggu sampai dengan 3 bulan pasca vaksinasi nyata lebih tinggi dibandingkan dengan persentase antibodi protektif anjing yang divaksinasi dengan Rabivet Supra92 (P<0,05). Penampilan grafis titer antibodi terhadap rabies dan persentase kekebalan kelompok anjing yang divaksin dengan Rabisin dan Rabivet Supra92 ditampilkan pada Gambar 5.1 dan 5.2. Gambar

37

tersebut menujukkan bahwa titer antibodi dan persentase yang tertinggi ditemukan pada kelompok anjing yang serumnya diambil >3 bulan sampai dengan enam bulan pasca vaksinasi.

Tabel 5.5 Rata-rata titer antibodi (EU) dan persentase antibodi protektif pada serum anjing yang divaksinasi Rabisin dan Rabivet Supra92 yang di Uji dengan kit ELISA Pusvetma _________________________________________________________ Jenis Vaksin Hasil Uji Rabisin Rabivet Supra92 _________________________________________________________ Rata-rata titer antibodi (EU) 2,8512a 0,9622b Rata-rata antibodi protektif 58,8%a 57,24%a _________________________________________________________ Keterangan: Nilai dengan hurup yang berbeda pada baris yang sama menunjukkan perbedaan yang sangat nyata (P<0,01), sedangkan nilai dengan hurup yang sama pada baris yang sama menunjukkan tidak berbeda nyata (P>0,05). Tabel 5.6. Persentase Antibodi Protektif Anjing yang di Vaksinasi Rabisin dan Rabivet Supra92 yang di Uji dengan Kit ELISA Pusvetma. _______________________________________________________ Pasca Vaksinasi Persentase antibodi protektif Rabisin Rabivet Supra92 _______________________________________________________ 40,35%b 3 mg 3 bln 64,91%a a >3 6 bln 72,64% 75,83%a >6 9 bln 45,28%a 25,24%b a >9 12 bln 37,25% 35,29%a _______________________________________________________ Keterangan: Nilai dengan hurup yang berbeda pada baris yang sama menunjukkan perbedaan yang nyata (P<0,05), sedangkan nilai dengan hurup yang sama pada baris yang sama menunjukkan tidak berbeda nyata (P>0,05).

38

Gambar 5.1. Rata-rata EU Serum anjing pasca vaksinasi Rabisin dan Rabivet Supra92 yang diuji dengan kit ELISA Pusvetma (

: Rabisin,

: Rabivet)

Gambar 5.2. Perbandingan Persentase antibodi protektif pada anjing yang divaksinasi dengan vaksin Rabivet supra92 dan Rabisin ( : Rabisin, : Rabivet)

39

Pengujian terhadap 53 sampel serum yang diambil dari anjing yang belum divaksinasi, dan diuji dengan ELISA Kit Pusvetma, menunjukkan bahwa 3 sampel (5,66%) mempunyai antibodi protektif terhadap virus rabies, dengan titer 0,5095EU, 0,529EU dan 0,5526EU.

5.2 Hasil Uji Banding Kit ELISA. Hasil uji banding Kit ELISA Pusvetma dan Platelia Rabies II kit (Bio-rad) terhadap semua serum anjing (serum referens, serum lapang yang divaksin dengan Rabivet dan Rabisin) ditampilkan pada Tabel 5.7. Sedangkan hasil yang diperoleh terhadap serum referens, serum lapang hasil Rabivet, dan Rabisin ditampilkan pada Tabel 5.8, 5.9, dan 5.10. Nilai kappa, sensitivitas, dan spesivisitas kit Pusvetma dari semua serum adalah berturut-turut 0,68 (substantial agreement), 96,8% dan 73,5%. Nilai-nilai tersebut dalam pengujian terhadap serum referens adalah 0,89 (excellent agreement), 92,3%, dan 96,29%. Dalam pengujian dengan serum anjing yang divaksinasi dengan Rabivet, nilai tersebut adalah 0,48 (moderate agreement), 96,77%, dan 61,22%. Dengan serum anjing yang divaksinasi dengan Rabisin, nilai tersebut adalah 0,91 (excellent agreement), 100%, dan 71,42%.

40

Tabel 5.7 Hasil uji banding kit ELISA Bio-Rad dan Pusvetma pada semua sampel serum. ________________________________________________________________ Hasil uji Kit Bio-Rad Kit Bio-Rad Total Positif Negatif ________________________________________________________________ Kit Pusvetma 61 22 83 Positif Kit Pusvetma Negatif 2 61 63 ________________________________________________________________ Total 63 83 146 Kappa Sensitivitas Spesivisitas = 0,68 (Substancial agreement) = (61/63) x 100% = 96,8% = (61 /83) x 100% = 73,5%

Tabel 5.8 Hasil Uji Banding Kit ELISA Bio-Rad pada Sampel Serum Referens ________________________________________________________________ Hasil uji Kit Bio-Rad Kit Bio-Rad Total Positif Negatif ________________________________________________________________ Kit Pusvetma 12 1 13 Positif Kit Pusvetma Negatif 1 26 27 ________________________________________________________________ Total 13 27 40 Kappa Sensitivitas Spesivisitas = 0,8860 = 0,89 (Exelent agreement) = (12/13) x 100% = 92,30% = (26 /27) x 100% = 96.29%

41

Tabel 5.9 Hasil Uji Banding Kit ELISA Bio-Rad dan kit Pusvetma pada Serum anjing yang di vaksinasi Rabivet Supra92. ________________________________________________________________ Hasil uji Kit Bio-Rad Kit Bio-Rad Total Positif Negatif ________________________________________________________________ Kit Pusvetma 30 19 49 Positif Kit Pusvetma Negatif 1 30 31 ________________________________________________________________ Total 31 49 80 Kappa Sensitivitas Spesivisitas = 0,475 9 = 0,48 (Moderate agreement) = (30/31) x 100% = 96,77% = (30/49) x 100% = 61,22%

Tabel 5.10 Hasil uji banding kit ELISA Bio-Rad dan Pusvetma pada sampel serum anjing yang di vaksinasi Rabisin. ________________________________________________________________ Hasil uji Kit Bio-Rad Kit Bio-Rad Total Positif Negatif ________________________________________________________________ Kit Pusvetma 19 2 21 Positif Kit Pusvetma Negatif 0 5 5 ________________________________________________________________ Total 19 7 26 Kappa Sensitivitas Spesivisitas = 0,9058 = 0,91(Exelent agreement) = (19/19) x 100% = 100,00% = (5 /7) x 100% = 71,42%

42

5.3

Analisis Gen Penyandi Glikoprotein Virus Rabies Isolat Bali Dalam penelitian ini dilakukan analisis fragmen gen penyandi glikoprotein

terhadap tiga virus rabies isolat Bali 2009, satu isolat Flores 2009 dan satu isolat Sulawesi 2009. Fragmen yang ditargetkan adalah ujung karboksi gen protein G yang berdasarkan analisis merupakan daerah yang paling bervariasi dari semua sekuen virus rabies yang tersedia di GeneBank (Prof. Dr.Drh. I Gusti Ngurah Kade Mahardika, Laboratorium Biomedik FKH Unud, 2010, komunikasi pribadi). Hasil PCR ditunjukkan pada Gambar 5.3. Primer yang didisain menghasilkan produk sebesar sekitar 700 bp seperti ditunjukkan pada Gambar itu. Hasil penyepadanan sekuen yang diperoleh dari sekuensing di Eijkman Insitut menunjukkan bahwa virus rabies yang ada di Bali berada dalam satu kluster (Gambar 5.4), mempunyai jarak genetik paling dekat yaitu 0,0366 dengan virus rabies isolat Flores (FL7/Flores/2009). Sedangkan dengan virus asal Sulawesi yang diperoleh pada tahun yang sama, jarak genetiknya adalah 0,15. Disamping itu, tabel jarak genetik (Tabel 5.11) menunjukkan bahwa Isolat Bali mempunyai jarak genetik sebesar 0,20 dengan isolat rabies strain Pasteur/PV yang banyak digunakan sebagai bibit vaksin.

43

600bp 300bp 100bp

700bp

Gambar 5.3 Hasil RT-PCR fragmen gen penyandi glikoprotein virus rabies dengan primer BPRG dan G688F (M = marker, BL1= bali 1, BL2 = bali 2, BL3 = Bali 3, SL = Sulawesi, FL = Flores).

Tabel 5.11 Jarak Genetik Virus Rabies isolat Bali dengan isolat Flores, isolat Sumatera, isolat Sulawesi, dan isolat lainnya dari GeneBank, berdasarkan gen penyandi glikoprotein
No. Kode Sekuen 1. SN01-23/ Sumatera /2001 2. CVS/India/ 3. BRct9/Brazil/ 4. Hunan_Wg432/ China/ 5. Guangxi_Cx14/China /2009 6. M135215/PV/India /1986 7. BL647/ BALI/2009 8. BL627/BALI/2009 9. SL_14/SULAWESI/ 2009 10. BL598_B/BALI/2009 11. FL7/FLORES/2009 12. 03003INDO/Padang/ Sumatera/2003 1 2 3 4 5 6 7 8 9 10 11

0,17 0,15 0,09 0,09 0,18 0,046 0,046 0,15 0,046 0,02 0,0181 0,11 0,20 0,19 0,03 0,19 0,19 0,17 0,19 0,18 0,17 0,15 0,14 0,12 0,16 0,16 0,16 0,16 0,15 0,14 0,03 0,22 0,11 0,11 0,16 0,11 0,08 0,08 0,21 0,11 0,11 0,16 0,11 0,08 0,08 0,20 0,20 0,20 0,20 0,19 0,18 0,00 0,1502 0,00 0,0366 0,0367 0,1502 0,00 0,0366 0,0367 0,15 0,13 0,14 0,0366 0,0367 0,01

44

63

Hunan Wg432/China/ Hunan Wg430/China/ Guangxi Cx25/China/ Jiangsu Wx32/China/ Hunan Wg13/China/ Hunan Xx35/China/ Guangxi Yl66/China/

20 47 53

65 Hunan Xx34/China/

Guangxi Cx14/China/ BeijingHu1/China/ Jiangsu Wx1/China/ Jiangsu Yc58/China/


65

89 44 95

Jiangsu Yc37/China/ Zhejiang Wz1(H)/China/ JX09-17(fb)/China/

91

64 79

03003INDO G/Padang/Sumatera/2003 SN01-23/Sumatera/2001 FL7 /FLORES/2009* BL598 B/BALI/2009* BL647/BALI/2009*


99 BL627/BALI/2009*

97 93

SL 14/SULAWESI/2009*
65 CVS/India/ 99 51

Jiangsu Wx0(H)/China/ PV/M135215/

97 61

BRdg640/Brazil/ BRdg652/Brazil/ BRdg642/Brazil/ BRdg603/Brazil/

39 91 61

BRdg117/Brazil/ BRdg13/Brazil/ BRdg125/Brazil/ BRct22/Brazil/


59 BRct9/Brazil/

0.02

Gambar 5.4 Pohon Phylogenetik Virus Rabies Isolat Bali dan Virus Rabies yang ada di Genbank. (Keterangan : * adalah isolast virus rabies yang di analisis)

45

BAB VI PEMBAHASAN Vaksinasi merupakan salah satu strategi yang sedang diterapkan dalam pengendalian rabies di Bali. Pengujian respon imun dari hasil vaksinasi merupakan data yang sangat penting dalam mengkaji keberhasilan vaksinasi. Masalah muncul akibat teknik uji yang tidak baku dan tersedianya berbagai merek vaksin yang digunakan. Teknik uji yang disediakan pemerintah dan beredar di Indonesia adalah produksi Pusvetma Surabaya. Teknik uji tersebut belum memperoleh validasi dari OIE. Karena itu uji banding kit akan sangat bermanfaat. Jenis vaksin yang berbeda juga perlu dikaji efektivitasnya. Hasil penelitian terhadap antibodi protektif pada anjing yang sudah divaksinasi rabies menunjukkan bahwa, persentase antibodi protektif tertinggi ditemukan pada periode waktu lebih dari 3 bulan sampai dengan 6 bulan PV, baik pada anjing yang divaksinasi dengan vaksin rabies Rabivet Supra92 maupun Rabisin. Persentase antibodi protektif mengalami penurunan pada periode lebih dari 6 bulan sampai dengan 9 bulan PV. Hal ini sesuai dengan hasil penelitian yang dilaporkan oleh Ohore et al. (2007). Hasil berbeda dengan hasil yang dilaporkan oleh Seghaier et al. (1999) bahwa persentase kekebalan protektif ditemukan pada anjing setelah satu bulan PV. Hasil penelitian ini mengindikasikan bahwa vaksin rabies Rabivet Supra92 dan Rabisin hanya mampu memberikan kekebalan sekitar 6 bulan, sehingga perlu dilakukan vaksinasi ulangan (booster). Booster penting dilakukan untuk

mempertahankan titer antibodi protektif (Simani et al., 2004). Hal ini sesuai

46

dengan yang di laporkan oleh Wilde dan Tepsumethanon (2010), bahwa satu dosis vaksinasi tidak menghasilkan antibodi neutralisasi yang lama. Sistem

pemeliharaan anjing

di Bali yang kebanyakan masih diliarkan menyebabkan

pelaksanaan vaksinasi ulangan secara massal mengalami kesulitan. Kesulitan dimaksud antara lain adanya kesulitan melakukan penangkapan anjing, karena aplikasi vaksin ini melalui suntikan. Selanjutnya perlu dipikirkan atau dicarikan alternatif penggunaan vaksin rabies lainnya yang lebih mudah aplikasinya dan mampu memberikan kekebalan lebih lama terutama untuk anjing-anjing yang diliarkan/tidak diikat. Anjing yang diliarkan perlu mendapatkan vaksinasi rabies karena anjing ini mempunyai potensi sangat besar untuk menyebarkan rabies. Hal ini sesuai dengan yang dikemukanan oleh Soeharsono (2007), bahwa anjing liar/anjing geladak (stray dogs) merupakan pelestari rabies yang potensial karena hidup bebas kesana kemari. Anjing ini mempunyai kesempatan luas menyebarkan

rabies ke hewan lain, bahkan juga ke manusia. Hasil uji potensi vaksin Rabivet Supra92 dibandingkan dengan vaksin impor (Rabisin) menunjukkan hasil yang sama (Hiswani, 2003). Hal ini sesuai dengan hasil penelitian ini dimana persentase antibodi protektif pada sampel serum dari anjing yang divaksinasi dengan vaksin Rabisin dengan satu kali dosis, secara statistik tidak berbeda nyata dengan sampel serum anjing yang divaksinasi dengan Rabivet Supra92 (P=0,971) . Jenis vaksin yang dipakai pada penelitian ini berpengaruh nyata terhadap titer antibodi yang diinduksi. Titer antibodi yang diinduksi oleh vaksin Rabisin

47

sangat nyata lebih tinggi dibandingkan dengan titer antibodi yang diinduksi oleh Rabivet Supra92 (P<0,01). Persentase antibodi protektif yang diinduksi oleh vaksin Rabisin pada periode lebih dari 3 minggu sampai dengan 3 bulan pasca vaksinasi nyata lebih tinggi dibandingkan dengan vaksin Rabivet Supra92 (P<0,05). Jenis vaksin tampaknya menghasilkan respon imun yang berbeda. Hasil penelitian Minke et al. (2009) menunjukkan bahwa titer antibodi >0,5IU sebesar 87% ditemukan pada hari 14 PV dengan vaksin Rabisin dan sebesar 100% pada anjing yang divaksinasi dengan vaksin Nobivac. Selanjutnya Kennedy et al. (2007) melaporkan bahwa vaksin yang diproduksi oleh perusahaan yang berbeda akan memberikan respon yang berbeda terhadap rata-rata titer antibodi dan tingkat kegagalan. Hal ini mungkin disebabkan karena formula dan perbedaan cara produksi, konsentrasi dan integritas kandungan antigen, serta adjuvan yang digunakan. Berdasarkan dosis dan aturan pakai vaksin Rabisin bahwa booster dilakukan setiap 2 tahun (Merial, 2011). Hal ini dapat diinterpretasikan bahwa vaksin Rabisin bisa memberikan kekebalan selama 2 tahun. Hal ini berbeda dengan yang ditemukan di Bali, dimana persentase antibodi protektif sudah mengalami penurunan setelah 6 bulan sampai dengan 9 bulan pasca vaksinasi. Untuk itu perlu dilakukan penelitian lebih lanjut, apakah hal ini disebabkan oleh rantai dingin yang tidak terpenuhi dalam penanganan vaksin di lapangan, ataukah adanya kesalahan dalam aplikasi, waktu vaksinasi yang kurang tepat, atau mungkin data vaksinasi yang kurang akurat, misalnya anjing yang sebenarnya belum divaksin tetapi dilaporkan sudah divaksinasi.

48

Berdasarkan hasil penelitian ini diperoleh hasil bahwa secara keseluruhan persentase anjing yang disampling yang memiliki antibodi protektif kurang dari 70% (sekitar 58%). Hasil yang tidak jauh berbeda dikemukakan oleh Riasari (2009), bahwa anjing yang sudah divaksinasi rabies yang dilalulintaskan melalui pelabuhan penyebrangan Merak, sebanyak 58,7% mempunyai antibodi tidak protektif terhadap rabies. Untuk itu perlu dilakukan upaya untuk meningkatkan persentase protektivitas tersebut menjadi 70% atau lebih. Untuk menghilangkan atau mencegah wabah rabies diperlukan setidaknya 70 persen populasi anjing harus mendapatkan kekebalan (Cleaveland et al., 2003; Reece and Chawla, 2006; Balogh et al., 1995.). Beberapa hambatan dalam memerangi rabies terjadi di Indonesia, antara lain sumberdaya tidak memadai, lemahnya konsensus terhadap strategi yang digunakan, lemahnya koordinasi lintas sektoral dan struktur manajemen serta kurangnya kerjasama masyarakat. Banyak faktor yang membuat kecepatan

program vaksinasi anjing tidak mampu mengejar penjalaran penyakit, misalnya cakupan vaksinasi yang tidak mencapai batas minimal 70%, seperti yang terjadi di Bali pada awal terjadinya rabies, cakupan vaksinasi hanya berkisar 45% (Putra et al., 2009). Hasil uji banding kit ELISA rabies produksi Pusvetma Surabaya dibandingkan dengan kit Platelia II rabies ELISA produksi Bio-rad, menunjukkan bahwa agreement kedua kit tersebut sebesar 0,68 (Substantial agreement), dengan sensitivitas 96,80% dan spesivisitas 73,05%. Nilai kesesuaian, sensitifitas dan spesivisitas Kit Pusvetma berbeda-beda tergantung serum yang diuji. Agreement

49

yang baik (excellent agreement) diperoleh pada pengujian dengan serum anjing hasil vaksinasi Rabisin dan serum referens. Sensitifitas Kit Pusvetma cenderung tinggi. Sedangkan nilai spesivisitasnya bervariasi tergantung serum yang diuji. Spesivisitas paling kecil diperoleh pada pengujian dengan serum hasil vaksinasi dengan Rabivet Supra92. Hasil ini mengindikasikan adanya kesesuaian (kekuatan kesepakatan) yang baik diantara kedua kit tersebut. Spesivisitas hasil uji sebesar 73,05%,

mengindikasikan adanya reaksi yang kurang spesifik terhadap sampel serum negatif, sehingga hasil uji positif dengan kit Pusvetma tetapi negatif dengan kit PlateliaII Bio-rad. Hal ini mungkin disebabkan karena antigen yang dipakai untuk coating plate berbeda. Antigen yang dipakai oleh Pusvetma adalah whole antigen virus rabies. Sedangkan pada Platelia II antigen yang digunakan adalah

glikoprotein. Sehingga kit platelia II Bio-Rad hanya bisa menangkap antibodi dari glikoprotein, sedangkan kit Pusvetma bisa bereaksi terhadap semua protein yang ada dalam virus rabies. Hal tersebut menyebabkan hasil uji negatif pada Platelia II Bio-Rad menjadi positif pada uji dengan kit Pusvetma Surabaya. Hasil yang hampir sama dikemukana oleh Simani (2011), bahwa rata-rata titer antibodi pada uji ELISA lebih rendah dibandingkan dengan pada uji MNT dan RFFIT. Hal tersebut disebabkan karena ELISA bereaksi spesifik terhadap glikoprotein virus rabies, sedangkan MNT dan RFFIT bisa bereaksi terhadap semua protein (whole antigen) virus rabies. Peneliti lain melaporkan bahwa sensitivitas 94,1%, spesivisitas 95,8%, dan agreement 95,1% Kit ELISA rabies dibandingkan dengan RFFIT (Welch et al.,2009). Sensitivitas sebesar 87,5%,

50

spesivisitas 92,4% dan agreement 88,5% antara uji ELISA dan neutralizing antibodies dengan metode simplified fluorescent inhibition micro test (SFIMT) dilaporkan oleh Piza et al. (1998). Lebih lanjut disimpulkan bahwa ELISA bisa digunakan sebagai uji skrining untuk deteksi antibodi pada beberapa jenis vaksin yang digunakan. Adanya korelasi antara FAVN dengan liquid-phase competitive ELISA (LPC-ELISA) dan sandwich competitive ELISA (SC-ELISA), dengan nilai r 0,893 di laporkan oleh Fachin et al. (2005). Lebih lanjut di laporkan bahwa pada LPC-ELISA nilai spesivisitas 98,00%, sensitivitas 99,49% dan akurasi 100% untuk uji serum anjing. Nilai tersebut untuk uji serum sapi adalah spesivisitas 86,90% dan sensitivitas 98,43% (Fachin et al., 2005). Servat et al. (2007)

melaporkan hasil positif palsu sebesar 1 sampai 2% pada kit ELISA Platelia II (Bio-rad) dibandingkan dengan Flourescent antibody virus neutralisation. Selanjutnya Wattanapiron et al. (2008), melaporkan sensitivitas 64% dan spesivisitas 100% dari hasil uji banding kit ELISA Platelia II dengan RFFIT. Hasil analisis fragmen gen penyandi glikoprotein virus rabies isolat Bali berada dalam satu kluster. Berdasarkan jarak genetikannya ditemukan bahwa virus rabies isolat Bali mempunyai jarak genetik paling dekat dengan virus rabies isolat asal Flores. Sedangkan jarak genetik dengan isolat asal Sulawesi sebesar 0,15. Data ini mengindikasikan bahwa virus yang berjangkit di Bali kemungkinan berasal dari Flores. Hasil ini berbeda dengan temuan Dibia et al. (in press) dilaporkan bahwa berdasarkan analisis gen penyandi nukleoprotein, virus rabies Bali mempunyai jarak genetik terdekat dengan virus asal Sulawesi. Namun demikian, karena jumlah sampel yang di uji dalam penelitian ini masih sangat

51

sedikit dan minimnya informasi hasil sekuen gen penyandi glikoprotein virus rabies isolat Indonesia di GenBank, maka penelitian lebih lanjut perlu dilakukan dengan jumlah sampel yang representatif sehingga diperoleh data yang lebih akurat. Hasil analisis sekuen gen penyandi glikoprotein virus rabies isolat Bali dengan isolat vaksin berada dalam kluster yang berbeda, dan mempunyai jarak genetik sebesar 0,20. Hasil ini mengiindikasikan bahwa kasus rabies pada anjing yang sudah divaksinasi di Bali bukan disebabkan oleh virus dari isolat vaksin, tetapi kemungkinan disebabkan karena pada saat vaksinasi anjing tersebut berada dalam masa inkubasi atau antibodi yang dimiliki sudah tidak protektif lagi. Ditemukannya antibodi protektif pada anjing yang belum divaksinasi kemungkinan disebabkan oleh beberapa hal, antara lain adanya maternal antibodi. Seperti yang dilaporkan oleh Minke et al.(2009), bahwa 2 ekor anak anjing yang belum divaksinasi mempunyai titer SN 0,66IU/ml. Penyebab lain adalah adanya informasi data vaksinasi yang kurang tepat, misalnya anjing yang diambil sampelnya tersebut sebenarnya sudah pernah di vaksinasi namun oleh pemiliknya dilaporkan belum. Dari data sampel pada penelitian ini diketahui bahwa ke tiga sampel serum yang mempunyai antibodi protektif tersebut diambil dari anjing yang berumur 5 bulan, 72 bulan, dan 12 bulan. Sampel diambil pada bulan Agustus 2009 di Kabupaten Badung. Vaksinasi rabies di Kabupaten Badung sudah dilakukan sejak akhir tahun 2008, sehingga ada kemungkinan bahwa anjing tersebut sudah pernah di vaksinasi rabies.

52

Kemungkinan lain adalah adanya reaksi positif palsu yang disebabkan oleh spesivisitas KIT ELISA yang digunakan kurang dari 100%. Seperti hasil yang diperoleh pada uji banding kit ELISA pada penelitian ini, dimana spesivisitas kit Pusvetman sebesar 73,5%. Hasil yang hampir sama dilaporkan oleh Piza et al. (1999) bahwa spesivisitas uji ELISA sebesar 92,4% dan spesivisitas sebesar 95,8% dilaporkan oleh Welch et al. (2009), serta hasil positif palsu sebesar 1 2% pada kit ELISA dilaporkan oleh Servat et al.(2007). Hasil penelitian tersebut menunjukkan bahwa ada kemungkinan reaksi positif palsu pada uji ELISA walaupun dalam jumlah yang sedikit. Di Bolivia sebesar 18% anjing yang tidak divaksinasi juga mempunyai antibodi terhadap rabies >0,5EU/ml, yang diuji dengan ELISA (Suzuki et al., 2008). Adanya antibodi protektif pada anjing yang belum divaksinasi rabies juga dilaporkan oleh Dibia et al. (2001) yaitu di Kabupaten Manggarai sebesar 56,4% dan 33,8% di Kabupaten Ende, Nusa Tenggara Timur. Hal yang sama juga dilaporkan oleh Gita (2010) yaitu sebanyak 4,41% (12/272 sampel) anjing yang tidak berpemilik yang belum divaksinasi memiliki antibodi potektif terhadap rabies. Di Pulau Lombok sebesar 0,27% (2/574 sampel) anjing yang di

sampling, memiliki antibodi protektif terhadap rabies (Ludra, 2010).

53

BAB VII SIMPULAN DAN SARAN 7.1 Simpulan 1. Persentase anjing yang mempunyai titer antibodi protektif yang divaksinasi dengan vaksin Rabivet Supra92 dan Rabisin tidak berbeda nyata (P=0,971). 2. Titer antibodi terhadap rabies pada anjing yang divaksinasi dengan vaksin Rabisin sangat nyata lebih tinggi dibandingkan dengan yang divaksin Rabivet Supra (P=0,000). 3. Persentase antibodi protektif tertinggi diperoleh pada periode lebih dari tiga bulan sampai dengan enam bulan pasca vaksinasi. 4. Kit ELISA Pusvetma mempunyai kekuatan kesepakatan yang baik dengan Kit Baku Platellia II Bio-rad dengan nilai kappa sebesar 0,68 (Substantial agreement). 5. Gen penyandi glikoprotein virus rabies isolat Bali menunjukkan bahwa virus rabies isolat Bali berada dalam satu kluster dan mempunyai jarak genetik paling dekat dengan virus rabies isolat Flores.

7.2

Saran Untuk mendapatkan persentase titer antibodi rabies protektif yang

memadai, disarankan untuk melakukan booster (vaksinasi ulangan) setelah 6 bulan vaksinasi pertama. Untuk memperkaya khasanah pengetahuan terhadap respon imun vaksinasi rabies, perlu dilakukan penelitian lebih lanjut terhadap faktor-faktor yang mempengaruhi efektifitas vaksin rabies di Bali.

54

DAFTAR PUSTAKA Adriana S.T.P., J.L.F.Santos, C.L. Botelho, and Z.C.Roberto. 1999. An ELISA suitable for the detection of rabies virus antibodies in serum samples from human vaccinated with either cell culture vaccine or sukling mouse brain vaccine. Rev. Inst. Med. Trop.S.Paulo.41(1). Adjid.R.M.A., A.Sarosa, T.Syapriati, dan Yuningsih. 2005. Penyakit rabies di Indonesia dan pengembangan teknik diagnosisnya. Wartazoa. 15(4 ) : 165172 Direktorat Kesehatan Hewan. 2006. Pedoman Pengendalian Rabies Terpadu. Departemen Pertanian, Direktorat Jenderal Peternakan, Direktorat Kesehatan Hewan. Balogh.K.K.L.M.D., F.Sabbe, and P.J.de Graaf.1995. Two Day Rabies Vaccination Campaign : A Sustainable Intervention?. School of Veterinary Medicine, Lusaka, Zambia. 125-133. http://searg.info/fichiers/articles/1995126134L.PDF. Benmansour A., H. Leblois, P. Coulon, C.Tuffereau, Y. Gaudin, A. Flamand dan F. Lapay. 1991. Antigenicity of Rabies Virus Glycoprotein. Journal of Virology. 65 (8): 4198-4203. Berg J.M., J.L.Tymoczko, L. Stryer. 2002. Immunology Provides Important Techniques with Which to Investigate Proteins. Section 4.3. Biochemistry. 5th edition. New York: W H Freeman. http://www.ncbi.nlm.nih.gov/books/NBK22420/. Diakses januari 2011 Bingham J. 2005. Canine Rabies Ecology in Southern Africa. Emerging Infectious Diseasses. 11(9) : 1337-1341. www.cdc.org. Diakses Maret 2011. Bourhy H., J.M.Reynes, E.J.Dunham, L.Dacheux, F.Larrous, V.T.Q.Huang, G.Xu, J. Yan, M.E.G.Miranda, and E.C.Holmes. 2008. The Origin and Phylogeography of Dog Rabies Virus. J Gen Virol. 89(208):2673-2681. CDC. 2007. The Rabies Virus. Centers for Diseases Control and Prevention. CIVAS. 2010. Gejala Klinis (Hewan, manusia). Posted Tuesday, 06/08/2010 by Admin. Center for Indonesian Veterinary Analytical Studies. http://www. Civas.net/gejala-klinis-hewan-manusia. Diakses tanggal 7 Nopember 2010.

55

Cliquet F., T. Muller, F.Mutinelli, S.Geronutti, B.Brochier, T.Selhorst, J.L.Schereffer, N.Krafft, J.Burrow, A.Schmeitat,H.Schluter dan M.Aubert. 2003. Standardisation and establishment of rabies ELISA test in European laboratories for assesing the efficacy of oral fox vaccination campaigns.Vaccine 21 (2003) : 2986 2993. Cliquet F., L.Sagne, J.L. Schereffer dan M.F.A. Aubert. 2000. ELISA test for rabies antibody titration in orally vaccinated foxes sampled in the fields. Vaccine.18 (2000) : 3272 3279. Cliquet F., L.M.McElhinney, A.Servat, J.M.Boucher, J.P.Lowings, T.Goddard, K.L.Mansfield dan A.R.Fooks. 2004. Protocol. Development of a qualitative indirect ELISA for the measurement of rabies virus-specific antibodies from vaccinated dogs and cats. Journal of Virological Methods. 117 (2004):1 8. Cleaveland S., J.Barrat, M.J.Barrat, M.Selve, M.Kaare, dan J.Esterhuysen. 1999. A Rabies Serosurvey of Domestic Dogs in Rural Tanzania: result of a Rapid Flourescent focus Inhibition Test (RFFIT) and a Liquid-Phase Blocking ELISA Used in Parallel. Epidemiol.Infect.123: 157 164. Cleaveland S., M.Kaare, P.Tiringa, T.Mlengeya, and J. Barrat. 2003. A dog rabies vaccination campaign in rural Africa: impact on the incidence of dog rabies and human dog-bite injuries .Vaccine. 21(17-18):1965-1973. http://www.sciencedirect.com/science/article/pii/S0264410X02007788. di akses April 2011. Coll.J.M. 1995. The Glikoprotein G of Rhabdoviruses. Arch.140:827-851. Cox J.H., B. Dietzschold and L.G. Schneider. 1977. Rabies Virus Glycoprotein.II. Biological and Serological Characterization. Infect Immun. 16(3):754-759. Dietzschold B., M.Schnell, H.Koprowski. 2005. Pathogenesis of rabies. Curr. Top. Microbial. Immunol. 292 : 45-56. Dibia I N., K.S.A. Putra, N. Sutami, dan N. Purnatha (2001). Prevalensi Antibodi Rabies Pada Anjing Pravaksinasi di Kabupaten Manggarai dan Ende, Nusa Tenggara Timur. Buletin Veteriner, BPPV.VI. XIII (59) : 28-33. Direktorat Kesehatan Hewan. 2006. Pedoman Pengendalian Rabies Terpadu. Departemen Pertanian, Direktorat Jenderal Peternakan, Direktorat Kesehatan Hewan.

56

Faber M., M.L.Faber, A.Papaneri, M.Bette, E.Weihe, B.Dietzschold, and M.Schnell. 2005. A Single Amino Acid Changes In Rabies Virus Glycoprotein Increases Virus Spread and Enhances Virus Pathogenicity. J.Virol.79(22):14141-14148. Fachin N., B.A.Caralho, and T.C.Cardoso. 2005. A Comparison of Serological Methods for Detecting The Immune Response After Rabies Vaccination in Dogs and Cows from Rabies-Endemic Areas in Brazil. Intern J Appl Res Med. 3(3) : 199-206. Gita P.L. (2010). Pemantauan Daerah Sebar Hama Penyakit Hewan Karantina Penyakit Anjing Gila (Rabies) di Propinsi Bali. Seminar Pemantauan, Denpasar 2010. Gould, A.R., A.D.Hyatt, R.Lunt, J.A.Kattenbelt, S.Hengsberger, S.D.Blacksell. 1998. Characterization of novel lyssavirus isolated from Pteropid bats in Australia. Virus. Res. 54 : 165-187. Gupta P.K., S.Sharma, S.S.Walunj, V.K.Chaturvedi, A.A.Raut, S.Patial, A.Rai, K.D.Pandey and M.Saini. 2005. Abstrak, Immunogenic and Antigenic Properties of Recombinant Soluble Glycoprotein of Rabies Virus. Veterinary Microbiology. 198(3-4):207-214. Guyat, K.J., J.Twin, P.Davis, E.C.Holmes, G.A.Smith, I.L.Smith, J.S.Mackenzie, P.L.Young, 2003. A moleculer epidemiological study of Australian bat lyssavirus. J.Gen.Virol. 84: 485-496. Harmita. 2004. Petunjuk Pelaksanaan Validasi Metode dan Cara Perhitungannya. Majalah Ilmu Kefarmasian. 1 (3): 117-135. Hiswani. 2003. Pencegahan dan Pemberantasan Rabies. USU digital library. http://library-usu.ac.id/download/fkm/fkm-hiswani10.pdf. diakses 8 Juli 2010. Inoue, S., M.Yurie, K.Tomoko, O.Kenichiro, and Y.Akio. 2003. Safe and Easy monitoring of anti-rabies antibody in dogs using His-Tagged Recombinant N-protein. Jpn.J.Infect.Dis. 56 : 158-160. Ito N., M. Takayama, K. Yamada, M. Sugiyama, and N. Minamoto.2001. Rescue of Rabies Virus From Cloned cDNA and Identification of the PathogenicityRelated Gene : Glycoprotein Gene Is Associated With Virulance for Adult Mice. Journal of Virology.75(19): 9121-9128. Jallet C, Y. Jacob, C.Bahloul, A. Drings, E. Desmezieres, N. Tordo and P. Perrin. 1999. Chimeric Lyssavirus Glycoprotein with Increased Immunological Potential. Journal of Virology. 73(1), Jan1999 : 225-233.

57

Kang B., J.S.Oh, C.S.Lee, B.K.Park, Y.N.Park, K.S.Hong, K.G.Lee, B.K.Cho, and D.S.Song. 2007. Evaluation of Rapid Immunodiagnostic Test kit for Rabies Virus. Journal of Virology Methods.145(2007): 30-36. Karamany R.M., J. Kazar, S.A. Malik, S. al-Multi, dan M. Badriya. 1988. Rapid Quantitative Assay of Rabies Post-Vaccination Antibody ELISA. Abstract. PubMed. APMIS Suppl.(3):40-3. Kartika H. 2008. Respon Imun Outline. http://hennykartika.wordpress.com/2008/ 01/01/respon-imun-outline/ diakses juni 2010. Kasempimolporn.S., B. Sichanasai, W. Saengseesom, S. Pesempumpanich, S. Chatraporn, and V. Sitpsija. 2006. Prevalence of rabies virus infection and rabies antibody in stray dogs : A Survey in Bangkok, Thailand. Preventive Veterinary medicine XXX (2006). PreVET. 2253. 1-8. Kennedy L.J., M.Lunt, A.Barnes, L.McElhinney, A.R.Fooks, D.N.Baxer, and W.E.R.Ollier. 2007. Factor Influencing the Antibody Response of Dogs Vaccinated Against Rabies. Vaccine. 25(2007) : 8500-8507. Lancet. 2007. Rabies Has Ist Day. The Lancet Infectious Diseases. 7 (October 2007). http://Infection.thelancet.com. Diakses Nopember 2010. Langevin C.and C. Tuffereau.2002. Mutation Confering Resistance to Neutralization by a Soluble Form of The Neurotropin Receptor (P75NTR) Map Outside of The Known Antigenic Sites of The Rabies Virus Glycoprotein. Journal of Virology.76(21): 10756-10765. Lestari.I.S dan D.M.N. Dharma.2005. Review Rabies. Prosiding Lokakarya Nasional Penyakit Zoonosis. Bogor, 15 September 2005. Ludra I N. (2010). Pemantauan Daerah Sebar Penyakit Anjing Gila (Rabies) di Wilayah Pemantauan Balai Karantina Pertanian Kelas I Mataram. Seminar Pemantauan, Denpasar 2010. Maillard.P.A. dan Y. Gaudin. 2002. Rabies virus glycoprotein can fold in two alternative, antigenically distinct conformations depending on membraneanchor type. Journal of General virology. 83 : 1465-1476. Mansfield K.L., P.D.Burr, D.R.Snodgrass, R.Savers dan A.R.Fooks. 2004. Factors Affecting the Serological Response of Dogs and Cats to Rabies Vaccination. The Veterinary Record, April 3, (2004) : 423 426. McElhinney.L.M., A.R.Fooks, and A.D.Radford. 2008. Diagnostic tools for the detection of rabies virus.EJCAP-Vol.18-issue 3 December 2008. 224-231.

58

McPherson M.J. and S.G.Moller. 2000. Analysis of Gene Expression. Chapter 8 in PCR the Basics from Background to Bench. Bios Scientific Publishers.Ltd. Oxford IRE.UK. First Publised. 183-204. Menteri Pertanian. 2008. Surat Keputusan Menteri Pertanian Nomor 1637.1/Kpts/PD 640/12.2008. Tentang Pernyataan Berjangkitnya Wabah Penyakit Anjing Gila (Rabies) di Kabupaten Badung, Provinsi Bali. Merial. 2011. Rabisin.http://uk.merial.com/data_sheet/rabisin.asp. Diakses April 2011. Meslin.F.X, dan M.M.Kaplan.1996. An overview of laboratory techniques in the diagnosis and prevention of rabies and in rabies research hal 9-27, Chapter2 in laboratory techniques in rabies fouth edition. Metlin A., L.Paulin, S.Suomalainen, E.Neuvonen, S.Rybakov, V.Mikhalishin and A.Huovilainen. 2007. Characterization of Russian Rabies Virus Vaccine Strain RV-97. Short Communication. Virus Research xxx(2007) xxx-xxx. Article in Press. Miah, A. 2005. Bat rabies the achilles heel of a viral killer? Lancet 366: 876877. Minke.J.M., J.Bauvet, F.Cliquet, M.Wasniewski, A.L.Gulot, L.Lemaiter, C.Cariou, V.Cozette, L.Vergne dan P.M.Guigal. 2009. Comparison of Antibody Responses After vaccination with two inactivated rabies vaccines. Short communication. Vet.Microbiology. 133 (2009) : 283-286. Mirjana S.P., P. Hoetnik, S.Levinik-Stezinar, dan L. Zaletel-Kragelj. 2006. Vaccination Against Rabies and Protective Antibodies Comparison of ELISA and Flourescent Antibody Virus Neutralization (FAVN) Assays. Veterinary Archives.76 (4). Moore S.M. dan C.A. Hanton. 2010. Rabies-Specific Antibodies: Measuring Surrogates of Protection Against a Fatal Disease. PloS Neglected Tropical Diseases. http://www.plosntds.org/article/info:doi%2F10.1371%2Fjournal.pnt. Diakses Maret 2011. Nagaraja T., B. Mohanasubramanian, E.V. Seshagiri, S.B. Nagendrakumar, M.R.Saseendranath, M.L. Satyanarayana, D. Thiagarajan, P.N. Rangarajan, dan V.A. Srinivasan. 2006. Molecular Epidemiology of Rabies Virus Isolates in India. Journal of Clinical Microbiology. 44 (9) : 3218-3224.

59

Nagaraja T., S.Madhusudana dan A. Desal. 2008. Molecular Characterization of Full-length Genome of Rabies Virus Isolated from India. Virus Genes. 36 : 449 459. Ohore.O.G., B.O.Emikpe., O.O.Oke, and D.O.Oluwayelu. 2007. The seroprofile of rabies antibodies in companion urban dogs in Ibalan Nigeria. Journal of animal and veterinary advance 6 (1). 53-56. Medwell online. Ondrejkova A., J.Soli, R.Ondrejka, Z. Benesek, R.Franka, S. Svrcek,M.Madar, dan A. Bugarsky. 2002. Comparison of The Detection and Qualification of Rabies Antibodie in Canine Sera. Vet.Med-Czech, 47,2002 (8) : 218-221. OIE . 2008. Rabies. Manual of standard for diagnostic techniques. Chapter 2.1.13. Terrestrial manual. P.304-323. Piza A.S.D.T., J.L.F.Santos, L.B. Chaves, and C.R. Zanetti. 1998. An ELISA Suitable For The Detection Of Rabies Virus Antibodies In Serum Samples From Human Vaccinated With Either Cell-Culture Or Suckling-MouseBrain Vaccine . 2009 Instituto de Medicina Tropical de Sao Paulo, Brazil. Protocol-online.org. 2011. http://www.protocol-online.org/prot/ Molecular_Biology/PCR/RT-PCR/index.html. diakses 8 April 2011. Putra A.A.G. 2009. Validasi Metode Uji Untuk Memelihara Unjuk Kerja Laboratorium Veteriner. Buletin Veteriner. XXI (74) : 42-47. Putra.A.A.G., I.K.Gunata, Faizah., N.L.Dartini, D.H.W.Hartawan, G.Setiaji, A.A.G.Semara-Putra, Soegiarto, dan H.Scott-Orr. 2009. Situasi Rabies Bali: Enam bulan pasca program pemberantasan. Buletin Veteriner. XXI (74) : 13-26 Rahman A. dan R. Maharis. 2008. Analisis Keberhasilan Vaksin Oral Rabies Sebagai Perbandingan Pengendalian Rabies di Indonesia. Buletin Pengujian Mutu Obat Hewan.13 (2008). Reece J.F. and S.K. Chawla. 2006. Control of Rabies in Jaipur, India, by The Sterilisation and Vaccination of Neigbhourhood dogs. Vet.Record.16:379383.http://www.fao.org/fileadmin/user_upload/animalwelfare/Vet%20Recor d%20Paper.pdf. di akses April 2011. Ren L. 2010. Short report Molecular Characterization of a Chinese Variant of the Flury-LEF Strain. VirologyJournal: 7(80). http://www.virologyj.com/content/7/1/80. diakses 9 Juli 2010.

60

Riasari J.R.2009. Kajian Titer Antibodi terhadap Rabies pada Anjing yang di Lalulintaskan Melalui Pelabuhan Penyebrangan Merak. (Tesis) Sekolah Pascasarjana Institut Pertanian Bogor. http://repository.ipb.ac.id/bitstream/handle/123456789/4622/Cover_2009jrr. pdf?sequence=5. Diakses Maret 2011. Robertson I. 2008. VET 641 Principles of Epidemiology Reader. Murdoch University. Perth. 148-149. Roitt I., J. Brostotoff and D. Male. 2000. Immunology. Fifth Edition. Mosby . London Philadelphia st Louis Syndney Tokyo. 77-80 Rupprecth C.E., M.D. Leonard-Blass, K. Smith, L.A. Orciari, M. Niezgoda, S.G. Whitfield, R.V. Gibbons, M. Guerra, dan C.A. Hanion. 2001. Human Infection Due to Recombinant Vaccinia-Rabies Glycoprotein Virus. The New England Journal of Medicine: 345 (8): 582-586. Salinas J., F.Cuello, M.R.Coro, M.C.Gallego, M.J.Sanches, A.J.Buendia, J.Breton, B.Marsilla. 1992. Qualification and evolution of rabies antibodies level by ELISA in dog sera with different number of vaccination. ANVET (Murcia) (8) : 3-6. Sebunya T.K., N.Ndabumbi and S.Mpuchane. 2007. A serosurvey of rabies antibodies in dogs in Goborone, Botswana. Journal of animal and veterinary advances 6 (4) : 549-553. Seghaier C., F.Cliquet, S.Hammami, T. Aouina, A. Tlatli, and M. Aubert. 1999. Rabies Mass Vaccination Campaigns In Tunisia : Are Vaccinated Dogs Correctly Immunized?. Am. J. Trop. Med. Hyg. 61(6) : 879 884. Servat A. dan Cliquet F. 2006. Review. Collaborative Study to Evaluated a New ELISA Test to Monitor The Effectiveness of Rabies Vaccination in Domestict Carnivores. Virus Research. 120 : 17 27. Servat A., M.Feyssaguet, L.Blanchard, J.L.Morize, J.L.Schereffer, F.Boue dan F.Cliquet. 2007. Review. A Quantitative Indirect ELISA to Monitor the Effectiveness of Rabies Vaccination in Domestic and Wild Carnivores. Journal of Immunological Methods. 318 : 1 10. Servat A., M.Wasnieswski dan F.Cliquet. 2006. Tools for Rabies Serology to Monitor the Effectiveness of Rabies Vaccination in Domestic and Wild Carnivores. Dev. Biol (Basel). Basel Karger. 125 : 91 94. Shanker B.R. 2009. Advances in Diagnosis of Rabies. Veterinary world. 2(2) : 74-78.

61

Simani S., A.Amirkhani, F.Farahtaj, B.Hooshmand, A.Nadim, J.Sharifion, N.Howaizi, N.Eslami, A.Gholami, A.Janami, and A.Fayas.2004. Evaluation of The Effectiveness of Pre Exposure Rabies Vaccination in Iran. Arch Med.7(4) : 251-255. Simani S. 2011. Comparison of Tree Serological Tests For Titration Of Rabies In Immunized Individuals. Original article.WHO-Collaborating Center For Reference and Research On Rabies, Pasteur Institute of Iran. http://www.ams.ac.ir/aim/9923/simani9923/html. Diakses Maret 2011. Sissoe L., M. Mousi, P. England, and C. Tuffereau. 2005. Stable Trimerization of Recombinant Rabies Virus Glycoprotein Ectodomain Is required for Interaction with P75NTR Receptor. Journal of general Virology. 86 : 25452552. Soeharsono.2007. Penyakit Zoonotik Pada Anjing dan Kucing. Edisi 1. Penerbit Kanisius Jogyakarta. Suryadi Y., I.Manzila, dan M.Machmud.2009. Tinjauan Potensi Pemanfaatan Perangkat Diagnostik ELISA Serta Variannya Untuk Deteksi Patogen Tanaman. Journal of Agro Biogen.5(1) : 39-40. Susan A., N.Davis, Y. Feng, D. Mousse, I Alexander, Wondeler, and s.ArisBrosou.2010. Spatial and Temporal Dynamic of Rabies Virus Variants in Long Brown Bat Population Across Coroda: Foot Prints of an Emerging Zoonosis. Molecular ecology.19: 2120-2136. Susetya H. 2005. Analisis genetik gen penyandi glikoprotein dari virus rabies isolat Indonesia. Seminar nasional teknologi peternakan dan veteriner. Susetya H., I. Naoto, M. Sugiyama, and N. Minamoto.2005. Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus. Indonesian Journal of Biotecnology.10(1) : 795-800. Suwarno. 2005. Identifikasi Virus Rabies Diadaptasi pada Kultur Sel Neuroblastoma dengan Indirect Sandwich ELISA dan direct-FAT. Media Kedokteran Hewan. 21(1) : 43-47. Suzuki K., M.R. Pecoraro, M.Perez, G.Ruiz, G. Ascarrunz, A. Loza, J.A.C. Pereira, J.A. Guzman, dan E.T. Gonzales. 2008. Antibody Response to a Vaccine Against Rabies In Owned Dogs In Santa Cruz, Bolivia.

62

Suzuki K., Gonzlez, E. T., Ascarrunz, G., Loza, A., Prez, M., Ruiz, G., Rojas, L., Mancilla, K., Pereira, J. A. C., Guzman, J. A. and Pecoraro, M. R. (2008), Abstrak, Antibody Response to an Anti-rabies Vaccine in a Dog Population under Field Conditions in Bolivia. Zoonoses and Public Health, 55: 414420. http://onlinelibrary.wiley.com/doi/10.1111/j.18632378.2008.01126.x/ abstract, diakses April 2011. Tamura K., J. Dudley, M. Nei, and S. Kumar. 2005. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Sofware Version 4.0. MEGA4 sofware. 1597-1599. Tao L., J. Ge, X.Wang, H. Zhai, T.Hua, B. Zhao, D. Kong, C. Yang, H. Chen, and Z. Bu. 2010. Molecular Basis of Neurovirulence of Flury Rabies Virus Vaccine Strains: Importance of the Polymerase and The Glycoprotein R333Q Mutation. Journal of virology. 84(17) : 8926-8936. Tepsumethanon V., B.Lumlertdacha, C. Mitmoonpitak, V.Sitprija, F.X. Meslin, and H.Wilde. 2004. Survival of Naturally Infected Rabid Dogs and Cats. Brief Report. Clinical Infectious Diseases. 39 : 278-280. Tepsumethanon V., H.Wilde, dan V. Sitprija. 2008. Ten-day Observation of Live Rabies Suspected Dogs. Dev. Biol. Basel, Kanger. 131 : 543-546. Tizard I.R. 2004. Veterinary Immunology. An introduction. Sevent edition. Saunders an Inprint of alsever. 145-168. Tomar N.R., V.Singh, S.S.Marla, R.Chandra, R.Kumar, and A.Kumar. 2010. Molecular Docking Studies With Rabies Virus Glycoprotein to Design Viral Therapeutics. Research paper.72(4) : 486-490. Touihri L., I. Zaouia, K.Elhili, K.Dellagi, and C.Bahloul. 2011. Evaluation of Mass Vaccination Campaign Coverage Against Rabies in Dogs in Tunisia. Zoonoses and Public Health, 58: 110-118. Doi:10.1111/j.18632378.2009.01306.x Triakoso B., 2007. Pencegahan dan Pengendalian Rabies. Penerbit Kanisius. http://books.google.co.id. Di akses Desember 2010. Transfuzion aabb.org. 2009. Rhabdo Virus (Virus Rabies). Appendix2 Transfuzion. 49:146s-147s. Viera A.J. and J. M. Garrett. 2005. Understanding Interobserver Agreement: The Kappa Statistic. Research series. 37 (5) : 361-363. Wahyuriadi. 2009. Validasi Metode Analisis. http://wahyuriadi.blogsport.com/ 2009/03/validasi metode-analisis.html. diakses Juni 2010.

63

Warrell M.J.2009. Rabies and Other Lyssavirus Infection. Dalam Principle & Practice of Clinical Virology. Sixth edition. Editor. Zuckerman A.J.,choub, P.Mostimer. 777-800. WHO. 2010. RABIES. http://www.who.int/immunization/topics/rabies/en/ Last updated: 6 August 2010. Diakses April 2011. Wilde H., T. Hemachuda, dan A.C. Jackson. 2008. Viewpoint: Management of Human Rabies. Trans R Soc Trop Med Hyg (2008),xxx, xxx-xxx. Wilde H.,2009. Rabies Vaccines.Travelers Vaccines State of the Art. Chapter 9 : 215 236. Wilde H dan V. Tepsumethanon. 2010. Rabies and Thailand. www.cueid.org : 114. diakses Juni 2010. Zee Y.C. dan N.J.Maclachlan, 2004. Rhabdoviridae: Rabies. Chapter 61 Veterinary. Microbiology. 2nded. Editor: Hirch D.C., N.J.Maclachlan, R.L.Walker. http//www.ubmb.edu/gsbs/microbook/ch061.htm. Diakses 17 Februari 2010. Zhang S., Y Liu, F. Zhang, dan R. Hu. 2009. Competitive ELISA Using a Rabies Glycoprotein-Transformed Line to Semi-Quantify Rabies NeutralizingRelated Antibodies In Dogs. Abstract, Vaccine, 2009.Mar 28;27(15):210813. Epub 2009 Feb 6.

64