Anda di halaman 1dari 17

LAPORAN PRAKTIKUM BIOINFORMATIKA PENGENALAN NCBI (National Centre for Biotechnology Information)

NAMA NIM TANGGAL PRAKTIKUM

: SORAYA WIDYASARI : 0910910073 : 8 MARET 2012

LABORATORIUM BIOINFORMATIKA JURUSAN BIOLOGI FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM UNIVERSITAS BRAWIJAYA MALANG 2012

BAB I PENDAHULUAN 1.1 Latar Belakang NCBI (National Centre for Biotechnology Information) didirikan pada tahun 1988, merupakan suatu institusi yang menyediakan sumber informasi terkait perkembangan biologi molekuler. NCBI memuat database yang dapat diakses oleh publik dan mengembangkan software penganalisis data genom. Data base terus menerus di update sesuai dengan penemuanpenemuan terkini yang menyangkut DNA, Protein, Senyawa aktif dan taksonomi. NCBI merupakan salah satu bank data gen, protein dan literature khususnya dibidang kesehatan yang terlengkap dan diacu oleh para peneliti di dunia. NCBI dimaksudkan untuk membantu dalam memahami mekanisme molekuler yang mempengaruhi kesehatan manusia dan penyakit (Dhiantika, 2010). NCBI menyediakan situs web yang komprehensif bagi ahli biologi yang mencakup biologi yang berhubungan dengan database, dan alat untuk melihat dan menganalisis data yang melekat di database. Sebuah divisi dari Perpustakaan Nasional Kedokteran di National Institutes of Health, NCBI adalah instansi yang bertanggung jawab untuk menciptakan sistem otomatis untuk menyimpan dan menganalisis profesi yang berkembang pesat data genetik dan molekuler. Salah satu tantangan yang paling sulit yang dihadapi dalam bidang bioinformatika adalah bagaimana untuk menyimpan, dengan cara yang mudah diakses, kelimpahan besar informasi baru, termasuk urutan genom keseluruhan, penemuan gen baru yang sedang berlangsung dan produk gen, dan penentuan fungsi dan struktur. NCBI (Dhiantika, 2010). Beberapa dari banyak manfaat penggunaan NCBI yaitu ketika kita melakukan penelitian mengenai homologi protein antarorganisme. Dengan memanfaatkan salah satu tool pada NCBI, dapat dibandingkan kemiripan asam amino yang menyusun protein. Melalui program blastp pada situs NCBI dapat dilakukan pencarian protein homolog dari berbagai macam organisme. Literatur jurnal yang tersedia dapat diakses melalui PubMed. PubMed merupakan alat penghubung pencarian di web yang menyediakan akses ke lebih dari 11 juta sitasi jurnal di MEDLINE (Dhiantika, 2010). 1.1 Tujuan Tujuan pelaksanaan praktikum yang berjudul pengenalan NCBI (National Center for Biotechnology Information) yaitu untuk mempelajari cara mencari dan mendapatkan data dari genbank 1.2 Manfaat Manfaat yang diperoleh dari pelaksanaan praktikum ini yaitu mahasiswa mengenal database NCBI, mampu mencari dan mendapatkan data dari genbank, sehingga dapat diaplikasikan pada penelitian terkait dengan bidang ilmu biologi molekuler.

BAB II TINJAUAN PUSTAKA

NCBI (National Centre for Biotechnology Information) merupakan suatu institusi yang menyediakan sumber informasi terkait perkembangan biologi molekuler. NCBI membuat database yang dapat diakses oleh publik dan mengembangkan software penganalisis data genom. Biotechnology sangat membantu dalam kehidupan manusia, mulai dari proses bio-yang sederhana sampai kepada tingkat yang lebih canggih. NCBI juga mendorong komunikasi ilmiah pada bidang komputer. NCBI juga mengembangkan dan mempromosikan standar untuk database, deposisi data dan pertukaran, serta tata-nama biologi. Berikut merupakan Data base and Software dari NCBI (National Centre for Biotechnology Information) : (Dhiantika, 2010). 1. Entrez Entrez merupakan sistem pencarian informasi dalam NCBI yang menyediakan akses terintegrasi untuk melakukan sekuensing, pemetaan (mapping) , taksonomi dan data struktural. Entrez juga menyediakan gambaran grafis untuk mapping sekuen dan kromosom. Ciri khas dan keunggulan Entrez adalah kemampuan untuk pencarian informasi terkait sekuen, struktur dan referensi. Literatur jurnal yang tersedia dapat diakses melalui PubMed. PubMed merupakan alat penghubung pencarian di web yang menyediakan akses ke lebih dari 11 juta sitasi jurnal di MEDLINE. Entrez Gene adapat diakses pada www.ncbi.nlm.nih.gov/gene. (Dhiantika, 2010). 2. Nucleotide Database Database nukleotida merupakan suatu koleksi sekuen dari beberapa sumber, termasuk diantaranya GenBank, Reference Sequence (RefSeq), Third Party Annotation (TPA) dan Protein Data Bank (PDB). GenBank merupakan database sekuen genetik dari NIH (National Institutes of Health), berupa koleksi sekuen DNA yang dapat diketahui oleh publik. Database GenBank dibiayai dan didistribusi NCBI. Data sekuen dikirim ke GenBank oleh peneliti dari seluruh dunia. 3.BLAST (Dhiantika, 2010). BLAST (Basic Local Alignment Search Tool) merupakan suatu program untuk pencarian kemiripan sekuen (sequence similarity) dan merupakan alat dalam identifikasi gen dan karakter genetik. Blast dapat melakukan pencarian sekuen melalui perbandingan dengan database DNA dalam waktu singkat (kurang dari 15 detik). Ada 5 program utama dalam BLAST, yaitu : a. nucleotide blast (blastn) : membandingkan suatu sekuen nukleotida meragukan (querysequence) yang kita miliki dengan database sekuen nukleotida.

b. protein blast (blastp) database sekuen protein.

: membandingkan suatu sekuen asam amino yang kita miliki dengan

c. blastx : membandingkan produk translasi konsep 6frame sebuah sekuen nukleotida (translated nucleotide) yang kita miliki dengan database sekuen protein. d. tblastn : membandingkan suatu sekuen protein yang kita miliki dengan database sekuen nukleotida yang secara dinamis ditranslasi pada semua pembacaan 6 frame. e. tblastx : membandingkan suatu translasi 6 frame dari nukleotida (Dhiantika, 2010). Beberapa journal penelitian dapat diakses pada database NCBI melalui Pubmed maupun Pubmed central. PubMed adalah sebuah layanan dari National Library of Medicine, yang menyertakan lebih dari 20 juta kutipan untuk artikel-artikel biomedis sejak tahun 1950-an hingga kini. Kutipan-kutipan itu dari MEDLINE dan tambahan dari jurnal-jurnal sains kehidupan. PuMed menyertakan link ke banyak situs yang menyediakan teks lengkap dari artikel tersebut dan sumbersumber yang berhubungan. PubMed Central (PMC) adalah tempat arsip digital jurnal bebas/gratis yang disediakan oleh Institut Kesehatan Nasional AS (National Institutes of Health-NIH) yang menyediakan literatur ilmiah di bidang biomedik dan ilmu hayat (Berkeley Library, 2012). NCBI (National Center for Biotechnology Information) (RefSeq) database dapat diakses melalui alamat (http://www.ncbi.nlm.nih.gov/RefSeq/) menyediakan koleksi non-redundant urutan genom yang mewakili data, transkrip dan protein. Meskipun tujuannya adalah untuk menyediakan dataset komprehensif mewakili informasi urutan lengkap untuk setiap spesies tertentu, database pragmatis termasuk data urutan yang saat ini tersedia untuk umum dalam database arsip. Basis data menggabungkan data dari lebih dari 2400 organisme dan mencakup lebih dari satu juta protein yang mewakili keragaman taksonomi yang signifikan mencakup prokariota, eukariota dan virus. Sequen nukleotida dan protein secara eksplisit terkait, dan urutan yang terkait dengan sumber daya lain termasuk Viewer Peta NCBI dan Gene. Sequen dianotasikan untuk masuk daerah pengkodean, domain, variasi, referensi, nama, database referensi silang, dan fitur lain yang menggunakan pendekatan gabungan kolaborasi dan masukan lainnya dari komunitas ilmiah, penjelasan otomatis, serta propagasi dari GenBank (Pruitt, 2004). Database GenBank merupakan suatu bentuk koleksi data dari semua urutan nukleotida serta hasil translasi berua sequen protein yang dapat diakses untuk umum. Database ini dihasilkan di National Center for Biotechnology Information (NCBI) sebagai bagian dari kerjasama internasional dengan Laboratorium Biologi Molekuler Eropa (EMBL) , Perpustakaan Data dari Eropa Bioinformatics Institute (EBI) dan DNA Data Bank of Japan (DDBJ). GenBank dan kolaborator menerima urutan diproduksi di laboratorium di seluruh dunia dari lebih dari 100.000 organisme yang berbeda. GenBank terus tumbuh pada tingkat eksponensial, dua kali lipat setiap 10 bulan. Rilis 134, diproduksi pada bulan Februari 2003, berisi lebih dari 29,3 miliar basa nukleotida di lebih dari 23,0 juta urutan. GenBank dibangun dengan pengiriman langsung dari

laboratorium individu, serta dari pengiriman massal dari skala besar pusat sekuensing (NCBI, 2009). Sequen Protein awalnya dikembangkan sebagai suatu sequen berbasis windows editor dengan beberaa kemamuan analisis DNA polimorpism untuk single gen data set. Versi terbaru tersedia untuk windows dan linux dan dapat menangani dataset besar dengan ribuan gen. ukuran dataset dibatasi oleh memori dan dengan niai maksimal 32 bit. program ini akan digunakan untuk mengedit sequen, enanganan outut dari suatu sequen, dapat bekerja ada pencarian blast serta untuk analisis populasi berbagai gen, mendukung dan menfasilitasi semua langkah alur kerja sekuensing (Filatov, 2009).

BAB III METODE PRAKTIKUM 3.1 Waktu dan Tempat Praktikum bioinformatika yang berjudul pengenalan NCBI (National Centre for Biotechnology Information) dilaksanakan pada hari Kamis, 8 Maret 2012 pukul 15.10- 16.30 bertempat di Laboratorium Bioinformatika, Jurusan Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Brawijaya, Malang. 3.2 Cara Kerja 3.2.1 Homo sapiens glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mRNA Berikut ini merupakan langkah-langkah untuk mencari dan mendapatkan data dari genbank NCBI: -Ketik www.ncbi.nlm.nih.gov pada lokasi bar pencarian.

-Pilih nucleotide dan ketik gen yang dikehendaki GAD65 lalu klik search

-gambar dibawah ini merupakan beberapa pilihan sekuens yang berkaitan dengan gen GAD 65. Dipilih berdasarkan organism/spesies yang dikehendaki. Dalam hal ini dipilih homo sapiens NM_001134366.1

-Sebelum dipilh sekuens yang dikehendaki, format display setting diubah menjadi FASTA

Gambar dibawah merupakan hasil sekuens nukleotida yang didapat setelah diklik pada bagian judul spesies yang dikehendaki.

Hasil di copy, dan di save di note pad.

Hasil diatas di copy, dan di save di note pad.

3.2.2 Canis lupus familiaris glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), Mrna -Ketik www.ncbi.nlm.nih.gov pada lokasi bar pencarian.

-Pilih nucleotide dan ketik gen yang dikehendaki GAD65 lalu klik search

-gambar dibawah ini merupakan beberapa pilihan sekuens yang berkaitan dengan gen GAD 65. Dipilih berdasarkan organism/spesies yang dikehendaki. Dalam hal ini dipilih Canis lupus NM_
NM_001077439.1

-Sebelum dipilh sekuens yang dikehendaki, format yang terletak dibawah judul, diubah menjadi FASTA, dengan cara mengkliknya.

-Gambar dibawah merupakan hasil sekuens nukleotida yang didapat setelah diklik pada bagian FASTA

Hasil di copy, dan di save di note pad.

3.2.3 Sus scrofa glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), mRNA -Ketik www.ncbi.nlm.nih.gov pada lokasi bar pencarian.

-Pilih nucleotide dan ketik gen yang dikehendaki GAD65 lalu klik search

-gambar dibawah ini merupakan beberapa pilihan sekuens yang berkaitan dengan gen GAD 65. Dipilih berdasarkan organism/spesies yang dikehendaki. Dalam hal ini dipilih Sus scrofa NM_213895.2

-Sebelum dipilh sekuens yang dikehendaki, format diubah menjadi FASTA dengan cara: send -> file->FASTA->creat file. Kemudian hasil sekuens nukleotida akan terdownload dengan sendirinya

-Gambar dibawah merupakan hasil sekuens nukleotida yang didapat setelah melalui prosedur perubahan menjadi format FASTA:

Hasil di copy, dan di save di note pad.

BAB IV HASIL DAN PEMBAHASAN 4.1 Hasil Praktikum 4.1.1 Homo sapiens glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mRNA
> Homo sapiens glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mRNA GCGGCCGCCCGCACTTCCCGCCTCTGGCTCGCCCGAGGACGCGCTGGCACGCCTCCCACCCCCTCACTCT GACTCCAGCTGGCGTGCATGGTCTGCCTCGCATCCTCACGACTCAGCTCCCTCCCTCTCTCGTGTTTTTT TCCTCCGCCGCCCCCTCATTCATCCCCACTGGGCTCCCTTTCCCTCAAATGCTCTGGGGCTCTCCGCGCT TTCCTGAGTCCGGGCTCCGAGGACCCTTAGGTAGTCCCGGTCTCTTTTAAAGCTCCCCGGCTTCCAAAGG GTTGCCACGTCCCTAAACCCTGTCTCCAGCTCGCATACACACACGCACAGACACGCACGTTTTCTGTTCC TGCGTGACACCCGCCCTCGCCGCTCGGCCCCGCCGGTCCCCGCGCGGTGCCCTCCTCCCGCCACACGGGC ACGCACGCGCGCGCAGGGCCAAGCCCGAGGCAGCTCGCCCGCAGCTCGCACTCGCAGGCGACCTGCTCCA GTCTCCAAAGCCGATGGCATCTCCGGGCTCTGGCTTTTGGTCTTTCGGGTCGGAAGATGGCTCTGGGGAT TCCGAGAATCCCGGCACAGCGCGAGCCTGGTGCCAAGTGGCTCAGAAGTTCACGGGCGGCATCGGAAACA AACTGTGCGCCCTGCTCTACGGAGACGCCGAGAAGCCGGCGGAGAGCGGCGGGAGCCAACCCCCGCGGGC CGCCGCCCGGAAGGCCGCCTGCGCCTGCGACCAGAAGCCCTGCAGCTGCTCCAAAGTGGATGTCAACTAC GCGTTTCTCCATGCAACAGACCTGCTGCCGGCGTGTGATGGAGAAAGGCCCACTTTGGCGTTTCTGCAAG ATGTTATGAACATTTTACTTCAGTATGTGGTGAAAAGTTTCGATAGATCAACCAAAGTGATTGATTTCCA TTATCCTAATGAGCTTCTCCAAGAATATAATTGGGAATTGGCAGACCAACCACAAAATTTGGAGGAAATT TTGATGCATTGCCAAACAACTCTAAAATATGCAATTAAAACAGGGCATCCTAGATACTTCAATCAACTTT CTACTGGTTTGGATATGGTTGGATTAGCAGCAGACTGGCTGACATCAACAGCAAATACTAACATGTTCAC CTATGAAATTGCTCCAGTATTTGTGCTTTTGGAATATGTCACACTAAAGAAAATGAGAGAAATCATTGGC TGGCCAGGGGGCTCTGGCGATGGGATATTTTCTCCCGGTGGCGCCATATCTAACATGTATGCCATGATGA TCGCACGCTTTAAGATGTTCCCAGAAGTCAAGGAGAAAGGAATGGCTGCTCTTCCCAGGCTCATTGCCTT CACGTCTGAACATAGTCATTTTTCTCTCAAGAAGGGAGCTGCAGCCTTAGGGATTGGAACAGACAGCGTG ATTCTGATTAAATGTGATGAGAGAGGGAAAATGATTCCATCTGATCTTGAAAGAAGGATTCTTGAAGCCA AACAGAAAGGGTTTGTTCCTTTCCTCGTGAGTGCCACAGCTGGAACCACCGTGTACGGAGCATTTGACCC CCTCTTAGCTGTCGCTGACATTTGCAAAAAGTATAAGATCTGGATGCATGTGGATGCAGCTTGGGGTGGG GGATTACTGATGTCCCGAAAACACAAGTGGAAACTGAGTGGCGTGGAGAGGGCCAACTCTGTGACGTGGA ATCCACACAAGATGATGGGAGTCCCTTTGCAGTGCTCTGCTCTCCTGGTTAGAGAAGAGGGATTGATGCA GAATTGCAACCAAATGCATGCCTCCTACCTCTTTCAGCAAGATAAACATTATGACCTGTCCTATGACACT GGAGACAAGGCCTTACAGTGCGGACGCCACGTTGATGTTTTTAAACTATGGCTGATGTGGAGGGCAAAGG GGACTACCGGGTTTGAAGCGCATGTTGATAAATGTTTGGAGTTGGCAGAGTATTTATACAACATCATAAA AAACCGAGAAGGATATGAGATGGTGTTTGATGGGAAGCCTCAGCACACAAATGTCTGCTTCTGGTACATT CCTCCAAGCTTGCGTACTCTGGAAGACAATGAAGAGAGAATGAGTCGCCTCTCGAAGGTGGCTCCAGTGA TTAAAGCCAGAATGATGGAGTATGGAACCACAATGGTCAGCTACCAACCCTTGGGAGACAAGGTCAATTT CTTCCGCATGGTCATCTCAAACCCAGCGGCAACTCACCAAGACATTGACTTCCTGATTGAAGAAATAGAA CGCCTTGGACAAGATTTATAATAACCTTGCTCACCAAGCTGTTCCACTTCTCTAGGTAGACAATTAAGTT GTCACAAACTGTGTGAATGTATTTGTAGTTTGTTCCAAAGTAAATCTATTTCTATATTGTGGTGTCAAAG TAGAGTTTAAAAATTAAACAAAAAAGACATTGCTCCTTT

4.1.2 Canis lupus familiaris glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), mRNA
> Canis lupus familiaris glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), mRNA ATGGCATCTCCAGGCTCTGGCTTCTGGTCCTTCGGGTCTGAAGATGGCTCCGGGGATCCCGAGAACCCCA GCACAGCGAGAGCCTGGTGTCAGGTGGCCCAGAAGTTCACGGGCGGCATCGGAAACAAGCTGTGCGCCCT GCTCTACGGAGATGCCGAGAAGCCCGCGGAGAGTGGCGGGAGCGAGCCCCCGCGCGCCACCTCCAGGAAG GCCGCCTGCGCTTGTAATCAGAAGCCTTGCAGCTGCCCCAAAGCGGAGGTCAACTATGCGTTTCTACACG CAACAGACCTGCTGCCAGCCTGTGATGGAGAAAGGCCCACGTTGGCGTTTCTGCAAGATGTTATGGACAT TTTGCTTCAGTATGTTGTGAAAAGTTTCGATAGATCAACCAAAGTGATTGATTTCCATTACCCTAATGAG

CTCCTTCAAGAGTATAACTGGGAATTGGCAGACCAACCACAAAATTTGGAGGAAATTTTGATGCATTGCC AAACGACTCTAAAATATGCAATTAAAACAGGGCATCCCAGATATTTCAATCAGCTTTCCACTGGACTGGA TATGGTTGGATTAGCAGCAGACTGGCTGACATCAACAGCAAACACAAACATGTTCACCTATGAAATTGCT CCAGTATTTGTGCTCTTGGAATATGTCACACTAAAGAAAATGAGAGAAATCATTGGCTGGCCGGGAGGCT CTGGCGATGGGATATTTTCTCCTGGTGGCGCTATTTCTAACATGTATGCCATGCTGATCGCACGCTTTAA GATGTTCCCAGAAGTCAAGGAGAAAGGAATGGCTGCGGTTCCCAGGCTCATTGCCTTCACATCTGAGCAT AGTCACTTTTCTCTCAAGAAGGGAGCTGCAGCTTTGGGGATTGGAACAGACAGCGTGATTCTGATTAAAT GTGATGAGAGGGGGAAAATGGTCCCATCTGATCTTGAAAGAAGGATCCTTGAAGCCAAACAAAAAGGATT TGTTCCTTTCCTTGTGAGCGCCACAGCTGGGACCACCGTGTATGGAGCATTCGACCCCCTCTTAGCAGTT GCTGACATTTGTAAAAAGTACAAGATCTGGATGCATGTGGATGCTGCTTGGGGTGGGGGATTACTGATGT CCCGGAAGCACAAATGGAAGCTGAGCGGCGTGGAGAGGGCCAACTCTGTGACATGGAACCCACACAAGAT GATGGGCGTCCCTTTACAGTGCTCCGCTCTCCTGGTTAGAGAAGAGGGATTGATGCAGAGTTGCAACCAG ATGCATGCCTCCTACCTCTTCCAGCAAGATAAACACTATGACCTGTCCTATGATACTGGGGATAAGGCCT TACAGTGTGGACGCCACGTTGATGTTTTTAAATTATGGCTAATGTGGAGGGCAAAGGGCACCACTGGGTT TGAAGCACATATTGATAAGTGCCTGGAGCTGGCTGAGTATTTATACAGTATCATAAAAAACCGAGAAGGA TACGAAATGGTGTTTGATGGAAAGCCTCAGCACACAAATGTCTGCTTCTGGTACGTGCCTCCAAGTTTGC GTGTCCTGGAAGACAATGAAGAGAGAATGAACCGCCTCTCAAAGGTGGCCCCAGTGATTAAAGCCCGAAT GATGGAGTATGGGACCACAATGGTCAGCTATCAGCCCTTGGGAGACAAGGTCAATTTCTTCCGCATGGTT ATCTCAAATCCCGCAGCAACTCACCAAGACATCGACTTCCTGATTGAAGAAATAGAACGCCTTGGACAAG ATTTATAA

4.1.3 Sus scrofa glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), mRNA
> Sus scrofa glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), mRNA CTTTGGTTCCTTTCCCTATTCAACTCTTCAGCTTTCAGAGTGTTGCCACGTCTCTAAGCTCTAATCCCAG CACTCTCACACACATGCAGACACTCACGTTTCCTGTCCCTGTGTGACACCCACCCGGTCCCCGCGCGGCG TCCTCCTCCCGCCACACACACACACACACACACGCACGCACGCACGCGCGCAGGGCCGAGCGGAGGACAG CTCGCSGGCAGTTCGCACTTGGAGGCGTCCTGCTTCGGTCTCGCAGCGCTGATGGCATCTCCGGGCTCGG GCTTTTGGTCCTTCGGATCTGAAGATGGCTCTGGGGATCCAGAGAACTCTGGCACAGCGAGAGCTTGGTG TCAGGTGGCCCAGAAGTTCACGGGCGGCATCGGAAACAAGCTWTGCGCCCTGCTCTACGGAGACGCAGAG AAGCCGGCGGAGAGCGGCGGRAGCCAGCCCCCGMGGACCACCTCCCGCAAGGCTACCTGCGCCTGCAACC AGAAGCCCTGCARCTGCCCCAAAGCGGAGGTCAACTATGCGTTTCTACACGCAACAGACCTGCTACCAGC GTGTGATGGAGAAAGGCCCACTTTGGCATTTCTGCAAGATGTTATGGACATTTTGCTTCAGTATGTGGTG AAAAGTTTCGATAGATCAACCAAAGTGATTGATTTCCATTACCCTAATGAGCTTCTTCAAGAATATAATT GGGAGTTAGCAGACCAGCCACAAAATTTGGAGGAAATTTTGATGCATTGCCAAACAACTCTAAAATATGC AATCAAAACAGGGCATCCCAGATATTTCAATCAGCTTTCTACTGGACTGGATATGGTAGGATTAGCAGCA GACTGGCTGACATCAACTGCAAACACTAATATGTTCACCTATGAAATTGCTCCGGTATTTGTGCTTTTGG AATATGTCACGCTAAAGAAAATGAGAGAAATCATTGGCTGGCCTGGGGGCTCTGGCGATGGGATATTTTC TCCTGGTGGAGCCATATCCAACATGTACGCCATGCTGATTGCACGCTTTAAGATGTTCCCTGAGGTCAAG GAGAAAGGGATGGCCGCTGTTCCCAGGCTCATTGCCTTCACCTCTGAGCATAGTCATTTTTCTCTCAAGA AGGGAGCTGCAGCCTTGGGCATTGGAACAGACAGTGTGATTCTGATTAAATGTGATGAAAGGGGGAAAAT GATCCCATCTGACCTTGAAAGAAGGATCCTTGAAGCCAAACAAAAAGGATTTGTCCCCTTCCTTGTGAGT GCCACAGCTGGGACCACTGTCTATGGAGCATTCGATCCCCTGCTAGCTGTCGCTGACATCTGCAAAAAGT ATAAGATCTGGATGCACGTGGATGCAGCTTGGGGTGGGGGATTACTGATGTCCCGAAAACACAAGTGGAA ACTGAGCGGCGTGGAGAGGGCCAACTCTGTGACATGGAATCCACATAAGATGATGGGTGTCCCTCTGCAG TGCTCTGCTCTCCTCGTTAGAGAAGAGGGGTTGATGCAGAGCTGCAACCAGATGCATGCCTCCTACCTCT TTCAGCAAGATAAACACTATGACCTGTCCTACGACACTGGAGACAAGGCCTTACAGTGCGGACGCCACGT TGATGTTTTTAAACTCTGGCTAATGTGGAGGGCAAAGGGGACAACTGGGTTTGAAGCACACATTGATAAG TGTTTGGAGCTGGCGGAGTATTTATACAACATCATCAAAAACCGAGAAGGGTATGAAATGGTGTTTGATG GAAAGCCTCAGCACACAAACGTCTGCTTCTGGTATGTTCCACCGAGTCTGCGAGTGCTGGACAACAATGA AGAGAGGATGAGCCGCCTTTCCAAGGTGGCTCCAGTGATTAAGGCCAGAATGATGGAGTCCGGGACCACG ATGGTGAGCTACCAGCCCTTGGGAGACAAGGTCAATTTCTTCCGCATGGTCATCTCAAACCCCGCAGCAA CCCACCAAGACATTGACTTTCTGATTGAAGAAATAGAACGCCTTGGACAAGATTTATAATAACCTAGCTC ACCAAGCTGCTTCAGTTCTCTAGGTAGACAATGAAGTTGTCACAAACCGTGTAAATGTATTTGTAGTTTG TTCCAAAGTAAATCTATTTCTATATTGTGGTGTCAAAGTAGAGTACAGTTTAAAAAAAATCAAAAGCAAA CAAACATTGCTCCTTTTCAGAATCCTTTCTTAAGTTAAGATTACCTCTCTAATAATTAGTGACAAAAGGC

TGTGTGCTAATCAATAAGGAAAAGCTTAATATTGTTATAAATACTTCCCTTACTTTTAATATAGTGTGCA AATCAGAGCTTTATTTTCACTTCAGAGTAGTAGGATTGAATAGTGCCAAATTGCCCCTGAATCATCAAAG GTTCTTTGGGGTGCAGTGAAAAGGGTAAAGTAAATATAAAATGTATGTTGACAATAAAAAAAAAACTTTT GCCTTTTTAAA

BAB V PENUTUP 5.1 Kesimpulan Berdasarkan praktikum yang telah dilakukan data disimpulkan bahwa NCBI (National Centre for Biotechnology Information) merupakan suatu institusi yang menyediakan sumber informasi terkait perkembangan biologi molekuler. NCBI membuat database yang dapat diakses oleh publik dan mengembangkan software penganalisis data genom. Untuk mencari dan mendapatkan data bank dilakukan dengan cara Ketik www.ncbi.nlm.nih.gov, jika ingin mengetahui sequen nukleotida pilih Nucleotide sequen , dan tulis gen serta organism yang akan dicari, kemudian dipilih sekuen target dan klik FASTA agar bisa dibaca ada software tertentu. Terdaat 3 cara untuk mengubah data dalam bentuk FASTA. 5.2 Saran Sebaiknya pada saat pelaksanaan praktikum praktikan telah berusaha memahami tentang NCBI, agar pada saat pelaksanaan praktikum, praktikan bisa menanyakan sesuatu yang tidak dimengeti, selanjutnya tujuannya yaitu agar tidak ada lagi pertanyaan saat akan mengerjakan laporan.

DAFTAR PUSTAKA

Bekerly Library. 2012. Pubmed: Quick Guide. The Regents of the University of California. Dhiantika. 2010. Pengenalan National Centre For Biotechnology Information (NCBI). http://dhiantika.staff.ugm.ac.id/files/2010/11/BUKU-PETUNJUK-DRYLAB-BIOSEL-2010.pdf. Tanggal akses 14 Maret 2012. Filatov, D. 2009. Processing and population genetic analysis of multigenic datasets with ProSeq3 software. http://bioinformatics.oxfordjournals.org/content/25/23/3189.full.pdf Department of Plant Sciences, University of Oxford, South Parks Rd, Oxford OX1 3RB, UK. Tanggal akses 14 Maret 2012. NCBI.2009. GenBank: The Nucleotide Sequence Database. http://www.ncbi.nlm.nih.gov/books/NBK21105/. Tanggal akses 14 Maret 2012. Pruitt,Kimm D. 2004. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. http://nar.oxfordjournals.org/content/33/suppl_1/D501.full. Tanggal akses 14 Maret 2012.