P. 1
cdk_145_Obsgin

cdk_145_Obsgin

|Views: 3,489|Likes:
Dipublikasikan oleh revliee

More info:

Published by: revliee on Oct 12, 2009
Hak Cipta:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

04/25/2013

pdf

text

original

2004

http://www.kalbe.co.id/cdk

ISSN : 0125-913X

145. Ginekologi (1)

2004
http. www.kalbe.co.id/cdk
International Standard Serial Number: 0125 – 913X

145. Ginekologi
Daftar isi :
2. Editorial 4; 57. English Summary

Artikel
5. 9. 13. 17. 21.
Keterangan Gambar Sampul : Siklus Menstruasi Normal Dikutip dari: Carola B, Harley JP, Noback CR. Human Anatomy and Physiology. McGraw Hill Publ. Co. 1990. p.843

26. 31. 34.

Perbandingan Akurasi Diagnostik Lesi Pra Kanker Serviks antara Tes Pap dengan Inspeksi Visual Asam Asetat (IVA) pada Wanita dengan Lesi Serviks – S.D. Iswara, I.K. Suwiyoga, I.G.P. Mayura M., I.G. Artha A. Infeksi Chlamydia trachomatis pada Kanker Serviks Terinfeksi Human Papilloma Virus tipe 16 dan 18: Studi Cross - Sectional – K. Tonika, K. Suwiyoga Risiko Lesi Intraepitel Skuamosa Serviks Derajat Tinggi pada Penderita Terinfeksi Virus Human Papiloma 16 dan 18 – I.G.N. Darmaja, K. Suwiyoga, I.G.A. Artha Korioamnionitis Histopatologik sebagai Risiko Persalinan Preterm di RS Sanglah Denpasar – K. Suardana, A.A.N. Jaya Kusuma, K. Suwiyoga, A.A.A.N. Susraini Risiko Ancaman Persalinan Preterm pada Infeksi Chlamydia trachomatis – A.A.N.M.A Putra Wirawan, A.A.N. Jaya Kusuma, D.M. Sukrama, M. Dharmadi Risiko Partus Prematurus Iminen pada Kehamilan dengan Infeksi Saluran Kemih – I Nyoman Nuada, Made Kornia Karkata, Ketut Suastika Pengelolaan Persalinan Prematur – Jefferson Rompas Diagnosis Laboratorium Infeksi Saluran Reproduksi dari Para Pekerja Seksual Wanita di Banyuwangi Juni 2003 – Eko Rahardjo

38. Masalah Gender dan Kesehatan – Sunanti Zalbawi, Kartika Handayani 45. Pengetahuan, Sikap, dan Perilaku Pekerja Remaja terhadap Penyakit Menular Seksual (PMS) serta Faktor-Faktor yang Mempengaruhi Terjadinya Hubungan Seksual Pranikah (Studi Kasus di PT. Flower Indonesia Pasuruan Jawa Timur) – Sarwanto, Suharti Ajik 51. Makanan Pendamping ASI – Husein Albar 56. 59. 60. 62. 64. Kapsul Informatika Kedokteran Kegiatan Ilmiah Indeks Karangan Tahun 2004 RPPIK

EDITORIAL
Masalah ginekologi merupakan topik yang dibahas pada penerbitan ini. Terima kasih kepada Bagian Kebidanan dan Penyakit Kandungan Fakultas Kedokteran Universitas Udayana yang telah bersedia menyumbangkan naskah ilmiahnya untuk diterbitkan oleh majalah kami. Kami tentu berharap agar pengalaman para Sejawat (terutama) di Universitas Udayana tersebut dapat memperkaya pengalaman dan pengetahuan Sejawat, tidak hanya di lingkungan kebidanan dan penyakit kandungan saja, melainkan juga bernilai bagi Sejawat lain, terutama para praktisi. Di akhir tahun ini kembali redaksi mencantumkan daftar makalah yang telah diterbitkan sepanjang tahun 2004, semoga berguna untuk penelusuran naskah yang (mungkin) diperlukan di kemudian hari. Selamat membaca. Semoga kita bertemu lagi di tahun mendatang dalam keadaan yang lebih sejahtera.

Redaksi

2

Cermin Dunia Kedokteran No. 145, 2004

2004

International Standard Serial Number: 0125 - 913X KETUA PENGARAH
Prof. Dr. Oen L.H. MSc

REDAKSI KEHORMATAN

PEMIMPIN UMUM
Dr. Erik Tapan

- Prof. DR. Sumarmo Poorwo Soedarmo
Staf Ahli Menteri Kesehatan Departemen Kesehatan RI Jakarta

- Prof. Dr. R Budhi Darmojo
Guru Besar Ilmu Penyakit Dalam Fakultas Kedokteran Universitas Diponegoro Semarang

KETUA PENYUNTING
Dr. Budi Riyanto W.

PELAKSANA
Sriwidodo WS.

- Prof. Drg. Siti Wuryan A Prayitno, SKM, - Prof. DR. Hendro Kusnoto, Drg, SpOrt. Laboratorium Ortodonti MScD, PhD.
Bagian Periodontologi, Fakultas Kedokteran Gigi Universitas Indonesia, Jakarta Fakultas Kedokteran Gigi Universitas Trisakti Jakarta

TATA USAHA
- Dodi Sumarna - Djuni Pristiyanto

ALAMAT REDAKSI
Majalah Cermin Dunia Kedokteran, Gedung Enseval Jl. Letjen. Suprapto Kav. 4, Cempaka Putih, Jakarta 10510, P.O. Box 3117 JKT. Tlp. 021 - 4208171 E-mail : cdk@kalbe.co.id http: //www.kalbe.co.id/cdk

- DR. Arini Setiawati
Bagian Farmakologi Fakultas Kedokteran Universitas Indonesia Jakarta

NOMOR IJIN
151/SK/DITJEN PPG/STT/1976 Tanggal 3 Juli 1976

DEWAN REDAKSI

PENERBIT
Grup PT. Kalbe Farma Tbk.

- Dr. Boenjamin Setiawan Ph.D

- Prof. Dr. Sjahbanar Zahir MSc.

Soebianto

PENCETAK
PT. Temprint

http://www.kalbe.co.id/cdk PETUNJUK UNTUK PENULIS

Cermin Dunia Kedokteran menerima naskah yang membahas berbagai aspek kesehatan, kedokteran dan farmasi, juga hasil penelitian di bidangbidang tersebut. Naskah yang dikirimkan kepada Redaksi adalah naskah yang khusus untuk diterbitkan oleh Cermin Dunia Kedokteran; bila pernah dibahas atau dibacakan dalam suatu pertemuan ilmiah, hendaknya diberi keterangan mengenai nama, tempat dan saat berlangsungnya pertemuan tersebut. Naskah ditulis dalam bahasa Indonesia atau Inggris; bila menggunakan bahasa Indonesia, hendaknya mengikuti kaidah-kaidah bahasa Indonesia yang berlaku. Istilah medis sedapat mungkin menggunakan istilah bahasa Indonesia yang baku, atau diberi padanannya dalam bahasa Indonesia. Redaksi berhak mengubah susunan bahasa tanpa mengubah isinya. Setiap naskah harus disertai dengan abstrak dalam bahasa Indonesia. Untuk memudahkan para pembaca yang tidak berbahasa Indonesia lebih baik bila disertai juga dengan abstrak dalam bahasa Inggris. Bila tidak ada, Redaksi berhak membuat sendiri abstrak berbahasa Inggris untuk karangan tersebut. Naskah diketik dengan spasi ganda di atas kertas putih berukuran kuarto/ folio, satu muka, dengan menyisakan cukup ruangan di kanan kirinya, lebih disukai bila panjangnya kira-kira 6 - 10 halaman kuarto disertai/atau dalam bentuk disket program MS Word. Nama (para) pengarang ditulis lengkap, disertai keterangan lembaga/fakultas/institut tempat bekerjanya. Tabel/skema/ grafik/ilustrasi yang melengkapi naskah dibuat sejelas-jelasnya dengan tinta hitam agar dapat langsung direproduksi, diberi nomor sesuai dengan urutan

pemunculannya dalam naskah dan disertai keterangan yang jelas. Bila terpisah dalam lembar lain, hendaknya ditandai untuk menghindari kemungkinan tertukar. Kepustakaan diberi nomor urut sesuai dengan pemunculannya dalam naskah; disusun menurut ketentuan dalam Cummulated Index Medicus dan/ atau Uniform Requirement for Manuscripts Submitted to Biomedical Journals (Ann Intern Med 1979; 90 : 95-9). Contoh : 1. Basmajian JV, Kirby RL.Medical Rehabilitation. 1st ed. Baltimore, London: William and Wilkins, 1984; Hal 174-9. 2. Weinstein L, Swartz MN. Pathogenetic properties of invading microorganisms. Dalam: Sodeman WA Jr. Sodeman WA, eds. Pathologic physiology: Mechanism of diseases. Philadelphia: WB Saunders, 1974;457-72. 3. Sri Oemijati. Masalah dalam pemberantasan filariasis di Indonesia. Cermin Dunia Kedokt. 1990; 64: 7-10. Bila pengarang enam orang atau kurang, sebutkan semua; bila tujuh atau lebih, sebutkan hanya tiga yang pertama dan tambahkan dkk. Naskah dikirimkan ke alamat : Redaksi Cermin Dunia Kedokteran, Gedung Enseval, Jl. Letjen Suprapto Kav. 4, Cempaka Putih, Jakarta 10510 P.O. Box 3117 JKT. Tlp. (021) 4208171. E-mail : cdk@kalbe.co.id Pengarang yang naskahnya telah disetujui untuk diterbitkan, akan diberitahu secara tertulis. Naskah yang tidak dapat diterbitkan hanya dikembalikan bila disertai dengan amplop beralamat (pengarang) lengkap dengan perangko yang cukup.

Tulisan dalam majalah ini merupakan pandangan/pendapat masing-masing penulis dan tidak selalu merupakan pandangan atau kebijakan instansi/lembaga/bagian tempat kerja si penulis.

English Summary
COMPARISON OF ACCURACY BETWEEN PAP TEST AND ACETIC ACID VISUAL INSPECTION FOR CERVICAL LESION DIAGNOSIS S.D. Iswara*, I.K. Suwiyoga*, I.G.P. Mayura M.*, I.G. Artha A.**
*)Dept of Obstetrics and Gynecology and **) Anatomical Pathology Lab. ; Faculty of Medicine, Udayana University/Sanglah Hospital, Denpasar, Bali, Indonesia

1.01 (p=0.312) and false negative value 2.06 (p=0.039). Significant difference were found in sensitivity, specificity and false negative value. Conclusion : VIA method can be used as a substitute for Pap test as screening instrument in cervical lesion cases in Indonesia.
Cermin Dunia Kedokt.2004; 145; 5-8 sdi, iks, pmm, iga

Objective : To compare the diagnostic accuracy between Pap test and VIA method. Material and method : Sixty-one women with cervical lesions visiting the gynecologic-oncologic clinic of Sanglah Hospital in Denpasar from January 2002 to January 2003 and willing to participate, underwent Pap test, VIA examination and biopsy assisted by colposcopic guidance for histopathologic examination. The diagnostic accuracy between Pap test and VIA method was compared based on Z test. Results : VIA sensitivity was 92.5%, specificity was 42.9%, positive and negative predictive value were 75.5% and 75.0%, false positive and false negative value were 24.5% and 25.0%. Z values between VIA method and Pap test for sensitivity 3.01 (p=0.003), specificity 3.32 (p=0.003), positive predictive value 1.01 (p=0.312), negative predictive value 2.06 (p=0.039), false positive value

CHLAMYDIA TRACHOMATIS INFECTION IN CERVICAL CANCER INFECTED BY HUMAN PAPILLOMA VIRUS TYPE 16 AND 18; CROSS SECTIONAL STUDY K. Tonika, K. Suwiyoga
Dept. of Obstetrics and Gynecology, Faculty of Medicine, Udayana University, Denpasar, Bali, Indonesia

Objective: To examine the role of Chlamydia trachomatis infection on cervical cancer infected by human papilloma virus type 16 and 18. Material and method : The crosssectional study was performed at Sanglah Hospital during year 20022003. The samples are the new and untreated cervical cancer. Sample size was determined by Pocock rule and obtained by consecutive sampling. Diagnosis of cervical cancer is based on histopathologic finding on cervical lesion guided biopsy

specimen. HPV infection is diagnosed based on PCR technic at Biomedical Lab Mataram Hospital and chlamydia trachomatis infection is diagnosed by serum antibody level test at Lab Prodia Denpasar. Data was analyzed by SPSS 10.0 for Windows. Results: Fifty consecutive cases were divided into three groups: (1) cevical cancer infected by HPV type 16 and 18, (2) cervical cancer infected by HPV other type, and (3) cervical cancer without HPV infection. The difference of C. trachomatis infection between group (1) and group (2) is not significant (Fisher's exact test: p = 0,576, RP = 0,667; CI 95% 0,273-1,631). The difference of C. trachomatis infection between group (1) and group (3) is significant but not conclusive (Fisher's exact tes: p=0,039, RP = 3,824; CI 95% 0,649-22,510). The difference of C. trachomatis infection between group (2) and group (3) is not significant (Fisher's exact test: p = 0,464, RP = 3,353; CI 95% 0,485-22,897). Conclusion : Chlamydia trachomatis infection is not proved to be the risk for cervical cancer either in HPV type 16 and 18 infections.
Cermin Dunia Kedokt.2004; 145; 9-12 kto, ksu

Bersambung ke halaman 57

Batter the gates heaven with storms of prayer. (Tennyson)

4

Cermin Dunia Kedokteran No. 145, 2004

Artikel
HASIL PENELITIAN

Perbandingan Akurasi Diagnostik Lesi Pra Kanker Serviks antara Tes Pap dengan Inspeksi Visual Asam Asetat (IVA) pada Wanita dengan Lesi Serviks
S.D. Iswara*, I.K. Suwiyoga*, I.G.P. Mayura M. *, I.G. Artha A.**
*)Bagian/SMF Obstetri dan Ginekologi Fakultas Kedokteran Universitas Udayana/ Rumah Sakit Sanglah Denpasar **)Laboratorium Patologi Anatomi Fakultas Kedokteran Universitas Udayana/ Rumah Sakit Sanglah Denpasar

ABSTRAK Tujuan : Mengetahui perbedaan akurasi diagnostik antara tes Pap dan metode IVA. Bahan dan cara : Rancangan penelitian ini adalah uji diagnostik eksperimental dengan metode IVA dan tes Pap sebagai faktor prediktor dan pemeriksaan histopatologi sebagai baku emas. Populasi adalah wanita dengan lesi serviks dan sampel adalah wanita dengan lesi serviks yang datang ke poliklinik GinekologiOnkologi Perjan RS Sanglah Denpasar dari Januari 2002 sampai dengan Januari 2003 dan bersedia ikut serta sebagai subyek penelitian yang ditentukan secara acak. Sebanyak 61 consecutive sample menjalani pemeriksaan tes Pap, pemeriksaan IVA dan histopatologis dari bahan biopsi serviks dengan tuntunan kolposkopi. Data dicatat dalam formulir khusus, ditabulasi dan dilakukan penghitungan sensitifitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif, nilai positif palsu, dan nilai negatif palsu. Perbedaan akurasi diagnostik antara tes Pap dan metode IVA dihitung dengan uji Z. Hasil analisis disajikan dalam bentuk tabel dan narasi. Hasil : Didapatkan sensitifitas IVA sebesar 92,5%, spesifisitas sebesar 42,9%, nilai prediksi positif dan negatif masing-masing sebesar 75,5% dan 75,0%, nilai positif palsu dan negatif palsu masing-masing sebesar 24,5% dan 25,0%. Didapatkan nilai Z pada perbandingan antara metode IVA dengan tes Pap masing-masing untuk sensitifitas 3,01 (p=0,003), spesifisitas 3,32 (p=0,003), nilai prediksi positif 1,01 (p=0,312), nilai prediksi negatif 2,06 (p=0,039), nilai positif palsu 1,01 (p=0,312) dan nilai negatif palsu 2,06 (p=0,039). Sensitifitas, spesifisitas dan nilai negatif palsu tes Pap dan metode IVA berbeda bermakna. Simpulan : Metode IVA dapat dipakai sebagai pengganti tes Pap untuk alat skrining lesi pra kanker/kanker serviks pada kasus-kasus lesi serviks di Indonesia. Kata kunci : IVA – tes Pap – lesi serviks – lesi pra kanker serviks. PENDAHULUAN Kanker serviks merupakan keganasan yang paling banyak ditemukan dan merupakan penyebab kematian utama kanker pada wanita di negara-negara sedang berkembang termasuk Indonesia. Insiden kanker serviks di Indonesia belum diketahui, akan tetapi diperkirakan terdapat 180.000 kasus kanker baru pertahunnya dengan kanker ginekologik di tempat teratas. Kanker serviks merupakan lebih kurang ¾ dari kanker ginekologik tersebut. 1,2 Angka kematian kanker serviks juga belum diketahui, diduga mencapai 75% dalam tahun pertama. Cermin Dunia Kedokteran No. 145, 2004 5

Kematian ini terutama dihubungkan dengan bahwa sebagian besar stadium kanker serviks (70% kasus) adalah stadium invasif, lanjut dan bahkan stadium terminal pada saat diagnosis ditegakkan. 1,2,3,4 Di negara maju, diagnosis dini dengan tes Pap telah terbukti mampu menurunkan mortalitas serta morbiditas kanker serviks; tetapi di Indonesia tes Pap belum mampu mencapai tujuan tersebut karena berbagai kendala antara lain faktor sumber daya manusia, dana, sarana/prasarana, organisasi pelaksana, keadaan geografi dan wanita yang selayaknya menjalankan skrining. 1,3,5 Dipandang dari metodenya, teknik ini kurang praktis, prosedurnya panjang dan kompleks, memerlukan tenaga terlatih, interpretasi hasil lama dan biaya yang relatif mahal. 5,6 Kelemahan lainnya, teknik ini memiliki sensitifitas yang bervariasi dan nilai negatif palsu yang cukup tinggi. Hal ini akibat saat pengambilan, cara pengambilan dan pengiriman sediaan tidak adekuat, kesalahan saat memproses bahan dan kesalahan interpretasi, serta adanya darah, eksudat peradangan dan debris nekrotik. 7,8,9,10 Adanya hambatan dan kelemahan tes Pap ini menimbulkan pemikiran untuk skrining alternatif sebagai upaya mendapatkan lebih banyak temuan kanker serviks stadium dini. Metode Inspeksi Visual Asam asetat (IVA), mungkin mampu menjawab kendala tes Pap. Metode IVA menggunakan cairan asam asetat 3%-5% yang dioleskan pada serviks dan 20 detik setelah pulasan akan tampak bercak berwarna putih yang disebut aceto white epithelium (WE). IVA positif jika terdapat WE dan negatif jika tidak terjadi perubahan warna. Berdasarkan uraian di atas, dilakukan penelitian untuk mengetahui perbedaan sensitifitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif, nilai positif palsu dan nilai negatif palsu antara metode IVA dengan tes Pap sebagai metode skrining lesi pra kanker/kanker serviks. Diharapkan metode IVA dapat dipakai untuk substitusi atau alternatif skrining kanker serviks di Indonesia. BAHAN DAN CARA KERJA Rancangan penelitian adalah uji diagnostik eksperimental. Sebagai prediktor adalah metode IVA dan tes Pap; sedangkan baku emas adalah histopatologis. Populasi dalam penelitian ini adalah wanita yang sudah menikah atau sudah pernah melakukan hubungan seksual. Sampel adalah wanita dengan lesi serviks yang datang ke poliklinik Ginekologi-Onkologi Perjan RS Sanglah Denpasar dari bulan Januari 2002 sampai dengan Januari 2003 yang memenuhi kriteria sampel dan bersedia ikut serta dalam penelitian. Kriteria eksklusi adalah sedang haid, menderita perdarahan abnormal, menderita infeksi organ genitalia, memakai obat/bahan antiseptik kurang dari 1 minggu sebelum pemeriksaan, pasca bersalin, pasca operasi rahim, pasca radiasi kurang dari 6 minggu sebelum pemeriksaan, dan melakukan hubungan seksual kurang dari 24 jam sebelum pemeriksaan. Besar sampel dihitung dengan memakai rumus n= Zα2 (sensitifitas/spesifisitas X (1-sensitifitas/spesifisitas)/d2. Sensitifitas dan spesifisitas masing-masing 77,9% dan 75,5%. (Seputra, 2001). Dengan menerima penyimpangan (d) sebesar 6 Cermin Dunia Kedokteran No. 145, 2004

15 % dan tingkat kemaknaan yang dikehendaki sebesar 95% (α=0,05), maka besar sampel adalah (n1 + n2) = 60,97; dibulatkan menjadi 61 orang. Data dicatat pada formulir khusus untuk selanjutnya ditabulasi dan dilakukan penghitungan sensitifitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif, nilai positif palsu dan nilai negatif palsu. Perbedaan akurasi diagnostik antara tes Pap dan metode IVA dihitung dengan uji Z dengan mempergunakan rumus : P1 – P2 √ {P1Q1/n1 + P2Q2/n2}
Keterangan : P1 = Akurasi diagnostik tes Pap P2 = Akurasi diagnostik metode IVA Q1 = 1 – P1 Q2 = 1 – P2 n1 = Jumlah subyek pada tes Pap n2 = Jumlah subyek pada metode IVA

Hasil uji analisis disajikan dalam bentuk tabel dan narasi. Definisi Operasional Variabel. 1. Akurasi diagnostik alat/metode adalah kemampuan suatu alat atau metode untuk mendeteksi suatu lesi pra kanker serviks pada wanita dengan lesi serviks yang mencakup sensitifitas, spesifisitas, nilai prediksi positif, nilai prediksi negatif, nilai positif palsu dan nilai negatif palsu. 2. Lesi serviks adalah kelainan serviks yang ditemukan pada saat pemeriksaan inspekulo yang berisiko menimbulkan kanker serviks. Lesi serviks meliputi salah satu/bersamaan kelainan berupa leukoplakia, eritroplakia, ulkus/erosi, papiloma. 3. Tes Pap adalah : pemeriksaan sitologi porsio dengan menggunakan cytobrush dan interpretasinya berpedoman pada sistem Bethesda. 4. Inspeksi Visual Asam asetat (IVA) adalah : inspeksi porsio dengan mata telanjang dan dinyatakan positif apabila setelah 20 detik pengolesan asam asetat 5% tampak daerah berwarna putih (White Epithelium). 5. Pemeriksaan Patologi Anatomi (PA) adalah : pemeriksaan histopatologi sediaan dengan mikroskop ditemukan sel koilosit, sel displastik/atipik dan/atau sel anaplastik pada 1/3, 2/3 atau seluruh lapisan epitel dengan membrana basalis yang masih utuh. HASIL DAN DISKUSI Dari hasil pemeriksaan IVA, tes Pap dan pemeriksaan histopatologi terhadap 61 sampel penelitian didapatkan hasil sebagai berikut (Lihat tabel).
Tabel 1. Analisis uji diagnostik metode IVA terhadap Histopatologi IVA Positif Negatif Jumlah Histopatologi Positif 37 3 40 Negatif 12 9 21 Jumlah 49 12 61

Sensitifitas = 92,5% (IK 95% : 91.8 - 93,2) Spesifisitas = 42,9% (IK 95% : 30,5 - 55,3) Nilai prediksi positif = 75,5% (IK 95% : 64,7 - 86,3) Nilai prediksi negatif = 75,0% (IK 95% : 64,0 - 86,0) Nilai positif palsu = 24,5% (IK 95% : 13,7 - 35,3) Nilai negatif palsu = 25,0% (IK 95% : 14,1 - 35,9) Tabel 2. Analisis uji diagnostik tes Pap terhadap Histopatologi Histopatologi Tes Pap Positif Negatif Jumlah Positif 29 11 40 = 72,5% = 71,4% = 82,9% = 57,7% = 17,1% = 42,3% Negatif 6 15 21 Jumlah 35 26 61

Sensitifitas Spesifisitas Nilai prediksi positif Nilai prediksi negatif Nilai positif palsu Nilai negatif palsu

(IK 95% : 61,3 - 83,7) (IK 95% : 60,1 - 82,7) (IK 95% : 73,4 - 92,3) (IK 95% : 45,3 - 70,1) (IK 95% : 7,6 - 26,5) (IK 95% : 29,9 - 54,7)

Tabel 3. Perbandingan hasil uji diagnostik antara metode IVA dan tes Pap. Akurasi diagnostik Sensitifitas Spesifisitas Nilai prediksi positif Nilai prediksi negatif Nilai positif palsu Nilai negatif palsu Z 3,01 3,32 1,01 2,06 1,01 2,06 P 0,003 0,003 0,312 0,039 0,312 0,039

menyerupai laporan penelitian Universitas ZimbabweJHPIEGO(1999) dan laporan penelitian di Afrika Selatan (2000), masing-masing sebesar 73,3% dan 79,8%. Tetapi lebih rendah dari penelitian Hanafi (2000) sebesar 99,9%.9,12,13 Dengan nilai prediksi positif dan nilai prediksi negatif pada penelitian ini masing masing sebesar 75,5% dan 75,0%, berarti pemeriksaan IVA mampu menyatakan benar-benar lesi pra kanker atau benar-benar normal lebih kurang sebesar 75%.Nilai positif palsu IVA pada penelitian ini sebesar 24,5% (IK95%: 13,7-35,3). Hal ini disebabkan karena reaksi aceto white bersifat non spesifik, 80% lesi aceto white tidak berhubungan dengan neoplasia intraepitelial serviks maupun kanker serviks, bisa merupakan reaksi fisiologis regeneratif atau peradangan termasuk infeksi. 14 Nilai negatif palsu IVA pada penelitian ini sebesar 25,0% (IK95%: 14,1-35,9). Negatif palsu ini dapat disebabkan faktor keterbatasan kemampuan mata telanjang (pemeriksa) mendeteksi lesi aceto white yang minimal, lesi berada di daerah endo serviks atau sumber cahaya yang kurang terang. Selain itu ada faktor konsentrasi asam asetat yang menurun akibat penyimpanan lama. 15,16 Tes Pap Pada penelitian ini, sensitifitas tes Pap sebesar 72,5% (IK95%: 61,3-83,7), spesifisitas 71,4% (IK95%: 60,1-82,7), nilai prediksi positif 82,9% (IK95%: 73,4-92,3), nilai prediksi negatif 57,7% (IK95%: 45,3-70,1), nilai positif palsu 17,1% (IK95%: 7,6-26,5) dan nilai negatif palsu 42,3% (IK95%: 29,954,7). Sensitifitas Tes Pap untuk mendeteksi lesi pra kanker sangat bervariasi yaitu antara 44%-98%, dengan spesifisitas 90%, nilai prediksi positif 80,2%, nilai prediksi negatif 91,3% dan angka positif palsu berkisar antara 3%-15%. 2,3,7,9 Selain memiliki sensitifitas yang amat bervariasi, Tes Pap juga memiliki angka negatif palsu yang cukup tinggi yaitu berkisar antara 5%-50%, antara lain akibat pengambilan sediaan yang tidak adekuat (62%), kegagalan skrining (15%) dan kesalahan interpretasi (23%).2 Negatif palsu dikatakan 5%-30% untuk lesi skuamosa, 40% untuk lesi adenomatosa dan 50% untuk lesi invasif.3,7 Tingginya negatif palsu pada kanker invasif disebabkan adanya darah, eksudat peradangan dan debris nekrotik.7,8,9 Dari hasil evaluasi sitologi Tes Pap oleh Yayasan Kanker Indonesia (YKI) wilayah Bali, pada periode tahun 1992-1995 didapatkan sediaan inkonklusif sebesar 5,25%. 17 dan pada periode tahun 1996-1999 jumlah sediaan inkonklusif meningkat sebesar 6,7%.10 Sediaan inkonklusif ini sebagian besar disebabkan karena kesalahan pengambilan bahan, yaitu bahan tidak mengenai sambungan skuamo-kolumner, sediaan terlalu tipis atau terlalu tebal, banyak mengandung darah, kotor, sediaan terlalu lambat dikirim, fiksasi terlambat atau memakai alkohol yang kadarnya kurang dari 95% dan kesalahan pada saat proses pengecatan10,17 Angka ini di atas angka sediaan inkonklusif yang ditetapkan secara nasional yaitu kurang dari 5%. Perbandingan antara Metode IVA dengan Tes Pap Dari penelitian ini didapatkan sensitifitas dan nilai prediksi negatif IVA untuk mendeteksi lesi pra kanker/kanker serviks lebih tinggi dari tes Pap yaitu masing masing sebesar Cermin Dunia Kedokteran No. 145, 2004 7

Inspeksi Visual Asam Asetat Dari penelitian ini didapatkan sensitifitas IVA sebesar 92,5% (IK95%: 91,8-93,2) dan spesifisitas sebesar 42,9% (IK95%: 30,5-55,3). Sensitifitas ini hampir serupa dengan penelitian Hanafi (2000) di Jakarta yaitu sebesar 90,9%. Berbeda dengan laporan Universitas Zimbabwe-JHPIEGO (1999) dan Afrika Selatan (2000) yang masing-masing mendapatkan sensitifitas IVA sebesar 76,7% dan 49,4%. Spesifisitasnya lebih rendah daripada laporan Universitas Zimbabwe-JHPIEGO (1999) dan penelitian Hanafi (2000) yang masing-masing mendapatkan spesifisitas IVA sebesar 64,1% dan 99,8%. Akan tetapi, spesifisitas ini hampir serupa dengan laporan penelitian di Afrika Selatan (2000) yaitu 48,5%. 9,12,13 Dengan sensitifitas sebesar 92,5% dan spesifisitas sebesar 42,9% pada penelitian ini, berarti pemeriksaan IVA mampu mendeteksi 92,5% kasus displasia dari seluruh penderita lesi prakanker yang diperiksa; tetapi hanya mampu menyingkirkan 42,9% penderita sehat; sehingga metode IVA perlu ditunjang dengan pemeriksaan lainnya seperti kolposkopi dan histopatologi. Nilai prediksi positif dan negatif IVA dari penelitian ini masing-masing sebesar 75,5% (IK95%: 64,7-86,3) dan 75,0% (IK95%: 64,0-86,0). Nilai prediksi positif penelitian ini lebih tinggi dari laporan penelitian yang dilakukan oleh universitas Zimbabwe-JHPIEGO (1999) dan penelitian yang dilakukan di Afrika Selatan (2000) yang masing-masing mendapatkan nilai prediksi positif IVA sebesar 25,9% dan 18,9%. Tetapi lebih rendah dari laporan penelitian Hanafi (2000) yaitu sebesar 83,3%. Nilai prediksi negatif dari penelitian ini hampir

92,5% vs 72,5% dan 75,0% vs 57,7%. Perbedaan sensitifitas dan nilai prediksi negatif ini secara statistik bermakna (p = 0,003 dan p = 0,039). Sebaliknya spesifisitas dan nilai prediksi positif IVA lebih rendah dari tes Pap yaitu masing-masing sebesar 42,9% vs 71,4% dan 75,5% vs 82,9%. Perbedaan spesifisitas ini secara statistik bermakna (p = 0,003), sedangkan perbedaan nilai prediksi positif ini secara statistik tidak bermakna ( p = 0,312). Nilai positif palsu IVA pada penelitian ini lebih tinggi dari tes Pap yaitu masing-masing sebesar 24,5% dan 17,1%, sedangkan nilai negatif palsu IVA lebih rendah dari tes Pap yaitu masing-masing sebesar 25,0% dan 42,3%; perbedaan nilai positif palsu ini tidak bermakna ( p = 0,312) sedangkan perbedaan nilai negatif palsu ini bermakna (p = 0,039). Tingginya angka negatif palsu pada tes Pap ini dapat disebabkan adanya darah, eksudat peradangan dan debris nekrotik.7,8,9 Selain itu dapat disebabkan oleh kesalahan pengambilan bahan, yaitu bahan tidak mengenai sambungan skuamo-kolumner, sediaan terlalu tipis atau terlalu tebal, banyak mengandung darah, kotoran, sediaan terlalu lama dikirim, fiksasi terlambat atau memakai alkohol yang kadarnya kurang dari 95% dan kesalahan saat proses pengecatan. 10,17 Dengan hasil akurasi diagnostik IVA tersebut dan membandingkannya dengan tes Pap, maka pemeriksaan IVA memenuhi syarat sebagai alat penapis lesi pra kanker /kanker serviks selain tes Pap. Di samping itu, metode IVA memiliki kelebihan dibandingkan tes Pap seperti murah, mudah dilaksanakan, praktis, sederhana, interpretasi hasil cepat serta hanya memerlukan sumber daya berkualitas bidan terlatih saja; mengingat di Indonesia pada tahun 1977, terdapat 55.000 bidan desa dan 16.000 bidan praktek swasta maka pemberdayaan tenaga paramedis ini dapat menjanjikan kelancaran pelaksanaan metode IVA. Di lain pihak jumlah ahli patologi anatomi yang berhak membaca tes Pap hanya 178 orang dan teknisi sitologi/skriner masih kurang dari 100 orang pada periode yang sama. Di tambah pula oleh kendala tes Pap lainnya seperti kuantitas dan kualitas sumber daya manusia yang rendah, prosedur tes Pap yang panjang dan kompleks, akurasi diagnostik yang sangat bervariasi dengan negatif palsu yang tinggi serta sistem pelaporan dan terminologi yang berbeda-beda. Selain itu, teknik pengambilan dan pemeriksaan yang kurang praktis, wilayah Indonesia sangat luas yang terkait dengan kesulitan transportasi dan komunikasi, dan para wanita yang selayaknya menjalankan skrining enggan untuk diperiksa karena ketidaktahuan, rasa malu, rasa takut dan faktor biaya; ditambah dengan masih rendahnya tingkat pendidikan penduduk di Indonesia juga merupakan kendala bagi tes Pap. SIMPULAN DAN SARAN Sensitifitas IVA untuk mendeteksi lesi pra kanker/kanker serviks lebih tinggi dari tes Pap (92,5% vs 72,5%) dan nilai negatif palsu IVA lebih rendah dari tes Pap (25,0% vs 42,3%). Perbandingan sensitifitas : spesifisitas : nilai negatif palsu antara Metode IVA dengan tes Pap adalah 3,01 : 3,32 : 2,06 (p<0,05).

Mengingat kelebihan metode IVA seperti murah, mudah/sederhana, praktis dan interpretasi hasil yang cepat serta hanya memerlukan sumber daya bidan terlatih saja dibandingkan dengan tes Pap, maka metode IVA sebaiknya disosialisasikan ke semua tenaga medis dan paramedis terutama bidan yang merupakan ujung tombak kesehatan perempuan di Indonesia.

KEPUSTAKAAN 1. 2. Sjamsuddin S. Inspeksi visual dengan aplikasi asam asetat (IVA), suatu metode alternatif skrining kanker serviks. Jakarta : Bag Obstetri dan Ginekologi FK UI/RSCM, 2000: 1-4. Muharam R, Indarti J, Soepardiman HM. Laporan penelitian : Akurasi diagnostik sitologi pada lesi prakanker serviks di Bagian Obstetri dan Ginekologi FK UI/RSCM. Jakarta : Bag Obstetri dan Ginekologi FK UI/RSCM, 2000. Nuranna L. Skrining kanker serviks, upaya downstaging dan metode skrining alternatif. Jakarta: Bag Obstetri dan Ginekologi FK UI/RSCM, 1999: 1-8. Darma Putra IGN. Kanker serviks uterus di RSUP Denpasar. Bali : Lab/SMF Obstetri dan Ginekologi FK UNUD/RSUP Denpasar, 2000: 130. Wijaya I. Tindak lanjut Pap`s smear yang abnormal. Semarang : Badan Penerbit Universitas Diponegoro, 1993: 1-59. Halimun WA. Pap smear dan masalahnya. Bagian Patologi Anatomi. Jakarta, 2000: 13-21. Kim SJ. Screening and epidemiological trends in cancer of cervix. In : Saifuddin AB, Affandi B, Wiknjosastro GH eds. Women`s health. Recent advances in the Asia-Oceania region. Proc. XVth Asian and Oceanian Congress of Obstetric and Gynecology. Jakarta: Yayasan Bina Pustaka Sarwono Prawiroharjo (ed.) 1995: 317-20. Sherman ME. Cytopathology. In : Kurman RJ ed. Blaustein`s pathology of the female genital tract 4 th ed. New-York: Springer-Verlag, 1995: 1097-1125 Nazeer S. Visual inspection with acetic acid for cervical cancer screening : tes qualities in a primary- care setting. Lancet 1999; 353: 869-73. Mulyadi. Evaluasi sitologik tes Pap konvensional menurut sistem Bethesda di YKI wilayah Bali periode tahun 1996-1999. Bali: YKI wilayah, 2000: 1-13. Seputra A. Tesis : Evaluasi pemeriksaan gineskopi pada pap smear abnormal untuk deteksi dini pra kanker serviks di RSUP Denpasar. Bali: Lab/SMF Obstetri dan Ginekologi FK Unud/RSUP Denpasar, 2000. CronjeHS, CooremanBF, Beyer E, et al. Screening for cervical neoplasia in a developing country utilizing cytology, cervicography and the acetic acid test. Internat. J. Gynecol &Obstet 2000; 72: 151- 57. Hanafi, Ocviyanti D., Prihartono J. dkk. Laporan penelitian : Efektivitas pemeriksaan inspeksi visual dengan asam asetat oleh bidan sebagai upaya mendeteksi lesi pra kanker serviks. Jakarta: Bag/SMF Obstetri dan Ginekologi FKUI/RSCM, 2002. Coppleson M, Pixley EC. Gynecologic oncology - Colposcopy of the cervix. 2 nd ed., vol.1. Edinburgh: Churchill Livingstone, 1992: 55-69. Suhartini. Tesis : Inspeksi visual dengan hapusan asam asetat (IVA) dibandingkan dengan pap smear sebagai salah satu cara penapisan kanker serviks dini. Surabaya: Lab/SMF Obstetri dan Ginekologi FK Unair/RSUD Dr. Soetomo, 2001. Yulpetropala, Alfian, Hasan M. Laporan penelitian : Skrining neoplasia intraepitel serviks (NIS) dengan metode inspeksi visual dengan asam asetat. Padang: Bag Obstetri dan Ginekologi RSUP Dr. M. Djamil/FK Universitas Andalas, 2002. Mulyadi. Evaluasi hasil Pap tes di laboratorium sitologi YKI wilayah Bali tahun 1992-1995. Bali: YKI wilayah, 1996: 1-8.

3. 4. 5. 6. 7.

8. 9. 10. 11. 12. 13.

14. 15.

16.

17.

8

Cermin Dunia Kedokteran No. 145, 2004

HASIL PENELITIAN

Infeksi Chlamydia trachomatis pada Kanker Serviks Terinfeksi Human Papilloma Virus tipe 16 dan 18 :
Studi Cross – Sectional
K. Tonika, K. Suwiyoga
Bagian Obstetri dan Ginekologi Fakultas Kedokteran Universitas Udayana, Denpasar

ABSTRAK Tujuan: Mengetahui peran infeksi Chlamydia trachomatis pada kanker serviks yang terinfeksi HPV tipe 16 dan 18. Bahan dan cara: Studi cross-sectional dilakukan di Bagian Obstetri dan Ginekologi FK UNUD/RS Sanglah Denpasar selama tahun 2002-2003. Sampel adalah kanker serviks baru dan belum pernah diterapi serta bersedia ikut serta sebagai subyek penelitian. Penentuan sampel secara berturut-turut dan besarnya dihitung dengan memakai rumus Pocock. Diagnosis kanker serviks berdasarkan hasil histopatologi biopsi lesi serviks dengan tuntunan kolposkopi. Infeksi HPV berdasarkan isolasi DNA memakai teknik PCR di unit riset Biomedik RSUD Mataram, dan pemeriksaan serologi di Laboratorium Prodia Denpasar. Data dicatat pada formulir penelitian, kemudian diolah memakai program SPSS 10.0 for Windows. Dilakukan uji X2 dan hasil analisis disajikan dalam bentuk tabel dan narasi. Hasil: Sejumlah 50 sampel dibagi atas tiga kelompok yaitu (1) kanker serviks terinfeksi HPV tipe 16 dan 18, (2) kanker serviks terinfeksi HPV tipe lain, dan (3) kanker serviks tidak terinfeksi HPV. Didapatkan perbedaan infeksi Chlamydia trachomatis pada kelompok 1 dengan kelompok 2 adalah tidak bermakna (Fisher's exact test: p = 0,576, RP = 0,667; CI 95% 0,273-1,631). Infeksi C.trachomatis pada kelompok 1 dengan kelompok 3 berbeda tidak bermakna (Fisher's exact test: p=0,039, RP = 3,824; CI 95% 0,649-22,510). Infeksi C.trachomatis pada kelompok 2 dengan kelompok 3 berbeda tidak bermakna (Fisher's exact test: p = 0,464, RP = 3,353; CI 95% 0,485-22,897). Kesimpulan: Infeksi C. trachomatis tidak terbukti sebagai faktor risiko minor kanker serviks terinfeksi HPV tipe 16 dan 18, infeksi HPV selain tipe 16 dan 18, dan tidak terinfeksi HPV. Kata kunci: Chlamydia trachomatis, infeksi HPV tipe 16 dan 18, kanker serviks.

PENDAHULUAN Kanker serviks masih merupakan masalah yang cukup besar di negara-negara sedang berkembang termasuk Indonesia karena insiden dan kematiannya yang tinggi. Di dunia (1980), diperkirakan 450.000 kasus baru kanker serviks tiap tahun :

96.100 di negara maju dan 369500 di negara sedang berkembang dengan 300.000 kematian tiap tahun akibat kanker serviks.1 Insiden penderita kanker serviks di Indonesia sampai saat ini tidak diketahui pasti karena lemahnya sistem registrasi. Dari 13 Pusat Lab. Patologi Anatomi (1998), prevalensi kanker Cermin Dunia Kedokteran No. 145, 2004 9

serviks menempati urutan pertama yaitu 28,66% dari 9.043 kanker pada wanita.1,2 Laporan beberapa rumah sakit pendidikan di Indonesia menyatakan bahwa proporsi kanker serviks antara 62-70% dari kanker ginekologi.2,3,4 Penyebab kanker serviks adalah multifaktorial. Faktor risiko mayor adalah infeksi human papilloma virus (HPV). Infeksi Chlamydia trachomatis diduga sebagai ko-faktor yang bekerja sinergis dengan HPV melalui mekanisme radikal bebas dan sistim imun. Sejak tahun 1990-an, infeksi Chlamydia trachomatis yang merupakan penyakit hubungan seksual (PHS) tersering, menggantikan posisi N.gonorrhe.5,6,7 Suatu studi kasus kontrol (Santosa et al, 1994), mendapatkan hubungan antara kanker serviks dengan 4 penyebab utama PHS yaitu HPV, CMV, HSV-2 dan C. trachomatis. Risiko cervical intraepithelial lesion (CIN) III meningkat dengan meningkatnya titer antibodi C. trachomatis.5 Hal ini didukung oleh studi lain yang mendapatkan bahwa risiko kanker serviks menjadi bermakna jika pada infeksi HPV juga ditemukan peningkatan titer antibodi HSV-2 dan C. trachomatis. Didapatkan pula, hanya infeksi C. trachomatis yang dihubungkan dengan peningkatan risiko perkembangan kanker serviks.8-13 Di sisi lain, seroepidemiologis menunjukkan hubungan yang tidak bermakna antara infeksi C. trachomatis dengan kanker serviks dan sebagai faktor risiko yang tidak tergantung untuk terjadinya CIN. Sedangkan hubungan antara kanker serviks dengan PHS yang lain seperti gonorhea, vaginosis bakterial, sitomegalovirus dan virus Epstein Barr adalah tidak konsisten. (6,13,14) Penelitian ini bertujuan untuk mengetahui adanya perbedaan frekuensi infeksi C. trachomatis pada kanker serviks terinfeksi HPV tipe 16 dan 18. Hasil penelitian ini diharapkan dapat sebagai masukan terhadap kontroversi peran infeksi C.trachomatis pada karsinogenesis kanker serviks oleh infeksi HPV tipe 16 dan 18. BAHAN DAN CARA Rancangan penelitian ini adalah cross-sectional. Populasi adalah pasien kanker serviks dan sampel adalah kanker serviks dan bersedia ikut serta dalam penelitian ini (informed consent). Penelitian dilakukan di poliklinik Onkologi Ginekologi RS Sanglah Denpasar November 2002 - Juli 2003. Sampel ditentukan secara consecutive, dibagi atas tiga kelompok yaitu kelompok 1 adalah kanker serviks terinfeksi HPV tipe 16 dan 18, kelompok 2 adalah kanker seviks terinfeksi HPV tipe lain, dan kelompok 3 adalah kanker serviks tidak terinfeksi HPV. Biopsi serviks dan aspirasi darah vena kubiti dilakukan untuk pemeriksaan histopatologi, polymerase chain reaction (PCR), dan ELISA. Pemeriksaan histopatologi dilakukan di Lab. Patologi Anatomi FK UNUD/RS Sanglah Denpasar, serologi ELISA di Lab Prodia Denpasar, and PCR di Lab Biomedika RSUD Mataram. Besar sampel dapat dihitung dengan rumus :

Keterangan : n =jumlah sampel yang dibutuhkan untuk setiap kelompok. f =proporsi drop out Zα = nilai Z untuk alfa P = perkiraan proporsi kejadian dipopulasi. d = deviasi sampel terhadap populasinya Zα =1,96 pada confidence level 95% P : perkiraan yang menderita Chlamydia trachomatis = 50% (0,5) d : deviasi yang diinginkan = 20% (0.2) f : 0%

Dari perhitungan di atas didapatkan besar sampel adalah 49,61, dibulatkan menjadi 50. Data hasil penelitian dicatat dalam formulir khusus kemudian ditabulasi dan diolah dengan komputer program SPSS 10.0 for Windows. Dilakukan T test terhadap variabel umur,paritas, dan jumlah pasangan seksual untuk mengetahui homogenitas. Uji X2 untuk mengetahui perbedaan infeksi C.trachomatis di antara ketiga kelompok. DEFINISI OPERASIONAL VARIABEL 1. Kanker serviks yang dimaksud adalah kanker serviks uteri jenis epitelial berdasarkan pemeriksaan histopatologi. 2. Umur adalah usia kasus berdasarkan tanggal lahir atau seperti yang tertera pada kartu tanda penduduk. 3. Jumlah pasangan seksual adalah jumlah pria yang pernah melakukan kontak seks dengan pasien. 4. Paritas adalah jumlah janin viabel yang pernah dilahirkan. 5. Terinfeksi C.trachomatis, bila kadar antibodi klamidia > 1,10 : (+) dengan tes Elisa. 6. Terinfeksi HPV, apabila protein L1 positif dan dinyatakan HPV 16 (+), 18 (+); apabila pada pemeriksaan DNA dengan PCR primer khusus terdapat hasil positif. HASIL DAN DISKUSI Penelitian ini hanya mengambil HPV tipe 16 dan 18 dengan pertimbangan kedua tipe HPV tersebut termasuk kelompok onkogenik tinggi, prevalensinya 84,5%, penelitian di Indonesia masih sangat terbatas, dan juga karena keterbatasan biaya. Sedangkan C. trachomatis dipilih sebagai variabel karena agen penyebab PHS ini menempati urutan pertama baik di Bali maupun di Indonesia (SKRT dan PHS, 2001). Uji Levent T terhadap usia, paritas dan jumlah pasangan seksual menunjukkan bahwa variabel-variabel tersebut homogen (p>0,05) (Tabel 1).
Tabel 1. Homogenitas usia, paritas, dan pasangan seksual
Kelompok 1 Rer ata Umur (tahun) Paritas Pas. Seksual 42, 7 3,5 2,3 SD 3,66 0,62 0,50 Kelompok 2 Rerata 41,4 3,2 2,7 SD 3,86 0,55 0,52 Kelompok 3 Rerata 43,8 3,6 3,1 SD 4,18 0,58 0,56 0,486 0,197 0,115 0,457 0,175 0,102 P1 P2

n=

1 ( Zα ) 2 P(1 − P) x 1− f (d ) 2

Selanjutnya, perbedaan prevalensi infeksi C.trachomatis pada masing-masing kelompok dapat dilihat pada Tabel 2.

10 Cermin Dunia Kedokteran No. 145, 2004

Tabel 2. Perbedaan infeksi C.trachomatis pada kanker serviks terinfeksi HPV tipe 16 dan 18, kanker serviks terinfeksi HPV tipe lain, dan kanker serviks tidak terinfeksi HPV. Chlamydia trachomatis Positif HPV tipe 16 dan 18 (+) HPV tipe lain HPV Jumlah (+) (-) 26 4 2 32 Negatif 8 2 8 18 34 6 10 50 0,576 0,039 0,464 Total p

Kelompok (1) dengan (2) Fisher’s Exact Test: p: 0,576, RP: 0,667; IK 95%: 0,273-1,631 Kelompok (1) dengan (3) Fisher’s Exact Test: p: 0,039, RP: 3,824; IK 95%: 0,649-22,510 Kelompok (2) dengan (3) Fisher’s Exact Test: p: 0,464, RP: 3,353; IK 95%: 0,485-22,897

Perbedaan infeksi C. trachomatis antar ketiga kelompok tersebut tidak bermakna (Tabel 2). Dari 50 kasus kanker serviks yang menjalani pemeriksaan antibodi C. trachomatis dari serum darah ditemukan 32 kasus (64,0%) positif, sedangkan dari pemeriksaan PCR terhadap biopsi porsio didapatkan infeksi HPV tipe 16 pada 22 kasus (44,0%), HPV tipe 18 sebanyak 2 kasus (16,0%) dan HPV tipe 16 dan 18 pada 4 kasus (8,0%), serta HPV tipe lain sebanyak 6 kasus (12,0%). Pada penelitian sebelumnya di RS Sanglah Denpasar didapatkan 84,8% infeksi HPV tipe 16, 18, infeksi HPV tipe 16 sebesar 65,6% dan infeksi HPV tipe 18 sebesar 68,8%.15 Teknik PCR merupakan teknik biomolekuler yang terbaik dengan sensitivitas dan spesifisitas tinggi. PCR dapat meningkatkan secara bermakna skrining DNA dan dapat menunjukkan prevalensi infeksi HPV pada serviks lebih dari 70% wanita dengan sitologi normal dan 100% pada sitologi yang abnormal. PCR dapat mendeteksi DNA HPV pada lebih dari 90% kanker serviks.16,17,18,19,20 Hasil penelitian ini tidak banyak dapat dikomparasi dengan studi lain kerena keterbatasan studi tentang prevalensi C. trachomatis pada HPV tipe 16 dan atau 18, terutama di Indonesia. Berbagai penelitian akhir-akhir ini, melaporkan bahwa secara klinikopatologi terdapat hubungan bermakna antara HPV dengan lesi intraepitel skuamosa.12,20 Demikan juga, secara klinikoserologi terdapat hubungan bermakna antara infeksi C. trachomatis dengan karsinoma sel skuamosa serviks.13 Dengan pemeriksaan PCR, ditemukan 12 kasus (48,0%) terinfeksi HPV, dengan pemeriksaan serologi antibodi C. trachomatis ditemukan 16 kasus (64%) positif. 17,18 Sebagai organisme patogen intraseluler, C.trachomatis memerlukan satu sistem kultur sel untuk perkembangbiakan di laboratorium, yang selama bertahun- tahun merupakan standar emas untuk deteksi C. trachomatis. Akan tetapi, karena alasan tidak adekuat, biaya dan kesulitan teknik kultur sel, maka pengembangan tes – tes non kultur merupakan prioritas utama penelitian selama 15 tahun terakhir ini. Tes serologik belum dipergunakan secara luas untuk diagnosis karena beberapa

masalah pokok seperti: 1) prevalensi seropositif yang tinggi dapat menggambarkan infeksi sebelumnya atau infeksi yang menetap. 2) tidak ada awal gejala yang dapat dideteksi, sehingga sering ditemukan dalam periode titer antibodi Ig M atau titer antibodi Ig G baik tinggi maupun rendah.12,17 Studi hubungan seropositif C. trachomatis dan risiko karsinoma sel skuamosa serviks adalah berdasarkan penelitian Anttila et al (1998) di Finlandia, Norwegia dan Swedia yang mendapatkan hubungan sangat kuat antara seropositif C. trachomatis tipe G dengan karsinoma sel skuamosa; makin banyak jumlah serotipe Chlamydia yang menginfeksi, makin besar risiko karsinoma sel skuamosa. Fischer N (2002), menganalisis 81 kasus NIS dan karsinoma serviks invasif dan 68 pasien kelompok kontrol, dilakukan pemeriksaan pengaruh infeksi C. trachomatis terhadap adanya EGFR, TGF alpha, Ki 67, HPV 16 dan 18.16 Kadar antibodi serum diukur dengan teknik PCR untuk menilai adanya infeksi sebagai penyebab hipertrofi serviks pada wanita dengan dan tanpa NIS dan karsinoma invasif. Infeksi Chlamydia, juga HPV berkaitan dengan tingginya Ki 67 pada epitelium. Infeksi C.trachomatis juga meningkatkan adanya HPV 16 pada NIS I. Hasil tersebut mendukung dugaan bahwa infeksi C.trachomatis mempengaruhi aktivitas virus. Garland et al (2001), dengan teknik PCR mendapatkan prevalensi infeksi multipatogen pada 58 kasus (53%), infeksi patogen tunggal sebanyak 43 kasus (39%), 15 kasus (14%) terinfeksi patogen campuran. Didapatkan pula C. trachomatis pada 15 kasus (14%), N. gonorrhoe pada 12 kasus (11%), T. vaginalis pada 9 kasus (8%), dan HPV pada 39 kasus (36%).14 Melalui penelitian prospektif seroepidemiologi, Koskela et al (2000) mencari hubungan antara antibodi C.trachomatis serum dengan risiko karsinoma sel skuamosa serviks (HPV dan merokok, OR: 2.2; IK 95%: 1,3 – 3,5). Didapatkan pula. hubungan yang menetap antara merokok dengan seronegatif dan seropositif HPV 16 (OR: 3.0, IK 95%: 1,8 – 5,1; OR: 2.3; IK 95%: 0,8 – 7,0). Pada penelitian tersebut disimpulkan bahwa infeksi C. trachomatis meningkatkan risiko perkembangan lanjut karsinoma sel skuamosa serviks invasif.21 Hasil penelitian di atas, mirip dengan penelitian kasus kontrol oleh Dillner et al. (1997), bahwa pada populasi dengan prevalensi antibodi C. trachomatis yang rendah terdapat hubungan dengan risiko HPV 16 yang tinggi (RR: 11,8; 95% CI: 3,7 – 37,0). Penelitian lain, mendapatkan hubungan antara seropositif HPV tipe 11, 16, 18, 33 dengan kebiasaan seksual. Pada penelitian tersebut ditemukan proporsi seropositif HPV 16 meningkat secara linear sekitar 4% per partner (p<0.001), dari 4% jika hanya partner tunggal selama hidupnya, sampai 35% jika lebih dari 5 partner. Demikian juga, seroprevalensi HPV 33 dan 18 secara linear tergantung dari jumlah partner (p < 0.001). Sebaliknya pada populasi dengan prevalensi antibodi C. trachomatis yang tinggi, tidak ditemukan peningkatan risiko terhadap kejadian kanker serviks.12 Epitel serviks pada zona transformasi sangat sensitif terhadap respon eksternal sehingga mudah terjadi metaplasia. Metaplasia ini dapat berpotensi ganas bila kontak dengan agen seperti C. trachomatis, virus Papova termasuk bahan lain terjadi pada fase aktif atau pada fase awal metaplasia. Juga oleh infeksi HPV terutama HPV tipe 16 dan 18 yang ditularkan Cermin Dunia Kedokteran No. 145, 2004 11

lewat kontak seksual pada zona transformasi. Selain itu, merokok, aktivitas seksual, keradangan serviks ataupun trauma, status imunitas dan umur dapat membentuk lesi intraepitel skuamosa, yang selanjutnya dapat menimbulkan kanker skuamosa yang invasif.6,13 SIMPULAN Penelitian cross-sectional terhadap 50 kasus kanker serviks invasif di RS Sanglah Denpasar selama tahun 2002-2003, mendapatkan: Pada kanker serviks, prevalensi infeksi C.trachomatis adalah 64,0%, infeksi HPV tipe 16 adalah 44,0%, tipe 18 adalah 16,0%, sedangkan infeksi HPV tipe lain adalah 12,0%. 1. Tidak terdapat perbedaan bermakna dalam hal infeksi C. trachomatis pada kanker serviks antara yang terinfeksi HPV tipe 16 dan 18 dengan yang terinfeksi HPV tipe lain (Fisher exact test p= 0,576, RP= 0,667; IK 95%: 0,273-1,631). 2. Tidak terdapat perbedaan bermakna dalam hal infeksi C.trachomatis pada kanker serviks antara yang terinfeksi HPV tipe 16 dan 18 dengan yang tidak terinfeksi HPV (Fisher exact test: p: 0,039, RP: 3,824; IK 95%: 0,64922,510). 3. Tidak terdapat perbedaan bermakna dalam hal infeksi C.trachomatis pada kanker serviks antara yang terinfeksi HPV tipe lain dengan yang tidak terinfeksi HPV (Fisher exact test: p: 0,464, RP: 3,353; IK 95%: 0,485-22,897).

5. 6. 7. 8.

9.

10.

11. 12. 13. 14.

15.

KEPUSTAKAAN 1. Herman S, Wartiman M, Haryanto Y, Tinjauan epidemiologi atas penderita kanker serviks di enam belas rumah sakit pemerintah di Jawa Barat periode Januari – Desember 1998. Dalam: Naskah lengkap Pertemuan Ilmiah Tahunan XI Perkumpulan Obstetri dan Ginekologi FK Unpad/RSUP Dr. Hasan Sadikin Bandung 1998: 164-75. Azis MF. Pilihan terapi kanker ginekologi stadium awal. Naskah Lengkap Pertemuan Ilmiah Tahunan XI. Perkumpulan Obstetri dan Ginekologi Indonesia, Semarang 1999; 111-2. Darma Putra, Suwiyoga K. Kanker serviks uterus di RSUP Denpasar 2000: 12-7. Dillner J et al.. Seropositive to human papillomavirus type 16,18, or 33 capsid and to chlamydia trachomatis are marker of sexual behavior. Am J Obstet Gynecol 1996; 173 (6); 1394-8.

16. 17. 18. 19. 20. 21.

2. 3. 4.

De Sanjose S, Munoz N, Bosch FX, Remainn K, Pedersen NS, Orfila J et al. Sexually transmitted agents and cervical neoplasia in Colombia and Spain. Am J Obstet Gynecol 2002; 136 (35): 1345-9. Zenilman JM. Chlamydia and cervical cancer a real association ? JAMA 2002; 285 (1): 34-9. Cotran RS, Kumar V, Collins T. The female genital tract. in: Robbins Pathologic Basis of Disease. Sixth ed. WB Saunders Co. 1999; 345-67. Nazeer S. Protocol model for cervical cancer screening/ early detection programme in developing countries 2000. Http://matweb.hcuge,ch/matweb/endo/internationalNetwork protoCerviCa.html. Runowics SD, Lymberis S, Tobias D (03/07/1997). Cervical neoplasia and cigarette smoking: are they linked ?. Medscape General Medicine, http://www.medscape.com/medscape/womenHealth/journal/v02.n03/w141 .runowicsz141.runowicz.html, 13 Agustus 2003 Sianturi MHR, Indarti J, Irmansyah F. Pemeriksaan DNA HPV pada infeksi HPV, neoplasia intraepitel serviks dan karsinoma invasif. Dalam: Naskah Lengkap Pertemuan Ilmiah Tahunan XI POGI Semarang 1999; 3: 23-8. Stephen J, Lurie, Zylke JW. Chlamydia trachomatis and cervical squamous cell carcinoma . JAMA 2001; 285 (13): 267-9. Dillner J et al. Prospective seroepidemiologic study of human papillomavirus infection as a risk factor for invasive cervical cancer. J Natl Cancer Inst 1997, Sept 3 ; 89 (17); 1293-9. Anttila T, Saikku P, Koskela P, Bloigu A, Dillner J, Ikaheimo I, et al. Serotype of chlamydia trachomatis and risk for development of cervical squamous cell carcinoma. JAMA 2001; 285 (1):47-51. Garland SM, Tabrizi SN, Chen S, Byambaa C, Davaajav K. Prevalence of sexually transmitted infection (Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis and human papillomavirus) in female attendees of a sexually transmitted diseases clinic in Ulaanbaatar, Mongolia. Infect Dis Obstet Gynaecol 2001; 9 (3) : 143-6. Surya N, Suwiyoga K. Kajian infeksi human papilloma virus tipe 16 dan 18 sebagai faktor risiko kanker serviks dan penyakit menular seksual. Tesis, Lab/SMF Obstetri dan Ginekologi FK UNUD/RSUP Denpasar 2002. Fischer N. Chlamydia trachomatis infection in cervical intraepithelial neoplasia and invasive carcinoma. Eur J Gynaecol Oncol 2002; 23 (3) : 247-50. Jawetz E, Melnick JL, Adelberg EA. Chlamydia. In: Review of Medical Microbiology 1995; 134 (34): 234-39. Jones RB, Chlamydia disease in: Principle and Practice of Infectious Disease, 14th ed, Churchill Livingstone 1995; 1451-59. Grayston JT. Chlamydia. In : Tropical and geographical medical, 2 nd ed. Mc Graw-Hill information service company, 1995, 644-53. Holmes KK. Lower genital infection in woman: vaginal infection, in: Holmes KK, Mardh PA, Sparling PF, (eds.). Sexually transmitted disease, New York: Mc Graw-Hill Book Co., 1997; 244-65. Koskela P, Anttila T, Bjorge T, Brunsvig A, Dillner J, Hakama M et al. Chlamydia trachomatis infection as a risk factor for invasive cervical cancer. Internat. J Cancer 2001; 85 (1) : 35-9.

RALAT Artikel : Toksoplasmosis Ibu Hamil di Indonesia (Studi Tindak Lanjut Survai Kesehatan Rumah Tangga 1995) Oleh : Salma Ma’roef, Soeharsono Soemantri Di : Cermin Dunia Kedokteran No. 139, 2003, hal. 42 Sebelum alinea : Data didapatkan dari ……………. seharusnya ada Subjudul : METODOLOGI Redaksi mohon maaf atas kekeliruan tersebut, dengan ini kekeliruan tersebut telah diperbaiki. Redaksi Cermin Dunia Kedokteran

12 Cermin Dunia Kedokteran No. 145, 2004

HASIL PENELITIAN

Risiko Lesi Intraepitel Skuamosa Serviks Derajat Tinggi pada Penderita Terinfeksi Virus Human Papiloma 16 dan 18
I.G.N. Darmaja*, K. Suwiyoga*, I.G.A. Artha**
*

Bagian / SMF Obstetri dan Ginekologi Fakultas Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar ** Bagian / SMF Patologi Anatomi Fakultas Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar

ABSTRAK Tujuan : Mengetahui peranan infeksi Virus Human Papilloma (VHP) 16 dan 18 sebagai faktor risiko terjadinya lesi intraepitel (LIS) derajat tinggi. Subyek dan cara kerja : Penelitian kasus-kontrol, 31 sampel LIS derajat tinggi dan 31 sampel kelompok kontrol. Penelitian dilakukan di Poliklinik Obstetri dan Ginekologi FK Unud/RS Sanglah Denpasar. Dilakukan scraping dengan cytobrush di daerah endo dan ektoserviks; selanjutnya dilakukan pemeriksaan PCR di unit Riset Biomedik RSU Mataram. Hasil : Kejadian infeksi VHP tipe 16,18 pada LIS derajat tinggi adalah 22 kasus (71%), pada kontrol 10 kasus (32,3%). infeksi VHP tipe 16 pada LIS derajat tinggi adalah 16 kasus (51,6%), pada kontrol 7 kasus (22,6%). infeksi VHP tipe 18 pada LIS derajat tinggi adalah 17 kasus (54,8%), dan pada kontrol 6 kasus (19,4%). Infeksi VHP tipe 16,18 meningkatkan risiko LIS derajat tinggi 7 kali dibanding yang tidak terinfeksi RO 7 (IK 95%: 1,16-42,15), x2=7,5 , p=0,04. Infeksi VHP tipe 16 meningkatkan risiko LIS derajat tinggi 5,5 kali dibanding tidak terinfeksi RO 5,5 (IK 95%: 1,003-30,15), x2=4,9 , p=0,02. Infeksi VHP tipe 18 meningkatkan risiko LIS derajat tinggi 6,5 kali dibanding yang tidak terinfeksi RO 6,5 (IK 95%: 1,09-38,68), x2=6,7 , p=0,007. Sekitar 63% dan 67% LIS derajat tinggi dapat dicegah bila infeksi VHP tipe 16, VHP tipe 18 dapat dihilangkan. Kesimpulan : Risiko terjadinya LIS derajat tinggi pada penderita dengan infeksi VHP tipe 16,18 sebesar 7 kali, pada infeksi VHP tipe 16 adalah 5,5 kali, sedang pada infeksi VHP tipe 18 adalah 6,5 kali dibandingkan yang tidak terinfeksi. Penelitian ini memperlihatkan proporsi infeksi VHP 18 yang tinggi. Kata kunci : VHP tipe 16 dan 18, faktor risiko, LIS derajat tinggi. PENDAHULUAN Lesi intraepitel skuamosa (LIS) serviks merupakan gangguan diferensiasi sel pada lapisan skuamosa serviks. Kriteria diagnostik LIS berdasarkan imaturitas seluler, disorganisasi seluler, abnormalitas inti sel, dan peningkatan aktifitas mitosis sel. Jika mitosis dan sel-sel imatur hanya pada sepertiga bawah lapisan epitel dikenal sebagai LIS derajat rendah, jika meliputi seluruh lapisan epitel disebut dengan LIS derajat tinggi.(1) Karsinoma serviks yang merupakan tingkat perkembangan lanjut dari LIS insidennya cukup tinggi, baik di negara sedang berkembang maupun negara maju. Sekitar 500.000 kasus baru ditemukan setiap tahun di seluruh dunia dan hampir 77% di antaranya terjadi di negara sedang berkembang.(2) Data WHO menyebutkan kira-kira 230.000 wanita meninggal karena karsinoma serviks setiap tahunnya, 190.000 di antaranya terjadi di negara sedang berkembang.(3) Cermin Dunia Kedokteran No. 145, 2004 13

Studi epidemiologi menunjukkan beberapa faktor risiko LIS, seperti usia saat hubungan seksual pertama kali, usia saat kehamilan pertama, jumlah pasangan seksual, merokok, kontrasepsi oral, paritas, sosial ekonomi, infeksi virus herpes simpleks tipe 2 dan infeksi virus human papiloma (VHP). VHP tipe risiko onkogenik tinggi dideteksi pada 90-95% lesi prakanker dan karsinoma serviks.(4) Di seluruh dunia VHP 16 merupakan tipe yang paling sering ditemukan yaitu 51,5%(5), sedangkan Kjellberg L mendapatkan VHP 16 pada NIS 2 dan 3 sebanyak 44 %, VHP 18 sebanyak 9%.(6) Marrazzo mendapatkan 41% VHP 16 atau 18 pada NIS 2 dan 3.(7) Di Indonesia yang terbanyak adalah VHP 18 yaitu 50%.(5,8,9) BAHAN DAN CARA KERJA Rancangan penelitian ini adalah studi kasus kontrol. Sebagai kasus adalah 31 penderita LIS derajat tinggi yang dibuktikan dengan pemeriksaan sitologi dan kontrol adalah 31 orang normal yang juga dibuktikan dengan pemeriksaan sitologi; parameter lain disamakan sehingga hanya faktor risiko VHP yang belum diketahui. Pada penderita yang memenuhi kriteria kasus dan kontrol kemudian diambil sediaan dari ekto dan endoserviks dengan cytobrush, dimasukkan ke tabung microcentifuge yang telah diisi NaCl 0,9% untuk pemeriksaan PCR. Selanjutnya bahan untuk pemeriksaan PCR dikirim ke lab/unit riset Biomedik RSU Mataram untuk pemeriksaan VHP 16 dan 18. Pasien diwawancarai mengenai umur, umur kontak seks pertama kali, jumlah pasangan seks, paritas, perokok, suami perokok, pernah memakai kontrasepsi oral lebih dari 6 tahun. Data dicatat dalam formulir khusus kemudian ditabulasi dan diolah dengan komputer SPSS 10.0, dengan menghitung proporsi infeksi VHP tipe 16 dan 18 pada penderita LIS derajat tinggi, menghitung rasio odds (RO) dan menghitung population attributable risk (PAR) dan juga dilakukan uji x2 McNemar untuk sampel yang berpasangan. HASIL DAN DISKUSI Telah dilakukan pemeriksaan DNA VHP dengan teknik PCR dari bulan Februari 2002 hingga bulan Desember 2003 pada 62 sampel dengan rincian 31 kasus LIS derajat tinggi dan 31 kontrol normal. Karakteristik dan komparabilitas sampel Dari 31 kasus umur termuda 27 tahun dan tertua 60 tahun, sedangkan dari 31 kontrol umur termuda 28 tahun dan tertua berumur 59 tahun. Paritas pada penelitian ini bervariasi dari nullipara hingga paritas 6 dengan paritas 2 paling banyak yaitu 10 (32,1%) pada kasus dan 11 (35,5%) pada kontrol. Umur termuda saat kawin pertama baik pada kasus dan kontrol adalah 15 tahun. Sudah diketahui bahwa faktor penyebab LIS dan karsinoma serviks bersifat multifaktorial, oleh karena itu pengaruh beberapa variabel pengganggu harus dihilangkan, jadi dikontrol by design. Di samping upaya eksklusi dan matching beberapa variabel juga dilakukan kontrol saat analisis uji statistik. Uji Chi square pada p < 0,05, tidak mendapatkan perbedaan bermakna antara kasus dan kontrol dalam hal umur (p= 0,740), paritas (p=0,554), umur saat kawin (p=1,000). 14 Cermin Dunia Kedokteran No. 145, 2004

Tabel 1. Perbandingan beberapa variabel pengganggu antara kasus dan kontrol Variabel Umur: < 35 tahun ≥ 35 tahun Paritas: <5 ≥5 Umur kawin: < 20 tahun ≥ 20 tahun Kasus 6 (19,4%) 25 (80,6%) 29 (93,5%) 2 (6,5%) 4 (12,9%) 27 (87,1%) Kontrol 5 (16,1%) 26 (83,9%) 30 (96,8%) 1 (3,2%) 4 (12,9%) 27 (87,1%) P 0,740 0,554 1,000

Proporsi VHP tipe 16 dan 18, tipe 16, tipe 18 dan Population Attributable Risk (PAR) Pemeriksaan PCR terhadap 31 kasus LIS derajat tinggi dan 31 kontrol atas bahan yang diambil dari ekto dan endoserviks dengan menggunakan cytobrush mendapatkan hasil sebagai berikut (Tabel 2).
Tabel 2. Proporsi infeksi VHP 16 dan 18 pada kasus, kontrol dan PAR VHP 16,18 16 18 f (%) Kasus 22 (71,0%) 16 (51,6%) 17 (54,8%) Kontrol 10 (32,3%) 7 (22,6%) 6 (19,4%) PAR 0,76 0,63 0,67

Dari pemeriksaan PCR atas 31 LIS derajat tinggi, didapatkan VHP tipe 16,18 pada 22 kasus (71,0%), VHP tipe 16 pada 16 kasus (51%), VHP tipe 18 pada 17 kasus (54,8%). Sedangkan dari 31 kontrol ditemukan VHP tipe 16,18 pada 10 kasus (32,3%), VHP tipe 16 pada 7 kasus (22,6%), VHP tipe 18 pada 6 kasus (19,4%). Irmansyah F. melakukan pemeriksaan VHP dengan teknik Hybrid Capture Chemiluminescence (HCC) terhadap 49 kasus - 26 kasus dengan sitologi normal dan 23 kasus dengan sitologi abnormal; didapatkan 19,23% sitologi normal mengandung DNA VHP sedangkan yang dengan sitologi abnormal 52% mengandung DNA VHP. Kasus dengan LIS derajat rendah 45% mengandung VHP risiko tinggi 11% dengan VHP risiko rendah sedangkan LIS derajat tinggi 50% mengandung VHP risiko tinggi.(10) Adam E. dengan teknik PCR melaporkan dari 261 kasus CIN 2 dan CIN 3, 131 kasus (50,2%) mengandung VHP 16 dan 10 kasus (3,8%) mengandung VHP 18. Pada kontrol 24,5% mengandung VHP 16 dan 4,5% mengandung VHP 18 dengan p < 0.001.(11) Kjellberg et al. mendapatkan dari 57 kasus dengan sitologi CIN 2 dan CIN 3 kemudian dengan Cytobrush diambil bahan dari endoserviks untuk pemeriksaan PCR mendapatkan 55 kasus (96%) mengandung VHP, 24 kasus (44%) VHP tipe 16, 5 kasus (9%) dengan VHP tipe 18, 2 kasus (4%) dengan VHP tipe 33. Pada 12 kasus dengan sitologi normal 25% dengan VHP tipe 16 dan tidak ditemukan VHP tipe 18 dan VHP tipe 33.(6) Koutsky et al. dengan studi kohort dari 110 wanita dengan CIN 2 dan CIN 3 kemudian dibiopsi dan dilakukan pemeriksaan dengan Southern blot hybridization mendapatkan 49% dengan VHP 16 atau 18 dan melaporkan risiko menderita CIN 2 dan CIN 3, 11 kali (95% IK : 3,7 – 31) dibandingkan yang tidak terpapar VHP 16,18.(12) Becker melaporkan prevalensi VHP 93,8% dengan VHP tipe 16

sebesar 52,4% dengan RO 9,8 pada penderita dengan CIN 2 dan CIN 3.(8) Pada beberapa kepustakaan disebutkan di Indonesia lebih banyak didapatkan VHP 18 yaitu 50% dari VHP yang dapat diidentifikasi.(5,8,9) DNA VHP dapat dideteksi pada 10%-15% dari Pap smear yang normal.(13) Juga pada penelitian lain didapatkan 5%-40% DNA VHP pada wanita usia reproduksi.(14) Marrazzo JM melaporkan DNA VHP sebanyak 20% pada wanita dengan Pap smear normal.(7) Cox JT dengan teknik PCR melaporkan adanya DNA VHP pada 20% wanita normal.(15) Schneider et al. mendapatkan prevalensi DNA VHP tipe 16 pada wanita dengan sitologi normal 14%.(15) Dari uraian di atas tampak bahwa angka yang didapat pada penelitian ini tidak jauh berbeda. Secara teoritis sangat wajar bila VHP tipe onkogenik tipe 16 dan tipe 18 (khususnya di Indonesia) mempunyai risiko tinggi, apalagi bila kontak dengan VHP tipe 16 dan 18 terjadi pada masa di sekitar menars, saat maturasi sel belum sempurna. Zone transformasi (antara epitel skuamo-kolumner dengan skuamo-skuamosa) sangat sensitif terhadap rangsangan eksternal; sel-sel metaplasia ini dapat menjadi sel yang berpotensi ganas bila kontak dengan mutan seperti sperma, virus Herpes Simplex tipe-2, klamidia, virus Papova (termasuk di dalamnya semua VHP tipe onkogenik) dan bahan lain yang mengandung DNA pada saat fase aktif atau pada fase awal dari metaplasia. Kejadian tersebut disebut displasia. Paparan atau infeksi DNA-VHP terutama yang ditularkan lewat kontak seksual akan bermasalah bila mengenai zone transformasi serviks uteri. Infeksi VHP tipe 16 dan 18 dengan beberapa kofaktor seperti merokok, aktivitas seksual, keradangan serviks atau trauma, status imunitas dan umur dapat menyebabkan perubahan-perubahan proses maturasi sel dan dapat berkembang menjadi lesi intraepitel skuamosa serviks yang selanjutnya akan menjadi karsinoma serviks bila imunitas tubuh tidak mampu mengatasinya. Population Attributable Risk (PAR) pada infeksi VHP 16,18 adalah 0,76 ini berarti 76% penderita LIS derajat tinggi dapat dicegah bila faktor risiko infeksi VHP 16,18 dapat dihilangkan. PAR pada VHP 16 adalah 0,63 jadi proporsi LIS derajat tinggi dapat dicegah sebanyak 63% bila faktor risiko VHP 16 dapat dihilangkan. Dengan kata lain, dengan menghilangkan faktor risiko VHP 16 kita dapat mencegah proporsi LIS derajat tinggi sebanyak 63%. Untuk VHP 18 PARnya adalah 0,67 jadi bila infeksi VHP 18 dapat dihilangkan maka proporsi LIS derajat tinggi dapat dicegah sebanyak 67%. Dengan menghitung population attributable risk dapat diketahui berapa persen proporsi LIS derajat tinggi dapat dicegah dengan menghilangkan faktor risiko infeksi VHP tipe 16 dan 18. Dengan mengetahui besarnya PAR dapat membantu menentukan kebijakan, karena dengan menekan faktor risiko proporsi kasus dalam masyarakat dapat diturunkan. Upaya menurunkan insiden LIS dan karsinoma serviks telah dilakukan dengan membuat vaksin terhadap VHP. Upaya ini telah dilakukan sejak tahun 1997 dan saat ini telah memasuki fase ke-3. Harapan keberhasilannya didukung oleh beberapa hal yaitu; pertama, tidak diragukan lagi peran reaksi imun dalam mengontrol infeksi VHP. Kedua, ada bukti-bukti efektivitas vaksin pada uji coba dengan binatang ; patologi dan

natural history virus papiloma pada binatang menyerupai VHP. Dr Crum menyatakan suatu vaksin yang efektif terhadap lima VHP risiko tinggi akan mencegah sampai 85% karsinoma serviks.(16) Risiko LIS derajat tinggi pada infeksi VHP tipe 16,18 Pada studi ini dari 31 pasang sampel, 8 pasang positif DNA VHP 16,18 (kasus positif, kontrol positif), 7 pasang negatif DNA VHP 16,18 (kasus negatif, kontrol negatif), 2 pasang dengan kasus negatif DNA VHP 16,18 sedangkan pada kontrolnya positif, yang lainnya 14 pasang dengan kasus positif DNA VHP 16,18 sedangkan kontrolnya negatif. (tabel 3)
Tabel 3. Risiko LIS derajat tinggi pada infeksi VHP tipe 16,18 pada kasus dan kontrol Kasus VHP 16,18(+) VHP 16,18 (-) Total Keterangan: RO = 7 x2 = 7,5 (p = 0,04) Kontrol VHP 16,18 (+) VHP 16,18 (-) 8 2 10 14 7 21 22 9 31 To tal

Digunakan uji x2 untuk 2 kelompok yang berpasangan (matched individuals) yaitu uji McNemar untuk menguji kemaknaan perbedaan risiko LIS derajat tinggi antara kelompok yang terpapar dan tidak terpapar VHP. Pada perhitungan data di atas didapatkan rasio odds sebesar 7 (IK 95% : 1,16 – 42,15) dengan x2 = 7,5 dan p = 0,04. Jadi bila hipotesis 0 benar, kemungkinan untuk mendapatkan RO 7 adalah 4% dan kita percaya 95% bahwa besarnya risiko terjadinya LIS derajat tinggi pada populasi terletak antara 1,16 sampai 42,15 kali. Berarti penderita yang terinfeksi VHP 16,18 mempunyai risiko menderita LIS derajat tinggi 7 kali dibandingkan dengan yang tidak terinfeksi VHP 16,18 dan pada uji statistik bermakna. Risiko LIS derajat tinggi pada infeksi VHP tipe 16. Dari 31 pasang sampel, didapatkan 5 pasang positif DNA VHP tipe 16 (kasus dan kontrol positif), 11 pasang dengan DNA VHP 16 positif pada kasus sedangkan kontrolnya negatif. DNA VHP tipe 16 negatif pada kasus dan positif pada kontrol didapatkan sebanyak 2 pasang, sedangkan 13 pasang yang lain didapatkan DNA VHP tipe 16 negatif baik pada kasus dan kontrol. (Tabel 4).
Tabel 4. Risiko LIS derajat tinggi pada infeksi VHP tipe 16 pada kasus dan kontrol Kasus VHP 16 (+) VHP 16 (-) Total Keterangan: RO = 5,5 x2 = 4,9 (p= 0,02) Kontrol VHP 16 (+) VHP 16 (-) 5 11 2 13 7 24 Total 16 15 31

Cermin Dunia Kedokteran No. 145, 2004 15

Pada VHP tipe 16 didapatkan rasio odds sebesar 5,5 (IK 95% : 1,003 – 30,15) x2 = 4,9, p = 0,02. Jadi bila hipotesis 0 benar, kemungkinan untuk mendapatkan RO 5,5 adalah 2% dan kita percaya 95% bahwa besarnya risiko terjadinya LIS derajat tinggi pada populasi terletak antara 1,003 sampai 30,15 kali Jadi penderita dengan infeksi VHP tipe 16 mempunyai risiko 5,5 kali untuk menderita LIS derajat tinggi dibandingkan dengan yang tidak terinfeksi VHP tipe 16, dan bermakna pada uji statistik. Risiko LIS derajat tinggi pada infeksi VHP tipe 18 Pada Tabel 5 dapat dilihat dari 31 pasang sampel yang diperiksa DNA VHP 18nya, didapatkan 4 pasang positif DNA VHP 18 (kasus dan kontrol positif), 13 pasang positif DNA VHP 18 pada kasus sedang kontrolnya negatif, 2 pasang sampel dengan kasus negatif DNA VHP 18 sedang pada kontrol positif, 12 pasang sampel dengan DNA VHP negatif baik pada kasus maupun pada kontrol.
Tabel 5. Risiko LIS derajat tinggi pada infeksi VHP tipe 18 pada kasus dan kontrol Kasus VHP 18 (+) VHP 18 (-) Total Kontrol VHP 18 (+) VHP 18 (-) 4 13 2 12 6 25 Total 17 14 31

Saran Mengingat pengobatan lebih mahal dan lebih sulit, dan karena mencegah lebih baik daripada mengobati, maka yang terutama untuk menurunkan kejadian LIS derajat tinggi dan juga karsinoma serviks uteri adalah melakukan skrining teratur dalam jangka waktu tertentu. Yaitu dengan pemeriksaan Pap smear dan memeriksa VHP tipe 16 dan 18 dan jika mungkin pemeriksaan terhadap VHP tipe onkogenik lain. Juga perlu dilakukan komunikasi, informasi dan edukasi tentang faktorfaktor risiko. Cara ini diharapkan mampu menekan kejadian LIS derajat tinggi yang pada akhirnya juga kejadian karsinoma serviks. Perlu dilakukan penelitian dengan sampel yang lebih besar dan juga menentukan proporsi infeksi VHP pada LIS yang didiagnosis secara histopatologi untuk mendapatkan angka yang lebih representatif.

KEPUSTAKAAN 1. 2. 3. Hatch KD, Hacker NF. Intraepithelial disease of cervix, vagina, and vulva. In: Berek JS, Adashi EY, Hillard PA, eds. Novak’s Textbook of Gynecology. 12th ed. Baltimore : Williams and Wilkins, 1996; pp. 447-86. Sjamsuddin S. Inspeksi visual dengan aplikasi asam asetat (IVA). Suatu metode alternatif skrining kanker serviks. KOGI Xl, Denpasar, 2000. Wells M, Oslor AG, Crum CP, et al. Pathology and genetics of tumours of the breast and female genital organs, 2003; pp. 261-79. Wright TC, Kurman RJ, Ferenczy A. Precancerous lesions of the servix. In : Kurman RJ, ed. Blaustein,s pathology of the female genital tract, 4th ed. Berlin : Springer- Verlag, 1995; pp. 229-61. Blomfield PI, Garland S. Viral infections and cervical neoplasia. In : Luesley DM, Barrasso R, (eds.). Cancer and pre-cancer of the cervix, 1st ed. London : Chapman & Hall, 1998; pp. 133-52. Kjellberg L, Wiklund F, Sjoberg I. A population-based study of human papillomavirus deoxyribonucleic acid testing for predicting cervical intraepithelial neoplasia. Am J Obstet Gynecol.1998; 179 : 1497-502. Marrazzo JM, Stine K, Koutsky LA. Genital human papillomavirus infection in women who have sex with women. Am J Obstet Gynecol, 2000; 183 : 770-4. Bosch FX, Munoz N, Castellsague X. Epidemiology of cervical dysplasia and neoplasia. In : Luesley DM, Barrasso R, (eds.). Cancer and pre-cancer of the cervix, 1st ed. London : Chapman & Hall, 1998; pp. 51-76. Kaufman RH, Adam E, Vonka V. Human papillomavirus infection and cervical carcinoma. In : Pitkin RM, Scott JR, (eds.). Clinical Obstetrics and Gynecology. Philadelphia : Lippincott Williams & Wilkins, 2000; 43(2) : 368-93. Irmansyah F, Indarti J, Sianturi MHR. Hubungan antara infeksi HPV dengan kejadian LIS serviks dan karsinoma. Maj Obstet Ginekol Indones, 1998; 22 : 92-6. Adam E, Berkova Z, Daxnerova Z, et al. Papilloma virus: Demographic and behavioral chracteristics influencing the identification of cervical disease. Am J Obstet Gynecol, 2000; 182(2) : 257-64. Koutsky LA, Holmes KK, Critchlow CW, et al. A cohort study of risk of cervical intraepithepial neoplasia grade 2 or 3 in relation to papillomavirus infection. N Engl J Med, 1992; 327 : 1272-8. Reid R, Campion MJ. HPV-associated lesions of the cervix: biology and colposcopic features. In : Clinical Obstetrics and Gynecology, 1989; 32(1) : 157-79. Unger ER, Franco ED. Human papillomavirus. Obstetrics and Gynecology Clinics. Philadelphia : W.B. Saunders Company, 2001; 28(4) : 653-66. Cox JT. Epidemilogy of cervical intraepithelial neoplasia: the role of human papillomavirus. Bailliere’s Clin Obstet Gynaecol, 1995; 9: pp.1-37. Koutsky LA, Ault KA, Wheeler CM, et al. A controlled trial of a human papillomavirus type 16 vaccine. N Engl J Med, 2002; 347 : 1645-51.

Keterangan: RO = 6,5 x2 = 6,7 (p = 0,007)

4. 5. 6. 7. 8. 9.

Didapatkan rasio odds sebesar 6,5 (95% IK : 1,09 – 38,68) dengan x2 = 6,7, p = 0,007. Jadi bila hipotesis 0 benar, kemungkinan untuk mendapatkan RO 6,5 adalah 0,7% dan kita percaya 95% bahwa besarnya risiko terjadinya LIS derajat tinggi pada populasi terletak antara 1,09 sampai 38,68 kali. Ini berarti risiko LIS derajat tinggi pada penderita yang terinfeksi VHP tipe 18 6,5 kali dibandingkan yang tidak terinfeksi VHP tipe 18, dan bermakna pada uji statistik. Becker mendapatkan RO VHP 20,8 (95% IK : 10,8 – 40,2) sedangkan RO VHP tipe 16 sebesar 9,8 (95% IK : 5,4 – 18,3).(8) Adam E. mendapatkan RO untuk VHP risiko tinggi 3,35 (95% IK : 2,28 – 4,93) dengan p < 0 001.(11) SIMPULAN DAN SARAN Simpulan Proporsi infeksi virus human papiloma (VHP) tipe 16 dan 18 pada pasien LIS derajat tinggi di Poliklinik Kebidanan dan Penyakit Kandungan RSUP Denpasar adalah sebesar 71,0%, infeksi VHP tipe 16 pada LIS derajat tinggi sebesar 51,6%, dan infeksi VHP tipe 18 sebesar 54,8%. Risiko terjadinya LIS derajat tinggi pada infeksi VHP 16,18 adalah 7 kali (RO 7, IK 95%: 1,16 – 42,15, p = 0,04), pada infeksi VHP tipe 16 sebesar 5,5 kali (RO 5,5, IK 95%: 1.003 – 30,15, p = 0,02) , pada infeksi VHP tipe 18 sebesar 6,5 kali (RO 6,5, IK 95%: 1,09 – 38,69, p = 0,007) ; secara statistik bermakna dibandingkan dengan yang tidak terinfeksi VHP 16 dan 18. Bila infeksi ini dapat dihilangkan maka 76% LIS derajat tinggi pada penderita yang terinfeksi VHP tipe 16,18 dapat dicegah; 63% pada infeksi VHP tipe 16 dan 67% pada infeksi VHP tipe 18. 16 Cermin Dunia Kedokteran No. 145, 2004

10. 11. 12. 13. 14. 15. 16.

HASIL PENELITIAN

Korioamnionitis Histopatologik sebagai Risiko Persalinan Preterm di RS Sanglah Denpasar
K. Suardana*, A.A.N. Jaya Kusuma*, K. Suwiyoga*, A.A.A.N. Susraini**
*Bagian / SMF Obstetri dan Ginekologi Fakultas Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar **Bagian / SMF Patologi Anatomi Fakultas Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar

ABSTRAK Tujuan : Mengetahui peranan korioamnionitis histopatologik sebagai faktor risiko terjadinya persalinan preterm. Subyek dan cara kerja : Penelitian ini merupakan suatu studi kohort retrospektif, 27 sampel dengan paparan korioamnionitis dan 27 sampel lainnya tanpa paparan korioamnionitis. Penelitian dilakukan di kamar bersalin RS Sanglah Denpasar. Diagnosis korioamnionitis ditegakkan dengan pemeriksaan histopatologik. Hasil : Persalinan preterm terjadi pada 62,96 % kelompok dengan paparan korioamnionitis dan pada 22,22 % kelompok tanpa paparan korioamnionitis. Kejadian persalinan preterm pada kelompok dengan paparan korioamnionitis 2,83 kali lebih tinggi (RR 2,83, CI 95 %:2,33 – 4,96, χ2=9,16, p = 0,002). Sebanyak 47,78 % kejadian persalinan preterm dapat dicegah jika korioamnionitis dihilangkan. Kesimpulan : Risiko persalinan preterm pada wanita dengan korioamnionitis 2,83 kali lebih besar dibandingkan dengan wanita tanpa korioamnionitis. Kata kunci : Korioamnionitis histopatologik, persalinan preterm.

PENDAHULUAN Pada tahun-tahun belakangan ini, persalinan preterm menjadi perhatian utama dalam bidang obstetri; karena erat kaitannya dengan morbiditas dan mortalitas perinatal. Di Amerika Serikat angka kejadian persalinan preterm berkisar 6 – 10 % (1). Di Asia Tenggara sekitar 3 juta kasus setiap tahunnya sedangkan di Indonesia masih di atas 10%. (2). Di RSUP Denpasar angka kejadian persalinan preterm 7,44%

(1996), meningkat menjadi 8,65% antara Oktober 1997 sampai Januari 1999. (3). Persalinan preterm merupakan penyebab utama yaitu 6080% morbiditas dan mortalitas neonatal di seluruh dunia. Di RSUP Ciptomangunkusumo (1986) angka kematian perinatal adalah 70 per 1000 kelahiran hidup dan 73% dari seluruh kematian tersebut disebabkan oleh prematuritas. Di RS Kariadi (1995) angka kematian perinatal 44,7 per 1000 kelahiran Cermin Dunia Kedokteran No. 145, 2004 17

dengan penyebab utama prematuritas sebesar 40%. (3). Penyebab pasti persalinan preterm sampai saat ini belum diketahui. Beberapa keadaan yang dianggap sebagai faktor risiko persalinan preterm adalah ketuban pecah dini, infeksi cairan amnion, anomali hasil pembuahan, riwayat persalinan preterm sebelumnya atau abortus, overdistensi uterus, kematian janin, inkompetensi serviks, kelainan uterus, plasentasi yang salah, retensi IUD, kelainan medis pada ibu, induksi persalinan elektif, dan sebab-sebab yang tidak diketahui. (4,5) Beberapa tahun terakhir diduga ada hubungan antara persalinan preterm dengan korioamnionitis yaitu terjadinya invasi bakteri atau mikoplasma di selaput ketuban dan cairan amnion. Meskipun insidennya tidak diketahui namun makin banyak bukti menunjukkan bahwa mungkin sepertiga dari persalinan preterm berkaitan dengan korioamnionitis. (4,5,6). Masalahnya adalah tidak semua korioamnionitis manifes secara klinis, tetapi meskipun secara klinis belum muncul, hal ini sudah cukup untuk merangsang timbulnya prostaglandin yang menentukan terjadinya persalinan. Bobitt et al.(1981) mengaspirasi cairan amnion pada wanita yang mengalami persalinan preterm untuk dikultur; ternyata ditemukan mikroorganisme dan disebut sebagai korioamnionitis histopatologis pada 25% kasus; 75% wanita yang kulturnya positif tidak demam. (7). Penelitian Salafia et al. (1989) menunjukkan berbagai derajat korioamnionitis terjadi pada 4% persalinan aterm tanpa komplikasi ; 1,2% di antaranya korioamnionitis tanpa gejala klinis. Peneliti lain mendapatkan kejadian persalinan preterm pada korioamnionitis histopatologis 69,7%, dibandingkan pada non korioamnionitis histopatologis sebesar 22,6%.(8) BAHAN DAN CARA KERJA Rancangan penelitian ini adalah suatu studi kohort retrospektif. Sampelnya adalah ibu hamil dengan umur kehamilan 28 - 42 minggu yang datang bersalin ke RS Sanglah, yang memenuhi kriteria inklusi dan setuju diikutkan dalam penelitian. Korioamnionitis ditentukan melalui pemeriksaan histopatologik. Diambil masing - masing 27 sampel untuk kelompok dengan faktor risiko dan tanpa faktor risiko, selanjutnya ditelusuri seolah - olah secara prospektif apakah terjadi efek atau tidak. Data dikumpulkan kemudian ditabulasi dan diolah dengan komputer SPSS 10,0 dan dianalisis dengan menggunakan Chi Square ( χ2 ). HASIL DAN DISKUSI Penelitian dikerjakan di Kamar Bersalin Rumah Sakit Sanglah Denpasar mulai 18 Januari 2003 sampai dengan 29 Januari 2004. Selama kurun waktu tersebut berhasil dikumpulkan 61 sampel yang memenuhi kriteria dan setuju ikut dalam penelitian ini. Dari 61 sampel tersebut, setelah pemeriksaan histopatologik selaput ketuban dan plasenta didapatkan 34 sampel dengan tanda keradangan (korioamnionitis +) tetapi hanya 27 sampel pertama yang diambil, yang selanjutnya dijadikan kelompok dengan faktor risiko; dan 27 sampel tanpa tanda keradangan (korioamnionitis 18 Cermin Dunia Kedokteran No. 145, 2004

-) yang selanjutnya dijadikan kelompok tanpa faktor risiko. Uji Komparabilitas Sampel Sebelum melakukan analisis statistik terhadap variabel bebas yang dalam hal ini adalah paparan keradangan ( korioamnionitis ) yang diperkirakan mempengaruhi kejadian persalinan preterm ( variabel tergantung ), terlebih dahulu dilakukan uji komparabilitas terhadap berbagai variabel yang juga diperkirakan dapat mempengaruhi hasil penelitian ini antara lain adalah umur ibu, paritas, kadar hemoglobin dan jumlah leukosit dalam darah ibu.
Tabel 1. Uji t beberapa variabel pada kelompok dengan dan tanpa paparan korioamnionitis Variabel Umur Paritas Hemoglobin Leukosit Korioamnionitis (+) Rerata SD 24,00 0,33 11,93 13,75 3,94 0,48 1,10 4,43 Korioamnionitis (-) Rerata SD 25,63 0,56 11,88 12,43 4,17 0,58 1,16 3,09 T -1,48 -1,54 0,17 1,27 p 0,15* 0,13 * 0,87 * 0,21 *

Keterangan : * = tidak signifikan ; p > 0,05

Pada Tabel 1 tampak bahwa keempat variabel dari kedua kelompok tidak berbeda bermakna, sehingga pengaruh keempat variabel tersebut pada penelitian ini dapat diabaikan. Rerata kadar hemoglobin pada kelompok dengan paparan korioamnionitis adalah 11,93 + 1,10 g % dan pada kelompok tanpa paparan korioamnionitis adalah 11,88 + 1,16 g %. Dengan uji t, kadar rata – rata pada kelompok preterm (10,8 + 1,0 g % ) dan aterm (10,6 + 1,3 g %) tidak berbeda bermakna (t: 0,69 p: 0,50). Penelitian Abadi A (1999) yang mengaitkan kadar hemoglobin dengan persalinan preterm hasilnya secara statistik ( Chi Square ) juga tidak berbeda bermakna (X2.: 0,13 p: 0,72). Terdapat perbedaan rerata jumlah leukosit: di kelompok dengan paparan korioamnionitis adalah 13,75 + 4,43 k/uL sedangkan di kelompok tanpa paparan korioamnionitis adalah 12,43 + 3,09 k/uL; sedangkan jumlah leukosit normal pada ibu hamil berkisar antara 5 – 12 k/uL. (Cunningham et al., 1993). Namun perbedaan tersebut tidak bermakna (uji t: t: 1,29 p:0,21), sehingga jumlah leukosit tidak bisa dipakai sebagai petanda laboratorik adanya korioamnionitis. Nilai batas untuk ibu hamil dengan infeksi dalam rahim (intrauterin) yang sudah menunjukkan gejala klinis adalah 15 k/uL (Gibbs, 1993). Abadi A (1999) menemukan perbedaan bermakna (p: 0,01) dari rerata jumlah leukosit kelompok persalinan preterm (13.671,0 + 5009,14 /ml) dan kelompok persalinan aterm (10.805,5 + 2694,00 /ml). Dengan menggunakan kurva ROC ditemukan nilai batas jumlah leukosit 11500 /ml yang bisa dipakai untuk meramalkan kejadian persalinan preterm {RR 2,16 ( CI 95 % 1,14 – 4,08, sensitivitas 70 %,spesifisitas 65 %, nilai prediktif positif 75 %}. Begitu juga halnya dengan penemuan Yoon dkk.: untuk lebih meyakinkan apakah jumlah leukosit memang mempunyai hubungan dengan paparan keradangan selaput ketuban dan plasenta dilakukan analisis

dengan uji korelasi Pearson, hasilnya ditemukan hubungan yang bermakna ( p < 0,05 ). Temuan ini mempunyai nilai yang sangat berarti karena jumlah sel leukosit ibu dengan nilai batas 11.500 sel/ml sebagai petanda laboratorik bisa segera dan mudah diperiksa, serta dengan biaya yang relatif murah. Kejadian Persalinan Preterm pada Korioamnionitis Histopatologik. Pada penelitian ini kejadian persalinan preterm pada kelompok terpapar korioamnionitis sebanyak 17 dari 27 sampel (62,96 %) sedangkan pada kelompok tidak terpapar korioamnionitis sebanyak 6 dari 27 sampel (22,22 %). Peneliti lain menemukan angka kejadian korioamnionitis (histopatologik ) pada persalinan preterm bervariasi mulai dari 66 % hingga 88 % (Tabel 2) . (9)
Tabel 2. Angka kejadian korioamnionitis (histopatologik) pada persalinan preterm. Penulis Cherouny et al Greig et al Yoon et al Abadi dkk Tahun 1992 1993 1995 1998a Angka kejadian 82 % 88 % 66 % 71,4 %

Angka kejadian korioamnionitis (histopatologik ) pada persalinan aterm dapat dilihat pada tabel 3. (9)
Tabel 3. Angka kejadian korioamnionitis (histopatologik) pada persalinan aterm. Penulis Patkul et al Hillier et al Greig et al Abadi dkk Tahun 1985 1988 1993 1998a Angka kejadian 22 % 21 % 23,66 % 39,34 %

Untuk mengetahui pengaruh korioamnionitis histopatologik terhadap kejadian persalinan preterm, dilakukan uji statistik Chi square (Tabel 4).
Tabel 4. Hasil uji χ2 persalinan histopatologik. n 17 6 preterm dan korioamnionitis Aterm n 10 21 % 37,04 77,78

Faktor Risiko Korioamnionitis ( + ) Korioamnionitis ( - )

Preterm % 62,96 22,22

menemukan bahwa 81,3 % kasus yang menunjukkan tanda keradangan selaput ketuban secara histopatologi (tingkat I atau lebih menurut kriteria Salafia) mengalami persalinan preterm sedangkan 76,9 % kasus dengan tanda keradangan plasenta berakhir dengan persalinan preterm. Dari hasil tersebut bisa disimpulkan bahwa kejadian proses keradangan selaput ketuban dan plasenta pada persalinan preterm dan pada persalinan aterm berbeda bermakna. Apabila ditinjau dari tingkat keradangan selaput ketuban dan plasenta yakni negatif (tidak ada tanda keradangan), ringan (tingkat I) dan berat (tingkat 2-4) dihubungkan dengan hasil persalinan (analisis Chi square dengan CI 95 %), radang ringan tidak mempunyai pengaruh yang bermakna terhadap proses persalinan preterm (p > 0,05); hanya radang berat yang berpengaruh secara bermakna terhadap terjadinya persalinan preterm (p < 0,05). Sehingga dapat dikatakan makin tinggi tingkat keradangan selaput ketuban dan plasenta akan makin besar risiko persalinan preterm. Dengan analisis lebih lanjut bisa disimpulkan bahwa pada keradangan selaput ketuban risiko persalinan preterm 4 kali (RR: 3,66 CI 95 % 1,52 – 8,82), sedangkan pada keradangan plasenta risikonya 2 kali lebih tinggi (RR: 1,85 CI 95 % 1,10 – 3,10) dibanding dengan tanpa keradangan. (9) Guzick, et al. (1985) dalam penelitian prospektif terhadap 2774 wanita, mendapatkan korioamnionitis secara histologis lebih sering ditemukan pada persalinan preterm (32, 8 %) dibandingkan dengan persalinan aterm (10 %). (1) Di Medan Candra S, dkk (1998) dalam penelitiannya mendapatkan kejadian persalinan preterm pada korioamnionitis histopatologis (69,7 %) dibandingkan pada non korioamnionitis histopatologis (22,6 %).(8) Greig PC, et al. (1993) melaporkan korioamnionitis histologik pada 21 dari 24 (88 %) kasus persalinan preterm gagal tokolitik dan pada 28 dari 120 (23 %) kontrol yang mengalami persalinan aterm. Juga 10 dari 57 (18 %) pada kelompok persalinan preterm kultur cairan amnionnya positif , sedangkan pada 201 kontrol semuanya negatif.(10) Untuk menghitung besarnya kejadian persalinan preterm yang dapat dicegah dengan menghilangkan faktor risiko paparan korioamnionitis, digunakan PAR. Pada penelitian ini proporsi korioamnionitis sebesar : 50 % dan relative risk sebesar 2,83; dari angka – angka tersebut PAR dapat dihitung dan hasilnya adalah 47,78 %. Dengan demikian jika korioamnionitis histopatologik dapat dihilangkan, 47,78 % persalinan preterm akan dapat dicegah. SIMPULAN DAN SARAN Simpulan Risiko kejadian persalinan preterm pada korioamnionitis histopatologik adalah 2,83 kali lebih tinggi dibandingkan dengan jika tanpa korioamnionitis histopatologik. Risiko persalinan preterm dapat diturunkan 47,78 % jika faktor risiko korioamnionitis dihilangkan. Saran Untuk mengurangi kejadian, morbiditas ataupun mortalitas akibat persalinan preterm dapat dipertimbangkan Cermin Dunia Kedokteran No. 145, 2004 19

Keterangan : * = berarti signifikan (p < 0,05) RR : Relative Risk. χ2 = 9,16 RR = 2,83

Tabel 4 menunjukkan bahwa ada atau tidaknya tanda keradangan selaput ketuban dan plasenta menyebabkan perbedaan yang bermakna antara kedua kelompok yang diteliti ( X2 : 9,16 p : 0,002 ) dengan relative risk 2.83; (CI 95%: 2,33 – 4,96 ). Artinya di kelompok yang terpapar faktor risiko (korioamnionitis +), risiko persalinan preterm 2,83 kali dibandingkan dengan kelompok tanpa faktor risiko (korioamnionitis -). Abadi A. (1999) pada penelitian kohort terhadap 50 kasus

pemberian antibiotika yang adekuat pada ibu hamil yang mengalami ancaman persalinan preterm.

KEPUSTAKAAN 1. 2. 3. 4. Kipikasa J, Bolognece RJ. Obstetrics management of prematurity. In : Funaroff A, Amartin RS. (eds). Neonatal perinatal medicine. 6th ed. St Louis : Mosby Year book, 1997. 264 – 9. Abadi A. Kontroversi dalam pengelolaan persalinan kurang bulan. Divisi Kedokteran Fetomaternal Lab.SMF.Kebidanan dan Kandungan FK UNAIR RSUD Dr. Soetomo Surabaya. 2000. Ardhana Ketut. Perbandingan efektifitas Magnesium Sulfat dan Ritodrine untuk menghambat proses persalinan prematur di RSUP Denpasar, Bagian/SMF Obstetri dan Ginekologi FK UNUD RSUP Denpasar. 1999. Cunningham, McDonald, Gant. Williams Obstetrics. 20th (eds).

Connecticutt: Appleton and Lange, 1997:797 – 821. Goodwin TM. Preterm Labor : Background and prevention. In : Mishell DR , Brenner PF. (eds). Management of common problems in obstetrics and gynecology. 3rd eds. Boston: Blackwell Scient. Publ.1994; pp. 97 – 9. 6. Shaver DC. Premature Labor and Delivery. In : Shaver DC, Phellan ST, Beckmenn CRB, Ling FW, (eds). Clinical Manual of Obstetrics. 2nd ed, Singapore : McGraw-Hill, 1993; pp.281 – 92. 7. Benirschke K. Pathology of human placenta. 3rd. ed. New York: SpringerVerlag, 1995; pp.14 – 55. 8. Candra Syafei dkk. Hubungan Khorioamnionitis dengan Persalinan Preterm, Bagian/SMF Obstetri dan Ginekologi FK USU RSHAM-RSP Medan. 1998. 9. Abadi A. Radang selaput ketuban dan plasenta serta interleukin-6 dalam air ketuban sebagai faktor penentu terjadinya persalinan pada persalinan kurang bulan membakat. Program Pasca Sarjana Universitas Airlangga Surabaya. 1999. 10. Greig PC et al. Amniotic fluid interleukin-6 levels correlate with histologic chorioamnionitis and amniotic fluid cultures in patients in premature labor with intact membranes. Am J Obstet Gynecol 1993;169 (4):1035 – 44. 5.

A friend’s eye is a good looking-glass.

20 Cermin Dunia Kedokteran No. 145, 2004

HASIL PENELITIAN

Risiko Ancaman Persalinan Preterm pada Infeksi Chlamydia trachomatis
A.A.N.M.A. Putra Wirawan*, A.A.N. Jaya Kusuma*, D.M. Sukrama**, M. Dharmadi*** *Bagian Ilmu Kebidanan dan Penyakit Kandungan Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar ** Bagian Ilmu Farmakologi Kedokteran Universitas Udayana / Rumah Sakit Sanglah Denpasar *** Bagian Ilmu Kesehatan Masyarakat Kedokteran Universitas Udayana

ABSTRAK Tujuan : Mengetahui besarnya risiko ancaman persalinan preterm pada wanita hamil dengan infeksi Chlamydia trachomatis. Bahan dan Cara : Penelitian ini merupakan suatu studi kasus-kontrol. Dari 40 sampel yang memenuhi kriteria inklusi, 20 sampel masuk dalam kelompok kasus dan 20 sampel masuk dalam kelompok kontrol. Sampel diambil di Kamar Bersalin dan di Poliklinik Kebidanan dan Penyakit Kandungan. Pada kedua kelompok dilakukan pengambilan swab endoserviks kemudian dilakukan pemeriksaan PCR untuk mengetahui adanya bakteri Chlamydia trachomatis. Hasil : Infeksi Chlamydia trachomatis didapatkan pada 80,00 % kelompok kasus, sedangkan pada kelompok kontrol sebanyak 25,00 % . Secara stastistik kejadian infeksi pada kelompok kasus lebih tinggi secara bermakna bila dibandingkan dengan kelompok kontrol ( p=0,001; rasio odds 12,00; 95 % IK:2,70 – 53,33). Simpulan : Risiko ancaman persalinan preterm pada wanita hamil dengan infeksi Chlamydia trachomatis 12,00 kali lebih besar dibandingkan dengan wanita yang tidak menderita infeksi Chlamydia trachomatis. Risiko tersebut secara statistik bermakna. Saran : Swab endoserviks dan pemeriksaan PCR sebaiknya dikerjakan pada kasus wanita hamil dengan ancaman persalinan preterm. Kata Kunci : Infeksi Chlamydia trachomatis, ancaman persalinan preterm,PCR

PENDAHULUAN Persalinan preterm masih merupakan masalah perinatologi karena baik di negara berkembang maupun negara maju penyebab morbiditas dan mortalitas neonatus yang terbanyak adalah bayi yang lahir prematur.1 Angka kejadian persalinan preterm sangat bervariasi. Di Amerika (1981 – 1989) didapatkan 9 – 11%.2 Di Kalifornia (1996) sebesar 7,4%.3 Di Indonesia berkisar antara 10 – 20% dan di bagian Obstetri dan Ginekologi RS Sanglah Denpasar (1999) didapatkan sebesar 17,1%. Ardhana dalam penelitiannya di RSUP Denpasar (1998) mendapatkan angka 8,65%.4

Dewasa ini kekerapan infeksi Chlamydia trachomatis yang merupakan penyakit akibat hubungan seksual makin tinggi. Prevalensi infeksi Chlamydia trachomatis pada serviks wanita hamil antara 2 – 37%.5 Infeksi serviks oleh Chlamydia trachomatis yang laten merupakan predisposisi untuk hasil akhir kehamilan yang jelek, salah satunya disebabkan oleh korioamnionitis asenden. Ditemukan banyak bukti yang memperlihatkan bahwa paling tidak sepertiga wanita dengan persalinan preterm mengalami korioamnionitis tersembunyi.6 Angka kejadian infeksi Chlamydia trachomatis yang menyebabkan persalinan preterm bervariasi.6 Marti dkk. (1982) melaporkan peningkatan angka mortalitas perinatal Cermin Dunia Kedokteran No. 145, 2004 21

sebanyak sepuluh kali lipat dan peningkatan angka kelahiran preterm sebanyak lima kali lipat pada sekelompok wanita hamil yang ditemukan tanda positif untuk infeksi Chlamydia trachomatis pada awal kehamilan.6 Sweet dkk. (1987) mendapatkan bahwa wanita dengan bukti infeksi Chlamydia trachomatis yang baru terjadi lebih cenderung mengalami persalinan preterm.6 Umenai T. (1999) mendapatkan infeksi Chlamydia trachomatis pada wanita hamil sebesar 24,5%.7 Paul VK. (1999) melaporkan prevalensi infeksi Chlamydia trachomatis pada kehamilan pertengahan adalah 17%.8 Ngassa PC. (1994) pada penelitiannya di Kamerun mendapatkan nilai odd ratio 2,8 ( 95% C.I. 1.13-6.97 ) pada wanita hamil yang terinfeksi Chlamydia trachomatis.9 Shenoy (2002) melakukan apusan serviks terhadap 450 wanita hamil, 70 wanita ( 15%) positif untuk antigen Chlamydia trachomatis, sebagian besar (89,1%) usianya di bawah 30 tahun. Dari 98 persalinan preterm, 42 kasus (42,8%) positif terinfeksi Chlamydia trachomatis.10 Ville Y. (1997) mendapatkan 20 dari 89 wanita hamil preterm (23%) positif terinfeksi Chlamydia trachomatis.11 Data tersebut merangsang beberapa pakar peneliti untuk menyelidiki manfaat pemberian antibiotika kepada ibu hamil yang mengalami ancaman persalinan preterm untuk dapat memperpanjang kehamilan.6 BAHAN DAN CARA KERJA Rancangan penelitian ini adalah studi kasus – kontrol. Berdasarkan perhitungan statistik diperlukan 40 pasien untuk sampel penelitian ( 20 wanita hamil dengan ancaman persalinan preterm sebagai kasus dan 20 wanita hamil preterm tanpa ancaman persalinan preterm sebagai kontrol ). Terhadap subyek penelitian yang memenuhi kriteria inklusi dilakukan pemeriksaan hapusan/swab pada endoserviks sedalam satu sentimeter. Bahan tersebut dimasukkan ke dalam tabung berisi cairan fisiologis. Kemudian dilakukan pemeriksaan PCR DNA Chlamydia trachomatis di Laboratorium Biomedik RSU Mataram. Data disajikan dalam bentuk tabel dan dilakukan uji chi square. HASIL DAN DISKUSI Penelitian dikerjakan di Poliklinik Kebidanan dan Penyakit Kandungan serta di Kamar Bersalin dari 1 Januari 2003 sampai dengan 30 Mei 2003. Selama kurun waktu tersebut berhasil didapat 40 sampel yang memenuhi kriteria inklusi dan setuju ikut serta dalam penelitian ini. Dari 40 sampel tersebut, 20 sampel termasuk dalam kelompok kasus (dengan ancaman persalinan preterm). Sedangkan 20 sampel sisanya merupakan kelompok kontrol (tanpa ancaman persalinan preterm). Sebelum melakukan analisis statistik terhadap variabel Chlamydia trachomatis yang merupakan kuman utama penelitian ini, terlebih dahulu dilakukan uji komparabilitas sampel antara kelompok kasus dan kelompok kontrol; berbagai variabel yang diperkirakan dapat mempengaruhi hasil penelitian pada kedua kelompok, dibandingkan dengan menggunakan uji t untuk variabel hemoglobin, dan Fisher’s Exact test untuk variabel leukosit urine dan bakteriuria pada kedua kelompok yang dibandingkan (Tabel 1, 2, 3). 22 Cermin Dunia Kedokteran No. 145, 2004

Tabel 1. Uji t variabel hemoglobin pada kelompok kasus dan kontrol Kelompok Kasus Rerata SD 11,49 0,90 Kelompok Kontrol Rerata SD 11,10 0,52

Variabel Hemoglobin ( gr / % )

T 1,65

P 0,11 (TS*)

Keterangan : TS* = tidak signifikan ; p>0,05

Hemoglobin. Pada penelitian ini rerata kadar hemoglobin pada kelompok kasus 11,49 ± 0.90 g %. Sedangkan rerata kadar hemoglobin pada kelompok kontrol adalah 11,10 ± 0,52 g % (nilai t = 1,65 dan p = 0,11; 95 % IK : - 8,76 – 0,86). Pada keadaan defisiensi besi yang pertama kali mengalami penurunan adalah serum ferritin sebelum penurunan serum besi. Penurunan konsentrasi hemoglobin terjadi paling akhir; pada keadaan ini red cell mean cell volume juga akan mengalami penurunan yang merupakan indikasi pertama pada wanita hamil dengan defisiensi besi. Hal ini akan mempengaruhi sintesis hemoglobin, juga berpengaruh pada ikatan besi dengan enzim besi (iron defendant enzym) yang bermanifestasi pada setiap sel. Keadaan ini pada akhirnya akan mempengaruhi fungsi tubuh seperti gangguan fungsi otot, aktifitas neurotransmiter, kelelahan, proses epitelisasi dan gangguan fungsi gastrointestinal.12 Defisiensi besi dapat menyebabkan berbagai efek pada fungsi sel, hal ini mungkin dapat menjelaskan hubungan antara defisiensi besi selama kehamilan dengan persalinan preterm.12 Pada penelitian ini tidak dilakukan pemeriksaan serum ferritin untuk mengetahui tanda-tanda awal adanya defisiensi besi, pemeriksaan hemoglobin hanya dilakukan pada saat kasus dan kontrol datang untuk melakukan pemeriksaan dan memenuhi kriteria inklusi.
Tabel 2. Fisher’s Exact Test variabel leukosit urine pada kelompok kasus dan kontrol
Kelompok Kasus Variabel N Leukosit Urine > 5/lpb Leukosit Urine 1 – 4 /lpb TOTAL 2 18 20 % 10,0 90,0 100,0 Kelompok Kontrol N % 0 20 20 0 100,0 100,0 2,11 *) 0,49 X2 p

Keterangan : Fisher’s Exact Test

Kadar Leukosit Urine. Jumlah leukosit urine pada penelitian ini juga tidak berbeda bermakna (Tabel 2) sehingga pengaruh variabel kadar leukosit urine dalam penelitian dapat diabaikan. Adanya leukosit dalam urine tidak memastikan adanya ISK dan tidak adanya leukosit dalam urine juga tidak memastikan tidak ada ISK.13,14 Bakteriuria. Kasus bakteriuria pada penelitian ini tidak berbeda bermakna sehingga pengaruh variabel bakteriuria dalam

penelitian ini dapat diabaikan. (Tabel 3). Bakteriuria asimtomatis adalah didapatkannya 100.000 atau lebih satu spesies kuman dalam 1 ml urine tanpa gejala khas. Pada pemeriksaan mikroskopis urine yang dikerjakan dengan baik yaitu : volume 10 ml, porsi tengah, diputar 2000 putaran per menit selama 5 menit dan endapan disuspensi kembali dengan 0,5 ml urine, maka adanya lebih 5 leukosit tiap lapang pandang menunjukkan adanya ISK. Meskipun demikian sudah lama diketahui bahwa tidak semua bakteriuri disertai leukosuri, dan tidak semua leukosuri disertai bakteriuri.13
Tabel 3. Fisher’s Exact Test variabel bakteriuria pada kelompok kasus dan kontrol Variabel Bakteriuria Positif Bakteriuria Negatif TOTAL Kelompok Kasus N % 4 20,0 16 20 80,0 100,0 Kelompok Kontrol N % 3 15,0 17 20 85,0 100,0 X2 p

1,42

*) 1,00

Keterangan : Fisher’s Exact Test

LUARAN UTAMA Diagnosis infeksi Chlamydia trachomatis pada penelitian ini ditentukan melalui pemeriksaan PCR. Sampel dinyatakan menderita infeksi Chlamydia trachomatis jika pada pemeriksaan PCR dijumpai kuman Chlamydia trachomatis (Ct +). Sebaliknya tidak menderita infeksi Chlamydia trachomatis, bila pada pemeriksaan PCR kuman Chlamydia trachomatis negatif (Ct -). Proporsi Infeksi Chlamydia trachomatis Pada kelompok kasus didapatkan 16 dari 20 sampel (80,00%) menderita infeksi Chlamydia trachomatis (Ct +); sedangkan pada kelompok kontrol 5 dari 20 sampel (25,00%) menderita infeksi Chlamydia trachomatis (Ct +). Secara keseluruhan dari 40 sampel kelompok kasus dan kelompok kontrol didapat 21 (16 + 5) – 40% kasus infeksi Chlamydia trachomatis (Ct+); proporsi infeksi Chlamydia trachomatis di kelompok kasus lebih tinggi daripada di kelompok kontrol (Tabel 4).
Tabel 4. Proporsi, Uji X2, dan rasio odds pada kelompok kasus dan kontrol.
Variabel Ct + Ct TOTAL Kelompok Kasus Jml % 16 4 20 80.00 20,00 100,0 Kelompok Kontrol Jml % 5 15 20 25,00 75,00 100,0 X2 21(52,50) 19 (47,50) 40 (100,00) P X2 = 12,13 P=0,001(S*) RO = 12,00

Keterangan : S* berarti signifikan (P<0,05) RO : Rasio Odds

Untuk mengetahui perbedaan kejadian infeksi Chlamydia trachomatis pada kelompok kasus dan kelompok kontrol dilakukan uji statistik Chi Square. Seperti telah diketahui kejadian infeksi Chlamydia trachomatis pada kelompok kasus

adalah sebesar 80,00 %. Sedangkan kejadian infeksi Chlamydia trachomatis pada kelompok kontrol adalah sebesar 25,00 %. Analisis statistik dengan uji Chi square menghasilkan X2 : 12,13 dan p= 0,001; 95 % IK : 2,70 – 53,33 (p < 0,05). Dengan demikian dapat disimpulkan bahwa risiko ancaman persalinan preterm pada infeksi Chlamydia trachomatis berbeda bermakna dengan yang tidak terinfeksi Chlamydia trachomatis . Untuk mengetahui risiko ancaman persalinan preterm pada pasien dengan infeksi Chlamydia trachomatis dihitung rasio odds (Tabel 4). Ternyata paparan infeksi Chlamydia trachomatis dapat meningkatkan risiko ancaman persalinan preterm 12,00 kali dibandingkan dengan tanpa paparan infeksi Chlamydia trachomatis ( 95 % IK : 2,70 – 53,33). Infeksi serviks oleh Chlamydia trachomatis merupakan akhir kehamilan yang jelek. Kejadian ini disebabkan oleh korioamnionitis yang asenden. Ditemukan banyak bukti bahwa paling tidak sepertiga wanita dengan persalinan preterm mengalami korioamnionitis yang tersembunyi. Adanya infeksi akan menimbulkan respon leukosit polimorfonuklear dan diikuti oleh infiltrasi limfosit, makrofag dan plasma sel ke dalam jaringan.6 Infeksi oleh kuman Chlamydia trachomatis akan mengeluarkan LPS yang akan meningkatkan produksi prostaglandin melalui makrofag amnion, desidua. Infeksi ini akan mengaktifkan makrofag sehingga menghasilkan sitokin (agen bioaktif) yang terdiri dari interleukin 1 (Il-1), interleukin 6 (Il-6), interleukin 8 (Il-8), tumor necrotic factor (TNF), platelet activity factor (PAF), dan colony stimulating factor (CSF).15 Interleukin 1 (Il-1) merangsang produksi prostaglandin lewat amnion dan desidua. TNF diproduksi oleh desidua akibat aktifitas makrofag akibat infeksi Chlamydia trachomatis yang juga akan merangsang produksi prostaglandin. Jadi pengeluaran sitokin ini akan merangsang pelepasan prostaglandin dari asam arakhidonat. Mekanisme ini berpotensi memicu persalinan karena menyebabkan kontraksi miometrium.15,16 Penelitian ini dilakukan untuk mengetahui besarnya peranan infeksi Chlamydia trachomatis sebagai faktor risiko ancaman persalinan preterm. Penelitian kami mendapat 16/20 (80,00 %) ancaman persalinan preterm dengan infeksi Chlamydia trachomatis. Pada penelitian Shenoy S. dkk. (2000) dari bulan Juli 1995 sampai dengan Mei 1997, dari 450 wanita hamil yang menjalani pemeriksaan swab serviks, 70 wanita (15,00 %) positif untuk antigen Chlamydia trachomatis. Dan dari 450 wanita hamil tersebut 98 kasus dengan persalinan preterm; 42 kasus di antaranya (42,80 %) positif terinfeksi Chlamydia trachomatis.10 Persamaan penelitian kami dengan Shenoy S adalah dalam hal teknik pengambilan sampel, namun berbeda cara pemeriksaannya; penelitian kami menggunakan PCR untuk mendeteksi DNA Chlamydia trachomatis sedangkan Shenoy S mendeteksi antigen Chlamydia trachomatis dengan tehnik immuno fluoresensi. Osborne dkk. (1998) melaporkan prevalensi infeksi Chlamydia trachomatis pada wanita hamil sebesar 34,40 % dengan pemeriksaan Indirect Immunoperoxidase.10 Ngassa PC dkk. ( 1994 ) meneliti 126 wanita dengan umur kehamilan 28 – Cermin Dunia Kedokteran No. 145, 2004 23

34 minggu dengan melakukan pemeriksaan serologis dan kultur swab serviks, mendapatkan rasio odds persalinan preterm oleh infeksi Chlamydia trachomatis genital sebesar 72,59 (exact 95 % CI : 0,99 – 7,14 ) ; O.R MH ( Mantel Haenszel ) 2,80 ( appr. 95 % CI: 1,13 – 6,97 ). Proporsi wanita dengan Chlamydia trachomatis positif pada swab serviks antara kasus dan kontrol berbeda bermakna ( Fisher’s exact test p = 0,02 ).9 Ada persamaan dalam hal pengambilan sampel, sedangkan Ngassa menggunakan pemeriksaan serologis dan kultur. Odds ratio baik pada penelitian kami maupun Ngassa secara statistik berbeda bermakna. Claman P dkk. ( 1995 ) mendapatkan 21/103 (20 %) wanita hamil seropositif untuk antibodi Ig G Chlamydia trachomatis. Persalinan preterm di kalangan wanita seropositif lebih banyak dibandingkan di kalangan wanita seronegatif ( 24 % [5/21] vs. 7 % [ 6/82 ] p = 0,029, odds ratio 3,96, 95 % CI : 1,08 – 14,27 ).17 Villy Y dkk. (1997) melakukan swab endoserviks terhadap 89 wanita hamil dengan umur kehamilan dari 18 - 36 minggu ( rata – rata 27 minggu ) dan dikonfirmasi dengan pemeriksaan ultrasonografi. Kemudian dilakukan pemeriksaan PCR untuk Chlamydia trachomatis menggunakan primer cryptic plasmid yaitu:
primer 1 :5’TCTTTCATCTCATTACCA3, dan primer 2:5’ CAATCTGCTCGTGAAAAAAGTACTAAC3’.

bila faktor risiko infeksi Chlamydia trachomatis dihilangkan maka dapat mencegah kasus ancaman persalinan preterm sebanyak 85.52 %. Tujuan yang paling penting dari strategi pencegahan infeksi Chlamydia trachomatis adalah mencegah penularan termasuk pencegahan infeksi perinatal. Strategi pencegahannya yaitu : 19 • Perubahan perilaku yang mengurangi risiko terjadinya atau penularan infeksi Chlamydia trachomatis, misalnya : tidak berganti – ganti pasangan seks, menyeleksi pasangan seks, menggunakan alat kontrasepsi ( kondom ) • Mengidentifikasi dan mengobati penderita infeksi Chlamydia trachomatis, sebelum mereka menularkan kepada pasangan seksnya, dan untuk wanita hamil sebelum mereka menularkan pada bayinya. Upaya mendeteksi infeksi Chlamydia trachomatis adalah sangat penting untuk mencegah penularan. Identifikasi dan pengobatan infeksi Chlamydia trachomatis membutuhkan skrining yang aktif karena baik pada wanita maupun laki-laki biasanya tidak menunjukkan gejala. Pada wanita hamil sebaiknya dilakukan skrining untuk Chlamydia trachomatis pada trimester ke dua sehingga dapat diobati dengan pemberian antibiotika. 18,19 SIMPULAN DAN SARAN Simpulan • Risiko ancaman persalinan preterm pada infeksi Chlamydia trachomatis 12,00 kali lebih besar dibandingkan dengan pasien tanpa infeksi Chlamydia trachomatis. • Proporsi infeksi Chlamydia trachomatis pada penderita dengan ancaman persalinan preterm adalah 16/20 (80,00 %), lebih besar dibandingkan dengan kejadian pada penderita tanpa ancaman persalinan preterm (5/20 25,00%), dan secara statistik berbeda bermakna (p=0,001) • Risiko ancaman persalian preterm dapat diturunkan 85,52% bila infeksi Chlamydia trachomatis dapat dicegah. Saran • Perlu dilakukan pemeriksaan swab endoserviks pada wanita hamil yang melakukan perawatan antenatal di poliklinik Obstetri Rumah Sakit Sanglah Denpasar untuk mendiagnosis dini infeksi Chlamydia trachomatis sehingga dapat mengurangi risiko ancaman persalinan preterm dengan memberikan antibiotika.
KEPUSTAKAAN 1. 2. 3. Godwin TM. Preterm labor; background and prevention. In: Mishell DR. Brenner PF, eds. Management of common problem in Obstetric and Gynecology 3rd (eds). Blackwell Scient. Publ. 1994; 97 – 107. Creasy R. Preterm birth prevention: Where are we. Am J. Obstet. Gynecol. 1993; 168 : 1223 – 30. Greenhagen JB et al. Value of fetal fibroectin as a predictor of preterm delivery for a low risk population. Am. J. Obstet Gynecol. 1996; 175: 1045 – 6.

Didapatkan amplifikasi DNA Chlamydia trachomatis positif pada 20/89 (23,00 %) swab endoserviks ancaman persalinan preterm.11. Penelitian ini mempunyai persamaan dengan penelitian kami dalam hal pengambilan bahan sampel dengan cara swab/hapusan endoserviks, pemeriksaan PCR untuk deteksi DNA Chlamydia trachomatis, dan cara interpretasi dengan mendapatkan amplifikasi DNA Chlamydia trachomatis pada swab endoserviks. Rastogi dkk. (1999 ) melakukan penelitian kohort terhadap 122 wanita hamil yang datang ke klinik antenatal untuk menentukan prevalensi infeksi Chlamydia trachomatis genital. Dilakukan swab endoserviks pada wanita dengan kehamilan lebih dari 12 minggu, kemudian dikultur. Didapatkan infeksi Chlamydia trachomatis pada 21,30 %. Kemudian 87 wanita hamil diikuti persalinannya di rumah sakit; didapatkan peningkatan insiden lahir mati, prematur dan berat badan lahir rendah pada wanita hamil yang positif terinfeksi Chlamydia trachomatis ( 16,6 % vs 5,7 % , 26,6 % vs 18,4 % , 26,6 % vs 23,0 %), yang bermakna secara statistik ( p < 0.5 , p < 0.5 , p < 0.05 ).18 Perbedaan penelitian Rastogi dengan kami adalah dalam hal rancangan penelitian; mereka menggunakan rancangan kohort, sedangkan penelitian kami menggunakan rancangan kasus – kontrol; juga berbeda dalam hal pemeriksaan sampel, Rastogi melakukan pemeriksaan kultur, dan kami dengan pemeriksaan PCR DNA. Persamaannya adalah teknik pengambilan sampel. Kedua penelitian ini sama – sama menunjukkan hasil yang bermakna secara statistik Population attributable risk (PAR) merupakan besarnya persentase kejadian ancaman persalinan preterm yang dapat dicegah dengan menghilangkan faktor risiko paparan infeksi Chlamydia trachomatis. Pada penelitian ini didapatkan nilai PAR 85,52 %. Dengan demikian dapat disimpulkan, bahwa 24 Cermin Dunia Kedokteran No. 145, 2004

Ardhna I K, Suwardewa TGA, Widarsa KT. Perbandingan efektifitas magnesium sulfat dan ritodrin untuk menghambat proses persalinan prematur di RSUP Sanglah Denpasar. Tesis,1999, 5. Hanifa W, Saifuddin AB, Rachimhadhi T. Penyakit dan kelainan yang tidak langsung berhubungan dengan kehamilan. Ilmu Kebidanan. Yayasan Bina Pustaka. Sarwono Prawirohardjo. Jakarta. 1994; 554 –6. 6. Cunningham FG, Mac Donald FC, Gant NF. Kelainan medis dan bedah yang mempersulit kehamilan, dalam Obstetri Willams edisi 18, EGC Penerbit BukuKedokteran.1995; 1027 – 29. 7. Umenai T, Sakano S, Suzuki K. Study on Chlamydia trachomatis infection among student and pregnant women in Japan. Medline ® 1999/011999/10. 1999 (abstract). 8. Paul VK, Sight M, Gupta V. Chlamydia trachomatis infection among pregnant women: prevalence and prenaatal importance.Medline ® 1999/01-1999/10.1999 (abstract). 9. Ngassa PC, Egbe JA. Maternal genital Chlamidia trachomatis infection and the ride of preterm labor. Internat. J. Gynaecol Obstet 1994;47. 241-6. (abstract). 10. Shenoy S, Sakano S, Suzuki K. Study on Chlamydia trachomatis infection among student and pregnant women in Japan. Medline ® 1999/011999/10. 1999 (abstract). 11. Ville Y.Carrol SG, Watts P. Chlamydia trachomatis in prelabour

4.

amniorrhexis. Br. J. Obstet.Gynaecol. 1997; 104: 1091-9. 12. Elizabeth A, Letsky, Warwick. Hematological problem. In : James DK. High risk pregnancy, management options. W B Saunders Co. Ltd. 1994; 337 – 45. 13. Montessori SM. Bakteriura asimtomatik pada kehamilan. Lab/SMF Obstetri dan Ginekologi FK UNUD/RSUP Denpasar. 1992. 14. Yogiantoro M. Pengelolaan penderita dengan infeksi traktus urinarius. Dalam : Simposium antibiotika Ikatan Ahli Farmakologi Indonesia cabang Surabaya.1997 : 39 – 49. 15. Jones RB. Chlamydial Diseases. In : Principles and Practice of Infectious Diseases 14 ed. Churchill Livingstone.1995 : 1676 – 8. 16. Wibowo P. Infeksi intra amnion sebagai penyebab persalinan prematur. Lab/SMF Obstetri dan Ginekologi RSUD Dr.Soetomo/ FK Unair, Surabaya.1994. 17. Claman P, Toye B, Peeling RW, et al. Serologic evidence of Chlamydia trachomatis infection and risk of preterm. CMAJ 1995; 153 (3) : 259-62. 18. Rastogi S, Kapur S, Salhan S, et al. Chlamydia trachomatis infection in pregnancy : risk factor and adverse outcome. Br. J. Biomed Sci. 1999; 56 (2): 94-8. 19. Stuart M, Berman MD , Carl H, et al. Recommendations for the prevention and management of Chlamydia trachomatis infection. US Department of Health and Human Services . 1993 : 1 - 9

KALENDER KEGIATAN ILMIAH PERIODE OKTOBER – DESEMBER 2004
Bulan Tanggal 1-2 1-2 1- 3 6-9 7-9 Oktober 7-9 7 - 10 7 - 10 Seminar & Workshop Pengembangan Kurikulum Informatika Kesehatan berbasis kompetensi Clinical Course and Annual Meeting of Nephrology 2004 Annual Scientific Meeting DIGM III : Update in Paediatric and Cardiovacular Diseases Jakarta Diabetes Meeting 2004: Optimizing Efforts in the Prevention of Type 2 DM 1st South East Asian Course on Serology and Laboratory Methods : The Diagnosis of Leptospirosis Jakarta Endocrinology Meeting: Update on Thyroid and Pituitary The 6th Training of OHP Pratama 6th RESPINA : The Glitters of Respiratory Care 8 - 11 Seminar Nasional VI PERSI dan Hospital Expo XVII 2004 16th WECOC: Women's Cardiovasculer Health: Upstream to Downstream 3rd Indonesian Biotechnology Conference KEGIATAN Symp. Heart-Brain Interaction ke-2 The 6th National Symposium on Brain and Heart : From New Emerging Risk Factors to Sophisticated Interventions in Brain and Heart Atherosclerosis Pertemuan Ilmiah Nasional ke-2 PB PAPDI Tempat dan Sekretariat Makassar; Telp: 021-3917349; Fax: 021-2305856 Email : sekretariat@perdossi.or.id Hotel Hyatt Regency, Bandung Telp: 022-2039592; Fax: 022-2041337 Email : ikki_westjava@yahoo.com Sanur Paradise Plaza Hotel, Bali Telp: 021-31931384, 021-3918301 pst 6703, 02131930808; Email : pb_papdi@indo.net.id Jakarta Convention Center Telp : 021-53677981, 53677982; Fax: 021-53677983 Email : osi@pdpersi.co.id; Website : www.okta.co.id Hotel Shangri-La Jakarta Telp: 021-5684085; Fax: 021-5608902 Denpasar - Bali, Indonesia; Telp: 0361-704625; Fax: 0361- 704625; Email : IBC2004@brawijaya.ac.id, subekti@nikkoindonesia.com Jogjakarta Plaza Hotel Telp: 0274-902511, 562139; Fax: 0274-561196 Email: cmhpe_fkugm@yahoo.com Hotel Sheraton Mustika, Yogyakarta Telp: 0274-553120; Fax: 0274-553120 Email : pernefriyogya2004@yahoo.com Hotel Borobudur, Jakarta Telp: 021-4532202; Fax: 021-4535833 Email : digm@globalmedicaonline.com, globalmedica@link.net.id Hotel Gran Melia Jakarta Telp: 021-3928658, 3907703; Fax: 021-3928659; Email: endocrin@rad.net.id Makassar; Telp : 0411-586971; Fax: 0411-586971 Email : agneskwe@indosat.net.id; Website :
www.kit.nl/biomedical_research/training_consultancies.asp

8 - 10

9 - 10 Nopember 24 - 30 4-5 Desember 6 - 16

Jakarta; Telp: 021-3928658, 3907703; Fax: 021-3928659; Email: endocrin@rad.net.id Bidakara, Jakarta; Telp: 021-79184052; Email: ppidki@rad.net.id Jakarta Convention Center Telp : 021-4786 4646; Fax: : 021-4786 6543 Email : info@respina.com; Website : www.respina.com

Informasi terkini, detail dan lengkap (jadwal acara/pembicara) bisa diakses di http://www.kalbe.co.id/calendar>>Complete

Cermin Dunia Kedokteran No. 145, 2004 25

HASIL PENELITIAN

Risiko Partus Prematurus Iminen pada Kehamilan dengan Infeksi Saluran Kemih
I Nyoman Nuada*, Made Kornia Karkata*, Ketut Suastika**
*Bagian Ilmu Kebidanan dan Penyakit Kandungan Fakultas Kedokteran Universitas Udaya / Rumah Sakit Sanglah Denpasar **Bagian Ilmu Penyakit Dalam Fakultas Kedokteran Universitas Udaya / Rumah Sakit Sanglah Denpasar

ABSTRAK Tujuan : Mengetahui besarnya risiko partus prematurus iminen pada wanita hamil dengan infeksi saluran kemih. Bahan dan Cara : Studi kasus-kontrol yang dilakukan di Lab/SMF Obstetri dan Ginekologi FK UNUD/RS Sanglah Denpasar. Dari 50 sampel yang memenuhi kriteria, 25 sampel masuk dalam kelompok kasus (partus prematurus iminen) dan 25 sampel masuk dalam kelompok kontrol (hamil aterm yang tidak inpartu). Sampel diambil di Kamar Bersalin dan di Poliklinik Kebidanan dan Penyakit Kandungan. Pada kedua kelompok dilakukan pengambilan urine porsi tengah, kemudian dikerjakan kultur urin dan test sensitivitas. Hasil : Infeksi saluran kemih (ISK) didapatkan pada 20% kelompok kasus dan pada 12% kelompok kontrol. Kejadian ISK di kelompok kasus lebih tinggi daripada di kelompok kontrol dengan Rasio Odds 1,83; tetapi perbedaan ini tidak bermakna (χ2 = 0,595 dan p = 0,702). Pada pemeriksaan bakteriologis didapatkan kuman yang terbanyak ditemukan adalah E. coli yang sensitif terhadap amoksisilin, mesilinam, Baktrim, siprofloksasin dan fleroksasin. Simpulan : Risiko partus prematurus iminen pada wanita hamil dengan ISK 1,83 kali lebih besar dibandingkan dengan wanita hamil yang tidak menderita ISK. Kata Kunci : Infeksi saluran kemih, partus prematurus iminen, pola kuman.

PENDAHULUAN Persalinan preterm masih merupakan masalah penting dalam obstetri khususnya di bidang perinatologi, karena baik di negara berkembang maupun negara maju penyebab morbiditas dan mortalitas neonatus terbanyak adalah bayi yang lahir preterm. Kira-kira 75% kematian neonatus berasal dari bayi yang lahir preterm.1 26 Cermin Dunia Kedokteran No. 145, 2004

Angka kejadian persalinan preterm sangat bervariasi. Di Amerika Serikat (1981-1989) sekitar 9-11%.2 Di Kalifornia (1996) sekitar 7,4%.3 Di Indonesia berkisar antara 10-20%4 dan di RS Sanglah (1996) sebesar 7,44%.5 Ardhana (1999) di RS Sanglah mendapatkan angka kejadian persalinan preterm 431 dari 4.984 persalinan (8,65%).6

Penyebab persalinan preterm adalah multifaktorial; beberapa diantaranya adalah sebagai berikut :7 Infeksi : • Korioamnionitis. • Infeksi traktus urogenitalis. Kelainan rahim: • Uterus septus, Uterus subseptus, Uterus bikornu. • Serviks inkompetens, riwayat konisasi. Stres atau hipoksia janin Endokrinopati idiopatik Sedangkan faktor risiko persalinan preterm adalah riwayat persalinan preterm sebelumnya, riwayat memakai obat diethylstilbestrol, abortus pada trimester II, riwayat penyakit hubungan seksual; dan pada kehamilan sekarang didapatkan keadaan seperti berikut; hamil ganda, perdarahan setelah trimester I, merokok 10 batang atau lebih perhari, ada infeksi saluran kemih, anemia (hematokrit < 34%), ada pembukaan serviks sebelum umur kehamilan 32 minggu (pembukaan serviks > 1 cm dan pendataran serviks < 1 cm.8 Infeksi saluran kemih (ISK) sering terjadi pada wanita hamil.9 Bila tidak ditangani dengan baik bisa menjadi penyulit terhadap kehamilan, terjadi abortus atau partus prematurus iminen. Banyak wanita dengan ISK tidak merasakan adanya keluhan atau tidak ada gejala. Infeksi baru terdeteksi setelah terlihat adanya bakteri pada pemeriksaaan urine. Keadaan ini disebut bakteriuria asimptomatik.10 Angka kejadian infeksi saluran kemih (ISK) dengan koloni bakteri lebih dari 100.000/ml urine pada wanita hamil baik dengan gejala maupun tanpa gejala (asimptomatik) sekitar 712%.9 Hubungan antara ISK asimptomatik dengan persalinan preterm telah diperdebatkan, tetapi telah terdapat cukup bukti yang menyokong adanya hubungan tersebut.1 Bila wanita hamil dengan ISK, khususnya yang asimptomatik tidak mendapat terapi antibiotika, 30-50% akan berkembang menjadi pielonefritis.6,11 Pielonefritis telah diketahui merupakan penyebab persalinan preterm karena adanya endotoksin yang merangsang produksi prostaglandin sehingga menyebabkan terjadinya kontraksi miometrium dan juga oleh karena ada respon infeksi yang mengakibatkan kerusakan struktur uterus dan pembuluh darah plasenta.12 Kass mendapatkan angka kejadian partus prematurus 27% pada wanita hamil dengan ISK yang tidak mendapat terapi antibiotika dan hanya 7% dari 84 wanita hamil dengan ISK yang mendapat terapi antibiotika.13 Oleh karena itu penting sekali mengadakan skrining infeksi saluran kemih pada wanita hamil dan memberi terapi antibiotika apabila ditemukan ISK.9 Penyebab pasti partus prematurus sampai saat ini belum jelas diketahui. Infeksi saluran kemih merupakan salah satu faktor risiko yang telah banyak diteliti. Data bakteriologis dan test kepekaan kuman sebagai dasar terapi rasional sampai saat ini masih sangat terbatas. BAHAN DAN CARA KERJA Rancangan penelitian ini adalah studi kasus-kontrol. Berdasarkan perhitungan statistik diperlukan 50 pasien sebagai sampel penelitian (25 wanita hamil yang mengalami partus prematurus iminen sebagai kasus dan 25 wanita hamil aterm

yang tidak inpartu sebagai kontrol). Terhadap subyek penelitian yang memenuhi kriteria inklusi dilakukan pengambilan urine porsi tengah dan kemudian dilakukan kultur urine dan test sensitivitas di Lab Mikrobiologi FK UNUD. Data disajikan dalam bentuk tabel dan dilakukan uji chi-square. HASIL DAN DISKUSI Pada penelitian ini berhasil dikumpulkan sebanyak 50 sampel yang memenuhi kriteria dan setuju untuk ikut dalam penelitian ini. Dari 50 sampel tersebut, 25 sampel termasuk kelompok kasus (partus prematurus iminen), sedangkan 25 sampel sisanya merupakan kelompok kontrol (hamil aterm yang tidak inpartu). Diagnosis infeksi saluran kemih (ISK) pada penelitian ini didasarkan atas ditemukannya koloni kuman ≥ 100 000 per ml dari urine porsi tengah. Terhadap seluruh sampel kedua kelompok dilakukan kultur urine, hitung koloni serta tes kepekaan mikroorganisme terhadap beberapa antibiotika. Sebelum analisis statistik terhadap hasil penelitian, pada beberapa variabel dilakukan uji komparabilitas (Tabel 1).
Tabel 1. Uji Chi-Square beberapa variabel pada kelompok kasus dan kontrol Variabel N 1. Umur Ibu : < 20 tahun 20 – 35 tahun Paritas : Nullipara Multipara 3. Leukosit darah Leukosit ≥ 15.000 Leukosit < 15.000 1. 4 21 23 2 3 22 Subyek Penelitian Kasus Kontrol (PPI) (Bukan PPI) % 16,0 84,0 92,0 8,0 12,0 88,0 N 0 25 17 8 0 25 % 0 100 68,0 32,0 0 100,0 4,348 *) 0,110 *) 0,074 *) 0,235 χ2 P

4,500 3,191

Keterangan : *) Fisher`s Exact Test

Pada Tabel 1 tampak bahwa variabel umur dan paritas antara kedua kelompok berbeda tidak bermakna sehingga dapat diperbandingkan (masing-masing χ2 =4.348 dan p = 0,110, χ2 = 4.500 dan p = 0,074). Demikian pula tampak bahwa variabel leukosit darah pada kedua kelompok berbeda tidak bermakna (χ2 = 3,191, p=0,235 ). Kejadian ISK pada kedua kelompok dilihat pada Tabel 2.
Tabel 2. Hubungan ISK dengan partus prematurus iminen Subyek Penelitian Kasus Kontrol 5 3 20 22 25 25 Total 8 42 50

ISK NON ISK TOTAL

Keterangan: χ2 = 0,595, P = 0,702, OR = 1,83

Di kelompok kasus didapatkan 5 kasus (20%) ISK dari 25 jumlah sampel yang diperiksa. Sedangkan di kelompok kontrol didapatkan 3 kasus (12%) ISK dari 25 sampel yang.diperiksa. Cermin Dunia Kedokteran No. 145, 2004 27

Secara keseluruhan didapatkan 8 kasus (16%) yang menderita ISK. Tampak bahwa proporsi ISK di kelompok kasus lebih besar dari di kelompok kontrol; perbedaannya secara statistik tidak bermakna (χ2 = 0,595, P = 0,702; OR=1,83, 95% CI: 0,387-8,674). Angka kejadian ISK yang berhubungan dengan kasuskasus kebidanan khususnya persalinan preterm sangat bervariasi pada beberapa penelitian; berkisar antara 3-10%, namun penelitian di RSCM (1999) menunjukkan infeksi serviks, vagina yang disertai ISK 40,74% menimbulkan ancaman persalinan preterm. Beberapa variabel yang diduga berhubungan dengan variasi angka kejadian ini antara lain faktor ras, paritas dan sosial ekonomi. Penelitian lain mendapatkan insiden kelahiran preterm dengan ISK sekitar 9%, sedangkan pada kelompok kontrol hanya sekitar 5%. Barangkali batasan-batasan diagnosis dan teknis pemeriksaan juga berpengaruh pada variasi angka kejadian ini. Dengan metode pemeriksaan sederhana yaitu pemeriksaan uji celup LEA di RSCM (1996) didapatkan angka kejadian ISK sebesar 7%. Dikatakan tehnik pemeriksaan ini mempunyai sensitivitas sebesar 83% dan spesifisitas 86%, akan tetapi metode pemeriksaan ini bukan merupakan metode pemeriksaan standar.14,15,16 Pada penelitian ini didapatkan angka kejadian ISK sebesar 16%. Angka kejadian ISK pada wanita hamil dengan PPI sebesar 20%, sedangkan di kelompok kontrol sebesar 12%. Dibandingkan dengan beberapa penelitian di atas, maka angka kejadian ISK pada penelitian ini cukup besar. Jika benar faktor ras dan sosial ekonomi berpengaruh terhadap kejadian ISK, maka data tentang hal ini dapat berguna. Sayang tidak pernah disajikan ras mana saja yang mempunyai risiko lebih tinggi untuk terjadinya ISK. Millar LK mendapatkan angka kejadian ISK pada penduduk miskin meningkat secara nyata.17 Rasio Odds Rasio Odds dihitung untuk mengetahui peranan ISK terhadap perbedaan risiko partus prematurus iminen. Pada penelitian ini didapatkan perbedaan paparan ISK antara kelompok kasus dan kelompok kontrol. Pada kelompok kasus didapatkan paparan ISK lebih tinggi (5 ISK positif : 20 ISK negatif) dibandingkan kelompok kontrol (3 ISK positif : 22 ISK negatif). Rasio Odds pada penelitian ini sebesar 1,83 dengan Confidence Interval 95%. Dengan demikian pada penelitian ini dapat disimpulkan bahwa risiko partus prematurus iminen pada wanita hamil dengan ISK 1,83 kali dibandingkan dengan wanita hamil tanpa ISK. Noroyono Wibowo menyatakan bahwa bakteriuria asimptomatik setidaknya dapat meningkatkan risiko persalinan preterm dua kali lipat. Yanto Kusnawara (RS Kariadi Semarang, 2001) juga mendapatkan ISK pada ibu hamil yang mengalami persalinan preterm hampir dua kali lipat daripada kelompok kontrol (27,6% vs. 14,5%). Penelitian di Bandung (2002) bahkan mendapatkan risiko kejadian yang jauh lebih tinggi dengan Rasio Odds sebesar 11,36.15 Pada penelitian ini didapatkan risiko persalinan preterm pada wanita hamil dengan ISK mendekati 2 kali lipat (Rasio Odds 1,83). 28 Cermin Dunia Kedokteran No. 145, 2004

Disayangkan data beberapa penelitian hubungan ISK dengan persalinan preterm masih menjadi perdebatan. Hal ini didasarkan atas fakta penelitian bahwa tidak terjadi penurunan kejadian persalinan preterm pada penderita hamil dengan ISK yang diterapi antibiotika. Tetapi meta-analisis terakhir menunjukkan ada hubungan antara ISK yang tidak diobati dengan tingginya angka kejadian persalinan preterm.16 Population Attributable Risk (PAR) Pada penelitian ini didapatkan proporsi paparan ISK pada kasus maupun kontrol sebesar 16% dan rasio odds sebesar 1,83. Dari angka-angka tersebut PAR dapat dihitung dan besarnya adalah 11,7%. Dengan demikian dapat disimpulkan, bahwa pencegahan terhadap paparan infeksi saluran kemih dapat menurunkan risiko partus prematurus iminen sebanyak 11,7%. Luaran Tambahan Pada penelitian ini dianalisis juga beberapa variabel yang berhubungan dengan kejadian ISK, hubungan antara leukosituria dengan partus prematurus iminen, hubungan ISK dengan kegagalan perawatan konservatif serta pola mikroorganisme dan tes resistensi kuman pada kelompok kasus dan kontrol yang positif ISK. Diantara beberapa variabel tersebut hubungan antara leukosituria dengan partus prematurus iminen mempunyai hubungan yang bermakna (Tabel 3).
Tabel 3. Hubungan antara leukosituria dengan partus prematurus iminen Kadar leukosit Urine Leukosit ≥ 5/ lpb Leukosit < 5/ lpb Total Subyek Penelitian Kasus Kontrol (PPI) (Bukan PPI) N % N % 10 40,0 2 8,0 15 25 60,0 100,0 23 25 92.0 100,0 χ2 P

7,018

*) 0,018

Keterangan : *) Fisher`s Exact test.

Wanita hamil diyakini merupakan kelompok yang harus menjalani skrining terhadap ISK dan diterapi bila ditemukan. Hal ini untuk mencegah komplikasi baik maternal maupun fetal; di antaranya pyelonefritis yang mencapai 30%, persalinan preterm serta abortus atau fetal loss lainnya.18 Dari Tabel 3 dapat dilihat bahwa terdapat hubungan yang bermakna antara leukosituria dengan PPI (χ2 = 7,018, p = 0,018, OR = 7,67 ; 95% CI : 1,470-39,987). Wanita hamil dengan leukosit urine ≥ 5/ lpb berisiko PPI 7,67 kali lebih besar bila dibandingkan dengan wanita hamil dengan leukosit urine < 5/lpb. Pemeriksaan urinalisis dengan leukosit sedimen ≥ 5 /lpb mempunyai hubungan bermakna dengan hasil kultur urine; pada leukosit sedimen ≥ 5 /lpb kemungkinan kultur urine positif (menderita ISK) 8,3 kali lebih besar dibandingkan dengan leukosit sedimen < 5/lpb.

Tabel 4. Hubungan antara leukosituria dengan hasil kultur urine Leukosituria ≥ 5 /LPB < 5 /LPB Jumlah Keterangan: χ2 =7.739 Kultur urine Positif Negatif 5 7 3 35 8 42 OR = 8,3 p = 0,014 Jumlah 12 38 50

Pada Tabel 4 terlihat antara leukosituria dengan hasil kultur urine terdapat hubungan yang bermakna (p= 0,014); nilai diagnostik leukosituria dalam menentukan adanya ISK mempunyai sensitivitas dan spesifisitas masing-masing 62,5% dan 83%. Dwi Lingga dalam penelitiannya tentang nilai diagnostik urinalisis pada penderita ISK juga mendapatkan hubungan yang bermakna antara hasil kultur urine dengan leukosit sedimen ≥ 5 /lpb dengan sensitivitas dan spesifisitas masing-masing 98,48% dan 33,3%. Dengan peningkatan jumlah leukosit dapat mengarahkan diagnosis ISK, tetapi harus dikonfirmasi dengan biakan urine. Adanya leukosituria tidak memastikan adanya ISK dan tidak adanya leukosituria tidak memastikan bahwa tidak ada ISK19,20. E. coli merupakan mikroorganisme yang paling sering ditemukan pada kultur urine (Tabel 5 dan 6). Test resistensi kuman menunjukkan sebagian besar sensitif terhadap antibiotika ; amoksisilin, mesilinam Baktrim, fleroksasin dan siprofloksasin.
Tabel 5. Pola mikroorganisme dan tes resistensi kuman pada kelompok kasus No 1 2 Jenis Mikroorganis me E. coli Proteus morgagni E. coli Proteus morgagni Stafilokokus N 2 1 % 40 20 Test Resistensi Siprofloksasin, Klorampenikol, Fleroksasin, Baktrim, Mesilinam. Baktrim, Negram, Amoksisilin, Siprofloksasin, Mesilinam, Klorampenikol, Fleroksasin. Siproploksasin, Klorampenikol, Fleroksasin Baktrim, Amoksisilin, Augmentin, Siprofloksasin, Klorampenikol, Fleroksasin.

1998) mendapatkan angka kejadian ISK pada wanita hamil sebesar 24% dan kuman dari isolat urin yang tersering adalah Pseudomonas (50%), diikuti Paracolon (25%), Proteus (16,7%) dan Enterobacter (8,3%).22 Yang tidak kalah pentingnya adalah data hasil tes kepekaan kuman. Tabel 4 dan 5 menunjukkan bahwa baik pada kasus maupun kontrol sebagian besar mikroorganisme yang ditemukan sensitif terhadap Baktrim, siprofloksasin dan fleroksasin. Data ini sangat penting untuk rasionalitas terapi. Kami berasumsi bahwa secara bakteriologis pola kuman ISK wanita hamil sama dengan pada ISK wanita tidak hamil. Kehamilan hanya merupakan faktor yang dapat meningkatkan risiko ISK dan memperburuk perjalanan penyakitnya. Lebih dari 95% ISK terjadi secara ascending dan E. coli merupakan kuman yang paling sering ditemukan; beberapa kuman yang lain adalah Proteus dan Klebsiella. Data pola kuman pada pemeriksaan isolat urin menunjukkan bahwa E. coli menempati urutan pertama.18 Resistantie N dan Effendi JS (Bandung) menemukan E. coli merupakan yang terbanyak (47%) pada pemeriksaan bakteriuria asimptomatik diikuti oleh Klebsiela pneumoniae (33%), Pseudomonas cepacia (17%) dan Mikrokokus (3%).15 Pada penelitian ini di kelompok kasus E. coli merupakan kuman yang paling sering ditemukan (40%) (Tabel 5). Datadi atas memperlihatkan bahwa pola kuman di setiap daerah atau rumah sakit tidak sama. Pada setiap wanita hamil dengan ISK disarankan untuk diberi antibiotika yang sesuai dengan mempertimbangkan segi keamanannya baik bagi ibu maupun janin. SIMPULAN DAN SARAN Angka kejadian ISK pada partus prematurus iminen adalah 5/25 (20%) lebih besar dibandingkan dengan angka kejadian ISK pada kehamilan aterm 3/25 (12%) ; perbedaan ini tidak bermakna (p = 0,702). Partus prematurus iminen lebih sering terjadi pada wanita hamil dengan ISK (Rasio Odds = 1,83 dan CI : 0,387-8.674). Pencegahan terhadap paparan infeksi saluran kemih dapat menurunkan risiko partus prematurus iminen sebanyak 11,7%. Mikroorganisme yang paling sering ditemukan pada wanita hamil dengan infeksi saluran kemih adalah Escherichia coli dan sensitif terhadap amoksisilin, mesilinam, Baktrim, siprofloksasin dan fleroksasin. Pada penelitian ini semua penderita ISK asimptomatik, oleh karena itu untuk menurunkan risiko persalinan preterm akibat ISK, disarankan skrining rutin ISK pada setiap wanita hamil.

3 4

1 1

20 20

Tabel 6. Pola mikroorganisme dan tes resistensi kuman pada kelompok kontrol No Jenis N % Test Resistensi Mikroorganis me 1 E. coli 1 33,3 Baktrim, Fleroksasin, Enterobacter Siprofloksasin. cloacae 2 Stafilokokus 1 33,3 Baktrim, Fleroksasin, Siprofloksasin. 3 Citrobacter 1 33,3 Baktrim, Negram, diversus Siprofloksasin, Mesilinam, Klorampenikol, Fleroksasin, Metisilin.

KEPUSTAKAAN 1. 2. 3. Godwin T M. Preterm labor : background and prevention. In : Mishell Dr Bremen PF, (eds). Management of common problem in obstetric and gynecology 3th edition. Blackwell scientific publications. 1994; 97-107. Creasy RK. Preterm birth prevention: where are we. Am. J. Obstet Gynecol. 1993; 168: 1223-30. Greenhagen JB et al, Value of fetal fibronectin as a predictor of preterm delivery for a low-risk population. Am J. Obstet Gynecol 1996; 175:10546.

Banyak referensi yang menunjukkan hubungan antara ISK dengan persalinan preterm, namun sangat sedikit data studi tentang pola kuman pada wanita hamil dengan bakteriuria. Watumbara IG, Wagey F, Warouw N N. (RSUP Manado,

Cermin Dunia Kedokteran No. 145, 2004 29

4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

Krisnadi SR. Program pencegahan persalinan prematur dalam Kumpulan makalah POGI cabang Bandung pada Pertemuan Ilmiah Tahunan XII Palembang, 2001; 36-43. Sudira N. Pencegahan partus prematurus.Dibacakan pada Seminar meningkatkan kualitas anak dalam era globalisasi. IDAI cabang Bali 1997. Ardhana I K, Suwardewa TGA, Widarsa KT. Perbandingan efektifitas magnesium sulfat dan ritodrine untuk menghambat proses persalinan prematur di RSUP Sanglah Denpasar. 1999, Tesis. McDonald HM et al. Prenatal microbiological risk factor associated with preterm birth Br. J. Obstet Gynecol. 1992; 99: 190-6. Iams J D. Prematurity : prevention and treatment. In : Queenan JT (eds). Management of high risk pregnancy. Boston:Blackwell Scient. Publ. 1994; 464-75 Cuningham FG. Urinary tract infections complicating pregnancy. Baillier’s clin obstet gynaecol. 1, 1994; 891-909. Chamberlain G. dan Dewhurst SJ, alih Bahasa Maulany RF. Masalah traktus urinarius dalam kebidanan dalam: (eds). Ronardy DH. Obstetri dan Ginekologi praktis edisi kedua. 1994; 217-223. Spellacy WN. Urinary tract infection. In : High risk pregnancy third edition, 1994; 408-10 Fard S, and fenner D E. Urinary tract infctions. In : Clinical obstetrics and gynecology. 41, 1998; 744-54. Wibowo P. Infeksi intra amnion sebagai penyebab persalinan prematur. Lab/SMF obstetri ginekologi RSUD DR. Soetomo/FK UNAIR Surabaya 1994.

14. Noroyono W. Risiko dan pencegahan kelahiran prematur. Dalam : Rulina S, Hans EM, Pustika A, Dyani K. (eds). Naskah lengkap pendidikan kedokteran berkelanjutan ilmu kesehatan anak XXXVIII. 1997; 1-9. 15. Resistantie N, Effendi JS. Bakteriuria asimptomatis sebagai faktor risiko pada persalinan preterm di Rumah Sakit dr. Hasan Sadikin Bandung. 2002 16. Yost NP, Cox SM. Infection and preterm labor. In : Blanco JD, Keye WR. Clinical obstetric and gynecology. 43, 2000; 759-67. 17. Millar LK. Urinary tract infections complicating pregnancy. In : Mishell DR, Brenner PF. Eds.Management of common problems in obstetric and gynecology 3th edition, blackwell scientific publications 1994; 57-61. 18. Rubin RH, Cotran RS, Tolkoff NE. Urinary tract infection, pyelonephritis, and reflux nephropathy. In : Brenner MB eds. The kidney. 5th edition. WB Saunders Company. 1996; 1597-641. 19. Montessori SM. Bakteriuria asimptomatik pada kehamilan. Lab/SMF 0bstetri dan ginekologi FK UNUD/RSUP Denpasar, 1992. 20. Yogiantoro M. Pengelolaan penderita dengan infeksi traktus urinarius. Dalam : simposium antibiotika ikatan ahli farmakologi Indonesia cabang Surabaya, 1997; 39-49. 21. Abadi A. Kontroversi dalam pengelolaan persalinan kurang bulan. Dalam : Tarjoto BH, Kosim M S, Deliana E, Muarif YS. eds. Naskah lengkap kongres nasional VII perkumpulan perinatologi indonesia dan simposium internasional, 2001; 29-45. 22. Watumbara I G, Wagey F, Warouw N N. Bakteriuria asimptomatik pada wanita hamil. Bag/SMF Obstetri dan Ginekologi FK UNSRAT/RSUP Manado, 1998.

A fool may make money, but it takes a wise man to spend it.

30 Cermin Dunia Kedokteran No. 145, 2004

TINJAUAN KEPUSTAKAAN

Pengelolaan Persalinan Prematur
Jefferson Rompas
Bagian/SMF Obstetri dan Ginekologi Fakultas Kedokteran Universitas Sam Ratulangi/ Rumah Sakit Umum Pusat Manado

PENDAHULUAN Pada haid yang teratur, persalinan preterm dapat didefinisikan sebagai persalinan yang terjadi antara usia kehamilan 20-37 minggu dihitung dari hari pertama haid terakhir (ACOG,1995). Di negara berkembang insidennya sekitar 7% dari seluruh persalinan Persalinan preterm merupakan hal yang berbahaya karena potensial meningkatkan kematian perinatal sebesar 65%-75%, umumnya berkaitan dengan berat lahir rendah. Berat lahir rendah dapat disebabkan oleh kelahiran preterm dan pertumbuhan janin yang terhambat. Keduanya sebaiknya dicegah karena dampaknya yang negatif; tidak hanya kematian perinatal tetapi juga morbiditas, potensi generasi akan datang, kelainan mental dan beban ekonomi bagi keluarga dan bangsa secara keseluruhan.1,2,3,4,5 Pada kebanyakan kasus, penyebab pasti persalinan preterm tidak diketahui. Berbagai sebab dan faktor demografik diduga sebagai penyebab persalinan preterm, seperti: solusio plasenta, kehamilan ganda, kelainan uterus, polihidramnion, kelainan kongenital janin, ketuban pecah dini dan lain-lain. Penyebab persalinan preterm bukan tunggal tetapi multikompleks, antara lain karena infeksi. Infeksi pada kehamilan akan menyebabkan suatu respon imunologik spesifik melalui aktifasi sel limfosit B dan T dengan hasil akhir zat-zat yang menginisiasi kontraksi uterus. Terdapat makin banyak bukti yang menunjukkan bahwa mungkin sepertiga kasus persalinan preterm berkaitan dengan infeksi membran korioamnion. Dari penelitian Lettieri dkk. (1993), didapati 38% persalinan preterm disebabkan akibat infeksi korioamnion. Knox dan Hoerner (1950) telah mengetahui hubungan antara infeksi jalan lahir dengan kelahiran prematur. Bobbitt dan Ledger (1977) membuktikan infeksi amnion subklinis sebagai penyebab kelahiran preterm. Dengan amniosentesis didapati bakteri patogen pada + 20% ibu yang mengalami persalinan preterm dengan ketuban utuh dan tanpa gejala klinis infeksi (Cox dkk.,1996 ; Watts dkk., 1992). 6,7,8,9 Cara masuknya kuman penyebab infeksi amnion, dapat sebagai berikut :

1) Melalui jalur transervikal masuk ke dalam selaput amniokorion dan cairan amnion. E. coli dapat menembus membran korioamnion. (Gyr dkk ,1994) 2) Melalui jalur transervikal ke desidua/chorionic junction pada segmen bawah rahim. 3) Penetrasi langsung ke dalam jaringan serviks. 4) Secara hematogen ke plasenta dan selaputnya. 5) Secara hematogen ke miometrium Selain itu endotoksin dapat masuk ke dalam rongga amnion secara difusi tanpa kolonisasi bakteri dalam cairan amnion.10,11,12 Infeksi dan proses inflamasi amnion merupakan salah satu faktor yang dapat memulai kontraksi uterus dan persalinan preterm. Menurut Schwarz (1976), partus aterm diinisiasi oleh aktivasi enzim phospholipase A2 yang dapat melepaskan asam arakidonat dari membran janin sehingga terbentuk asam arakidonat bebas yang merupakan bahan dasar sintesis prostaglandin. Bejar dkk (1981) melaporkan sejumlah mikroorganisme mempunyai kemampuan untuk menghasilkan enzim phospholipase A2 sehingga dapat menginisiasi terjadinya persalinan preterm. Bennett dan Elder (1992), menunjukkan bahwa mediator-mediator dapat merangsang timbulnya kontraksi uterus dan partus preterm melalui pengaruhnya terhadap biosintesis prostaglandin.12,13,14 FAKTOR RISIKO PREMATURITAS Mayor 1. Kehamilan multipel 2. Hidramnion 3. Anomali uterus 4. Serviks terbuka lebih dari 1 cm pada kehamilan 32 minggu 5. Serviks mendatar/memendek kurang dari 1 cm pada kehamilan 32 minggu 6. Riwayat abortus pada trimester II lebih dari 1 kali 7. Riwayat persalinan preterm sebelumnya 8. Operasi abdominal pada kehamilan preterm 9. Riwayat operasi konisasi 10. Iritabilitas uterus

Cermin Dunia Kedokteran No. 145, 2004 31

Minor 1. Penyakit yang disertai demam 2. Perdarahan pervaginam setelah kehamilan 12 minggu 3. Riwayat pielonefritis 4. Merokok lebih dari 10 batang perhari 5. Riwayat abortus pada trimester II 6. Riwayat abortus pada trimester I lebih dari 2 kali Pasien tergolong risiko tinggi bila dijumpai satu atau lebih faktor risiko mayor; atau dua atau lebih faktor risiko minor; atau keduanya
Hasil Produk Bakteri Desidua dan/atau Amnion Manosit Sitokin: IL-1,6 dan 8 TNF Cairan Amnion : PAF Asam Arakidonat Prostaglandin E2 dan F2a

2) • • • • • 3) •

Amniosentesis Hitung lekosit Pewarnaan Gram bakteri (+) pasti amnionitis Kultur Kadar IL-1, IL-6 (↑) Kadar glukosa cairan amnion,(↓) Pemeriksaan ultrasonografi Oligohidramnion : Goulk dkk. (1985) mendapati hubungan antara oligohidramnion dengan korioamnionitis klinis antepartum. Vintzileos dkk. (1986) mendapati hubungan antara oligohidramnion dengan koloni bakteri pada amnion. • Penipisan serviks: Iams dkk. (1994) mendapati bila ketebalan seviks < 3 cm (USG) , dapat dipastikan akan terjadi persalinan preterm. Sonografi serviks transperineal lebih disukai karena dapat menghindari manipulasi intravagina terutama pada kasus-kasus KPD dan plasenta previa.3,4,16 • Kardiotokografi : kesejahteraan janin, frekuensi dan kekuatan kontraksi

Miometrium: Kontraksi Uterus

KRITERIA DIAGNOSIS 1. Usia kehamilan antara 20 dan 37 minggu lengkap atau antara 140 dan 259 hari 2. Kontraksi uterus (his) teratur, pastikan dengan pemeriksaan inspekulo adanya pembukaan dan servisitis. 3. Pemeriksaan dalam menunjukkan bahwa serviks telah mendatar 50-80%, atau sedikitnya 2 cm 4. Selaput ketuban seringkali telah pecah 5. Merasakan gejala seperti rasa kaku di perut menyerupai kaku menstruasi, rasa tekanan intrapelvik dan nyeri bagian belakang 6. Mengeluarkan lendir pervaginam, mungkin bercampur darah15,16,17 DIAGNOSIS BANDING • Kontraksi pada kehamilan preterm • Persalinan pada pertumbuhan janin terhambat PEMERIKSAAN PENUNJANG 1) Laboratorium • Pemeriksaan kultur urine • Pemeriksaan gas dan pH darah janin • Pemeriksaan darah tepi ibu: o Jumlah lekosit o C-reactive protein . CRP ada pada serum penderita yang menderita infeksi akut dan dideteksi berdasarkan kemampuannya untuk mempresipitasi fraksi polisakarida somatik nonspesifik kuman Pneumococcus yang disebut fraksi C. CRP dibentuk di hepatosit sebagai reaksi terhadap IL-1, IL-6, TNF.17,18,19

PENATALAKSANAAN Ibu hamil yang diidentifikasi memiliki risiko persalinan preterm akibat amnionitis dan yang mengalami gejala persalinan preterm membakat harus ditangani seksama untuk meningkatkan keluaran neonatal. Pada kasus-kasus amnionitis yang tidak mungkin ditangani ekspektatif, harus dilakukan intervensi, yaitu dengan: 1) Akselerasi pematangan fungsi paru • Terapi glukokortikoid, misalnya dengan betamethasone 12 mg im. 2 x selang 24 jam. Atau dexamethasone 5 mg tiap 12 jam (im) sampai 4 dosis.1,5,9 • Thyrotropin releasing hormone 400 ug iv, akan meningkatkan kadar tri-iodothyronine yang dapat meningkatkan produksi surfaktan.1 • Suplemen inositol, karena inositol merupakan komponen membran fosfolipid yang berperan dalam pembentukan surfaktan.1 2) Pemberian antibiotika Mercer dan Arheart (1995) menunjukkan bahwa pemberian antibiotika yang tepat dapat menurunkan angka kejadian korioamnionitis dan sepsis neonatorum. Diberikan 2 gram ampicillin (iv) tiap 6 jam sampai persalinan selesai (ACOG). Peneliti lain memberikan antibiotika kombinasi untuk kuman aerob maupun anaerob. Yang terbaik bila sesuai dengan kultur dan tes sensitivitas1,5,7 Setelah itu dilakukan deteksi dan penanganan terhadap faktor risiko persalinan preterm, bila tidak ada kontra indikasi, diberi tokolitik. 3) Pemberian tokolitik a. Nifedipin 10 mg diulang tiap 30 menit, maksimum 40 mg/6 jam. Umumnya hanya diperlukan 20 mg dan dosis perawatan 3 x 10 mg. 5 b. Golongan beta-mimetik - Salbutamol Per infus: 20-50 µg/menit Per oral : 4 mg, 2-4 kali/hari (maintenance) atau :

32 Cermin Dunia Kedokteran No. 145, 2004

- Terbutalin Per infus: 10-15 µg/menit Subkutan: 250 µg setiap 6 jam Per oral : 5-7.5 mg setiap 8 jam (maintenance) - Efek samping : Hiperglikemia, hipokalemia, hipotensi, takikardia, iskemi miokardial, edema paru c. Magnesium sulfat - Parenteral : 4-6 gr/iv pemberian bolus selama 20-30 menit infus 2-4gr/jam (maintenance) - Efek samping : Edema paru, letargi, nyeri dada, depresi pernafasan (pada ibu dan bayi) KONTRAINDIKASI PENUNDAAN PERSALINAN • Mutlak Gawat janin, korioamnionitis, perdarahan antepartum yang banyak • Relatif Gestosis; diabetes mellitus (beta-mimetik), pertumbuhan janin terhambat, pembukaan serviks lebih dari 4 cm CARA PERSALINAN • Janin presentasi kepala : pervaginam dengan episiotomi lebar dan perlindungan forseps terutama pada bayi < 35 minggu • Indikasi seksio sesarea : a. Janin sungsang b. Taksiran berat badan janin kurang dari 1500 gram (masih kontroversial) c. Gawat janin, bila syarat pervaginam tidak terpenuhi d. Infeksi intrapartum dengan takikardi janin, gerakan janin melemah, ologohidramnion, dan cairan amnion berbau. bila syarat pervaginam tidak terpenuhi e. Kontraindikasi partus pervaginam lain (letak lintang, plasenta previa, dan sebagainya). • Lindungi bayi dengan handuk hangat, usahakan suhu 3637oC ( rawat intensif di bagian NICU ), perlu dibahas dengan dokter bagian anak. • Bila bayi ternyata tidak mempunyai kesulitan ( minum, nafas, tanpa cacat) maka perawatan cara kangguru dapat diberikan agar lama perawatan di rumah sakit berkurang. PENYULIT 1. Sindroma gawat nafas (RDS) 2. Perdarahan intrakranial 3. Trauma persalinan 4. Paten duktus arteriosus 5. Sepsis 6. Gangguan neurologi KOMPLIKASI Pada ibu, setelah persalinan preterm, infeksi endometrium lebih sering terjadi mengakibatkan sepsis dan lambatnya penyembuhan luka episiotomi. Bayi-bayi preterm memiliki risiko infeksi neonatal lebih

tinggi; Morales (1987) menyatakan bahwa bayi yang lahir dari ibu yang menderita anmionitis memiliki risiko mortalitas 4 kali lebih besar, dan risiko distres pernafasan, sepsis neonatal, necrotizing enterocolitis dan perdarahan intraventrikuler 3 kali lebih besar.

KEPUSTAKAAN 1. 2. 3. 4. Cuningham FG et al. Preterm Birth. William Obstetrics. 20 th ed. Connecticutt: Appleton & Lange, 1997; 797-820 Iams JD. Prematurity: Prevention and Treatment. In: Quenan JT ed. Management of High-Risk Pregnancy. Boston: Blackwell Scient Publ, 1994; 464-75. Quilligan EJ. Pathological causes of preterm labor. In: Elder MG, Hendricks CH eds. Preterm Labor. London: Butterworths International Medical Reviews, 1981; 61-74. Stubblefield PG. Causes and Prevention of Premature Birth: An Overview. In: Fuchs AR, Fuchs F, Stubblefield PG eds. Preterm Birth Causes, Prevention, and Management. 2 nd ed. McGraw-Hill Inc, 1993; 3-40. Moeloek FA, Nuranna L, Wibowo N, Purbadi S. Prematuritas. Dalam: Standard Pelayanan Medik Obstetri dan Ginekologi. Jakarta 2003; 49-51 Wiknjosastro H. Kelainan dalam lamanya kehamilan .Dalam: Wiknjosastro H eds. Ilmu Kebidanan edisi ke tiga. Jakarta: Yayasan Bina Pustaka, 1991. Seo K, McGregor JA, French JI. Infection in premature rupture of the membranes. In: Quenan JT eds. Management of High-Risk Pregnancy. Boston: Blackwell Scient Publ, 1994; 476-82. Romeo R,Avila C, Sepulveda W. The Role of Systemic and Intrauterine Infection in Preterm Labor. In: Fuchs AR, Fuchs F, Stubblefield PG (eds). Preterm Birth Causes, Prevention, and Management. 2nd ed. McGrawHill Inc, 1993; 97-136. Huszar G,Hayashi R. Physiologic Aspects of Myometrial Contractility and Cervical Dilatation. In: Fuchs AR, Fuchs F, Stubblefield PG (eds). Preterm Birth Causes, Prevention, and Management. 2 nd ed. McGrawHill Inc, 1993; 41-58. El-Bastawissi AY,Williams MA, Riley DE, et al. Amniotic fluid Interleukin-6 and preterm delivery: A Review. Obstet Gynecol 2000; 95: 1056-64. Menon R, Swan KF, Leyden TW, Rote NS, Fortunato SJ. Expression of inflammatory cytokines (IL-1 beta and IL-6) in amniochorion. Am J Obstet Gynecol 1995; 172: 493-500. Gibbs RS, Blanco JD. Premature rupture of the membranes. Obstet Gynecol 1982; 60: 671-9. Osmer RGW, Blaser J, Kuhn W, et al. Interleukin-8 synthesis and the onset of labor. Obstet Gynecol 1995; 86 : 223-9. Besinger RE. The Diagnosis and Treatment of Preterm Labor. In: Witter FR, Keith LG eds. Textbook of Prematurity Antecedents, Treatment, and Outcome. Boston: Little, Brown and Co; 1993; 65-114. Goldenberg RL, Andrews WW, Mercer BM, et al. The Preterm Prediction Study: Granulocyte colony-stimulating factor and spontaneous preterm birth. Am J Obstet Gynecol. 2000; 182: 625-30. Goldenberg RL, Andrews WW, Mercer BM, et al. The Preterm Prediction Study: Cervical lactoferrin concentration, other marker of lower genital tract infection, and preterm birth. Am J Obstet Gynecol. 2000; 182: 631-5. Bittar RE, Yamasaki AA, Sasaki S, et al. Cervical fetal fibronectin in patients at increase risk for preterm delivery. Am J Obstet Gynecol. 1996; 175: 178-81. Hsu CD, Hong SH, Harirah H, et al. Amniotic fluid soluble fat levels in intra-amniotic infection. Obstet Gynecol 2000; 95: 667-70. Nakatsuka M, Habara T, Kamada Y et al. Elevation of total nitrite and nitrate concentration in vaginal secretions as a predictor of premature delivery. Am J Obstet Gynecol. 2000; 182: 644-5.

5. 6. 7. 8.

9.

10. 11. 12. 13. 14. 15. 16.

17. 18. 19.

Cermin Dunia Kedokteran No. 145, 2004 33

HASIL PENELITIAN

Diagnosis Laboratorium Infeksi Saluran Reproduksi dari Para Pekerja Seksual Wanita di Banyuwangi Juni 2003
Eko Rahardjo
Pusat Penelitian dan Pengembangan Pemberantasan Penyakit Badan Penelitian dan Pengembangan Kesehatan Departemen Kesehatan RI, Jakarta

PENDAHULUAN 1. Latar Belakang Prevalensi HIV pada pekerja seks wanita (PSW) di Indonesia telah meningkat dari nol pada tahun 1998 menjadi 8% di Kepulauan Riau dan 26,5% di Kota Merauke pada tahun 2000(1). Beberapa tempat surveilans sentinel HIV sekarang melaporkan prevalensi HIV pada PSW yang cukup tinggi, lebih dari 5%(2). Infeksi Saluran Reproduksi (ISR) diketahui mempermudah penularan HIV tetapi ISR pada PSW di Indonesia baru diukur secara sporadis. Laporan dari beberapa lokasi antara tahun 1999 sampai 2001 menunjukkan prevalensi infeksi gonore dan chlamydia yang tinggi antara 20-35%(3-8) dan prevalensi serologi sifilis positif sebesar 12,9%(3). Data dasar IMS/ISR diperlukan untuk mengamati perjalanan penyakit dan untuk advokasi sumber daya dan intervensi, penelitian ini akan membangun data dasar untuk merancang intervensi yang tepat, memantau dan mengukur efektivitas program. Diagnosis laboratorium dari duh tubuh dan serum PSW merupakan salah satu data dasar yang diperlukan untuk mengamati perjalanan penyakit, advokasi sumber daya, dan interfensi. Tujuan a. Tujuan Umum Melakukan diagnosis laboratorium agar diketahui jenis organisme penyebab infeksi pada PSW sehingga dapat untuk menentukan langkah kebijakan oleh pelaksana program. b. Tujuan Khusus
Disampaikan Pada: Pelatihan Pengelolaan Infeksi Menular Seksual, Palembang, Sumatera Selatan, 12-14 September 2003

Mengetahui prevalensi organisme penyebab infeksi antara lain : - Neisseria gonorrhoea - Chlamydia trachomatis - Treponema pallidum - Trichomonas vaginalis - Bacterial vaginosis - Candidiasis di kalangan PSW di Banyuwangi Jawa Timur. Data yang dihasilkan akan menjadi bahan advokasi dan menjadi informasi dasar untuk memantau intervensi yang sedang berjalan maupun yang masih direncanakan. ALAT DAN BAHAN 1. Alat - 2 buah mikroskop (Olympus CH 20 minimal, jika memungkinkan) - 1 centrifuge dengan kecepatan minimal 1500 rpm - 1 rotator dengan pengatur waktu dan kecepatan (setting 100 rpm) - 2 micropipet multiple volume (0 – 100 µl) - 1 micropipet multiple volume (50 – 200 µl) - 1 micropipet 1 ml - 5 rak tabung @ 12 lubang - 1 tourniquet - 4 pipet pasteur plastik - 3 kotak preparat - Kotak spesimen genprobe 2. Bahan - 3 box @ 100 tabung vacutainer 10 ml - 3 box @ 100 tabung reaksi 5 ml - 3 box @ 200 kapas lidi steril - 3 box syringe 5 ml

34 Cermin Dunia Kedokteran No. 145, 2004

-

3 box kapas alkohol 1 btl @ 500 ml NaCl 0.9% 1 btl @ 100 ml KOH 10% 6 btl @ 100 ml methylene blue 0.1 – 0.3% 1 btl @ 100 ml minyak imersi 1 pak @ 100 lembar kertas lensa 9 pak @ 125 mikropipet tips warna kuning 1 pak @ 500 mikropipet tips warna biru 6 box @ 50 kaca penutup No. 1 10 box @ 72 kaca objek 5 box pengambilan spesimen genprobe untuk wanita @ 50 kit (tabung transport dan 2 kapas lidi dakron) - Kit reagensia RPR @ 500 tes (kartu pemeriksa antigen, batang pengaduk, botol penetes, dan kontrol positif & negatif) - Kit reagensia TPHA @ 200 tes (microplate, sampel diluen, sensitized particles, unsensitized particles dan kontrol positif & negatif) - 3 pak @ 100 lembar kertas pH dengan indikator khusus (3.8 – 5.4) CARA KERJA 1. Gonore Bahan pemeriksaan berasal dari sekret serviks. Diagnosis laboratorium menggunakan sediaan langsung, dengan pewarnaan Gram akan menemukan diplokokus negatif Gram (DNG) intrasel, lekosit polimorfonuklear (PMN) dan DNG ekstrasel. DNG intrasel terutama ditemukan pada kasus akut. 2. Sifilis Diagnosis laboratorium menggunakan serum. Dengan uji RPR (Rapid Plasma Reagin) akan terdeteksi antibodi dari Treponema pallidum. Uji RPR kurang spesifik sehingga diperlukan konfirmasi dengan uji TPHA (Treponema Pallidum Hemagglutination). 3. Uretritis Non Spesifik Uretritis non spesifik (UNS) disebabkan oleh bakteri Chlamydia trachomatis. Bahan yang diperiksa adalah sekret duh tubuh vagina berupa lendir yang jernih sampai keruh. Diagnosis laboratorium dengan pewarnaan Gram ditemukan lekosit polimorfonuklear (PMN) >5 pada pemeriksaan mikroskopis pembesaran 1000x. 4. Vaginosis Bakterial Merupakan sindrom klinik akibat pergantian Lactobacillus spp penghasil H2O2 yang merupakan flora normal di dalam vagina oleh Gardnerella vaginalis dan Mycoplasma hominis, dengan konsentrasi tinggi. Diagnosis laboratorium a. pH vagina Menentukan pH vagina menggunakan kertas pH yang sesuai (interval 4 – 6/7). pH pada BV biasanya berkisar antara 5 - 5.5.(nilai normal - 3.8 – 4.2 ) b. Odor/bau (Whiff Test) Bau amis seperti ikan dapat dikenali dengan pemberian KOH 10% pada sekret vagina dari spekulum; disebabkan adanya pelepasan amin, terutama putresin

dan kadaverin. KOH 10% meningkatkan intensitas bau. c. Clue cells Merupakan sel epitel vagina yang ditutupi oleh berbagai bakteri vagina sehingga memberikan gambaran granular dengan batas sel tidak jelas karena melekatnya bakteri batang atau kokus kecil. 5. Kandidiasis Diagnosis laboratorium pemeriksaan mikroskopik sekret vagina dengan sediaan basah KOH 10% atau dengan pewarnaan Gram. Bentuk invasif terlihat berbentuk ragi (yeast form) - Blastospora bentuk lonjong - Sel tunas - Pseudohifa, seperti sosis panjang bersambung - Kadang-kadang hifa asli bersepta Dalam pewarnaan Gram bentuk ragi kandida bersifat positif . 6. Trikomoniasis Diagnosis laboratorium, sediaan basah dengan bahan berupa apusan forniks posterior dan anterior yang diambil dengan lidi kapas atau sengkelit steril lalu dilarutkan dalam larutan garam fisiologis dan dilihat ada tidaknya T. vaginalis. Untuk mempertajam hasil diagnosis laboratorium cairan sekret serviks juga diperiksa dengan metoda uji gene probes. HASIL Prevalensi IMS Secara umum, terdapat 47% PSW jalanan dan 47% PSW lokalisasi yang sedang terinfeksi salah satu atau lebih IMS yang diteliti. Prevalensi ini tergolong tinggi. Tingginya prevalensi IMS semacam ini meningkatkan risiko penularan HIV sebesar 2-9 kali lipat. Oleh karena itu diperlukan upaya untuk menurunkan prevalensi IMS, yang mencakup pengobatan, pemutusan rantai penularan, dan pencegahan. 1. Gonore Pervalensi Gonore cukup tinggi baik pada PSW lokalisasi (37%) maupun PSW jalanan (29%). Di antara semua PSW yang terinfeksi GO, ternyata hanya 61% yang bergejala, sedangkan 39% yang lain tidak bergejala sama sekali (Gambar 1).

Gambar 1. Prevalensi Gonore pada PSW di Banyuwangi

Cermin Dunia Kedokteran No. 145, 2004 35

2.

Chlamydia Prevalensi infeksi Chlamydia juga cukup tinggi pada PSW lokalisasi (20%) maupun pada PSW jalanan (12%). Di antara mereka yang terinfeksi Chlamydia, 34% tidak

pemberian pengobatan secara berkala pada populasi berisiko tinggi ini merupakan upaya kesehatan masyarakat yang efektif untuk memutus rantai penularan, menurunkan prevalensi, dan mengurangi risiko penyebaran HIV (Gambar 4).

menunjukkan gejala (Gambar 2).
Gambar 2. Prevalensi Chlamydia pada PSW di Banyuwangi Gambar 4. Prevalensi Sifilis pada PSW di Banyuwangi

3.

Infeksi Ganda Gonore dan Chlamydia Ko-infeksi (infeksi ganda) Gonore dan Chlamydia dilaporkan sering terjadi. Pada PSW jalanan yang diteliti, prevalensi infeksi ganda ini sebesar 6%, pada PSW lokalisasi 12%. Pada infeksi ganda ini 33% tidak menunjukkan gejala sama sekali (Gambar 3).

5.

Trichomoniasis vaginalis Prevalensi Trichomoniasis vaginalis pada PSW jalanan 15%, sedangkan pada PSW lokalisasi 6%. Secara keseluruhan, ternyata 94% kasus tidak menunjukkan gejala (Gambar 5).

Gambar 3. Prevalensi ganda Gonore & Chlamydia pada PSW di Banyuwangi

Gambar 5. Prevalensi Trichomoniasis pada PSW di Banyuwangi

4.

Sifilis Prevalensi sifilis dini pada PSW jalanan maupun PSW lokalisasi besarnya sama, yaitu 3%. Pada pemeriksaan fisik, 86% kasus sifilis dini tidak menunjukkan gejala. Prevalensi sifilis laten lanjut lebih besar pada PSW jalanan (18%) dibandingkan pada PSW lokalisasi (6%). Mengingat banyaknya kasus yang tidak menunjukkan gejala, dapat dipastikan sebagian terbesar PSW dengan sifilis tidak akan mencari pengobatan; dengan demikian, rantai penularan akan terus berlanjut. Skrining dan

6.

Bacterial Vaginosis dan Vaginal Candidiasis PSW lokalisasi memiliki prevalensi Bacterial Vaginosis sebesar 63%, PSW jalanan 44%. Sedangkan prevalensi Vaginal Candidiasis pada kedua kelompok sama besar, 6%. Kedua infeksi ini bukan IMS melainkan Infeksi Saluran Reproduksi (ISR). Walupun bukan IMS, kedua infeksi ini mengakibatkan gangguan epitel vagina yang meningkatkan kerawanan terhadap infeksi HIV (Gambar 6).

36 Cermin Dunia Kedokteran No. 145, 2004

lokalisasi didapat 9% dan di jalanan 21%, melebihi rata-rata nasional. Trichomonas vaginalis Prevalensi T. vaginalis pada PSW jalanan 15% sedangkan dari lokalisasi 6%. sedangkan pada penelitian sebelumnya di Jawa Timur 7.4%, jadi prevalensi pada PSW jalanan 2 kali lebih tinggi dibanding penelitian sebelumnya, namun prevalensi di lokalisasi sedikit lebih rendah. Bacterial vaginosis dan Vaginal candidiasis Bacterial vaginosis PSW lokalisasi dan PSW jalanan masing-masing 63% dan 44%, sedangkan vaginal candidiasis pada dua kelompok sama besarnya yaitu 6%. Penelitian sebelumnya di Jawa Timur, bacterial vaginosis 17.8% sedangkan vaginal candidiasis 0.9%, jadi pada penelitian ini keduanya jauh lebih tinggi dari penelitian sebelumnya. KESIMPULAN Prevalensi dari enam jenis ISR/IMS yang diteliti ternyata tinggi.

Gambar 6. Prevalensi Bacterial Vaginosis pada PSW di Banyuwangi

PEMBAHASAN Gonore Prevalensi Gonore pada PSW lokalisasi dan jalanan di Banyuwangi adalah 37% dan 29%.Pada penelitian sebelumnya, pervalensi tertinggi dijumpai di Jawa Timur, yaitu 38% dan terendah di Sulawesi Utara 19,6%(7), sedangkan di daerah lainnya berkisar antara 29,7% - 34%(3-6). Jadi hasil yang diperoleh pada PSW lokalisasi cukup tinggi sedangkan pada PSW jalanan hampir mendekati prevalensi rata-rata di Indonesia. Chlamydia Prevalensi Chlamydia di kalangan PSW lokalisasi yaitu 20%, sedangkan pada PSW jalanan 12%, penelitian sebelumnya di Jember dan Tulung Agung (Jawa Timur) prevalensi rata-rata Chlamydia 16.1%. Jadi hasil di lokalisasi lebih tinggi dibanding sebelumnya, tetapi pada PSW di jalanan lebih rendah. Infeksi Ganda Gonore dan Chlamydia Pada penelitian sebelumnya di Jawa Timur, infeksi ganda Gonore dan Chlamydia 44,3% sedangkan pada penelitian ini hasilnya 12% (lokalisasi) dan 6% (jalanan), jauh lebih rendah. Sifilis Prevalensi sifilis dini pada penelitian ini baik di lokalisasi dan jalanan masing-masing 3%, sedangkan prevalensi sifilis laten pada PSW lokalisasi dan jalanan masing-masing 6% dan 18%. Penelitian sebelumnya di Jawa Timur tidak melakukan diagnosis sifilis, sedangkan penelitian di Kupang mendapatkan 12,9%; prevalensi sifilis di Indonesia umumnya kurang dari 5%(3). Bila hasil sifilis dini dan laten digabung maka di

KEPUSTAKAAN 1. HIV/AIDS in Indonesia: Challenges and Opportunities for Action, National AIDS Control Board, Jakarta, 2001 2. Quarterly HIV Surveillance Report. Indonesian Ministry of Health, September, 2002. 3. Miller P, Otto B. .Prevalence of sexually transmitted infections in selected populations in Indonesia. Indonesia HIV/AIDS and STD Prevention and Care Project, AusAID 2001. 4. Silitonga N1, Donegan E2, Wignall FS1, Moncada J2. Schacter J2 Prevalence of N gonorrhoeae and C trachomatis Infection among Commercial Sex Workers in Timika Irian Jaya, Indonesia. 1PT Freeport Indonesia, Timika, Irian Jaya and 2University of California San Francisco, CA ISSTDR, Denver,1999. 5. Surjadi et al. Second Assessment of Sexually Transmitted Disease Prevalence of Commercial Female Sex Workers in North Jakarta, Surabaya, Manado, Indonesia., Indonesian Epidemiology Network, January 2000. 6. Rosana Y, Sjahrurachman A, Sedyaningsih ER, Simanjuntak CH, Arjoso S, Daili SF, Judarsono J, Ningsih I. Studi resistensi N. gonorrhoeae yang diisolasi dari pekerja seks komersial di beberapa tempat di Jakarta (Antimicrobial susceptibility pattern of N. gonorrhoeae isolated from female commercial sex workers in Jakarta.) J. Mikrobiol. Indon. 1999; 4(2): 60-3. 7. Sedyaningsih ER, Rahardjo E, Lutam B, Oktarina, Sihombing S. Harun S. Validasi pemeriksaan infeksi menular seksual secara pendekatan sindrom pada kelompok wanita berperilaku risiko tinggi. Bul. Penelit. Kes. 2001; 28(3-4), 460-67. 8. Preliminary Report: National Population Sizes Estimate, Indonesian Ministry of Health, October 2002. 9. Standard Procedure of HIV Sentinel Surveillance, Ministry of Health Republic of Indonesia, Directorate General CDC, Jakarta 1999.

Better say nothing than nothing to the purpose.

Cermin Dunia Kedokteran No. 145, 2004 37

OPINI

Masalah Gender dan Kesehatan
Sunanti Zalbawi, Kartika Handayani
Pusat Penelelitian Ekologi Kesehatan, Badan Penelitian dan Pengembangan Kesehatan, Departemen Kesehatan RI, Jakarta

PENDAHULUAN Kesetaraan perempuan dan laki-laki telah menjadi pembicaraan hangat dalam 20 tahun terakhir. Melalui perjalanan panjang untuk meyakinkan dunia bahwa perempuan telah mengalami diskriminasi hanya karena perbedaan jenis kelamin, dan perbedaan secara sosial (gender), akhirnya pada tahun 1979 Perserikatan Bangsa-Bangsa (PBB) menyetujui Konferensi mengenai penghapusan segala bentuk diskriminasi terhadap perempuan. Konferensi ini lebih dikenal dengan istilah CEDAW dan menjadi acuan utama untuk Hak Asasi Perempuan (HAP). Konferensi ini sebenarnya telah diratifikasi oleh Indonesia pada tahun 1984 menjadi UU No. 7/1984, tetapi tidak pernah disosialisasikan dengan baik oleh negara. Konferensi maupun UU tersebut pada kenyataannya tidak juga sanggup menghapus diskriminasi yang dialami oleh perempuan. Di seluruh dunia masih ada perempuan yang mengalami segala bentuk kekerasan (kekerasan fisik, mental, seksual dan ekonomi) baik di rumah, di tempat kerja maupun di masyarakat. Oleh karena itu PBB kembali mengeluarkan deklarasi Penghapusan Kekerasan terhadap Perempuan pada tahun 1993. Deklarasi ini tidak begitu dikenal oleh pemerintah Indonesia, sehingga jarang diacu dalam persidangan ataupun dalam penyelesaian masalah-masalah hukum yang berhubungan dengan kekerasan berbasis gender. (Qomariah, 2002) Pada dasarnya semua orang sepakat bahwa perempuan dan laki-laki berbeda. Manakah perbedaan yang dialami (pemberian Tuhan) dan manakah yang dipelajari atau diperoleh atau perbedaan yang dibangun oleh masyarakat sendiri ? Ketidak setaraan antara perempuan dan laki-laki berawal dari kerancuan pemahaman antara perbedaan alami dan yang tidak alami tersebut. Tulisan ini merupakan tinjauan pustaka mengenai masalah gender dan kesehatan khususnya bagi masyarakat Indonesia.

Gender Perbedaan alami yang dikenal dengan perbedaan jenis kelamin sebenarnya hanyalah segala perbedaan biologis yang dibawa lahir antara perempuan dan laki-laki. Di luar semua itu adalah perbedaan yang dikenal dengan istilah gender. Perbedaan yang tidak alami atau perbedaan sosial mengacu pada perbedaan peranan dan fungsi yang dikhususkan untuk perempuan dan laki-laki. Perbedaan tersebut diperoleh melalui proses sosialisasi atau pendidikan di semua institusi (keluarga, pendidikan, agama, adat dan sebagainya). Gender penting untuk dipahami dan dianalisis untuk melihat apakah perbedaan yang bukan alami ini telah menimbulkan diskriminasi dalam arti perbedaan yang membawa kerugian dan penderitaan terhadap perempuan. Apakah gender telah memposisikan perempuan secara nyata menjadi tidak setara dan menjadi subordinat oleh pihak lakilaki. Gender adalah semua atribut sosial mengenai laki-laki dan perempuan, misalnya laki-laki digambarkan mempunyai sifat maskulin seperti keras, kuat, rasional, gagah. Sementara perempuan digambarkan memiliki sifat feminin seperti halus, lemah, perasa, sopan, penakut. Perbedaan tersebut dipelajari dari keluarga, teman, tokoh masyarakat, lembaga keagamaan dan kebudayaan, sekolah, tempat kerja, periklanan dan media. Gender berbeda dengan seks. Seks adalah jenis kelamin laki-laki dan perempuan dilihat secara biologis. Sedangkan gender adalah perbedaan laki-laki dan perempuan secara sosial; masalah atau isu yang berkaitan dengan peran, perilaku, tugas, hak dan fungsi yang dibebankan kepada perempuan dan lakilaki. Biasanya isu gender muncul sebagai akibat suatu kondisi yang menunjukkan kesenjangan gender. (Retno Suharti, 1995). Karena citra ideal itu rekaan budaya, disebut juga sebagai gender, dalam kenyataannya, tidak selalu demikian. Kita tahu ada saja perempuan yang tidak lemah lembut, yang agresif, pencari nafkah, dan de facto sebagai kepala keluaga.

38 Cermin Dunia Kedokteran No. 145, 2004

Sebaliknya kita juga sering menemui laki-laki yang lemah lembut, de facto bukan pencari nafkah, dsb. Akan tetapi gambaran gender itu tetap menjadi pedoman hidupnya dalam melihat dirinya maupun dalam melihat lawan jenisnya. Sebab itu bagi sebagian besar perempuan, yang masih kental dipengaruhi oleh gambaran ideal gender, akan sulit sekali keluar dari gambaran ideal itu, meskipun barangkali perempuan itu sudah berpendidikan tinggi, dengan jabatan struktural/fungsional, pernah tinggal/hidup di kebudayaan lain, dsb, karena memang sudah menjadi kebudayaannya. Keadaan ini juga yang menjadi hambatan bagi perempuan untuk “tampil” dan berpartisipasi di domain yang secara budaya bukan domainnya. Ada rasa risi. Pekerjaan di kantor dalam hubungan citra budaya, bukanlah tempat perempuan. Kalaupun mereka bekerja, karena berbagai alasan memang harus bekerja, jarang mau “menonjolkan diri”, karena takut dijuluki berambisi atau agresif. Sebab itu banyak dari perempuan-perempuan yang berpotensi, dengan latar belakang pendidikan yang tinggi, tidak mengembangkan kemampuannya. Padahal perempuan yang jumlahnya lebih dari separuh itu seharusnya merupakan sumber daya manusia yang potensial dan berkualitas. Dengan pendekatan gender, masalah-masalah yang dihadapi perempuan tidak dilihat terpisah. Dengan pendekatan ini, harus dipastikan bahwa perempuan seperti juga dengan laki-laki, mempunyai akses yang sama terhadap sumbersumber dan kesempatan. Ada paling sedikit empat faktor, yaitu : (1) konsep dalan kebijaksanaan dan program harus mencerminkan pengalaman laki-laki dan juga perempuan, (2) Perempuan harus dipastikan ikut mempunyai akses dan mempunyai kontrol terhadap program, (3) dalam formulasi kebijaksanaan perencanaan maupun implementasinya perempuan harus ikut berpartisipasi, (4) Dalam evaluasi dan monitoring harus ada sistem yang memperlihatkan dampak program terhadap perempuan. (Retno Suhapti, 995). Teori gender adalah teori yang membedakan peran antara perempuan dan laki-laki yang mengakibatkan perbedaan perlakuan antara perempuan dan laki-laki dalam masyarakat (Squire 1989). Perbedaan ini tampaknya berawal dari adanya perbedaan faktor biologis antara perempuan dan laki-laki. Perempuan memang berbeda secara jasmaniah dari laki-laki, perempuan mengalami haid, dapat mengandung, melahirkan serta menyusui yang melahirkan mitos dalam masyarakat bahwa perempuan berhubungan dengan kodrat sebagai ibu. Banyak teori psikologi yang mendukung teori gender dan mereka mengembangkan pendapat bahwa perempuan dan lakilaki memang secara kodrat berbeda serta mempunyai ciri-ciri kepribadian yang berbeda. Menurut Lever (Gilligan 1989) perbedaan ciri-ciri kepribadian perempuan dan laki-laki terlihat sejak masa kanak-kanak: 1.

2.

Permainan anak laki-laki lebih bersifat kompetitif dan konstruktif. Ini disebabkan anak laki-laki lebih tekun dan lebih efektif dari anak perempuan 3. Permainan anak perempuan lebih banyak bersifat kooperatif dan lebih banyak berada di dalam ruangan. Perbedaan-perbedaan biologis dan psikologis ini menimbulkan pendapat atau suatu kesimpulan di masyarakat yang pada umumnya merugikan pihak perempuan. Kesimpulan itu antara lain : 1. Laki-laki lebih unggul dan lebih pandai dibanding anak perempuan 2. Laki-laki lebih rasional dari anak perempuan 3. Perempuan lebih diharapkan menjadi istri dan ibu (Retno Suhapti,1995). Menurut Shainess Squire (1989) perbedaan ini timbul karena teori gender diciptakan oleh laki-laki, dan dikembangkan berdasarkan norma dan sudut pandang laki-laki yang terkadang salah menginterpretasikan perempuan sehingga menimbulkan diskriminasi atau kerugian di pihak perempuan. Menurut Maccoby (1979) perbedaan perilaku bagi perempuan dan laki-laki sebenarnya timbul bukan karena faktor bawaan sejak lahir tetapi lebih disebabkan karena sosial budaya masyarakat yang membedakan perlakuan terhadap perempuan dan laki-laki sejak awal masa perkembangan (masa kanakkanak). Di samping faktor biologis, bentuk tatanan masyarakat yang pada umumnya patriarchal juga membuat laki-laki lebih dominan dalam sistem keluarga dan masyarakat; hal ini sangat merugikan kedudukan perempuan (Mohanty, 1988).

Masalah Gender di Indonesia Di Indonesia, di lingkungan pemerintah maupun swasta, perempuan yang telah berhasil menduduki jabatan tinggi masih sedikit dibandingkan dengan kaum laki-lakinya. Meskipun kita mempunyai menteri wanita, duta besar wanita, jenderal wanita, kita belum mempunyai gubernur. Memang belum biasa bagi seorang perempuan untuk mengepalai jabatan tinggi administrasi di Indonesia. Jabatanjabatan administratif tertinggi pernah dijabat dulu adalah sebagai bupati, walikota, mulai banyak sebagai camat dan lurah. (Yulfira Raharjo, 1995). Dan sekarang jabatan paling tinggi di Indonesia yaitu presiden dipegang oleh seorang wanita Dalam jumlah, perempuan merupakan mayoritas, ironinya sebagian besar dari mahluk perempuan ini “tidak terlihat”, lebih banyak yang buta huruf, lebih banyak yang menjadi buruh. Kesempatan yang diberikan di bidang pendidikan dan peluang untuk menduduki jabatan eksekutif pada umumnya baru dinikmati oleh segelintir perempuan saja. (Yulfira Raharjo, 1995). Dalam budaya Jawa istri itu sebagai “konco wingking” artinya teman belakang, sebagai teman dalam mengelola rumah tangga khususnya urusan anak, memasak, mencuci dan lainlain Citra, peran dan status sebagai perempuan, telah diciptakan Anak laki-laki lebih banyak memperoleh kesempatan bermain di luar rumah dan mereka bermain lebih lama dari oleh budaya. Citra bagi seorang perempuan seperti yang diidealkan oleh budaya, antara lain lemah lembut, penurut, anak perempuan tidak membantah, tidak boleh “melebihi” laki-laki, peran yang

Cermin Dunia Kedokteran No. 145, 2004 39

diidealkan seperti pengelola rumah tangga, sebagai pendukung karier suami, status yang diidealkan seperti pengelola rumah tangga, istri yang penurut, dan ibu yang “merantasi”. Citra yang dibuat untuk laki-laki, antara lain, “serba tahu”, sebagai panutan, harus “lebih” dari perempuan, rasional, agresif, peran laki-laki yang ideal adalah sebagai pencari nafkah keluarga, pelindung, “mengayomi”, sedangkan status idealnya adalah kepala keluarga. (Yulfira Raharjo, 1995). Sebenarnya kita telah mempunyai basis legal yang menjamin hak dan kesempatan bagi laki-laki dan perempuan. Akan tetapi masih banyak kendala budaya dan struktural yang membuat perempuan masih menghadapi kesulitan, khususnya dalam hal partisipasinya dalam mengambil keputusan dan kekuasaan. Saya melihat lingkungan dan struktur budaya tidak banyak mendukung terciptanya partisipasi penuh dari perempuan dalam dunia politik maupun dalam mengambil keputusan. KONSEP GENDER DALAM REALITAS KEHIDUPAN Telah disebut di atas bahwa perbedaan perlakuan antara perempuan dan laki-laki mempengaruhi kehidupan perempuan dan laki-laki baik secara langsung maupun tidak langsung di masyarakat. Hal ini dapat kita lihat di : a. Lingkungan keluarga Keluarga adalah tempat terpenting bagi seseorang karena merupakan tempat pendidikan yang pertama kali, dan di dalam keluarga pula seseorang paling banyak bergaul serta mengenal kehidupan. Menurut teori gender kedudukan yang terpenting bagi perempuan dalam keluarga adalah sebagai istri dan ibu yang mengatur jalannya rumah tangga serta memelihara anak (Beechey 1986:126). Untuk menjalankan tugas sebagai istri dan ibu perempuan diharapkan dapat memasak, menjahit, memelihara rumah serta melahirkan. Sehubungan dengan tugas ini alangkah baiknya bila kedudukan seorang istri di rumah. Sebaliknya, menurut ideologi ini kedudukan laki-laki yang terpenting dalam suatu keluarga adalah sebagai seorang suami yang bertanggung jawab sebagai pencari nafkah utama. Karena tugasnya sebagai pencari nafkah sering seorang suami tidak peduli dan tidak mau tahu dengan urusan rumah tangga, sebab dia merasa sudah memberi uang untuk jalannya roda rumah tangga (Smith 1988:154). Bila melihat kondisi masyarakat pada saat ini, tampak konsep-konsep di atas sudah agak bergeser. Banyak istri yang bekerja mencari nafkah di luar rumah. Penghasilan istri juga berfungsi menambah penghasilan. Istri yang bekerja mencari nafkah di luar rumah biasanya harus mendapat persetujuan terlebih dulu dari suami. Pada umumnya hingga saat ini meskipun istri bekerja, sang suami tetap tidak ingin bila posisi dan penghasilan yang diperoleh istri melebihi sang suami dan penghasilan suami tetap merupakan penghasilan pokok bagi keluarga. Di samping istri bekerja mencari nafkah di luar rumah tanggung jawab urusan rumah tangga tetap ada di pihak istri sehingga dapat dibayangkan beratnya beban yang ditanggung oleh seorang istri bila ia bekerja di luar rumah. (Abbott and Sapsford 1987).

Meskipun perempuan sudah dapat bekerja di luar rumah, pada saat ini masih tetap tampak berlakunya konsep gender, sebagai contoh istri yang bekerja masih harus memperhitungkan perasaan suami dengan tidak mau meraih posisi yang lebih tinggi dari suami sehingga sering mereka bekerja tanpa ambisi. Sering timbul dilema bagi dirinya untuk memilih antara karier dan keluarga. b. Lingkungan Pendidikan Di bidang pendidikan tampak bahwa konsep gender juga dominan. Sejak masa kanak-kanak ada orangtua yang memberlakukan pendidikan yang berbeda berdasarkan konsep gender ;sebagai contoh kepada anak perempuan diberi permainan boneka sedang anak laki-laki memperoleh mobilmobilan dan senjata sebagai permainannya. Bila diingat bahwa pada jaman kartini berlaku perbedaan pendidikan bagi anak perempuan dan laki-laki, tampaknya saat ini juga masih demikian. Sebagai contoh masyarakat kita masih menganggap bahwa anak perempuan lebih sesuai memilih jurusan bahasa, pendidikan atau pendidikan rumah tangga, sebaliknya anak laki-laki lebih sesuai untuk jurusan teknik. Perempuan dianggap lemah di bidang matematika, sebaliknya laki-laki dianggap lemah di bidang bahasa. Pada keluarga yang kondisi ekonominya terbatas banyak dijumpai pendidikan lebih diutamakan bagi anak laki-laki meskipun anak perempuannya jauh lebih pandai, keadaan ini menyebabkan lebih sedikitnya jumlah perempuan yang berpendidikan. (Millar 1992). c. Lingkungan Pekerjaan Sejak kaum perempuan dapat memperoleh pendidikan dengan baik jumlah perempuan yang mempunyai karier atau bekerja di luar rumah menjadi lebih banyak. Mednick (1979) berpendapat meskipun jumlah kaum perempuan yang bekerja meningkat tetapi jenis pekerjaan yang diperoleh masih tetap berdasar konsep gender. Kaum perempuan lebih banyak bekerja di bidang pelayanan jasa atau pekerjaan yang membutuhkan sedikit keterampilan seperti di bidang administrasi, perawat atau pelayan toko dan hanya sedikit yang menduduki jabatan manager atau pengambil keputusan (Abbott dan Sapsford 1987). Dari segi upah masih banyak dijumpai bahwa kaum perempuan menerima upah lebih rendah dari laki-laki untuk jenis pekerjaan yang sama, juga perbedaan kesempatan yang diberikan antara karyawan perempuan dan laki-laki di mana laki-laki lebih diprioritaskan. Dari perbedaan perlakuan tersebut banyak yang kemudian menyimpulkan, menggolongkan dan kemudian menganggap perempuan sebagai orang yang lemah, pasif serta dependen dan menganggap laki-laki lebih berharga. Akibatnya banyak orang lebih menghargai dan memilih mempunyai anak laki-laki dibanding dengan anak perempuan (Mednick, 1979) Menuju Langkah Baru Merasa bahwa perempuan diperlakukan tidak adil di masyarakat karena adanya konsep gender membuat sebagian feminis ahli psikologi sadar dan menganalisis kesalahan dari teori gender. Mereka mengajak seluruh masyarakat terutama kaum perempuan untuk sadar bahwa selama ini mereka diperlakukan tidak adil oleh konsep gender dan

40 Cermin Dunia Kedokteran No. 145, 2004

mengembangkan suatu konsep baru yang mengkikis perbedaan perlakuan bagi perempuan dan laki-laki. Harus disadari bahwa konsep atau ideologi gender membuat manusia menjadi terkotak-kotak. Konsep baru ini diharapkan dapat memberi kesempatan dan kedudukan yang sejajar bagi perempuan maupun laki-laki untuk membuat keputusan bagi dirinya sendiri tanpa harus berorientasi pada konsep gender (Millar, 1992). Gender dan Kesehatan Dari uraian di atas tampak bahwa perlakuan yang diterima oleh kaum perempuan selama ini tidak adil, perempuan tidak mendapat kesempatan yang sama dengan laki-laki. Perjuangan untuk mendapatkan kesempatan yang sama dan kedudukan yang sejajar bagi perempuan dan laki-laki di masyarakat bukanlah perjuangan yang mudah karena melawan atau mengubah tatanan apapun yang sudah mapan merupakan suatu hal yang sulit. Untuk itu dibutuhkan kemauan yang keras, kaum perempuan harus mengejar ketinggalannya dari kaum laki-laki akibat kesempatan yang tidak didapat sebelumnya. Penelitian menunjukkan bahwa untuk menjadi sejajar antara perempuan dan laki-laki di negara negara maju seperti di Amerika Serikat dan Inggris saja membutuhkan waktu sekitar 50 tahun lagi, bagaimana dengan kondisi di Indonesia ? (Kompas 28 Juni 1995) Kesehatan wanita memang menjadi dilema dalam pembangunan kesehatan di Indonesia. Banyak program pembangunan kesehatan yang ditujukan untuk wanita terbilang kurang berhasil. Sebagai contoh adalah pemberian pil besi yang telah dilakukan selama bertahun-tahun, namun masih gagal untuk mengurangi anemia wanita hamil. Di masa mendatang, bukan saja anemia, berbagai penyakit lain yang terbilang lebih sulit pengobatannya akan menjadi masalah; kanker khusus wanita, seperti rahim dan payudara, menunjukan prevalensi yang semakin meningkat. Penyakit lain, seperti HIV/AIDS juga akan lebih prevalen di tahun-tahun mendatang (Rahmat, 1995). Perempuan Indonesia masih diperlakukan tidak adil dan masih merupakan masyarakat nomor dua. Masih banyak orang Indonesia yang berpendapat bahwa tempat yang paling utama bagi kaum perempuan adalah di rumah sebagai istri dan ibu pendidik bagi anak-anaknya. Bila dibutuhkan, perempuan Indonesia bisa bekerja mencari nafkah di luar rumah tetapi pendapatan yang diperolehnya biasanya bukan merupakan pendapatan pokok dalam rumah tangga tersebut. Pada saat ini di Indonesia jumlah perempuan yang bekerja sudah meningkat bila dibanding dengan kondisi 20 tahun yang lalu meskipun tetap belum seimbang dengan laki-laki;, 55% dari total populasi Indonesia adalah perempuan tetapi hanya 40 % dari kaum perempuan yang bekerja (UNDP 1994:162). GBHN dan penjabarannya intinya menyebutkan bahwa perempuan Indonesia berfungsi sebagai isteri pengatur rumah tangga, sebagai tenaga kerja di segala bidang dan sebagai pendidik bagi anak-anaknya. Konsep ini membuat perempuan menjadi bingung untuk memilih antara terjun dalam kegiatan di luar rumah dan menjadi isteri serta ibu yang baik. Konsep ini tampaknya sangat berat untuk bisa dilakukan secara pro-

porsional oleh kaum perempuan dan menjadi tidak adil bila hal ini harus dibebankan pada kaum perempuan. Tembakau telah dikenali sebagai suatu faktor penyebab ketidaksetaraan jender (gender inequity) dan merongrong prinsip-prinsip hak kesehatan wanita dan anak-anak sebagai hak azasi manusia yang mendasar. Wanita mempunyai risiko yang spesifik jender dari tembakau dan Asap Rokok yang berasal dari Lingkunagan (ARL) atau Environmental Tobacco Smoke (ETS) berupa dampak negatif pada kesehatan reproduktif dan komplikasi-komplikasi selama kehamilan (Wasis Sumartono, 2000) Penelitian di Nusa Tenggara Timur menunjukkan bahwa peran suami dalam menentukan tempat dan penolong persalinan pada umumnya masih rendah, hanya 24.9 % suami (18.8% di pedesaan dan 29.2 % di perkotaan) ikut menganjurkan tempat persalinan. Dalam kondisi darurat seharusnya orang yang ada di sekelilingnya banyak membantu menganjurkan dan mengambil keputusan dalam penentuan tempat persalinan, terutama suaminya. Hal ini disebabkan oleh faktor kebiasaan/adat, sosial ekonomi dan kesediaan sarana pelayanan kesehatan ibu. Permasalahan pembangunan berwawasan gender pada dasarnya adalah masalah pembangunan pada umumnya, tetapi dengan penekanan masalah ketimpangan antara kaum laki-laki dan kaum perempuan, dan mengangkat permasalahan yang khusus melekat pada keadaan kaum perempuan, seperti masalah kesehatan reproduksi dan masalah kekerasan dalam keluarga dan tempat kerja (Mely G Tan, 1994) Perempuan di beberapa negara bekerja lebih lama daripada laki-laki dan kemungkinan setengah dari jumlah waktu kerja perempuan dipergunakan untuk pekerjaan yang tidak dibayar. Penghasilan perempuan merupakan faktor penting dalam menentukan kualitas kehidupan yang secara langsung berdampak pada kesehatan, perkembangan dan kesejahteraan menyeluruh di dalam keluarga mereka. Dikatakan juga masalah reproduksi kesehatan berkaitan dengan ketidakamanan yang berhubungan dengan kemiskinan. Perempuan miskin lebih banyak memiliki anak yang tidak diinginkan karena kurang mendapatkan akses terhadap pelayanan dan informasi kesehatan reproduksi. Kemungkinan terkena infeksi menular seksual, termasuk HIV/AIDS, menambah risiko yang akan dihadapi oleh perempuan; ketidakadilan gender sering menghilangkan kemampuan perempuan untuk menolak praktek-praktek berisiko kekerasan seksual dan perilaku seksual, membuat perempuan tidak mendapat informasi mengenai pencegahan dan menempatkan mereka di urutan terakhir dalam pelayanan dan tindakan untuk menyelamatkan kehidupan ( Ahmad Fauzi dkk. 2002). Peningkatan pendidikan perempuan telah terbukti mempunyai kontribusi yang sangat besar untuk menurunkan angka anak kurang gizi, lebih penting dari perubahan dalam ketersediaan makanan. Pendidikan ibu menghasilkan peningkatan gizi. Menghilangkan kesenjangan gender dalam pendidikan juga membantu perempuan menurunkan tingkat kesuburan dan meningkatkan ketahanan anak. Di negara dengan jumlah anak perempuan yang ke sekolah hanya ½ dari jumlah anak laki-laki ternyata rata-rata jumlah

Cermin Dunia Kedokteran No. 145, 2004 41

kematian bayi per 1000 kelahiran hidup nya 21,1 kali lebih tinggi dari negara yang tidak mempunyai kesenjangan gender (Ahmad Fauzi dkk. 2002). Salah satu penelitian mengenai pandangan budaya dalam tugas pria dan wanita di masyarakat menunjukkan bahwa karena perang suku telah menjadi tradisi sejak kurun waktu lama, makin mantap pula adat menetapkan pembagian tugas pria dan wanita dalam lingkungan kerabat dan komunitas untuk mengakomodasi tradisi itu. Pria bertugas menjaga keamanan kerabat, klen dan kampung dari serangan musuh, sedangkan wanita bertugas menjaga kelangsungan hidup kerabat dan masyarakatnya dengan memelihara ladang untuk menghasilkan bahan makanan, dan memelihara ternak untuk keperluan upacara adat, upacara perdamaian setelah usainya perang suku, dan untuk peningkatan status dan gengsi sosial suami, bila mungkin menjadi panglima perang atau kepala suku. Dalam masa kemudian, ketika perang suku secara resmi telah tidak dibenarkan lagi oleh pemerintah, pria tidak lagi melaksanakan kegiatan perang. Namun ide mengenai tugas budaya mereka sebagai penjaga keamanan tetap dianut. Sebaliknya, wanita tetap dalam tugas budayanya sebagai pelaksana pemenuhan kebutuhan hidup, sehingga pengerjaan ladang sebagai besar merupakan tugas kaum wanita. Beratnya tugas wanita dalam seharinya, yang juga berlangsung sepanjang tahun, dapat dilihat dari gambaran sbb : Pada pagi hari sebelum matahari terbit, kaum wanita telah bangun dan mulai memasang api di tungku mereka, masak air untuk merebus hipere serta mempersiapkan makanan dan minuman untuk bekal di ladang. Kadang-kadang hipere dibakar saja. Setelah kegiatan rumah tangga selesai, para wanita dan anak-anaknya yang masih kecil berangkat ke kebun (ladang), membawa noken yang digantungkan pada dahi. Kantung menjulur, sekaligus menutup punggung . Jumlah noken yang digantungkan di tubuhnya mencapai beberapa buah. Sebuah noken berisi bayinya, noken lain berisi hipere yang dialasi rumput-rumputan, untuk dimakan siang hari di ladang. Masih ada noken lain yang berisi keperluan bekerja di ladang. Babi kecil yang masih memerlukan perawatan yang lebih cermat, dimasukkan ke dalam noken lainnya, atau didekap di dada. Sementara itu tangan kanannya menyunggi tugal atau sekop panjang penggembur tanah. Semua noken tersusun berdasarkan ukuran besar kecil sehingga barang-barang hipere, anak babi dan bayinya tidak menumpuk menjadi satu, melainkan bersusun bertingkat di punggung sang wanita. Tak jarang, antara tiga hingga tujuh buah noken beserta isinya sekaligus tergantung pada punggungnya. Di ladang, wanita mulai dengan menggemburkan tanah, merawatnya baik-baik, menjaga tanaman dari rumput-rumput liar, kemudian memetik hasilnya serta membawanya pulang untuk disimpan dan dimasak. Wanita tidak diharapkan pergi sendirian tanpa suaminya bila akan memasarkan hasil ladangnya. Berjalan di belakang atau di sisi suaminya, seorang istri memikul sendiri hasil ladangnya atau menggantungkannya dalam noken di punggungnya. Sebaliknya, sang suami berjalan tanpa beban apapun selain kadang-kadang menggandeng tangan istrinya. Setelah hasil ladang terjual, uang penghasilan yang diperoleh

akan digunakan oleh suaminya saja. Wanita tidak bebas memiliki uang hasil kerjanya. Tugas wanita yang demikian berat tidak ditunjang oleh kecukupan zat gizi dalam susunan menu mereka sehari-hari. Selain miskinnya kadar gizi dalam menu, masalah sering pula diperberat dengan adanya kecenderungan wanita untuk mengutamakan makanan suami dan anak-anaknya. Dari statisik kesejahteraan rakyat disebutkan bahwa salah satu usaha perbaikan gizi nasional ditujukan pada tenaga kerja wanita (nakerwan) yang merupakan 40.53 % tenaga kerja di Indonesia. (Biro Pusat Statistik, 1995). Usaha-usaha perbaikan gizi tersebut antara lain menurunkan angka anemi gizi besi (AGB) dari 30.0 % pada tahun 1994/1995 menjadi 20.0 % di akhir Pelita (1998/1999). Hasil penelitian mengenai dampak krisis ekonomi menunjukkan bahwa, bagi perempuan di dalam keluarga, krisis juga membawa dampak tersendiri. Dengan bertambah sulitnya kehidupan, banyak keluarga tidak dapat lagi menanggung anggota perempuan dalam keluarganya untuk “menganggur”, sehingga perempuan juga lebih banyak terlibat dalam kegiatankegiatan yang bertujuan menghasilkan uang tunai. Tetapi dengan ketatnya persaingan untuk mendapatkan pekerjaan, perempuan akan menjadi lebih terpuruk untuk mengerjakan pekerjaan “keras” dengan upah yang rendah. Di salah satu desa penelitian di Bekasi, pekerjaan ini misalnya sebagai pemetik kangkung, dengan upah Rp. 2500,- setelah setengah hari berendam di kebun kangkung (Romdiati, 1999), tentunya ini juga berpengaruh terhadap kesehatannya. Karena masa krisis, pengeluaran untuk mendapatkan pelayanan kesehatan di puskesmas, balai pengobatan atau tenaga kesehatan juga dikurangi bahkan dihilangkan, dan diganti dengan obat-obatan yang mudah didapatkan di warung. Bahkan pada kasus-kasus penyakit ringan beberapa keluarga menyatakan hanya membiarkan saja sampai sembuh sendiri,. (Romdiati, 1999; Raharto, 1999). Strategi keluarga mengurangi pengeluaran untuk kebutuhan lain selain pangan pada pokoknya untuk menjaga kelangsungan makan keluarga. Tetapi pada kondisi yang sangat sulit, usaha ini juga tidak berhasil penuh sehingga keluarga juga harus menerapkan strategi lain yaitu mengubah pola konsumsi. Penelitian di salah satu desa di Kebumen menunjukkan bahwa keluarga mengubah pola konsumsi bukan saja pada besaran yang dikonsumsi tetapi juga komposisinya. Makanan yang biasanya menjadi selingan seperti ubi kayu dan pisang, diperbesar porsinya untuk mengurangi komposisi nasi yang harganya melonjak terus. Di Bekasi banyak keluarga yang merasa puas dengan menu sehari-hari yang terdiri nasi dengan sayuran dan sambal, karena sayuran masih dapat diambil dari kebun atau sawah, dan melupakan lauk pauk seperti ikan, telur, tahu dan tempe yang sebelum krisis masih mampu mereka konsumsi. Meningkatnya harga beras akibat krisis yang berkepanjangan juga menyebabkan ada keluarga-keluarga di Bekasi yang bahkan harus mengurangi frekuensi makan, dari tiga kali menjadi dua kali bahkan menjadi sekali bahkan mengganti beras dengan singkong. Penelitian lain di Sriharjo, Yogyakarta yang menemukan keadaan yang sama, keluarga

42 Cermin Dunia Kedokteran No. 145, 2004

juga sudah mulai mengubah pola konsumsi serta menekan pengeluaran non pangan (Made K, 1998). Anak-anak, selain ikut melaut selagi krisis juga terpaksa menjadi buruh angkut ikan di TPI Muara Baru (Dalyo, 1999). Pada masa krisis banyak perempuan anggota keluarga yang tadinya tidak terlibat dalam kegiatan mencari uang tunai sekarang harus ikut terlibat, karena keluarga sudah tidak mampu lagi menanggung anggota keluarganya untuk “menganggur”. Pekerjaan sebagai kuli pemetik kangkung bagi wanita di salah satu desa di Bekasi semakin banyak diminati, baik oleh ibu rumah tangga maupun anak-anak perempuan, yang biasanya tidak terlibat dalam pekerjaan ini. Selain itu keterlibatan anak-anak juga meningkat dari sekedar mencari uang jajan menjadi kontribusi terhadap kebutuhan sehari-hari keluarga. Ada kecenderungan keterlibatan anak-anak dalam kegiatan mencari uang tunai meningkat karena terbatasnya akses orangtua mereka (Romdiati, 1999). Keterlibatan anak-anak dalam kegiatan ini secara tidak langsung berhubungan dengan kelangsungan pendidikan mereka. Sriharjo (Jawa Tengah), pekerjaan “nderep” yang biasanya dilakukan orangtua, pada masa krisis juga dilakukan oleh anakanak mereka yang kehilangan pekerjaannya di kota (Made K, 1998). Keterlibatan anak dalam kegiatan mencari uang tunai juga dijumpai di kelurahan Kalibaru; anak-anak di bawah usia 10 tahun juga terlibat membantu orangtuanya mengupas kerang. Mereka bekerja selepas pulang sekolah sampai sore, bahkan ada beberapa keluarga yang anak-anaknya harus putus sekolah untuk membantu orangtuanya sebagai buruh pengupas kerang (Dalyo, 1999). Di masyarakat, gender menentukan bagaimana dan apa yang harus diketahui oleh laki-laki dan perempuan mengenai masalah seksualitas, termasuk perilaku seksual, kehamilan dan penyakit menular seksual (PMS). Konstruksi sosial mengenai atribut dan peran feminin ideal menekankan bahwa ketidaktahuan seksual, keperawanan, dan ketidaktahuan perempuan mengenai masalah seksual merupakan tanda kesucian. Data juga menunjukkan bahwa perbedaan definisi budaya diaplikasikan kepada laki-laki yang diharapkan lebih berpengetahuan dan berpengalaman sehingga mengambil posisi sebagai pengambil keputusan dalam masalah seksual. Penelitian juga membuktikan bahwa pandangan gender ini juga merupakan bagian dari proses sosialisasi sejak kanak-kanak dan bagaimana pengetahuan ini tertanam di antara laki-laki dan perempuan. Misalnya kemampuan remaja perempuan untuk mencari informasi atau membicarakan mengenai seks dibatasi oleh norma budaya yang kuat mengenai keperawanan. Remaja perempuan takut mencari informasi mengenai seks atau kondom karena menjadikan mereka dianggap aktif seksual tanpa memandang aktifitas seksual yang sebenarnya. Juga, jika keluarga mereka mengetahui bahwa mereka mencari pelayanan seksual, maka keperawanannya akan dipertanyakan. Akibatnya perempuan tidak mendapat informasi yang cukup mengenai reproduksi dan seks. Contohnya, remaja perempuan banyak yang tidak mengetahui tubuh mereka

sendiri, kehamilan, kontrasepsi dan PMS. Perempuan miskin dari sebuah negara berkembang menyatakan bahwa mereka tidak mendapatkan informasi apapun tentang seks sebelum pengalaman pertama mereka. Kurangnya informasi ini membatasi kemampuan perempuan untuk melindungi diri mereka sendiri dari HIV, serta malah menimbulkan ketakutan di antara perempuan mengenai penggunaan kondom. Hal itu terjadi karena dalam sebuah studi ditemukan bahwa perempuan takut memakai kondom karena takut tertinggal didalam vagina, lalu pindah ke kerongkongan. Ketakutan lainnya dalam memakai kondom adalah apabila kondom ditarik keluar maka organ reproduksinya akan turut terlepas. Studi lain menunjukkan bahwa kurangnya informasi mengenai tubuh mereka membatasi kemampuan perempuan untuk mengenali gejala gangguan pada organ reproduksinya akibat PMS. Sudah waktunya perempuan dan laki-laki di Indonesia sama-sama berfungsi sebagai pengatur rumah tangga, sebagai tenaga kerja di segala bidang dan sebagai pendidik anak. Mungkin hal ini juga sudah dimulai di beberapa keluarga dari golongan tertentu tetapi jelas belum secara proporsional dan memasyarakat. Dengan tercapainya kondisi ini diharapkan terjalin hubungan lebih harmonis bagi perempuan dan laki-laki di Indonesia. Perempuan juga harus dapat mempunyai kesempatan memilih dan meraih posisi yang sejajar dengan laki-laki di mayarakat. Untuk mewujudkan kondisi ini mau tidak mau kaum perempuan Indonesia harus sadar bahwa selama ini konsep yang berlaku adalah konsep yang berorientasi gender yang membuat membedakan peran antara perempuan dan lakilaki di Indonesia, padahal konsep ini menghambat kesempatan mereka. Kesadaran kaum perempuan Indonesia saat ini sangat dibutuhkan untuk dapat meningkatkan kondisinya di bidang kesehatan, pendidikan, pekerjaan, dll.. Sudah saatnya pula kaum perempuan Indonesia dapat membuat keputusan bagi dirinya sendiri tanpa harus dibebani konsep gender.
KEPUSTAKAAN 1. 2. 3. 4. Ahmad Fauzi. Ketidakadilan Jender menimbulkan Halangan yang Besar terhadap Pembangunan, 2002. Abbott P, Sapsford R. Women and Social Class. London : Tavistock Publ, 1987; pp. 184-185. Aswatini Raharto. Strategi Keluarga dalam Menghadapi Krisis : Temuan dari Lapangan : Lokakarya Pemberdayan Masyarakat dan Jaringan Pengaman Sosial. Jakarta,17 Mei 1999. Badan Penelitian dan Pengembangan Kesehatan. Peningkatan Peran Suami dan Orangtua dalam Upaya Kesehatan Ibu di Propinsi NTT. Badan Penelitian dan Pengembangan Kesehatan RI bekerjasama dengan Direktorat Bina Peran Serta Masyarakat Ditjen Binkesmas Departemen Kesehatan RI, 1998. Biro Pusat Statistik. Statistik Kesejahteraan Rakyat 1994. 1995; hal 2930. Dalyo. Masyarakat Miskin Kota dalam Masa Krisis (Kasus Kelurahan Kalibaru dan Kampung Melayu, DKI Jakarta). Dalam : Tim peneliti Dampak Krisis Ekomoni Terhadap Kehidupan Keluarga Kelompok Rentan : Beberapa kasus, Jakarta: Puslitbang Kependudukan dan Ketenagakerjaan, Lembaga Ilmu Pengetahuan Indonesia (PPT-LIPI) bekerja sama dengan Departemen Sosial, Republik Indonesia, 1999. Hamilton R , Barrett M. The Politics of Diversity. Toronto : Verso, 1986. Gilligan C. In a Different Voice. Massachusetts : Harvard University Press, 1982; p.9.

5. 6.

7. 8.

Cermin Dunia Kedokteran No. 145, 2004 43

9. 10.

11. 12. 13. 14.

15.

16. 17. 18. 19.

Maccoby LE. Woman’s Sociobiological Heritage: Destiny or Free choice ? In Gullahorn J.E (ed). Psychology and Women in Transition. London :John Wiley & Sons. 1979; pp 147 –66. Made K, Pande. Dampak Krisis Terhadap Kehidupan Rumah Tangga Pedesaan, Makalah dalam Workshop Dampak Krisis Terhadap Buruh di Indonesia. Bandung 12-14 Juli 1998. Kerjasama CASA, AKATIGA dan CLARA. Makalah disampaikan pada Forum Komunikasi Eselon I dan II wanita yang diselenggarakan oleh kantor MENUPW, di Jakarta, 6 Januari 1995 Maltin M. The Psychology of Women. London : Harcourt Brace Jovanovich College Publ., 1993. Mednick MTS. The New Psychology of Women. In. Gullahron JE. (ed). Psychology and Women in Transition. London : John Wiley & Sons, 1979; pp 147-166 Tan MG. Sistematika Identifikasi dan Perumusan Pembangunan berwawasan jender. Makalah pada rapat Koordinasi Penyusunan Analisa Situasi Wanita Tingkat Nasional yang diselenggarakan oleh Kantor Menteri Urusan Peranan Wanita, Jakarta 2-3 Maret 1994. Hal. 3 Swasono MF dkk. Masyarakat Dani di kecamatan Kurulu kabupaten Jaya Wijaya, Irian Jaya : Adat-Istiadat dan pengaruhnya terhadap kesehatan. Disampaikan pada Seminar Perilaku dan Penyakit dalam Konteks Perubahan Sosial Kerjasama Program Antropologi Kesehatan Jurusan Antropologi Fisip UI Dengan The Ford Foundation Jakarta, 27 Agustus 1994. Millar J. Cross-National Research on Women in The European Community. In. Women’s Studies International Forum 1992; 15 (1): 77 – 84. Mohanty C. Under Western Eyes : Feminist Scholarship and Colonial Discourses. Feminist Review 1988; 30 : 61 – 88. Nielsen JM. Feminist Research Methods. London : Westview Press, 1990 Qomariah. Short Course Mengenai Kesehatan Wanita : Gender and Reproductive Health. Media Penelitian dan Pengembangan Kesehatan 2002; XII (4): 47-49.

20. 21. 22. 23. 24. 25.

26.

27. 28. 29. 30.

Smith JNH. Women and Politeness. The Javanese Example. In Language Society Cambridge University Press 1988; 17 :535 - 54 Squire C. Significant Differences. Feminism In Psychology UNDP. Human Development Report. UNDP & Oxford University Press, 1994. Rahmat. Kesehatan Wanita : Catatan Kelam Kesehatan Indonesia. Medika 1995; XXI (12 ). Retno Suhapti. Gender dan Permasalahannya. Bul. Psikologi 1995; hal. 44. Romdiati, H. Dampak Krisis Ekonomi terhadap Kehidupan Keluarga Petani Miskin di pinggiran kota (kasus Desa Pahlawan Setia, kecamatan Tarumajaya, kabupaten Bekasi) dalam : Tim Peneliti Dampak Krisis Ekomoni Terhadap Kehidupan Keluarga Kelompok Rentan : Beberapa kasus, Jakarta: Puslitbang Kependudukan dan Ketenagakerjaan, Lembaga Ilmu Pengetahuan Indonesia (PPT-LIPI) bekerja sama dengan Departemen Sosial, Republik Indonesia, 1999. Romdiati, Haning, Aswatini Raharto. Dampak Krisis Ekonomi terhadap Kehidupan Keluarga Miskin (kasus Desa Segara Makmur, kecamata Tarumajaya, Kabupaten Daerah Tingkat II Bekasi) dalam : Tim Peneliti Dampak Krisis Ekomoni terhadap Kehidupan Keluarga Kelompok Rentan : Beberapa kasus, Jakarta: Puslitbang Kependudukan dan Ketenagakerjaan, Lembaga Ilmu Pengetahuan Indonesia (PPT-LIPI) bekerja sama dengan Departemen Sosial, Republik Indonesia, 1999. R.Wasis Sumantono, Memberdayakan Peran Wanita dalam Mencegah Wabah Tembakau pada Wanita dan Remaja. Media Penelit. dan Pengembangan Kes. 2000; X (2). Tim Pemberdayan Bidang Agama Departemen Agama RI. Keadilan dan Kesetaraan Jender, Jakarta : Tim Pemberdayaan Perempuan Bidang Agama Departemen Agama RI, 2001. UNFPA, 3 Desember 2002. Yulfira Raharjo. Gender dan Pembangunan Puslitbang Kependudukan dan ketenagakerjaan LIPI (PPT-LIPI).

Be not overcome of evil, but overcome evil with good.

44 Cermin Dunia Kedokteran No. 145, 2004

HASIL PENELITIAN

(Studi Kasus di PT. Flower Indonesia Pasuruan Jawa Timur)
Sarwanto, Suharti Ajik
Pusat Penelitian dan Pengembangan Pelayanan dan Teknologi Kesehatan Departemen Kesehatan RI, Surabaya

Pengetahuan, Sikap, dan Perilaku Pekerja Remaja terhadap Penyakit Menular Seksual (PMS) serta FaktorFaktor yang Mempengaruhi Terjadinya Hubungan Seksual Pranikah

ABSTRAK Telah dilakukan penelitian mengenai pengetahuan, sikap, dan perilaku pekerja remaja terhadap PMS (Penyakit Menular Seksual) serta faktor-faktor yang mempengaruhi terjadinya hubungan seks pranikah dengan menggunakan data sekunder dari penelitian “Pengembangan Model Pelayanan Kesehatan Pekerja Remaja pada Pencegahan Infeksi HIV / AIDS (Tahap II) tahun 1999 / 2000”. Penelitian dilakukan di lokasi PT. Flower Indonesia Pasuruan Jawa Timur. Dengan menggunakan analisis regresi logistik ganda (PIN = 0,15 dan POUT = 0,20) dari 11 variabel teridentifisir yang secara logika substantif berpengaruh pada terjadinya hubungan seksual pranikah di antara para remaja, akhirnya hanya didapatkan 3 variabel yang berpengaruh. Variabel-variabel tersebut adalah lama bekerja di perusahaan (p = 0,0779), penghasilan (p = 0,0426), dan pengetahuan (p = 0,1119) yang masuk dalam model persamaan regresi logistik. Pekerja remaja yang telah bekerja di perusahaan 5 tahun atau lebih, mempunyai risiko 3,5 kali lebih besar dibandingkan yang lain terhadap terjadinya hubungan seks pranikah. Sedang mereka yang penghasilannya antara Rp 200.001,- sampai Rp 250.000,- per bulan risiko tersebut 1,6 kali dibandingkan yang lain, dan bagi mereka yang pengetahuannya rendah (dengan nilai 79 atau kurang) risikonya sebesar 1,2 kali dibandingkan yang lain.

PENDAHULUAN Masa remaja adalah masa peralihan dari masa anak ke masa dewasa, meliputi semua perkembangannya yang dialami sebagai persiapan memasuki masa dewasa(1). Demikian pula perkembangan masyarakat mengakibatkan perubahan peranan yang dilakukan manusia. Wanita tidak hanya berperan di dalam rumah tangga sebagai ibu, tetapi juga mempunyai peranan sosial ekonomi. Keadaan ini mempunyai risiko terhadap

gangguan-gangguan termasuk tindakan yang berhubungan dengan seksualitas yang ditujukan terhadapnya. Di Indonesia saat ini makin banyak remaja yang menunda perkawinan dan mengejar pendidikan lebih tinggi yang dapat menekan laju pertambahan penduduk. Namun di sisi lain, sikap dalam hal seksualitas juga makin bebas. Penyalahgunaan seks dapat terjadi pada setiap orang selama keadaan memungkinkan, karena pada hakekatnya setiap individu secara potensial adalah

Cermin Dunia Kedokteran No. 145, 2004 45

pelaku seks. Potensi ini akan mencapai puncaknya pada usia remaja, sampai ia tidak membutuhkan lagi di usia tua 2) . Sensus Penduduk 1980 di Indonesia membatasi kriteria remaja yang mendekati ketentuan PBB yaitu berusia 14 – 24 tahun. Remaja yang berada pada fase meningkatnya dorongan seksual selalu mencari lebih banyak informasi mengenai seks. Remaja Indonesia mencakup 37% dari penduduk, tetapi informasi berkaitan dengan kesehatan reproduksi yang ditujukan pada mereka dan yang mereka miliki sangat sedikit. Masyarakat masih menganggap tabu segala sesuatu yang berhubungan dengan seks, termasuk antara lain pembicaraan, pemberian informasi, dan pendidikan seks. Oleh karena itu remaja mencari pelbagai sumber informasi yang mungkin dapat diperoleh, misalnya membahasnya dengan teman sebayanya, membaca buku-buku tentang seks, atau mengadakan percobaan dengan masturbasi, bercumbu, atau bersanggama 3) . Hasil penelitian Faturochman4) di Tabanan dan Badung Propinsi Bali dengan subyek 324 remaja menemukan sebanyak 4,9% responden pernah melakukan hubungan seks pranikah. Hasil penelitian Pusat Penelitian Kependudukan UGM 5) di Manado cukup mengejutkan;dari responden remaja umur 14 – 24 tahun, 26,6% pernah melakukan hubungan seks pranikah. Tjokorda Gde Agung Suwardewa, dkk 6) melaporkan bahwa 20,63% karyawan swasta remaja melakukan hubungan seks pranikah. Sebagian besar pasangan sanggama adalah pacarnya (77,06%) dan 12,98% yang melakukan sanggama dengan tunangannya. Fenomena ini menunjukkan bahwa perilaku remaja di berbagai kota di Indonesia mempunyai kecenderungan yang sama. Bertolak dari permasalahan di atas perlu dilakukan penelitian yang mengarah pada pengkajian pengetahuan, sikap, dan perilaku remaja terhadap PMS serta faktor-faktor yang berpengaruh terhadap terjadinya hubungan seks pranikah. TUJUAN Secara umum penelitian ini ingin mengkaji pengetahuan, sikap, dan perilaku remaja terhadap PMS termasuk HIV / AIDS serta faktor-faktor yang mempengaruhi hubungan seks pranikah. Khususnya penelitian ini ingin : a). Mempelajari karakteristik pekerja remaja. b). Mengidentifikasi faktor-faktor yang berpengaruh terhadap terjadinya hubungan seks pranikah. c). Mempelajari faktor yang paling menentukan dan besarnya risiko yang ditimbulkan. METODE Penelitian ini menggunakan data sekunder dari penelitian “Pengembangan Model Pelayanan Kesehatan Dalam Pencegahan Infeksi HIV / AIDS Pada Pekerja Remaja (Tahap II)” 7) , yang dilakukan di Pasuruan Jawa Timur. Analisis deskriptif dilakukan untuk menjelaskan karakteristik pekerja remaja, termasuk pengetahuan, sikap, dan perilakunya. Dalam mengidentifikasi faktor-faktor yang berpengaruh terhadap terjadinya hubungan seksual pranikah dilakukan dengan analisis regresi logistik univariat. Selanjutnya analisis regresi logistik ganda diterapkan untuk mengetahui faktor-faktor yang

secara serentak berpengaruh terhadap terjadinya hubungan seksual pranikah dan besarnya risiko yang ditimbulkan. HASIL 1. Karakteristik Responden Dari analisis data pekerja remaja di PT. Flower Indonesia Pasuruan Jawa Timur yang melibatkan 400 responden, didapatkan bahwa mayoritas (93%) perempuan dan 7% lainnya laki-laki. Mereka berumur minimal 17 tahun, maksimal 24 tahun; mayoritas (60,8%) berumur 24 tahun dan belum menikah. Sebanyak 62% tamat SLTP, 29,8% tamat SLTA, dan yang tamat SD 7,5%. Lebih dari 99% beragama Islam dan 73% tinggal di rumah sendiri. Di perusahaan tersebut statusnya 96,5% sebagai pekerja tetap, 2,5% sebagai pekerja harian, dan selebihnya sebagai pekerja kontrak. Secara keseluruhan ratarata gaji setiap bulannya Rp 220.110,- dengan kisaran antara Rp 112.150,- sampai Rp 274.200,-. Semua responden memanfaatkan pelayanan klinik kesehatan perusahaan yang ditangani oleh perawat. 2. PMS Tentang masalah PMS (Penyakit Menular Seksual), 99% responden telah mendengarnya. Sumber terbanyak (72,5%) dari TV, 12% dari surat kabar, dan 6,3% dari radio. Selebihnya dari sumber lain, misalnya majalah, guru, tokoh agama, teman, tenaga kesehatan, dsb. Demikian pula mengenai HIV / AIDS, lebih dari 97% telah mendengarnya. Paling banyak juga dari TV (83,8%) dan surat kabar (10%). Dari apa yang mereka dengar mengenai PMS, 61,8% dapat memberikan 1 – 2 jawaban yang benar dan 37,2% memberikan 3 – 4 jawaban benar. Sisanya yang 1% meskipun pernah dengar tetapi tidak tahu apa yang dimaksud. Mengenai jenis-jenis PMS pun 91,5% dapat memberikan 1 – 2 jawaban. Selanjutnya mengenai tanda-tanda dan penyebab penyakit kelamin, lebih dari 71% dapat memberikan 1 – 2 jawaban yang benar. Cara penyembuhannyapun 93,5% tahu meskipun hanya dengan 1 jawaban, 6% dapat memberikan 2 jawaban. Dengan 1 – 2 jawaban, 76,5% tahu apa yang disebut HIV, bahkan 20% lainnya dapat memberikan 3 – 4 jawaban. Demikian halnya dengan apa yang disebut AIDS, hanya 12,8% yang dapat memberikan 3 – 4 jawaban ; 77,5% dapat memberikan 1 – 2 jawaban mengapa AIDS perlu diperhatikan. Cara penularannya pun 81,3% mereka tahu, bahkan 95,8% tahu akibat terkena AIDS ini. Sikap Menanggapi bila remaja berpacaran, 57% setuju dan 21,4% setidaknya merasa kurang setuju. Terkait dengan hubungan seks pranikah, lebih dari 98% cenderung kurang setuju, tidak setuju, bahkan ada yang sangat tidak setuju. Demikian halnya dengan bila remaja ganti-ganti pasangan seksual atau menggugurkan kandungan. Lain halnya sikap mereka terhadap onani / masturbasi, 15% setuju, 3% cukup setuju, dan 81,8% cenderung kurang setuju sampai sangat tidak setuju. Sikap terhadap seseorang yang melakukan hubungan seks dengan WTS minimal 37,5% tidak setuju, lebih dari 30% sangat tidak setuju. 3.

46 Cermin Dunia Kedokteran No. 145, 2004

Terhadap anggapan bahwa hubungan seks dengan WTS aman bila dengan kondom, hanya 13,8% setuju, 7,8% cukup setuju, dan lebih dari 78% merasa setidaknya kurang setuju atau bahkan sangat tidak setuju. Lebih dari 62% ada kecenderungan kurang setuju / tidak setuju bahwa orang menderita penyakit kelamin perlu dijauhi. Sedangkan terhadap anggapan bahwa remaja yang jauh dari orang tuanya mudah melakukan hubungan seksual, lebih dari 91% cenderung kurang setuju bahkan sangat tidak setuju. Kecenderungan cukup setuju sampai setuju sekali terhadap anggapan bahwa AIDS merupakan penyakit yang dapat mengakibatkan kematian, mencakup hampir 89% responden. Terhadap anggapan bahwa pemeriksaan darah untuk mengetahui adanya HIV tidak berguna, lebih dari 90% responden menyatakan kurang setuju bahkan sangat tidak setuju. Sikap menjauhi teman yang terkena AIDS cukup beragam bagi responden, 4,3% setuju sekali, 19,3% setuju, 16,8% cukup setuju, 35% kurang setuju, 21,8% tidak setuju, dan sebanyak 3% sangat tidak setuju. Dalam kaitannya dengan anggapan bila ibu yang terkena HIV diperbolehkan hamil, lebih dari 93% kurang setuju atau bahkan sangat tidak setuju. Lebih dari 28% setuju sekali bahwa penyakit kelamin dapat disembuhkan, tetapi 19,3% tidak setuju bahwa AIDS dapat disembuhkan. Perilaku Sebagian besar responden (68,5%) tidak pernah membicarakan masalah seks, namun 42% mereka mengakui pernah pacaran 1 kali dan 19,5% sebanyak 2 kali. Secara kumulatif sebanyak 6,6% mereka pernah pacaran 3 kali atau lebih. Selama pacaran tersebut 33,8% pernah bercumbu dan 1,3% pernah berhubungan seks dengan frekuensi 1 – 2 kali meskipun semua responden belum pernah menikah. Secara keseluruhan, pengetahuan, sikap, dan perilaku terhadap PMS termasuk HIV / AIDS dari para pekerja remaja di PT. Flower Indonesia Pasuruan Jawa Timur sebagai berikut : a). Nilai rata-rata pengetahuan mencapai 119,65 (standar deviasi 12,62) dari nilai maksimum sebesar 236. Dengan demikian baru mencapai sekitar 50% nya. Nilai terendah 70 dan tertinggi 172. b). Nilai rata-rata sikap mencapai 20,14 (standar deviasi 2,17) dari nilai maksimum 24. Nilai terendah sebesar 14 dan tertinggi 24. c). Nilai rata-rata perilaku mencapai 11,09 (standar deviasi 1,76) dari nilai maksimal 30. Nilai terendah sebesar 10 dan nilai tertinggi 30. Terdapat 5 orang yang melakukan hubungan seksual pranikah (tabel 1);1 orang laki-laki dan 4 orang perempuan, berumur 23 – 24 tahun dengan lama kerja di perusahaan ini antara 5 – 8 tahun. Pengalaman kerja di tempat lain, 4 orang antara 0 – 2 tahun dan 1 orang lainnya antara 3 – 5 tahun. Kesemuanya dengan status pekerja tetap, 4 orang berpendidikan tamat SLTP dan 1 orang lainnya tamat SLTA. Dilihat dari penghasilannya, 1 orang berpenghasilan antara Rp 150.000,- sampai Rp 200.000,-, 2 orang antara Rp 200.001 sampai Rp 250.000,- sedang 2 orang lainnya berpenghasilan di atas Rp 250.000,- setiap bulan (Tabel 1). 4.

Tabel 1. Tabulasi silang hubungan seks pranikah dengan karakteristik pekerja remaja di PT.Flower Indonesia Pasuruan Jawa Timur. Variabel Hubungan Seks Pranikah Ya Tidak n % n % 1 4 5 5 3,6 1,1 1,6 1,9 27 358 8 80 307 91 260 44 96,4 98,7 100 100 98,4 100 98,1 100 Jumlah n 28 362 8 80 312 91 265 44 % 100 100 100 100 100 100 100 100

1. Jenis kelamin a. Laki-laki b. Perempuan 2. Umur (tahun) a. 17 – 19 b. 20 – 22 c. 23 – 24 3. Lama kerja di perusahaan (tahun) a. 1 – 4 b. 5 – 8 c. ≥ 6 4. Lama kerja di tempat lain (tahun) a. 0 – 2 b. 3 – 5 c. ≥ 6 5. Status pekerjaan a. Harian b. Tetap c. Kontrak 6. Pendidikan a. SD tamat b. SLTP tamat c. SLTP tidak tamat d. SLTA tamat e. PT tidak tamat 7. Penghasilan a. ≤ 150.000 b. 150.001200.000 c. 200.001250.000 d. ≥ 250.000

4 1 5 -

1 50 1,3 -

393 1 1 10 381 4

99 50 100 100 98,7 100

397 2 1 10 386 4

100 100 100 100 100 100

4 1 1 2 2

1,6 0,8 1,6 0,8 12,5

30 244 2 118 1 2 60 319 14

100 98,4 100 99,2 100 100 98,4 99,4 87,5

30 248 2 119 1 2 61 321 16

100 100 100 100 100 100 100 100 100

Tabel 2. Tabulasi silang hubungan seks pranikah dengan pengetahuan, sikap, dan kebiasaan bercumbu pekerja remaja di PT. Flower Indonesia Pasuruan Jawa Timur. Variabel Hubungan Seks Pranikah Ya Tidak n % n % 4 1 2 3 1 25 2,1 1 1 391 3 92 303 100 99 75 97,8 99 Jumlah n 1 395 4 94 306 % 100 100 100 100 100

1. Pengetahuan a. ≤ 79 (rendah) b. 80 – 158 (sedang) c. ≥ 159 (tinggi) 2. Sikap a. ≤ 18 (negatif) b. 19 – 24 (positif) 3. Kebiasaan bercumbu a. Jarang b. Kadangkadang c. Sering

5 -

3,7 -

2 130 263

100 96,3 100

2 135 263

100 100 100

Cermin Dunia Kedokteran No. 145, 2004 47

Pada Tabel 2 tampak bahwa mereka yang melakukan hubungan seks pranikah, 4 orang tergolong berpengetahuan “sedang” (nilai 80 – 158) dan 1 orang berpengetahuan “tinggi” (nilai 159 ke atas). Dalam hal sikap, 2 di antara mereka bersikap cukup setuju (negatif) dan 3 orang lainnya bersikap tidak setuju (positif) terhadap masalah PMS & HIV / AIDS. Sedangkan ke 5 orang yang melakukan hubungan seks pranikah ini “kadang-kadang” mempunyai kebiasaan bercumbu dengan pasangan seksualnya. 5. Regresi Logistik Beberapa faktor yang diperkirakan terkait dengan terjadinya hubungan seks pranikah pada pekerja remaja di PT. Flower Indonesia Pasuruan Jawa Timur ini antara lain : 1) Jenis kelamin, 2) Umur, 3) Lama kerja di perusahaan, 4) Lama kerja di tempat lain, 5) Status pekerjaan, 6) Pendidikan, 7) Penghasilan, 8) Pengetahuan, 9) Sikap, 10) Biasa bercumbu, dan 11) Penggunaan narkotika. Dengan analisis regresi logistik univariat (PIN = 0,15 dan POUT = 0,20) hanya faktor Lama kerja di perusahaan dan Pengetahuan yang berpengaruh terhadap terjadinya hubungan seks pranikah pada pekerja remaja, masing-masing dengan p = 0,1017 dan p = 0,1045. Namun secara serentak setelah dilakukan analisis regresi logistik ganda, faktor-faktor yang berpengaruh terhadap terjadinya hubungan seks pranikah adalah Lama kerja di perusahaan (p = 0,0779), Penghasilan (p = 0,0426), dan Pengetahuan (p = 0,1119). Risiko hubungan seks pranikah bagi mereka yang bekerja di perusahaan lebih lama (5 tahun ke atas) 3,5 kali dibandingkan mereka yang bekerja kurang dari 5 tahun. Mereka yang penghasilannya lebih besar (di atas Rp 200.000,-) berisiko hubungan seks pranikah 1,6 kali dibandingkan mereka yang gajinya Rp 200.000,- ke bawah. Demikian pula mereka yang pengetahuannya rendah (dengan nilai 79 ke bawah) mempunyai risiko 1,2 kali dibandingkan mereka yang pengetahuannya lebih tinggi (dengan nilai 80 – 158). (Tabel 3).
Tabel 3. Hasil Regresi Logistik Ganda
Variable
V8R (2) V12 (3) Peng 2 (1) V58 AR1 V58 AR(1) V58 AR(2) V58 AR(3) Constant

V8R(2) = Lama kerja di perusahaan 5 tahun ke atas V12(3) = Penghasilan Rp 200.001,- sampai Rp 250.000,Peng2(1) = Pengetahuan dengan nilai 79 ke bawah V58AR1 = Kebiasaan bercumbu V58AR1(1) = Jarang bercumbu V58AR1(2) = Kadang-kadang bercumbu V58AR1(3) = Sering bercumbu

DISKUSI Dalam penelitian ini didapatkan bahwa lebih dari 99% responden / pekerja remaja beragama Islam. Mungkin dengan demikian masyarakat pekerja remaja ini masih mengutamakan norma-norma agama, yang menyatakan bahwa hubungan seks pranikah merupakan perbuatan tercela. Akan tetapi tidak berarti bahwa hubungan seks pranikah tidak ada sama sekali, walaupun tidak secara terbuka. Beberapa variabel yang berpengaruh terhadap terjadinya hubungan seksual pranikah pekerja remaja adalah Lama kerja di perusahaan, Penghasilan, dan Pengetahuan mengenai PMS termasuk HIV / AIDS. Lama kerja Lama kerja di perusahaan cukup berpengaruh terhadap terjadinya hubungan seks pranikah pada pekerja remaja, khususnya bagi mereka yang sudah lebih dari 5 tahun (p = 0,0779). Mungkin dengan lebih lama bekerja di perusahaan, akan lebih lama pula mereka mengenal lingkungannya, termasuk teman sebayanya di tempat kerja. Dengan demikian akan lebih akrab dan dapat berkomunikasi lebih bebas, bahkan pada masalah-masalah yang sifatnya pribadi dan bermuara pada meningkatnya dorongan seksual. Berdasarkan lama kerja di suatu tempat, yaitu di perusahaan tempat kerja sekarang dan tempat lain (Tabel 1), seseorang memiliki mental map tentang obyek-obyek, tempat, aktifitas, sehingga orang bisa mendapatkan pacar / teman dekat yang dapat diajak berhubungan seksual. Mental map atau Cogniting map adalah struktur informasi yang dimiliki seseorang tentang lingkungannya. Cogniting map ini dapat memotivasi tingkah laku(8) Hasil penelitian ini juga sama dengan hasil penelitian pada pekerja Jermal di pantai Labu Kabupaten Deli Serdang yang menunjukkan bahwa perilaku seks pekerja unit Jermal dilakukan oleh pekerja yang cukup lama hidup dan bekerja di Jermal 10) . Penghasilan Gaji / penghasilan per bulan merupakan faktor yang paling menentukan terjadinya hubungan seks pranikah pada pekerja remaja ini (p = 0,0426), khususnya bagi mereka yang penghasilannya antara Rp 200.001,- sampai Rp 250.000,- per bulan [lihat V12(3) pada hasil regresi logistik]. Dengan melihat penghasilan itu di daerah pedesaan dan dikaitkan dengan UMR setempat sebesar Rp 196.000,- besar kemungkinan kebutuhan primer (sandang, pangan, papan) sudah terpenuhi, apalagi sebagian besar responden (73%) tinggal di rumah sendiri. Perilaku manusia antara lain dipengaruhi oleh faktor sosial ekonomi, (11) begitu pula perilaku seksual pekerja remaja ini; biasanya orang yang mempunyai perhatian pada lawan jenis berusaha untuk berpenampilan menarik (pakaian, asesoris,

B
1,2694 8,12E-05 0,0853

SE

Variables in the Equation Wald df Sig
3,1089 4,1123 2,5278 0,0727 0,0000 0,0000 0,0726 0,7376 1 1 1 1 1 1 1 1 0,0779 0,0426 0,1119 0,9949 0,9955 0,9982 0,7876 0,3924

R
0,1436 0,1982 0,0991 0,0000 0,0000 0,0000 0,0000 0,0000

Exp (B)
3,5589 1,6001 1,2890

0,720 0 4,004 E-05 0,053 6 1214, 8649 1214, 8640 52,63 99 54,50 23

6,8928 2,7676 14,1802 -46,6185

989,1729 15,9206 1440106, 3

Term Removed V8R(2) V12(3) Peng 2(1) V58 AR1

Log Likelihood - 17,392 - 18,685 - 17,101 - 23,816

Model if Term Removed -2 Log LR df Significance of Log LR 3,213 1 0,0730 5,819 1 0,0159 2,652 1 0,1034 16,081 3 0,0011

Keterangan : No more variables can be deleted or added

48 Cermin Dunia Kedokteran No. 145, 2004

kosmetika), apalagi 4 orang dari 5 orang pelaku hubungan seks dalam penelitian ini adalah perempuan. Oleh karena itu dapat dimengerti bila pelaku hubungan seks adalah mereka yang mempunyai gaji tinggi di perusahaan. Pengetahuan PMS dan HIV / AIDS Pengetahuan dan perilaku pekerja remaja mengenai PMS dalam penelitian ini masih rendah (belum mencapai 50%); sikapnya juga masih perlu ditingkatkan. Pengetahuan merupakan faktor predisposisi terjadinya perilaku (12). Pekerja remaja yang memiliki pengetahuan PMS dan HIV / AIDS rendah mungkin karena mayoritas responden berpendidikan SLTP;berperilaku seks lebih berani karena tidak / kurang memahami risikonya; dalam usia 23 – 24 tahun secara biologis mereka sudah siap untuk menikah, secara psikologis mereka sudah tertarik lawan jenis, dan ada kebutuhan untuk mendapatkan pengalaman baru, berpetualang dan mencari selingan. Dengan meningkatnya usia perkawinan remaja saat ini, makin besar pula kesenjangan antara usia aktif seksual dengan usia menikah. Remaja menanggung masalah pemuasan hasrat seksual, karena mereka belum mendapat izin dari masyarakat untuk menyalurkannya; sementara itu godaan dari media cetak, media elektronik, dan kurangnya disiplin dalam keluarga dan pekerjaan, cederung melonggarkan norma-norma kehidupan. Situasi ini mendorong remaja untuk lebih mudah menyalurkan hasrat seksual mereka yang laten dengan cara melakukan hubungan seksual. Karena itulah remaja dapat dikategorikan berisiko tinggi dalam penularan HIV / AIDS (13),dan didasari pengetahuan PMS dan HIV / AIDS yang rendah, seseorang dapat mencari pengalaman / selingan yang keliru. Perilaku seksual Perilaku seksual berangkat dari stadium paling ringan ke stadium paling berat (14), yaitu : 1. saling berpegangan mesra. 2. saling berpelukan dengan tangan di luar baju. 3. saling bercumbu bibir. 4. saling berpelukan dengan tangan di dalam baju. 5. coitus / bersetubuh Dengan adanya pacaran / percumbuan, usia antara 23 – 24 tahun, uang, pekerjaan tetap, pengetahuan PMS dan HIV / AIDS rendah, dan mental map tentang lingkungannya, orang dapat mencari pengalaman / selingan hidup yang salah. Hasil studi ini tidak menyimpang dengan hasil penelitian di Bali yang menunjukkan 29,3% remaja (n = 150) di Bali telah melakukan hubungan seksual (15) .
Tabel 4. Distribusi pekerja remaja di PT. Flower Indonesia Pasuruan Jawa Timur menurut pernah tidaknya berpacaran dan atau bercumbu. Variabel Berpacaran Bercumbu Ya
276 (69%) 135 (33,8%)

homoseks, hubungan seks pranikah) adalah baik. Ini berarti bahwa sebagian besar responden tidak menyetujui adanya perilaku seksual yang negatif. Sikap yang tidak seiring dengan perilaku disebabkan faktor situasi dan kondisi(16). Bila keyakinan normatif responden tentang perilaku seks pranikah bersifat mendukung, artinya bahwa pandangan orang lain, baik lingkungan maupun keluarga menganggap bahwa perilaku seks merupakan sesuatu yang wajar, maka hal tersebut akan memicu terjadinya perilaku seks pranikah di kalangan mereka. Tetapi bila keyakinan normatif yang mereka miliki tidak mendukung, keyakinan subyektif terhadap perilaku seks pranikah akan berbeda. Akibatnya sikap yang sudah bagus tidak termanifestasi dalam perilaku yang baik seperti sikapnya terhadap sesuatu obyek. KESIMPULAN 1. Pengetahuan pekerja remaja tentang PMS termasuk HIV/AIDS di PT. Flower Indonesia tergolong masih rendah, baru mencapai 50%. 2. Sikap mereka positif terhadap masalah-masalah yang terkait dengan PMS termasuk HIV/AIDS, khususnya dalam hal ketidaksetujuannya terhadap hubungan seks pranikah, ganti-ganti pasangan, pengguguran kandungan, hubungan seks dengan sesama jenis kelamin. 3. Perilaku terhadap PMS dan HIV/AIDS masih rendah juga, baru mencapai nilai 11,09 dari nilai 30 yang ditentukan (37%) dan di antara pekerja remaja ada yang melakukan hubungan seks pranikah, (5 orang dari 400 responden). 4. Faktor-faktor yang berpengaruh terhadap terjadinya hubungan seks pranikah antara lain lama kerja di perusahaan lebih dari 5 tahun (p = 0,0779), penghasilan (p = 0,0426), dan pengetahuan (p = 0,1119), yang paling menentukan adalah faktor penghasilan. 5. Lama kerja di perusahaan 5 tahun atau lebih mempunyai risiko hubungan seksual pranikah 3,5 kali lebih besar dibandingkan mereka yang lama kerjanya kurang dari 5 tahun. Sedangkan mereka yang mempunyai penghasilan per bulan antara Rp 200.001,- sampai Rp 250.000,mempunyai risiko hubungan seks pranikah 1,6 kali dibandingkan dengan mereka yang gajinya kurang dari Rp 200.000,-. Demikian pula mereka yang pengetahuannya rendah, risiko terjadinya hubungan seks pranikah 1,2 kali dibandingkan yang pengetahuannya tinggi. SARAN 1. Petugas klinik kesehatan perusahaan memberikan penyuluhan secara berkesinambungan mengenai PMS dan HIV / AIDS untuk meningkatkan pengetahuan dan mencegah perilaku seksual pranikah. Materi penyuluhan dapat diperoleh dari instansi kesehatan (Bagian Promosi Kesehatan) dan LSM yang berkaitan dengan Kesehatan Reproduksi Remaja (PKBI, Yayasan Kusuma Buana). 2. Perlu pendekatan khusus baik secara formal maupun informal pada pekerja yang mempunyai gaji tinggi, telah lama bekerja, usia 23 tahun lebih.

Tidak
124 (31%) 141 (35,2%)

Blank
124 (31%)

Jumlah
400 400 (100%) (100%)

Sikap terhadap masalah seksual Pada umumnya sikap responden terhadap masalah yang berkaitan dengan seksual (ganti-ganti pasangan, aborsi,

Cermin Dunia Kedokteran No. 145, 2004 49

KEPUSTAKAAN 1. 2. 3. 4. 5. 6. Gunarsa SD, Gunarsa YSD. Psikologi Remaja, Jakarta: BPK Gunung Mulia, 1978. Sarwono S, Siti Purwanti Brotowasisto. Aspek Psikososial AIDS, Maj. Kes. Masy. Indon. (Nop).1990;XIX (6). Widjanarko M. Seksualitas Remaja, Kerjasama Ford Foundation dengan Pusat Penelitian Kependudukan Universitas Gadjah Mada Yogyakarta, 1999. Faturohman. Sikap dan Perilaku Seksual Remaja di Bali, Pusat Penelitian Kependudukan Universitas Gadjah Mada Yogyakarta, 1990. Pusat Penelitian Kependudukan Universitas Gadjah Mada Yogyakarta Determinan Pengetahuan, Sikap dan Praktik Kesehatan Reproduksi Remaja di Kota Manado, 1992. Suwardewa, Tjokorda Gde Agung, Soehartono DS, Djoko Waspodo. Karakteristik Klien yang Berkonsultasi di Balai Konsultasi Remaja Klinik Indrapura Surabaya 1989 – 1993, Lab/UPF Ilmu Kebidanan dan Penyakit Kandungan Fakultas Kedokteran Universitas Airlangga – RSUD Dr. Soetomo Surabaya, 1994. Ajik, Suharti, Sarwanto, Setia Pranata, Daryadi, Nurhasanah. Pengembangan Model Pelayanan Kesehatan dalam Pencegahan Infeksi 8. 9. 10. 11. 12. 13. 14. 15. 16.

7.

HIV/AIDS pada Pekerja Remaja (Tahap II), Depkes RI – Badan Litbangkes, Puslitbang Pelayanan dan Teknologi Kesehatan Jl. Indrapura 17 Surabaya, 2000. Kaplan S. dalam Health Behavior. Gochman DS. New York: Plenum Press, 1988. Sofian, Ahmad, Rinaldi, Emil W Aulia, Agus Susanto. Kekerasan Seksual terhadap Anak Jermal, Pusat Penelitian Kependudukan Universitas Gadjah Mada & Ford Foundation, Yogyakarta, 1999. Ruben BD. Communication and Human Behavior, New York: Macmillan Publ. Co., 1984. Berger RL, Frederico RC. Human Behavior, New York: Longman, 1982. Green L. dalam: Theory and Practice in Health Education . Rose HS, Mico PR. California: Maxfield Publ. Co., 1980. Tobing NL Kelompok Resiko Tinggi. Matra, April 1992. Mboik PB. Psikologi Keluarga dan Kehamilan Remaja – Suatu Bahasan Psikologis & Paedagogis, Simposium Terbuka Kehamilan Remaja, Surakarta, 1991. Ida Laksmiwati AA. Perubahan Perilaku Seks Remaja Bali, Pusat Penelitian Kependudukan Universitas Gadjah Mada & Ford Foundation, Yogyakarta, 1999. Azwar, Saifudin. Sikap Manusia, Liberty, Yogyakarta, 1988.

An idler is a watch that wants both hands; As use less if it goes as if it stands. (Cowper)

50 Cermin Dunia Kedokteran No. 145, 2004

OPINI

Makanan Pendamping ASI
Husein Albar
Bagian Ilmu Kesehatan Anak Fakultas Kedokteran Universitas Hasanuddin / Rumah Sakit Umum Pusat dr. Wahidin Sudirohusodo Makassar, Sulawesi Selatan

PENDAHULUAN Anak mempunyai kebutuhan dasar yang harus disadari oleh orang tua, meliputi kebutuhan makan, tidur, bermain, sehat, aman, dan interaksi sosial dengan anggota keluarga dan orang sekitar. Anak akan melakukan yang terbaik bila mereka dirawat dengan penuh kasih sayang. Sekitar 99,99% dari 10.9 juta anak balita yang meninggal selama tahun 2000 berasal dari negara bekembang seperti Asia (36%) dan Afrika (33%).1 Kekurangan gizi masih merupakan masalah utama di negara berkembang yang merupakan salah satu faktor penyebab kematian anak. Untuk mencegah anak kekurangan gizi dengan segala akibatnya maka orang tua harus menyediakan energi dan zat gizi adekuat bagi sang anak. PERKEMBANGAN KETRAMPILAN MAKAN Pada saat lahir, bayi secara refleks mempunyai ketrampilan alamiah menyusui untuk memenuhi kebutuhan nutrisi, seperti refleks mencari (rooting), refleks menyusui dan refleks isaptelan. Pada saat bayi mengisap payudara, lidah bergerak ke depan–belakang dan rahang bergerak ke atas – bawah. Bayi mulai mampu mengunyah bila sudah trampil menggerakkan lidah dan rahang ke samping kiri – kanan dan memutar. 2,3 Ketrampilan makan bayi mengikuti pola normal berikut: - Umur 0-1 bulan : Ketrampilan refleks mencari, refleks menyusui, refleks isap-telan, dan menggerakkan lidah dan rahang ke atas-bawah. - Umur 2 bulan : Refleks menyusui masih aktif dan bayi mampu menggerakkan lidah ke depan-belakang - Umur 3 bulan : Bibir menjadi aktif dalam menyusui dan lidah dijulurkan keluar bila merasa ada makanan. - Umur 4 bulan : Mulai tahapan mengisap, juluran lidah masih ada, dan bila melihat botol, lidah terangsang. - Umur 5 bulan : Mulai tahapan mengunyah. Kedua bibir mengecap. - Umur 6 bulan : Kedua bibir mampu mengatup sendok dalam mulut dan kemajuan makanan berlanjut. - Umur 7 bulan : Lidah mulai bergerak saat mengunyah, mulai tahapan kunyah vertikal, lidah dan rahang bergerak ke atas -

bawah, bayi bermain dengan sendok dan dapat mendekatkan sendok ke mulut. - Umur 8-9 bulan : Kedua bibir sudah mengatup erat, mulai minum menggunakan mangkuk, makan biskuit atau kue kering sendiri, dan memegang botol. - Umur 10-12 bulan : Lateralisasi lidah membantu kunyah berputar, menjilat makanan dari bibir bawah, pegang botol dengan baik, dan dapat pegang mangkuk walaupun masih tumpah.4 Umur 6 - 9 bulan merupakan masa kritis dalam perkembangan ketrampilan makan anak sehinga bila bayi berumur 6 bulan tidak dilatih seoptimal mungkin akan timbul masalah makan pada usia selanjutnya akibat kelainan motorik mulut.5 Anak umur 1-3 tahun mulai melatih ketrampilan baru dengan makan menggunakan tangan, jari atau sendok. Ibu yang mengetahui tingkat perkembangan anak akan memberikan makanan sesuai dengan tingkatan ketrampilan makan.4 SAAT TEPAT PEMBERIAN MAKANAN PENDAMPING ASI Penyapihan adalah proses memperkenalkan makanan padat kepada anak sebagai makanan pendamping ASI (MP ASI), yang diberikan secara bertahap sampai anak mampu makan makanan keluarga.6 Sidang Rapat Sedunia menganjurkan pemberian ASI eksklusif selama 6 bulan,8 sebagai nutrisi ideal bagi tumbuh kembang optimal bayi dan perlindungan bayi dari infeksi. Tujuan pengenalan MP ASI bukan hanya untuk menjamin kebutuhan nutrisi bayi tapi juga untuk memperkenalkan pola makan keluarga ke pada bayi secara bertahap. Keuntungan ASI meliputi mudah diberikan kapan dan di mana saja tanpa persiapan dan sterilisasi, hampir semua zat gizi cukup, seimbang dan adekuat untuk memenuhi kebutuhan bayi; lemak dengan emulsi tinggi sehingga mudah dicerna, laktosa sebagai pemanis alamiah membantu penyerapan kalsium dan zat besi, protein ASI rendah mengurangi beban ginjal bayi untuk membuang kelebihan nitrogen, kandungan vitamin C ASI cukup dan tidak dirusak oleh panas seperti susu sapi,

Cermin Dunia Kedokteran No. 145, 2004 51

khasiat anti infeksi, sumber kekebalan alamiah, khasiat antialergi karena tidak mengandung laktoglobulin dan serum bovine seperti susu sapi, dan keuntungan psikologis karena memberikan hubungan emosional berupa kasih sayang dan kebahagian pada bayi. Sekresi cairan tebal berwarna kuning dari payudara ibu baru melahirkan, disebut kolostrum, mengandung sejumlah zat kekebalan alamiah pada bayi sehingga melindungi bayi dari berbagai penyakit infeksi dan zat gizi yang berguna bagi tumbuh kembang bayi. Oleh sebab itu, kolostrum jangan dibuang tapi harus disusukan pada bayi baru lahir. Anak mulai diberi MP ASI pada umur 6 bulan dan secara bertahap jenis, konsistensi, dan tekstur makanan ditambah sampai umur 2-3 tahun; saat anak mampu makan makanan keluarga serta menggantikan secara lengkap fungsi ASI sebagai sumber nutrisi anak.1 Menjelang umur 6 bulan, bayi umumnya tidak lagi mendapat cukup energi dan zat gizi dari ASI semata sedangkan bayi harus bertumbuh sampai 2 kali atau lebih dari waktu lahir dan tetap bertumbuh cepat dan lebih aktif. Oleh sebab itu, bayi membutuhkan makanan lain sebagai tambahan ASI pada umur 6 bulan karena saluran cerna bayi sudah dapat mencerna sebagian makanan keluarga seperti tepung dan sesudah umur 9 bulan bayi umumnya tidak mau mencoba rasa baru atau makanan baru.6 Mengapa tidak dianjurkan MP ASI sebelum umur 6 bulan? Jika MP ASI diberikan terlalu dini maka mungkin - Bayi menderita diare karena makanan terkontaminasi. - Bayi kurang mengisap payudara sehingga produksi ASI berkurang. - Bayi kurang mengisap payudara sehingga ibu lebih mudah subur lagi dan risiko hamil kembali sebelum siap.6 Mengapa tidak boleh menunda MP ASI sesudah umur 6 bulan ? Bila MP ASI dimulai setelah umur 6 bulan maka mungkin - Berat badan bayi tidak bertambah, malah menjadi kurang gizi. - Akan lebih sulit membujuk bayi mulai makan makanan padat pada usia lebih tua. Bayi yang tidak dilatih makan pada umur 6 bulan biasanya tidak mau makanan lain selain ASI, susu formula, atau minuman cair sesudah berumur 1 tahun. Keadaan ini akan menyebabkan bayi kekurangan gizi.6 Isyarat bayi siap makan1,4,7 Pada umur 6 bulan bayi umumnya sudah mampu memberikan isyarat bahwa bayi telah siap makan MP ASI. - Isyarat berat badan dan perkembangan fisik. Berat badan di atas 6 kg, kepala dapat ditegakkan, lengan dan siku dapat menopang berat badan bila berbaring pada perut, tegakkan kepala bila duduk di pangkuan ibu, punggung tegak dalam posisi duduk di pangkuan ibu, dan bayi duduk serta meraih makanan yang dimakan ibunya.

- Isyarat sensorik. Bayi meraih sendok atau tangan ibunya yang berada di depan mulut, bayi sering memasukkan tangan ke mulut, mengisap kepalan, jempol atau jari tangan atau kaki, bayi suka memasukkan mainan ke mulut untuk merasa dan mengecap mainan temasuk dedaunan atau tanah, dan bayi tertarik dengan rasa baru dan mencoba makanan baru. Ini merupakan isyarat sensorik bahwa bayi ingin mengetahui perbedaan rasa benda yang berbeda di mulut. - Isyarat komunikasi. Bayi tahu kapan dia ingin makan dan jumlah makanan yang perlu dimakan. Bayi menggunakan komunikasi verbal sebagai isyarat berkata "ya" dan "tidak" untuk makan, ganti popok, mandi atau main. Kata "ya" sebagai isyarat makan nonverbal yaitu memiringkan badan ke arah sendok dan makanan, meraih sendok atau tangan ibu, melihat dan tersenyum ke makanan, membuka mulut dan mulai mengisap, atau membuat suara senang. Kata "tidak" sebagai isyarat makan nonverbal yaitu menjauhkan kepala dan badan dari sendok atau makanan, melihat dan bermain dengan makanan di piring, mendorong sendok atau tangan ibu, muka bayi cemberut dan tidak senang, mengatup mulut saat sendok mendekati mulut, atau menangis. - Isyarat mulut. Bayi membuka mulut bila sendok mendekati atau menyentuh bibir, bayi tidak menjulur lidah saat sendok dimasukkan ke mulut, gerakan lidah secara ritmik depanbelakang saat makanan berada dalam mulut, bayi mampu memasukkan makanan ke mulut dan mengunyah pelahanlahan. Kapan bayi mulai mampu mengunyah? Bayi mulai mampu mengunyah pada umur 6 bulan walaupun masih kurang efektif. Pada umur 6-9 bulan, bayi mampu makan bubur saring. Sesudah umur 9 bulan, bayi dapat mengunyah cukup baik makanan bentuk irisan kecil dan menjelang umur 2 tahun, gigi susu sudah lengkap dan mampu makan sebagian besar makanan keluarga.6 Mengapa masa penyapihan adalah masa berbahaya bagi anak? Masa penyapihan selama umur 6 buan sampai 3 tahun adalah masa berbahaya bagi anak karena risiko: - Tidak mendapat energi dan zat gizi cukup bila anak tidak mendapat cukup MP ASI, makanan keluarga, dan berhenti menyusui sebelum umur 2 tahun misalnya karena ibunya hamil lagi. - Sering menderita diare bila MP ASI atau minuman terkontaminasi kuman. - Sering memasukkan benda-benda kotor ke mulut sehingga menyebabkan diare atau cacingan. Bertemu anak-anak atau orang dewasa lain sebagai sumber infeksi yang dapat menularkan penyakit. Kehilangan kekebalan yang berasal dari ASI padahal belum mampu membentuk kekebalan sendiri.6 MP ASI komersial MP ASI komersial dibuat di pabrik untuk anak berumur di bawah 3 tahun (batita). Misalnya bubur bayi bertahap, biskuit bayi, dan makanan ringan bergizi lainnya.

52 Cermin Dunia Kedokteran No. 145, 2004

Keuntungan makanan bayi komersial6 - Cepat dan mudah disajikan - tidak perlu dimasak. - Bersih dan aman – bila belum kadaluarsa dan masih utuh dalam kemasan. - Umumnya disukai bayi. - Beberapa makanan bayi komersial mengandung cukup energi dan zat gizi. Kerugian makanan bayi komersial6 - Harga relatif mahal. - Banyak makanan bayi komersial dibuat untuk bayi berumur 4 bulan. Padahal usia ini terlalu dini dan dapat mengganggu produksi ASI dan kerugian lain. - Relatif berbahaya jika disajikan dengan air dingin. Bila air terkontaminasi, bayi mungkin sakit. - Makanan bayi komersial kadang-kadang tidak ada di pasaran Kesalahan promosi makanan bayi komersial6 - Sering dipromosi seakan-akan mempunyai keuntungan khusus bagi bayi. - Sering dipromosi untuk bayi di bawah 4 bulan - Tidak dijelaskan bahaya bagi bayi yang peka terhadap makanan komersial. Orang tua harus bijaksana memilih dan memilah mana yang sesuai bagi anaknya. Jika perlu konsultasi dengan dokter anak atau ahli gizi anak.6 MASALAH MAKAN PADA ANAK Anak akan makan bila mempunya selera makan, ketrampilan motorik dan sensorik mulut, ketrampilan isapkunyah-telan, fungsi kendali tubuh, saluran napas, saluran cerna, dan kesehatan umum normal. Bila salah satu proses tersebut di atas terganggu akan menyebabkan masalah makan pada anak.9 Masalah makan pada anak diartikan sebagai ketidakmampuan anak untuk makan atau anak menolak makan karena terdapat kelainan neuromotorik, sumbatan mekanik atau faktor psikososial. Jadi masalah makan merupakan suatu gejala klinik dan bukan suatu penyakit.7 Penyebab masalah makan pada anak meliputi faktor organik antara lain seriawan, diare, kecacingan, infeksi saluran napas akut, tuberkulosis, kelumpuhan otak, leukemia, kanker, diabetes mellitus; faktor nutrisi misalnya kekurangan gizi, atau kekurangan seng (Zn) akan mengurangi selera makan; atau faktor psikologik misalnya anak harus mengikuti aturan makanan yang ketat atau ibu memaksa anak makan.10 Makan bukan berarti hanya memberikan nutrisi pada bayi tapi juga memberikan dasar ketrampilan sosial, kognitif, motorik, dan komunikasi. Makan memberikan kesempatan pertama komunikasi antara ibu dan bayi. Masalah makan akibat kelainan motorik mulut,5 meliputi: - Refleks tonik menggigit (tonic bite reflex), menutup rahang sekuat-kuatnya bila gigi dan gusi dirangsang. - Tolakan lidah (tongue thrust), tolakan lidah kuat dan berulang bila mulut dirangsang. - Tolakan rahang (jaw thrust), rahang dibuka sekuat-kuatnya dan selebar-lebarnya saat makan atau minum.

- Tarikan lidah (tongue retraction), menarik kembali lidah ke dalam mulut saat diberi makanan, sendok atau mangkuk. - Tarikan bibir (lip retraction), menarik kedua bibir ke dalam bila sendok atau mangkuk didekatkan ke mulutnya. - Perlawanan sensorik (sensory defensiveness), reaksi berlawanan muncul bila merasakan rangsangan sensorik seperti sentuhan, suara, atau cahaya. Gejala yang timbul bervariasi tergantung penyebab kelainan; umumnya meliputi sulit mengunyah, sulit menelan, sulit minum dari botol atau mangkuk, sulit menetek, menolak makanan padat atau cair, batuk atau tersedak saat makan atau minum, liur berlebihan, makanan tumpah dari mulut, makanan keluar dari hidung, katup mulut, muntah selama makan, rewel atau tangis bertambah selama makan, hanya mau makanan tertentu misalnya makanan cair atau makanan kunyah, berat badan tidak bertambah, dan infeksi saluran napas bila makanan cair terhirup ke saluran napas.9 Pencitraan mungkin diperlukan untuk mengetahui penyebab pasti. Biasanya perlu ditangani oleh tim meliputi dokter anak, psikolog, ahli terapi kerja, ahli terapi fisik, ahli gizi dan perawat. Masalah makan berdampak tidak hanya pada fisik tapi juga pada emosi anak. Anak dengan kesulitan makan berisiko kekurangan gizi, dehidrasi, dan infeksi saluran napas. Tatalaksana anak dengan masalah makan meliputi penanganan medik, terapi dietetik untuk memenuhi kebutuhan anak, perubahan pola makan, perubahan posisi tubuh, terapi perilaku, desensitisasi makanan, perubahan suhu dan tekstur makanan, latihan penguatan otot mulut, gerakan lidah, dan cara mengunyah, perbaiki kemampuan mengisap, menyedot, dan minum, terapi koordinasi pola isap-telan-napas, mengubah tekstur dan viskositas makanan agar mudah ditelan, dan intervensi lain bergantung kebutuhan khusus anak. Pemeriksaan berkala perlu dilakukan berupa pemantauan berat dan tinggi badan dan mencari penyebab. Bila masalah makan diketahui lebih dini akan lebih mudah dicegah sehingga tidak menyebabkan kekurangan gizi dan penyulit lain pada anak.9 Anak menolak MP ASI Anak menolak MP ASI merupakan masalah serius karena dapat menyebabkan kurang gizi. Penyebab anak menolak makanan antara lain: - Anak sakit. Selera makan anak berkurang atau hilang bila ada infeksi, kecacingan, sakit mulut atau sakit tenggorokan. - Anak tidak senang. Misalnya ibunya sakit, keluar rumah, atau baru melahirkan. Anak membutuhkan ekstra perhatian dan kasih sayang terutama menjelang makan. - Gigi anak sedang tumbuh. Berikan benda bersih dan keras untuk dikunyah misalnya sendok.6 Beberapa anak hanya mau ASI atau air, jus buah, atau minuman lain dari botol susu, sehingga anak gagal tumbuh dan kurang gizi. Hal ini bukan karena terlalu lama minum ASI tetapi karena cara pengenalan MP ASI yang keliru; misalnya: - Baru memberikan MP ASI saat bayi berumur 9 bulan. - Mencoba memaksa anak untuk makan makanan yang tidak disukai anak sehingga merupakan pengalaman tidak menyenangkan bagi anak.

Cermin Dunia Kedokteran No. 145, 2004 53

- Kebiasaan memberikan ASI pada jam makan atau beberapa menit sebelum jam makan keluarga. - Anak banyak makan makanan ringan dan minuman manis. - Memberikan MP ASI semipadat dalam botol susu. Untuk mengatasi masalah ini maka: - Memulai MP ASI yang sesuai komposisinya dengan umur bayi. - Memperhatikan selera makan anak dan memberikan kasih sayang terutama bila anak sakit atau ibu baru melahirkan. - Jangan pernah memberi MP ASI dalam botol susu.6 KIAT PEMBERIAN MAKANAN PADA BATITA4,6,7 Bayi umur 6 – 9 bulan - Berikan MP ASI bila bayi berumur 6 bulan dan ASI tetap dilanjutkan. Jangan berikan MP ASI pada umur 4 bulan walaupun untuk membiasakan bayi. - Berikan 1-2 sendok bubur bayi semipadat 1 atau 2 kali sehari. Sebaiknya diberikan sesudah bayi minum ASI. - Bila bayi sudah terbiasa dengan satu jenis MP ASI, cobalah jenis lain. Misalnya sayuran atau buah lumat bersama bubur bayi atau rentang waktu terpisah. - Gunakan sendok atau mangkuk untuk memberi MP ASI. Jangan masukkan makanan ke dalam botol susu. Botol relatif sulit dibersihkan dan mengganggu kemampuan bayi mengisap dari payudara. - Cobalah satu jenis makanan baru setiap 4-7 hari untuk mengetahui toleransi bayi terhadap makanan. - Jika bayi mulai siap mengunyah berikan makanan lunak dengan aneka tekstur - Jika bayi mulai menggigit mainan berarti sudah mampu makan makanan genggam ( finger’s food ) seperti biskuit bayi, kue kering, roti panggang, sereal kering tidak manis, buah mentah lunak, atau irisan sayuran rebus. - Makanan genggam berguna untuk mempersiapkan bayi makan sendiri bila bayi sudah mampu mengkoordinasi gerakan tangan-mulut. - Jika bayi mulai siap menggunakan sendok dan makanan irisan, mulailah dengan variasi tekstur sehingga bayi terbiasa dan tidak menolak bila diberikan pada kesempatan berikutnya. Boleh dicoba minuman teguk dari mangkuk. - Biarkan ibu sendiri yang memberi makan agar bayi merasa aman, senang dan bahagia. Bila bayi sudah terbiasa makan, orang lain dapat membantu memberi makan. - Lanjutkan ASI kapan saja bayi meminta, sekurangkurangnya 10 kali sehari. Bayi umur 9-12 bulan - Lanjutkan ASI sesering mungkin. ASI tetap sebagai makanan utama dan MP ASI sebagai makanan tambahan. MP ASI tidak harus menggantikan ASI. - Jika bayi mulai mampu menggunakan sendok dan minum dari mangkuk, berikan makanan keluarga misalnya bubur kaya energi dan zat gizi dan makanan genggam. Sajikan 3 kali makanan utama dan 1-2 kali makanan genggam setiap hari.

- Jangan berikan roti isi sosis daging (hot dogs), kacangkacangan, anggur, jagung bakar (popcorn), gula-gula, atau sayuran mentah yang keras karena risiko bayi tersedak - Berikan sayuran atau buah lumat untuk menjamin kecukupan vitamin C dan sayuran kuning atau hijau kehitaman untuk mendapat tambahan vitamin A. - Mulai coba sebagian makanan keluarga yang dimasak untuk keluarga. - Jika bayi mulai mengunyah, berikan makanan genggam dan jamin kebersihan dan keamanan makanan tersebut. - Perlahan-lahan menambah jumlah makanan, jam makan perhari, dan variasi makanan sehingga saat anak berumur 1 tahun sudah makan aneka variasi makanan 4 5 kali sehari. Anak umur 1-3 tahun - Sekarang ASI berfungsi sebagai pendamping makanan utama. Namun, ASI tidak harus digantikan oleh makanan utama. Lanjutkan ASI terutama malam hari. - Berikan makanan utama pada anak 5 kali sehari. Misalnya 2 kali makanan keluarga, satu kali bubur kaya energi dan zat gizi, dan 2 kali makanan genggam atau makanan ringan bergizi setiap hari. - ASI dapat melengkapi 1/3 atau lebih energi, protein, zat besi, vitamin A dan vitamin C yang sangat dibutuhkan oleh anak umur 1-2 tahun. ASI dapat menambah zat gizi bila kurang diperoleh dari makanan keluarga. - ASI masih dapat melengkapi zat gizi sesudah umur 2 tahun. Namun menjelang umur 3 tahun, anak biasanya hanya minum sedikit ASI siang atau malam hari. ASI saat ini hanya melengkapi sebagian kecil zat gizi yang dibutuhkan anak tetapi dapat merupakan makanan ringan yang berguna dan menyenangkan anak. - ASI tetap masih melindungi anak terhadap beberapa penyakit infeksi sampai anak berumur 3 tahun dan merupakan sumber penting zat gizi dan kebahagiaan bagi anak yang sakit. - Bila perlu tambahkan sedikit margarine, mentega, minyak, krem keju; kalori ekstra berasal dari lemak. - Hindari makanan ringan tidak berkalori atau kalori rendah, misalnya berbagai jenis kerupuk, keripik, jelly, agar-agar, gula-gula, minuman soda, teh atau kopi, yang akan mengurangi selera terhadap makanan utama. - Biarkan anak mengisyaratkan telah kenyang dan jangan memaksa anak menghabiskan semua makanan di piring. - Jangan melakukan bermacam “trik” agar anak makan. Tugas ibu hanya menyiapkan makanan sehat dan seimbang. Bila lapar, anak akan makan dan bila tidak, dia akan makan di jam makan berikutnya. - Ibu boleh memutuskan jenis makanan dan kapan harus makan tapi anak yang menentukan apakah segera atau menunda makan dan jumlah makanan yang akan dimakan. Memperkenalkan makanan baru - Mulai coba satu jenis makanan baru pada setiap kali makan - Konsistensi makanan sesuai usia anak dan dinaikkan secara bertahap dari makanan cair, semipadat sampai padat. - Mulai dengan porsi kecil, kemudian berangsu-angsur ditambah bila anak sudah terbiasa.

54 Cermin Dunia Kedokteran No. 145, 2004

- Tawarkan makanan baru dalam suasana santai dan menyenangkan - Jangan paksa bila anak tidak menyukai makanan tertentu; dapat dicoba lagi saat usia anak bertambah. Namun, bila anak tetap tidak menyukai makanan tersebut, cari makanan pengganti yang lain. - Hindari makanan pedas, bumbu masak dan gorengan - Buat menu dengan variasi warna, aroma, tekstur, dan bentuk makanan sesuai usia anak dan sajikan di piring dengan hiasan misalnya irisan jeruk atau peterseli agar tampak menarik. - Orang tua jangan menunjukkan ketidaksukaan pada makanan tertentu. Minuman untuk anak batita Jangan berikan minuman manis atau bergula pada anak batita. - Pada anak batita terutama di bawah 6 bulan, minuman manis bergula akan mengurangi selera makan, mengganggu jadual pemberian ASI dan menyebabkan diare. - Gula hanya memberi energi; anak sudah mendapat cukup energi dan zat gizi dari ASI atau MP ASI. - Kadang-kadang gula ditambah dalam suplemen vitamin D yang relatif mahal padahal vitamin D terbanyak dan gratis didapat dari sinar matahari pagi. - Makanan atau minuman manis antara lain: sirup manis, gulagula merupakan sumber utama kerusakan gigi anak. - Jus buah komersial, minuman soda dan sejenisnya tidak baik bagi anak karena mengandung gula, zat warna, pengawet, dan penyedap. Buah segar dan makanan alamiah lebih murah dan relatif aman. - ASI cukup mengandung Vitamin C untuk bayi sedangkan jus buah tidak mengandung protein atau kalsium sehingga tidak membantu bayi bertumbuh. - Air putih sudah diperoleh dari ASI atau MP ASI. Bila mem berikan air putih atau jus buah, batasi 90-120 ml perhari sesudah bayi berumur 9-12 bulan.

SIMPULAN Kekurangan gizi disebabkan oleh asupan energi dan zat gizi tidak adekuat atau penyakit infeksi, atau keduanya. ASI eksklusif dianjurkan selama 6 bulan untuk memenuhi kebutuhan energi dan zat gizi bayi. Pengenalan makanan pendamping ASI dimulai pada usia 6 bulan dan ASI tetap dipertahankan sampai 2 tahun. Jangan memaksa anak makan; percayakan pada pusat kendali selera makan di otak anak. Tugas orang tua hanyalah menyajikan makanan sehat dan seimbang. Bila anak lapar, ia akan makan dan bila tidak lapar, ia akan makan di lain waktu. Jangan menyuapi anak bila ia mampu makan sendiri. Batasi makanan ringan atau cairan berkalori rendah yang mengurangi selera makan anak terhadap makanan utama misalnya kerupuk, keripik, teh, kopi, minuman bersoda, gulagula, jelly, atau agar-agar.
Kepustakaan 1. 2. 3. Integrated Management of Childhood Illnesses.The Information Package, 1999. www. WHO/UNICEF Palmer S , Horn S. Feeding Problem in Children. Development Disorders In: Pediatric Nutrition.. . Palmer S , Ekvall S. (eds). Springfield; Charles C. Thomas Publ. 1978. Cloud H. Feeding problems of the child with special health care needs. In. Pediatric Nutrition in chronic disease and developmental disorders. Prevention, assessment and treatment..Ekvall S (ed.). New York–Oxford University Press, 1993. www. Eating tips for children-young toddler. Htm Lane SJ, Cloud HH. Feeding problems and intervention: an interdisciplinary approach. Top Clin nutrition 1988. King SV,Burgess A. Starting other foods. In : Nutrition for developing countries. 2nd ed. Oxford Medical Publications. Oxford University Press, 1996. www. Guidelines for success feeding. Files.adobe acrobat doc. www.World Health Assembly. Recommends Exclusive Breastfeeding for First Six Months. www. Feeding and Swallowing Disorders in Infants and children. Samsudin. Penyebab dan tatalaksana kesulitan makan. Pertemuan Ilmiah Berkala II IDAI Yogyakarta, 1992. 99

4. 5. 6. 7. 8. 9. 10.

Cermin Dunia Kedokteran No. 145, 2004 55

apsul
PEDOMAN PENGGUNAAN KONTRASEPSI ORAL ESTROGEN-PROGESTIN PADA WANITA
VARIABEL Perokok, usia lebih dari 35 tahun < 15 batang/hari ≥ 15 batang/hari Hipertensi Terkontrol Tidak terkontrol PEDOMAN ACOG (tahun 2000) Risiko tak dapat diterima Risiko tak dapat diterima Risiko dapat diterima; tidak mencantumkan definisi hipertensi terkontrol Risiko tak dapat diterima; tidak mencantumkan definisi hipertensi tak terkontrol Risiko tak dapat diterima Risiko dapat diterima jika tidak ada risiko kardiovaskular lain dan tidak ada kerusakan end-organ Risiko dapat diterima jika LDL < 160 mg/dl dan tidak ada risiko kardiovaskular lain Tidak disebut PEDOMAN WHO (tahun 2000) Risiko umumnya lebih besar dari manfaat Risiko tak dapat diterima Risiko biasanya lebih besar dari manfaat jika sistolik 140 – 159 mmHg dan diastolik 90 – 99 mmHg Risiko tak dapat diterima jika sistolik ≥ 160 mmHg atau diastolik ≥ 100 mmHg Risiko tak dapat diterima Manfaat lebih besar dari risiko jika tidak ada kerusakan end-organ dan diabetes diderita ≤ 20 tahun. Manfaat/risiko tergantung ada/tidaknya risiko kardiovaskular lain. Risiko biasanya lebih besar dari manfaat, atau tidak dapat diterima, tergantung faktor risikonya. Risiko biasanya lebih besar dari manfaat Risiko tak dapat diterima Risiko tak dapat diterima Risiko umumnya lebih besar dari manfaat Risiko dapat diterima Etinil estradiol ≤ 35 ug tidak menyinggung progestin

Riwayat stroke, penyakit jantung iskemik atau tromboemboli vena Diabetes

Hiperkholesterolemi

Faktor risiko kardiovaskular multipel

Nyeri kepala migren Usia ≥ 35 tahun Disertai gejala fokal Kanker payudara Masih ada Riwayat ada, tidak aktif selama 5 tahun Riwayat keluarga kanker payudara atau ovarium Sediaan yang dianjurkan

Risikonya umumnya lebih besar dari manfaat Risiko tak dapat diterima Risiko tak dapat diterima Risiko tak dapat diterima Risiko dapat diterima Etinil estradiol < 50 ug dengan progestin dosis sekecil mungkin

Dari : Petitti DB. Combination Estrogen-Progestin Oral Contraceptives. N Engl J Med 2003; 349: 1443-50 ACOG : American College of Obstetricians and Gynecologists WHO : World Health Organization brw

56 Cermin Dunia Kedokteran No. 145, 2004

English Summary
Sambungan dari halaman 4.

RISK OF HIGH-GRADE CERVICAL INTRAEPITHELIAL LESION IN HUMAN PAPILLOMA VIRUS TYPE 16 AND 18 INFECTED WOMEN I.G.N. Darmaja*, K. Suwiyoga*, I.G.A. Artha**
Dept. of Obstetrics and Gynecology and **Dept. of Pathological Anatomy, Faculty of Medicine, Udayana University, Denpasar, Bali, Indonesia
*

infections is 7 times, with HPV 16 infection is 5,5 times, with HPV 18 infection is 6,5 times than those who are not infected. Patients with HSIL mostly infected by HPV 18 .
Cermin Dunia Kedokt.2004; 145; 13-17 gnd, ksu, iga

KNOWLEDGE, ATTITUDE AND PRACTICE ON SEXUALLY TRANSMITTED DISEASE AND FACTORS INFLUENCING PREMARITAL INTERCOURSE AMONG PT FLOWERS INDONESIA WORKERS Sarwanto, Suhartono Adjik
Health Technology Research Center, Department of Health, Surabaya, Indonesia

HISTOPATHOLOGICAL CHORIOAMNIONITIS AS RISK FOR PRETERM LABOR IN SANGLAH HOSPITAL K. Suardana*, A.A.N. Jaya Kusuma*, K. Suwiyoga*, A.A.A.N. Susraini**
*Dept. of Obstetrics and Gynecology, **Dept. of Pathological Anatomy, Faculty of Medicine, Udayana University, Sanglah Hospital, Denpasar

Objective : To examine the role of HPV 16 and 18 infection as risk factor for high grade squamous intraepithelial lesions. Subjects and methods : Case control study on 31 high-grade SIL (HSIL) compared with 30 control at the Obstetrics and Gynecology Polyclinics Faculty of Medicine Udayana University/Sanglah General Hospital Denpasar. Specimen from endo and ectocervical was aqcuired by scraping and then analysed by PCR. Result : HPV 16 and 18 infections in HSIL were found in 22 cases (71%), in control 10 cases (32,3%); HPV 16 infection in HSIL was found in 16 cases (51,6%), in control 7 cases (22,6%). HPV 18 infection in HSIL was found in 17 cases (54,8%), in control 6 cases (19,4%). HPV 16 and 18 infection carry 7 times higher risk - OR 7 (95% CI : 1,16-42,15), x2=7,5 , p=0,04. HPV 16 carries 5,5 times higher risk - OR 5,5 (95% CI : 1,003-30,15), x2=4,9 , p=0,02. HPV 18 infection carries 6,5 times higher risk - OR 6,5 (95% CI : 1,09-36,68), x2=6,7 , p=0,007 for HSIL. Approximately 63% and 67% HSIL can be prevented if HPV 16 and HPV 18 infection were eradicated. Conclusions : Risk of HSIL in patients with HPV 16 and 18

Objective : To examine the role of histopathologic chorioamnionitis as risk factor for preterm labor. Subjects and method : A retrospective cohort study was done on 27 chorioamnionitis cases compared with 27 control at delivery room Sanglah Hospital Denpasar. Chorioamnionitis was diagnosed histopathologically. Result : Preterm labor was found in 62,96 % of chorioamnionitis group and in 22,22 % of control group. (RR 2,83, 95%CI 2,33 – 4,96, χ2=9,16, p= 0,002). Without chorioamnionitis approximately 47,78 % preterm labor can be prevented Conclusions : The risk of pretrm labor in women with chorioamnionitis was 2,83 times compared with women without chorioamnionitis.
Cermin Dunia Kedokt.2004; 145; 18-21

ksu, njk, ksu, ans

A research on the knowledge, attitude, and practice of STD (Sexual Transmitted Diseases) and the influencing factors on premarital intercourse among adolescent workers was conducted using secondary data from the Development of Health Services Model Research on HIV / AIDS Infected Prevention for Adolescent Workers (Step II) in 1999 / 2000. The case studies research was conducted at PT. Flower Indonesia Pasuruan East Java. By using multivariate logistic regression analysis (PIN = 0,15 and POUT = 0,20) out of 11 identified variables that may substantially influenced the incidence of premarital intercourse among adolescent workers, only 3 variables have been identified: length of work in the industry (p = 0,0779), income (p = 0,0426) and knowledge (p = 0,1119). The risk (Odd ratio) for premarital intercourse among adolescent workers who work in the industry for 5 years or more was 3.5. The risk of adolescent workers with income of Rp 200.001,- to Rp 250.000,- was 1.6, and among adolescent workers with low knowledge (score less than 79) the risk was 1.2 .
Cermin Dunia Kedokt.2004; 145; 46-51

swt, sua

Cermin Dunia Kedokteran No. 145, 2004 57

RISK OF IMMINENT PRETERM LABOR IN PREGNANCY WITH URINARY TRACT INFECTION I Nyoman Nuada*, Made Kornia Karkata*, Ketut Suastika**
*Dept. of Obstetrics and Gynecology **Dept. of Internal Medicine, Faculty of Medicine, Udayana University, Denpasar, Indonesia

RISK OF PRETERM LABOR IN C. TRACHOMATIS INFECTION A.A.N.M.A. Putra Wirawan*, A.A.N. Jaya Kusuma*, D.M. Sukrama**, M. Dharmadi.***
*Dept. of Obstetrics and Gynecology, Sanglah Hospital, Udayana University, Denpasar, Indonesia **Dept. of Pharmacology, ***Dept. of Public Health, Faculty of Medicine, Udayana University, Denpasar, Indonesia

FEEDING CHILDREN Husein Albar

STRATEGIES

FOR

Dept. of Child Health, Hasanuddin University, Makassar, South Sulawesi, Indonesia

Objective : To determine the risk of threatened preterm labor on pregnant women with urinary tract infection. Design and method : Case-control study on 50 women who visited labor ward and obstetric polyclinic in Sanglah Hospital; 25 with threatened preterm labor and other 25 as control (term pregnant women not in labor). The urine culture, colony count and sensitivity test was performed on their mid stream urine Result : Urinary tract infection was found in 20% in case group and 12% in control group. Odds Ratio 1,83,not significant (x2 = 0,595 , p = 0,702). Urine culture found that E.coli was the most frequent bacteria; sensitive to amoxycillin, mecilinam, Bactrim@, Ciprofloxacin and Fleroxacin. Conclusion : The risk of threatened preterm labor among pregnant women with urinary tract infection was 1,83 compared with pregnant women without urinary tract infection.
Cermin Dunia Kedokt.2004; 145; 21-31

Objective : To determine the risk of threatened preterm labor on pregnant women with Chlamydia trachomatis infection. Design and method : A casecontrol study on 20 women with infection compared to 20 control. All were patients in obstetric gynaecological clinics. Both groups underwent endocervical swab and PCR examination for Chlamydia trachomatis detection. Result : Chlamydia trachomatis infection was found in 80,00% of case group and in 25,00% of control group ( p=0,001 ; Odds ratio 12,00; 95% CI : 2,70 – 53,33). The risk of threatened preterm labor in women with Chlamydia trachomatis infection was 12,00 times compared with women without infection of Chlamydia trachomatis.
Cermin Dunia Kedokt.2004; 145; 22-26

Malnutrition may be caused by inadequate nutrient and energy intake or infectious diseases or both. Exclusive breastfeeding is an ideal nutrition and energy supply sufficient to support optimal growth and development during the first 6 months. Solid foods should be introduced after six months of age and breastfeeding remains to be continued up to two years. Parents may decide what and when to feed, but children decides when to eat and how much they will eat; therefore, parents have to let children control their appetite. Do not feed a child but encourage the child to learn how to feed him or herself. Snacks or drinks containing low nutrients and calories should not be offered because the child may lose the appetite toward more important regular food.
Cermin Dunia Kedokt.2004; 145; 52-56

hua

apw, njk, dms, mdh

inn, mkk, kes

All things are double, one against another Good is set against evil, and life againts death.

58 Cermin Dunia Kedokteran No. 145, 2004

INFORMATIKA KEDOKTERAN
Perkembangan Internasional Informatika Kedokteran

APAMI GA, Kuala Lumpur- Malaysia 6 April 2004.

International Medical Informatics Association (IMIA) adalah organisasi non profit tingkat dunia, bergerak dalam bidang Informatika Kedokteran yang dikenal WHO. Informatika Kedokteran menjadi suatu bidang yang berkembang sangat pesat seiring dengan perkembangan dunia Teknologi Informasi. IMIA atau International Medical Informatics Association merupakan organisasi dunia yang diakui oleh WHO. Berawal dari organisasi International Federation of Information Processing (IFIP) membentuk Komite Teknikal 4 (TC4) yang berfokus pada komputerisasi bidang-bidang yang berhubungan dengan kesehatan (healthrelated computing). Pada tahun 1989, IMIA resmi berdiri (di bawah undang-undang Swis). Saat ini IMIA, selain mempunyai organisasi afiliasi dengan IFIP juga dengan International Federation of Health Records Organizations dan tentu, WHO. Keanggotaan IMIA Sebagai asosiasi dari kelompok masyarakat, saat ini IMIA mempunyai jenis-jenis keanggotaan seperti keanggotaan (diakses Mei 2004 dari http://www.imia.org): 1. Institusi Akademik (25 akademik) 2. Institusi Korporat (12 korporat) 3. Kelompok Nasional atau Asosiasi (41 negara) 4. Koresponden (57 orang) Selain jenis keanggotaan di atas, IMIA juga mengenal 4 kelompok regional seperti: European Federation for Medical Informatics (EFMI), Asia Pacific Association for Medical Informatics (APAMI), Helina (African Region) dan Federation of Health Societies in Latin America (IMIA- LAC).

APAMI (Asia Pacific Association for Medical Informatics) APAMI yang didirikan sejak tahun 1993, saat ini (APAMI General Assembly, April 2004) memiliki 10 anggota (Korea, Taiwan, Malaysia, Hongkong, Jepang, Sri Lanka, Singapura, Filipina, Thailand, Vietnam) dan 1 observer (Indonesia). Pada pertemuan tersebut, pengurus APAMI yang terlibat adalah: - Prof Kwak Yun Sik dari Korea selaku Presiden APAMI, - Prof Jack Li Yu-Chuan dari Taiwan sebagai VicePresident - Dr HM Goh, Malaysia menjabat sebagai Sekretaris dan - Dr CP Wong, dari Hongkong sebagai Bendahara Kegiatan di Indonesia Indonesia merupakan negara yang aktivitas kedokteran informatikanya sering luput dari percaturan di dunia. Meskipun banyak kegiatan dalam bidang ini yang telah dilakukan oleh praktisi-praktisi di Indonesia, tetapi pelaporannya ke organisasi seperti APAMI/IMIA masih sering on – off. Kadang-kadang dilaporkan, kadang-kadang tidak. Oleh karena itu, sampai berita ini diturunkan status Indonesia masih dianggap sebagai pengamat atau observer saja. Dalam pertemuan APAMI di Kuala Lumpur, penulis menjadi observer dari Indonesia. Mudah-mudahan ke depan, Indonesia bisa tetap eksis untuk selalu melaporkan aktivitasnya sehingga bisa memperoleh dukungan dari APAMI maupun IMIA. (Bagi yang ingin memperoleh CD-ROM hasil kegiatan ini, silakan kontak dr_erik_tapan@yahoo.com (dr. Erik Tapan, MHA)

Cermin Dunia Kedokteran No. 145, 2004

59

Kegiatan Ilmiah

Holistic Approach in Brain-Heart and Mind Diseases, Hotel JW Marriot Surabaya, 12 Juni 2004 Hipertensi dialami sekitar 1 milyar orang di seluruh dunia. Angka kejadian bisa meningkat pesat jika tidak ada langkah-langkah pencegahan. Demikian dikatakan Prof Dr. Djoko Soemantri, dr Sp JP, saat membawakan topik pertama dalam Seminar Sehari Holistic Approach in Brain-Heart and Mind Diseases di Surabaya, Sabtu 12 Juni yang lalu. Acara yang disponsori oleh Divisi Discovery PT Kalbe Farma Tbk ini dihadiri sekitar 250 dokter-dokter dari Surabaya dan sekitarnya. Tampil dalam seminar sehari ini, 4 orang dokter ahli yaitu Prof. Dr. Djoko Soemantri, SpJP(K), Prof. Dr. Djoenaidi Widjaja, SpS(K), Prof. Dr. Hendro Martono, SpPD,KEM, Dr. Marlina S Mahjudin, SpKJ(K) yang kesemuanya adalah para dosen pengajar dan konsultan dari FK Unair/RSUD Dr. Soetomo Surabaya. (tampak dalam foto pemberian kenang-kenangan kepada Prof. Djoenaidi Widjaja dr. PhD, Sp. S(K))

Simposium Terapi Cairan Kalbe Farma di KONAS VII IDSAI, Makassar 15 Juli 2004 Di hari pertama KONAS VII IDSAI di Makassar, PT Kalbe Farma menyelenggarakan symposium Fluid Therapy. Dalam simposium ini dr. Sun Sunatrio, SpAn menyampaikan topik Intraoperative Fluid Management and Choice of Fluid, dan dalam presentasinya beliau menyampaikan bahwa tata laksana cairan merupakan bagian penting penanganan pasien selama masa perioperatif. Seminar “Obrolan Manis” bagi penderita Diabetes Melitus, Hotel Borobudur Jakarta, 17 Juli 2004 Bertempat di Hotel Borobudur Jakarta, 17 Juli 2004 yang lalu, diselenggarakan Seminar "Obrolan Manis" bagi penderita Diabetes Melitus. Menurut pelaksana, seminar ini diselenggarakan guna memasyarakatkan pengetahuan mengenai kencing manis atau Diabetes Melitus. Para pembicara terdiri dari pakar DM seperti: dr Benyamin Lukito, SpPD, dr Yusak MT Siahaan SpS, dr Mega Imeyati, SpRM, dengan menampilkan moderator Ayu Diah Pasha.

Laporan lengkap dari simposium, bisa diakses di http://www.kalbe.co.id/seminar. Pada topik yang diberi tanda Breaking News, berarti peserta simposium bisa memperoleh berita dalam bentuk cetak (print) bersamaan dengan acara di Stand Kalbe Farma, dan bisa langsung diakses pada homepage Kalbe Farma
Simposium Telemedicine 2004, Yogyakarta 10 Juli 2004 Dengan berkembangnya berbagai teknologi informasi dan komputer khususnya, saat ini telah ada asosiasi yang menghimpun praktisi medis di dunia yang tergabung dalam International Medical Informatics Association (IMIA). Sedangkan di Indonesia baru-baru ini telah didirikan asosiasi serupa dengan nama Indonesia Health Informatics Association (INAHIA), demikian dijelaskan Dr. Moedjiono, MSc., saat memberi presentasi yang berjudul "Masa Depan Teknologi Informasi bagi Terciptanya Health Information System" pada acara Simposium Telemedicine 2004 di Yogyakarta. Website Kalbe Farma, http://www.kalbefarma.com sebagai salah satu sumbangsih Kalbe Farma, dalam bidang Informatika Kesehatan.

Seminar ke-2 IKCC, Jakarta 19 Juni 2004
Tidak semua penderita gagal ginjal memperoleh informasi mengenai cara diet yang baik dan benar. Banyak diantaranya begitu takut dan sangat membatasi diri untuk mengkonsumsi pelbagai jenis makanan yang mengakibatkan tubuh bertambah kurus dan lebih memperparah penyakitnya. Demikian dikatakan ahli gizi, Ibu Triyani Kresnawan, DCN, saat memberi informasi pada acara bulanan IKCC yang lalu. Temu Ilmiah Penanganan Terkini MCI Akut, Jakarta, 12 Agustus 2004 Pada keadaan Acute Myocardial Infarction, terapi reperfusi terdiri dari (1)Farmakologikal/fibrinolisis dan (2) Mekanikal. Farmakologikal atau pemberian obat-obatan berupa Streptokinase, rt-PA dan Atelplase. Sedangkan Mekanikal adalah tindakan PTCA ataupun Bedah. Demikian diutarakan Yoga Yuniadi, Spesialis Penyakit Jantung & Pembuluh Darah RS Mitra Keluarga Kelapa Gading saat memberi ceramah pada acara Ramah Tamah dan Temu Ilmiah Penanganan Terkini MCI Akut.

60 Cermin Dunia Kedokteran No. 142, 2004

Seminar ke-3 IKCC, Jakarta 17 Juli 2004 Selain menyaring kotoran dan hasil metabolisme, ginjal juga berfungsi mengeluarkan hormon yang bisa meningkatkan hemoglobin. Oleh sebab itu, penderita dengan masalah ginjal berisiko menderita kurang darah atau anemia. Demikian penuturan dr Pudji Rahardjo SpPD-KGH dalam acara pertemuan bulanan IKCC (Indonesian Kidney Care Club). Liver Up-Date 2004, Hotel Borobudur Jakarta, 4-6 Juni 2004 Saat ini pendekatan terapi untuk kasus hepatitis B kronik (CHB) meliputi immunomodulator (contohnya interferon (IFN), pegylated (peg) IFN, thymosin alpha, vaksinasi), dan supresi virus misalnya nukleosida analog (lamivudin /LAM, adefovir, dan entecavir). Beberapa studi terapi kombinasi (COMBO) antara IFN plus lamivudin (LAM) memperlihatkan serokonversi HbeAg sekitar 36% dibanding dengan 22% IFN tunggal dan 19% LAM tunggal. Dokter Indonesia Masa Depan, FKUI - Jakarta, 8 Juni 2004 Dokter Indonesia masa depan harus memiliki pola pikir "Paradigma Sehat". Demikian dikatakan Prof. Dr. dr. Farid Anfasa Moeloek, SpOG (K), saat memberi presentasi pada acara Kuliah Umum hari Rabu lalu (8/6). Acara yang diselenggarakan oleh Unit Pendidikan Berkelanjutan (PKB)/CME FKUI ini, berlangsung di Ruang Aula FKUI Salemba Jakarta dan diikuti oleh berbagai peserta yang terdiri dari mahasiswa, guru tamu, pimpinan fakultas, dan undangan lainnya. Materi presentasi PDF 338 KB bisa di download di http://www.kalbe.co.id. 4th Jakarta Nephrology Hypertension Couse (JNHC), Hotel Borobudur Jakarta, 28-30 Mei 2004 Insiden kejadian batu ginjal di negara maju, contohnya Amerika, adalah 36/100.000 penduduk setiap tahunnya. Sedangkan data di Indonesia sendiri, salah satunya dari RS Sanglah Denpasar, menyebutkan kasus batu ginjal mencakup 63,7 % dari seluruh terapi urologi pada tahun 2000 - 2003. Penyebab tersering dari penyakit ini adalah adanya kondisi diabetes mellitus, yang dikatakan mencakup hingga 48 % di luar negeri. First Annual of PERDICI Meeting, Hotel Grand Melia, 4 - 5 Juni 2004 Ada banyak fungsi albumin, yang merupakan salah satu protein penting dalam tubuh. Satu di antaranya adalah menjaga keseimbangan tekanan onkotik; pada keadaan normal albumin menyumbang 80% tekanan osmotik karena besarnya molekul dan banyak muatan negatif (the Gibbs-Donnan effect). Demikian dijelaskan Dr.Untung Widodo, Sp An KIC pada kuliahnya dalam acara First Annual of PERDICI Meeting di Jakarta beberapa waktu lalu. Pelatihan Perawatan Kaki Diabetik, FKUI/RSCM, 7-9 Juni 2004 Pada penderita diabetes, masalah kaki diabetik merupakan salah satu komplikasi yang sangat ditakuti. Masalah ini menjadi penting karena membawa dampak yang sangat besar baik terhadap penderita, keluarga, maupun pemerintah karena membutuhkan perawatan yang lama, biaya yang tidak sedikit dan risiko terjadinya gangren dan amputasi yang cukup besar. Pengenalan terhadap faktor-faktor risiko dan kelainan dini pada kaki diabetik akan sangat bermanfaat terhadap usaha pencegahan atau menurunkan kejadian kasus ini. The 13th Congress of WPACCM, Seoul, 10-13 Juni 2004 Western Pasific Association of Critical Care Medicine (WPACCM) menyelenggarakan kongres ketigabelasnya bersamaan dengan kongres tahunan ke-24 KSCCM (Korean Society of Critical Care Medicine). Kongres yang diketuai oleh dr.Shin Ok Koh dari Universitas Yonsei ini diselenggarakan di Hotel Lotte Jamsil di Seoul,

Korea, beberapa waktu lalu. Acara ini menghadirkan pembicara dari berbagai negara, bukan hanya negara Asia saja namun para ahli dari Australia, Switzerland, Perancis, USA dan Inggris juga turut berbagi pengetahuan. Kongres Nasional VII IDSAI (Perhimpunan Dokter Spesialis Anestesiologi Indonesia) Kongres Nasional IDSAI ke-7 tahun 2004 mengangkat tema “High Tech and High Touch in Anesthesia”. Acara yang diselenggarakan oleh bagian Anestesiologi dan Perawatan Intensif FK Universitas Hasanuddin ini bertempat di Hotel Sahid Jaya Makassar, dari tanggal 15 hingga 17 Juli 2004.. Pelatihan Dasar Penatalaksanaan DM, Ruang Kuliah Penyakit Dalam FKUI/RSCM, 18-19 Juni 2004 Bertempat di Ruang Kuliah Penyakit Dalam FKUI/RSCM, beberapa waktu lalu telah diadakan kegiatan pelatihan dasar penatalaksanaan diabetes mellitus bagi dokter umum. Kegiatan yang diadakan oleh Pusat Lipid dan Diabetes serta Divisi Endokrin-Metabolik FKUI/RSCM ini diikuti oleh 31 orang dokter dari Jakarta dan luar Jakarta, yang bekerja baik di rumah sakit pemerintah atau swasta, Puskesmas, dokter perusahaan, dan juga dokter praktek dan klinik swasta. Pendekatan Holistik Penyakit Kardiovaskular III dan KARIMUN III, Hotel Sahid Jaya Jakarta, 16-18 Juli 2004 Bertempat di Hotel Sahid Jaya Jakarta, beberapa waktu lalu Departemen Penyakit Dalam FKUI mengadakan seminar tiga hari yang dihadiri oleh sekitar 300 dokter umum, spesialis penyakit dalam, spesialis jantung, dan lain-lain. Acara ini berlangsung dari tanggal 16 sampai dengan 18 Juli 2004 dan bertajuk: “Pendekatan Holistik Penyakit Kardiovaskular III dan KARIMUN III”, mencakup topiktopik seputar Kardiologi (Endokrin)-Respirasi-Alergi Imunologi.. PIT Interna, Hotel Sahid Jaya Jakarta, 30 Juli -1 Agustus 2004 2004 Sekitar 500 dokter umum maupun spesialis mengikuti acara Pertemuan Ilmiah Tahunan Interna yang diadakan di Hotel Sahid Jaya Jakarta. Acara yang diselenggarakan oleh Bagian Penyakit Dalam FKUI/RSCM ini menyajikan beragam topik dari bidang gastrohepatologi, onkologi, ginjal-hipertensi, metabolik-endokrin, psikiatri, dan lain-lain. Tampil sebagai pembicara antara lain adalah Prof. Dr. Daldiyono, SpPD, KGEH, Prof. Dr. Endang Susalit,SpPD-KGH, Prof. Dr. Sarwono Waspadji,SpPD-KEMD, Prof. Dr. Miftah,SpPD-KKV dan lain-lain. KONKER PGI XII, PEGI XII, dan PPHI XIII, Yogyakarta 31 Juli – 1 Agustus 2004 Pada tanggal 31 Juli – 01 Agustus 2004 yang lalu, telah diselenggarakan acara Kongres Kerja PGI (Perkumpulan Gastroenterologi Indonesia) XII, PEGI (Perkumpulan Endoskopi Gastroenterologi Indonesia) XII, dan PPHI (Perhimpunan Peneliti Hati Indoensia) XIII. Acara yang dihadiri oleh sekitar 400 dokter dari berbagai daerah di Indonesia tersebut bertempat di Hotel Sheraton Mustika Yogyakarta. Short Course Quantitative Clinical Research oleh Netherland Institute of Health Science, 28 Juni - 2 Juli 2004 di FKUI Program pasca sarjana dari Fakultas Kesehatan Masyarakat Universitas Indonesia, mengadakan short course dengan mendatangkan para pengajar dari Netherland Institute of Health Science, di Belanda, selama 2 minggu dari tanggal 28 Juni sampai 2 Juli yang lalu. Program ini sudah berjalan selama 2 tahun dan rencananya akan diadakan setiap tahun.
Bersambung ke halaman 63

Cermin Dunia Kedokteran No. 142, 2004

61

Indeks Karangan Cermin Dunia Kedokteran Tahun 2004
CDK 142. ALERGI English Summary Iris Rengganis : Alergi Merupakan Penyakit Sistemik Karnen Baratawidjaja : Alergi dan Imunologi pada Penyakit Akibat Kerja Teguh Harjono Karjadi : Alergi Lateks pada Pekerja Kesehatan Samsuridjal Djauzi, Teguh Harjono Karjadi : Perbaikan Kualitas Hidup pada Karyawan Penderita Alergi Iris Rengganis : Peranan Antihistamin pada Inflamasi Alergi Heru Sundaru : United Airway Diseases – apakah itu ? Nanang Sukmana : Penatalaksanaan LES pada Berbagai Target Organ Zuljasri Albar : Keterlibatan Paru dan Pleura pada SLE RA Yuniarti, Umi Widyastuti : Populasi Mesocyclops aspericornis pada Pengendalian Jentik Aedes aegypti Menggunakan Metode Simulasi Kandang Nyamuk Blondine Ch.P, Damar Tri Boewono : Uji Efikasi Formulasi Cair (Liquid) Bacillus thuringiensis H-14 Galur Lokal pada Berbagai Fermentasi terhadap Jentik Nyamuk Vektor di Laboratorium Hasan Boesri, Damar Tri Boewono, Hadi Suwasono : Uji Efikasi Insektisida Abate 500 EC secara Pengabutan terhadap Nyamuk Aedes aegypti Sri Sugihati Slamet, Ni’mah Bawahab : Tingkat Aktivitas Kholinesterase, Pengetahuan dan Cara Pengelolaan Pestisida pada Petani/Buruh Penyemprot Apel di Desa Gubuk Klakah, Jawa Timur Janahar Murad, D. Mutiatikum, SR. Muktiningsih : Status Kesehatan Petani Perkebunan Rakyat Pengguna Paraquat Dibandingkan dengan Petani bukan Pengguna Paraquat di Lampung Selatan Satmoko Wisaksono : Risiko Pemajanan Benzen terhadap Pekerja dan Cara Pemantauan Biologis Produk Baru : Kaltrofen® gel Kegiatan Ilmiah Internet untuk Dokter : Panduan AMA bagi para Dokter Internet Kapsul : Bell’s Palsy Abstrak Risiko Demensia N. Engl. J. Med. 2003; 348: 1215-22 Hubungan antara Trom-Bosis dan Aterosklerosis N. Engl. J. Med. 2003; 348: 1435-41 Risiko Alergi Kacang N. Engl. J. Med. 2003; 348: 977-85 Manfaat Budesonid pada Asma Lancet 2003; 361: 1071-76 Candesartan Clin.Drug Invest.2003; 23(8) : 545-50 Terapi Sulih Hormon N. Engl. J. Med. 2003; 349: 523-34 Estrogen dan Atero-Sklerosis N. Engl. J. Med. 2003; 349 : 535-45 Prognosis Pasien ICU N. Engl. J. Med. 2003; 349 : 1123-32 Terapi Osteoporosis untuk Pria N. Engl. J. Med. 2003; 349: 216-26 Penurun Demam Clin. Drug Invest. 2003; 23(8) : 519-26 CDK 143. KARDIOVASKULER English Summary Sarjaini Jamal : Deskripsi Penyakit Sistim Sirkulasi : Penyebab Utama Kematian di Indonesia Sunarya Soerianata, William Sanjaya : Penatalaksanaan Sindrom Koroner Akut dengan Revaskularisasi Non Bedah William Sanjaya, Sunarya Soerianata : Peranan Faktor-faktor Hemodinamik dan Non Hemodinamik dalam Mekanisme Patogenik Hipertrofi Ventrikel Kiri Carta A. Gunawan : Kardiomiopati Hipertrofik William Sanjaya, Starry Homenta Rampengan, Otte J. 4 5 - 9 10 - 14 15 - 18 19 - 23 4 5- 7 8 - 10 11 - 14 15 - 18 19 - 21 22 - 26 27 - 30 31 - 34 35 - 37 38 - 41 42 - 45 46 - 48 Rachman : Regurgitasi Mitral Iskemik Tuti Atikah, A. Samik Wahab : Kesalahan Muara Semua Vena Pulmonalis Finariawan Asrining Santosa, A. Samik Wahab : Anomali Ebstein Sugeng Wiyono, Krisnawaty Bantas, Ratna Djuwita Hatma, Sri Wahjoe Soekirman : Hubungan Antara Rasio Lingkar PinggangPinggul dengan Kadar Kolesterol pada Orang Dewasa di Kota Surakarta (Analisis Data Riset Unggulan Terpadu 1996) Kusnindar Atmosukarto, Mitri Rahmawati : Terapi Nutrisi Kromium untuk Penderita Diabetes Reviana Ch. : Peranan Mineral Seng (Zn) Bagi Kesehatan Tubuh H Nuchsan Umar Lubis : Tetanus Lokal pada Anak Produk Baru : Fimalbumin® Kapsul : PROCAM Scoring Scheme Kegiatan Ilmiah Abstrak Faktor Risiko Asma N. Engl. J. Med. 2003; 349: 1414-22 Risiko Alergi terhadap Sulfa N.Engl. J. Med. 2003; 349: 1628-35 Efek Samping Obat Anti HIV N. Engl. J. Med. 2003; 349: 1993-2003 Valsartan dan Kaptopril untuk Infark Miokard N. Engl. J. Med. 2003; 349: 1893-906 Masalah Pengasuhan Pasien Demensia N. Engl. J. Med. 2003; 349: 1936-42 Semua Antihipertensi Sama Efektif ? Lancet 2003; 362: 1527-35 Kanabis untuk Spastisitas Lancet 2003; 362: 1517-26 Penyebab Kematian Mendadak Lancet 2003; 362: 1457-9 Kelambu Anti Nyamuk Lancet 2003; 362: 1549-50 CDK 144. THT 53 - 55 56 57 - 59 60 61 62 62 62 62 62 63 63 63 63 63 English Summary Rizalina Arwinati Asnir : Rinitis Atrofi Bambang Supriyatno, Lia Amalia : Papiloma Laring pada Anak Hafni : Kista Duktus Tiroglosus Delfitri Munir, Rizalina A Asnir, Firmansyah : Rinoskleroma R. Susworo : Kanker Nasofaring - Epidemiologi dan Pengobatan Mutakhir Retno Gitawati, Ani Isnawati : Pola Sensitivitas Kuman dari Isolat Hasil Usap Tenggorok Penderita Tonsilofaringitis Akut terhadap Beberapa Antimikroba Betalaktam di Puskesmas Jakarta Pusat Novi Arifiani : Pengaruh Kebisingan terhadap Kesehatan Tenaga Kerja Ambar W. Roestam : Program Konservasi Pendengaran di Tempat Kerja HR Krisnabudhi : Perawatan Mandiri Pasca Trakeostomi Budi Riyanto Wreksoatmodjo : Vertigo: Aspek Neurologi Prasti Pirawati, L. Yvonne Siboe : Terapi Akupunktur untuk Vertigo Sulistyowati Tuminah : Teh [Camellia sinensis O.K. var. Assamica (Mast)] sebagai Salah satu Sumber Antioksidan Enny Muchlastriningsih, Sri Susilowati, Diana Hutauruk : Hasil Pemeriksaan Uji Hemaglutinasi pada Penderita Tersangka Demam Berdarah Dengue di Jakarta Tahun 2001 Produk Baru : Hemapo® Kapsul : Hearing threshold level Informatika Kedokteran : Pengantar Kegiatan Ilmiah Abstrak Kelainan Korteks pada Adhd Lancet 2003; 362: 1699-707 Sick Building Syndrome Lancet 2003; 362: 1785-91 Alas Tidur Keras untuk Nyeri Pinggang Bawah Lancet 2003; 362: 1599-604 4 5 - 7 8 - 10 11 - 12 13 - 15 16 - 19 20 - 23 24 - 28 29 - 34 35 - 40 41 - 46 47 - 51 52 - 54 55 - 56 57 58 59 60 - 61 62 62 62 24 - 27 28 - 35 37 - 43

44 - 49 50 - 52 53 - 54 55 - 56 57 58 59 - 61 62 62 62 62 63 63 63 63 63

49 - 52

62 Cermin Dunia Kedokteran No. 145, 2004

Pengukuran Ultrasonografi untuk Menilai Risiko Fraktur Lancet 2004;363:197-202 Metilprdenisolon untuk Sindrom Guillain Barre Lancet 2004;363:192-6 Efek Samping Trimetoprim-Kotrimoksazol N Engl J Med 2004;350:88-9 Aspirin untuk Polisitemia Vera N Engl J Med 2004;350:114-24 Efek Latihan terhdap Ketahanan Jantung BMJ 2004;328:189-92 Mencegah Eksaserbasi Asma Lancet 2004;363:271-5 145. GINEKOLOGI English Summary S.D. Iswara, I.K. Suwiyoga, I.G.P. Mayura M., I.G. Artha A. : Perbandingan Akurasi Diagnostik Lesi Pra Kanker Serviks antara Tes Pap dengan Inspeksi Visual Asam Asetat (IVA) pada Wanita dengan Lesi Serviks K. Tonika, K. Suwiyoga : Infeksi Klamidia Trakomatis pada Kanker Serviks Terinfeksi Human Papilloma Virus tipe 16 dan 18: Studi Cross - Sectional I.G.N. Darmaja, K. Suwiyoga, I.G.A. Artha : Risiko Lesi Intraepitel Skuamosa Serviks Derajat Tinggi pada Penderita Terinfeksi Virus Human Papiloma 16 dan 18 K. Suardana, A.A.N. Jaya Kusuma, K. Suwiyoga, A.A.A.N. Susraini : Korioamnionitis Histopatologik sebagai Risiko Persalinan Preterm di RS Sanglah Denpasar

62 62 63 63 63 63

4

5 - 8 9 - 12 13 - 17 18 - 21

A.A.N.M.A. Putra Wirawan, A.A.N. Jaya Kusuma, D.M. Sukrama, M. Dharmadi : Risiko Ancaman Persalinan Preterm pada Infeksi Chlamydia trachomatis I Nyoman Nuada, Made Kornia Karkata, Ketut Suastika : Risiko Partus Prematurus Iminen pada Kehamilan dengan Infeksi Saluran Kemih Jefferson Rompas : Pengelolaan Persalinan Prematur Eko Rahardjo : Diagnosis Laboratorium Infeksi Saluran Reproduksi dari Para Pekerja Seksual Wanita di Banyuwangi Juni 2003 Sunanti Zalbawi, Kartika Handayani : Masalah Gender dan Kesehatan Sarwanto, Suharti Ajik : Pengetahuan, Sikap, dan Perilaku Pekerja Remaja terhadap Penyakit Menular Seksual (PMS) serta Faktor-Faktor yang Mempengaruhi Terjadinya Hubungan Seksual Pranikah (Studi Kasus di PT. Flower Indonesia Pasuruan Jawa Timur) Husein Albar : Makanan Pendamping Asi Informatika Kedokteran Kegiatan Ilmiah Indeks Karangan Tahun 2004

22 - 26 27 - 31 32 - 34 35 - 38 39 - 45

46 - 51 52 - 56 59 60 62

Sambungan dari halaman 62.

11th International Symposium on Shock & Critical Care, Bali 13 15 Agustus 2004 Tahun ini Indonesian Foundation of Critical Care Medicine menjadi panitia dalam penyelenggaraan 11th International Symposium on Shock and Critical Care, di Bali International Convention Center, Nusa Dua Bali, tanggal 13 – 15 Agustus 2004. Acara tingkat internasional ini mengangkat tema New Insight in Diagnosis, Management, and Therapy in Critical Care Medicine dan diketuai oleh alm. Dr. dr.Iqbal Mustafa, didukung oleh PERDICI, Indonesian Shock Society (ISS) dan Western Pasific Association of Critical Care Medicine (WPACCM). Ramah Tamah dan Temu Ilmiah Penanganan Terkini MCI Akut. Simposium Pendidikan Urologi Berkelanjutan Ikatan Ahli Urologi Indonesia, 10-13 Juli 2004, Hotel Novotel Corelia, Bukittinggi Pembesaran prostat jinak atau BPH sering ditemukan pada pria yang menapak usia lanjut. Kurang lebih 70% pria diatas usia 60 tahun dan 90% pria berusia diatas 80 tahun pada pemeriksaan histopatologis menunjukkan pembesaran prostat jinak. Demikian salah satu hal yang terungkap dalam Simposium Pendidikan Urologi Berkelanjutan Ikatan Ahli Urologi Indonesia 10-13 Juli 2004 di hotel Novotel Corelia Bukittinggi Sumatera Barat yang mengambil tema Update on Oncology and Andrology. Seminar PERMAPKIN - HMRCE III, Jakarta 24 - 26 Agustus 2004 Sesuai dengan perkembangan jaman, pelayanan kesehatan di abad 21 ini membutuhkan: sistem IT yang efektif, pelayanan personal yg berkualitas dan aman, penggunaan standar-standar, dan kepe-

mimpinan dari pemerintahan. Dalam bidang IT, dibutuhkan: data yang bisa dibagi dan interoperabilitas. Demikian penjelasan Chairman Pantai Holdings Berhad, Datuk Dr. Ridzwan Bakar, pada acara Seminar Tahunan PERMAPKIN - HMRCE III 2004. Acara yg dibuka secara resmi oleh Menkes RI, dr. Ahmad Sujudi MHA dan dihadiri sekitar 200 manajer pelayanan kesehatan dari seluruh lndonesia tsb berlangsung selama 3 hari. Tema yg diambil tahun ini adalah Planning, Design, Facilities & Trend for Future Healthcare. Pertemuan Ilmiah Tahunan (PIT) Farmakologi ke-4, Hotel Millenium Sirih Jakarta, 20-21 Agustus 2004 Seperti tahun-tahun sebelumnya, tahun ini Bagian Farmakologi dan Terapi FKUI menyelenggarakan Pertemuan Ilmiah Tahunan (PIT) atau Annual Scientific Meeting Farmakologi, dan tahun ini PIT Farmakologi ke-4 diadakan di Millennium Sirih Hotel, tanggal 20-21 Agustus 2004. Acara yang diketuai oleh DR.Arini Setiawati,PhD ini mengangkat tema “Recent Advances in Pharmacotherapeutics”. Topik tentang terapi trombolitik diangkat sebagai topik pertama, dibawakan oleh dr.Boenyamin Setiawan,PhD, salah satu tokoh senior di bagian farmakologi sekaligus pendiri PT Kalbe Farma Tbk. Seminar sehari K3, RS Siloam Gleneagles Lippo Karawaci, 28 Agustus 2004 Mengacu pada Sistem Kesehatan Nasional & Pendidikan Berdasarkan Kompetensi, maka pembagian pelayanan kesehatan saat ini berdasarkan: kompetensi di bidang pelayanan kesehatan tingkat pertama, kedua, maupun minat khusus seperti Kesehatan Kerja. Demikian dikatakan dr. Sudjoko Kuswadji MSc (OM), Ketua Umum PP IDKl, saat memberikan sambutan sekaligus membuka Seminar K3 dalam meningkatkan Perlindungan Pekerja & Produktifitas Kerja yang berlangsung Sabtu, 28 Agustus 2004 di RS Siloam Gleneagles Lippo Karawaci.

Cermin Dunia Kedokteran No. 145, 2004 63

Ruang Penyegar dan Penambah Ilmu Kedokteran
Dapatkah saudara menjawab pertanyaan-pertanyaan di bawah ini?
1. Pemeriksaan Inspeksi Visual Asam Asetat positif jika: a) Timbul bau amis b) Tampak bercak putih c) Tampak sel nekrotik d) Tampak sel displastik e) Tampak perdarahan Inspeksi Visual Asam Asetat dapat positif palsu akibat: a) Reaksi fisiologik b) Keterbatasan penglihatan pengamat c) Tercampur darah d) Tercampur sel radang e) Semua bisa Infeksi Chlamydia trachomatis dihubungkan dengan risiko: a) Kanker serviks b) Kanker endometrium c) Infeksi HIV d) Gonore e) Sifilis Infeksi HPV (human papilloma virus) dihubungkan dengan risiko: a) Kanker serviks b) Kanker endometirum c) Infeksi HIV d) Gonore e) Sifilis 5. Korioamnionitis dikaitkan dengan risiko: a) Infertilitas b) Persalinan preterm c) Persalinan postmatur d) Kanker serviks e) Kanker endometrium Kemampuan mengunyah diperoleh bayi saat usia: a) 2 bulan b) 3 bulan c) 4 bulan d) 5 bulan e) 6 bulan Makanan pengganti ASI sebaiknya baru diberikan setelah usia: a) 3 bulan b) 6 bulan c) 9 bulan d) 12 bulan e) 24 bulan Keberhasilan makan dengan tangan/sendok diperoleh sejak usia: a) 6 – 9 bulan b) 9 – 12 bulan c) 1 – 3 tahun d) 3 – 5 tahun e) 5 – 8 tahun

2.

6.

3.

7.

4.

8.

JAWABAN RPPIK : 1. 5. B B 2. 6. A D 3. 7. A B 4. 8. A C

64 Cermin Dunia Kedokteran No. 145, 2004

You're Reading a Free Preview

Mengunduh
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->