Anda di halaman 1dari 346

BIOKIMIA

Struktur & Fungsi Biomolekul


Oleh : Yohanis Ngili


Edisi Pertama
Cetakan Pertama, 2009
Hak Cipta 2009 pada penulis,
Hak Cipta dilindungi undang-undang. Dilarang memperbanyak atau memindahkan sebagian
atau seluruh isi buku ini dalam bentuk apa pun, secara elektronis maupun mekanis, termasuk
memfotokopi, merekam, atau dengan teknik perekaman lainnya, tanpa izin tertulis dari
penerbit.
Candi Gebang Permai Blok R/6
Yogyakarta 55511
Telp. : 0274-882262; 0274-4462135
Fax. : 0274-4462136
E-mail : info@grahailmu.co.id
Ngi l i , Yohanes
BI OKOMI A: St r ukt ur & f ungsi Bi omol ekul / Yohanes Ngi l i
- Edi si Per t ama Yogyakar t a; Gr aha I l mu, 2009
xx + 324 hl m, 1 J i l . : 23 cm.
I SBN: 978- 979- 756- 448- 3
1. Ki mi a I . J udul
KATA PENGANTAR
Puji syukur kami panjatkan kehadirat Tuhan Yang Maha Esa,
karena atas Anugerah dan Berkat-Nya, sehingga penulis dapat me-
nyelesaikan buku Biokimia: Struktur dan Fungsi Biomolekul. Penu-
lisan buku Biokimia ini secara khusus bertujuan untuk menunjang
proses pembelajaran mata kuliah Biokimia pada Program Sarjana
(S-1) dan Magister (S-2). Buku ini disusun untuk membantu yang
selama ini terkendala oleh minimnya buku biokimia berbahasa In-
donesia. Seperti kita ketahui bahwa biokimia merupakan suatu in-
terdisiplin ilmu yang merupakan pusat dari berbagai subbidang
ilmu seperti Kedokteran, Nutrisi, Bioteknologi, Mikrobiologi, Fi-
siologi, Biologi Sel, Biofisik, Genetik, Kimia Organik, Farmasi, dan
lainnya
Penulisan buku ini disusun secara kompilasi dari berbagai sum-
ber, baik dari informasi yang ada di Internet yang merupakan hasil
penelitian, yang disediakan secara open source maupun dari buku
cetak (textbook) yang telah ada. Selain itu juga, pada beberapa sub-
materi diambil dari jurnal penelitian internasional. Buku Biokimia:
Stuktur dan Fungsi Biomolekul ini dapat digunakan sebagai buku
acuan dalam mempelajari Biokimia pada tingkat dasar dan lanju-
tan. Biokimia yang menyangkut Struktur dan Fungsi Biomolekul
dalam kurikulum kimia meliputi materi-materi : Karbohidrat; Asam
Amino dan Peptida; Protein; Lipid, Membran, Transpor, Penyina-
lan; Asam Nukleat; dan Katalis dan Kinetika Enzim. Ilmu Biokimia
sebagai disiplin ilmu yang mandiri adalah ilmu yang mempelajari
struktur organisasi, dan fungsi materi hidup pada tingkat molekul.
Pembagian kajian biokimia dikategorikan dalam 3 bagian yakni, (1)
Struktur dan Fungsi Biomolekul; (2) Metabolisme dan Bioenergi-
tika; dan (3) Aliran Informasi Genetik.
BIOKIMIA: Struktur dan Fungsi Biomolekul viii
Perkembangan Biokimia yang cepat saat ini menuntut adanya
pelbagai strategi untuk menghasilkan produk (output) pembelajaran
biokimia yang memadai. Bercermin dari hal tersebut maka penulisan
buku ini diharapkan membantu pembaca mencerna ilmu biokimia
secara sistematis dan komprehensif. Penulisan buku ini juga merupakan
salah satu cara penulis memperkenalkan ilmu biokimia sebagai cabang
ilmu paling menantang saat ini. Sebagai contoh riset tentang AIDS,
Kanker, TBC, Malaria, maupun penyakit-penyakit yang diakibatkan
karena mutasi genetik, perlu ditangani dari perspektif pemahaman
biokimia yang memadai. Perkembangan ilmu biokimia yang sering
di sebut sebagai The Front Line of Science saat ini menuntut kita
untuk lebih banyak membaca artikel Jurnal riset maupun buku-buku
biokimia yang terbaru.
Penulis melalui kesempatan ini mengucapkan terima kasih kepada
banyak pihak yang telah membantu penulisan buku ini. Terima kasih
kepada Bapak A. Saifuddin Noer, Ph.D sebagai pembimbing dan
pendorong serta dengan rela hati telah memberikan banyak referensi
berarti dalam penyelesaian dan penyempurnaan buku ini. Juga kepada
pak Susanto sebagai kepala pemasaran Penerbit Graha Ilmu cabang
Bandung yang telah banyak membantu.
Dengan senang hati penulis menunggu saran dan kritik untuk
penyempurnaan buku ini dan semoga buku ini dapat digunakan untuk
menunjang proses pembelajaran Biokimia pada program sarjana dan
magister di Indonesia.
Bandung, Desember 2008
Penulis,
Yohanis Ngili
Gambar 2-1 Struktur dasar asam a-amino dalam konfigurasi L
R adalah gugus samping dari 20 gugus kimia 37
Gambar 2-2 Titrasi 10 mmol glisin.HCl oleh larutan NaOH.
Garis putus-putus menunjukkan titrasi dengan
ditambahkan formaldehid 50
Gambar 2-3 Titrasi 10 mmol asam glutamat hidroklorida oleh
NaOH 53
Gambar 2-4 Pemisahan asam amino menggunakan
kromatografi penukar ion. Luas puncak adalah
proporsional dengan jumlah asam amino dalam
larutan. 57
Gambar 2-5 Protein dibangun oleh asam amino yang
dihubungkan oleh ikatan peptida untuk
membentuk rantai polipeptida. 61
Gambar 2-6. Bagian dari rantai polipeptida yang dibagi menjadi
unit-unit peptida, digambarkan sebagai balok dalam
diagram. 63
Gambar 2-7 Diagram menunjukkan rantai polipeptida
di mana atom-atom rantai utama digambarkan
sebagai unit peptida kaku, dihubungkan melalui
atom-atom Ca 64
Gambar 2-8 Plot Ramachandran menunjukkan kombinasi yang
diperbolehkan untuk sudut konformasi phi dan psi 67
Gambar 2-9 Contoh-contoh atom logam intrinsik fungsional
penting dalam protein. (a) Pusat di-besi pada enzim
ribonukleotida reduktase 69
Gambar 2-10 Disulfide biasanya merupakan produk akhir dari
oksidasi udara dengan reaktan 2-CH
2
SH + 1/2 O
2
70
DAFTAR GAMBAR
BIOKIMIA: Struktur dan Fungsi Biomolekul x
Gambar 3-1 Reaksi reaksi degradasi Edman 77
Gambar 3-2 Gel filtrasi protein 82
Gambar 3-3 Jembatan garam antara rantai-rantai samping
residu Arg dan Glu 85
Gambar 3-4 Definisi sudut torsi protein w, f, y, dan c 89
Gambar 3-5 Plot Ramachandran untuk alanilalanin 91
Gambar 3-6 Kaidah tangan kanan a-heliks 93
Gambar 3-7 Struktur b sheet 94
Gambar 3-8 Representasi model struktur protein dimana
a-heliks 96
Gambar 3-9 Spektrum ORD untuk poli-D-lisin 97
Gambar 3-10 Diagram topologi untuk (a) protein pengikat
retinol (RBP, retinol binding protein) dan (b)
triosefosfat isomerase (TPI) 99
Gambar 3-11 Representasi diagram unit lipatan
supersekunder
b-a-b dari suatu protein 101
Gambar 3-12 a-Heliks adalah salah satu elemen utama
struktur sekunder dalam protein 108
Gambar 3-13 Gugus bermuatan negatif seperti ion fosfat
seringkali terikat pada ujung amino a-heliks 111
Gambar 3-14 Ilustrasi skematik b sheet antiparalel 113
Gambar 3-15 b -Sheet paralel 114
Gambar 3-16 Ilustrasi pilinan b-sheet dan Ikatan hidrogen
antara untai b dalam b-sheet campuran dari
protein yang sama 115
Gambar 3-17 Struktur mioglobin memperlihatkan semua
atom sebagai lingkaran kecil yang dihubungkan
oleh garis lurus 115
Gambar 3-18 Contoh diagram skematik untuk tipe struktur
miglobin dan struktur enzim triosefosfat
isomerase yang dipelopori oleh Jane Richardson 117
Dafar Gambar xi
Gambar 3-19 b -Sheet biasanya digambarkan hanya dengan
panah dalam diagram topologi yang
menunjukkan arah tiap untai b dan bagaimana
untai tersebut dihubungkan satu sama lain
sepanjang rantai polipeptida 118
Gambar 3-20 Motif hairpin sangat sering dalam b -sheet dan
dibangun dari dua untai b bersebelahan yang
dihubungkan oleh daerah loop 119
Gambar 3-21 Dua untai b paralel yang bersebelahan biasanya
dihubungkan oleh satu a-heliks dari ujung-C
untai 1 kepada ujung-N untai 2 121
Gambar 3-22 Motif b-a-b pada prinsipnya bisa memiliki dua
tangan 122
Gambar 3-23 Motif yang bersebelahan dalam urutan
asam amino juga biasanya bersebelahan dalam
struktur tiga dimensi 124
Gambar 3-24 Rantai peptida lisozim dari bakteriofage T4 yang
melipat menjadi 2 domain 139
Gambar 3-25 Struktur lisozim T4 yang menunjukkan lokasi
terjadinya 2 mutasi yang menstabilkan struktur
protein melalui interaksi elektrostatik dengan
dipol-dipol pada a-heliks. 141
Gambar 3-26 Konstruksi 2 heliks pada domain Z 142
Gambar 3-27 Diagram ribbon struktur domain B1 dari
protein G (biru) dan dimer Rop merah. 145
Gambar 4-1 Suatu amfifil membentuk suatu monolayer pada
permukaan air 170
Gambar 4-2 Satu bentuk micelle, yakni micelle bentuk bola 171
Gambar 4-3 Bentuk-bentuk lipid bilayer 172
Gambar 4-4 Struktur umum partikel lipoprotein 176
Gambar 4-5 Liposom adalah vesicle yang memiliki banyak
lapisan fosfolipid 177
Gambar 4-6 Fosfopipid dengan kepala yang besar cenderung
berpartisi ke dalam lapisan luar di mana tolakannya
lebih lemah 178
BIOKIMIA: Struktur dan Fungsi Biomolekul xii
Gambar 4-7 Beberapa protein integral yang diisolasi dari
membran memiliki berat molekul besar 181
Gambar 4-8 Model mosaik fluida struktur membran 182
Gambar 4-9 Oligosakarida berikatan-N dalam glikoprotein:
tipe kompleks, dan tipe manosa tinggi 185
Gambar 4.10 Struktur membran gliserofosfolipid 188
Gambar 4-11 Struktur dari spingolipid spingomielin dan
galaktoserebrosida 190
Gambar 4-12 Plot radioaktivitas sel yang telah dicuci pada
waktu-waktu yang berbeda 193
Gambar 4-13 Ketergantungan kecepatan transport pada
konsentrasi zat terlarut 194
Gambar 4-14 Plot v terhadap [S]o tidak akan menunjukkan
kejenuhan kecuali jika difusi sederhana dianggap
sepele dibandingkan transpor carrier 195
Gambar 4-15 Plot 1/v terhadap 1/[S]o untuk kedua persamaan
garis lurus. Untuk difusi sederhana dan transpor
memakai carrier 196
Gambar 4-16 Cara zat terlarut bergerak melintasi membran 197
Gambar 4-17 [S+] dan [s+] = konsentrasi kesetimbangan,
terlihat bahwa terdapat lebih banyak muatan
negatif daripada positif pada membran 198
Gambar 6-18 Tipe-tipe transpor aktif 199
Gambar 4-19 Protein transpor bisa berperan sebagai carrier yang
dapat bergerak, misalnya protein transmembran besar
dapat berotasi, protein kecil bisa menyilang membran,
dan protein transpor bisa membentuk pori-pori atau
saluran 201
Gambar 4-20 Perubahan konformasi dalam suatu pori-pori
protein sebagai tempat transpor zat terlarut 202
Gambar 4-21 Pengikatan K+ oleh Valinomisin 203
Gambar 4-22 Struktur reseptor Glucocorticoid 206
Gambar 4-23 Kajian skematis dari reseptor-reseptor yang
bergabung dengan protein G 206
Dafar Gambar xiii
Gambar 4-24 Siklus aktivasi dan deaktivasi heterotrimerik
protein G 208
Gambar 4-25 Hidrolisis fosfatidilinositol 4,5-bifosfat (PIP
2
)
oleh fosfolipase C 210
Gambar 4-26 Skema reseptor faktor pertumbuhan epidermal /
epidermal growth factor (EGF) 211
Gambar 4.27 Aktivasi cAMP protein kinase oleh cAMP 214
Gambar 5-1 Untai DNA yang berperan sebagai templat
untuk replikasi 217
Gambar 5-2 Pasangan Basa dalam DNA 232
Gambar 5-3 Pasangan-pasangan basa dalam dupleks DNA 233
Gambar 5-4 Diagram heliks ganda DNA bentuk B 235
Gambar 5-5 Bentuk Z dan bentuk B DNA. 237
Gambar 5-6 Variasi yang tergantung pada urutan dalam
geometri pasangan basa DNA 237
Gambar 5-7 Sistesis oligonukleotida fase padat 239
Gambar 5-8 Perbedaan spektrum uv untuk bentuk
DNA aslinya (heliks ganda), dan bentuk
terdenaturasi (untai tunggal) 240
Gambar 5-9 Kurva pelelehan untuk DNA dari spesies
yang berbeda 241
Gambar 5-10 Suhu lelehan DNA sebagai fungsi dari
kandungan G + C 242
Gambar 5-11 Analisis COT pada berbagai DNA 244
Gambar 5-12 Penyusunan histon dan DNA dalam nukleosom 247
Gambar 5-13 Bentuk-bentuk topoisomer dari supercoil 248
Gambar 5-14 Pemanjangan DNA melalui pasangan basa yang
ujungnya overlapping yang dilakukan oleh EcoRI 252
Gambar 5-15 Langkah-langkah pembentukkan suatu sambungan,
atau rekombinasi dari molekul DNA 253
Gambar 5-16 Proses denaturasi, penempelan primer, dan
pemanjangan dalam Polymerase Chain Reactin
(PCR) 256
Gambar 5-17 Reaksi PCR 258
BIOKIMIA: Struktur dan Fungsi Biomolekul xiv
Gambar 6-1 Energi aktivasi adalah energi yang lebih rendah
untuk reaksi-reaksi yang dikatalisis.
Energi substrat pada tiap tahap reaksi 271
Gambar 6-2 Hubungan hiperbol antara kecepatan awal (v
0
)
dan konsentrasi substrat awal ([S]0 dari suatu
reaksi katalisis enzim 281
Gambar 6-3 Grafik Lineweaver-Burk, prosedur untuk
menentukan 2 parameter kinetik steady-state
pada persamaan Michaelis-Menten 283
Gambar 6-4 Plot dari log (apparent Km = pKm versus pH
untuk enzim. 297
Gambar 6-5 Plot Lineweaver-Burk : 1/v0 versus 1/[S]0 untuk
(a) inhibisi kompetitif murni dan (b) inhibisi
nonkompetitif murni 300
Gambar 6-6 Bentuk paling sederhana dari regulasi jalur
metabolisme yakni inhibisi suatu enzim oleh
produk jalur tersebut 301
Gambar 6-7 Kontrol dalam jalur metabolisme bercabang 302
Gambar 6-8 Sifat kinetik yang mungkin dari enzim-enzim
regulator 303
Gambar 6-9 Kurva pengikatan oksigen untuk hemoglobin
dan mioglobin 305
Gambar 6-10 Kurva pengikatan yang dibahas oleh persamaan
n-site MWC models dengan KR[X]=a 312
Gambar 6-11 Sifat-sifat dari suatu enzim alosterik MWC
dengan adanya efektor-efektor heterotropik 314
-oo0oo-
Tabel 2.1 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino netral, nonpolar, alifatik) 39
Tabel 2.2 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino polar, alifatik) 40
Tabel 2.3 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino aromatis) 41
Tabel 2.4 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino mengandung sulfur) 41
Tabel 2.5 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino mengandung gugus asam amino
sekunder) 41
Tabel 2.6 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino yang bersifat asam) 42
Tabel 2.7 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino yang bersifat basa) 43
Tabel 2.8 Nilai pKa Beberapa Asam Amino 52
Tabel 2-9 Berbagai bentuk asam glutamat yang mendominasi
hadir pada titik-titik yang berbeda selama titrasi 55
Daftar Tabel
BIOKIMIA: Struktur dan Fungsi Biomolekul xvi
Tabel 3-1 Jenis-jenis Interaksi Nonkovalen yang Terlibat dalam
Stabilitas Struktur Protein 87
Tabel 3-2 Kecenderungan residu-residu asam amino untuk
membentuk a-heliks 93
Tabel 4-1 Beberapa Kelompok Utama Fosfogliserida 162
Tabel 4-2 Lipoprotein Plasma 176
Tabel 4-3 Komposisi Membran 180
Tabel 4-4 Sistem Transpor Carrier 200
Tabel 5-1 Komposisi Basa DNA dalam Berbagai Spesies 231
Tabel 5-2 Perbandingan Heliks-heliks DNA 236
Tabel 6-1 Kelas-kelas Utama Enzim 264
Tabel 6-2 Subklasifikasi Hidrolase 265
-oo0oo-
KATA PENGANTAR v
DAFTAR GAMBAR vii
DAFTAR TABEL xiii
DAFTAR ISI xv
BAB 1 KARBOHIDRAT
1. Pendahuluan 1
2. Gliseraldehid 2
3. Aldosa Sederhana 6
4. Ketosa Sederhana 9
5. Struktur D-glukosa 12
6. Konformasi Glukosa 20
7. Monosakarida Selain Glukosa 21
8. Ikatan Glikosida 27
9. Polisakarida 32
BAB 2 ASAM AMINO DAN PEPTIDA 37
1. Asam Amino 37
2. Sifat Asam-basa dari Asam Amino 44
3. Analisis Asam Amino 56
4. Ikatan Peptida 57
5. Rantai Polipeptida 59
6. Reaksi Sistein 68
BAB 3 PROTEIN 73
1. Pengantar 73
2. Pemurnian dan Karakterisasi Protein 74
3. Pelipatan Protein 84
Daftar Isi
BIOKIMIA: Struktur dan Fungsi Biomolekul xviii
4. Struktur Protein 89
5. Motif-motif Struktur Protein 104
6. Homologi Urutan dan Evolusi Protein 125
7. Prediksi, Rekayasa, dan Rancangan Struktur Protein 126
8. Metode Penentuan Struktur Protein 146
BAB 4 LIPID, MEMBRAN, TRANSPOR, DAN
PENSINYALAN 153
1. Pengantar 153
2. Kelompok-kelompok Lipid 154
3. Asam Lemak 156
4. Gliserolipid 159
5. Sfingolipid 163
6. Lipid yang Diturunkan dari Isopren (Terpen) 166
7. Sifat Lipid dalam Air 170
8. Asam Empedu dan Garam Empedu 173
9. Lipoprotein Plasma 175
10. Vesicle 177
11. Membran 179
12. Struktur dan Fungsi Membran 186
13. Transpor 191
14. Mekanisme Molekul Transpor Lintas Membran 200
15. Pensinyalan 204
BAB 5 ASAM NUKLEAT 215
1. Pengantar 215
2. Asam Nukleat dan Konstituen Kimianya 217
3. Nukleosida 222
4. Nukleotida 224
5. Polinukleotida 227
6. Struktur DNA 230
7. Denaturasi DNA 239
8. Ukuran, Organisasi, dan Topologi DNA 245
9. Struktur dan Tipe RNA 248
10. Nuklease 249
Dafar Isi xix
11. Dna Rekombinan dan Isolasi Gen 251
12. Polymerase Chain Reaction 253
BAB 6 KATALITAS DAN KINETIKA ENZIM 261
1. Konsep Dasar Katalisis Enzim 261
2. Klasifikasi Enzim 263
3. Mode Peningkatan Laju Pemotongan Ikatan 266
4. Peningkatan Laju dan Energi Aktivasi 275
5. Mutagenesis Sisi-terarah (Site-directed Mutagenesis) 277
6. Kinetika Enzim 278
7. Ketergantungan Laju Reaksi Enzim
Pada Konsentrasi Substrat 281
8. Evaluasi Grafik Km dan Vmaks 282
9. Definisi Inhibisi Enzim 283
10. Persamaan Inhibisi Enzim 284
11. Dasar Mekanis Persamaan Michaelis-menten 285
12. Turunan Persamaan Steady-state 288
13. Enzim-enzim Multireaktan 292
14. Pengaruh Ph Pada Laju Reaksi Enzim 294
15. Mekanisme Inhibisi Enzim 298
16. Enzim Regulator 301
DAFTAR PUSTAKA 317
TENTANG PENULIS 321
-oo0oo-
Bab
K A R B O H I D R A T
1
1. PENDAHULUAN
Karbohidrat adalah kelompok senyawa yang mengandung unsur C, H,
dan O. Senyawa-senyawa karbohidrat memiliki sifat pereduksi karena
adanya gugus karbonil dalam bentuk aldehid atau keton. Senyawa
ini juga memiliki banyak gugus hidroksil. Karena itu, karbohidrat
merupakan suatu polihidroksi aldehid atau polihidroksi keton, atau
turunan senyawa-senyawa tersebut.
Senyawa karbohidrat yang memiliki tiga sampai sembilan
atom karbon disebut monosakarida. Gabungan senyawa-senyawa
monosakarida akan membentuk senyawa karbohidrat yang lebih besar.
Ikatan penghubung antara dua buah monosakarida disebut ikatan
glikosida atau glikosidik.
Dalam disakarida, terdapat satu ikatan glikosida yang meng-
hubungkan dua monosakarida. Sedangkan dalam trisakarida terdapat
dua ikatan glikosida yang menghubungkan tiga buah monosakarida.
Karbohidrat yang memiliki beberapa unit monosakarida disebut oligo-
sakarida, sedangkan yang memiliki banyak unit monosakarida disebut
sebagai polisakarida. Banyak monosakarida maupun oligosakarida
memiliki rasa manis, karena itu karbohidrat yang massa molekul relatif
(Mr)-nya kecil sering disebut sebagai gula.
Terdapat dua jenis monosakarida, yakni aldosa dan ketosa.
Aldosa mengandung gugus aldehid (R-CHO), sedangkan ketosa
mengandung gugus keton (R-CO-R). Selain itu, monosakarida juga
dapat dikelompokkan menurut jumlah atom karbon yang dimilikinya.
Bila mengandung tiga atom karbon maka monosakarida tersebut
disebut triosa; sedangkan bila mengandung empat atom karbon maka
disebut tetrosa; pentosa untuk yang mengandung lima atom karbon;
heksosa untuk yang mengandung enam atom karbon; dan seterusnya.
BIOKIMIA: Struktur dan Fungsi Biomolekul 2
Kedua macam pengelompokkan monosakarida ini dapat digabungkan.
Misalnya, glukosa merupakan aldoheksosa, yakni gula monosakarida
dengan enam atom karbon dan suatu gugus aldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 2
Ketotriosa Aldopentosa Aldopentosa Ketoheptosa Ketopentosa
CH
2
OH
CO
CH
2
OH
CH
2
OH
CHOH
CHOH
CHOH
CHO
CHO
CHOH
COH
CH
2
OH HOH
2
C
CH
2
OH
CO
CHOH
CHOH
CHOH
CHOH
CH
2
OH
CH
2
OH
CHOH
CO
CHOH
CH
2
OH
2. GLISERALDEHID
Gliseraldehid merupakan aldosa yang paling sederhana:
L-Gliseraldehid D-Gliseraldehid
Karbon Kiral
1
CHO
2
CHOH
3
CH
2
OH
Cermin
2. GLISERALDEHID
Gliseraldehid merupakan aldosa yang paling sederhana:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 2
Ketotriosa Aldopentosa Aldopentosa Ketoheptosa Ketopentosa
CH
2
OH
CO
CH
2
OH
CH
2
OH
CHOH
CHOH
CHOH
CHO
CHO
CHOH
COH
CH
2
OH HOH
2
C
CH
2
OH
CO
CHOH
CHOH
CHOH
CHOH
CH
2
OH
CH
2
OH
CHOH
CO
CHOH
CH
2
OH
2. GLISERALDEHID
Gliseraldehid merupakan aldosa yang paling sederhana:
L-Gliseraldehid D-Gliseraldehid
Karbon Kiral
1
CHO
2
CHOH
3
CH
2
OH
Cermin
Bab I Karbohidrat 3
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 3
Gliseraldehid memiliki sifat pereduksi karena merupakan suatu aldehid.
Atom C-2 pada molekul ini adalah pusat kiral (disebut juga pusat asimetris),
sehingga terdapat dua isomer yang dikenal sebagai enansiomer:
D-Gliseraldehid L-Gliseraldehid
CHO
C
CH
2
OH
OH H
CHO
C
CH
2
OH
HO H
D-Gliseraldehid
L-Gliseraldehid
Gliseraldehid memiliki sifat pereduksi karena merupakan suatu
aldehid. Atom C-2 pada molekul ini adalah pusat kiral (disebut juga
pusat asimetris), sehingga terdapat dua isomer yang dikenal sebagai
enansiomer:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 3
Gliseraldehid memiliki sifat pereduksi karena merupakan suatu aldehid.
Atom C-2 pada molekul ini adalah pusat kiral (disebut juga pusat asimetris),
sehingga terdapat dua isomer yang dikenal sebagai enansiomer:
D-Gliseraldehid L-Gliseraldehid
CHO
C
CH
2
OH
OH H
CHO
C
CH
2
OH
HO H
D-Gliseraldehid
L-Gliseraldehid
BIOKIMIA: Struktur dan Fungsi Biomolekul 4
Bila digambarkan menurut proyeksi Fischer, maka strukturnya
seperti berikut:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 4
Bila digambarkan menurut proyeksi Fischer, maka strukturnya seperti berikut:
CHO
CH
2
OH
OH H
CHO
CH
2
OH
H HO
Proyeksi Fischer ini menyederhanakan struktur tiga dimensi gliseraldehid seperti
berikut:
CHO
CH
2
OH
CHO
CH
2
OH
H OH HO H
Enansiomer adalah bayangan cermin satu sama lain. Struktur sebelah
kiri disebut D-gliseraldehid, sedangkan yang kanan disebut L-gliseraldehid.
Awalan D- dan L- menunjukkan konfigurasi atau penataan gugus di sekeliling
pusat kiral.
Bila hanya terdapat satu atom karbon kiral, maka di antara kedua
enansiomer hanya terdapat sedikit perbedaan sifat fisik maupun sifat kimia.
Sifat yang paling besar perbedaannya adalah aktivitas optik, yakni kemampuan
suatu larutan enansiomer untuk berotasi ketika disinari oleh cahaya polarisasi.
Salah satu enansiomer akan berotasi searah jarum jam, dan diberi tanda (+).
Enansiomer lainnya akan berotasi berlawanan arah jarum jam, diberi tanda (-).
Contohnya adalah enansiomer D-gliseraldehid adalah (+) sehingga ditulis
lengkap sebagai D-(+)-gliseraldehid, sedangkan pasangannya adalah L-(-)-
gliseraldehid. Campuran enansiomer D dan L akan memberikan rotasi total
tergantung pada proporsi masing-masing enansiomer. Bila proporsi kedua
enansiomer itu seimbang, maka rotasi totalnya adalah nol, dan larutan tersebut
dinamakan sebagai campuran rasemat.
Aktivitas optik diukur menggunakan polarimeter. Besarnya aktivitas
optik diukur sebagai sudut rotasi dengan simbol (alfa). Satuannya yakni
derajat atau radian (SI). Aktivitas optik suatu larutan tergantung pada beberapa
faktor, yakni konsentrasi senyawa, panjang sel tempat larutan tersebut, panjang
Proyeksi Fischer ini menyederhanakan struktur tiga dimensi
gliseraldehid seperti berikut:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 4
Bila digambarkan menurut proyeksi Fischer, maka strukturnya seperti berikut:
CHO
CH
2
OH
OH H
CHO
CH
2
OH
H HO
Proyeksi Fischer ini menyederhanakan struktur tiga dimensi gliseraldehid seperti
berikut:
CHO
CH
2
OH
CHO
CH
2
OH
H OH HO H
Enansiomer adalah bayangan cermin satu sama lain. Struktur sebelah
kiri disebut D-gliseraldehid, sedangkan yang kanan disebut L-gliseraldehid.
Awalan D- dan L- menunjukkan konfigurasi atau penataan gugus di sekeliling
pusat kiral.
Bila hanya terdapat satu atom karbon kiral, maka di antara kedua
enansiomer hanya terdapat sedikit perbedaan sifat fisik maupun sifat kimia.
Sifat yang paling besar perbedaannya adalah aktivitas optik, yakni kemampuan
suatu larutan enansiomer untuk berotasi ketika disinari oleh cahaya polarisasi.
Salah satu enansiomer akan berotasi searah jarum jam, dan diberi tanda (+).
Enansiomer lainnya akan berotasi berlawanan arah jarum jam, diberi tanda (-).
Contohnya adalah enansiomer D-gliseraldehid adalah (+) sehingga ditulis
lengkap sebagai D-(+)-gliseraldehid, sedangkan pasangannya adalah L-(-)-
gliseraldehid. Campuran enansiomer D dan L akan memberikan rotasi total
tergantung pada proporsi masing-masing enansiomer. Bila proporsi kedua
enansiomer itu seimbang, maka rotasi totalnya adalah nol, dan larutan tersebut
dinamakan sebagai campuran rasemat.
Aktivitas optik diukur menggunakan polarimeter. Besarnya aktivitas
optik diukur sebagai sudut rotasi dengan simbol (alfa). Satuannya yakni
derajat atau radian (SI). Aktivitas optik suatu larutan tergantung pada beberapa
faktor, yakni konsentrasi senyawa, panjang sel tempat larutan tersebut, panjang
Enansiomer adalah bayangan cermin satu sama lain. Struktur
sebelah kiri disebut D-gliseraldehid, sedangkan yang kanan disebut
L-gliseraldehid. Awalan D- dan L- menunjukkan konfigurasi atau
penataan gugus di sekeliling pusat kiral.
Bila hanya terdapat satu atom karbon kiral, maka di antara kedua
enansiomer hanya terdapat sedikit perbedaan sifat fisik maupun sifat
kimia. Sifat yang paling besar perbedaannya adalah aktivitas optik,
yakni kemampuan suatu larutan enansiomer untuk berotasi ketika
disinari oleh cahaya polarisasi. Salah satu enansiomer akan berotasi
searah jarum jam, dan diberi tanda (+). Enansiomer lainnya akan
berotasi berlawanan arah jarum jam, diberi tanda (-). Contohnya
adalah enansiomer D-gliseraldehid adalah (+) sehingga ditulis lengkap
sebagai D-(+)-gliseraldehid, sedangkan pasangannya adalah L-(-)-
gliseraldehid. Campuran enansiomer D dan L akan memberikan
rotasi total tergantung pada proporsi masing-masing enansiomer. Bila
Bab I Karbohidrat 5
proporsi kedua enansiomer itu seimbang, maka rotasi totalnya adalah
nol, dan larutan tersebut dinamakan sebagai campuran rasemat.
Aktivitas optik diukur menggunakan polarimeter. Besarnya
aktivitas optik diukur sebagai sudut rotasi dengan simbol a (alfa).
Satuannya yakni derajat atau radian (SI). Aktivitas optik suatu larutan
tergantung pada beberapa faktor, yakni konsentrasi senyawa, panjang
sel tempat larutan tersebut, panjang gelombang cahaya polarisasi, suhu,
dan pelarut. Penggambaran yang lebih jelas mengenai skema dari alat
polarimeter sebagai berikut.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 5
gelombang cahaya polarisasi, suhu, dan pelarut. Penggambaran yang lebih
jelas mengenai skema dari alat polarimeter sebagai berikut.
Karena ketergantungannya pada banyak faktor, yang diukur dalam
percobaan selalu diubah dan diekspresikan sebagai rotasi spesifik
T
D
, dengan
superscript dan subscript yang menunjukkan suhu dan panjang gelombang
sinar (D yakni bentuk D untuk uap natrium, 589,2 nm).

-3
T
D
panjang sel (dm) konsentrasi (g cm )

Nama pelarut diberikan dalam tanda kurung setelah nilainya, misalnya


25
D
=
+17,5
0
(dalam air).
3. ALDOSA SEDERHANA
Aldosa sederhana diturunkan dari gliseraldehid, yakni dengan
memasukkan atom karbon kiral terhidroksilasi (CHOH) di antara karbon C-1 dan
C-2 pada molekul gliseraldehid. Misalnya, dua macam molekul tetrosa
terbentuk ketika CHOH dimasukkan ke dalam D-gliseraldehid:
sinar
monokromatik
sinar tak terpolarisasi
cahaya bidang terpolarisasi
filter
polarisasi
tabung sampel
bidang rotasi-
sinar terpolarisasi
Karena ketergantungannya pada banyak faktor, a yang diukur
dalam
percobaan selalu diubah dan diekspresikan sebagai rotasi spesifik

[ ]
T
-3 D
panjang sel (dm) konsentrasi (g cm )
=

, dengan superscript dan subscript yang menunjukkan suhu dan


panjang gelombang sinar (D yakni bentuk D untuk uap natrium,
589,2 nm).
[ ]
T
-3 D
panjang sel (dm) konsentrasi (g cm )
=

Nama pelarut diberikan dalam tanda kurung setelah nilainya, misalnya


=
[ ]
25
D


+17,5
0
(dalam air).
BIOKIMIA: Struktur dan Fungsi Biomolekul 6
3. ALDOSA SEDERHANA
Aldosa sederhana diturunkan dari gliseraldehid, yakni dengan
memasukkan atom karbon kiral terhidroksilasi (CHOH) di antara
karbon C-1 dan C-2 pada molekul gliseraldehid. Misalnya, dua macam
molekul tetrosa terbentuk ketika CHOH dimasukkan ke dalam D-
gliseraldehid:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 6
CHO
C
CH
2
OH
OH H
D-Gliseraldehid
CHO
C
C
CH
2
OH
OH H
OH H
CHO
C
C
CH
2
OH
H HO
OH H
D-Eritrosa
D-Treosa
+CHOH
L
Gliseraldehid akan menurunkan dua aldotetrosa, yaitu L-eritrosa dan L-
treosa. Dengan demikian terdapat empat macam aldotetrosa. Dari masing-
masing aldotetrosa diturunkan dua aldopentosa, sehingga totalnya terdapat
delapan aldopentosa. Dari molekul-molekul aldopentosa diturunkan 16
aldoheksosa. Di bawah ini adalah struktur delapan aldopentosa dan 16
aldoheksosa yang disederhanakan, dengan o melambangkan aldehid;
melambangkan gugus OH; dan atom H tidak digambarkan.
Treosa
Eritrosa
Gliseraldehid akan menurunkan dua aldotetrosa, yaitu L-eritrosa
dan L-treosa. Dengan demikian terdapat empat macam aldotetrosa.
Dari masing-masing aldotetrosa diturunkan dua aldopentosa, sehingga
totalnya terdapat delapan aldopentosa. Dari molekul-molekul
aldopentosa diturunkan 16 aldoheksosa. Di bawah ini adalah struktur
Bab I Karbohidrat 7
delapan aldopentosa dan 16 aldoheksosa yang disederhanakan, dengan
o melambangkan aldehid; melambangkan gugus OH; dan atom
H tidak digambarkan.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 7
CHO
CH
2
OH
OH H
OH H
CHO
CH
2
OH
H HO
H HO
CHO
CH
2
OH
H HO
OH H
CHO
CH
2
OH
OH H
H HO
D-Eritrosa L-Eritrosa D-Treosa L-Treosa
O O O O O O O O
Ribosa Arabinosa Xilosa
Liksosa
D
D D D L
L L L
O O O O
O O
O O
Alosa Altrosa
Glukosa Manosa
D D
D
D
L L
L L
O O O O O O O O
Gulosa Idosa Galaktosa Talosa
D D D D L
L L L
Ada dua kelompok aldosa sederhana, yaitu kelompok D dan kelompok
L. Untuk menentukan di kelompok mana suatu aldosa tergabung, adalah
dengan memperhatikan atom karbon kiral yang paling dekat dengan gugus
pereduksi kemudian membandingkannya dengan gliseraldehid.
BIOKIMIA: Struktur dan Fungsi Biomolekul 8
Ada dua kelompok aldosa sederhana, yaitu kelompok D dan
kelompok L. Untuk menentukan di kelompok mana suatu aldosa
tergabung, adalah dengan memperhatikan atom karbon kiral yang
paling dekat dengan gugus pereduksi kemudian membandingkannya
dengan gliseraldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 8
CHO
C
C
C
C
CH
2
OH
OH H
H HO
OH H
OH H
CHO
C
CH
2
OH
OH H
D-Glukosa
D-Gliseraldehid
Karbon kiral
yang paling
dekat dengan
gugus pereduksi
Persamaan
struktur
Dalam gula yang ditunjukkan di bawah, (1) adalah L dan (2), (3), dan
(4) adalah D. Pada (3) atom karbon kiral terjauh dari gugus pereduksi adalah
C-2.
CHO
C
C
C
CH
2
OH
OH H
OH H
H HO
CHO
CH
2
C
C
CH
2
OH
OH H
OH H
CHO
C
C
CH
2
OH
OH H
CH
2
OH HO
CHO
C
C
C
C
OH H
H HO
H HO
H
CH
2
OH
NH
2
(1) (4) (3) (2)
Aldotetrosa memiliki dua pusat kiral, aldopentosa memiliki tiga pusat
kiral, dan aldoheksosa memiliki empat pusat kiral. Setiap pusat kiral ini
memberikan aktivitas optik. Aktivitas optik total tergantung pada besarnya
kontribusi dari tiap pusat kiral.
Jika terdapat lebih dari empat atom karbon kiral, suatu aldosa diberi
dua awalan konfigurasi. Salah satunya untuk empat pusat kiral dengan nomor
terendah, dan yang lainnya untuk sisa molekulnya. Konfigurasi untuk gugus
bernomor tertinggi disebutkan lebih dulu.
Dalam gula yang ditunjukkan di bawah, (1) adalah L dan (2),
(3), dan (4) adalah D. Pada (3) atom karbon kiral terjauh dari gugus
pereduksi adalah C-2.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 8
CHO
C
C
C
C
CH
2
OH
OH H
H HO
OH H
OH H
CHO
C
CH
2
OH
OH H
D-Glukosa
D-Gliseraldehid
Karbon kiral
yang paling
dekat dengan
gugus pereduksi
Persamaan
struktur
Dalam gula yang ditunjukkan di bawah, (1) adalah L dan (2), (3), dan
(4) adalah D. Pada (3) atom karbon kiral terjauh dari gugus pereduksi adalah
C-2.
CHO
C
C
C
CH
2
OH
OH H
OH H
H HO
CHO
CH
2
C
C
CH
2
OH
OH H
OH H
CHO
C
C
CH
2
OH
OH H
CH
2
OH HO
CHO
C
C
C
C
OH H
H HO
H HO
H
CH
2
OH
NH
2
(1) (4) (3) (2)
Aldotetrosa memiliki dua pusat kiral, aldopentosa memiliki tiga pusat
kiral, dan aldoheksosa memiliki empat pusat kiral. Setiap pusat kiral ini
memberikan aktivitas optik. Aktivitas optik total tergantung pada besarnya
kontribusi dari tiap pusat kiral.
Jika terdapat lebih dari empat atom karbon kiral, suatu aldosa diberi
dua awalan konfigurasi. Salah satunya untuk empat pusat kiral dengan nomor
terendah, dan yang lainnya untuk sisa molekulnya. Konfigurasi untuk gugus
bernomor tertinggi disebutkan lebih dulu.
Bab I Karbohidrat 9
Aldotetrosa memiliki dua pusat kiral, aldopentosa memiliki tiga
pusat kiral, dan aldoheksosa memiliki empat pusat kiral. Setiap pusat
kiral ini memberikan aktivitas optik. Aktivitas optik total tergantung
pada besarnya kontribusi dari tiap pusat kiral.
Jika terdapat lebih dari empat atom karbon kiral, suatu aldosa
diberi dua awalan konfigurasi. Salah satunya untuk empat pusat kiral
dengan nomor terendah, dan yang lainnya untuk sisa molekulnya.
Konfigurasi untuk gugus bernomor tertinggi disebutkan lebih dulu.
Aldooktosa yang ditunjukkan berikut memiliki nama D-eritro-L-
galaktooktosa.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 9
Aldooktosa yang ditunjukkan berikut memiliki nama D-eritro-L-galaktooktosa.
CHO
CH
2
OH
H HO
OH H
OH H
H HO
OH H
OH H
L-Galakto
D-Eritro
4. KETOSA SEDERHANA
Ketosa sederhana diturunkan dari dihidroksiaseton, yang merupakan
suatu isomer dari gliseraldehid.
CH
2
OH
CO
CH
2
OH
CHO
CHOH
CH
2
OH
Dihidroksiaseton Gliseraldehid
Dihidroksiaseton tidak memiliki pusat kiral, tetapi turunannya memiliki atom
karbon kiral di antara gugus keto dan salah satu gugus hidroksimetil. Terdapat
dua ketotetrosa, empat ketopentosa, dan delapan ketoheksosa.
Ketosa yang paling banyak ditemukan yakni D-fruktosa ditunjukkan di
bawah. Bandingkanlah konfigurasi untuk atom karbon kiral yang paling jauh
dari gugus keto (C-5) dengan D-gliseraldehid.
4. KETOSA SEDERHANA
Ketosa sederhana diturunkan dari dihidroksiaseton, yang merupakan
suatu isomer dari gliseraldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 9
Aldooktosa yang ditunjukkan berikut memiliki nama D-eritro-L-galaktooktosa.
CHO
CH
2
OH
H HO
OH H
OH H
H HO
OH H
OH H
L-Galakto
D-Eritro
4. KETOSA SEDERHANA
Ketosa sederhana diturunkan dari dihidroksiaseton, yang merupakan
suatu isomer dari gliseraldehid.
CH
2
OH
CO
CH
2
OH
CHO
CHOH
CH
2
OH
Dihidroksiaseton Gliseraldehid
Dihidroksiaseton tidak memiliki pusat kiral, tetapi turunannya memiliki atom
karbon kiral di antara gugus keto dan salah satu gugus hidroksimetil. Terdapat
dua ketotetrosa, empat ketopentosa, dan delapan ketoheksosa.
Ketosa yang paling banyak ditemukan yakni D-fruktosa ditunjukkan di
bawah. Bandingkanlah konfigurasi untuk atom karbon kiral yang paling jauh
dari gugus keto (C-5) dengan D-gliseraldehid.
BIOKIMIA: Struktur dan Fungsi Biomolekul 10
Dihidroksiaseton tidak memiliki pusat kiral, tetapi turunannya
memiliki atom karbon kiral di antara gugus keto dan salah satu gugus
hidroksimetil. Terdapat dua ketotetrosa, empat ketopentosa, dan
delapan ketoheksosa.
Ketosa yang paling banyak ditemukan yakni D-fruktosa ditunjuk-
kan di bawah. Bandingkanlah konfigurasi untuk atom karbon kiral
yang paling jauh dari gugus keto (C-5) dengan D-gliseraldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 10
CH
2
OH
CO
C
C
C
H HO
OH H
OH H
CH
2
OH
1
2
3
4
5
6
Fruktosa dinamai demikian jauh sebelum strukturnya diketahui. Hal yang sama
terjadi pada banyak aldosa lainnya. Nama-nama seperti glukosa, manosa,
ribosa, dan fruktosa disebut nama trivial, yakni bersifat nonsistematik.
Ketosa yang ditunjukkan di bawah ini dikenal luas sebagai D-ribulosa
karena merupakan isomer dari D-ribosa. Nama ini tidak tepat, karena senyawa
ini hanya memiliki dua pusat kiral, bukan tiga seperti yang disiratkan oleh
awalan rib-. Senyawa ini berkaitan dengan D-eritrosa, dan nama yang tepat
adalah D-eritro-pentulosa.
CH
2
OH
CO
C
C
CH
2
OH
OH H
OH H
Dua gula di bawah ini memiliki nama sistematik yang tepat yakni (1) L-Treo-
pentulosa, umumnya disebut L-xilulosa; (2) D-Arabino-heksulosa, umumnya
disebut D-fruktosa.
Fruktosa dinamai demikian jauh sebelum strukturnya diketahui.
Hal yang sama terjadi pada banyak aldosa lainnya. Nama-nama seperti
glukosa, manosa, ribosa, dan fruktosa disebut nama trivial, yakni
bersifat nonsistematik.
Ketosa yang ditunjukkan di bawah ini dikenal luas sebagai
D-ribulosa karena merupakan isomer dari D-ribosa. Nama ini tidak
tepat, karena senyawa ini hanya memiliki dua pusat kiral, bukan tiga
seperti yang disiratkan oleh awalan rib-. Senyawa ini berkaitan dengan
D-eritrosa, dan nama yang tepat adalah D-eritro-pentulosa.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 10
CH
2
OH
CO
C
C
C
H HO
OH H
OH H
CH
2
OH
1
2
3
4
5
6
Fruktosa dinamai demikian jauh sebelum strukturnya diketahui. Hal yang sama
terjadi pada banyak aldosa lainnya. Nama-nama seperti glukosa, manosa,
ribosa, dan fruktosa disebut nama trivial, yakni bersifat nonsistematik.
Ketosa yang ditunjukkan di bawah ini dikenal luas sebagai D-ribulosa
karena merupakan isomer dari D-ribosa. Nama ini tidak tepat, karena senyawa
ini hanya memiliki dua pusat kiral, bukan tiga seperti yang disiratkan oleh
awalan rib-. Senyawa ini berkaitan dengan D-eritrosa, dan nama yang tepat
adalah D-eritro-pentulosa.
CH
2
OH
CO
C
C
CH
2
OH
OH H
OH H
Dua gula di bawah ini memiliki nama sistematik yang tepat yakni (1) L-Treo-
pentulosa, umumnya disebut L-xilulosa; (2) D-Arabino-heksulosa, umumnya
disebut D-fruktosa.
Bab I Karbohidrat 11
Dua gula di bawah ini memiliki nama sistematik yang tepat yakni
(1) L-Treo-pentulosa, umumnya disebut L-xilulosa; (2) D-Arabino-
heksulosa, umumnya disebut D-fruktosa.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 11
CH
2
OH
CO
CH
2
OH
OH H
H HO
CH
2
OH
CO
H HO
OH H
CH
2
OH
OH H
(1) (2)
Nama sistematik untuk monosakarida ketosa selalu diakhiri dengan
ulosa, selain fruktosa dan nama trivial lainnya. Beberapa ketosa strukturnya
tidak berkaitan dengan dihidroksiaseton, dan dinamai dengan
mempertimbangkan konfigurasi semua atom karbon kiral sebagai suatu unit,
dengan mengabaikan gugus karbonil.
Perhatikan ketosa di bawah ini. Ketosa tersebut memiliki tiga atom
karbon kiral dalam konfigurasi D-arabino (meskipun disusupi oleh gugus keto).
Gugus keto ini berada pada posisi 3. Ketosa ini memiliki enam atom karbon,
sehingga dinamai D-arabino-3-heksulosa.
C
CO
C
C
CH
2
OH
OH H
OH H
CH
2
OH
H HO
Jika nama suatu ketosa tidak mengandung nomor, maka diasumsikan bahwa
ketosa tersebut berkaitan dengan dihidroksiaseton dan gugus keto berada pada
posisi 2.
Nama sistematik untuk monosakarida ketosa selalu diakhiri
dengan ulosa, selain fruktosa dan nama trivial lainnya. Beberapa
ketosa strukturnya tidak berkaitan dengan dihidroksiaseton, dan
dinamai dengan mempertimbangkan konfigurasi semua atom karbon
kiral sebagai suatu unit, dengan mengabaikan gugus karbonil.
Perhatikan ketosa di bawah ini. Ketosa tersebut memiliki tiga atom
karbon kiral dalam konfigurasi D-arabino (meskipun disusupi oleh
gugus keto). Gugus keto ini berada pada posisi 3. Ketosa ini memiliki
enam atom karbon, sehingga dinamai D-arabino-3-heksulosa.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 11
CH
2
OH
CO
CH
2
OH
OH H
H HO
CH
2
OH
CO
H HO
OH H
CH
2
OH
OH H
(1) (2)
Nama sistematik untuk monosakarida ketosa selalu diakhiri dengan
ulosa, selain fruktosa dan nama trivial lainnya. Beberapa ketosa strukturnya
tidak berkaitan dengan dihidroksiaseton, dan dinamai dengan
mempertimbangkan konfigurasi semua atom karbon kiral sebagai suatu unit,
dengan mengabaikan gugus karbonil.
Perhatikan ketosa di bawah ini. Ketosa tersebut memiliki tiga atom
karbon kiral dalam konfigurasi D-arabino (meskipun disusupi oleh gugus keto).
Gugus keto ini berada pada posisi 3. Ketosa ini memiliki enam atom karbon,
sehingga dinamai D-arabino-3-heksulosa.
C
CO
C
C
CH
2
OH
OH H
OH H
CH
2
OH
H HO
Jika nama suatu ketosa tidak mengandung nomor, maka diasumsikan bahwa
ketosa tersebut berkaitan dengan dihidroksiaseton dan gugus keto berada pada
posisi 2.
BIOKIMIA: Struktur dan Fungsi Biomolekul 12
Jika nama suatu ketosa tidak mengandung nomor, maka diasumsi-
kan bahwa ketosa tersebut berkaitan dengan dihidroksiaseton dan
gugus keto berada pada posisi 2.
5. STRUKTUR D-GLUKOSA
D-Glukosa adalah monosakarida yang paling banyak ditemukan.
Monomer D-glukosa terdapat dalam darah, sedangkan polimernya
terdapat dalam tepung maupun selulosa. Proyeksi Fischer molekul
D-glukosa adalah seperti berikut:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 12
5. STRUKTUR D-GLUKOSA
D-Glukosa adalah monosakarida yang paling banyak ditemukan.
Monomer D-glukosa terdapat dalam darah, sedangkan polimernya terdapat
dalam tepung maupun selulosa. Proyeksi Fischer molekul D-glukosa adalah
seperti berikut:
CHO
CH
2
OH
OH H
H HO
OH H
OH H
Penulisan seperti di atas disebut juga sebagai struktur rantai terbuka atau
struktur rantai lurus. Struktur seperti ini hanya ada dalam larutan. D-glukosa
dalam bentuk kristal memiliki dua macam struktur ( dan ) yang juga berbeda
aktivitas optiknya ketika dilarutkan. Baik -D-glukosa maupun -D-glukosa,
keduanya berupa molekul lingkar:
O
CH
2
OH
H
H
HO
OH
H
H
OH
OH
H
O
CH
2
OH
H
H
HO
OH
H
H
OH
H
OH
-D-Glukosa
-D-Glukosa
Kedua struktur seperti di atas dikenal sebagai rumus proyeksi Haworth. Struktur
tersebut tidak menggambarkan bentuk molekul aslinya, tetapi menunjukkan
konfigurasi tiap atom kiral.
Ketika -D-glukosa atau -D-glukosa dilarutkan dalam air, struktur
lingkar akan terbuka sehingga terbentuk struktur rantai terbuka. Reaksi ini
reversibel, dan kesetimbangan terjadi antara struktur terbuka dan kedua struktur
Penulisan seperti di atas disebut juga sebagai struktur rantai terbuka
atau struktur rantai lurus. Struktur seperti ini hanya ada dalam larutan.
D-glukosa dalam bentuk kristal memiliki dua macam struktur (a dan
b) yang juga berbeda aktivitas optiknya ketika dilarutkan. Baik a-D-
glukosa maupun b-D-glukosa, keduanya berupa molekul lingkar:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 12
5. STRUKTUR D-GLUKOSA
D-Glukosa adalah monosakarida yang paling banyak ditemukan.
Monomer D-glukosa terdapat dalam darah, sedangkan polimernya terdapat
dalam tepung maupun selulosa. Proyeksi Fischer molekul D-glukosa adalah
seperti berikut:
CHO
CH
2
OH
OH H
H HO
OH H
OH H
Penulisan seperti di atas disebut juga sebagai struktur rantai terbuka atau
struktur rantai lurus. Struktur seperti ini hanya ada dalam larutan. D-glukosa
dalam bentuk kristal memiliki dua macam struktur ( dan ) yang juga berbeda
aktivitas optiknya ketika dilarutkan. Baik -D-glukosa maupun -D-glukosa,
keduanya berupa molekul lingkar:
O
CH
2
OH
H
H
HO
OH
H
H
OH
OH
H
O
CH
2
OH
H
H
HO
OH
H
H
OH
H
OH
-D-Glukosa
-D-Glukosa
Kedua struktur seperti di atas dikenal sebagai rumus proyeksi Haworth. Struktur
tersebut tidak menggambarkan bentuk molekul aslinya, tetapi menunjukkan
konfigurasi tiap atom kiral.
Ketika -D-glukosa atau -D-glukosa dilarutkan dalam air, struktur
lingkar akan terbuka sehingga terbentuk struktur rantai terbuka. Reaksi ini
reversibel, dan kesetimbangan terjadi antara struktur terbuka dan kedua struktur
Bab I Karbohidrat 13
Kedua struktur seperti di atas dikenal sebagai rumus proyeksi
Haworth. Struktur tersebut tidak menggambarkan bentuk molekul
aslinya, tetapi menunjukkan konfigurasi tiap atom kiral.
Ketika a-D-glukosa atau b-D-glukosa dilarutkan dalam air,
struktur lingkar akan terbuka sehingga terbentuk struktur rantai
terbuka. Reaksi ini reversibel, dan kesetimbangan terjadi antara struktur
terbuka dan kedua struktur lingkar. Pada umumnya, aldehid bereaksi
reversibel dengan alkohol untuk membentuk hemiasetal lalu dengan
adanya katalis asam akan membentuk asetal:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 13
lingkar. Pada umumnya, aldehid bereaksi reversibel dengan alkohol untuk
membentuk hemiasetal lalu dengan adanya katalis asam akan membentuk
asetal:
O
C
H
R
OH
C
H
R
OR'
OR''
C
H
R
OR'
+ R'OH + R''OH
Pembentukan lingkar dari struktur terbuka D-glukosa terjadi ketika gugus
hidroksil pada C-5 bereaksi dengan gugus aldehid. Karbon aldehid menjadi
kiral, sehingga terbentuk dua hemiasetal yaitu -D-glukosa dan -D-glukosa.
C
C
C
C
C
CH
2
OH
OH H
H HO
OH H
H
1
C
2
C
3
C
4
C
5
C
6
CH
2
OH
OH H
H HO
OH H
OH H
H OH H
O C
C
C
C
C
CH
2
OH
OH H
H HO
OH H
H
HO H
Hemiasetal (-D-glukosa) Hemiasetal (-D-glukosa)
O O
Kedua hemiasetal di atas disebut sebagai anomer, dan karbon C-1 pada
struktur lingkar disebut karbon anomerik.
Pembentukan hemiasetal dan hemiketal, dari suatu aldehid atau keton
yang direaksikan dengan alkohol dengan perbandingan 1:1 yang akan
menghasilkan suatu pusat kiral pada karbon karbonil.
Pembentukan lingkar dari struktur terbuka D-glukosa terjadi
ketika gugus hidroksil pada C-5 bereaksi dengan gugus aldehid.
Karbon aldehid menjadi kiral, sehingga terbentuk dua hemiasetal yaitu
a-D-glukosa dan b-D-glukosa.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 13
lingkar. Pada umumnya, aldehid bereaksi reversibel dengan alkohol untuk
membentuk hemiasetal lalu dengan adanya katalis asam akan membentuk
asetal:
O
C
H
R
OH
C
H
R
OR'
OR''
C
H
R
OR'
+ R'OH + R''OH
Pembentukan lingkar dari struktur terbuka D-glukosa terjadi ketika gugus
hidroksil pada C-5 bereaksi dengan gugus aldehid. Karbon aldehid menjadi
kiral, sehingga terbentuk dua hemiasetal yaitu -D-glukosa dan -D-glukosa.
C
C
C
C
C
CH
2
OH
OH H
H HO
OH H
H
1
C
2
C
3
C
4
C
5
C
6
CH
2
OH
OH H
H HO
OH H
OH H
H OH H
O C
C
C
C
C
CH
2
OH
OH H
H HO
OH H
H
HO H
Hemiasetal (-D-glukosa) Hemiasetal (-D-glukosa)
O O
Kedua hemiasetal di atas disebut sebagai anomer, dan karbon C-1 pada
struktur lingkar disebut karbon anomerik.
Pembentukan hemiasetal dan hemiketal, dari suatu aldehid atau keton
yang direaksikan dengan alkohol dengan perbandingan 1:1 yang akan
menghasilkan suatu pusat kiral pada karbon karbonil.
Kedua hemiasetal di atas disebut sebagai anomer, dan karbon C-1
pada struktur lingkar disebut karbon anomerik.
BIOKIMIA: Struktur dan Fungsi Biomolekul 14
Pembentukan hemiasetal dan hemiketal, dari suatu aldehid atau
keton yang direaksikan dengan alkohol dengan perbandingan 1:1 yang
akan menghasilkan suatu pusat kiral pada karbon karbonil.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 14
Penerjemahan struktur rantai terbuka ke dalam struktur cincin Haworth
paling baik dilakukan dalam prosedur step-by-step. D-Glukosa digunakan
dalam contoh berikut:
1. Tulis struktur rantai terbuka.
CHO
CH
2
OH
OH H
H HO
OH H
OH H
2. Putar struktur searah jarum jam pada sisinya dan bengkokkan melingkar
hampir membentuk cincin.
O
H
HO
H
OH H
OH
H
OH
CH
2
OH
H
5
4
Aldehid Alkohol
Alkohol Keton
Hemiasetal
Hemiketal
Asetal
Ketal
Penerjemahan struktur rantai terbuka ke dalam struktur cincin
Haworth paling baik dilakukan dalam prosedur step-by-step. D-Glukosa
digunakan dalam contoh berikut:
1. Tulis struktur rantai terbuka.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 14
Penerjemahan struktur rantai terbuka ke dalam struktur cincin Haworth
paling baik dilakukan dalam prosedur step-by-step. D-Glukosa digunakan
dalam contoh berikut:
1. Tulis struktur rantai terbuka.
CHO
CH
2
OH
OH H
H HO
OH H
OH H
2. Putar struktur searah jarum jam pada sisinya dan bengkokkan melingkar
hampir membentuk cincin.
O
H
HO
H
OH H
OH
H
OH
CH
2
OH
H
5
4
Aldehid Alkohol
Alkohol Keton
Hemiasetal
Hemiketal
Asetal
Ketal
2. Putar struktur searah jarum jam pada sisinya dan bengkokkan
melingkar hampir membentuk cincin.
Bab I Karbohidrat 15
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 14
Penerjemahan struktur rantai terbuka ke dalam struktur cincin Haworth
paling baik dilakukan dalam prosedur step-by-step. D-Glukosa digunakan
dalam contoh berikut:
1. Tulis struktur rantai terbuka.
CHO
CH
2
OH
OH H
H HO
OH H
OH H
2. Putar struktur searah jarum jam pada sisinya dan bengkokkan melingkar
hampir membentuk cincin.
O
H
HO
H
OH H
OH
H
OH
CH
2
OH
H
5
4
Aldehid Alkohol
Alkohol Keton
Hemiasetal
Hemiketal
Asetal
Ketal
3. Putar ikatan C-4C-5 untuk membawa hidroksil pada C-5
mendekati gugus karbonil.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 15
3. Putar ikatan C-4C-5 untuk membawa hidroksil pada C-5 mendekati
gugus karbonil.
O
H
HO
H
OH H
OH
CH
2
OH
H
OH
H
5
4
4. Bentuk hemiasetal dengan pengikatan hidroksil pada C-5 dengan gugus
karbonil.
O
CH
2
OH
H
OH
H
H
HO
H
OH
H
OH
O
CH
2
OH
H
OH
H
H
HO
H
OH
OH
H
5

Penerjemahan struktur rantai terbuka ke dalam struktur bentuk tertutup juga


dilakukan pada prosedur sebagai berikut:
D-Glukosa
(bentuk rantai terbuka)
-D-Glukosa
-D-Glukosa
4. Bentuk hemiasetal dengan pengikatan hidroksil pada C-5 dengan
gugus karbonil.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 15
3. Putar ikatan C-4C-5 untuk membawa hidroksil pada C-5 mendekati
gugus karbonil.
O
H
HO
H
OH H
OH
CH
2
OH
H
OH
H
5
4
4. Bentuk hemiasetal dengan pengikatan hidroksil pada C-5 dengan gugus
karbonil.
O
CH
2
OH
H
OH
H
H
HO
H
OH
H
OH
O
CH
2
OH
H
OH
H
H
HO
H
OH
OH
H
5

Penerjemahan struktur rantai terbuka ke dalam struktur bentuk tertutup juga


dilakukan pada prosedur sebagai berikut:
D-Glukosa
(bentuk rantai terbuka)
-D-Glukosa
-D-Glukosa
Penerjemahan struktur rantai terbuka ke dalam struktur bentuk
tertutup juga dilakukan pada prosedur sebagai berikut:
BIOKIMIA: Struktur dan Fungsi Biomolekul 16
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 15
3. Putar ikatan C-4C-5 untuk membawa hidroksil pada C-5 mendekati
gugus karbonil.
O
H
HO
H
OH H
OH
CH
2
OH
H
OH
H
5
4
4. Bentuk hemiasetal dengan pengikatan hidroksil pada C-5 dengan gugus
karbonil.
O
CH
2
OH
H
OH
H
H
HO
H
OH
H
OH
O
CH
2
OH
H
OH
H
H
HO
H
OH
OH
H
5

Penerjemahan struktur rantai terbuka ke dalam struktur bentuk tertutup juga


dilakukan pada prosedur sebagai berikut:
D-Glukosa
(bentuk rantai terbuka)
-D-Glukosa
-D-Glukosa
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 16
Adalah normal untuk menulis struktur cincin gula dengan menghilangkan atom
H yang menempel pada karbon, misalnya -D-glukosa ditulis sebagai:
O
CH
2
OH
OH
HO
OH
OH
D-(+)-Glukosa
D-(+)-Glukosa
bentuk terbuka bentuk intermediet bentuk siklik
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 16
Adalah normal untuk menulis struktur cincin gula dengan menghilangkan atom
H yang menempel pada karbon, misalnya -D-glukosa ditulis sebagai:
O
CH
2
OH
OH
HO
OH
OH
D-(+)-Glukosa
D-(+)-Glukosa
bentuk terbuka bentuk intermediet bentuk siklik
Bab I Karbohidrat 17
Adalah normal untuk menulis struktur cincin gula dengan
menghilangkan atom H yang menempel pada karbon, misalnya b-D-
glukosa ditulis sebagai:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 16
Adalah normal untuk menulis struktur cincin gula dengan menghilangkan atom
H yang menempel pada karbon, misalnya -D-glukosa ditulis sebagai:
O
CH
2
OH
OH
HO
OH
OH
D-(+)-Glukosa
D-(+)-Glukosa
bentuk terbuka bentuk intermediet bentuk siklik
Penyebutan a atau b pada anomer tergantung pada konfigurasi
karbon anomerik relatif terhadap konfigurasi atom kiral yang
menentukan apakah monosakarida tersebut termasuk kelompok L
atau D (dalam glukosa yakni C-5). Jika dalam rumus proyeksi Fischer
gugus hidroksil pada karbon ini berorientasi cis, maka anomer tersebut
disebut a. Sedangkan jika gugus hidroksil tersebut trans, maka anomer
disebut b. Perbandingan struktur dalam langkah (2) contoh soal di atas
dengan langkah (4) menunjukkan bahwa gugus hidroksil pada C-5
berada di bawah bidang datar cincin sebelum cincin tertutup. Karena
itu, anomer dengan hidroksil anomerik yang berada di bawah bidang
datar cincin disebut a.
Meskipun bentuk rantai terbuka glukosa mempunyai empat pusat
kiral, namun pembentukan cincin menciptakan pusat kiral yang kelima.
Hal ini menyebabkan kedua anomer berbeda dalam rotasi optik. Ketika
a-D-glukosa padat dilarutkan dalam air,
[ ]
25
D

yakni +112
0
. Ketika b-
D-glukosa padat dilarutkan dalam air,
[ ]
25
D

yakni +19
0
.
Rotasi optik larutan a- dan b-D-glukosa padat yang baru dibuat
berubah seiring dengan waktu, peristiwa ini disebut mutarotasi.
Perubahan dalam rotasi optik berarti perubahan dalam struktur.
Ketika a-D-glukosa dilarutkan dalam air, anomer a-D merupakan
satu-satunya struktur yang ada pada saat pelarutan. Pembukaan cincin
merupakan reaksi yang lambat, tetapi karena reaksi tersebut reversibel,
maka anomer b-D akan muncul bersama dengan bentuk rantai
terbuka. Akhirnya, suatu kesetimbangan antara bentuk rantai terbuka
BIOKIMIA: Struktur dan Fungsi Biomolekul 18
dan kedua anomer dicapai pada
[ ]
25
D

+52
0
. Untuk alasan ini, struktur
di bawah digunakan untuk menggambarkan keadaan glukosa dalam
larutan, dan juga ketika konfigurasi karbon anomerik tidak diketahui.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 17
Penyebutan atau pada anomer tergantung pada konfigurasi karbon
anomerik relatif terhadap konfigurasi atom kiral yang menentukan apakah
monosakarida tersebut termasuk kelompok L atau D (dalam glukosa yakni C-5).
Jika dalam rumus proyeksi Fischer gugus hidroksil pada karbon ini berorientasi
cis, maka anomer tersebut disebut . Sedangkan jika gugus hidroksil tersebut
trans, maka anomer disebut . Perbandingan struktur dalam langkah (2) contoh
soal di atas dengan langkah (4) menunjukkan bahwa gugus hidroksil pada C-5
berada di bawah bidang datar cincin sebelum cincin tertutup. Karena itu,
anomer dengan hidroksil anomerik yang berada di bawah bidang datar cincin
disebut .
Meskipun bentuk rantai terbuka glukosa mempunyai empat pusat kiral,
namun pembentukan cincin menciptakan pusat kiral yang kelima. Hal ini
menyebabkan kedua anomer berbeda dalam rotasi optik. Ketika -D-glukosa
padat dilarutkan dalam air,
25
D
yakni +112
0
. Ketika -D-glukosa padat
dilarutkan dalam air,
25
D
yakni +19
0
.
Rotasi optik larutan - dan -D-glukosa padat yang baru dibuat berubah
seiring dengan waktu, peristiwa ini disebut mutarotasi. Perubahan dalam rotasi
optik berarti perubahan dalam struktur. Ketika -D-glukosa dilarutkan dalam air,
anomer -D merupakan satu-satunya struktur yang ada pada saat pelarutan.
Pembukaan cincin merupakan reaksi yang lambat, tetapi karena reaksi tersebut
reversibel, maka anomer -D akan muncul bersama dengan bentuk rantai
terbuka. Akhirnya, suatu kesetimbangan antara bentuk rantai terbuka dan
kedua anomer dicapai pada
25
D
+52
0
. Untuk alasan ini, struktur di bawah
digunakan untuk menggambarkan keadaan glukosa dalam larutan, dan juga
ketika konfigurasi karbon anomerik tidak diketahui.
O
CH
2
OH
OH
HO
OH
H, OH
Selain terbentuk struktur anomerik D-glukosa lingkar enam, bisa
juga terbentuk anomerik lingkar lima. Lingkar lima terjadi ketika
yang bereaksi adalah gugus hidroksil C-4 dengan gugus karbonil pada
aldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 18
Selain terbentuk struktur anomerik D-glukosa lingkar enam, bisa juga terbentuk
anomerik lingkar lima. Lingkar lima terjadi ketika yang bereaksi adalah gugus
hidroksil C-4 dengan gugus karbonil pada aldehid.
C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
1
C
2
C
3
C
4
C
5
C
6
CH
2
OH
OH H
H HO
OH H
OH H
HO H H
O C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
H OH
anomer anomer
OH OH
O O
Bentuk rantai terbuka glukosa diterjemahkan ke dalam rumus proyeksi Haworth
untuk cincin lingkar lima sebagai berikut, bersama dengan simbol dan yang
sesuai untuk rumus-rumus tersebut.
O
OH
OH
OH
CH
2
OH
HO H

O
OH
OH
OH
CH
2
OH
HO H

Cincin lingkar enam disebut piran, sedangkan cincin lingkar lima disebut furan.
O
O
Furan Piran
Bentuk rantai terbuka glukosa diterjemahkan ke dalam rumus proyeksi
Haworth untuk cincin lingkar lima sebagai berikut, bersama dengan
simbol a dan b yang sesuai untuk rumus-rumus tersebut.
Bab I Karbohidrat 19
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 18
Selain terbentuk struktur anomerik D-glukosa lingkar enam, bisa juga terbentuk
anomerik lingkar lima. Lingkar lima terjadi ketika yang bereaksi adalah gugus
hidroksil C-4 dengan gugus karbonil pada aldehid.
C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
1
C
2
C
3
C
4
C
5
C
6
CH
2
OH
OH H
H HO
OH H
OH H
HO H H
O C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
H OH
anomer anomer
OH OH
O O
Bentuk rantai terbuka glukosa diterjemahkan ke dalam rumus proyeksi Haworth
untuk cincin lingkar lima sebagai berikut, bersama dengan simbol dan yang
sesuai untuk rumus-rumus tersebut.
O
OH
OH
OH
CH
2
OH
HO H

O
OH
OH
OH
CH
2
OH
HO H

Cincin lingkar enam disebut piran, sedangkan cincin lingkar lima disebut furan.
O
O
Furan Piran
Cincin lingkar enam disebut piran, sedangkan cincin lingkar lima
disebut furan.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 18
Selain terbentuk struktur anomerik D-glukosa lingkar enam, bisa juga terbentuk
anomerik lingkar lima. Lingkar lima terjadi ketika yang bereaksi adalah gugus
hidroksil C-4 dengan gugus karbonil pada aldehid.
C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
1
C
2
C
3
C
4
C
5
C
6
CH
2
OH
OH H
H HO
OH H
OH H
HO H H
O C
C
C
C
C
CH
2
OH
OH H
H HO
H
H
H OH
anomer anomer
OH OH
O O
Bentuk rantai terbuka glukosa diterjemahkan ke dalam rumus proyeksi Haworth
untuk cincin lingkar lima sebagai berikut, bersama dengan simbol dan yang
sesuai untuk rumus-rumus tersebut.
O
OH
OH
OH
CH
2
OH
HO H

O
OH
OH
OH
CH
2
OH
HO H

Cincin lingkar enam disebut piran, sedangkan cincin lingkar lima disebut furan.
O
O
Furan
Piran
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 19
Karena itu, glukosa lingkar enam disebut glukopiranosa, dan glukosa
lingkar lima disebut glukofuranosa. Biasanya furanosa kurang stabil karena
besarnya halangan sterik antara gugus H, hidroksil, dan hidroksimetil pada
karbon-karbon yang berbeda. Dalam larutan glukosa, hanya sedikit sekali -
dan -glukofuranosa yang terdapat dalam kesetimbangan campuran tersebut.
6. KONFORMASI GLUKOSA
Struktur Haworth untuk anomer D-glukopiranosa dapat diubah sedikit
untuk menunjukkan bentuk asli molekul. Atom-atom karbon dalam molekul ini
membentuk sudut 109
0
di tiap atom. Tekukan ini membuat molekul lebih stabil.
Dengan sudut 109
0
, terdapat dua kemungkinan konformasi, yaitu kursi dan
perahu:
Kursi Perahu
Piran
Furan -D-Fruktofuranosa
-D-Glukopiranosa
-D-Glukopiranosa
-D-Fruktofuranosa
Karena itu, glukosa lingkar enam disebut glukopiranosa, dan
glukosa lingkar lima disebut glukofuranosa. Biasanya furanosa kurang
stabil karena besarnya halangan sterik antara gugus H, hidroksil,
dan hidroksimetil pada karbon-karbon yang berbeda. Dalam larutan
BIOKIMIA: Struktur dan Fungsi Biomolekul 20
glukosa, hanya sedikit sekali a- dan b-glukofuranosa yang terdapat
dalam kesetimbangan campuran tersebut.
6. KONFORMASI GLUKOSA
Struktur Haworth untuk anomer D-glukopiranosa dapat diubah
sedikit untuk menunjukkan bentuk asli molekul. Atom-atom karbon
dalam molekul ini membentuk sudut 109
0
di tiap atom. Tekukan
ini membuat molekul lebih stabil. Dengan sudut 109
0
, terdapat dua
kemungkinan konformasi, yaitu kursi dan perahu:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 19
Karena itu, glukosa lingkar enam disebut glukopiranosa, dan glukosa
lingkar lima disebut glukofuranosa. Biasanya furanosa kurang stabil karena
besarnya halangan sterik antara gugus H, hidroksil, dan hidroksimetil pada
karbon-karbon yang berbeda. Dalam larutan glukosa, hanya sedikit sekali -
dan -glukofuranosa yang terdapat dalam kesetimbangan campuran tersebut.
6. KONFORMASI GLUKOSA
Struktur Haworth untuk anomer D-glukopiranosa dapat diubah sedikit
untuk menunjukkan bentuk asli molekul. Atom-atom karbon dalam molekul ini
membentuk sudut 109
0
di tiap atom. Tekukan ini membuat molekul lebih stabil.
Dengan sudut 109
0
, terdapat dua kemungkinan konformasi, yaitu kursi dan
perahu:
Kursi
Perahu
Piran
Furan
-D-Fruktofuranosa
-D-Glukopiranosa
-D-Glukopiranosa
-D-Fruktofuranosa
Gugus-gugus yang terikat pada atom karbon bisa berada pada
posisi ekuatorial atau posisi aksial. Posisi ekuatorial yakni jika gugus
tersebut berada pada bidang datar, sedangkan aksial bila tegak lurus
terhadap bidang.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 20
Gugus-gugus yang terikat pada atom karbon bisa berada pada posisi ekuatorial
atau posisi aksial. Posisi ekuatorial yakni jika gugus tersebut berada pada
bidang datar, sedangkan aksial bila tegak lurus terhadap bidang.
a
e
a
e
a
a
e
e
a
e
a
e
a
e
a
e
a
a
e
a
e
a
e
e
Konformer yang paling stabil adalah konformer kursi. Pada sikloheksana,
perbedaan energi antara konformer perahu dengan konformer kursi adalah
sekitar 25 kJmol
-1
yang berarti hanya terdapat 1 konformasi perahu dari 1000
molekul pada 25
0
C.
Monosakarida memiliki gugus hidroksil dan hidroksimetil pada atom-
atom karbon cincin. Hal ini menyebabkan gugus-gugus ini cenderung berada
pada posisi ekuatorial. Pada posisi aksial gugus-gugus ini akan mengganggu
kestabilan cincin karena besarnya halangan sterik.
O
O
HO
HO
CH
2
OH
OH
OH
CH
2
OH
OH
OH
OH
OH
lebih stabil
Dua kemungkinan bentuk kursi
Konformasi -D-glukopiranosa
Konformer yang paling stabil adalah konformer kursi. Pada
sikloheksana, perbedaan energi antara konformer perahu dengan
Bab I Karbohidrat 21
konformer kursi adalah sekitar 25 kJmol
-1
yang berarti hanya terdapat
1 konformasi perahu dari 1000 molekul pada 25
0
C.
Monosakarida memiliki gugus hidroksil dan hidroksimetil pada
atom-atom karbon cincin. Hal ini menyebabkan gugus-gugus ini
cenderung berada pada posisi ekuatorial. Pada posisi aksial gugus-gugus
ini akan mengganggu kestabilan cincin karena besarnya halangan sterik.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 20
Gugus-gugus yang terikat pada atom karbon bisa berada pada posisi ekuatorial
atau posisi aksial. Posisi ekuatorial yakni jika gugus tersebut berada pada
bidang datar, sedangkan aksial bila tegak lurus terhadap bidang.
a
e
a
e
a
a
e
e
a
e
a
e
a
e
a
e
a
a
e
a
e
a
e
e
Konformer yang paling stabil adalah konformer kursi. Pada sikloheksana,
perbedaan energi antara konformer perahu dengan konformer kursi adalah
sekitar 25 kJmol
-1
yang berarti hanya terdapat 1 konformasi perahu dari 1000
molekul pada 25
0
C.
Monosakarida memiliki gugus hidroksil dan hidroksimetil pada atom-
atom karbon cincin. Hal ini menyebabkan gugus-gugus ini cenderung berada
pada posisi ekuatorial. Pada posisi aksial gugus-gugus ini akan mengganggu
kestabilan cincin karena besarnya halangan sterik.
O
O
HO
HO
CH
2
OH
OH
OH
CH
2
OH
OH
OH
OH
OH
lebih stabil
Dua kemungkinan bentuk kursi
Konformasi -D-glukopiranosa
7. MONOSAKARIDA SELAIN GLUKOSA
Terdapat dua aldoheksosa yang merupakan isomer dari glukosa, yakni
manosa dan galaktosa:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 21
7. MONOSAKARIDA SELAIN GLUKOSA
Terdapat dua aldoheksosa yang merupakan isomer dari glukosa, yakni
manosa dan galaktosa:
CHO
CH
2
OH
H HO
H HO
OH H
OH H
CHO
CH
2
OH
OH H
H HO
H HO
OH H
D-Manosa D-Galaktosa
Berikut digambarkan struktur rantai tertutup Glukosa dan galaktosa
yang dibedakan hanya berdasarkan orientasi satu gugus hidroksil (-OH), pada
C4.
D-Manosa dan D-galaktosa mudah diterjemahkan ke dalam struktur
Haworth. Berikut ini diperlihatkan anomer dari kedua gula tersebut.
O
CH
2
OH
OH
HO
OH
OH
O
CH
2
OH
OH
HO
OH
OH
-D-Manopiranosa -D-Galaktopiranosa
-D-Glukosa
-D-Galaktosa
Berikut digambarkan struktur rantai tertutup Glukosa dan
galaktosa yang dibedakan hanya berdasarkan orientasi satu gugus
hidroksil (-OH), pada C4.
BIOKIMIA: Struktur dan Fungsi Biomolekul 22
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 21
7. MONOSAKARIDA SELAIN GLUKOSA
Terdapat dua aldoheksosa yang merupakan isomer dari glukosa, yakni
manosa dan galaktosa:
CHO
CH
2
OH
H HO
H HO
OH H
OH H
CHO
CH
2
OH
OH H
H HO
H HO
OH H
D-Manosa D-Galaktosa
Berikut digambarkan struktur rantai tertutup Glukosa dan galaktosa
yang dibedakan hanya berdasarkan orientasi satu gugus hidroksil (-OH), pada
C4.
D-Manosa dan D-galaktosa mudah diterjemahkan ke dalam struktur
Haworth. Berikut ini diperlihatkan anomer dari kedua gula tersebut.
O
CH
2
OH
OH
HO
OH
OH
O
CH
2
OH
OH
HO
OH
OH
-D-Manopiranosa -D-Galaktopiranosa
-D-Glukosa
-D-Galaktosa
D-Manosa dan D-galaktosa mudah diterjemahkan ke dalam
struktur Haworth. Berikut ini diperlihatkan anomer a dari kedua gula
tersebut.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 21
7. MONOSAKARIDA SELAIN GLUKOSA
Terdapat dua aldoheksosa yang merupakan isomer dari glukosa, yakni
manosa dan galaktosa:
CHO
CH
2
OH
H HO
H HO
OH H
OH H
CHO
CH
2
OH
OH H
H HO
H HO
OH H
D-Manosa D-Galaktosa
Berikut digambarkan struktur rantai tertutup Glukosa dan galaktosa
yang dibedakan hanya berdasarkan orientasi satu gugus hidroksil (-OH), pada
C4.
D-Manosa dan D-galaktosa mudah diterjemahkan ke dalam struktur
Haworth. Berikut ini diperlihatkan anomer dari kedua gula tersebut.
O
CH
2
OH
OH
HO
OH
OH
O
CH
2
OH
OH
HO
OH
OH
-D-Manopiranosa -D-Galaktopiranosa
-D-Glukosa
-D-Galaktosa
Keduanya merupakan epimer dari glukosa, yakni dengan meng-
abaikan karbon anomerik, keduanya berbeda dari glukosa dalam
konfigurasi hanya satu atom karbon, manosa pada C-2, galaktosa pada
C-4.
Fruktosa merupakan suatu ketoheksosa, dengan struktur rantai bentuk
terbuka dan bentuk silklik sebagai berikut,
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 22
Keduanya merupakan epimer dari glukosa, yakni dengan mengabaikan
karbon anomerik, keduanya berbeda dari glukosa dalam konfigurasi hanya satu
atom karbon, manosa pada C-2, galaktosa pada C-4.
Fruktosa merupakan suatu ketoheksosa, dengan struktur rantai bentuk
terbuka dan bentuk silklik sebagai berikut,
Aldopentosa yang paling umum dikenal adalah D-ribosa, yakni gula yang
ada dalam RNA:
CHO
OH H
OH H
OH H
CH
2
OH
D-Ribosa
Struktur Haworth cincin lima dan cincin enam untuk D-ribosa yakni (hanya
anomer yang diperlihatkan):
O
OH
HO
OH
OH
-D-Ribopiranosa
OH
HOH
2
C
OH
OH
O
-D-Ribofuranosa
D-Fruktosa
-D-fruktosa
-D-fruktosa
Bab I Karbohidrat 23
Aldopentosa yang paling umum dikenal adalah D-ribosa, yakni
gula yang ada dalam RNA:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 22
Keduanya merupakan epimer dari glukosa, yakni dengan mengabaikan
karbon anomerik, keduanya berbeda dari glukosa dalam konfigurasi hanya satu
atom karbon, manosa pada C-2, galaktosa pada C-4.
Fruktosa merupakan suatu ketoheksosa, dengan struktur rantai bentuk
terbuka dan bentuk silklik sebagai berikut,
Aldopentosa yang paling umum dikenal adalah D-ribosa, yakni gula yang
ada dalam RNA:
CHO
OH H
OH H
OH H
CH
2
OH
D-Ribosa
Struktur Haworth cincin lima dan cincin enam untuk D-ribosa yakni (hanya
anomer yang diperlihatkan):
O
OH
HO
OH
OH
-D-Ribopiranosa
OH
HOH
2
C
OH
OH
O
-D-Ribofuranosa
D-Fruktosa
-D-fruktosa
-D-fruktosa
Struktur Haworth cincin lima dan cincin enam untuk D-ribosa
yakni (hanya anomer b yang diperlihatkan):
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 22
Keduanya merupakan epimer dari glukosa, yakni dengan mengabaikan
karbon anomerik, keduanya berbeda dari glukosa dalam konfigurasi hanya satu
atom karbon, manosa pada C-2, galaktosa pada C-4.
Fruktosa merupakan suatu ketoheksosa, dengan struktur rantai bentuk
terbuka dan bentuk silklik sebagai berikut,
Aldopentosa yang paling umum dikenal adalah D-ribosa, yakni gula yang
ada dalam RNA:
CHO
OH H
OH H
OH H
CH
2
OH
D-Ribosa
Struktur Haworth cincin lima dan cincin enam untuk D-ribosa yakni (hanya
anomer yang diperlihatkan):
O
OH
HO
OH
OH
-D-Ribopiranosa
OH
HOH
2
C
OH
OH
O
-D-Ribofuranosa
D-Fruktosa
-D-fruktosa
-D-fruktosa
Dalam bentuk kristal hanya terdapat b-D-piranosa, tetapi dalam
larutan akan terbentuk juga anomer a dan b dari D-ribosa, baik
piranosa maupun furanosa.
Sudut pentagon umum yakni 108
0
, sangat mendekati sudut
tetrahedral, menunjukkan bahwa bentuk cincin furanosa mendekati
planar. Beberapa gula yang memiliki cincin furanosa tidak bisa memiliki
struktur planar karena halangan sterik antara substituen pada cincin.
Dalam b-D-ribofuranosa, perhatikan bahwa gugus hidroksil
dan atom H yang terikat pada atom karbon pada ikatan C-2C-
3 adalah eclipsed. Tolakan antara gugus-gugus eclipsed dihindari
dengan memilin cincin keluar bidang datar, yakni dengan menaikkan
C-3 ke atas bidang datar dan menurunkan C-2 ke bawah bidang
datar. Konformer ini dikenal sebagai T
2
3
(T untuk twist, dengan C-3
dinaikkan dan C-2 diturunkan). Alternatif lain untuk menghindari
BIOKIMIA: Struktur dan Fungsi Biomolekul 24
halangan sterik yakni dengan menaikkan atau menurunkan C-3 keluar
bidang datar dan membentuk konformer E (untuk envelope).
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 23
Dalam bentuk kristal hanya terdapat -D-piranosa, tetapi dalam larutan akan
terbentuk juga anomer dan dari D-ribosa, baik piranosa maupun furanosa.
Sudut pentagon umum yakni 108
0
, sangat mendekati sudut tetrahedral,
menunjukkan bahwa bentuk cincin furanosa mendekati planar. Beberapa gula
yang memiliki cincin furanosa tidak bisa memiliki struktur planar karena
halangan sterik antara substituen pada cincin.
Dalam -D-ribofuranosa, perhatikan bahwa gugus hidroksil dan atom H
yang terikat pada atom karbon pada ikatan C-2C-3 adalah eclipsed. Tolakan
antara gugus-gugus eclipsed dihindari dengan memilin cincin keluar bidang
datar, yakni dengan menaikkan C-3 ke atas bidang datar dan menurunkan C-2
ke bawah bidang datar. Konformer ini dikenal sebagai
3
2
T (T untuk twist,
dengan C-3 dinaikkan dan C-2 diturunkan). Alternatif lain untuk menghindari
halangan sterik yakni dengan menaikkan atau menurunkan C-3 keluar bidang
datar dan membentuk konformer E (untuk envelope).
O
OH
CH
2
OH
OH
OH
O
HOH
2
C
HO
HO
HO

3
2
T E
3
Gula yang tereduksi akan membentuk gula deoksi, dengan satu gugus hidroksil
tergantikan oleh atom hidrogen. Gula deoksi yang paling banyak adalah 2-
deoksi-D-ribosa yang ada dalam DNA:
CHO
H H
OH H
OH H
CH
2
OH
2-Deoksi-D-Ribosa
Gula yang tereduksi akan membentuk gula deoksi, dengan satu
gugus hidroksil tergantikan oleh atom hidrogen. Gula deoksi yang
paling banyak adalah 2-deoksi-D-ribosa yang ada dalam DNA:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 23
Dalam bentuk kristal hanya terdapat -D-piranosa, tetapi dalam larutan akan
terbentuk juga anomer dan dari D-ribosa, baik piranosa maupun furanosa.
Sudut pentagon umum yakni 108
0
, sangat mendekati sudut tetrahedral,
menunjukkan bahwa bentuk cincin furanosa mendekati planar. Beberapa gula
yang memiliki cincin furanosa tidak bisa memiliki struktur planar karena
halangan sterik antara substituen pada cincin.
Dalam -D-ribofuranosa, perhatikan bahwa gugus hidroksil dan atom H
yang terikat pada atom karbon pada ikatan C-2C-3 adalah eclipsed. Tolakan
antara gugus-gugus eclipsed dihindari dengan memilin cincin keluar bidang
datar, yakni dengan menaikkan C-3 ke atas bidang datar dan menurunkan C-2
ke bawah bidang datar. Konformer ini dikenal sebagai
3
2
T (T untuk twist,
dengan C-3 dinaikkan dan C-2 diturunkan). Alternatif lain untuk menghindari
halangan sterik yakni dengan menaikkan atau menurunkan C-3 keluar bidang
datar dan membentuk konformer E (untuk envelope).
O
OH
CH
2
OH
OH
OH
O
HOH
2
C
HO
HO
HO

3
2
T E
3
Gula yang tereduksi akan membentuk gula deoksi, dengan satu gugus hidroksil
tergantikan oleh atom hidrogen. Gula deoksi yang paling banyak adalah 2-
deoksi-D-ribosa yang ada dalam DNA:
CHO
H H
OH H
OH H
CH
2
OH
2-Deoksi-D-Ribosa
Gula deoksi lainnya yang juga banyak ditemukan adalah L-fukosa
dalam binatang, dan L-ramnosa dalam tumbuhan dan bakteri.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 24
Gula deoksi lainnya yang juga banyak ditemukan adalah L-fukosa dalam
binatang, dan L-ramnosa dalam tumbuhan dan bakteri.
CHO
CH
3
H HO
OH H
OH H
H HO
CHO
CH
3
OH H
OH H
H HO
H HO
L-Fukosa L-Ramnosa
Jenis gula tereduksi lainnya adalah alditol, di mana gugus aldehid pada
suatu aldosa telah tereduksi. Misalnya, alditol yang dihasilkan dari D-glukosa
diberi nama D-glusitol (sorbitol).
CH
2
OH
CH
2
OH
OH H
H HO
OH H
OH H
D-Glusitol
Bila gugus hidroksimetil pada aldosa dioksidasi menjadi asam karboksilat, maka
molekul yang dihasilkan disebut asam uronat. Pada pH fisiologis, molekul ini
terdapat dalam bentuk garam yang dinamakan uronat.
O
COO
-
HO
OH
OH
OH
-D-Glukuronat
Bab I Karbohidrat 25
Jenis gula tereduksi lainnya adalah alditol, di mana gugus aldehid
pada suatu aldosa telah tereduksi. Misalnya, alditol yang dihasilkan
dari D-glukosa diberi nama D-glusitol (sorbitol).
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 24
Gula deoksi lainnya yang juga banyak ditemukan adalah L-fukosa dalam
binatang, dan L-ramnosa dalam tumbuhan dan bakteri.
CHO
CH
3
H HO
OH H
OH H
H HO
CHO
CH
3
OH H
OH H
H HO
H HO
L-Fukosa L-Ramnosa
Jenis gula tereduksi lainnya adalah alditol, di mana gugus aldehid pada
suatu aldosa telah tereduksi. Misalnya, alditol yang dihasilkan dari D-glukosa
diberi nama D-glusitol (sorbitol).
CH
2
OH
CH
2
OH
OH H
H HO
OH H
OH H
D-Glusitol
Bila gugus hidroksimetil pada aldosa dioksidasi menjadi asam karboksilat, maka
molekul yang dihasilkan disebut asam uronat. Pada pH fisiologis, molekul ini
terdapat dalam bentuk garam yang dinamakan uronat.
O
COO
-
HO
OH
OH
OH
-D-Glukuronat
Bila gugus hidroksimetil pada aldosa dioksidasi menjadi asam
karboksilat, maka molekul yang dihasilkan disebut asam uronat.
Pada pH fisiologis, molekul ini terdapat dalam bentuk garam yang
dinamakan uronat.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 24
Gula deoksi lainnya yang juga banyak ditemukan adalah L-fukosa dalam
binatang, dan L-ramnosa dalam tumbuhan dan bakteri.
CHO
CH
3
H HO
OH H
OH H
H HO
CHO
CH
3
OH H
OH H
H HO
H HO
L-Fukosa L-Ramnosa
Jenis gula tereduksi lainnya adalah alditol, di mana gugus aldehid pada
suatu aldosa telah tereduksi. Misalnya, alditol yang dihasilkan dari D-glukosa
diberi nama D-glusitol (sorbitol).
CH
2
OH
CH
2
OH
OH H
H HO
OH H
OH H
D-Glusitol
Bila gugus hidroksimetil pada aldosa dioksidasi menjadi asam karboksilat, maka
molekul yang dihasilkan disebut asam uronat. Pada pH fisiologis, molekul ini
terdapat dalam bentuk garam yang dinamakan uronat.
O
COO
-
HO
OH
OH
OH
-D-Glukuronat
Asam aldonat diturunkan dengan mengoksidasi gugus aldehid pada
aldosa menjadi gugus asam karboksilat. Pada pH fisiologis, molekul
ini terdapat dalam bentuk garam aldonat. Jika asam aldonat memiliki
lima atau lebih atom karbon, maka secara spontan terbentuk d-lakton
sebagai hasil reaksi gugus hidroksil pada C-5. Misalnya, glukosa dapat
teroksidasi menjadi asam glukonat, yang berada dalam kesetimbangan
dengan asam rantai terbuka dan glukonolakton.
BIOKIMIA: Struktur dan Fungsi Biomolekul 26
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 25
Asam aldonat diturunkan dengan mengoksidasi gugus aldehid pada
aldosa menjadi gugus asam karboksilat. Pada pH fisiologis, molekul ini terdapat
dalam bentuk garam aldonat. Jika asam aldonat memiliki lima atau lebih atom
karbon, maka secara spontan terbentuk -lakton sebagai hasil reaksi gugus
hidroksil pada C-5. Misalnya, glukosa dapat teroksidasi menjadi asam glukonat,
yang berada dalam kesetimbangan dengan asam rantai terbuka dan
glukonolakton.
COH
CH
2
OH
OH H
H HO
OH H
OH H
COOH
OH
CH
2
OH
HO
OH
OH
H
H
H
H
O
CH
2
OH
HO
OH
OH
OH
O
CH
2
OH
HO
OH
OH
O
Kimia
(+O)
Enzimatik
(-2H)
+H
2
O -H
2
O
Asam D-glukonat
(C
6
H
12
O
7
)
D-Glukonolakton
(C
6
H
10
O
6
)
Gula amino merupakan molekul yang terbentuk ketika gugus hidroksil pada gula
diganti dengan gugus amino. Gula amino ini tersebar luas secara alami, yang
paling banyak adalah D-glukosamin, D-galaktosamin, dan asam neuraminat.
Gugus amino dalam senyawa-senyawa tersebut biasanya terasetilasi:
Gula amino merupakan molekul yang terbentuk ketika gugus
hidroksil pada gula diganti dengan gugus amino. Gula amino ini
tersebar luas secara alami, yang paling banyak adalah D-glukosamin,
D-galaktosamin, dan asam neuraminat. Gugus amino dalam senyawa-
senyawa tersebut biasanya terasetilasi:
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 26
O
CH
2
OH
HO
OH
NHCOCH
3
H,OH
O
CH
2
OH
OH
NHCOCH
3
H,OH
HO
N-Asetil-D-glukosamin N-Asetil-D-galaktosamin
COOH
CO
H H
OH H
H H
3
COCHN
CH
2
OH
H HO
OH H
OH H
Asam N-Asetilneuraminat
(asam sialat)
Di alam, banyak monosakarida maupun turunannya yang berada dalam bentuk
ester, yakni satu atau lebih gugus hidroksilnya telah tersubstitusi oleh gugus
fosfat atau sulfat. Ester fosfat biasa ditemukan sebagai komponen metabolisme
di dalam sel, sedangkan ester sulfat ditemukan pada oligosakarida dan
polisakarida di luar sel.
8. IKATAN GLIKOSIDA
Monosakarida dalam bentuk lingkar memiliki karbon pereduksi yang
disebut karbon anomerik. Gugus hidroksil pada karbon anomerik jauh lebih
reaktif daripada alkohol primer atau sekunder biasa. Reaktivitas ini dipengaruhi
tarikan elektron oleh atom oksigen pada cincin.
C
O H
OH
Gugus hidroksil anomerik sangat mudah bereaksi dengan alkohol (OH) atau
amina (NH
2
). Proses ini dikenal sebagai glikosilasi, dan produknya disebut O-
glikosida (reaksi dengan alkohol) dan N-glikosida (reaksi dengan amina).
Bab I Karbohidrat 27
Di alam, banyak monosakarida maupun turunannya yang berada
dalam bentuk ester, yakni satu atau lebih gugus hidroksilnya telah
tersubstitusi oleh gugus fosfat atau sulfat. Ester fosfat biasa ditemukan
sebagai komponen metabolisme di dalam sel, sedangkan ester sulfat
ditemukan pada oligosakarida dan polisakarida di luar sel.
8. IKATAN GLIKOSIDA
Monosakarida dalam bentuk lingkar memiliki karbon pereduksi yang
disebut karbon anomerik. Gugus hidroksil pada karbon anomerik jauh
lebih reaktif daripada alkohol primer atau sekunder biasa. Reaktivitas
ini dipengaruhi tarikan elektron oleh atom oksigen pada cincin.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 26
O
CH
2
OH
HO
OH
NHCOCH
3
H,OH
O
CH
2
OH
OH
NHCOCH
3
H,OH
HO
N-Asetil-D-glukosamin
N-Asetil-D-galaktosamin
COOH
CO
H H
OH H
H H
3
COCHN
CH
2
OH
H HO
OH H
OH H
Asam N-Asetilneuraminat
(asam sialat)
Di alam, banyak monosakarida maupun turunannya yang berada dalam bentuk
ester, yakni satu atau lebih gugus hidroksilnya telah tersubstitusi oleh gugus
fosfat atau sulfat. Ester fosfat biasa ditemukan sebagai komponen metabolisme
di dalam sel, sedangkan ester sulfat ditemukan pada oligosakarida dan
polisakarida di luar sel.
8. IKATAN GLIKOSIDA
Monosakarida dalam bentuk lingkar memiliki karbon pereduksi yang
disebut karbon anomerik. Gugus hidroksil pada karbon anomerik jauh lebih
reaktif daripada alkohol primer atau sekunder biasa. Reaktivitas ini dipengaruhi
tarikan elektron oleh atom oksigen pada cincin.
C
O H
OH
Gugus hidroksil anomerik sangat mudah bereaksi dengan alkohol (OH) atau
amina (NH
2
). Proses ini dikenal sebagai glikosilasi, dan produknya disebut O-
glikosida (reaksi dengan alkohol) dan N-glikosida (reaksi dengan amina).
Gugus hidroksil anomerik sangat mudah bereaksi dengan alkohol
(OH) atau amina (NH
2
). Proses ini dikenal sebagai glikosilasi, dan
produknya disebut O-glikosida (reaksi dengan alkohol) dan N-glikosida
(reaksi dengan amina).
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 27
O
OH
ROH
RNH
2
H
2
O
H
2
O
O
OR
O
NHR
O-Glikosida
N-Glikosida
Suatu
monosakarida
Gugus R dalam kedua glikosida di atas dinamakan aglikon.
Cincin molekul glikosida tak dapat membuka untuk membentuk struktur
rantai lurus. Karena itu, glikosida tidak memiliki sifat pereduksi. Nama lain dari
glikosida adalah asetal.
O
C
H
R
OH
C
H
R
OR'
OR''
C
H
R
OR'
+ R'OH + R''OH
Aldehid
(monosakarida
rantai terbuka)
Hemiasetal
(bentuk cincin)
Asetal
(glikosida)
Istilah glikosida adalah nama generik, glikosida yang berasal dari glukosa,
fruktosa, dan ribosa dikenal sebagai glukosida, fruktosida, ribosida, dan
sebagainya. Akhiran osida diberikan pada glikosida. Glikosida juga bisa
memiliki cincin lingkar lima atau lingkar enam yang dikenal sebagai furanosida
atau piranosida.
BIOKIMIA: Struktur dan Fungsi Biomolekul 28
Gugus R dalam kedua glikosida di atas dinamakan aglikon.
Cincin molekul glikosida tak dapat membuka untuk membentuk
struktur rantai lurus. Karena itu, glikosida tidak memiliki sifat
pereduksi. Nama lain dari glikosida adalah asetal.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 27
O
OH
ROH
RNH
2
H
2
O
H
2
O
O
OR
O
NHR
O-Glikosida
N-Glikosida
Suatu
monosakarida
Gugus R dalam kedua glikosida di atas dinamakan aglikon.
Cincin molekul glikosida tak dapat membuka untuk membentuk struktur
rantai lurus. Karena itu, glikosida tidak memiliki sifat pereduksi. Nama lain dari
glikosida adalah asetal.
O
C
H
R
OH
C
H
R
OR'
OR''
C
H
R
OR'
+ R'OH + R''OH
Aldehid
(monosakarida
rantai terbuka)
Hemiasetal
(bentuk cincin)
Asetal
(glikosida)
Istilah glikosida adalah nama generik, glikosida yang berasal dari glukosa,
fruktosa, dan ribosa dikenal sebagai glukosida, fruktosida, ribosida, dan
sebagainya. Akhiran osida diberikan pada glikosida. Glikosida juga bisa
memiliki cincin lingkar lima atau lingkar enam yang dikenal sebagai furanosida
atau piranosida.
Istilah glikosida adalah nama generik, glikosida yang berasal dari
glukosa, fruktosa, dan ribosa dikenal sebagai glukosida, fruktosida,
ribosida, dan sebagainya. Akhiran osida diberikan pada glikosida.
Glikosida juga bisa memiliki cincin lingkar lima atau lingkar enam
yang dikenal sebagai furanosida atau piranosida.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 28
O
CH
2
OH
OH
HO
OH
OCH
3
O
OH
OH
OCH
3
CH
2
OH
HO H
-D-Metilglukopiranosida -D-Metilglukofuranosida
Karena cincin glikosida tidak dapat membuka, struktur tersebut tidak
menunjukkan mutarotasi pada putaran optik.
Jika kita mengambarkan struktur -D-metilfruktofuranosida, maka
langkah-langkah yang harus dilakukan adalah:
1. Tulislah struktur untuk D-fruktosa.
2. Ubah menjadi bentuk cincin Haworth lingkar lima.
3. Ambil anomer dan substitusi hidroksil anomerik dengan gugus metil.
CH
2
OH
CO
H HO
OH H
CH
2
OH
OH H
(1)
O
OH
HO
CH
2
OH
OH, CH
2
OH
O
OH
HO
OCH
3
CH
2
OH
CH
2
OH
(2) (3)
-D-Metilfruktofuranosida
Ikatan glikosida banyak ditemukan dalam senyawa-senyawa biologis.
Bila aglikon juga merupakan suatu monosakarida, maka ikatan glikosida yang
terjadi akan membentuk senyawa yang dinamakan disakarida. Ikatan glikosida
yang terbentuk dengan monosakarida berikutnya akan menghasilkan
trisakarida; demikian seterusnya. Sejumlah besar monosakarida yang
terhubung oleh ikatan glikosida dinamakan polisakarida.
Karena cincin glikosida tidak dapat membuka, struktur tersebut
tidak menunjukkan mutarotasi pada putaran optik.
Jika kita mengambarkan struktur b-D-metilfruktofuranosida,
maka langkah-langkah yang harus dilakukan adalah:
1. Tulislah struktur untuk D-fruktosa.
2. Ubah menjadi bentuk cincin Haworth lingkar lima.
3. Ambil anomer b dan substitusi hidroksil anomerik dengan gugus
metil.
Bab I Karbohidrat 29
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 28
O
CH
2
OH
OH
HO
OH
OCH
3
O
OH
OH
OCH
3
CH
2
OH
HO H
-D-Metilglukopiranosida -D-Metilglukofuranosida
Karena cincin glikosida tidak dapat membuka, struktur tersebut tidak
menunjukkan mutarotasi pada putaran optik.
Jika kita mengambarkan struktur -D-metilfruktofuranosida, maka
langkah-langkah yang harus dilakukan adalah:
1. Tulislah struktur untuk D-fruktosa.
2. Ubah menjadi bentuk cincin Haworth lingkar lima.
3. Ambil anomer dan substitusi hidroksil anomerik dengan gugus metil.
CH
2
OH
CO
H HO
OH H
CH
2
OH
OH H
(1)
O
OH
HO
CH
2
OH
OH, CH
2
OH
O
OH
HO
OCH
3
CH
2
OH
CH
2
OH
(2) (3)
-D-Metilfruktofuranosida
Ikatan glikosida banyak ditemukan dalam senyawa-senyawa biologis.
Bila aglikon juga merupakan suatu monosakarida, maka ikatan glikosida yang
terjadi akan membentuk senyawa yang dinamakan disakarida. Ikatan glikosida
yang terbentuk dengan monosakarida berikutnya akan menghasilkan
trisakarida; demikian seterusnya. Sejumlah besar monosakarida yang
terhubung oleh ikatan glikosida dinamakan polisakarida.
Ikatan glikosida banyak ditemukan dalam senyawa-senyawa
biologis. Bila aglikon juga merupakan suatu monosakarida, maka ikatan
glikosida yang terjadi akan membentuk senyawa yang dinamakan
disakarida. Ikatan glikosida yang terbentuk dengan monosakarida
berikutnya akan menghasilkan trisakarida; demikian seterusnya.
Sejumlah besar monosakarida yang terhubung oleh ikatan glikosida
dinamakan polisakarida.
Unit-unit monosakarida dalam oligosakarida atau polisakarida
diberi nama dengan menambahkan akhiran osil. Misalnya,
trisakarida yang dibentuk dari tiga molekul glukosa dinamakan
glukosilglukosilglukosa. Agar tidak terlalu panjang, nama tiap unit
monosakarida dapat disingkat, misalnya: Glc (glukosil), Gal (galaktosil),
Fru (fruktosil), GlcN (glukosaminil), GlcNAc (N-asetilglukosaminil),
GlcA (glukuronil), NeuNAc (N-asetilneuraminil).
Istilah glikan adalah nama alternatif untuk polisakarida. Misalnya,
glukan merupakan poliner dari glukosa; xilan merupakan polimer dari
xilosa; dan glukomanan adalah polimer dari glukosa dan manosa.
Di bawah ini adalah contoh struktur dua molekul disakarida, yang
masing-masing dibentuk dari dua monomer glukosa.
BIOKIMIA: Struktur dan Fungsi Biomolekul 30
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 29
Unit-unit monosakarida dalam oligosakarida atau polisakarida diberi
nama dengan menambahkan akhiran osil. Misalnya, trisakarida yang dibentuk
dari tiga molekul glukosa dinamakan glukosilglukosilglukosa. Agar tidak terlalu
panjang, nama tiap unit monosakarida dapat disingkat, misalnya: Glc (glukosil),
Gal (galaktosil), Fru (fruktosil), GlcN (glukosaminil), GlcNAc (N-
asetilglukosaminil), GlcA (glukuronil), NeuNAc (N-asetilneuraminil).
Istilah glikan adalah nama alternatif untuk polisakarida. Misalnya,
glukan merupakan poliner dari glukosa; xilan merupakan polimer dari xilosa; dan
glukomanan adalah polimer dari glukosa dan manosa.
Di bawah ini adalah contoh struktur dua molekul disakarida, yang masing-
masing dibentuk dari dua monomer glukosa.
O
CH
2
OH
HO
OH
OH
O
O
CH
2
OH
OH
OH
H,OH
O
CH
2
OH
HO
OH
OH
O
O
CH
2
OH
OH
OH
H,OH
Maltosa
-Glc-(1 4)-Glc
Selobiosa
-Glc-(1 4)-Glc
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 30
Maltosa adalah gula pereduksi. Meskipun merupakan glikosida, unit
glukosa kedua memiliki atom karbon anomerik dan cincinnya bisa membuka
untuk membentuk aldehid. Untuk alasan yang sama, larutan maltosa
menunjukkan mutarotasi.
Maltosa
(terhubung melalui ikatan
glikosidik 1 4)
Selobiosa
(terhubung melalui ikatan
glikosidik 1 4)
-D-glukosa
-D-glukosa
Ikatan glikosidik -1,4
Maltosa [-D-glukopiranosil)-(14)-D-glukopiranosa]
Maltosa adalah gula pereduksi. Meskipun merupakan glikosida,
unit glukosa kedua memiliki atom karbon anomerik dan cincinnya
bisa membuka untuk membentuk aldehid. Untuk alasan yang sama,
larutan maltosa menunjukkan mutarotasi.
Bab I Karbohidrat 31
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 30
Maltosa adalah gula pereduksi. Meskipun merupakan glikosida, unit
glukosa kedua memiliki atom karbon anomerik dan cincinnya bisa membuka
untuk membentuk aldehid. Untuk alasan yang sama, larutan maltosa
menunjukkan mutarotasi.
Maltosa
(terhubung melalui ikatan
glikosidik 1 4)
Selobiosa
(terhubung melalui ikatan
glikosidik 1 4)
-D-glukosa
-D-glukosa
Ikatan glikosidik -1,4
Maltosa [-D-glukopiranosil)-(14)-D-glukopiranosa]
Sukrosa tidak memiliki sifat pereduksi. Sukrosa atau gula tebu
adalah disakarida dengan hidroksil anomerik dari a-D-glukosa
dikondensasikan dengan hidroksil anomerik dari b-D-fruktosa. Karena
itu keduanya adalah a-glukosida dan b-fruktosida. Tidak ada unit yang
memiliki hidroksil anomerik dan tidak ada cincin yang dapat terbuka
untuk membentuk aldehid.
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 31
Sukrosa tidak memiliki sifat pereduksi. Sukrosa atau gula tebu adalah
disakarida dengan hidroksil anomerik dari -D-glukosa dikondensasikan dengan
hidroksil anomerik dari -D-fruktosa. Karena itu keduanya adalah -glukosida
dan -fruktosida. Tidak ada unit yang memiliki hidroksil anomerik dan tidak ada
cincin yang dapat terbuka untuk membentuk aldehid.
O
CH
2
OH
OH
HO
HO
O
OH
HO
O
CH
2
OH
CH
2
OH
Ikatan (1 2)
-glukosa
-fruktosa
Sukrosa [-D-fruktofuranosil -D-glukopiranosa
BIOKIMIA: Struktur dan Fungsi Biomolekul 32
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 32
Nama sistematik untuk sukrosa yakni -D-glukosil-(1 2)--D-fruktosida (-D-
glukopiranosil-(1 2)--D-fruktofuranosida) atau -D-fruktosil-(2 1)--D-
glukosida (-D-fruktofuranosil-(2 1)--D-glukopiranosida). Dalam bentuk
singkatan, namanya yakni -Glc-(1 2)--Fru dan -Fru-(2 1)--Glc.
9. POLISAKARIDA
Polisakarida memiliki fungsi utama sebagai pembentuk struktur atau
untuk penyimpanan energi. Tepung dan glikogen merupakan polimer glukosa
yang berfungsi sebagai penyimpan gula di dalam tumbuhan dan hewan.
Tepung terdapat sebagai amilosa dan amilopektin. Amilosa adalah suatu
polimer linear dari -D-glukosa yang terhubung oleh ikatan (14). Sedangkan
amilopektin memiliki cabang yang terbentuk oleh ikatan (16), selain rantai
linear yang terbentuk oleh ikatan (14).
-D-Galaktosa
-D-Galaktosa
dari
Ikatan glikosidik -1-4
Laktosa [-D-galaktopiranosil-(1 4)- -D-Glukopiranosa]
Nama sistematik untuk sukrosa yakni a-D-glukosil-(1 2)-b-D-
fruktosida (a-D-glukopiranosil-(1 2)-b-D-fruktofuranosida) atau
b-D-fruktosil-(2 1)-a-D-glukosida (b-D-fruktofuranosil-(2 1)-
a-D-glukopiranosida). Dalam bentuk singkatan, namanya yakni a-
Glc-(1 2)-b-Fru dan b-Fru-(2 1)-a-Glc.
9. POLISAKARIDA
Polisakarida memiliki fungsi utama sebagai pembentuk struktur atau
untuk penyimpanan energi. Tepung dan glikogen merupakan polimer
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 31
Sukrosa tidak memiliki sifat pereduksi. Sukrosa atau gula tebu adalah
disakarida dengan hidroksil anomerik dari -D-glukosa dikondensasikan dengan
hidroksil anomerik dari -D-fruktosa. Karena itu keduanya adalah -glukosida
dan -fruktosida. Tidak ada unit yang memiliki hidroksil anomerik dan tidak ada
cincin yang dapat terbuka untuk membentuk aldehid.
O
CH
2
OH
OH
HO
HO
O
OH
HO
O
CH
2
OH
CH
2
OH
Ikatan (1 2)
-glukosa
-fruktosa
Sukrosa [-D-fruktofuranosil -D-glukopiranosa
Bab I Karbohidrat 33
glukosa yang berfungsi sebagai penyimpan gula di dalam tumbuhan
dan hewan. Tepung terdapat sebagai amilosa dan amilopektin. Amilosa
adalah suatu polimer linear dari a-D-glukosa yang terhubung oleh
ikatan a(14). Sedangkan amilopektin memiliki cabang yang
terbentuk oleh ikatan a(16), selain rantai linear yang terbentuk oleh
ikatan a(14).
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 33
Ikatan (14)
Struktur amilosa
Struktur 3-D amilosa
Glikogen juga merupakan polimer bercabang, dengan jumlah
percabangan lebih banyak daripada amilopektin.
BIOKIMIA: Struktur dan Fungsi Biomolekul 34
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 34
Glikogen juga merupakan polimer bercabang, dengan jumlah
percabangan lebih banyak daripada amilopektin.
Polimer glukosa lainnya adalah selulosa, yang merupakan bahan utama
pembentuk dinding sel pada tanaman. Ikatan pada selulosa adalah (14).
Selulosa tidak dapat dicerna oleh mamalia, tetapi beberapa serangga, protozoa,
dan jamur memiliki enzim selulase yang dapat menghidrolisis ikatan (14).
Sapi dan kambing dapat mencerna selulosa dengan bantuan protozoa yang
hidup dalam sistem pencernaannya.
Selain selulosa, tumbuhan juga mengandung pektin dan hemiselulosa.
Pektin merupakan polimer dari arabinosa, galaktosa, dan asam galakturonat.
Hemiselulosa adalah polimer dari D-xilosa, D-manosa, atau D-galaktosa.
Dinding sel jamur, eksoskeleton serangga dan artropoda, serta
moluska, terdiri atas kitin, yakni polimer N-asetil--D-glukosamin yang
terhubung oleh ikatan glikosida (14).
Ikatan (1 6)
Ikatan (1 4)
Contoh struktur glikogen dan amilopektin yang terikat melalui ikatan (1 4) dengan
cabangyang terhubung melalui ikatan (16)
Polimer glukosa lainnya adalah selulosa, yang merupakan bahan
utama pembentuk dinding sel pada tanaman. Ikatan pada selulosa
adalah b(14). Selulosa tidak dapat dicerna oleh mamalia, tetapi
beberapa serangga, protozoa, dan jamur memiliki enzim selulase
yang dapat menghidrolisis ikatan b(14). Sapi dan kambing dapat
mencerna selulosa dengan bantuan protozoa yang hidup dalam sistem
pencernaannya.
Selain selulosa, tumbuhan juga mengandung pektin dan
hemiselulosa. Pektin merupakan polimer dari arabinosa, galaktosa,
dan asam galakturonat. Hemiselulosa adalah polimer dari D-xilosa, D-
manosa, atau D-galaktosa.
Dinding sel jamur, eksoskeleton serangga dan artropoda, serta
moluska, terdiri atas kitin, yakni polimer N-asetil-b-D-glukosamin
yang terhubung oleh ikatan glikosida b(14).
Karbohidrat
Biokimia: Struktur dan Fungsi Biomolekul 35
Jaringan penghubung dalam mamalia kaya akan polisakarida
glikosaminoglikan, yang disebut juga mukopolisakarida. Kondroitin sulfat adalah
polimer dengan ikatan (13) yang menghubungkan disakarida asam
glukuronat dan N-asetilgalaktosamin; dengan gugus hidroksil pada karbon 6
galaktosamin banyak diganti oleh gugus sulfat. Asam hialuronat merupakan
polimer dari disakarida yang terdiri atas asam glukuronat dan N-
asetilglukosamin; asam ini berfungsi sebagai pelumas pada sendi seperti siku
dan lutut.
Contoh struktur kitin: polimer N-asetil--D-glukosamin yang terhubung oleh
ikatan glikosida (14)
Bab I Karbohidrat 35
Jaringan penghubung dalam mamalia kaya akan polisakarida
glikosaminoglikan, yang disebut juga mukopolisakarida. Kondroitin
sulfat adalah polimer dengan ikatan a(13) yang menghubungkan
disakarida asam glukuronat dan N-asetilgalaktosamin; dengan gugus
hidroksil pada karbon 6 galaktosamin banyak diganti oleh gugus sulfat.
Asam hialuronat merupakan polimer dari disakarida yang terdiri atas
asam glukuronat dan N-asetilglukosamin; asam ini berfungsi sebagai
pelumas pada sendi seperti siku dan lutut.
-oo0oo-
BIOKIMIA: Struktur dan Fungsi Biomolekul 36
Bab
ASAM AMINO DAN
PEPTIDA
2
1. ASAM AMINO
Asam-asam amino dalam protein seluruhnya merupakan asam a-
amino, yakni baik gugus amino maupun gugus karboksil keduanya
mengikat atom karbon yang sama yaitu atom karbon a. Atom
karbon a merupakan pusat kiral, sehingga asam amino memiliki
aktivitas optik (kecuali bila rantai samping adalah atom H). semua
asam amino yang ditemukan dalam protein memiliki konfigurasi
L.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 36
C H
3
N
+
H
R
COO
-
BAB II
ASAM AMINO DAN PEPTIDA
1. ASAM AMINO
Asam-asam amino dalam protein seluruhnya merupakan asam -
amino, yakni baik gugus amino maupun gugus karboksil keduanya mengikat
atom karbon yang sama yaitu atom karbon . Atom karbon merupakan pusat
kiral, sehingga asam amino memiliki aktivitas optik (kecuali bila rantai samping
adalah atom H). semua asam amino yang ditemukan dalam protein memiliki
konfigurasi L.
Gambar 2-1 Struktur dasar asam -amino dalam konfigurasi L; R adalah
gugus samping dari 20 gugus kimia
Terdapat 20 macam asam amino yang digunakan dalam sintesis
protein (lihat Tabel 2.1 - 2.7). Penamaan asam amino dapat disingkat menjadi
tiga huruf atau satu huruf. Dalam banyak protein, sebagian asam amino
mengalami modifikasi setelah masuk menjadi bagian protein. Misalnya dalam
kolagen, gugus hidroksil ditambahkan pada residu prolin sehingga
menghasilkan residu hidroksiprolin.
Asam amino dikelompokkan menurut sifatnya, yakni polar atau
nonpolar, aromatik atau alifatik, atau asam atau basa. Asam amino aromatik
dapat menyerap cahaya ultraviolet. Kemampuan ini dimanfaatkan untuk
menentukan konsentrasinya dalam larutan. Hukum Lambert-Beer menyatakan
bahwa absorbansi sinar dengan panjang gelombang tertentu oleh suatu
Gambar 2-1 Struktur dasar asam a-amino dalam konfigurasi L; R
adalah gugus samping dari 20 gugus kimia
Terdapat 20 macam asam amino yang digunakan dalam
sintesis protein (lihat Tabel 2.1 - 2.7). Penamaan asam amino dapat
BIOKIMIA: Struktur dan Fungsi Biomolekul 38
disingkat menjadi tiga huruf atau satu huruf. Dalam banyak protein,
sebagian asam amino mengalami modifikasi setelah masuk menjadi
bagian protein. Misalnya dalam kolagen, gugus hidroksil ditambahkan
pada residu prolin sehingga menghasilkan residu hidroksiprolin.
Asam amino dikelompokkan menurut sifatnya, yakni polar atau
nonpolar, aromatik atau alifatik, atau asam atau basa. Asam amino
aromatik dapat menyerap cahaya ultraviolet. Kemampuan ini
dimanfaatkan untuk menentukan konsentrasinya dalam larutan.
Hukum Lambert-Beer menyatakan bahwa absorbansi sinar dengan
panjang gelombang tertentu oleh suatu substansi dalam larutan adalah
proporsional dengan konsentrasinya, C (molL
-1
) dan panjang jalur
sinar, l (cm) dalam larutan.
= A Cl
dengan A merupakan absorbansi larutan dan e adalah koefisien
absorbansi molar. Absorbans didefinisikan sebagai logaritma dari rasio
intensitas sinar (Io) terhadap intensitas sinar yang ditransmisikan (I).
0
10
log =
I
A
I
Bab 2 Asam Amino dan Peptida 39
Tabel 2.1 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya (asam amino netral,
nonpolar, alifatik)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 37
substansi dalam larutan adalah proporsional dengan konsentrasinya, C (molL
-1
)
dan panjang jalur sinar, l (cm) dalam larutan.
A Cl
dengan A merupakan absorbansi larutan dan adalah koefisien absorbansi
molar. Absorbans didefinisikan sebagai logaritma dari rasio intensitas sinar (I
o
)
terhadap intensitas sinar yang ditransmisikan (I).
0
10
log
I
A
I

Tabel 2.1 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino netral, nonpolar, alifatik)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Glisin
H
C
COO
-
H H
3
N
+
Gly G
Alanin
H
C
COO
-
CH
3
H
3
N
+
Ala A
Valin
H
C
COO
-
CH H
3
N
+
CH
3
CH
3
Val V
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 38
Leusin
H
C
COO
-
CH
2
H
3
N
+
CH
CH
3
CH
3
Leu L
Isoleusin
H
C
COO
-
CH H
3
N
+
CH
3
CH
2
CH
3
Ile I
Tabel 2.2 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino polar, alifatik)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Serin
H
C
COO
-
CH
2
H
3
N
+
OH Ser S
Threonin
H
C
COO
-
CH H
3
N
+
CH
3
OH
Thr T
BIOKIMIA: Struktur dan Fungsi Biomolekul 40
Tabel 2.2 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino polar, alifatik)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 38
Leusin
H
C
COO
-
CH
2
H
3
N
+
CH
CH
3
CH
3
Leu L
Isoleusin
H
C
COO
-
CH H
3
N
+
CH
3
CH
2
CH
3
Ile I
Tabel 2.2 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino polar, alifatik)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Serin
H
C
COO
-
CH
2
H
3
N
+
OH Ser S
Threonin
H
C
COO
-
CH H
3
N
+
CH
3
OH
Thr T
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 39
Asparagin
H
C
COO
-
CH
2
H
3
N
+
C NH
2
O
Asn N
Glutamin
H
C
COO
-
CH
2
H
3
N
+
CH
2
C NH
2
O
Gln Q
Tabel 2.3 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino aromatis)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Fenilalanin
H
C
COO
-
CH
2
H
3
N
+
Phe F
Tirosin
H
C
COO
-
CH
2
H
3
N
+
OH
Tyr Y
Bab 2 Asam Amino dan Peptida 41
Tabel 2.3 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya (asam amino aromatis)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 39
Asparagin
H
C
COO
-
CH
2
H
3
N
+
C NH
2
O
Asn N
Glutamin
H
C
COO
-
CH
2
H
3
N
+
CH
2
C NH
2
O
Gln Q
Tabel 2.3 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino aromatis)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Fenilalanin
H
C
COO
-
CH
2
H
3
N
+
Phe F
Tirosin
H
C
COO
-
CH
2
H
3
N
+
OH
Tyr Y
Tabel 2.4 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino mengandung sulfur)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 40
Triptofan
H
C
COO
-
CH
2
H
3
N
+
C
N
H
Trp W
Tabel 2.4 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino mengandung sulfur)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Sistein
H
C
COO
-
CH
2
H
3
N
+
SH Cys C
Metionin
H
C
COO
-
CH
2
H
3
N
+
CH
2
S CH
3
Met M
Tabel 2.5 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino mengandung gugus asam amino
sekunder)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Prolin

C CH
2
CH
2
CH
2
H
2
N
+
COO
-
H Pro P

BIOKIMIA: Struktur dan Fungsi Biomolekul 42
Tabel 2.5 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya (asam amino mengandung
gugus asam amino sekunder)

Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 40
Triptofan
H
C
COO
-
CH
2
H
3
N
+
C
N
H
Trp W
Tabel 2.4 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino mengandung sulfur)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Sistein
H
C
COO
-
CH
2
H
3
N
+
SH Cys C
Metionin
H
C
COO
-
CH
2
H
3
N
+
CH
2
S CH
3
Met M
Tabel 2.5 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino mengandung gugus asam amino
sekunder)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Prolin

C CH
2
CH
2
CH
2
H
2
N
+
COO
-
H Pro P
Tabel 2.6 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino yang bersifat asam)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 41
Tabel 2.6 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino yang bersifat asam)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Aspartat
H
C

COO
-

CH
2
H
3
N
+
COO
-
Asp D
Glutamat
H
C

COO
-

CH
2
H
3
N
+
CH
2
COO
-
Glu E
Tabel 2.7 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino yang bersifat basa)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Lisin
H
C

COO
-

CH
2
H
3
N
+
CH
2

CH
2

CH
2
+
NH
3
Lys K
Bab 2 Asam Amino dan Peptida 43
Tabel 2.7 Asam amino yang digunakan dalam sintesis protein,
dikelompokkan menurut struktur kimianya
(asam amino yang bersifat basa)
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 41
Tabel 2.6 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino yang bersifat asam)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Aspartat
H
C

COO
-

CH
2
H
3
N
+
COO
-
Asp D
Glutamat
H
C

COO
-

CH
2
H
3
N
+
CH
2
COO
-
Glu E
Tabel 2.7 Asam amino yang digunakan dalam sintesis protein, dikelompokkan
menurut struktur kimianya (asam amino yang bersifat basa)
Nama & Struktur Kimia Asam Amino Struktur 3D Singkatan
Lisin
H
C

COO
-

CH
2
H
3
N
+
CH
2

CH
2

CH
2
+
NH
3
Lys K
Banyak asam amino yang terlibat dalam metabolisme, tetapi tidak
ditemukan dalam protein. Misalnya b-alanin,
-
OOC-CH
2
-CH
2
-NH
3
+
,
yang merupakan intermediet dalam sintesis vitamin B asam pantotenat.
b-alanin tidak ditemukan dalam protein. Meskipun asam amino yang
terdapat di alam kebanyakan memiliki konfigurasi L, namun beberapa
asam amino berkonfigurasi D ditemukan dalam antibiotik tertentu
serta dalam dinding sel beberapa bakteri.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 42
Arginin
H
C
COO
-
CH
2
H
3
N
+
CH
2
CH
2
NH C
NH
2
+
NH
2
Arg R
Histidin
H
C
COO
-
CH
2
H
3
N
+
C
CH
NH
CH
N
His H
Banyak asam amino yang terlibat dalam metabolisme, tetapi tidak
ditemukan dalam protein. Misalnya -alanin,
-
OOC-CH
2
-CH
2
-NH
3
+
, yang
merupakan intermediet dalam sintesis vitamin B asam pantotenat. -alanin
tidak ditemukan dalam protein. Meskipun asam amino yang terdapat di alam
kebanyakan memiliki konfigurasi L, namun beberapa asam amino
berkonfigurasi D ditemukan dalam antibiotik tertentu serta dalam dinding sel
beberapa bakteri.
2. SIFAT ASAM-BASA DARI ASAM AMINO
Asam amino merupakan senyawa amfoter, yakni memiliki gugus asam
dan juga gugus basa. Karena itu, asam amino dapat membawa muatan listrik
total yang tergantung pada sifat larutannya. Muatan yang dibawa suatu
molekul mempengaruhi interaksinya dengan molekul lain. Sifat ini
dimanfaatkan untuk isolasi dan pemurnian asam amino maupun protein.
BIOKIMIA: Struktur dan Fungsi Biomolekul 44
2. SIFAT ASAM-BASA DARI ASAM AMINO
Asam amino merupakan senyawa amfoter, yakni memiliki gugus asam
dan juga gugus basa. Karena itu, asam amino dapat membawa muatan
listrik total yang tergantung pada sifat larutannya. Muatan yang dibawa
suatu molekul mempengaruhi interaksinya dengan molekul lain. Sifat
ini dimanfaatkan untuk isolasi dan pemurnian asam amino maupun
protein.
Air merupakan pelarut biologis utama. Sifat asam-basa molekul
terlarut berkaitan erat dengan disosiasi air. Air merupakan elektrolit
lemah yang bisa terdisosiasi menjadi proton dan ion hidroksil. Dalam
proses disosiasi air, proton berikatan dengan molekul air lainnya yang
berikatan (ikatan hidrogen) sehingga membentuk ion hidronium
(H3O
+
):
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 43
Air merupakan pelarut biologis utama. Sifat asam-basa molekul
terlarut berkaitan erat dengan disosiasi air. Air merupakan elektrolit lemah yang
bisa terdisosiasi menjadi proton dan ion hidroksil. Dalam proses disosiasi air,
proton berikatan dengan molekul air lainnya yang berikatan (ikatan hidrogen)
sehingga membentuk ion hidronium (H
3
O
+
):
O
H
H
H O
H
O H
H
H
+
OH
-
K
e
Dalam air murni bersuhu 25
0
C terdapat 1,0 x 10
-7
mol L
-1
H
3
O
+
dan ion OH
-
dengan konsentrasi ekuivalen. Proton tidak berada dalam keadaan telanjang
di dalam air karena proton memiliki afinitas tinggi untuk molekul air. Tetapi
untuk tujuan penyederhanaan, proton dalam air seringkali ditulis sebagai H
+
.
Proses disosiasi air merupakan proses kesetimbangan yang
berlangsung sangat cepat, dengan tetapan kesetimbangan ditulis seperti
berikut:
( )
-
3
2
H O OH
2
H O
e
a a
K
a
+

=
Untuk larutan encer, aktivitas (a) air dianggap konstan mendekati 1,0 dan
aktivitas zat terlarut merupakan konsentrasinya. Dengan demikian, dapat ditulis
suatu tetapan praktis, K
w
, yakni produk ionik dari air:
K
w
= [H
3
O
+
].[OH
-
]
atau sering juga ditulis K
w
= [H
+
][OH
-
], dengan mengabaikan hidrasi proton.
Air murni pada suhu 25
0
C memiliki K
w
= 10
-14
. Karena dalam air murni [H
+
] =
[OH
-
], maka
-14 -7 -1
H 10 10 mol L
+
( = =

Dalam air murni bersuhu 25
0
C terdapat 1,0 x 10
-7
mol L
-1
H3O+ dan
ion OH
-
dengan konsentrasi ekuivalen. Proton tidak berada dalam
keadaan telanjang di dalam air karena proton memiliki afinitas tinggi
untuk molekul air. Tetapi untuk tujuan penyederhanaan, proton dalam
air seringkali ditulis sebagai H
+
.
Proses disosiasi air merupakan proses kesetimbangan yang
berlangsung sangat cepat, dengan tetapan kesetimbangan ditulis seperti
berikut:
( )
-
3
2
H O OH
2
H O


+

=
e
a a
K
a
Bab 2 Asam Amino dan Peptida 45
Untuk larutan encer, aktivitas (a) air dianggap konstan mendekati 1,0
dan aktivitas zat terlarut merupakan konsentrasinya. Dengan demikian,
dapat ditulis suatu tetapan praktis, K
w
, yakni produk ionik dari air:
K
w
= [H3O
+
].[OH
-
]
atau sering juga ditulis K
w
= [H
+
][OH-], dengan mengabaikan hidrasi
proton.
Air murni pada suhu 25
0
C memiliki Kw = 10
-14
. Karena dalam air
murni [H
+
] = [OH
-
], maka
-14 -7 -1
H 10 10 mol L
+
= =

Dalam larutan asam, [H
+
] lebih tinggi dan [OH-] lebih rendah
karena produk ionik adalah konstan. Nilai Kw tergantung pada suhu,
misalnya pada 37
0
C K
w
= 2,4 x 10
-14
.
Seorang ahli kimia Denmark, S.P.L Srensen mendefinisikan pH
(potentia Hydrogenii) sebagai:
pH = -log10 [H
+
]
Pada larutan netral, [H
+
] = [OH
-
], dan untuk air murni pada 25
0
C
maka
pH = -log10 (10-7) = 7,0
Air destilasi yang biasa dipakai dalam laboratorium tidak terlalu
murni. Sejumlah kecil CO2 yang terlarut dalam air akan membentuk
asam karbonat sehingga meningkatkan konsentrasi ion hidrogen sampai
sekitar 10-5 mol L-1. Karena itu air destilasi memiliki pH sekitar 5.
Suatu asam adalah senyawa yang dapat menyumbangkan proton pada
senyawa lain (menurut definisi Brnsted). Senyawa CH
3
COOH adalah
suatu asam, yang bernama asam asetat. Ketika dilarutkan dalam air,
gugus karboksil pada asam asetat tidak terdisosiasi sempurna. Karena
BIOKIMIA: Struktur dan Fungsi Biomolekul 46
itu asam asetat termasuk sebagai asam lemah. Reaksi disosiasi asam
lemah bertipe HA dalam air adalah
Maka, reaksi disosiasi untuk asam asetat adalah
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 44
HA + H
2
O A
-
+ H
3
O
+
Dalam larutan asam, [H
+
] lebih tinggi dan [OH
-
] lebih rendah karena produk
ionik adalah konstan. Nilai K
w
tergantung pada suhu, misalnya pada 37
0
C K
w
=
2,4 x 10
-14
.
Seorang ahli kimia Denmark, S.P.L Srensen mendefinisikan pH
(potentia Hydrogenii) sebagai:
pH = -log
10
[H
+
]
Pada larutan netral, [H
+
] = [OH
-
], dan untuk air murni pada 25
0
C maka
pH = -log
10
(10
-7
) = 7,0
Air destilasi yang biasa dipakai dalam laboratorium tidak terlalu murni.
Sejumlah kecil CO
2
yang terlarut dalam air akan membentuk asam karbonat
sehingga meningkatkan konsentrasi ion hidrogen sampai sekitar 10
-5
mol L
-1
.
Karena itu air destilasi memiliki pH sekitar 5.
Suatu asam adalah senyawa yang dapat menyumbangkan proton pada
senyawa lain (menurut definisi Brnsted). Senyawa CH
3
COOH adalah suatu
asam, yang bernama asam asetat. Ketika dilarutkan dalam air, gugus karboksil
pada asam asetat tidak terdisosiasi sempurna. Karena itu asam asetat
termasuk sebagai asam lemah. Reaksi disosiasi asam lemah bertipe HA dalam
air adalah
Maka, reaksi disosiasi untuk asam asetat adalah
CH
3
COOH
+ H
2
O CH
3
COO
-
H
3
O
+
+
Donor H
+
(asam)
Akseptor H
+
(basa)
Basa
konjugasi
Asam
konjugasi
Pemberian dan penerimaan proton merupakan proses dua arah. Ion
H
3
O
+
yang terbentuk dapat mendonorkan proton kembali pada ion asetat untuk
membentuk asam asetat. Hal ini berarti ion H
3
O
+
dapat dianggap sebagai
asam dan ion asetat dapat dianggap sebagai basa. Karena itu asetat disebut
basa konjugasi dari asam asetat.
Proses asosiasi dan disosiasi di atas membentuk suatu
kesetimbangan, dan larutan akan memiliki konsentrasi H
3
O
+
yang lebih besar
daripada dalam air murni. Karena itu larutan ini akan memiliki pH di bawah 7,0.
Pemberian dan penerimaan proton merupakan proses dua arah.
Ion H3O
+
yang terbentuk dapat mendonorkan proton kembali pada
ion asetat untuk membentuk asam asetat. Hal ini berarti ion H
3
O
+

dapat dianggap sebagai asam dan ion asetat dapat dianggap sebagai
basa. Karena itu asetat disebut basa konjugasi dari asam asetat.
Proses asosiasi dan disosiasi di atas membentuk suatu
kesetimbangan, dan larutan akan memiliki konsentrasi H
3
O
+
yang lebih
besar daripada dalam air murni. Karena itu larutan ini akan memiliki
pH di bawah 7,0.
Tetapan disosiasi asam, Ka, adalah ukuran kekuatan suatu asam.
Untuk asam asetat, Ka adalah
dengan a merupakan aktivitas termodinamika dari zat kimia tersebut.
Dalam larutan encer, konsentrasi air sangat mendekati konsentrasi
air murni. Menurut konvensi, aktivitas air murni adalah 1,0. Selanjutnya,
aktivitas zat terlarut dalam larutan encer dapat diperkirakan dari
konsentrasi zat tersebut. Untuk itu, persamaan untuk tetapan disosiasi
asam dapat ditulis sebagai berikut:
-14 -7 -1
H 10 10 mol L
+
= =

O H H
A O H
a
a a
a a
K
a 2
3


O H COOH CH
COO CH O H
a
a a
a a
K
2 3
3 3


O H H
A O H
a
a a
a a
K
a 2
3


O H COOH CH
COO CH O H
a
a a
a a
K
2 3
3 3


Bab 2 Asam Amino dan Peptida 47
[ ]
-
[H ][A ]
HA
+
=
a
K
Untuk asam asetat, persamaan ini menjadi
[ ]
-
3
3
[H ][CH COO ]
CH COOH
+
=
a
K
Semakin besar nilai Ka maka semakin besar pula kecenderungan
asam tersebut untuk melepaskan proton, yang berarti asam semakin
kuat.
Dengan cara yang sama seperti pH, pKa dapat ditulis
pKa = -log Ka
Semakin rendah nilai pKa suatu senyawa kimia maka semakin
tinggi nilai Ka, yang berarti senyawa tersebut makin kuat sifat
asamnya.
Suatu basa adalah senyawa yang dapat menerima proton dari suatu
asam. Ketika metilamin (CH
3
-NH
2
) dilarutkan dalam air, senyawa
tersebut menerima proton dari air sehingga meningkatkan konsentrasi
OH- dan pH menjadi semakin tinggi.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 46
Suatu basa adalah senyawa yang dapat menerima proton dari suatu
asam. Ketika metilamin (CH
3
-NH
2
) dilarutkan dalam air, senyawa tersebut
menerima proton dari air sehingga meningkatkan konsentrasi OH
-
dan pH
menjadi semakin tinggi.
CH
3
+ H
2
O CH
3
NH
3
+
+ OH
-
NH
2
Basa Asam Asam
konjugasi
Basa
konjugasi
Sama seperti pada asam asetat, dengan naiknya konsentrasi OH
-
maka reaksi sebaliknya menjadi lebih signifikan sampai akhirnya proses
tersebut mencapai kesetimbangan. Persamaan untuk tetapan kebasaan, K
b
,
dapat ditulis sebagai berikut:

-
3 3
3 2
[CH -NH ][OH ]
CH -NH
b
K

Akan tetapi, penggunaan tetapan K


b
dapat membingungkan karena kita harus
menjaga dua macam tetapan, K
a
dan K
b
. Kesetimbangan kimia merupakan
proses dua arah, karena itu lebih mudah bila mengukur kebasaan dari sudut
pandang asam konjugasinya. Artinya, asam konjugasi ini dianggap
mendonorkan proton pada air:
CH
3
NH
3
+
+ H
2
O CH
3
NH
2
+ H
3
O
+
3 2 3
3 3
[CH -NH ][H O ]
[CH -NH ]
a
K

K
a
dan K
b
memiliki hubungan sebagai berikut:

-
- 3 2 3 3 3
3
3 3 3 2
[CH -NH ][H O ] [CH -NH ][OH ]
[H O ][OH ]
[CH -NH ] CH -NH
a b
K K


maka,
w b a
K K K
Dengan kata lain, jika kita mengetahui K
a
dari asam konjugasi, maka kita dapat
menghitung K
b
untuk basanya. Dengan demikian, kuatnya sifat basa suatu
senyawa ditandai oleh rendahnya nilai K
a
untuk asam konjugasinya.
Sama seperti pada asam asetat, dengan naiknya konsentrasi OH-
maka reaksi sebaliknya menjadi lebih signifikan sampai akhirnya proses
tersebut mencapai kesetimbangan. Persamaan untuk tetapan kebasaan,
Kb, dapat ditulis sebagai berikut:
BIOKIMIA: Struktur dan Fungsi Biomolekul 48
[ ]
-
3 3
3 2
[CH -NH ][OH ]
CH -NH
+
=
b
K
Akan tetapi, penggunaan tetapan Kb dapat membingungkan karena
kita harus menjaga dua macam tetapan, Ka dan Kb. Kesetimbangan
kimia merupakan proses dua arah, karena itu lebih mudah bila
mengukur kebasaan dari sudut pandang asam konjugasinya. Artinya,
asam konjugasi ini dianggap mendonorkan proton pada air:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 46
Suatu basa adalah senyawa yang dapat menerima proton dari suatu
asam. Ketika metilamin (CH
3
-NH
2
) dilarutkan dalam air, senyawa tersebut
menerima proton dari air sehingga meningkatkan konsentrasi OH
-
dan pH
menjadi semakin tinggi.
CH
3
+ H
2
O CH
3
NH
3
+
+ OH
-
NH
2
Basa Asam Asam
konjugasi
Basa
konjugasi
Sama seperti pada asam asetat, dengan naiknya konsentrasi OH
-
maka reaksi sebaliknya menjadi lebih signifikan sampai akhirnya proses
tersebut mencapai kesetimbangan. Persamaan untuk tetapan kebasaan, K
b
,
dapat ditulis sebagai berikut:

-
3 3
3 2
[CH -NH ][OH ]
CH -NH
b
K

Akan tetapi, penggunaan tetapan K


b
dapat membingungkan karena kita harus
menjaga dua macam tetapan, K
a
dan K
b
. Kesetimbangan kimia merupakan
proses dua arah, karena itu lebih mudah bila mengukur kebasaan dari sudut
pandang asam konjugasinya. Artinya, asam konjugasi ini dianggap
mendonorkan proton pada air:
CH
3
NH
3
+
+ H
2
O CH
3
NH
2
+ H
3
O
+
3 2 3
3 3
[CH -NH ][H O ]
[CH -NH ]
a
K

K
a
dan K
b
memiliki hubungan sebagai berikut:

-
- 3 2 3 3 3
3
3 3 3 2
[CH -NH ][H O ] [CH -NH ][OH ]
[H O ][OH ]
[CH -NH ] CH -NH
a b
K K


maka,
w b a
K K K
Dengan kata lain, jika kita mengetahui K
a
dari asam konjugasi, maka kita dapat
menghitung K
b
untuk basanya. Dengan demikian, kuatnya sifat basa suatu
senyawa ditandai oleh rendahnya nilai K
a
untuk asam konjugasinya.
3 2 3
3 3
[CH -NH ][H O ]
[CH -NH ]
+
+
=
a
K
Ka dan Kb memiliki hubungan sebagai berikut:
[ ]
-
- 3 2 3 3 3
3
3 3 3 2
[CH -NH ][H O ] [CH -NH ][OH ]
[H O ][OH ]
[CH -NH ] CH -NH
+ +
+
+
= =
a b
K K
maka, K
a
.K
b
=K
w
Dengan kata lain, jika kita mengetahui Ka dari asam konjugasi,
maka kita dapat menghitung Kb untuk basanya. Dengan demikian,
kuatnya sifat basa suatu senyawa ditandai oleh rendahnya nilai Ka
untuk asam konjugasinya.
Campuran suatu asam dan basa konjugasinya dapat menahan
perubahan pH ketika sedikit asam atau basa lain ditambahkan.
Campuran seperti ini dikenal sebagai penyangga (buffer).
Reaksi disosiasi asam asetat adalah seperti berikut:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 47
Campuran suatu asam dan basa konjugasinya dapat menahan
perubahan pH ketika sedikit asam atau basa lain ditambahkan. Campuran
seperti ini dikenal sebagai penyangga (buffer).
Reaksi disosiasi asam asetat adalah seperti berikut:
CH
3
COOH
+ H
2
O CH
3
COO
-
H
3
O
+
+
Asam tambahan menyebabkan H
3
O
+
dan CH
3
COO
-
tergabung kembali
membentuk asam asetat, sehingga pembentukan H
3
O
+
dihalangi. Sebaliknya,
penambahan NaOH menyebabkan disosiasi asam asetat menjadi asetat,
sehingga mengurangi penurunan konsentrasi H
3
O
+
.
Sifat di atas bisa dikuantisasi dengan menurunkan persamaan

-
[H ][A ]
HA
a
K

yakni: log K
a
= log [H
+
] + log [A
-
] log [HA]
log K
a
= log [H
+
] log [A
-
] + log [HA]
Karena log K
a
= pK
a
dan log [H
+
] = pH maka
-
[HA] [asam]
p pH log pH log
[A ] [basa konjugasi]
a
K
atau
[basa]
pH p log
[asam konjugasi]
a
K
Kedua persamaan di atas adalah persamaan Henderson-Hasselbalch. Dari
persamaan ini dapat dihitung komposisi penyangga yang memiliki pH tertentu.
Perlu diperhatikan bahwa jika [HA] = [A
-
] maka pH = pK
a
.
Banyak molekul biologis yang memiliki lebih dari satu gugus yang bisa
terdisosiasi. Disosiasi salah satu gugus dapat mempengaruhi kecenderungan
gugus-gugus lainnya untuk terdisosiasi. Hal ini terjadi pada asam amino yang
memiliki gugus karboksil dan gugus amino. Dalam air, gugus karboksil
cenderung melepaskan proton sedangkan gugus amino mengikat proton.
Kedua reaksi tersebut dapat terjadi tanpa terbentuknya H
3
O
+
maupun OH
-
.
Hasilnya, asam amino membawa muatan negatif dan juga muatan positif di
Asam tambahan menyebabkan H3O
+
dan CH3COO
-
tergabung
kembali membentuk asam asetat, sehingga pembentukan H3O
+

Bab 2 Asam Amino dan Peptida 49
dihalangi. Sebaliknya, penambahan NaOH menyebabkan disosiasi
asam asetat menjadi asetat, sehingga mengurangi penurunan
konsentrasi H3O
+.
Sifat di atas bisa dikuantisasi dengan menurunkan persamaan
[ ]
-
[H ][A ]
HA
+
=
a
K
yakni: log Ka = log [H
+
] + log [A
-
] log [HA]
log Ka = log [H
+
] log [A
-
] + log [HA]
Karena log Ka = pKa dan log [H+] = pH maka
-
[HA] [asam]
p pH log pH log
[A ] [basa konjugasi]
= + = +
a
K
atau
[basa]
pH p log
[asam konjugasi]
= +
a
K
Kedua persamaan di atas adalah persamaan Henderson-
Hasselbalch. Dari persamaan ini dapat dihitung komposisi penyangga
yang memiliki pH tertentu. Perlu diperhatikan bahwa jika [HA] = [A
-
]
maka pH = pKa.
Banyak molekul biologis yang memiliki lebih dari satu gugus
yang bisa terdisosiasi. Disosiasi salah satu gugus dapat mempengaruhi
kecenderungan gugus-gugus lainnya untuk terdisosiasi. Hal ini terjadi
pada asam amino yang memiliki gugus karboksil dan gugus amino.
Dalam air, gugus karboksil cenderung melepaskan proton sedangkan
gugus amino mengikat proton. Kedua reaksi tersebut dapat terjadi
tanpa terbentuknya H
3
O
+
maupun OH
-
. Hasilnya, asam amino
membawa muatan negatif dan juga muatan positif di dalam larutan
BIOKIMIA: Struktur dan Fungsi Biomolekul 50
yang pH-nya mendekati netral. Dalam keadaan ini, senyawa tersebut
disebut sebagai zwitterion.
Titrasi suatu asam amino dilakukan untuk mempelajari sifat
zwiterionik asam amino tersebut. Sebagai contoh, suatu titrasi dimulai
dengan larutan glisin hidroklorida, yang kedua gugusnya terdapat
dalam bentuk asamnya. Penambahan natrium hidroksida menimbulkan
peningkatan pH larutan. Pada saat yang sama, proton yang terdisosiasi
bereaksi dengan ion hidroksil yang ditambahkan untuk membentuk
molekul air, sehingga menyebabkan disosiasi terus terjadi.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 48
dalam larutan yang pH-nya mendekati netral. Dalam keadaan ini, senyawa
tersebut disebut sebagai zwitterion.
Titrasi suatu asam amino dilakukan untuk mempelajari sifat zwiterionik
asam amino tersebut. Sebagai contoh, suatu titrasi dimulai dengan larutan
glisin hidroklorida, yang kedua gugusnya terdapat dalam bentuk asamnya.
Penambahan natrium hidroksida menimbulkan peningkatan pH larutan. Pada
saat yang sama, proton yang terdisosiasi bereaksi dengan ion hidroksil yang
ditambahkan untuk membentuk molekul air, sehingga menyebabkan disosiasi
terus terjadi.
Kurva titrasi terlihat pada Gambar 2-2. Pada titik A, kedua gugus yang
dimiliki glisin hidroklorida terdapat dalam bentuk asamnya (terprotonasi):
HOOC-CH
2
-NH
3
+
sehingga molekul bermuatan +1. Setelah penambahan 10
mmol NaOH (titik C, pH mendekati 6,0), salah satu gugus hampir
terdeprotonasi sempurna sehingga molekul tak bermuatan. Setelah ditambah
lagi 10 mmol NaOH, gugus kedua juga terdeprotonasi (titik E) dan bentuk
molekul akan menjadi

OOC-CH
2
-NH
2
dengan muatan -1.
Titrasi 10 mmol glisin.HCl oleh larutan NaOH
0
2
4
6
8
10
12
14
16
0 0.5 1 1.5 2 2.5
Jumlah proton terdisosiasi
p
H
Gambar 2-2 Titrasi 10 mmol glisin.HCl oleh larutan NaOH. Garis putus-putus
menunjukkan titrasi dengan ditambahkan formaldehid.
A
B
C
D
E
+1
0 -1 Muatan
Gambar 2-2 Titrasi 10 mmol glisin.HCl oleh larutan NaOH. Garis
putus-putus menunjukkan titrasi dengan ditambahkan formaldehid.
Kurva titrasi terlihat pada Gambar 2-2. Pada titik A, kedua gugus
yang dimiliki glisin hidroklorida terdapat dalam bentuk asamnya
(terprotonasi): HOOC-CH
2-
NH
3
+
sehingga molekul bermuatan +1.
Setelah penambahan 10 mmol NaOH (titik C, pH mendekati 6,0),
salah satu gugus hampir terdeprotonasi sempurna sehingga molekul
Bab 2 Asam Amino dan Peptida 51
tak bermuatan. Setelah ditambah lagi 10 mmol NaOH, gugus kedua
juga terdeprotonasi (titik E) dan bentuk molekul akan menjadi

OOC-
CH
2
-NH
2
dengan muatan -1.
Dekatnya titik B dan D menandakan bahwa pH hanya berubah
sedikit pada penambahan NaOH. Dalam hal ini, larutan berperan
sebagai penyangga. Pada titik B pH = 2,3, setengah dari gugus pertama
telah tertitrasi menjadi basa konjugasinya, sementara setengah sisanya
masih dalam bentuk asam, sehingga [asam] = [basa konjugasi]. Pada
titik ini pKa = pH atau pKa = 2,3 untuk titrasi dalam gambar. Gugus
yang pertama tertitrasi haruslah merupakan asam yang relatif kuat,
dalam hal ini adalah gugus karboksil. Gugus kedua yang tertitrasi
adalah gugus amino, dengan pKa = 9,6.
Nilai pH ketika molekul tidak memiliki muatan disebut titik
isoelektrik. Titik isoelektrik untuk glisin adalah pH 6,0. Ketika larutan
glisin berada dalam keadaan isoelektrik, sebagian molekul akan berupa
COOH-CH
2
-NH
3
+
yang jumlahnya seimbang dengan COO--CH
2
-
NH
2
, serta beberapa COOH-CH
2
-NH
2
. pH pada titik isoelektrik
dapat dihitung dari nilai pKa tiap gugus.
1 2
p p
pH
2
+
=
a a
I
K K
Dapat dilakukan modifikasi kimia untuk memeriksa nilai pKa
yang ditentukan dalam titrasi asam amino. Misalnya melakukan titrasi
dengan kehadiran formaldehid. Titrasi ini menunjukkan bahwa pK
a1

dalam Gambar 2-2 adalah milik gugus karboksil dan pK
a2
adalah milik
gugus amino.
Formaldehid (HCHO) bereaksi reversibel dengan gugus amino
seperti berikut:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 49
Dekatnya titik B dan D menandakan bahwa pH hanya berubah sedikit pada
penambahan NaOH. Dalam hal ini, larutan berperan sebagai penyangga.
Pada titik B pH = 2,3, setengah dari gugus pertama telah tertitrasi menjadi basa
konjugasinya, sementara setengah sisanya masih dalam bentuk asam,
sehingga [asam] = [basa konjugasi]. Pada titik ini pKa = pH atau pKa = 2,3
untuk titrasi dalam gambar. Gugus yang pertama tertitrasi haruslah merupakan
asam yang relatif kuat, dalam hal ini adalah gugus karboksil. Gugus kedua
yang tertitrasi adalah gugus amino, dengan pKa = 9,6.
Nilai pH ketika molekul tidak memiliki muatan disebut titik isoelektrik.
Titik isoelektrik untuk glisin adalah pH 6,0. Ketika larutan glisin berada dalam
keadaan isoelektrik, sebagian molekul akan berupa COOH-CH
2
-NH
3
+
yang
jumlahnya seimbang dengan COO
-
-CH
2
-NH
2
, serta beberapa COOH-CH
2
-NH
2
.
pH pada titik isoelektrik dapat dihitung dari nilai pK
a
tiap gugus.
1 2
p p
pH
2
a a
I
K K

Dapat dilakukan modifikasi kimia untuk memeriksa nilai pKa yang ditentukan
dalam titrasi asam amino. Misalnya melakukan titrasi dengan kehadiran
formaldehid. Titrasi ini menunjukkan bahwa pKa
1
dalam Gambar 2-2 adalah
milik gugus karboksil dan pKa
2
adalah milik gugus amino.
Formaldehid (HCHO) bereaksi reversibel dengan gugus amino seperti
berikut:
R NH
2
+ R N
CH
2
CH
2
OH
OH
2HCHO
Dengan demikian, pK
a
gugus amino menjadi berubah dalam larutan
formaldehid, sedangkan gugus karboksil tidak terpengaruh. Ditemukan bahwa
pK
a1
asam amino dalam formaldehid tidak berubah sehingga berarti pK
a
ini
menunjukkan gugus karboksil. Sementara itu, pK
a2
menjadi lebih rendah (garis
putus-putus dalam Gambar 2-2). Besarnya penurunan pK
a
ini tergantung pada
konsentrasi formaldehid. Oleh karena itu, pK
a2
menunjukkan disosiasi gugus
amino.
BIOKIMIA: Struktur dan Fungsi Biomolekul 52
Dengan demikian, pKa gugus amino menjadi berubah dalam
larutan formaldehid, sedangkan gugus karboksil tidak terpengaruh.
Ditemukan bahwa pKa1 asam amino dalam formaldehid tidak berubah
sehingga berarti pKa ini menunjukkan gugus karboksil. Sementara itu,
pK
a2
menjadi lebih rendah (garis putus-putus dalam Gambar 2-2).
Besarnya penurunan pKa ini tergantung pada konsentrasi formaldehid.
Oleh karena itu, pK
a2
menunjukkan disosiasi gugus amino.
Pada umumnya, gugus karboksil merupakan asam yang lebih kuat
daripada gugus NH3
+
. Gugus karboksil cenderuk mempunyai nilai
pKa di bawah 5 sedangkan gugus NH
3
+
di atas 7. pKa karboksil glisin
(2,3) lebih rendah daripada pKa asam asetat (4,7). Pada pH di bawah
6, gugus amino dalam larutan glisin memiliki muatan positif. Muatan
positif ini menstabilkan muatan negatif ion karboksilat dengan adanya
interaksi elektrostatik. Hal ini berarti gugus karboksil pada glisin akan
kehilangan protonnya lebih cepat, sehingga merupakan asam yang
lebih kuat (dengan nilai pKa lebih rendah).
Beberapa asam amino memiliki rantai samping prototropik.
Misalnya, asam aspartat dan asam glutamat memiliki gugus karboksil
tambahan, histidin memiliki gugus imidazol, lisin memiliki gugus
amino, dan arginin memiliki gugus guanidino. Nilai pKa asam-asam
amino ini dapat dilihat dalam Tabel 2.8.
Tabel 2.8 Nilai pKa Beberapa Asam Amino
Asam Amino pKa1 pKa pKa
(a-COOH) (a-NH3+) (rantai samping)
Glisin 2,3 9,6
Serin 2,2 9,2
Alanin 2,3 9,7
Valin 2,3 9,6
Leusin 2,4 9,6
Asam aspartat 2,1 9,8 3,9
Asam glutamat 2,2 9,7 4,3
Histidin 1,8 9,2 6,0
Sistein 1,7 10,8 8,3
Tirosin 2,2 9,1 10,1
Lisin 2,2 9,0 10,5
Bab 2 Asam Amino dan Peptida 53
Kurva titrasi asam-asam amino ini memiliki lekukan tambahan, seperti
terlihat dalam Gambar 2-3 untuk asam glutamat.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 51
0
2
4
6
8
10
12
14
16
0 0.5 1 1.5 2 2.5 3 3.5
Jumlah proton terdisosiasi
p
H
Gambar 2-3. Titrasi 10 mmol asam glutamat hidroklorida oleh NaOH
Berbagai gugus dalam asam amino memiliki muatan yang tergantung pada pH
larutan, yakni:
1. Bentuk terprotonasi pada gugus karboksil dan rantai samping tirosin
adalah tak bermuatan, sedangkan bentuk terdeprotonasinya memiliki
muatan negatif (anion).
2. Bentuk terprotonasi pada gugus amino, rantai samping imidazol asam
amino histidin, serta pada gugus guanidino asam amino arginin,
semuanya memiliki muatan positif (kation). Sedangkan bentuk
terdeprotonasi gugus-gugus tersebut tidak memiliki muatan.
Larutan lebih bersifat asam pada pH di bawah nilai pKa suatu gugus,
dan bentuk terdeprotonasi lebih mendominasi. Seiring naiknya pH sampai di
atas nilai pK
a
suatu gugus, maka gugus tersebut kehilangan protonnya.
Misalnya, gugus COOH menjadi COO
-
dan gugus NH
3
+
menjadi NH
2
.
Titik isoelektrik suatu asam amino dapat dihitung dengan bantuan nilai-
nilai pK
a
-nya. Sebagai contoh, titik isoelektrik untuk asam glutamat dapat
dihitung dengan melihat nilai pK
a
pada Tabel 2-8. Pada nilai pH kurang dari
2,2, semua gugus terprotonasi. Berbagai bentuk asam glutamat yang
A
B
C
D
+1 0 -1 -2 Muatan
Gambar 2-3. Titrasi 10 mmol asam glutamat hidroklorida
oleh NaOH
Berbagai gugus dalam asam amino memiliki muatan yang tergantung
pada pH larutan, yakni:
1. Bentuk terprotonasi pada gugus karboksil dan rantai samping
tirosin adalah tak bermuatan, sedangkan bentuk terdeprotonasinya
memiliki muatan negatif (anion).
2. Bentuk terprotonasi pada gugus amino, rantai samping imidazol
asam amino histidin, serta pada gugus guanidino asam amino
arginin, semuanya memiliki muatan positif (kation). Sedangkan
bentuk terdeprotonasi gugus-gugus tersebut tidak memiliki
muatan.
BIOKIMIA: Struktur dan Fungsi Biomolekul 54
Larutan lebih bersifat asam pada pH di bawah nilai pK
a
suatu
gugus, dan bentuk terdeprotonasi lebih mendominasi. Seiring naiknya
pH sampai di atas nilai pKa suatu gugus, maka gugus tersebut
kehilangan protonnya. Misalnya, gugus COOH menjadi COO
-
dan
gugus NH
3
+
menjadi NH2.
Titik isoelektrik suatu asam amino dapat dihitung dengan
bantuan nilai-nilai pK
a
-nya. Sebagai contoh, titik isoelektrik untuk
asam glutamat dapat dihitung dengan melihat nilai pKa pada Tabel 2-
8. Pada nilai pH kurang dari 2,2, semua gugus terprotonasi. Berbagai
bentuk asam glutamat yang mendominasi hadir pada titik-titik yang
berbeda selama titrasi, yakni pada Tabel 2.9.
Ketika pH terus naik melewati 2,2, a-karboksil terdisosiasi
membentuk zwitterion di sekitar pH 3. pH terus naik melampaui 4,3,
dan karboksil rantai samping terdisosiasi sehingga molekul memiliki
dua muatan negatif dan satu muatan positif (total muatan menjadi -
1). Pada sekitar pH 7 (yakni dalam larutan netral), baik asam glutamat
maupun asam aspartat terdapat dalam bentuk glutamat dan aspartat,
dengan rantai samping terionisasi. Akhirnya, ketika pH mencapai
pKa2, gugus amino terdisosiasi sehingga molekul menjadi bermuatan
-2. Dengan demikian, titik isoelektrik diapit oleh dua nilai pKa yakni
2,2 dan 4,3.
Maka untuk asam glumatat
pHI = (pK
a1
+ pK
aR
)/2 = (2,2 + 4,3)/2 = 6,5/2 = 3,25.
Titik isoelektrik suatu asam amino adalah rata-rata nilai pK
a
yang
mengapit kedua sisi keadaan isoelektrik.
Bab 2 Asam Amino dan Peptida 55
Tabel 2-9 Berbagai bentuk asam glutamat yang mendominasi hadir
pada titik-titik yang berbeda selama titrasi
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 52
mendominasi hadir pada titik-titik yang berbeda selama titrasi, yakni pada Tabel
2.9.
Ketika pH terus naik melewati 2,2, -karboksil terdisosiasi membentuk
zwitterion di sekitar pH 3. pH terus naik melampaui 4,3, dan karboksil rantai
samping terdisosiasi sehingga molekul memiliki dua muatan negatif dan satu
muatan positif (total muatan menjadi -1). Pada sekitar pH 7 (yakni dalam
larutan netral), baik asam glutamat maupun asam aspartat terdapat dalam
bentuk glutamat dan aspartat, dengan rantai samping terionisasi. Akhirnya,
ketika pH mencapai pK
a2
, gugus amino terdisosiasi sehingga molekul menjadi
bermuatan -2. Dengan demikian, titik isoelektrik diapit oleh dua nilai pK
a
yakni
2,2 dan 4,3.
Tabel 2-9 Berbagai bentuk asam glutamat yang mendominasi
hadir pada titik-titik yang berbeda selama titrasi
Titik Bentuk Bermuatan Besar Muatan
A (pH 1) COOH
CH
2
CH
2
CH NH
3
+
COOH
+1
B (pH 3,25) COOH
CH
2
CH
2
CH NH
3
+
COO
-
0
C (pH 7)
COO
-
CH
2
CH
2
CH NH
3
+
COO
-
-1
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 53
D (pH 12)
COO
-
CH
2
CH
2
CH NH
2
COO
-
-2
Maka, untuk asam glutamat,
pH
I
= (pK
a1
+ pK
aR
)/2 = (2,2 + 4,3)/2 = 6,5/2 = 3,25.
Titik isoelektrik suatu asam amino adalah rata-rata nilai pK
a
yang mengapit
kedua sisi keadaan isoelektrik.
3. ANALISIS ASAM AMINO
Asam-asam amino hasil hidrolisis protein dapat dipisahkan satu sama
lain dengan menggunakan kromatografi penukar ion. Tiga macam larutan
penyangga pH tinggi dipakai untuk mengelusi asam amino pada kolom
kromatografi. Urutan pengelusian tergantung pada muatan asam amino. Asam
amino basa (lisin, histidin, dan arginin) paling kuat mengikat muatan negatif
resin penukar ion. Teknik ini memungkinkan penentuan asam amino apa saja
yang terdapat dalam protein tertentu. Kelimpahan relatif asam-asam amino
juga bisa ditentukan dengan mengukur konsentrasi tiap asam amino. Senyawa
ninhidrin bereaksi dengan asam amino membentuk warna ungu. Larutan
berwarna ungu ini diukur absorbansinya pada panjang gelombang 570 nm, lalu
konsentrasi relatif tiap asam amino dapat ditentukan.
BIOKIMIA: Struktur dan Fungsi Biomolekul 56
3. ANALISIS ASAM AMINO
Asam-asam amino hasil hidrolisis protein dapat dipisahkan satu sama
lain dengan menggunakan kromatografi penukar ion. Tiga macam
larutan penyangga pH tinggi dipakai untuk mengelusi asam amino
pada kolom kromatografi. Urutan pengelusian tergantung pada muatan
asam amino. Asam amino basa (lisin, histidin, dan arginin) paling kuat
mengikat muatan negatif resin penukar ion. Teknik ini memungkinkan
penentuan asam amino apa saja yang terdapat dalam protein tertentu.
Kelimpahan relatif asam-asam amino juga bisa ditentukan dengan
mengukur konsentrasi tiap asam amino. Senyawa ninhidrin bereaksi
dengan asam amino membentuk warna ungu. Larutan berwarna
ungu ini diukur absorbansinya pada panjang gelombang 570 nm, lalu
konsentrasi relatif tiap asam amino dapat ditentukan.
Reaksi asam amino dengan ninhidrin:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 54
A
b
s
o
r
b
a
n
s

Reaksi asam amino dengan ninhidrin:
O
O
OH
OH
2
+ R C
H
NH
3
COO
-
C
C
C
O
O
N C
C
C
O
O
-
+ R C H
O
+ CO
2
+
Pigmen ungu
Ninhidrin Asam amino
3H
2
O
Asam amino prolin tidak memberikan warna ungu ketika direaksikan
dengan ninhidrin, melainkan warna kuning muda yang juga dapat dikuantisasi.
Prolin dapat langsung ditemukan dalam kromatogram selama analisis asam
amino karena tinggi relatif absorban pada panjang gelombang 570 nm
merupakan kebalikan pada panjang gelombang 440 nm dibandingkan dengan
asam-asam amino lainnya.
Gambar 2-4 Pemisahan asam amino menggunakan kromatografi penukar ion. Luas
puncak adalah proporsional dengan jumlah asam amino dalam larutan.
Asp
Thr
Pro
Gly
Ser
Cys
Val
Ala
Glu
Met
Leu
Ile
Tyr
Phe
His
Lys
Arg
NH3
0,2 M sitrat, pH 3,3 0,2 M sitrat, pH 4,3 0,35 M sitrat, pH 5,3
1,0
Volume eluen
0
Asam amino prolin tidak memberikan warna ungu ketika
direaksikan dengan ninhidrin, melainkan warna kuning muda yang
juga dapat dikuantisasi. Prolin dapat langsung ditemukan dalam
kromatogram selama analisis asam amino karena tinggi relatif absorban
Bab 2 Asam Amino dan Peptida 57
pada panjang gelombang 570 nm merupakan kebalikan pada panjang
gelombang 440 nm dibandingkan dengan asam-asam amino lainnya.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 54
A
b
s
o
r
b
a
n
s

Reaksi asam amino dengan ninhidrin:
O
O
OH
OH
2
+ R C
H
NH
3
COO
-
C
C
C
O
O
N C
C
C
O
O
-
+ R C H
O
+ CO
2
+
Pigmen ungu
Ninhidrin Asam amino
3H
2
O
Asam amino prolin tidak memberikan warna ungu ketika direaksikan
dengan ninhidrin, melainkan warna kuning muda yang juga dapat dikuantisasi.
Prolin dapat langsung ditemukan dalam kromatogram selama analisis asam
amino karena tinggi relatif absorban pada panjang gelombang 570 nm
merupakan kebalikan pada panjang gelombang 440 nm dibandingkan dengan
asam-asam amino lainnya.
Gambar 2-4 Pemisahan asam amino menggunakan kromatografi penukar ion. Luas
puncak adalah proporsional dengan jumlah asam amino dalam larutan.
Asp
Thr
Pro
Gly
Ser
Cys
Val
Ala
Glu
Met
Leu
Ile
Tyr
Phe
His
Lys
Arg
NH
3
0,2 M sitrat, pH 3,3 0,2 M sitrat, pH 4,3 0,35 M sitrat, pH 5,3
1,0
Volume eluen
0
Gambar 2-4 Pemisahan asam amino menggunakan kromatografi
penukar ion. Luas puncak adalah proporsional dengan jumlah asam
amino dalam larutan.
4. IKATAN PEPTIDA
Dalam molekul peptida, asam-asam a-amino dihubungkan secara
linear. Gugus a-karboksil pada satu asam amino dihubungkan dengan
gugus a-amino pada asam amino berikutnya melalui suatu ikatan
amida yang dikenal sebagai ikatan peptida. Pembentukan unit peptida
bentuk trans lebih disukai dibanding bentuk cis, karena bentuk cis
memiliki efek sterik. Panjang-panjang ikatan pada unit peptida adalah
sebagai berikut.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 55
4. IKATAN PEPTIDA
Dalam molekul peptida, asam-asam -amino dihubungkan secara
linear. Gugus -karboksil pada satu asam amino dihubungkan dengan gugus
-amino pada asam amino berikutnya melalui suatu ikatan amida yang dikenal
sebagai ikatan peptida. Pembentukan unit peptida bentuk trans lebih disukai
dibanding bentuk cis, karena bentuk cis memiliki efek sterik. Panjang-panjang
ikatan pada unit peptida adalah sebagai berikut.
Ikatan peptida terbentuk oleh reaksi kondensasi, yang memerlukan
pemasukan energi:
NH
3
+
CH
2
COO
-
NH
3
+
CH COO
-
CH
3
NH
3
+
CH
2
C
O
N
H
CH
CH
3
COO
-
H
2
O
H
2
O
+
Glisin
Alanin Glisilalanin
Bentuk trans
Bentuk cis
lebih disukai
tidak disukai
BIOKIMIA: Struktur dan Fungsi Biomolekul 58
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 55
4. IKATAN PEPTIDA
Dalam molekul peptida, asam-asam -amino dihubungkan secara
linear. Gugus -karboksil pada satu asam amino dihubungkan dengan gugus
-amino pada asam amino berikutnya melalui suatu ikatan amida yang dikenal
sebagai ikatan peptida. Pembentukan unit peptida bentuk trans lebih disukai
dibanding bentuk cis, karena bentuk cis memiliki efek sterik. Panjang-panjang
ikatan pada unit peptida adalah sebagai berikut.
Ikatan peptida terbentuk oleh reaksi kondensasi, yang memerlukan
pemasukan energi:
NH
3
+
CH
2
COO
-
NH
3
+
CH COO
-
CH
3
NH
3
+
CH
2
C
O
N
H
CH
CH
3
COO
-
H
2
O
H
2
O
+
Glisin
Alanin Glisilalanin
Bentuk trans
Bentuk cis
lebih disukai
tidak disukai
Ikatan peptida terbentuk oleh reaksi kondensasi, yang memerlukan
pemasukan energi:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 55
4. IKATAN PEPTIDA
Dalam molekul peptida, asam-asam -amino dihubungkan secara
linear. Gugus -karboksil pada satu asam amino dihubungkan dengan gugus
-amino pada asam amino berikutnya melalui suatu ikatan amida yang dikenal
sebagai ikatan peptida. Pembentukan unit peptida bentuk trans lebih disukai
dibanding bentuk cis, karena bentuk cis memiliki efek sterik. Panjang-panjang
ikatan pada unit peptida adalah sebagai berikut.
Ikatan peptida terbentuk oleh reaksi kondensasi, yang memerlukan
pemasukan energi:
NH
3
+
CH
2
COO
-
NH
3
+
CH COO
-
CH
3
NH
3
+
CH
2
C
O
N
H
CH
CH
3
COO
-
H
2
O
H
2
O
+
Glisin
Alanin Glisilalanin
Bentuk trans
Bentuk cis
lebih disukai
tidak disukai
Pembentukan ikatan-ikatan peptida dalam membentuk suatu
rangkaian protein tertentu membentuk suatu pola sebagai berikut:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 56
Pembentukan ikatan-ikatan peptida dalam membentuk suatu rangkaian
protein tertentu membentuk suatu pola sebagai berikut:
Karakter asam dan basa pada gugus amino dan karboksil terlibat
dalam pembentukan ikatan. Karakter-karakter ini menghilang setelah
kondensasi. Hidrolisis ikatan peptida untuk melepaskan asam-asam amino
merupakan proses spontan, tetapi biasanya berlangsung sangat lambat dalam
larutan netral.
Penamaan peptida dimulai dengan asam amino yang memiliki -NH
3
+
bebas (ujung N) dengan menggantikan akhiran in menjadi il (kecuali asam
amino yang terakhir). Asam amino dalam suatu peptida disebut sebagai residu,
karena asam-asam amino ini adalah residu yang tertinggal setelah hilangnya air
selama pembentukan ikatan peptida.
Cara membedakan antara dipeptida glisilalanin dan alanilglisin adalah
dengan cara penamaan peptida dimulai dari ujung amino. Dengan demikian,
glisilalanin memiliki gugus -amino bebas pada residu glisin, dan gugus
karboksil bebas pada residu alanin. Glisilalanin dan alanilglisin merupakan
contoh isomer urutan, yakni terdiri atas asam-asam amino yang sama tetapi
tersusun dalam urutan yang berbeda.
Senyawa yang terdiri atas dua molekul asam amino yang dihubungkan
oleh ikatan peptida disebut sebagai dipeptida; sedangkan yang terdiri atas tiga
asam amino disebut tripeptida; dan seterusnya. Oligopeptida mengandung
beberapa residu asam amino, sedangkan polipeptida mengandung sejumlah
besar asam amino. Polipeptida alami yang terdiri atas 50 residu atau lebih
disebut sebagai protein.
Karakter asam dan basa pada gugus amino dan karboksil terlibat
dalam pembentukan ikatan. Karakter-karakter ini menghilang setelah
kondensasi. Hidrolisis ikatan peptida untuk melepaskan asam-asam
Bab 2 Asam Amino dan Peptida 59
amino merupakan proses spontan, tetapi biasanya berlangsung sangat
lambat dalam larutan netral.
Penamaan peptida dimulai dengan asam amino yang memiliki a-
NH3
+
bebas (ujung N) dengan menggantikan akhiran in menjadi il
(kecuali asam amino yang terakhir). Asam amino dalam suatu peptida
disebut sebagai residu, karena asam-asam amino ini adalah residu yang
tertinggal setelah hilangnya air selama pembentukan ikatan peptida.
Cara membedakan antara dipeptida glisilalanin dan alanilglisin
adalah dengan cara penamaan peptida dimulai dari ujung amino.
Dengan demikian, glisilalanin memiliki gugus a-amino bebas pada
residu glisin, dan gugus karboksil bebas pada residu alanin. Glisilalanin
dan alanilglisin merupakan contoh isomer urutan, yakni terdiri atas
asam-asam amino yang sama tetapi tersusun dalam urutan yang
berbeda.
Senyawa yang terdiri atas dua molekul asam amino yang
dihubungkan oleh ikatan peptida disebut sebagai dipeptida; sedangkan
yang terdiri atas tiga asam amino disebut tripeptida; dan seterusnya.
Oligopeptida mengandung beberapa residu asam amino, sedangkan
polipeptida mengandung sejumlah besar asam amino. Polipeptida
alami yang terdiri atas 50 residu atau lebih disebut sebagai protein.
5. RANTAI POLIPEPTIDA
Ke-20 asam amino secara umum memiliki atom karbon pusat (Ca)
yang mengikat satu atom hidrogen, gugus amino (NH2), dan gugus
karboksil (COOH). Yang membedakan satu asam amino dari yang
lainnya yakni rantai samping yang menempel pada Ca melalui
valensinya yang ke-empat. Terdapat 20 macam rantai samping yang
ditentukan oleh kode genetik; sedangkan yang lainnya terdapat sangat
langka sebagai produk dari modifikasi enzimatik setelah translasi.
Asam-asam amino tersambung ujung ke ujung selama sintesis
protein dengan pembentukan ikatan polipeptida pada saat gugus
karboksil di satu asam amino bergabung dengan gugus amino di asam
amino berikutnya dengan menghilangkan air (Gambar 2.5). Proses
BIOKIMIA: Struktur dan Fungsi Biomolekul 60
ini diulang-ulang seiring dengan bertambah panjangnya rantai. Salah
satu akibatnya, gugus amino pada asam amino pertama di suatu rantai
polipeptida dan gugus karboksil pada asam amino terakhir tetap utuh,
dan rantai tersebut dikatakan memanjang dari ujung amino ke ujung
karboksilnya. Pembentukan ikatan-ikatan peptida menghasilkan suatu
rantai utama atau tulang punggung di mana terdapat berbagai
macam rantai samping.
Atom-atom rantai utama adalah atom karbon Ca tempat
menempelnya rantai samping, satu gugus NH terikat pada Ca, dan satu
gugus karbonil C=O dengan atom karbon C menempel pada Ca. Unit
atau residu ini terikat ke dalam suatu polipeptida oleh ikatan peptida antara
atom C di satu residu dan atom nitrogen di residu berikutnya. Dengan
demikian, unit pengulangan dasar sepanjang rantai utama menurut sudut
pandang biokimia atau genetika yakni (NH-CaH-C=O), yang merupakan
residu dari asam amino pada umumnya setelah ikatan peptida terbentuk
(lihat Gambar 2.5).
Asam amino biasanya dibagi ke dalam tiga kelompok yang
ditentukan oleh sifat kimiawi rantai sampingnya. Kelompok pertama
terdiri atas asam-asam amino yang memiliki rantai samping hidrofob:
Ala (A), Val (V), Leu (L), Ile (I), Phe (F), Pro (P), dan Met (M). Empat
residu bermuatan, Asp (D), Glu (E), Lys (K), dan Arg (R), membentuk
kelompok kedua. Kelompok ketiga terdiri atas asam-asam amino yang
memiliki rantai samping polar: Ser (S), Thr (T), Cys (C), Asn (N), Gln
(Q), His (H), Tyr (Y), and Trp (W). Asam amino glisin (G), yang rantai
sampingnya hanyalah sebuah atom hidrogen sehingga merupakan asam
amino yang paling sederhana, memiliki sifat-sifat khusus dan biasanya
dianggap membentuk kelompok keempat atau masuk kelompok
pertama.
Terdapat cara mudah untuk mengingat kode satu huruf asam
amino. Jika hanya satu asam amino dimulai dengan huruf tertentu,
huruf itu yang digunakan:
C = Cys = Sistein
H = His = Histidin
I = Ile = Isoleusin
Bab 2 Asam Amino dan Peptida 61
M = Met = Metionin
S = Ser = Serin
V = Val = Valin
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 58
Gambar 2-5 Protein dibangun oleh asam amino yang dihubungkan oleh ikatan peptida
untuk membentuk rantai polipeptida. Atom karbon pusat (C-alpha)
menempel pada gugus amino (NH
2
), gugus karboksil (COOH), atom
hidrogen (H), dan rantai samping (R). Dalam rantai polipeptida gugus
karboksil dari asam amino n membentuk ikatan peptida, C-N, pada gugus
amino dari asam amino n + 1. Satu molekul air dihilangkan dalam proses
ini. Unit-unit berulang, yang disebut residu, dibagi menjadi atom-atom
rantai utama dan rantai samping. Bagian rantai utama, yang sama persis
dalam semua residu, memiliki atom C-alpha pusat menempel pada gugus
NH, gugus C=O, dan atom H. Rantai samping R, yang berbeda pada
residu yang berbeda pula, terikat pada atom C-alpha.
Asam amino biasanya dibagi ke dalam tiga kelompok yang ditentukan
oleh sifat kimiawi rantai sampingnya. Kelompok pertama terdiri atas asam-
asam amino yang memiliki rantai samping hidrofob: Ala (A), Val (V), Leu (L), Ile
(I), Phe (F), Pro (P), dan Met (M). Empat residu bermuatan, Asp (D), Glu (E),
Lys (K), dan Arg (R), membentuk kelompok kedua. Kelompok ketiga terdiri atas
asam-asam amino yang memiliki rantai samping polar: Ser (S), Thr (T), Cys
(C), Asn (N), Gln (Q), His (H), Tyr (Y), and Trp (W). Asam amino glisin (G),
yang rantai sampingnya hanyalah sebuah atom hidrogen sehingga merupakan
asam amino yang paling sederhana, memiliki sifat-sifat khusus dan biasanya
dianggap membentuk kelompok keempat atau masuk kelompok pertama.
Terdapat cara mudah untuk mengingat kode satu huruf asam amino.
Jika hanya satu asam amino dimulai dengan huruf tertentu, huruf itu yang
digunakan:
C = Cys = Sistein
H = His = Histidin
I = Ile = Isoleusin
M = Met = Metionin
S = Ser = Serin
Ikatan
peptida
Gambar 2-5 Protein dibangun oleh asam amino yang dihubungkan
oleh ikatan peptida untuk membentuk rantai polipeptida. Atom karbon
pusat (C-alpha) menempel pada gugus amino (NH
2
), gugus karboksil
(COOH), atom hidrogen (H), dan rantai samping (R). Dalam rantai
polipeptida gugus karboksil dari asam amino n membentuk ikatan
peptida, C-N, pada gugus amino dari asam amino n + 1. Satu molekul
air dihilangkan dalam proses ini. Unit-unit berulang, yang disebut
residu, dibagi menjadi atom-atom rantai utama dan rantai samping.
Bagian rantai utama, yang sama persis dalam semua residu, memiliki
atom C-alpha pusat menempel pada gugus NH, gugus C=O, dan atom
H. Rantai samping R, yang berbeda pada residu yang berbeda pula,
terikat pada atom C-alpha.
Jika lebih dari satu asam amino dimulai dengan huruf tertentu, huruf
itu dipakai untuk asam amino yang paling banyak terdapat:
A = Ala = Alanin
G = Gly = Glisin
L = Leu = Leusin
BIOKIMIA: Struktur dan Fungsi Biomolekul 62
P = Pro = Prolin
T = Thr = Treonin
Beberapa merupakan huruf bunyi:
F = Phe = Fenilalanin
R = Arg = Arginin
Y = Tyr = Tirosin
W = Trp = Triptofan

Yang lainnya, huruf yang dekat dengan inisial digunakan. Amida
memiliki huruf dari tengah alphabet. Molekul yang lebih kecil (D, N,
B) di awal alphabet daripada molekul yang lebih besar (E, Q, Z).
D = Asp = Asam aspartat
N = Asn = Asparagin
B = Asx = Bukan D atau N
E = Glu = Asam Glutamat
Q = Gln = Glutamin
Z = Glx = Bukan E atau Q
K = Lys = Lisin
X = X = Asam amino yang belum ditentukan
Pada gambar 2.5 menunjukkan salah satu cara untuk memisahkan
rantai-rantai polipeptida, yang merupakan cara yang digunakan para
ahli biokimia. Ada juga cara lain untuk memisahkan rantai utama
menjadi unit-unit berulang, yang dipilih ketika kita ingin menjelaskan
sifat struktur protein. Untuk tujuan ini, lebih baik membagi rantai
polipeptida menjadi unit-unit peptida yang dimulai dari satu atom Ca
ke atom Ca berikutnya (lihat Gambar 2.6). Setiap atom Ca, kecuali
yang pertama dan terakhir, masuk ke dalam dua unit peptida. Alasan
mengapa membagi rantai dengan cara ini yakni semua atom dalam
unit peptida terletak pada bidang datar dengan panjang ikatan dan
sudut ikatan yang sangat mendekati serupa dalam semua unit di semua
protein. Perhatikan bahwa unit-unit peptida pada rantai utama tidak
mengindahkan rantai samping yang berbeda (Gambar 2.6). Kita akan
Bab 2 Asam Amino dan Peptida 63
menggunakan kedua alternatif penjelasan rantai polipeptida yakni
biokimia dan struktur dan membahas protein dalam arti urutan asam
amino yang berbeda dan urutan unit-unit peptida planar.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 60
yang berbeda (Gambar 2.6). Kita akan menggunakan kedua alternatif
penjelasan rantai polipeptida yakni biokimia dan struktur dan membahas
protein dalam arti urutan asam amino yang berbeda dan urutan unit-unit peptida
planar.
Gambar 2-6 Bagian dari rantai polipeptida yang dibagi menjadi unit-unit peptida,
digambarkan sebagai balok dalam diagram. Tiap unit peptida
mengandung atom C

dan gugus C=Opada residu n dan gugus NH dan


atom C

pada residu n + 1. Setiap unit seperti ini adalah gugus planar


dan kaku dengan jarak ikatan dan sudut ikatan yang diketahui. R
1
, R
2
,
dan R
3
adalah rantai samping yang menempel pada atom C

yang
menghubungkan unit-unit peptida dalam rantai polipeptida. Gugus
peptida berbentuk planar karena tambahan pasangan electron dari
ikatan C=O didelokalisasi pada gugus peptida sehingga rotasi keliling
ikatan C-N dicegah oleh suatu penghalang energi.
Karena unit-unit peptida merupakan gugus yang bersifat kaku yang
terikat pada rantai oleh ikatan kovalen pada atom C

, maka satu-satunya
derajat kebebasan yang dimiliki yakni rotasi mengelilingi ikatan ini. Setiap unit
dapat berotasi mengelilingi dua ikatan serupa: ikatan C

-C dan ikatan N-C

(Gambar 2.7). Sesuai konvensi, sudut rotasi keliling ikatan N-C

disebut phi ()
dan sudut keliling ikatan C

-C dari atom C

yang sama disebut psi ().


Dengan cara ini,tiap residu asam amino dihubungkan dengan dua sudut
konformasi dan . karena merupakan satu- satunya derajat kebebasan,
konformasi keseluruhan rantai utama polipeptida ditentukan apabila sudut
dan untuk tiap asam amino ditentukan dengan akurasi tinggi.
Ikatan Peptida
Gambar 2-6. Bagian dari rantai polipeptida yang dibagi menjadi unit-
unit peptida, digambarkan sebagai balok dalam diagram. Tiap unit
peptida mengandung atom Ca dan gugus C=Opada residu n dan gugus
NH dan atom Ca pada residu n + 1. Setiap unit seperti ini adalah gugus
planar dan kaku dengan jarak ikatan dan sudut ikatan yang diketahui.
R
1
, R
2
, dan R
3
adalah rantai samping yang menempel pada atom Ca
yang menghubungkan unit-unit peptida dalam rantai polipeptida. Gugus
peptida berbentuk planar karena tambahan pasangan electron dari
ikatan C=O didelokalisasi pada gugus peptida sehingga rotasi keliling
ikatan C-N dicegah oleh suatu penghalang energi.
Karena unit-unit peptida merupakan gugus yang bersifat kaku
yang terikat pada rantai oleh ikatan kovalen pada atom Ca, maka
satu-satunya derajat kebebasan yang dimiliki yakni rotasi mengelilingi
ikatan ini. Setiap unit dapat berotasi mengelilingi dua ikatan serupa:
ikatan Ca-C dan ikatan N-Ca (Gambar 2.7). Sesuai konvensi, sudut
rotasi keliling ikatan N-Cadisebut phi (a) dan sudut keliling ikatan
Ca-C dari atom Ca yang sama disebut psi (a).
BIOKIMIA: Struktur dan Fungsi Biomolekul 64
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 61
Gambar 2-7 Diagram menunjukkan rantai polipeptida di mana atom-atom rantai
utama digambarkan sebagai unit peptida kaku, dihubungkan melalui
atom-atom C

. Tiap unit memiliki dua derajat kebebasan; yakni bisa


berotasi mengelilingi dua ikatan, ikatan C

-C dan ikatan N-C

. Sudut
rotasi keliling N-C

disebut phi () dan keliling ikatan C

-C disebut psi
(). Konformasi atom-atom rantai utama ditentukan oleh nilai kedua
sudut ini untuk tiap asam amino.
Residu glisin dapat membentuk berbagai macam konformasi
Kebanyakan, kombinasi sudut dan untuk suatu asam amino tidak
diperbolehkan dikarenakan halangan sterik antara rantai samping dan rantai
utama. Dengan demikian bisa langsung dihitung kombinasi yang
diperbolehkan. Karena bentuk D- dan L- asam amino mempunyai orientasi
rantai samping yang berbeda dalam kaitannya dengan gugus CO, maka
Gambar 2-7 Diagram menunjukkan rantai polipeptida di mana
atom-atom rantai utama digambarkan sebagai unit peptida kaku,
dihubungkan melalui atom-atom Ca. Tiap unit memiliki dua derajat
kebebasan; yakni bisa berotasi mengelilingi dua ikatan, ikatan Ca-
C dan ikatan N-Ca. Sudut rotasi keliling N-Ca disebut phi (f) dan
keliling ikatan Ca-C disebut psi (y). Konformasi atom-atom rantai
utama ditentukan oleh nilai kedua sudut ini untuk tiap asam amino.
Dengan cara ini, tiap residu asam amino dihubungkan dengan
dua sudut konformasi f dan y. karena merupakan satu- satunya
derajat kebebasan, konformasi keseluruhan rantai utama polipeptida
ditentukan apabila sudut f dan y untuk tiap asam amino ditentukan
dengan akurasi tinggi.
Bab 2 Asam Amino dan Peptida 65
Residu glisin dapat membentuk berbagai macam konformasi
Kebanyakan, kombinasi sudut j dan y untuk suatu asam amino
tidak diperbolehkan dikarenakan halangan sterik antara rantai
samping dan rantai utama. Dengan demikian bisa langsung dihitung
kombinasi yang diperbolehkan. Karena bentuk D- dan L- asam amino
mempunyai orientasi rantai samping yang berbeda dalam kaitannya
dengan gugus CO, maka keduanya memiliki perbedaan sudut j dan y
yang diperbolehkan. Protein yang dibangun dari D-asam amino akan
mempunyai konformasi yang berbeda dari protein yang ditemukan
di alam yang terbuat dari L-asam amino. Karena bentuk L- dan D-
setiap asam amino merupakan bayangan cermin satu sama lain, apakah
protein yang dibuat dari residu bentuk D- akan membentuk struktur
yang merupakan bayangan cermin dari protein alami? Stephen Kent
dan kawan-kawan di Scripps Institute mensintesis bentuk L- serta
D- dari HIV-1 protease. Enzim D- terbukti persis sebagai bayangan
cermin dari enzim L-. Lebih lanjut, enzim D- dan enzim L- memiliki
spesifisitas kiral yang bertolak belakang pada substrat peptida, enzim
D- hanya mengenali dan memotong peptida yang terbuat dari D-
asam amino. Mungkin pemilihan bentuk L- ketika evolusi terjadi pada
kehidupan di bumi adalah pemilihan secara acak dan irrevocable.
Pasangan sudut j dan y biasanya diplotkan dalam suatu diagram
yang disebut sebagai plot Ramachandran, yang namanya diambil dari
biofisikawan India, G.N. Ramachandran, yang pertama kali membuat
perhitungan daerah-daerah yang diperbolehkan secara sterik. Gambar
2.8 menunjukkan hasil perhitungan seperti ini serta plot untuk semua
asam amino kecuali glisin, yang diambil dari sejumlah protein yang
telah ditentukan strukturnya dengan akurat. Tampak bahwa nilai-nilai
yang diamati berkelompok di daerah yang diperbolehkan secara sterik.
Terdapat satu pengecualian penting. Glisin, dengan hanya satu atom
hidrogen sebagai rantai sampingnya, bisa memiliki jauh lebih banyak
konformasi daripada residu lainnya, seperti terlihat dalam Gambar
2.8c. Karena itu glisin memiliki peran struktur yang sangat penting;
yakni memperbolehkan terjadinya konformasi-konformasi rantai
BIOKIMIA: Struktur dan Fungsi Biomolekul 66
utama langka dalam protein. Inilah satu alasan utama mengapa banyak
residu glisin yang ada sepanjang urutan protein homolog.
Daerah-daerah dalam plot Ramachandran dinamai sesuai dengan
konformasi yang dihasilkan dalam suatu peptida jika sudut j dan y
yang sesuai diulang dalam asam-asam amino sepanjang rantai. Daerah
utama yang diperbolehkan dalam Gambar 2.8a adalah kelompok
a-heliks tangan kanan, di kuadran kiri bawah; daerah luas untuk untai
beta yang dipanjangkan baik struktur beta paralel maupun antiparalel
di kuadran kiri atas; serta daerah kecil yang merupakan kumpulan a-
heliks tangan kiri di kuadran kanan atas. a-heliks tangan kiri biasanya
ditemukan di daaerah loop atau di heliks a putaran tunggal kecil.
Rantai-rantai samping ke-20 macam asam amino memiliki sifat
kimia yang sangat berbeda dan digunakan untuk berbagai macam fungsi
biologis. Namun keragaman sifat kimia ini juga terbatas, dan untuk
beberapa fungsi atom logam lebih cocok dan lebih efisien. Reaksi transfer
elektron merupakan satu contoh penting. Untungnya, rantai samping
histidin, sistein, asam aspartat, dan asam glutamat adalah ligan logam
yang baik, dan cukup banyak jumlah protein yang memakai atom logam
sebagai bagian intrinsik strukturnya; logam-logam yang sering digunakan
antara lain besi, seng, magnesium, dan kalsium.
Penggunaan besi yang paling penting dalam sistem biologis yakni
dalam darah kita, di mana eritrosit dipenuhi oleh protein pengikat
oksigen, hemoglobin. Warna merah darah disebabkan oleh atom besi
yang terikat pada gugus heme dalam hemoglobin. Atom besi terikat
heme yang serupa terdapat dalam sejumlah protein yang terlibat dalam
reaksi transfer elektron, terutama sitokrom. Penggunaan besi juga
ditemukan pada enzim ribonukleotida reduktase yang mengkatalisis
konversi ribonukleotida menjadi deoksiribonukleotida, yang merupa-
kan langkah penting dalam sintesis penyusun DNA.
Bab 2 Asam Amino dan Peptida 67
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 63
yang merupakan kumpulan -heliks tangan kiri di kuadran kanan atas. -heliks
tangan kiri biasanya ditemukan di daaerah loop atau di heliks putaran tunggal
kecil.
Gambar 2-8 Plot Ramachandran menunjukkan kombinasi yang diperbolehkan untuk
sudut konformasi phi dan psi. Karena phi () dan psi () menunjukkan
rotasi dua unit peptida kaku mengelilingi atom C

yang sama,
kebanyakan kombinasi menghasilkan halangan sterik antara atom-atom
dalam gugus peptida berbeda maupun antara unit peptida dengan rantai
samping yang menempel pada C

. Kombinasi ini tidak diperbolehkan.


(a) Daerah berwarna menunjukkan daerah yang diperbolehkan secara
sterik. Area yang diberi label , , dan L menunjukkan perkiraan sudut
konformasi yang ditemukan untuk heliks tangan kanan, untai , dan
heliks tangan kiri. (b) Nilai-nilai yang diamati untuk semua tipe residu
kecuali glisin. Tiap titik menunjukkan nilai dan untuk satu residu
asam amino dalam struktur sinar-x yang beresolusi tinggi. (c) Nilai yang
diamati untuk glisin. Perhatikan bahwa nilai termasuk kombinasi dan
yang tidak diperbolehkan untuk asam amino lainnya.
Gambar 2-8 Plot Ramachandran menunjukkan kombinasi yang
diperbolehkan untuk sudut konformasi phi dan psi. Karena phi (f) dan
psi (y) menunjukkan rotasi dua unit peptida kaku mengelilingi atom
Ca yang sama, kebanyakan kombinasi menghasilkan halangan sterik
antara atom-atom dalam gugus peptida berbeda maupun antara unit
peptida dengan rantai samping yang menempel pada Ca. Kombinasi
ini tidak diperbolehkan. (a) Daerah berwarna menunjukkan daerah
yang diperbolehkan secara sterik. Area yang diberi label a, b, dan L
menunjukkan perkiraan sudut konformasi yang ditemukan untuk a heliks
tangan kanan, untai b, dan a heliks tangan kiri. (b) Nilai-nilai yang
diamati untuk semua tipe residu kecuali glisin. Tiap titik menunjukkan
nilai f dan y untuk satu residu asam amino dalam struktur sinar-x yang
beresolusi tinggi. (c) Nilai yang diamati untuk glisin. Perhatikan bahwa
nilai termasuk kombinasi f dan y yang tidak diperbolehkan untuk asam
amino lainnya.
BIOKIMIA: Struktur dan Fungsi Biomolekul 68
Ribonukleotida reduktase dari Escherichia coli dan mamalia
mengandung pusat di-besi (Gambar 2.9) yang bereaksi dengan oksigen
dan mengoksidasi rantai samping tirosin di dekatnya, menghasilkan
radikal bebas tirosil yang sangat penting untuk katalisis. Kedua atom
besi di pusat besi terletak berdekatan satu sama lain dan dijembatani
oleh atom-atom oksigen dari rantai samping asam glutamat serta juga
oleh satu ion oksigen yang disebut sebagai jembatan m-okso. Sama
seperti molekul air, rantai samping asam glutamat, asam aspartat, dan
histidin pada protein tersebut melengkapi ruang koordinasi pada atom
besi yang berkoordinasi oktahedral.
Seng digunakan untuk menstabilkan daerah ikatan DNA pada
kelompok faktor transkripsi yang disebut jari seng. Ion-ion seng juga
terlibat langsung dalam reaksi katalisis di berbagai enzim dengan
cara mengikat molekul substrat dan menyediakan muatan positif
yang mempengaruhi susunan elektronik pada substrat sehingga
mempermudah reaksi katalisis. Salah satu contoh seperti ini ditemukan
dalam enzim alkohol dehidrogenase, yang dalam ragi memproduksi
alkohol selama fermentasi dan dalam hati kita mendetoksifikasi
alkohol yang telah kita konsumsi dengan cara mengoksidasinya. Enzim
ini menyediakan suatu penopang yang terdiri atas tiga ligan seng
satu rantai samping histidin dan dua rantai samping sistein yang
meninggalkan satu atom seng untuk mengikat alkohol sebagai ligan
keempat dalam koordinasi tetrahedral (Gambar 2.9b).
6. REAKSI SISTEIN
Dua residu sistein di bagian yang berbeda pada rantai polipeptida,
tetapi berdekatan dalam struktur tiga dimensi protein, bisa dioksidasi
untuk membentuk suatu jembatan disulfida (Gambar 2.10). Disulfida
ini biasanya merupakan produk akhir dari oksidasi udara menurut
skema reaksi berikut:
Bab 2 Asam Amino dan Peptida 69
2-CH2SH + O2 -CH2-S-S-CH2- + H2O
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 65
telah kita konsumsi dengan cara mengoksidasinya. Enzim ini menyediakan
suatu penopang yang terdiri atas tiga ligan seng satu rantai samping histidin
dan dua rantai samping sistein yang meninggalkan satu atom seng untuk
mengikat alkohol sebagai ligan keempat dalam koordinasi tetrahedral (Gambar
2.9b).
Gambar 2-9 Contoh-contoh atom logam intrinsik fungsional penting dalam protein. (a)
Pusat di-besi pada enzim ribonukleotida reduktase. Dua atom besi
membentuk pusat redoks yang menghasilkan radikal bebas dalam rantai
samping tirosin yang berdekatan. Atom-atom besi dijembatani oleh residu
asam glutamate dan atom oksigen bermuatan negatif yang disebut
sebagai jembatan -okso. Koordinasi atom besi dilengkapi oleh rantai
samping histidin, asam aspartat, dan asam glutamate serta molekul air.
(b) Atom seng yang aktif secara katalitik dalam enzim alkohol
dehidrogenase. Atom seng berkoordinasi dengan protein oleh satu rantai
samping histidin dan dua sistein. Selama katalisis, seng mengikat
molekul alcohol dalam posisi sesuai untuk transfer hidrida pada koenzim,
nikotinamid.
6. REAKSI SISTEIN
Dua residu sistein di bagian yang berbeda pada rantai polipeptida,
tetapi berdekatan dalam struktur tiga dimensi protein, bisa dioksidasi untuk
membentuk suatu jembatan disulfida (Gambar 2.10). Disulfida ini biasanya
merupakan produk akhir dari oksidasi udara menurut skema reaksi berikut:
2-CH
2
SH + O
2
-CH
2
-S-S-CH
2
- + H
2
O
A
B
Gambar 2-9 Contoh-contoh atom logam intrinsik fungsional penting
dalam protein. (a) Pusat di-besi pada enzim ribonukleotida reduktase.
Dua atom besi membentuk pusat redoks yang menghasilkan radikal
bebas dalam rantai samping tirosin yang berdekatan. Atom-atom besi
dijembatani oleh residu asam glutamate dan atom oksigen bermuatan
negatif yang disebut sebagai jembatan m-okso. Koordinasi atom besi
dilengkapi oleh rantai samping histidin, asam aspartat, dan asam
glutamate serta molekul air. (b) Atom seng yang aktif secara katalitik
dalam enzim alkohol dehidrogenase. Atom seng berkoordinasi dengan
protein oleh satu rantai samping histidin dan dua sistein. Selama
katalisis, seng mengikat molekul alcohol dalam posisi sesuai untuk transfer
hidrida pada koenzim, nikotinamid.
Reaksi ini membutuhkan suatu lingkungan oksidatif, dan jembatan
disulfida ini biasanya tidak detemukan dalam protein intrasel, yang
menghabiskan umurnya dalam lingkungan reduktif yang esensial. Akan
tetapi, jembatan disulfida terdapat cukup banyak pada protein ekstrasel
yang dikeluarkan dari sel, dan dalam eukariot, pembentukan jembatan
ini terjadi di dalam lumen retikulum endoplasma, kompartemen pertama
pada jalur pengeluaran.
Jembatan disulfida menstabilkan struktur tiga dimensi. Pada beberapa
protein, jembatan ini mengikat rantai-rantai polipeptida yang berbeda;
misalnya, rantai A dan B pada insulin dihubungkan oleh dua jembatan
disulfida di antara rantai-rantai tersebut. Lebih banyak jembatan disulfida
BIOKIMIA: Struktur dan Fungsi Biomolekul 70
intramolekul yang menstabilkan lipatan suatu rantai polipeptida tunggal,
maka protein tersebut makin susah untuk degradasi. Terdapat banyak
contoh hal ini, termasuk protein yang rantai polipeptidanya pendek,
seperti racun bisa ular dan inhibitor protease, yang membutuhkan faktor
penstabil tambahan untuk mendapatkan lipatan yang stabil. Saat ini banyak
usaha yang dilakukan untuk menempatkan tambahan jembatan disulfida
intramolekul ke dalam enzim dengan cara site-directed mutagenesis, dalam
rangka membuat enzim lebih termostabil sehingga lebih berguna untuk
penerapan industri sebagai katalis.
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 67
Gambar 2-10 Disulfide biasanya merupakan produk akhir dari oksidasi udara menurut
skema reaksi skematik berikut:
2-CH
2
SH + O
2
-CH
2
-S-S-CH
2
- + H
2
O
Ikatan disulfida terbentuk antara rantai-rantai samping dua residu
sistein. Dua gugus SH dari residu sistein, yang bisa jadi dalam bagian
yang berbeda pada urutan asam amino tetapi berdekatan dalam struktur
tiga dimensi, dioksidasi untuk membentuk satu gugus S-S (disulfida).
Jembatan disulfida sering ditemukan dalam struktur tertier protein,
yakni jika rantai samping sistein cukup dekat untuk membentuk suatu jembatan.
Selain itu, oksidasi gugus SH bebas pada permukaan protein tertentu dapat
menyebabkan dua molekul berbeda menjadi berikatan kovalen karena
terbentuknya jembatan disulfida. Ini merupakan proses yang tak diinginkan
dalam tubuh, karenanya sel seringkali mengandung zat pereduksi yang
mencegah atau membalikkan reaksi tersebut. Zat pereduksi yang paling umum
adalah glutation yang mampu mereduksi disulfida teroksidasi kembali menjadi
sistein
sistein
oksidasi
reduksi
sistin
Ikatan disulfida
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 66
Reaksi ini membutuhkan suatu lingkungan oksidatif, dan jembatan
disulfida ini biasanya tidak detemukan dalam protein intrasel, yang
menghabiskan umurnya dalam lingkungan reduktif yang esensial. Akan tetapi,
jembatan disulfida terdapat cukup banyak pada protein ekstrasel yang
dikeluarkan dari sel, dan dalam eukariot, pembentukan jembatan ini terjadi di
dalam lumen retikulum endoplasma, kompartemen pertama pada jalur
pengeluaran.
Jembatan disulfida menstabilkan struktur tiga dimensi. Pada beberapa
protein, jembatan ini mengikat rantai-rantai polipeptida yang berbeda; misalnya,
rantai A dan B pada insulin dihubungkan oleh dua jembatan disulfida di antara
rantai-rantai tersebut. Lebih banyak jembatan disulfida intramolekul yang
menstabilkan lipatan suatu rantai polipeptida tunggal, maka protein tersebut
makin susah untuk degradasi. Terdapat banyak contoh hal ini, termasuk
protein yang rantai polipeptidanya pendek, seperti racun bisa ular dan inhibitor
protease, yang membutuhkan faktor penstabil tambahan untuk mendapatkan
lipatan yang stabil. Saat ini banyak usaha yang dilakukan untuk menempatkan
tambahan jembatan disulfida intramolekul ke dalam enzim dengan cara site-
directed mutagenesis, dalam rangka membuat enzim lebih termostabil sehingga
lebih berguna untuk penerapan industri sebagai katalis.
Rantai samping sistein dapat dioksidasi membentuk asam amino sistin
yang memiliki jembatan disulfida:
NH
3
+
COO
-
CH CH
2
SH HS CH
2
CH
COO
-
NH
3
+
+
NH
3
+
COO
-
CH CH
2
S S CH
2
CH
COO
-
NH
3
+
+ H
2
O
+ 1/2 O
2
Sistin
Gambar 2-10 Disulfide biasanya merupakan produk akhir dari oksidasi
udara menurut skema reaksi skematik berikut:
Bab 2 Asam Amino dan Peptida 71
2-CH2SH + O2 -CH2-S-S-CH2- + H2O
Ikatan disulfida terbentuk antara rantai-rantai samping dua residu sistein. Dua
gugus SH dari residu sistein, yang bisa jadi dalam bagian yang berbeda pada
urutan asam amino tetapi berdekatan dalam struktur tiga dimensi, dioksidasi
untuk membentuk satu gugus S-S (disulfida).
Rantai samping sistein dapat dioksidasi membentuk asam amino
sistin yang memiliki jembatan disulfida:
Jembatan disulfida sering ditemukan dalam struktur tertier protein,
yakni jika rantai samping sistein cukup dekat untuk membentuk suatu
jembatan. Selain itu, oksidasi gugus SH bebas pada permukaan protein
tertentu dapat menyebabkan dua molekul berbeda menjadi berikatan
kovalen karena terbentuknya jembatan disulfida. Ini merupakan proses
yang tak diinginkan dalam tubuh, karenanya sel seringkali mengandung zat
pereduksi yang mencegah atau membalikkan reaksi tersebut. Zat pereduksi
yang paling umum adalah glutation yang mampu mereduksi disulfida
teroksidasi kembali menjadi bentuk sulfidril, dengan mengorbankan
dirinya sendiri untuk teroksidasi. Sel mengandung sistem pereduksi lain
dalam metabolismenya, yang kemudian dapat mereduksi kembali molekul
glutation.
Ikatan disulfida dapat diputuskan dalam laboratorium dengan
menggunakan pereaksi yang mirip seperti glutation, yakni memiliki
gugus SH bebas. Pereaksi yang paling sering dipakai adalah
merkaptoetanol, HO-CH
2
-CH
2
-SH.
Ada pereaksi lain yang lebih kuat dalam mereduksi disulfida (me-
miliki standar potensial redoks yang lebih rendah), misalnya ditiotreitol
yang memiliki dua gugus sulfidril. Oksidasi ditiotreitol menyebabkan
tertutupnya cincin lingkar sehingga menghasilkan disulfida yang sangat
stabil. Karena itu, ditiotreitol merupakan pereduksi yang lebih kuat
daripada merkaptoetanol.
BIOKIMIA: Struktur dan Fungsi Biomolekul 72
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 68
bentuk sulfidril, dengan mengorbankan dirinya sendiri untuk teroksidasi. Sel
mengandung sistem pereduksi lain dalam metabolismenya, yang kemudian
dapat mereduksi kembali molekul glutation.
Ikatan disulfida dapat diputuskan dalam laboratorium dengan
menggunakan pereaksi yang mirip seperti glutation, yakni memiliki gugus SH
bebas. Pereaksi yang paling sering dipakai adalah merkaptoetanol, HO-CH
2
-
CH
2
-SH.
Ada pereaksi lain yang lebih kuat dalam mereduksi disulfida (memiliki
standar potensial redoks yang lebih rendah), misalnya ditiotreitol yang memiliki
dua gugus sulfidril. Oksidasi ditiotreitol menyebabkan tertutupnya cincin lingkar
sehingga menghasilkan disulfida yang sangat stabil. Karena itu, ditiotreitol
merupakan pereduksi yang lebih kuat daripada merkaptoetanol.
HO CH
CH
SH
CH
2
CH
2
SH HO
HO CH
CH
S
CH
2
CH
2
S HO
+ 1/2 O
2
+ H
2
O
Ditiotreitol Tereduksi Ditiotreitol Teroksidasi
Adanya ikatan disulfida dapat menyebabkan protein tidak bisa melarut, juga
tidak bisa ditentukan urutannya. Karena itu oksidasi gugus sulfidril perlu
dicegah. Gugus SH reaktif bisa dihalangi oleh berbagai pereaksi kimia, antara
lain:
1. Iodoasetat. Pereaksi ini membentuk suatu turunan S-karboksimetil dari
residu sistein:
R SH I CH
2
+ COO
-
RS CH
2
COO
-
+ HI
2. N-Etilmaleimida. Reaksi dengan N-etilmaleimida mengakibatkan
hilangnya absorbansi pereaksi tersebut pada panjang gelombang 305
nm. Karakteristik ini bisa dimanfaatkan untuk mengukur jumlah reaksi
berikut:
Adanya ikatan disulfida dapat menyebabkan protein tidak bisa
melarut, juga tidak bisa ditentukan urutannya. Karena itu oksidasi
gugus sulfidril perlu dicegah. Gugus SH reaktif bisa dihalangi oleh
berbagai pereaksi kimia, antara lain:
1. Iodoasetat. Pereaksi ini membentuk suatu turunan S-karboksimetil
dari residu sistein:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 68
bentuk sulfidril, dengan mengorbankan dirinya sendiri untuk teroksidasi. Sel
mengandung sistem pereduksi lain dalam metabolismenya, yang kemudian
dapat mereduksi kembali molekul glutation.
Ikatan disulfida dapat diputuskan dalam laboratorium dengan
menggunakan pereaksi yang mirip seperti glutation, yakni memiliki gugus SH
bebas. Pereaksi yang paling sering dipakai adalah merkaptoetanol, HO-CH
2
-
CH
2
-SH.
Ada pereaksi lain yang lebih kuat dalam mereduksi disulfida (memiliki
standar potensial redoks yang lebih rendah), misalnya ditiotreitol yang memiliki
dua gugus sulfidril. Oksidasi ditiotreitol menyebabkan tertutupnya cincin lingkar
sehingga menghasilkan disulfida yang sangat stabil. Karena itu, ditiotreitol
merupakan pereduksi yang lebih kuat daripada merkaptoetanol.
HO CH
CH
SH
CH
2
CH
2
SH HO
HO CH
CH
S
CH
2
CH
2
S HO
+ 1/2 O
2
+ H
2
O
Ditiotreitol Tereduksi Ditiotreitol Teroksidasi
Adanya ikatan disulfida dapat menyebabkan protein tidak bisa melarut, juga
tidak bisa ditentukan urutannya. Karena itu oksidasi gugus sulfidril perlu
dicegah. Gugus SH reaktif bisa dihalangi oleh berbagai pereaksi kimia, antara
lain:
1. Iodoasetat. Pereaksi ini membentuk suatu turunan S-karboksimetil dari
residu sistein:
R SH I CH
2
+ COO
-
RS CH
2
COO
-
+ HI
2. N-Etilmaleimida. Reaksi dengan N-etilmaleimida mengakibatkan
hilangnya absorbansi pereaksi tersebut pada panjang gelombang 305
nm. Karakteristik ini bisa dimanfaatkan untuk mengukur jumlah reaksi
berikut:
2. N-Etilmaleimida. Reaksi dengan N-etilmaleimida mengakibatkan
hilangnya absorbansi pereaksi tersebut pada panjang gelombang
305 nm. Karakteristik ini bisa dimanfaatkan untuk mengukur
jumlah reaksi berikut:
Asam Amino dan Peptida
Biokimia: Struktur dan Fungsi Biomolekul 69
C
NCH
2
CH
3
C
O
O
RSH +
C
C
C
NCH
2
CH
3
C
H
H
H
S R
O
O
N-Etilmaleimida
Bab
P R O T E I N
3
1. PENGANTAR
Protein merupakan urutan linier dari residu asam-asam amino
yang terhubung melalui ikatan peptida. Ikatan peptida adalah
ikatan kovalen antara gugus-amino dari satu asam amino dan
gugus -karboksil dari asam amino dan gugus-karboksil dari asam
amino yang lain. Ikatan peptida memiliki karakter ikatan rangkap
parsial dan hampir selalu dalam konfigurasi trans. Ketika dua asam
amino digabungkan oleh ikatan peptida, mereka membentuk suatu
dipeptida. Penambahan asam amino seterusnya menghasilkan rantai
panjang yang disebut oligopeptida dan polipeptida.
Protein merupakan polipeptida alami yang memiliki berat
molekul lebih dari 5.000. Makromolekul ini sangat berbeda-beda
sifat fisiknya, mulai dari enzim yang larut dalam air sampai keratin
yang tak larut seperti rambut dan tanduk. Protein memiliki berbagai
fungsi biologis yang berbeda-beda pula, yaitu:
1. Katalis enzim. Enzim merupakan protein katalis yang mampu
meningkatkan laju reaksi sampai 10
12
kali laju awalnya.
2. Transport dan penyimpanan. Banyak ion dan molekul kecil
diangkut dalam darah maupun di dalam sel dengan cara
berikatan pada protein pengangkut. Contohnya, hemoglobin
merupakan protein pengangkut oksigen. Zat besi disimpan
dalam berbagai jaringan oleh protein ferritin.
BIOKIMIA: Struktur dan Fungsi Biomolekul 74
3. Fungsi mekanik. Protein ini menjalankan peranan sebagai pem-
bentuk struktur. Misalnya, protein kolagen menguatkan kulit,
gigi, serta tulang. Membran yang mengelilingi sel dan organel juga
mengandung protein yang berfungsi sebagai pembentuk struktur
sekaligus menjalankan fungsi biokimia lainnya.
4. Pergerakan. Kontraksi otot terjadi karena adanya interaksi antara ua
tipe protein filamen, yaitu aktin dan miosin. Miosin juga memiliki
aktivitas enzim yang dapat memudahkan perubahan energi kimia
ATP menjadi energi mekanik.
5. Pelindung. Antibodi merupakan protein yang terlibat dalam
perusakan sel asing.
6. Proses informasi. Rangsangan luar seperti sinyal hormon atau
intensitas cahaya dideteksi oleh protein tertentu yang meneruskan
sinyal ke dalam sel. Contoh protein seperti ini misalnya rodopsin
yang terdapat dalam membran sel retina.
Fungsi-fungsi protein ini berkaitan dengan struktur protein yang
masing-masing dapat melakukan ikatan spesifik dengan molekul-
molekul tertentu. Misalnya, hemoglobin mengikat oksigen, antibodi
mengikat molekul asing tertentu, enzim mengikat molekul substrat
tertentu.
2. PEMURNIAN DAN KARAKTERISASI PROTEIN
Langkah pertama dalam pemurnian protein adalah memisahkan
molekul protein dari zat terlarut lain yang memiliki berat molekul
rendah. Kemudian dilakukan beberapa derajat pemisahan protein
yang berbeda-beda, berdasarkan sifat-sifat fisik protein seperti muatan
listrik, ukuran molekul, serta kelarutan dalam berbagai macam pelarut.
Akhirnya, dilakukan proses kromatografi afinitas yang merupakan
proses pemurnian tingkat tinggi yang berdasarkan afinitas spesifik
senyawa tertentu yang berikatan dengan suatu padatan.
Bab 3 Protein 75
Molekul protein yang memiliki berat molekul lebih dari 5.000
tidak akan dapat melewati membran selofan. Permeabilitas selektif ini
merupakan dasar dari proses dialisis. Proses dialisis biasanya dilakukan
dengan menaruh larutan protein ke dalam kantung selofan lalu men-
celupkan kantung tersebut dalam larutan penyangga. Molekul-molekul
kecil akan berdifusi melewati kantung menuju larutan penyangga,
sedangkan protein tetap berada dalam kantung.
Protein-protein tertentu dapat diendapkan dari campuran ber-
macam-macam protein. Pengendapan dilakukan dengan menambahkan
zat kimia tertentu, yakni: garam netral seperti amonium sulfat (salting
out); pelarut organik seperti etanol atau aseton; atau zat pengendap
seperti asam trikloroasetat. Protein paling sedikit melarut dalam pelarut
apapun bila nilai pH sama dengan titik isoelektriknya (pHI). Pada titik
isoelektrik ini protein tidak bermuatan sehingga tolakan elektrostatik
antara molekul protein menjadi minimal. Meskipun protein bisa
saja memiliki muatan negatif sekaligus muatan positif pada titik
isoelektriknya, tetapi muatan totalnya nol.
Elektroforesis berarti pergerakan molekul protein bermuatan
listrik dalam suatu medan listrik. Prinsip elektroforesis ini dipakai
untuk memisahkan molekul-molekul protein yang berbeda. Elektro-
foresis protein menggunakan kertas atau gel poliakrilamida. Dalam
elektroforesis sering digunakan istilah anoda dan katoda yang
membingungkan. Perlu diingat bahwa anion adalah ion bermuatan
negatif. Dalam elektroforesis, anion bergerak menuju anoda.
Kromatografi penukar ion bergantung pada interaksi elektrostatik
antara protein bermuatan dengan partikel resin penukar ion yang
muatannya berlawanan. Kekuatan tarik menarik antara protein dan
partikel resin tergantung pada besarnya muatan protein (juga pH
larutan) dan pada konstanta dielektrik medium. Interaksi ini bisa
dimodifikasi dengan mengatur pH larutan atau mengatur konsentrasi
garam.
Pemisahan protein berdasarkan ukuran bisa dilakukan mengguna-
kan teknik filtrasi gel. Teknik ini bergantung pada kemampuan
molekul protein untuk berdifusi ke dalam pori-pori matriks gel dalam
BIOKIMIA: Struktur dan Fungsi Biomolekul 76
suatu kolom. Bahan gel yang biasa dipakai adalah dekstran (polimer
dari glukosa) yang berbentuk butiran kecil. Bahan ini dijual dengan
nama komersial Sephadex, yang terdapat dalam berbagai ukuran pori-
pori.
Bila protein berukuran lebih besar daripada pori-pori matriks
yang terbesar, maka difusi tidak akan terjadi sehingga protein dielusi
dengan cepat. Molekul yang lebih kecil daripada pori-pori yang terkecil
akan berdifusi dengan bebas ke dalam semua partikel gel dan dielusi
belakangan, yakni setelah dialiri larutan penyangga yang volumenya
lebih besar.
Struktur dan sifat peptida maupun protein sangat tergantung
pada urutan asam amino dalam rantai peptida. Insulin adalah protein
yang pertama kali diurutkan susunan asam aminonya secara lengkap
(51 residu asam amino), yakni oleh F. Sanger di tahun 1953. Proses
pengurutan protein kini dilakukan menggunakan mesin pengurut
protein otomatis (automated protein sequencers). Identifikasi asam
amino dilakukan secara step-by-step pada ujung N protein, dengan
menggunakan proses kimia yang dikenal sebagai degradasi Edman.
Asam amino pertama dalam urutan suatu peptida (residu
ujung-N) bisa ditentukan dengan cara mereaksikan peptida dengan
fenilisotiosianat. Pada pH netral, senyawa fenilisotiosianat bereaksi
dengan gugus a-amino. Setelah dilakukan hidrolisis asam lemah, hasil
reaksi akan bersiklisasi (melingkar), dengan melepaskan residu yang
paling ujung sebagai turunan feniltiohidantoin (PTH). Seluruh proses
ini adalah proses degradasi Edman (Gambar 3-1). Turunan PTH lalu
dianalisis untuk menentukan asam amino asalnya serta kuantitasnya.
Pereaksi lain yang juga bisa digunakan untuk mengidentifikasi
ujung N antara lain dansil klorida dan fluoro-2,4-dinitrobenzen.
Senyawa-senyawa ini dapat bereaksi dengan residu ujung amino.
Bab 3 Protein 77
Protein
Biokimia: Struktur dan Fungsi Biomolekul 73
menggunakan mesin pengurut protein otomatis (automated protein
sequencers). Identifikasi asam amino dilakukan secara step-by-step pada
ujung N protein, dengan menggunakan proses kimia yang dikenal sebagai
degradasi Edman.
Asam amino pertama dalam urutan suatu peptida (residu ujung-N) bisa
ditentukan dengan cara mereaksikan peptida dengan fenilisotiosianat. Pada pH
netral, senyawa fenilisotiosianat bereaksi dengan gugus -amino. Setelah
dilakukan hidrolisis asam lemah, hasil reaksi akan bersiklisasi (melingkar),
dengan melepaskan residu yang paling ujung sebagai turunan feniltiohidantoin
(PTH). Seluruh proses ini adalah proses degradasi Edman (Gambar 3-1).
Turunan PTH lalu dianalisis untuk menentukan asam amino asalnya serta
kuantitasnya.
N C S + H
2
N C C
H
R
1
NH
O
C
H
R
2
N C N C C NH
H S H H O
R
1
C
R
2
H
N
C
C
N
C
H R
1
S
H
O
H
3
N C
H
R
2
+
Fenilisotiosianat
Feniltiohidantoin
pH netral
pH asam
Gambar 3-1 Reaksi reaksi degradasi Edman
Gambar 3-1 Reaksi reaksi degradasi Edman
Protein
Biokimia: Struktur dan Fungsi Biomolekul 74
Pereaksi lain yang juga bisa digunakan untuk mengidentifikasi ujung N antara
lain dansil klorida dan fluoro-2,4-dinitrobenzen. Senyawa-senyawa ini dapat
bereaksi dengan residu ujung amino.
N
H
3
C CH
3
S
Cl
NO
2
NO
2
F O O
Dansil klorida Fluoro-2,4-dinitrobenzen
Banyak protein yang mengandung ratusan residu asam amino,
sehingga kurang efektif bila dilakukan penentuan seluruh urutan asam
aminonya sekaligus. Hal ini dikarenakan meningkatnya ketidakpastian pada
tiap tahap pengurutan. Akan lebih mudah bila dilakukan pemotongan protein
terlebih dahulu, agar didapat potongan-potongan protein yang lebih kecil untuk
diurutkan. Selain itu, protein bisa saja mengandung jembatan disulfida yang
menghubungkan residu-residu sistein pada bagian-bagian rantai yang berbeda
atau berjauhan. Ikatan disulfida ini harus diputuskan terlebih dahulu sebelum
protein dapat diurutkan.
Salah satu cara yang sering digunakan untuk memotong polipeptida
menjadi fragmen-fragmen yang lebih kecil adalah dengan hidrolisis oleh enzim
tripsin. Tripsin adalah enzim pencernaan yang diproduksi oleh pankreas.
Enzim ini menghidrolisis ikatan peptida pada sisi karboksil residu lisin dan
arginin (bermuatan positif):
R
1
Lys Ala R
2
R
1
Lys COO
-
+ NH
3
+
Ala R
2
Tripsin
Banyak protein yang mengandung ratusan residu asam amino,
sehingga kurang efektif bila dilakukan penentuan seluruh urutan asam
BIOKIMIA: Struktur dan Fungsi Biomolekul 78
aminonya sekaligus. Hal ini dikarenakan meningkatnya ketidakpastian
pada tiap tahap pengurutan. Akan lebih mudah bila dilakukan
pemotongan protein terlebih dahulu, agar didapat potongan-potongan
protein yang lebih kecil untuk diurutkan. Selain itu, protein bisa saja
mengandung jembatan disulfida yang menghubungkan residu-residu
sistein pada bagian-bagian rantai yang berbeda atau berjauhan. Ikatan
disulfida ini harus diputuskan terlebih dahulu sebelum protein dapat
diurutkan.
Salah satu cara yang sering digunakan untuk memotong
polipeptida menjadi fragmen-fragmen yang lebih kecil adalah dengan
hidrolisis oleh enzim tripsin. Tripsin adalah enzim pencernaan yang
diproduksi oleh pankreas. Enzim ini menghidrolisis ikatan peptida
pada sisi karboksil residu lisin dan arginin (bermuatan positif ):
Protein
Biokimia: Struktur dan Fungsi Biomolekul 74
Pereaksi lain yang juga bisa digunakan untuk mengidentifikasi ujung N antara
lain dansil klorida dan fluoro-2,4-dinitrobenzen. Senyawa-senyawa ini dapat
bereaksi dengan residu ujung amino.
N
H
3
C CH
3
S
Cl
NO
2
NO
2
F
O O
Dansil klorida Fluoro-2,4-dinitrobenzen
Banyak protein yang mengandung ratusan residu asam amino,
sehingga kurang efektif bila dilakukan penentuan seluruh urutan asam
aminonya sekaligus. Hal ini dikarenakan meningkatnya ketidakpastian pada
tiap tahap pengurutan. Akan lebih mudah bila dilakukan pemotongan protein
terlebih dahulu, agar didapat potongan-potongan protein yang lebih kecil untuk
diurutkan. Selain itu, protein bisa saja mengandung jembatan disulfida yang
menghubungkan residu-residu sistein pada bagian-bagian rantai yang berbeda
atau berjauhan. Ikatan disulfida ini harus diputuskan terlebih dahulu sebelum
protein dapat diurutkan.
Salah satu cara yang sering digunakan untuk memotong polipeptida
menjadi fragmen-fragmen yang lebih kecil adalah dengan hidrolisis oleh enzim
tripsin. Tripsin adalah enzim pencernaan yang diproduksi oleh pankreas.
Enzim ini menghidrolisis ikatan peptida pada sisi karboksil residu lisin dan
arginin (bermuatan positif):
R
1
Lys Ala R
2
R
1
Lys COO
-
+ NH
3
+
Ala R
2
Tripsin
Enzim lain yang biasa digunakan untuk pemotongan protein secara
selektif adalah kimotripsin. Enzim kimotripsin menghidrolisis ikatan
peptida pada sisi karboksil residu aromatik (fenilalanin, tirosin, dan
triptofan):
Protein
Biokimia: Struktur dan Fungsi Biomolekul 75
Enzim lain yang biasa digunakan untuk pemotongan protein secara selektif
adalah kimotripsin. Enzim kimotripsin menghidrolisis ikatan peptida pada sisi
karboksil residu aromatik (fenilalanin, tirosin, dan triptofan):
R
1
Phe Ser R
2
R
1
Phe COO
-
+ NH
3
+
Ser R
2
Kimotripsin
Metoda kimia non enzimatik untuk pemotongan polipeptida secara spesifik
yakni menggunakan pereaksi sianogen bromida (CNBr). Pereaksi ini bereaksi
dengan residu metionin:
R
1
C N
O
CH
H
CH
2
CH
2
S CH
3
Br
C N
O
R
2
H
C N
+
R
1
C N
O
CH
H
CH
2
C N
O
R
2
H
CH
2
CH
3
S CN
+
Br
-
R
1
C N
O
CH
H
CH
2
C
O
O
+ H
3
N R
2
H
2
O
CH
2
Bila protein telah dipotong dan masing-masing fragmen peptidanya
telah ditentukan urutannya, maka masalahnya sekarang adalah bagaimana
menyusun urutan fragmen-fragmen tersebut dalam susunan yang benar. Untuk
itu, setidaknya diperlukan dua set urutan fragmen peptida, yang masing-masing
set dipotong pada sisi yang berbeda.
Sebagian protein mengandung senyawa lain selain asam amino.
Protein seperti ini disebut sebagai protein konjugasi. Bagian selain asam amino
pada protein konjugasi disebut sebagai gugus prostetik, sedangkan bagian
asam amino pada protein tersebut dikenal sebagai apoprotein. Contoh protein
Metode kimia non enzimatik untuk pemotongan polipeptida secara
spesifik yakni menggunakan pereaksi sianogen bromida (CNBr).
Pereaksi ini bereaksi dengan residu metionin:
Bab 3 Protein 79
Protein
Biokimia: Struktur dan Fungsi Biomolekul 75
Enzim lain yang biasa digunakan untuk pemotongan protein secara selektif
adalah kimotripsin. Enzim kimotripsin menghidrolisis ikatan peptida pada sisi
karboksil residu aromatik (fenilalanin, tirosin, dan triptofan):
R
1
Phe Ser R
2
R
1
Phe COO
-
+ NH
3
+
Ser R
2
Kimotripsin
Metoda kimia non enzimatik untuk pemotongan polipeptida secara spesifik
yakni menggunakan pereaksi sianogen bromida (CNBr). Pereaksi ini bereaksi
dengan residu metionin:
R
1
C N
O
CH
H
CH
2
CH
2
S CH
3
Br
C N
O
R
2
H
C N
+
R
1
C N
O
CH
H
CH
2
C N
O
R
2
H
CH
2
CH
3
S CN
+
Br
-
R
1
C N
O
CH
H
CH
2
C
O
O
+ H
3
N R
2
H
2
O
CH
2
Bila protein telah dipotong dan masing-masing fragmen peptidanya
telah ditentukan urutannya, maka masalahnya sekarang adalah bagaimana
menyusun urutan fragmen-fragmen tersebut dalam susunan yang benar. Untuk
itu, setidaknya diperlukan dua set urutan fragmen peptida, yang masing-masing
set dipotong pada sisi yang berbeda.
Sebagian protein mengandung senyawa lain selain asam amino.
Protein seperti ini disebut sebagai protein konjugasi. Bagian selain asam amino
pada protein konjugasi disebut sebagai gugus prostetik, sedangkan bagian
asam amino pada protein tersebut dikenal sebagai apoprotein. Contoh protein
Bila protein telah dipotong dan masing-masing fragmen
peptidanya telah ditentukan urutannya, maka masalahnya sekarang
adalah bagaimana menyusun urutan fragmen-fragmen tersebut dalam
susunan yang benar. Untuk itu, setidaknya diperlukan dua set urutan
fragmen peptida, yang masing-masing set dipotong pada sisi yang
berbeda.
Sebagian protein mengandung senyawa lain selain asam amino.
Protein seperti ini disebut sebagai protein konjugasi. Bagian selain
asam amino pada protein konjugasi disebut sebagai gugus prostetik,
sedangkan bagian asam amino pada protein tersebut dikenal sebagai
apoprotein. Contoh protein konjugasi antara lain glikoprotein dan
proteoglikan yang mengandung karbohidrat dalam ikatan kovalen,
serta lipoprotein yang mengandung lipid sebagai gugus prostetiknya.
Tiap protein memiliki berat molekul yang unik. Ukuran atau berat
molekul suatu protein pada kondisi tertentu dapat membedakannya dari
protein-protein lain. Berat molekul (lebih tepat, berat molekul relatif ),
Mr, tidak mempunyai dimensi. Mr menunjukkan massa molekul relatif
terhadap 1/12 massa atom
12
C. Massa molekul itu sendiri biasanya
ditulis dalam satuan dalton (Da) atau kilodalton (kDa), dengan 1 Da
adalah 1/12 massa atom
12
C (1,66 x 10
-24
g). Massa molar adalah massa
BIOKIMIA: Struktur dan Fungsi Biomolekul 80
satu mol yang ditulis dalam gram. Ketiga ukuran yang disebutkan tadi
memiliki nilai numerik yang sama, tetapi dengan satuan yang berbeda.
Sebagai contoh, serum albumin dapat ditulis memiliki berat molekul
66.000, atau massa molekul 66 kDa, atau massa molar 66 kg mol-1.
Berat molekul suatu protein ditentukan oleh urutan asam
amino, modifikasi post-translasi (misalnya glikosilasi), serta gugus
nonpeptida (misalnya logam dan kofaktor). Berat sebenarnya dari
suatu rantai polipeptida dapat dihitung dari urutan asam aminonya,
tetapi ada perhitungan yang lebih mudah untuk memperkirakan berat
kasar polipeptida, yakni perhitungan rule-of-thumb (aturan ibu jari).
Perhitungan rule-of-thumb berdasarkan pada proporsi asam-asam
amino yang ditemukan dalam sebagian besar protein; sehingga berat
molekul didapat dengan mengalikan jumlah residu dengan 110.
Protein yang memiliki struktur kuaterner disusun oleh beberapa
rantai polipeptida terpisah yang ditahan oleh interaksi non kovalen. Berat
molekul komponen rantai polipeptida dalam protein seperti ini dapat
ditentukan dalam kondisi disosiasi, yakni 8 M urea untuk melemahkan
ikatan hidrogen dan interaksi hidrofob, dan 1 mM merkaptoetanol
untuk memutuskan ikatan disulfida. Dari perbandingan dengan berat
molekul keseluruhan, dapat ditentukan jumlah rantai polipeptida yang
terlibat dalam struktur awalnya (struktur kuarterner).
Berat molekul suatu protein dapat ditentukan menggunakan metode
termodinamika, misalnya pengukuran tekanan osmosis, dan juga analisis
sedimentasi dalam ultrasentrifuga. Tekan osmosis sensitif terhadap
jumlah molekul dalam larutan, sehingga bila massa protein total dalam
larutan telah diketahui maka berat molar dapat dihitung. Sedimentasi
molekul protein dalam sentrifuga tergantung pada massa molekul.
Berat molekul suatu protein juga bisa diperkirakan dengan
menggunakan filtrasi gel, atau dari pengukuran kecepatan migrasi
molekul melalui gel elektroforesis; hasil pengukuran-pengukuran ini
kemudian dibandingkan dengan sejumlah berat molekul standar yang
telah diketahui. Untuk menentukan berat molekul protein secara
akurat dapat digunakan teknik spektrometri massa.
Bab 3 Protein 81
Massa molar (M) suatu zat terlarut bisa ditentukan dari pengukuran
koefisien sedimentasi (s) dan koefisien difusi (D) menurut persamaan
Svedberg:
(1 )
RTs
M
D v
=

dengan R adalah tetapan gas, T adalah suhu mutlak, volume spesifik


parsial dari zat terlarut, dan r adalah kerapatan pelarut. Koefisien
sedimentasi tergantung pada ukuran, bentuk, dan berat molar
zat terlarut. Koefisien sedimentasi ini ditentukan dari kecepatan
sedimentasi zat terlarut dalam medan gravitasi suatu ultrasentrifuga.
Koefisien difusi tergantung pada ukuran dan bentuk zat terlarut, dan
ditentukan dari kecepatan terbentuknya perbatasan antara larutan dan
pelarut murni.
Koefisian sedimentasi sering ditulis dalam satuan Svedberg (S),
yang namanya diambil dari Th Svedberg, penemu sentrifuga: Koefisien
sedimentasi beberapa protein dapat dilihat pada daftar berikut.
Protein Mr s
Lisozim 14.000 1,9 S
Hemoglobin 64.500 4,5 S
Katalase 248.000 11,3 S
Urease 480.000 18,6 S
Volume yang dibutuhkan untuk mengelusi protein globular dari
kolom filtrasi gel merupakan fungsi penurunan dari berat molekul.
Bila hasil elusi protein sampel dibandingkan dengan serangkaian berat
molekul standar yang telah diketahui, maka perkiraan berat molekul
protein sampel dapat diinterpolasi (Gambar 3-2).

BIOKIMIA: Struktur dan Fungsi Biomolekul 82
Protein
Biokimia: Struktur dan Fungsi Biomolekul 78
Gambar 3-2 Gel filtrasi protein. Serangkaian protein yang Mr-nya berbeda dianalisis
dalam kolom Sephadex G-200 untuk mengetahui volume elusi V
el
masing-masing. Volume elusi ini diplotkan dalam grafik, dengan dua
titik data yang ditunjukkan oleh lingkaran putih tidak dipakai untuk
membentuk kurva kalibrasi.
Protein M
r
V
el
(mL)
Dekstran biru* 10
6
85
Lisozim 14.000 200
Kimptripsinogen 25.000 190
Ovalbumin 45.000 170
Serum albumin 65.000 150
Aldolase 150.000 125
Urease 500.000 90
Ferritin** 700.000 92
Ovomukoid** 28.000 160
Sampel enzim 130
*Dekstran biru merupakan karbohidrat yang berat
molekulnya besar yang mengandung molekul
pewarna yang terikat secara kovalen.
**Tidak digunakan dalam kurva kalibrasi.
Dalam deterjen natrium dodesil sulfat (SDS), banyak protein yang
terpisahkan dan terbuka lipatannya. Sama seperti volume elusi, mobilitas
elektroforesis rantai-rantai polipeptida yang terdenaturasi oleh SDS juga
4
5 6
80
120
160
200
Log Mr
Gambar 3-2 Gel filtrasi protein. Serangkaian protein yang Mr-nya berbeda
dianalisis dalam kolom Sephadex G-200 untuk mengetahui volume elusi Vel
masing-masing. Volume elusi ini diplotkan dalam grafik, dengan dua titik
data yang ditunjukkan oleh lingkaran putih tidak dipakai untuk membentuk
kurva kalibrasi.
Protein Mr Vel (mL)
Dekstran biru* 106 85
Lisozim 14.000 200
Kimptripsinogen 25.000 190
Ovalbumin 45.000 170
Serum albumin 65.000 150
Aldolase 150.000 125
Urease 500.000 90
Ferritin** 700.000 92
Ovomukoid** 28.000 160
Sampel enzim 130

* Dekstran biru merupakan karbohidrat yang berat molekulnya besar yang mengandung
molekul pewarna yang terikat secara kovalen.
** Tidak digunakan dalam kurva kalibrasi.
Bab 3 Protein 83
Dalam deterjen natrium dodesil sulfat (SDS), banyak protein
yang terpisahkan dan terbuka lipatannya. Sama seperti volume elusi,
mobilitas elektroforesis rantai-rantai polipeptida yang terdenaturasi
oleh SDS juga merupakan fungsi penurunan dari berat molekul.
Dengan demikian, berat molekul protein sampel dapat disimpulkan
dari mobilitas-mobilitas standar.
Dalam teknik filtrasi gel maupun teknik gel elektroforesis, sifat hi-
drodinamik tergantung pada bentuk molekul. Karena itu harus diang-
gap bahwa bentuk protein sampel adalah sama dengan bentuk protein-
protein standar (misalnya berbentuk bola, elips, dan sebagainya).
Filtrasi gel sangat tergantung pada ukuran efektif, bukan massa.
Karena itu, jika kerapatan protein sampel berbeda dengan standar,
maka perkiraan berat molekulnya akan tidak tepat.
Protein mengikat SDS, dan dianggap bahwa jumlah SDS yang
terikat per gram adalah sama untuk semua protein. Perbedaan jumlah
ikatan per molekul akan menghasilkan perbedaan muatan total dan
mobilitas elektroforesis, sehingga akan didapat besar berat molekul
yang salah.
Dahulu, penggunaan spektrometri massa untuk menentukan berat
molekul makromolekul biologis sangat terbatas. Hal ini dikarenakan
penguapan sampel dapat menyebabkan dekomposisi termal. Selama
bertahun-tahun telah dikembangkan berbagai teknik untuk mengatasi
masalah tersebut, dan sekarang spektrometri massa merupakan alat yang
digunakan secara rutin dalam sebagian besar laboratorium biokimia.
Metode yang kini digunakan untuk menganalisa sampel antara lain:
matrix assisted laser desorption (MALDI), yakni sampel dibungkus
dalam matriks organik yang memiliki berat molekul rendah kemudian
disinari laser UV; electrospray, yakni protein sampel dibuat larutan
asam encer kemudian disemprotkan dari jarum bermuatan positif
ke dalam kamar vakum (pelarut yang mengelilingi protein menguap
dengan cepat meninggalkan molekul protein yang bermuatan positif );
serta plasma desorption, yakni menggunakan partikel bermuatan yang
berenergi tinggi untuk membebaskan sampel dari suatu pendukung
logam. Spektrometri massa memiliki ketepatan sampai sekitar 0,01
BIOKIMIA: Struktur dan Fungsi Biomolekul 84
% dengan hanya membutuhkan beberapa pikomol sampel, dan dapat
digunakan untuk menentukan berat molekul dalam berbagai ukuran,
mulai dari asam amino tunggal sampai protein yang lebih besar dari
100 kDa.
3. PELIPATAN PROTEIN
Protein biasanya melipat membentuk struktur tiga dimensi yang
teratur dan kompak. Untuk memahami fungsi protein, perlu diketahui
mengenai konformasi atau pola lipatan tiga dimensi yang dimiliki
rantai polipeptida. Banyak poli asam amino buatan tidak memiliki
konformasi yang baik sehingga terlihat seperti random coils dalam
larutan. Akan tetapi kebanyakan protein biologis alami memiliki
struktur lipat yang baik. Beberapa protein seperti keratin rambut serta
bulu memiliki bentuk serat dan tersusun dalam struktur linear atau
lembaran yang polanya berulang-ulang secara teratur. Protein lainnya
seperti enzim, terlipat dalam konformasi globular (bulat) seperti bola
yang kompak.
Pelipatan protein menjadi struktur kompak berlangsung dengan
diiringi penurunan entropi konformasi protein. Konformasi lipat
ini dipertahankan oleh sejumlah interaksi nonkovalen lemah yang
meredam penurunan entropi. Interaksi-interaksi nonkovalen ini antara
lain ikatan hidrogen, interaksi elektrostatik, interaksi hidrofob, dan
interaksi van der Waals. Semua interaksi tersebut membuat protein
lipat lebih stabil daripada bentuk tak terlipat.
Partikel-partikel bermuatan saling berinteraksi satu sama lain
menurut hukum Coulomb:
2
A B
AB
Z Z
E
Dr

=
dengan DE adalah energi interaksi elektrostatik, Z
A
dan Z
B
adalah
jumlah muatan kedua partikel yang berinteraksi, r
AB
adalah jarak an-
tara kedua partikel, e adalah muatan elektron, dan D adalah tetapan
dielektrik medium. Bila kedua muatan saling berlawanan, energi inter-
Bab 3 Protein 85
aksi menurun saat keduanya saling mendekati, sehingga interaksi ter-
jadi dengan baik.
Separuh muatan negatif pada protein (seperti rantai samping
karboksilat dalam residu Asp dan Glu) seringkali berinteraksi dengan
rantai samping bermuatan positif pada residu Lys, Arg, atau His.
Interaksi elektrostatik ini membentuk jembatan garam, dengan
beberapa derajat ikatan hidrogen yang memperkuat tarikan elektrostatik
(perhatikan gambar 3.3 berikut ini).
Protein
Biokimia: Struktur dan Fungsi Biomolekul 81
hidrogen yang memperkuat tarikan elektrostatik (perhatikan gambar 3.3 berikut
ini).
C
O O
H H
N N H H
C
N H
Ikatan hidrogen
Arginin
Glutamat
Gambar 3-3 Jembatan garam antara rantai-rantai samping residu Arg dan Glu.
Energi yang menyertai pasangan ion dalam suatu protein yakni 0,5
1,5 kJ mol
-1
untuk interaksi di permukaan, sampai 15 kJ mol
-1
untuk interaksi
elektrostatik antara residu-residu yang berada di bagian dalam protein. Dalam
hal ini tetapan dielektriknya lebih rendah daripada air (tetapan dielektrik air
sebesar 80).
Semua atom maupun molekul saling tarik menarik satu sama lain
karena adanya interaksi dipol-dipol. Suatu molekul tidak perlu memiliki muatan
total untuk dapat melakukan interaksi dipolar. Kerapatan elektron dapat
menjadi sangat tidak merata bila atom-atom yang berinteraksi mempunyai
keelektronegatifan yang berbeda.
Atom-atom yang paling elektronegatif mempunyai kelebihan muatan negatif
yang paling besar, yakni atom O (keelektronegatifan sebesar 3,44); N (3,04); C
(2,55); dan H (2,20); seluruhnya dalam skala keelektronegatifan 0,8 4.
Interaksi dipolar ini dikenal sebagai interaksi van der Waals. Interaksi
ini bersifat lemah dan berjarak dekat. Apabila atom-atom dalam interaksi van
der Waals berada terlalu dekat satu sama lain, akan terjadi tolakan yang kuat.
Energi interaksi van der Waals (E
vdw
) biasanya diberikan oleh persamaan
berikut:
6 12
vdw
d
b
d
a
E
Gambar 3-3 Jembatan garam antara rantai-rantai samping residu Arg
dan Glu.
Energi yang menyertai pasangan ion dalam suatu protein yakni 0,5
1,5 kJ mol
-1
untuk interaksi di permukaan, sampai 15 kJ mol
-1
untuk
interaksi elektrostatik antara residu-residu yang berada di bagian dalam
protein. Dalam hal ini tetapan dielektriknya lebih rendah daripada air
(tetapan dielektrik air sebesar 80).
Semua atom maupun molekul saling tarik menarik satu sama
lain karena adanya interaksi dipol-dipol. Suatu molekul tidak perlu
memiliki muatan total untuk dapat melakukan interaksi dipolar.
Kerapatan elektron dapat menjadi sangat tidak merata bila atom-atom
yang berinteraksi mempunyai keelektronegatifan yang berbeda.
Atom-atom yang paling elektronegatif mempunyai kelebihan
muatan negatif yang paling besar, yakni atom O (keelektronegatifan
sebesar 3,44); N (3,04); C (2,55); dan H (2,20); seluruhnya dalam
skala keelektronegatifan 0,8 4.
BIOKIMIA: Struktur dan Fungsi Biomolekul 86
Interaksi dipolar ini dikenal sebagai interaksi van der Waals.
Interaksi ini bersifat lemah dan berjarak dekat. Apabila atom-atom
dalam interaksi van der Waals berada terlalu dekat satu sama lain, akan
terjadi tolakan yang kuat. Energi interaksi van der Waals (E
vdw
) biasanya
diberikan oleh persamaan berikut:
12 6 vdw
a b
E
d d
=
dengan d adalah jarak interatom, a dan b adalah tetapan positif.
Persamaan di atas seringkali disebut potensial 6,12 Lennard-Jones.
Jarak optimal untuk interaksi van der Waals adalah ketika atom-
atom yang berinteraksi terpisah 0,3 0,5 lebih besar daripada
jumlah jari-jari van der Waals-nya (didefinisikan sebagai jarak kontak
minimum yang teramati antara atom-atom dalam suatu kristal). Energi
interaksi van der Waals biasanya kurang dari 1 kJ mol
-1
. Ikatan hidrogen
dihasilkan dari suatu interaksi elektrostatik antara atom hidrogen yang
terikat secara kovalen pada atom elektronegatif (seperti O, N, atau S),
dengan atom elektronegatif lain yang mempunyai pasangan elektron
tak berikatan:
Protein
Biokimia: Struktur dan Fungsi Biomolekul 82
dengan d adalah jarak interatom, a dan b adalah tetapan positif. Persamaan di
atas seringkali disebut potensial 6,12 Lennard-Jones.
Jarak optimal untuk interaksi van der Waals adalah ketika atom-atom
yang berinteraksi terpisah 0,3 0,5 lebih besar daripada jumlah jari-jari van
der Waals-nya (didefinisikan sebagai jarak kontak minimum yang teramati
antara atom-atom dalam suatu kristal). Energi interaksi van der Waals
biasanya kurang dari 1 kJ mol
-1
. Ikatan hidrogen dihasilkan dari suatu interaksi
elektrostatik antara atom hidrogen yang terikat secara kovalen pada atom
elektronegatif (seperti O, N, atau S), dengan atom elektronegatif lain yang
mempunyai pasangan elektron tak berikatan:
O H O C
Donor Akseptor
Meskipun atom hidrogen terikat pada gugus donor, tetapi sebenarnya
atom tersebut dipakai bersama baik oleh donor maupun akseptor. Kebanyakan
ikatan hidrogen yang terdapat dalam protein berada di antara tulang punggung
gugus C=O dan NH, dengan jarak HO sebesar 1,9 2,0 . Ikatan hidrogen
jenis ini diperkirakan menyumbang sekitar ~5 kJ mol
-1
pada stabilitas protein
dalam larutan encer. Ikatan hidrogen itu sendiri besarnya bervariasi antara 2 kJ
mol
-1
sampai 7,5 kJ mol
-1
.
Tabel 3-1 Jenis-jenis Interaksi Nonkovalen yang Terlibat
dalam Stabilitas Struktur Protein
Interaksi Contoh
Energi ikatan
(kJ mol
-1
)*
van der Waals CHHC 0,4 2,0
Elektrostatik COO
-
H
3
N
+
0,5 15
Ikatan hidrogen NHO=C 2,0 7,5
Hidrofob** CH
2
~3
*Energi ikatan adalah energi yang dibutuhkan untuk memutuskan
interaksi.
**Nilai ini menggambarkan energi bebas yang dibutuhkan untuk
memindahkan gugus CH
2
dari rantai samping nonpolar di bagian
dalam protein menuju ke dalam air.
Adanya gugus nonpolar di dalam air akan menurunkan entropi larutan.
Karena itu, pemindahan gugus nonpolar dari air ke dalam suatu lingkungan
nonpolar akan disertai dengan peningkatan entropi molekul air, yang prosesnya
Meskipun atom hidrogen terikat pada gugus donor, tetapi
sebenarnya atom tersebut dipakai bersama baik oleh donor maupun
akseptor. Kebanyakan ikatan hidrogen yang terdapat dalam protein
berada di antara tulang punggung gugus C=O dan NH, dengan
jarak HO sebesar 1,9 2,0 . Ikatan hidrogen jenis ini diperkirakan
menyumbang sekitar ~5 kJ mol
-1
pada stabilitas protein dalam larutan
encer. Ikatan hidrogen itu sendiri besarnya bervariasi antara 2 kJ mol
-1

sampai 7,5 kJ mol
-1
.
Bab 3 Protein 87
Tabel 3-1 Jenis-jenis Interaksi Nonkovalen yang Terlibat dalam Stabilitas
Struktur Protein
Interaksi Contoh Energi ikatan (kJ mol-1)*
van der Waals CHHC 0,4 2,0
Elektrostatik COO-H3N+ 0,5 15
Ikatan hidrogen NHO=C 2,0 7,5
Hidrofob** CH2 ~3
* Energi ikatan adalah energi yang dibutuhkan untuk memutuskan interaksi.
** Nilai ini menggambarkan energi bebas yang dibutuhkan untuk memindahkan gugus
CH
2
dari rantai samping nonpolar di bagian dalam protein menuju ke dalam air.
Adanya gugus nonpolar di dalam air akan menurunkan entropi
larutan. Karena itu, pemindahan gugus nonpolar dari air ke dalam suatu
lingkungan nonpolar akan disertai dengan peningkatan entropi molekul
air, yang prosesnya berlangsung secara spontan. Pelipatan rantai protein
membentuk konformasi globular yang kompak dapat menghilangkan
kontak antara gugus nonpolar dengan air. Molekul air yang dibebaskan
akan meningkatkan entropi, sedangkan rantai polipeptida yang terlipat
akan mengalami penurunan entropi. Pembungkusan gugus metilen
(CH
2
) ke bagian interior protein memiliki energi ~3 kJ mol-1 yang
sama kuatnya seperti ikatan hidrogen.
Interaksi hidrofob merupakan suatu gaya yang penting dalam
pelipatan protein globular yang larut dalam air, sehingga dapat diru-
muskan aturan umum: residu hidrofob cenderung terbungkus di bagian
interior protein sehingga meminimalisasikan kontaknya dengan air.
Bila total energi lipatan suatu protein hanya 40 kJ mol-1, berapa
ikatan H yang harus diputuskan untuk dapat merusak strukturnya?
Tiap ikatan H rata-rata menyumbang ~5 kJ mol-1 untuk energi
stabilisasi, sehingga pemutusan sekitar delapan ikatan seperti itu akan
cukup untuk merusak struktur aslinya.
Energi stabilisasi kebanyakan protein sangatlah kecil, sehingga
pada suhu normal banyak protein yang mengalami fluktuasi kecil yang
cepat dalam strukturnya. Hal ini menyebabkan molekul protein cukup
mudah dibuka lipatannya atau terdenaturasi. Pendenaturasi protein
BIOKIMIA: Struktur dan Fungsi Biomolekul 88
yang umum dipakai antara lain:
(a) Suhu tinggi
(b) pH ekstrim
(c) Konsentrasi tinggi senyawa-senyawa seperti urea atau guanidin
hidroklorida:
Protein
Biokimia: Struktur dan Fungsi Biomolekul 83
berlangsung secara spontan. Pelipatan rantai protein membentuk konformasi
globular yang kompak dapat menghilangkan kontak antara gugus nonpolar
dengan air. Molekul air yang dibebaskan akan meningkatkan entropi,
sedangkan rantai polipeptida yang terlipat akan mengalami penurunan entropi.
Pembungkusan gugus metilen (CH
2
) ke bagian interior protein memiliki
energi ~3 kJ mol
-1
yang sama kuatnya seperti ikatan hidrogen.
Interaksi hidrofob merupakan suatu gaya yang penting dalam pelipatan
protein globular yang larut dalam air, sehingga dapat dirumuskan aturan umum:
residu hidrofob cenderung terbungkus di bagian interior protein sehingga
meminimalisasikan kontaknya dengan air.
Bila total energi lipatan suatu protein hanya 40 kJ mol
-1
, berapa ikatan
H yang harus diputuskan untuk dapat merusak strukturnya? Tiap ikatan H rata-
rata menyumbang ~5 kJ mol
-1
untuk energi stabilisasi, sehingga pemutusan
sekitar delapan ikatan seperti itu akan cukup untuk merusak struktur aslinya.
Energi stabilisasi kebanyakan protein sangatlah kecil, sehingga pada
suhu normal banyak protein yang mengalami fluktuasi kecil yang cepat dalam
strukturnya. Hal ini menyebabkan molekul protein cukup mudah dibuka
lipatannya atau terdenaturasi. Pendenaturasi protein yang umum dipakai
antara lain:
(a) Suhu tinggi
(b) pH ekstrim
(c) Konsentrasi tinggi senyawa-senyawa seperti urea atau guanidin
hidroklorida:
NH
2
C NH
2
O
NH
2
C NH
2
+
NH
2
Cl
-
Urea
Guanidin hidroklorida
(d) Larutan deterjen seperti natrium dodesil sulfat,
CH
3
(CH
2
)
10
CH
2
OSO
3
-
Na
+
Beberapa protein dan enzim yang telah terdenaturasi sempurna oleh
urea dengan jembatan disulfida yang telah tereduksi, dapat melipat kembali
(d) Larutan deterjen seperti natrium dodesil sulfat,
CH
3
(CH
2
)
10
CH
2
OSO
3
-
Na
+
Beberapa protein dan enzim yang telah terdenaturasi sempurna
oleh urea dengan jembatan disulfida yang telah tereduksi, dapat
melipat kembali seperti keadaan awalnya bila urea dihilangkan. Hal ini
menunjukkan bahwa informasi untuk pola lipatan yang tepat terdapat
dalam urutan asam amino.
Ribonuklease (enzim yang menghidrolisis asam ribonukleat) me-
miliki empat ikatan disulfida yang membantu stabilisasi konforma-
sinya. Pada enzim ini ditambahkan 6 M guanidin hidroklorida untuk
melemahkan ikatan hidrogen dan interaksi hidrofobnya, serta 1 mM
merkaptoetanol untuk mereduksi ikatan disulfida. Hasilnya, seluruh
aktivitas enzim menghilang, dan tak ada tanda-tanda residu struktur
sekunder. Kemudian guanidin hidroklorida dihilangkan dengan cara
dialisis atau filtrasi gel. Hasilnya, aktivitas enzim pulih kembali, kon-
formasi aslinya terbentuk, serta terbentuk pula ikatan disulfida yang
tepat seperti asalnya.
Banyak protein besar yang membutuhkan bantuan chaperonin untuk
dapat melipat dengan tepat. Chaperonin itu sendiri juga merupakan
protein. Chaperonin diperkirakan bekerja dengan cara menjerat
intermediet-intermediet yang salah melipat, lalu membuka lipatannya
sehingga ada kesempatan untuk melipat kembali dengan tepat.
Bab 3 Protein 89
4. STRUKTUR PROTEIN
Struktur tiga dimensi protein dapat digambarkan dalam sistem
koordinat Cartesian dan menyebutkan koordinat (x, y, z) untuk tiap
atom dalam protein. Struktur protein ini bisa digambarkan lebih jelas
lagi dengan menyebutkan sudut rotasi (sudut torsi) setiap ikatan dalam
protein (Gambar 3-4). Contohnya, konformasi tulang punggung suatu
residu asam amino bisa dispesifikasikan dengan menyebutkan sudut
torsi f (rotasi mengelilingi ikatan NCa), y (rotasi mengelilingi ikatan
CaC), dan w (rotasi mengelilingi ikatan NC).
Posisi nol untuk f yakni bila gugus NH trans terhadap ikatan
CaC. Sedangkan posisi nol untuk y adalah ketika ikatan CaN trans
terhadap ikatan C=O (Gambar 3-4). Sudut torsi ikatan peptida (w)
biasanya sebesar 180
0
. Penggambaran lengkap struktur tiga dimensi
suatu protein juga memerlukan pengetahuan mengenai sudut torsi
rantai samping c. Protein
Biokimia: Struktur dan Fungsi Biomolekul 85
Gambar 3-4 Definisi sudut torsi protein dan . Konformasi yang ditunjukkan
diperoleh ketika dan semuanya diset pada 180
0
.
Gugus peptida berbentuk planar, hal ini disebabkan ikatan CN
memiliki karakter ikatan rangkap parsial yang beresonansi antara dua bentuk
berikut:
C N
O
H
C N
O
-
H
Panjang ikatan CN (0,132 nm) merupakan pertengahan antara ikatan tunggal
CN (0,149 nm) dan ikatan rangkap C=N (0,129 nm). Karakter ikatan rangkap
parsial ini membatasi rotasi yang mengelilingi ikatan CN, sehingga penataan
atom O, C, N, dan H adalah berada pada suatu bidang datar, dengan atom O
C
0
C

0
N
H
C
1
C

0
C
2
N
H
R
1
H
1

Bidang amida 1

Bidang amida 2

Gambar 3-4 Definisi sudut torsi protein w, f, y, dan c. Konformasi


yang ditunjukkan diperoleh ketika w, f, dan y semuanya diset
pada 1800.
BIOKIMIA: Struktur dan Fungsi Biomolekul 90
Gugus peptida berbentuk planar, hal ini disebabkan ikatan CN
memiliki karakter ikatan rangkap parsial yang beresonansi antara dua
bentuk berikut:
Protein
Biokimia: Struktur dan Fungsi Biomolekul 85
Gambar 3-4 Definisi sudut torsi protein dan . Konformasi yang ditunjukkan
diperoleh ketika dan semuanya diset pada 180
0
.
Gugus peptida berbentuk planar, hal ini disebabkan ikatan CN
memiliki karakter ikatan rangkap parsial yang beresonansi antara dua bentuk
berikut:
C N
O
H
C N
O
-
H
Panjang ikatan CN (0,132 nm) merupakan pertengahan antara ikatan tunggal
CN (0,149 nm) dan ikatan rangkap C=N (0,129 nm). Karakter ikatan rangkap
parsial ini membatasi rotasi yang mengelilingi ikatan CN, sehingga penataan
atom O, C, N, dan H adalah berada pada suatu bidang datar, dengan atom O
C
0
C

0
N
H
C
1
C

0
C
2
N
H
R
1
H
1

Bidang amida 1

Bidang amida 2

Panjang ikatan CN (0,132 nm) merupakan pertengahan antara


ikatan tunggal CN (0,149 nm) dan ikatan rangkap C=N (0,129 nm).
Karakter ikatan rangkap parsial ini membatasi rotasi yang mengelilingi
ikatan CN, sehingga penataan atom O, C, N, dan H adalah berada
pada suatu bidang datar, dengan atom O dan H dalam posisi trans;
dalam hal ini sudut torsi w adalah 1800. Konformasi cis yang biasanya
hanya terdapat pada ikatan peptida X-Pro dalam protein, memiliki w
sebesar 00.
Dalam dipeptida glisilalanin, ikatan mana pada tulang punggung
yang gugus-gugusnya dapat berotasi dengan bebas?
Protein
Biokimia: Struktur dan Fungsi Biomolekul 86
dan H dalam posisi trans; dalam hal ini sudut torsi adalah 180
0
. Konformasi
cis yang biasanya hanya terdapat pada ikatan peptida X-Pro dalam protein,
memiliki sebesar 0
0
.
Dalam dipeptida glisilalanin, ikatan mana pada tulang punggung yang
gugus-gugusnya dapat berotasi dengan bebas?
+
NH
3

CH
H
C N
H
O

CH
2
CH
3
COO
-
Glisilalanin
Dalam struktur di atas, gugus peptida ditandai dengan garis putus-putus.
Gugus peptida itu sendiri kaku dan datar, sehingga tidak ada rotasi yang
mengelilingi ikatan antara atom karbon karbonil dengan atom nitrogen (ikatan
CN). Akan tetapi, rotasi bebas dapat terjadi mengelilingi ikatan antara karbon
dengan atom karbon karbonil (ikatan C

C) dan di sekitar ikatan antara atom


nitrogen dengan atom karbon pada alanil (ikatan NC

). Dengan demikian,
untuk semua gugus peptida dalam protein terdapat dua ikatan yang dapat
berotasi.
Tidak semua kombinasi sudut dan dapat terbentuk. Banyak yang
menimbulkan benturan antara atom-atom dalam residu yang berdekatan.
Untuk semua residu kecuali glisin, adanya halangan sterik dari atom-atom
rantai samping sangat menurunkan jumlah konformasi yang mungkin terbentuk.
Konformasi sudut-sudut dan yang tidak menimbulkan benturan dapat
diplotkan pada peta konformasi (dikenal juga sebagai plot Ramachandran, yang
namanya diambil dari nama ahli kimia yang memulai pekerjaan di bidang ini).
Gambar 3-5 memperlihatkan plot Ramachandran untuk alanilalanin. Daerah
berarsir ganda menandakan konformasi (kombinasi dan ) yang tidak
terhalang sama sekali. Daerah berarsir tunggal menandakan konformasi
dengan sedikit halangan, tetapi masih mungkin terjadi bila distorsi tersebut
ditutupi oleh interaksi-interaksi di tempat lain dalam protein.
Dalam struktur di atas, gugus peptida ditandai dengan garis putus-
putus. Gugus peptida itu sendiri kaku dan datar, sehingga tidak ada
rotasi yang mengelilingi ikatan antara atom karbon karbonil dengan
atom nitrogen (ikatan CN). Akan tetapi, rotasi bebas dapat terjadi
mengelilingi ikatan antara karbon a dengan atom karbon karbonil
(ikatan CaC) dan di sekitar ikatan antara atom nitrogen dengan atom
karbon a pada alanil (ikatan NCa). Dengan demikian, untuk semua
gugus peptida dalam protein terdapat dua ikatan yang dapat berotasi.
Bab 3 Protein 91
Tidak semua kombinasi sudut f dan y dapat terbentuk. Banyak
yang menimbulkan benturan antara atom-atom dalam residu yang
berdekatan. Untuk semua residu kecuali glisin, adanya halangan sterik
dari atom-atom rantai samping sangat menurunkan jumlah konfor-
masi yang mungkin terbentuk. Konformasi sudut-sudut f dan y yang
tidak menimbulkan benturan dapat diplotkan pada peta konformasi
(dikenal juga sebagai plot Ramachandran, yang namanya diambil dari
nama ahli kimia yang memulai pekerjaan di bidang ini). Gambar 3-5
memperlihatkan plot Ramachandran untuk alanilalanin. Daerah berar-
sir ganda menandakan konformasi (kombinasi f dan y) yang tidak ter-
halang sama sekali. Daerah berarsir tunggal menandakan konformasi
dengan sedikit halangan, tetapi masih mungkin terjadi bila distorsi
tersebut ditutupi oleh interaksi-interaksi di tempat lain dalam protein.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 87
Gambar 3-5 Plot Ramachandran untuk alanilalanin.
Jika Heliks right-handed memiliki nilai = 57
0
dan = 47
0
.
Apakah heliks dapat menjadi struktur yang stabil? Ya, Nilai-nilai tersebut
termasuk ke dalam daerah yang mungkin terjadi dalam plot Ramachandran,
yang ditandai dengan simbol
R
dalam Gambar 3-5.
Bila sudut torsi tulang punggung suatu polipeptida tetap konstan dari
satu residu ke residu berikutnya, maka akan terbentuk struktur berulang yang
teratur. Struktur jenis ini bisa berbentuk heliks atau sheet.
Melihat dari jari-jari van der Waals pada atom, sudut ikatan, dan bentuk
planar ikatan peptida, maka hanya ada dua struktur berulang yang dapat
terbentuk tanpa distorsi dan dengan pembentukan ikatan hidrogen yang
maksimum. Struktur-struktur tersebut yaitu:
1. Heliks, ditemukan dalam -keratin
2. Sheet (paralel dan antiparalel), contohnya yakni bentuk pada
keratin yang diregangkan serta pada protein sutera

L
X

p
-180
0
-180
0
180
0
180
0
0
0


Gambar 3-5 Plot Ramachandran untuk alanilalanin.
BIOKIMIA: Struktur dan Fungsi Biomolekul 92
Jika a Heliks right-handed memiliki nilai f = 57
0
dan y = 470.
Apakah a heliks dapat menjadi struktur yang stabil? Ya, Nilai-nilai
tersebut termasuk ke dalam daerah yang mungkin terjadi dalam plot
Ramachandran, yang ditandai dengan simbol aR dalam Gambar 3-5.
Bila sudut torsi tulang punggung suatu polipeptida tetap konstan
dari satu residu ke residu berikutnya, maka akan terbentuk struktur
berulang yang teratur. Struktur jenis ini bisa berbentuk a-heliks atau b
sheet.
Melihat dari jari-jari van der Waals pada atom, sudut ikatan, dan
bentuk planar ikatan peptida, maka hanya ada dua struktur berulang
yang dapat terbentuk tanpa distorsi dan dengan pembentukan ikatan
hidrogen yang maksimum. Struktur-struktur tersebut yaitu:
1. a Heliks, ditemukan dalam a-keratin
2. b Sheet (paralel dan antiparalel), contohnya yakni bentuk b pada
keratin yang diregangkan serta pada protein sutera
Struktur berulang yang teratur seperti ini juga ditemukan dalam
pola lipatan protein globular. Banyak protein globular yang rantai
polipeptidanya sebagian besar tidak menunjukkan keteraturan dalam
lipatan. Daerah-daerah ini mungkin memiliki bagian pendek di mana
ditemukan struktur seperti reverse turns, yang seringkali menghubung-
kan untai-untai b sheet. Daerah-daerah tanpa struktur sekunder yang
berulang teratur (daerah tak teratur) sering disebut sebagai daerah yang
memiliki konformasi random-coil.
Dalam a heliks, tulang punggung polipeptida terlipat sedemikian
rupa sehingga gugus C=O pada tiap residu asam amino berikatan
hidrogen dengan gugus NH pada residu keempat setelahnya. Sebagai
contoh, gugus C=O residu pertama berikatan dengan gugus NH
pada residu kelima pada rantai.
Tulang punggung a heliks berkeliling memutari sumbu yang
panjang, seperti diperlihatkan dalam Gambar 3-6. Ikatan-ikatan
hidrogen berbaris hampir paralel terhadap sumbu ini, dengan rantai-
rantai samping menjulur keluar. Tiap residu berjarak 0,15 nm dari
residu berikutnya di sepanjang sumbu. Dibutuhkan 3,6 residu untuk
membuat satu putaran lengkap heliks. Meskipun kaidah tangah kiri
Bab 3 Protein 93
dan kaidah tangan kanan keduanya dapat terjadi, tetapi kaidah tangan
kanan lebih disukai secara energetika dengan asam L-amino.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 89
N
H
C-3
C
O
C-2
H
N
H
C
C-1
O
H
N
C-6
C
N
C-7
H
O
C
C-5
O
H
N
C-10
C
C-9
O
Gambar 3-6 Kaidah tangan kanan -heliks. Diagram ini menunjukkan gugus
peptida pada bidang datar, dengan atom karbon pada
sambungan antarbidang.
Tiap gugus C=O dan NH berikatan hidrogen (kecuali pada empat
residu di tiap ujung rantai), sehingga heliks menjadi sangat stabil. Akan
tetapi, pada beberapa asam amino terdapat interaksi rantai samping yang bisa
melemahkan heliks. Hal ini menjadikan konformasi heliks kurang disukai
dalam rantai polipeptida yang mengandung banyak asam amino seperti itu.
Tabel 3-2 Kecenderungan residu-residu asam amino untuk membentuk heliks
Pembentuk heliks Glu, Ala, Leu, His, Met, Gln, Trp, Val, Phe, Lys, Ile
Perusak heliks Pro, Gly, Tyr, Asn
Residu yang tak
berpengaruh
Asp, Thr, Ser, Arg, Cys
Struktur berbeda dengan heliks, yakni rantai polipeptida dalam
sheet terbentang hampir sempurna (Gambar 3-7(a)). Ikatan hidrogen terdapat
di antara untai-untai polipeptida, bukan di dalam untai tunggal (Gambar 3-7(c)).
Gambar 3-6 Kaidah tangan kanan a-heliks. Diagram ini menunjukkan
gugus peptida pada bidang datar, dengan atom karbon a pada
sambungan antarbidang.
Tiap gugus C=O dan NH berikatan hidrogen (kecuali pada
empat residu di tiap ujung rantai), sehingga a heliks menjadi sangat
stabil. Akan tetapi, pada beberapa asam amino terdapat interaksi
rantai samping yang bisa melemahkan a heliks. Hal ini menjadikan
konformasi a heliks kurang disukai dalam rantai polipeptida yang
mengandung banyak asam amino seperti itu.
Tabel 3-2 Kecenderungan residu-residu asam amino untuk
membentuk a-heliks
Pembentuk heliks Glu, Ala, Leu, His, Met, Gln, Trp, Val, Phe, Lys, Ile
Perusak heliks Pro, Gly, Tyr, Asn
Residu yang tak
berpengaruh
Asp, Thr, Ser, Arg, Cys
BIOKIMIA: Struktur dan Fungsi Biomolekul 94
Struktur b berbeda dengan a heliks, yakni rantai polipeptida
dalam b sheet terbentang hampir sempurna (Gambar 3-7(a)). Ikatan
hidrogen terdapat di antara untai-untai polipeptida, bukan di dalam
untai tunggal (Gambar 3-7(c)).
Protein
Biokimia: Struktur dan Fungsi Biomolekul 90
Rantai-rantai yang bersebelahan dapat tersusun berjajar ke arah yang
sama (ujung N ke ujung C) seperti dalam sheet paralel, atau berjajar ke arah
yang berlawanan seperti dalam sheet antiparalael, seperti yang diperlihatkan
Gambar 3-7(c). Struktur-struktur ini sering membentuk lembaran seperti pada
Gambar 3-7(b). Kadangkala beberapa lembaran saling menumpuk satu sama
lain. Rantai-rantai samping cenderung untuk menjulur ke atas dan ke bawah
lembaran seperti pada Gambar 3-7(b), sehingga struktur sheet lebih disukai
untuk asam-asam amino yang rantai sampingnya relatif kecil seperti alanin dan
glisin. Rantai samping yang besar dapat menimbulkan halangan sterik di
antara berbagai bagian dari rantai protein.
Ikatan
peptida
R
R
R
R
R
R
R
(a)
R
R
R
R
R
R
R
R
R
R
R
R
(b)
Protein
Biokimia: Struktur dan Fungsi Biomolekul 91
C
C
R
C
O
R
C
C
R
R
C
O
N
C
H
O
ujung C
ujung C
N
H
(c)
Gambar 3-7 Struktur sheet: (a) segmen polipeptida dalam konformasi
terbentang; (b) lembaran terbentuk oleh susunan rantai-rantai
polipeptida yang terbentang saling bersebelahan; (c) detail
yang menunjukkan ikatan H di antara rantai-rantai polipeptida
yang bersebelahan dalam sheet antiparalel.
Banyak protein globular yang strukturnya terdiri atas heliks, struktur
, dan daerah tak teratur. Dalam Gambar 3-8, heliks digambarkan seperti
pita yang melilit, dan struktur digambarkan oleh panah yang menunjukkan
arah N C. Sheet paralel memiliki panah-panah yang menunjuk ke arah
yang sama, sedangkan sheet antiparalel memiliki panah-panah yang saling
bertolak belakang. Protein (protein pengikat retinol (gambar a) dan fragmen
pengikat antigen (gambar b)) mengandung lebih banyak struktur sekunder
sheet, sedangkan protein (myoglobin (gambar c)) lebih banyak tersusun oleh
heliks. Protein / (triosefosfat isomerase (gambar d)) mengandung
campuran heliks dan sheet.
Gambar 3-7 Struktur b sheet: (a) segmen polipeptida dalam
konformasi terbentang; (b) lembaran terbentuk oleh susunan rantai-
rantai polipeptida yang terbentang saling bersebelahan; (c) detail yang
menunjukkan ikatan H di antara rantai-rantai polipeptida yang
bersebelahan dalam b sheet antiparalel.
Bab 3 Protein 95
Rantai-rantai yang bersebelahan dapat tersusun berjajar ke arah
yang sama (ujung N ke ujung C) seperti dalam b sheet paralel, atau
berjajar ke arah yang berlawanan seperti dalam b sheet antiparalael,
seperti yang diperlihatkan Gambar 3-7(c). Struktur-struktur ini sering
membentuk lembaran seperti pada Gambar 3-7(b). Kadangkala
beberapa lembaran saling menumpuk satu sama lain. Rantai-rantai
samping cenderung untuk menjulur ke atas dan ke bawah lembaran
seperti pada Gambar 3-7(b), sehingga struktur b sheet lebih disukai
untuk asam-asam amino yang rantai sampingnya relatif kecil seperti
alanin dan glisin. Rantai samping yang besar dapat menimbulkan
halangan sterik di antara berbagai bagian dari rantai protein.
Banyak protein globular yang strukturnya terdiri atas a heliks,
struktur b, dan daerah tak teratur. Dalam Gambar 3-8, a heliks
digambarkan seperti pita yang melilit, dan struktur b digambarkan
oleh panah yang menunjukkan arah N C. b Sheet paralel memiliki
panah-panah yang menunjuk ke arah yang sama, sedangkan b sheet
antiparalel memiliki panah-panah yang saling bertolak belakang.
Protein b (protein pengikat retinol (gambar a) dan fragmen pengikat
antigen (gambar b)) mengandung lebih banyak struktur sekunder b
sheet, sedangkan protein a (myoglobin (gambar c)) lebih banyak
tersusun oleh a heliks. Protein a/b (triosefosfat isomerase (gambar d))
mengandung campuran a heliks dan b sheet.
Protein kolagen (terdapat dalam kulit dan tendon) tersusun oleh
sekitar 30 persen prolin dan hidroksiprolin, serta 30 persen glisin.
Protein ini memiliki struktur unik, yakni tiga rantainya berkonformasi
sangat mirip poliprolin, yang saling teranyam satu sama lain membentuk
suatu triple heliks. Ketiga untai ini berikatan hidrogen satu sama lain,
yakni NH dari residu glisin berikatan hidrogen dengan gugus C=O
dari asam amino yang lain.
Prolin jarang ditemukan di dalam segmen s heliks. Gugus a-
amino pada prolin merupakan gugus amino sekunder. Ketika prolin
membentuk ikatan peptida melalui gugus aminonya, maka tidak ada
lagi hidrogen amida yang dapat membentuk ikatan hidrogen. Selain
itu, rantai samping prolin menempel pada gugus a-aminonya, sehingga
BIOKIMIA: Struktur dan Fungsi Biomolekul 96
tidak ada rotasi bebas pada ikatan NCa, yang membuat prolin tidak
bisa membentuk konformasi a heliks yang benar.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 92
Gambar 3-8 Representasi model struktur protein dimana -heliks digambarkan dengan
pita bergulung dan untai digambarkan dengan panah dengan arah N
C. Protein mengandung lebih banyak struktur -sheet (contohnya:
Protein pengikat retinol dan fragmen pengikat antigen pada antibodi
sementara protein yang mengandung -heliks yang dominan
contohnya: mioglobin. Protein / mengandung campuran -heliks dan
-sheet (misalnya triosefosfat isomerase).
Protein kolagen (terdapat dalam kulit dan tendon) tersusun oleh sekitar
30 persen prolin dan hidroksiprolin, serta 30 persen glisin. Protein ini memiliki
struktur unik, yakni tiga rantainya berkonformasi sangat mirip poliprolin, yang
saling teranyam satu sama lain membentuk suatu triple heliks. Ketiga untai ini
berikatan hidrogen satu sama lain, yakni NH dari residu glisin berikatan
hidrogen dengan gugus C=O dari asam amino yang lain.
Prolin jarang ditemukan di dalam segmen heliks. Gugus -amino
pada prolin merupakan gugus amino sekunder. Ketika prolin membentuk ikatan
(a) Protein Pengikat retinol (b) Fragmen Pengikat antigen
(c) Mioglobin (d) Triosefosfat isomerase
Gambar 3-8 Representasi model struktur protein dimana a-heliks
digambarkan dengan pita bergulung dan untai b digambarkan dengan
panah dengan arah N C. Protein b mengandung lebih banyak
struktur b-sheet (contohnya: Protein pengikat retinol dan fragmen
pengikat antigen pada antibodi sementara protein a yang mengandung
a-heliks yang dominan contohnya: mioglobin. Protein a/b mengandung
campuran a-heliks dan b-sheet (misalnya triosefosfat isomerase).
Meskipun tidak dapat membentuk konformasi a heliks, tetapi
polipeptida yang hanya tersusun oleh prolin dapat membentuk
Bab 3 Protein 97
konformasi heliks jenis lain. Heliks poliprolin tidak distabilkan oleh
ikatan hidrogen, melainkan oleh efek tolakan sterik timbal balik dari
rantai-rantai samping prolil. Residu-residu yang bersebelahan dalam
heliks poliprolin terpisahkan dalam jarak 0,31 nm sepanjang sumbu.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 94
Gambar 3-9 Spektrum ORD untuk poli-D-lisin yang menunjukkan spektrum
konformasi -heliks dan konformasi tak teratur. (Satuan []
adalah derajat mL dm
-1
g
-1
.)
Struktur protein terbagi dalam beberapa tingkat (menurut ahli kimia protein
Denmark, Kai Linderstrm-Lang):
(a) Struktur primer : urutan asam amino.
Struktur tingkat primer dalam suatu protein yakni urutan linear asam-
asam amino yang digabungkan satu sama lain oleh ikatan peptida.
Urutan ini ditentukan oleh urutan basa nukleotida dalam gen yang
mengkode protein. Termasuk juga dalam struktur primer adalah lokasi
ikatan kovalen yang lain. Ikatan ini terutama yakni ikatan disulfida antara
200 220 240
Panjang Gelombang (nm)
- 20
0
20
40
60
80
-heliks



x

1
0
-
3
Gambar 3-9 Spektrum ORD untuk poli-D-lisin yang menunjukkan
spektrum konformasi a-heliks dan konformasi tak teratur. (Satuan [a]
adalah derajat mL dm
-1
g
-1
.)
Molekul asimetris seperti karbohidrat, asam amino, dan protein
dapat memutar bidang polarisasi suatu sinar polarisasi bidang. Besar
BIOKIMIA: Struktur dan Fungsi Biomolekul 98
rotasi tergantung pada konsentrasi zat serta panjang jalur sinar
dalam sampel, mirip seperti dalam absorbansi optik. Besar rotasi
(serta arah rotasi) juga tergantung pada panjang gelombang cahaya.
Ketergantungan rotasi spesifik [a] (ukuran rotasi per unit konsentrasi
dan panjang jalur) pada panjang gelombang cahaya dikenal sebagai
dispersi perputaran optik (ORD, optical rotatory dispersion).
Konformasi suatu protein menambahkan keasimetrisan yang
mempengaruhi spektrum ORD. Daerah heliks pada protein terlarut
menaikkan spektrum ORD tertentu (Gambar 3-9) yang berlainan
dengan daerah tak teratur. Proporsi struktur-struktur yang berbeda
dalam suatu protein dapat diperkirakan dengan cara membandingkan
spektrum ORD protein sampel dengan standar-standar yang
konformasinya telah diketahui.
Struktur protein terbagi dalam beberapa tingkat (menurut ahli
kimia protein Denmark, Kai Linderstrm-Lang):
(a) Struktur primer: urutan asam amino.
Struktur tingkat primer dalam suatu protein yakni urutan linear
asam-asam amino yang digabungkan satu sama lain oleh ikatan
peptida. Urutan ini ditentukan oleh urutan basa nukleotida dalam
gen yang mengkode protein. Termasuk juga dalam struktur primer
adalah lokasi ikatan kovalen yang lain. Ikatan ini terutama yakni
ikatan disulfida antara residu-residu sistein yang berdekatan dalam
ruang tapi bukan dalam urutan asam amino linear. Ikatan silang
kovalen ini antara rantai-rantai polipeptida terpisah atau antara
bagian-bagian yang berbeda dari rantai yang sama, terbentuk oleh
oksidasi gugus SH pada residu sistein yang juga terekspos dalam
ruang. Disulfida yang dihasilkan disebut sebagai residu sistin.
Ikatan disulfida sering terdapat dalam protein ekstrasel, namun
jarang ditemukan dalam protein intrasel.
(b) Struktur sekunder : pola lipatan teratur (seperti struktur a heliks
dan b sheet) yang distabilkan oleh ikatan hidrogen di antara
gugus-gugus peptida yang saling berdekatan dalam rantai. Struktur
sekunder dalam protein dapat digambarkan dalam bentuk diagram
Bab 3 Protein 99
topologi (Gambar 3-10), yang melukiskan orientasi relatif serta
kadarnya dalam dua dimensi. Diagram ini sering digunakan untuk
menunjukkan hubungan kekerabatan protein.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 95
residu-residu sistein yang berdekatan dalam ruang tapi bukan dalam
urutan asam amino linear. Ikatan silang kovalen ini antara rantai-rantai
polipeptida terpisah atau antara bagian-bagian yang berbeda dari rantai
yang sama, terbentuk oleh oksidasi gugus SH pada residu sistein yang
juga terekspos dalam ruang. Disulfida yang dihasilkan disebut sebagai
residu sistin. Ikatan disulfida sering terdapat dalam protein ekstrasel,
namun jarang ditemukan dalam protein intrasel.
(b) Struktur sekunder : pola lipatan teratur (seperti struktur heliks dan
sheet) yang distabilkan oleh ikatan hidrogen di antara gugus-gugus
peptida yang saling berdekatan dalam rantai. Struktur sekunder dalam
protein dapat digambarkan dalam bentuk diagram topologi (Gambar 3-
10), yang melukiskan orientasi relatif serta kadarnya dalam dua dimensi.
Diagram ini sering digunakan untuk menunjukkan hubungan
kekerabatan protein.
C
1 2 3 4 5 6 7 8
1 2 3 4 5 6 7 8
C
N
(a)
(b)
Gambar 3-10 Diagram topologi untuk (a) protein pengikat retinol (RBP, retinol
binding protein) dan (b) triosefosfat isomerase (TPI). Panah
menggambarkan untai (dinomori dari N ke C) dan kotak hitam
menggambarkan heliks. Kedua protein tersebut membentuk
struktur silinder yang terdiri atas delapan untai , untai pertama
berikatan hidrogen dengan untai terakhir dalam rangka menutup
silinder. Untai tersusun antiparalel dalam RBP, dan paralel dalam
TPI dan dikelilingi oleh lapisan luar heliks yang menghubungkan
tiap untai dengan kepada untai berikutnya dalam silinder.
Struktur tingkat sekunder dalam suatu protein yakni lipatan teratur
daerah-daerah rantai polipeptida. Tipe lipatan yang paling umum adalah
-heliks dan -sheet. Dalam -heliks yang mirip tongkat, asam-asam
Gambar 3-10 Diagram topologi untuk (a) protein pengikat retinol
(RBP, retinol binding protein) dan (b) triosefosfat isomerase (TPI). Panah
menggambarkan untai b (dinomori dari N ke C) dan kotak hitam
menggambarkan a heliks. Kedua protein tersebut membentuk struktur
silinder yang terdiri atas delapan untai b, untai pertama berikatan
hidrogen dengan untai terakhir dalam rangka menutup silinder. Untai
b tersusun antiparalel dalam RBP, dan paralel dalam TPI dan dikelilingi
oleh lapisan luar a heliks yang menghubungkan tiap untai b dengan
kepada untai berikutnya dalam silinder.
Struktur tingkat sekunder dalam suatu protein yakni lipatan
teratur daerah-daerah rantai polipeptida. Tipe lipatan yang paling
umum adalah a-heliks dan b-sheet. Dalam -heliks yang mirip tong-
kat, asam-asam amino menata dirinya sendiri dalam konformasi
heliks teratur. Oksigen karbonil dari tiap ikatan peptida berikatan
hidrogen, dengan hidrogen pada gugus amino dari asam amino
keempat, dengan ikatan hidrogen yang terletak hamper paralel te-
hadap sumbu heliks. Dalam suatu -heliks terdapat 3,6 asam amino
perputaran heliks yang melingkupi jarak 0,54 nm, dan setiap re-
sidu asam amino memiliki panjang 0,15 nm sepanjang sumbu he-
BIOKIMIA: Struktur dan Fungsi Biomolekul 100
liks. Rantai-rantai samping asam amino semuanya berada di luar
silinder heliks, asam-asam amino tertentu lebih sering ditemukan
dalam a-heliks daripada yang lainnya. Terutama, Prolin jarang
ditemukan dalam daerah a-heliks karena tidak dapat memben-
tuk pola ikatan hidrogen yang tepat karena tidak adanya atom hi-
drogen pada atom nitrogennya. Karena alasan inilah, asam amino
prolin sering ditemukan di ujung a-heliks, dimana ia mengubah
arah rantai polipeptida dan mengakhiri heliks. Protein yang ber-
beda memiliki jumlah rantai polipeptida tunggal pada mioglobin
mempunyai delapan a-heliks.
Dalam b-sheet, ikatan terbentuk antara ikatan-ikatan peptida
baik dalam rantai polipeptida yang berbeda atau dalam daerah
yang berbeda dari rantai polipeptida yang sama. Rantai-rantai
polipeptida yang berdekatan dalam b-sheet bisa berupa paralel
ataupun antiparalel tergantung paa apakah mereka berada dalam
arah yang sama atau dalam arah berlawanan. Rantai polipeptida
di dalam suatu b-sheet terbentang penuh, dengan ajrak 0,35
nm dari satu atom C ke yang berikutnya. b-sheet selalu sedikit
melengkung dan jika beberapa polipeptida termasuk di dalamnya,
maka lembaran bisa mendekat untuk membentuk kekakuan
dalam banyak protein struktur, misalnya serat sutra, yang hampir
seluruhnya terdiri atas tumpukan b-sheet antiparalel.
Untuk dapat melipat rapat ke dalam bentuk kompak suatu
protein globular, rantai polireptida sering berbalik arah, membuat
suatu hairpin atau b-turn. Dalam b-turn ini oksigen karbonil
dari satu asam amino berikatan hidrogen dengan hidrogen pada
gugus amino dari asam amino keempat. b-turn sering ditemukan
menghubungkan ujung-ujung b-sheet antiparalel. Daerah rantai
polireptida yang tidak berada dalam struktur sekunder biasa
dikatakan memiliki konformasi coil atau loop. Kira-kira setengah
bagian rantai polireptida dari suatu protein globular umum
memiliki konformasi seperti itu.
(c) Struktur supersekunder: pola berulang struktur sekunder yang
biasa terdapat pada banyak protein. Contohnya motif b-a-b,
Bab 3 Protein 101
yang memiliki suatu segmen b sheet, diikuti dengan a heliks, dan
segmen b sheet kedua yang berikatan hidrogen dengan b sheet
pertama (Gambar 3-11). Motif-motif lainnya yakni: b hairpin,
yang terdiri atas dua untai b antiparalel; motif aa, terdiri atas dua a
heliks yang tersusun antiparalel; dan b barrel, dengan b sheet yang
membentuk suatu silinder.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 97
sheet antiparalel. Daerah rantai polireptida yang tidak berada dalam
struktur sekunder biasa dikatakan memiliki konformasi coil atau loop.
Kira-kira setengah bagian rantai polireptida dari suatu protein globular
umum memiliki konformasi seperti itu.
(c) Struktur supersekunder : pola berulang struktur sekunder yang biasa
terdapat pada banyak protein. Contohnya motif --, yang memiliki
suatu segmen sheet, diikuti dengan heliks, dan segmen sheet
kedua yang berikatan hidrogen dengan sheet pertama (Gambar 3-11).
Motif-motif lainnya yakni: hairpin, yang terdiri atas dua untai
antiparalel; motif , terdiri atas dua heliks yang tersusun antiparalel;
dan barrel, dengan sheet yang membentuk suatu silinder.
Gambar 3-11 Representasi diagram unit lipatan supersekunder -- dari suatu
protein. Daerah-daerah ditunjukkan dengan panah, sementara
segmen -heliks ditunjukkan dengan struktur coiled. Posisi ikatan-
ikatan hidrogen ditunjukkan dengan garis terputus putus.
(d) Struktur tertier : untuk protein globular, struktur tertier yakni melipatnya
segmen-segmen struktur sekunder dalam tiga dimensi yang distabilkan
H
3
+
N
COO
-
Gambar 3-11 Representasi diagram unit lipatan supersekunder b-a-
b dari suatu protein. Daerah-daerah b ditunjukkan dengan panah,
sementara segmen a-heliks ditunjukkan dengan struktur coiled. Posisi
ikatan-ikatan hidrogen ditunjukkan dengan garis terputus putus.
(d) Struktur tertier: untuk protein globular, struktur tertier yakni me-
lipatnya segmen-segmen struktur sekunder dalam tiga dimensi
yang distabilkan oleh interaksi antara urutan-urutan yang jauh.
Sedangkan untuk protein yang hanya memiliki sedikit a heliks
atau struktur b (atau tak terdeteksi sama sekali), struktur tertier
berarti melipatnya protein dalam tiga dimensi yang distabilkan
BIOKIMIA: Struktur dan Fungsi Biomolekul 102
oleh interaksi antara bagian-bagian yang jauh urutannya. Struk-
tur tertier adalah penataan spasial asam amino yang terpisah jauh
dalam urutan linearnya serta juga residu-residu yang berdekatan.
Selain itu, yang merupakan urutan asam amino yang menentu-
kan struktur tiga dimensi akhir. Dalam protein globular yang larut
dalam air seperti mioglobin, gaya dorong utama dibalik kelipatan
rantai polipeptida yakni kebutuhan energitika untuk mengubur
asam amino non-polar dalam interior hidrofob jauh dari ling-
kungan air di sekelilingnya, medium hidrofil. Rantai polipeptida
melipat dengan spontan sehingga mayoritas rantai samping hidro-
fobnya terkubur dalam interior, dan mayoritas rantai sampingnya
yang bermuatan dan polar berada pada permukaan. Setelah ter-
lipat, konformasi tiga dimensi protein yang aktif biologis (asli) ini
dipertahankan tidak hanya oleh interaksi hidrofob, namun juga
oleh gaya elektrostatik, ikatan hidrogen, dan jika ada, ikatan disul-
fida kovalen. Gaya elektrostatik antara lain jembatan garam antara
gugus-gugus bermuatan berlawanan dan banyaknya interaksi van
der waals yang lemah antara rantai-rantai samping alifatik yang
tersusun rapat dalam interior protein.
(e) Struktur domain: domain banyak terdapat pada protein globular,
terutama yang memiliki massa molekul lebih dari 20 kDa.
Protein besar seringkali melipat sedemikian rupa sehingga setiap
domain berukuran ~17 kDa. Sebagai contoh, enzim gliseraldehid
3-fosfat dehidrogenase terlipat membentuk dua domain yang
masing-masing memiliki fungsi berbeda, yakni salah satu domain
berukuran ~16 kDa mengikat kofaktor NAD+, sedangkan domain
yang lain merupakan domain katalis berukuran ~21 kDa mengikat
substrat gliseraldehid 3-fosfat.
(f ) Struktur kuaterner: interaksi antara rantai-rantai polipeptida yang
berbeda membentuk suatu struktur oligomer, yang distabilkan
hanya oleh ikatan-ikatan nonkovalen.
Bab 3 Protein 103
Protein yang mengandung lebih dari satu rantai polipeptida, misalnya
hemoglobin, memunculkan tingkat keempat struktur protein yang
disebut struktur kuatner. Struktur tingkat ini yakni penataan spasial
sub unit-sub unit ini bisa merupakan ikatan kovalen (misalnya ikatan
disulfida) atau interaksi nonkovalen (gaya elektrostatik, ikatan hidrogen,
interaksi hidrofob).
Protein-protein globular dapat dikelompokkan menurut
penyusunan strukturnya. Kelompok a/b memiliki motif b-a-b yang
berulang, contohnya antara lain semua enzim glikolisis. Kelompok
a + b memiliki b sheet dan a heliks yang tidak saling berhubungan.
Kelompok a dan kelompok b hampir seluruhnya terdiri atas a heliks
maupun b sheet. Sebagian besar protein toksin termasuk ke dalam ke-
lompok protein jembatan SS, dengan pusat hidrofob yang kecil dijaga
oleh sejumlah besar ikatan disulfida. Contoh kelompok ini antara lain
racun kalajengking dan serangga yang hanya tersusun oleh 38 40 re-
sidu tetapi masing-masing memiliki tiga ikatan disulfida.
Volume protein yang berbentuk bola akan meningkat seiring dengan
meningkatnya berat molekul, lebih cepat daripada peningkatan luas
permukaan. Untuk menyesuaikan semua gugus bermuatan pada
permukaan dengan semua gugus nonpolar dalam interior, terdapat tiga
strategi yang mungkin terjadi:
1. Protein besar bisa menunjukkan perubahan komposisi, dengan
meningkatnya proporsi rantai samping asam amino nonpolar yang
memenuhi volume interior yang membesar.
2. Protein besar bisa melipat membentuk domain-domain yang ter-
pisah, tiap domain menjadi unit lipatan globular yang memiliki
interior dan permukaannya sendiri, dan suatu untai yang meng-
hubungkan tulang punggung antar domain.
3. Protein besar bisa melipat menjadi bentuk yang lebih panjang atau
bentuk seperti batang.
BIOKIMIA: Struktur dan Fungsi Biomolekul 104
5. MOTIF-MOTIF STRUKTUR PROTEIN
Penelitian struktur dengan sinar-x memainkan peran utama dalam
mengubah ilmu kimia yang pada awal abad ke-20 merupakan ilmu
deskriptif menjadi suatu ilmu yang di dalamnya sifat-sifat senyawa
baru bisa diprediksi secara teoritis. Ketika W.L. Bragg menyelesaikan
struktur kristal yang pertama kalinya, yakni batu garam NaCl, hasilnya
mengubah total konsep awal gaya ikatan dalam senyawa-senyawa ion.
Struktur hasil kristalografi sinar-x yang pertama untuk molekul
protein globular adalah pada mioglobin pada tahun 1958, dan
mengejutkan mereka yang mengharapkan struktur dan fungsi protein
yang umum dan sederhana seperti struktur DNA untai ganda (double
helix) yang sederhana dan indah yang telah ditentukan lima tahun
sebelumnya oleh James D. Watson dan Francis Crick. Pada tahun 1958,
John Kendrew dari Medical Research Council Laboratory of Molecular
Biology, Cambridge, Inggris, yang menentukan struktur mioglobin
dengan resolusi rendah, mengekspresikan kekecewaannya akan
kompleksitas struktur tersebut dalam kata-kata berikut: Mungkin hal
yang paling menakjubkan dari molekul tersebut adalah kompleksitasnya
dan tidak adanya simetri. Susunan ini tampaknya hampir sama sekali
tidak memiliki keteraturan yang mengantisipasi secara instingtif, dan
molekul ini lebih rumit daripada yang telah diperkirakan oleh teori
struktur protein manapun.
Di sisi lain, mudah untuk memahami bahwa ketidakteraturan
struktur seperti itu sebenarnya dibutuhkan oleh protein untuk me-
menuhi keberagaman fungsinya. Penyimpanan dan transfer informasi
dari DNA adalah linear, dan dengan demikian molekul DNA untuk
informasi yang sangat berbeda bisa saja mempunyai struktur yang
sebenarnya sama. Sebaliknya, protein harus mengenali beribu-ribu
macam molekul dalam sel melalui interaksi tiga dimensi mendetail,
yang memerlukan struktur molekul protein yang berbeda-beda dan tak
teratur. Selain kebutuhan ini, terdapat keteraturan dalam struktur pro-
tein, yang paling penting di antaranya yakni struktur sekunder.
Bab 3 Protein 105
Interior molekul protein berisi sebagian besar oleh rantai samping
hidrofob. Rantai utama dalam interior disusun dalam struktur sekunder
untuk menetralkan atom-atom polarnya melalui ikatan hidrogen.
Terdapat dua tipe utama struktur sekunder, a-heliks dan b-sheet. Beta
sheet bisa memiliki untai yang paralel, antiparalel, atau campuran.
Struktur protein dibangun oleh kombinasi elemen struktur
sekunder, a heliks, dan untai b. Elemen-elemen ini membentuk
daerah inti yakni interior molekul dan dihubungkan oleh daerah loop
pada permukaan. Diagram topologi skematik dan sederhana di mana
elemen-elemen struktur sekunder ini ditandai warna terang sangatlah
berguna dan sering digunakan. a-heliks atau untai b yang bersebelahan
dalam urutan asam amino biasanya juga berdekatan dalam struktur
tiga dimensi. Kombinasi tertentu, yang disebut motif, muncul sangat
sering, termasuk motif heliks-loop-heliks dan motif hairpin. Suatu
motif heliks-loop-heliks pengikat DNA dan motif heliks-loop-heliks
pengikat kalsium, masing-masing dengan kebutuhan urutan asam
amino dan geometri spesifiknya, digunakan dalam banyak protein
berbeda.
Motif b-a-b, yang terdiri atas dua untai b paralel digabungkan
oleh satu a-heliks, ada dalam hampir semua struktur yang memiliki
b-sheet paralel. Empat untai b antiparalel yang disusun dengan cara
spesifik membentuk motif kunci Yunani, yang sering ditemukan dalam
struktur dengan b-sheet antiparalel.
Rantai polipeptida melipat menjadi satu atau beberapa unit
terpisah, domain, yang merupakan unit fungsional dasar dan struktur
tiga dimensi. Inti domain dibangun dari kombinasi motif kecil dari
struktur sekunder, seperti motif a-loop-a, b-loop-b, atau b-a-b.
Domain dikelompokkan ke dalam tiga kelompok struktur utama:
struktur a, di mana inti dibangun hanya dari a-heliks; struktur b, yang
membentuk b sheet antiparalel; dan struktur a/b, di mana kombinasi
motif b-a-b membentuk dominasi b sheet paralel dikelilingi oleh
a-heliks.
BIOKIMIA: Struktur dan Fungsi Biomolekul 106
Interior protein bersifat hidrofob
Pada saat penelitian resolusi tinggi pada mioglobin telah ada, John
Kendrew memperhatikan bahwa asam amino dalam interior protein
memiliki rantai samping yang hampir seluruhnya hidrofob. Ini
adalah salah satu prinsip dasar penting yang pertama kali muncul
dari penelitian struktur protein. Gaya dorong utama untuk melipat
molekul protein globular terlarut dalam air adalah dengan memasang
rantai-rantai samping hidrofob di dalam interior molekul, sehingga
menciptakan inti hidrofob dan permukaan hidrofil.
Inti hidrofob ternyata penuh dengan rantai-rantai samping dalam
interior protein. Rantai-rantai samping hidrofob yang bentuknya
berbeda-beda ini posisinya harus sesuai dengan struktur sekunder
dalam interior protein, sehingga memenuhi inti. Dalam beberapa
kasus terdapat lubang dalam interior, yang biasanya diisi oleh satu atau
lebih molekul air yang berikatan hidrogen dengan gugus polar internal.
Molekul-molekul air internal yang terikat ini bisa dikatakan sebagai
bagian integral dari struktur protein.
Akan tetapi, terdapat masalah besar dengan menciptakan suatu
inti hidrofob dari rantai protein. Untuk membawa rantai samping
ke dalam inti, rantai utama juga harus melipat ke dalam interior.
Rantai utama sangatlah polar dan hidrofil, dengan satu donor ikatan
hidrogen, NH, dan satu akseptor ikatan hidrogen, C=O, pada setiap
unit peptida. Dalam lingkungan hidrofob, gugus-gugus polar rantai
utama ini harus dinetralkan oleh pembentukan ikatan hidrogen.
Masalah ini dipecahkan dengan pembentukan struktur sekunder
biasa di dalam interior molekul protein. Struktur sekunder seperti ini
biasanya merupakan salah satu dari dua tipe: alpha heliks (a-Heliks)
atau beta sheet (b- sheet). Kedua tipe ini dikarakterisasi oleh ikatan
hidrogen antara gugus NH dan C=O rantai utama, yang terbentuk
ketika sejumlah residu memiliki sudut phi (f) dan psi (y) yang sama.
Elemen struktur sekunder dibentuk dengan cara ini dan
dipertahankan oleh inti hidrofob sehingga membentuk rangka yang
kaku (rigid) dan stabil. Rangka ini hanya memiliki fleksibilitas yang
relatif kecil satu sama lainnya, dan merupakan bagian dari struktur
Bab 3 Protein 107
protein yang paling jelas ditentukan oleh teknik sinar-x maupun
NMR. Gugus-gugus fungsi pada protein menempel pada rangka ini,
baik secara langsung oleh rantai sampingnya, atau lebih sering dalam
daerah loop yang menghubungkan elemen-elemen struktur sekunder
yang berdekatan. Kini kita akan melihat lebih dekat pada elemen-
elemen struktur ini.
Alpha (a) heliks adalah elemen penting dari struktur sekunder
a-Heliks adalah elemen klasik dari struktur protein. a-Heliks pertama
kali dijelaskan pada tahun 1951 oleh Linus Pauling yang bekerja
dan meneliti pada California Institute of Technology (Caltech). Ia
memperkirakan bahwa struktur ini stabil dan disukai secara energetika
dalam protein. Ia membuat prediksi menakjubkan ini atas dasar
parameter geometris akurat yang diturunkan untuk unit peptida dari
hasil analisis kristalografi struktur pada serangkaian molekul kecil.
Prediksi ini segera mendapat dukungan eksperimen kuat dari pola
difraksi yang diperoleh oleh Max Perutz di Cambridge, Inggris, dari
kristal hemoglobin dan serat keratin. Semuanya ini diverifikasi dari
struktur mioglobin resolusi tinggi milik John Kendrew, yang semua
struktur sekundernya adalah heliks.
a-heliks dalam protein ditemukan ketika suatu bentangan residu
berurutan semuanya memiliki pasangan sudut f, y sekitar -600 dan -
500, sesuai dengan daerah yang diperbolehkan di kuadran kiri bawah
plot Ramachandran. a-Heliks memiliki 3,6 residu per putaran dengan
ikatan hydrogen antara C=O dari residu n dan NH dari residu n + 4
(Gambar 3.12). Dengan demikian semua gugus NH dan CO diikat
oleh ikatan hidrogen kecuali gugus NH pertama dan gugus CO
terakhir pada ujung a heliks. Akibatnya, ujung-ujung a-heliks bersifat
polar dan hampir selalu berada pada permukaan molekul protein.
BIOKIMIA: Struktur dan Fungsi Biomolekul 108
Protein
Biokimia: Struktur dan Fungsi Biomolekul 103
pada California Institute of Technology (Caltech). Ia memperkirakan bahwa
struktur ini stabil dan disukai secara energetika dalam protein. Ia membuat
prediksi menakjubkan ini atas dasar parameter geometris akurat yang
diturunkan untuk unit peptida dari hasil analisis kristalografi struktur pada
serangkaian molekul kecil. Prediksi ini segera mendapat dukungan eksperimen
kuat dari pola difraksi yang diperoleh oleh Max Perutz di Cambridge, Inggris,
dari kristal hemoglobin dan serat keratin. Semuanya ini diverifikasi dari struktur
mioglobin resolusi tinggi milik John Kendrew, yang semua struktur sekundernya
adalah heliks.
-heliks dalam protein ditemukan ketika suatu bentangan residu
berurutan semuanya memiliki pasangan sudut , sekitar -60
0
dan -50
0
, sesuai
dengan daerah yang diperbolehkan di kuadran kiri bawah plot Ramachandran.
-Heliks memiliki 3,6 residu per putaran dengan ikatan hydrogen antara C=O
dari residu n dan NH dari residu n + 4 (Gambar 3.12). Dengan demikian semua
gugus NH dan CO diikat oleh ikatan hidrogen kecuali gugus NH pertama dan
gugus CO terakhir pada ujung heliks. Akibatnya, ujung-ujung -heliks
bersifat polar dan hampir selalu berada pada permukaan molekul protein.
3,6 residu
A B C D
Protein
Biokimia: Struktur dan Fungsi Biomolekul 104
Gambar 3-12 -Heliks adalah salah satu elemen utama struktur sekunder dalam
protein. Atom N dan O rantai utama berikatan hidrogen satu sama lain
di dalam heliks. (a) Diagram ideal jalur rantai utama dalam heliks.
Alpha heliks seringkali diilustrasikan dengan cara ini. Terdapat 3,6
residu per putaran dalam heliks, yang berarti sepanjang 5,4 (1,5
per residu). (b) Sama seperti (a) tetapi dengan perkiraan posisi untuk
atom-atom rantai utama dan ikatan hidrogen. Anak panah menunjukkan
arah dari ujung-N ke ujung-C. (c) Diagram skematik suatu heliks.
Atom oksigen berwarna merah, dan atom N berwarna biru. Ikatan
hidrogen antara O dan N merah garis. Rantai samping ditunjukkan
dengan lingkaran ungu. (d) Model ball-and-stick salah satu -heliks
dalam mioglobin. Jalur rantai utama berwarna kuning; rantai samping
berwarna ungu. Atom-atom rantai utama tidak berwarna. (e) Satu
putaran -heliks dilihat dari sumbu heliks.
Variasi pada -heliks di mana rantai bergulung lebih longgar atau lebih
kuat, dengan ikatan hidrogen pada residu n + 5 atau n + 3 dan bukan pada n +
4 disebut sebagai heliks atau 3
10
heliks. 3
10
Heliks memiliki 3 residu per
putaran dan 10 atom di antara donor dan akseptor ikatan hidrogen. Baik
heliks maupun 3
10
heliks langka terdapat dan biasanya hanya pada ujung -
heliks atau sebagai heliks putaran tunggal. Bentuk-bentuk ini secara energetika
tidaklah disukai, karena atom-atom tulang punggungnya dikemas terlalu ketat
dalam 3
10
heliks dan terlalu longgar dalam heliks sehingga terdapat lubang di
tengahnya. Hanya dalam -heliks-lah atom-atom tulang punggungnya dikemas
sedemikian rupa membentuk struktur yang stabil.
Dalam protein globular, -heliks bervariasi panjangnya mulai dari empat
atau lima asam amino sampai lebih dari empat puluh residu. Panjang rata-
E
Gambar 3-12 a-Heliks adalah salah satu elemen utama struktur
sekunder dalam protein. Atom N dan O rantai utama berikatan hidrogen
satu sama lain di dalam a heliks. (a) Diagram ideal jalur rantai utama
dalam a heliks. Alpha heliks seringkali diilustrasikan dengan cara ini.
Terdapat 3,6 residu per putaran dalam a heliks, yang berarti sepanjang
5,4 (1,5 per residu). (b) Sama seperti (a) tetapi dengan perkiraan
posisi untuk atom-atom rantai utama dan ikatan hidrogen. Anak panah
menunjukkan arah dari ujung-N ke ujung-C. (c) Diagram skematik
suatu a heliks. Atom oksigen berwarna merah, dan atom N berwarna
biru. Ikatan hidrogen antara O dan N merah garis. Rantai samping
ditunjukkan dengan lingkaran ungu. (d) Model ball-and-stick salah satu
a-heliks dalam mioglobin. Jalur rantai utama berwarna kuning; rantai
samping berwarna ungu. Atom-atom rantai utama tidak berwarna. (e)
Satu putaran a-heliks dilihat dari sumbu heliks.
Bab 3 Protein 109
Variasi pada s-heliks di mana rantai bergulung lebih longgar
atau lebih kuat, dengan ikatan hidrogen pada residu n + 5 atau n +
3 dan bukan pada n + 4 disebut sebagai p heliks atau 3
10
heliks. 3
10

Heliks memiliki 3 residu per putaran dan 10 atom di antara donor
dan akseptor ikatan hidrogen. Baik p heliks maupun 3
10
heliks langka
terdapat dan biasanya hanya pada ujung a-heliks atau sebagai heliks
putaran tunggal. Bentuk-bentuk ini secara energetika tidaklah disukai,
karena atom-atom tulang punggungnya dikemas terlalu ketat dalam 3
10

heliks dan terlalu longgar dalam p heliks sehingga terdapat lubang di
tengahnya. Hanya dalam a-heliks-lah atom-atom tulang punggungnya
dikemas sedemikian rupa membentuk struktur yang stabil.
Dalam protein globular, a-heliks bervariasi panjangnya mulai dari
empat atau lima asam amino sampai lebih dari empat puluh residu.
Panjang rata-ratanya sekitar sepuluh residu atau tiga putaran. Jarak per
residu pada a-heliks yakni 1,5 sepanjang sumbu heliks, atau sekitar
15 dari satu ujung ke ujung lainnya pada a-heliks rata-rata.
Secara teori suatu a-heliks bisa berupa tangan kanan atau tangan
kiri tergantung pada arah perputaran rantai. Akan tetapi, a-heliks
tangan kiri tidak diperbolehkan untuk asam amino L- karena kedekatan
rantai-rantai samping dan gugus CO. Maka, a-heliks yang diamati
pada protein hampir selalu merupakan tangan kanan. Daerah pendek
a-heliks tangan kiri ( 3-5 residu) hanya kadang-kadang terdapat.
a-Heliks memiliki momen dipol
Semua ikatan hidrogen dalam suatu titik a-heliks berada dalam arah
yang sama karena unit-unit peptida berjajar dalam orientasi yang sama
sepanjang sumbu heliks. Karena satu unit peptida memiliki momen
dipol yang muncul dari perbedaan polaritas gugus NH dan CO,
momen-momen dipol ini juga berjajar di sepanjang sumbu heliks
(Gambar 3.13). Efek keseluruhannya yakni total dipol besar untuk
a-heliks yang memberikan muatan positif parsial pada ujung amino
dan muatan negatif parsial pada ujung karboksi dari a-heliks tersebut.
Besarnya momen dipol ini yakni sekitar 0,5 0,7 unit muatan pada
BIOKIMIA: Struktur dan Fungsi Biomolekul 110
tiap ujung heliks. Muatan-muatan ini diharapkan dapat menarik ligan
dengan muatan berlawanan dan ligan bermuatan negatif, terutama
jika ligan tersebut memiliki gugus fosfat dan seringkali berikatan pada
ujung-N a-heliks. Sebaliknya, ligan bermuatan positif jarang berikatan
pada ujung-C. Hal ini mungkin karena selain efek dipol, ujung-N
suatu a-heliks memiliki gugus NH bebas dengan geometri yang disukai
untuk posisi gugus fosfat oleh ikatan hidrogen tertentu (lihat Gambar
3.13). Pengikatan ligan seperti ini sering terjadi dalam protein; yang
memberikan contoh ikatan tertentu melalui konformasi rantai utama
di mana rantai samping tidak terlibat.
Beberapa asam amino lebih disukai dalam -heliks
Rantai samping asam amino diproyeksikan keluar dari a-heliks (lihat
Gambar 3.12e) dan tidak memasukinya, kecuali untuk prolin. Atom
terakhir pada rantai samping prolin terikat pada atom N rantai
utama, yang membentuk struktur linear C
a
-CH
2
-CH
2
-CH
2
-N. Hal
ini mencegah atom N untuk berpartisipasi dalam pembentukan
ikatan hidrogen dan juga memberikan suatu halangan sterik kepada
konformasi a-heliks. Prolin sangat cocok dalam putaran pertama suatu
a-heliks, tetapi biasanya menghasilkan bengkokan tajam jika berada di
tempat lain dalam heliks tersebut. Bengkokan seperti itu terjadi dalam
banyak a-heliks, bukan hanya dalam beberapa yang mengandung
prolin di tengahnya. Karena itu, meskipun kita bisa memperkirakan
bahwa residu prolin dapat menyebabkan suatu belokan dalam a-heliks,
tetapi bukan berarti bahwa semua belokan merupakan akibat dari
adanya prolin.
Beberapa macam rantai samping ternyata memiliki sifat terpilih
yang lemah tetapi pasti untuk berada dalam a-heliks atau tidak. Ala
(A), Glu (E), Leu (L), dan Met (M) adalah pembentuk a-heliks yang
baik, sedangkan Pro (P), Gly (G), Tyr (Y), dan Ser (S) sangat jelek
untuk a-heliks. Pemilihan seperti ini adalah inti bagi seluruh usaha
awal untuk memperkirakan struktur sekunder dari urutan asam amino,
tetapi tidak cukup kuat untuk memberikan prediksi yang akurat.
Bab 3 Protein 111
Protein
Biokimia: Struktur dan Fungsi Biomolekul 106
Gambar 3-13 Gugus bermuatan negatif seperti ion fosfat seringkali terikat pada ujung
amino -heliks. Momen dipol suatu -heliks sama seperti posibilitas
ikatan hidrogen pada gugus NH bebas pada ujung heliks menyukai
ikatan seperti ini. (a) Dipol satu unit peptida. Nilai dalam kotak
memberikan pendekatan muatan fraksional atom-atom dalam unit
peptida. (b) Dipol unit peptida dijajarkan sepanjang sumbu -heliks,
yang menciptakan momen dipol total untuk -heliks tersebut, positif
pada ujung amino dan negatif pada ujung karboksi. (c) Gugus fosfat
berikatan hidrogen pada ujung NH suatu -heliks.
Beberapa asam amino lebih disukai dalam -heliks
Rantai samping asam amino diproyeksikan keluar dari -heliks (lihat
Gambar 3.12e) dan tidak memasukinya, kecuali untuk prolin. Atom terakhir
pada rantai samping prolin terikat pada atom N rantai utama, yang membentuk
struktur linear C

-CH
2
-CH
2
-CH
2
-N. Hal ini mencegah atom N untuk
berpartisipasi dalam pembentukan ikatan hidrogen dan juga memberikan suatu
halangan sterik kepada konformasi -heliks. Prolin sangat cocok dalam putaran
pertama suatu -heliks, tetapi biasanya menghasilkan bengkokan tajam jika
berada di tempat lain dalam heliks tersebut. Bengkokan seperti itu terjadi
dalam banyak -heliks, bukan hanya dalam beberapa yang mengandung prolin
di tengahnya. Karena itu, meskipun kita bisa memperkirakan bahwa residu
prolin dapat menyebabkan suatu belokan dalam -heliks, tetapi bukan berarti
bahwa semua belokan merupakan akibat dari adanya prolin.
Momen dipol
fosfa
-
A
B
C
Gambar 3-13 Gugus bermuatan negatif seperti ion fosfat seringkali
terikat pada ujung amino a-heliks. Momen dipol suatu a-heliks sama
seperti posibilitas ikatan hidrogen pada gugus NH bebas pada ujung
heliks menyukai ikatan seperti ini. (a) Dipol satu unit peptida. Nilai
dalam kotak memberikan pendekatan muatan fraksional atom-atom
dalam unit peptida. (b) Dipol unit peptida dijajarkan sepanjang sumbu
a-heliks, yang menciptakan momen dipol total untuk a-heliks tersebut,
positif pada ujung amino dan negatif pada ujung karboksi. (c) Gugus
fosfat berikatan hidrogen pada ujung NH suatu a-heliks.
Lokasi yang paling banyak terdapat a-heliks dalam suatu struktur
protein yakni di sepanjang bagian luar protein, dengan satu sisi heliks
berhadapan dengan larutan dan sisi lainnya berhadapan dengan
interior hidrofob protein tersebut. Karena itu, dengan 3,6 residu
per putaran, ada kecenderungan rantai samping untuk berubah dari
hidrofob menjadi hidrofil dengan jarak tiga sampai empat residu.
Meskipun kecenderungan ini terkadang bisa terlihat dalam urutan
asam amino, tetapi tidak cukup kuat untuk prediksi struktur, karena
residu yang menghadap larutan bisa bersifat hidrofob sehingga a-heliks
bisa saja tenggelam seluruhnya dalam protein atau terlihat seluruhnya.
BIOKIMIA: Struktur dan Fungsi Biomolekul 112
Urutan berikut menunjukkan contoh-contoh urutan asam amino
yang a-heliksnya tenggelam total, tenggelam sebagian, dan terlihat
seluruhnya.
Urutan asam amino dari tiga a-heliks
1. Leu-Ser-Phe-Ala-Ala-Ala-Met-Asn-Gly-Leu-Ala-
2. Ile-Asn-Glu-Gly-Phe-Asp-Leu-Leu-Arg-Ser-Gly-
3. Lys-Glu-Asp-Ala-Lys-Gly-Lys-Ser-Glu-Glu-Glu-
Urutan pertama berasal dari enzim sitrat sintase, 260-270 residu,
yang membentuk heliks tenggelam; urutan kedua berasal dari enzim
alkohol dehidrogenase, 355-365 residu, yang membentuk heliks yang
terbuka sebagian; dan urutan ketiga dari troponin-C, 87-97 residu,
yang membentuk heliks terbuka seluruhnya. Residu bermuatan
berwarna merah, residu polar biru, dan residu hidrofob hijau.
Beta (b) sheet biasanya memiliki untai b yang paralel atau antiparalel
Unsur struktur utama yang kedua ditemukan dalam protein globular
yakni b-sheet. Struktur ini dibangun dari kombinasi beberapa daerah
rantai polipeptida, kebalikan dengan b-heliks, yang dibangun dari satu
daerah kontinu. Daerah ini, untai b, biasanya sepanjang 5 sampai 10
residu dan dalam konformasi yang hampir terbentang penuh dengan
sudut f, y di dalam daerah struktur luas yang diperbolehkan di kuadran
kiri atas pada plot Ramachandran. Untai b ini berjajar berdekatan satu
sama lain (lihat gambar 3.14 dan 3.15) sehingga ikatan hidrogen bisa
terbentuk antara gugus C=O di satu untai b dan gugus NH di untai b
sebelahnya dan sebaliknya. b Sheet yang terbentuk dari beberapa untai
bseperti ini berlipat-lipat dengan atom C
a
yang sedikit di atas dan
di bawah bidang b sheet. Rantai-rantai samping mengikuti pola ini
sehingga di dalam untai b mereka juga mengarah ke atas atau ke bawah
b sheet. Untai b bisa berinteraksi dalam dua cara untuk membentuk
lembaran berlipat-lipat. Yang pertama, asam amino dalam jajaran untai
b bisa semuanya ke arah biokimia yang sama, ujung amino ke ujung
karboksi, yang lembarannya disebut paralel. Yang kedua, asam amino
Bab 3 Protein 113
Protein
Biokimia: Struktur dan Fungsi Biomolekul 108
struktur luas yang diperbolehkan di kuadran kiri atas pada plot Ramachandran.
Untai ini berjajar berdekatan satu sama lain (lihat gambar 3.14 dan 3.15)
sehingga ikatan hidrogen bisa terbentuk antara gugus C=O di satu untai dan
gugus NH di untai sebelahnya dan sebaliknya. Sheet yang terbentuk dari
beberapa untai seperti ini berlipat-lipat dengan atom C

yang sedikit di atas


dan di bawah bidang sheet. Rantai-rantai samping mengikuti pola ini
sehingga di dalam untai mereka juga mengarah ke atas atau ke bawah
sheet.
Gambar 3-14 Ilustrasi skematik sheet antiparalel. Sheet adalah unsur utama
kedua dari struktur sekunder dalam protein. Untai bisa semuanya
antiparalel seperti dalam gambar ini atau semuanya paralel atau
campuran seperti digambarkan dalam gambar berikutnya. (a)
Konformasi terbentang suatu untai . Rantai samping ditunjukkan
sebagai lingkaran ungu. Orientasi untai adalah pada sudut kanan
pada (b) dan (c). Untai secara skematik digambarkan sebagai anak
A
B
C
D
Gambar 3-14 Ilustrasi skematik b sheet antiparalel. b Sheet adalah unsur
utama kedua dari struktur sekunder dalam protein. Untai b bisa semuanya
antiparalel seperti dalam gambar ini atau semuanya paralel atau campuran
seperti digambarkan dalam gambar berikutnya. (a) Konformasi terbentang
suatu untai b . Rantai samping ditunjukkan sebagai lingkaran ungu.
Orientasi untai b adalah pada sudut kanan pada (b) dan (c). Untai b
secara skematik digambarkan sebagai anak panah, dari ujung N ke C.
(b) Ilustrasi skematik pola ikatan hidrogen dalam b sheet antiparalel. NH
dan atom O rantai utama di dalam b sheet berikatan hidrogen satu sama
lain. (c) Versi ball-and-stick dari (b). Atom oksigen berwarna merah;
atom nitrogen berwarna biru. Atom hidrogen dalam N-HO berwarna
putih. Atom karbon dalam rantai utama, Ca, berwarna hitam. Rantai
samping digambarkan oleh satu atom ungu. Orientasi untai b berbeda
daripada dalam (a). (d) Ilustrasi lipatan b sheet. Dua untai b antiparalel
dilihat dari sisi b sheet. Perhatikan bahwa arah rantai samping, R
BIOKIMIA: Struktur dan Fungsi Biomolekul 114
di untai yang berdekatan memiliki arah berlawanan, ujung amino ke
ujung karboksi diikuti oleh ujung karboksi ke ujung amino, diikuti
oleh ujung amino ke ujung karboksi, dan seterusnya, yang lembarannya
disebut antiparalel. Masing-masing bentuk ini memiliki pola ikatan
hidrogen yang berbeda. b Sheet antiparalel (Gambar 3.14) memiliki
ruang antara pasangan ikatan hidrogen yang sempit serta ruang antar
pasangan yang lebar. b-Sheet paralel (Gambar 3.15) memiliki ruang
antara ikatan hidrogen berukuran rata-rata yang menjembatani untai b
di satu sudut. Di dalam kedua tipe b sheet semua kemungkinan ikatan
hidrogen rantai utama terbentuk, kecuali untuk dua untai b sheet yang
hanya memiliki satu untai b sebelahnya.
Untai-untai b bisa juga berkombinasi menjadi b-sheet campuran
dengan sebagian pasangan untai b paralel dan sebagian antiparalel.
Terdapat ketidakjelasan terhadap b -sheet campuran; hanya sekitar
20% untai di dalam b -sheet dari struktur protein yang telah diketahui
yang memiliki ikatan paralel di satu sisi dan ikatan antiparalel di sisi
lainnya. Gambar 3.16 mengilustrasikan bagaimana ikatan hidrogen
antara untai-untai b disusun dalam suatu b -sheet campuran.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 109
panah, dari ujung N ke C. (b) Ilustrasi skematik pola ikatan hidrogen
dalam sheet antiparalel. NH dan atom O rantai utama di dalam
sheet berikatan hidrogen satu sama lain. (c) Versi ball-and-stick dari
(b). Atom oksigen berwarna merah; atom nitrogen berwarna biru. Atom
hidrogen dalam N-HO berwarna putih. Atom karbon dalam rantai
utama, C

, berwarna hitam. Rantai samping digambarkan oleh satu


atom ungu. Orientasi untai berbeda daripada dalam (a). (d) Ilustrasi
lipatan sheet. Dua untai antiparalel dilihat dari sisi sheet.
Perhatikan bahwa arah rantai samping, R diikuti lipatanyang ditekankan.
Gambar 3-15 -Sheet paralel. (a) Diagram skematik menunjukkan pola ikatan
hidrogen dalam -sheet paralel. (b) Versi ball-and-stick dari (a).
Skema warna yang sama digunakan dalam Gambar 3.15c. (c)
Diagram skematik menggambarkan lipatan -sheet paralel.
Untai bisa berinteraksi dalam dua cara untuk membentuk lembaran
berlipat-lipat. Yang pertama, asam amino dalam jajaran untai bisa semuanya
ke arah biokimia yang sama, ujung amino ke ujung karboksi, yang lembarannya
disebut paralel. Yang kedua, asam amino di untai yang berdekatan memiliki
arah berlawanan, ujung amino ke ujung karboksi diikuti oleh ujung karboksi ke
ujung amino, diikuti oleh ujung amino ke ujung karboksi, dan seterusnya, yang
lembarannya disebut antiparalel. Masing-masing bentuk ini memiliki pola ikatan
hidrogen yang berbeda. Sheet antiparalel (Gambar 3.14) memiliki ruang
antara pasangan ikatan hidrogen yang sempit serta ruang antar pasangan yang
lebar. -Sheet paralel (Gambar 3.15) memiliki ruang antara ikatan hidrogen
berukuran rata-rata yang menjembatani untai di satu sudut. Di dalam kedua
A B
C
Gambar 3-15 b -Sheet paralel. (a) Diagram skematik menunjukkan pola
ikatan hidrogen dalam b -sheet paralel. (b) Versi ball-and-stick dari (a).
Skema warna yang sama digunakan dalam Gambar 3.15c. (c) Diagram
skematik menggambarkan lipatan b-sheet paralel.
Bab 3 Protein 115
Protein
Biokimia: Struktur dan Fungsi Biomolekul 110
tipe sheet semua kemungkinan ikatan hidrogen rantai utama terbentuk,
kecuali untuk dua untai sheet yang hanya memiliki satu untai sebelahnya.
Untai-untai bisa juga berkombinasi menjadi -sheet campuran dengan
sebagian pasangan untai paralel dan sebagian antiparalel. Terdapat
ketidakjelasan terhadap -sheet campuran; hanya sekitar 20% untai di dalam -
sheet dari struktur protein yang telah diketahui yang memiliki ikatan paralel di
satu sisi dan ikatan antiparalel di sisi lainnya. Gambar 3.16 mengilustrasikan
bagaimana ikatan hidrogen antara untai-untai disusun dalam suatu -sheet
campuran.
Gambar 3-16 (a) Ilustrasi pilinan -sheet. Untai digambar sebagai anak panah
dari ujung amino ke ujung karboksi dari untai dalam penggambaran
skematik ini dari protein tioredoksin dari E. coli pada resolusi 2,8 .
-Sheet campuran dilihat dari salah satu ujungnya. (b) Ikatan
hidrogen antara untai dalam -sheet campuran dari protein yang
sama.
Dalam struktur protein yang telah diketahui, hampir semua -sheet
paralel, antiparalel, dan campuran memiliki untai yang berpilin. Pilinan ini
selalu memiliki putaran tangan yang sama seperti yang ditunjukkan dalam
Gambar 3.16, yang didefinisikan sebagai pilinan tangan kanan.
A
B
Gambar 3-16 (a) Ilustrasi pilinan b-sheet. Untai b digambar sebagai
anak panah dari ujung amino ke ujung karboksi dari untai b dalam
penggambaran skematik ini dari protein tioredoksin dari E. coli pada
resolusi 2,8 . b -Sheet campuran dilihat dari salah satu ujungnya. (b)
Ikatan hidrogen antara untai b dalam b-sheet campuran dari protein
yang sama.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 111
Gambaran skematik struktur sekunder protein
Semua penggambaran molekul adalah versi yang disederhanakan dari
model molekul sebenarnya, yang merupakan atom-atom kuantum mekanik,
kumpulan probabilitas sama seperti partikel maupun gelombang. Hal ini sulit
untuk digambarkan. Karena itu kita menggunakan bermacam-macam tipe
penggambaran sederhana, termasuk model space-filling; model ball-and-stick,
dengan atom berbentuk bola dan ikatan berbentuk batang; dan model yang
menggambarkan sifat-sifat permukaan. Penggambaran yang paling mendetil
adalah model ball-and-stick. Akan tetapi, model struktur protein dengan semua
atom digambarkan membingungkan karena sedikitnya informasi yang tersedia
(Gambar 3.17a).
Gambar 3-17 (a) Struktur mioglobin memperlihatkan semua atom sebagai lingkaran
kecil yang dihubungkan oleh garis lurus. Meskipun hanya rantai
samping di permukaan molekul yang diperlihatkan, gambar ini memiliki
banyak atom sehingga penggambaran dua dimensi seperti ini sangat
membingungkan dan sangat sedikit informasi yang bisa didapat darinya.
A
C
D
A
B
Gambar 3-17 (a) Struktur mioglobin memperlihatkan semua atom
sebagai lingkaran kecil yang dihubungkan oleh garis lurus. Meskipun
hanya rantai samping di permukaan molekul yang diperlihatkan, gambar
ini memiliki banyak atom sehingga penggambaran dua dimensi seperti
ini sangat membingungkan dan sangat sedikit informasi yang bisa
didapat darinya. (b-d) Diagram skematik yang dibuat komputer dengan
derajat penyederhanaan berbeda untuk struktur mioglobin.
BIOKIMIA: Struktur dan Fungsi Biomolekul 116
Dalam struktur protein yang telah diketahui, hampir semua b-sheet
paralel, antiparalel, dan campuran memiliki untai yang berpilin.
Pilinan ini selalu memiliki putaran tangan yang sama seperti yang
ditunjukkan dalam Gambar 3.16, yang didefinisikan sebagai pilinan
tangan kanan.
Gambaran skematik struktur sekunder protein
Semua penggambaran molekul adalah versi yang disederhanakan
dari model molekul sebenarnya, yang merupakan atom-atom
kuantum mekanik, kumpulan probabilitas sama seperti partikel
maupun gelombang. Hal ini sulit untuk digambarkan. Karena itu
kita menggunakan bermacam-macam tipe penggambaran sederhana,
termasuk model space-filling; model ball-and-stick, dengan atom
berbentuk bola dan ikatan berbentuk batang; dan model yang
menggambarkan sifat-sifat permukaan. Penggambaran yang paling
mendetil adalah model ball-and-stick. Akan tetapi, model struktur
protein dengan semua atom digambarkan membingungkan karena
sedikitnya informasi yang tersedia (Gambar 3.17a).
Gambar dua dimensi model seperti ini tidak mungkin diinterpre-
tasikan. Bahkan jika atom-atom rantai samping dilepaskan, masih sulit
untuk mendapat informasi berarti dari gambar datar model seperti itu,
terutama karena sulit untuk melihat hubungan antara unsur-unsur
struktur sekunder. Karena elemen-elemen ini mendominasi struktur,
gambar akan menjadi lebih jelas jika disederhanakan dan ditandai den-
gan suatu cara. Hal ini biasanya dilakukan dengan menggambarkan
jalur rantai polipeptida dengan tiga macam simbol: silinder untuk b
-heliks; panah untuk untai b, yang memberikan arah untai dari ujung
amino ke ujung karboksi; dan pita untuk bagian sisanya. Diagram ske-
matik seperti ini memberikan gambar yang bagus dan sangat berguna
akan struktur protein, tetapi tanpa informasi detil. Detilnya paling baik
dipelajari dengan sistem grafik yang bisa dimanipulasi modelnya yang
dibuat oleh komputer pada layar; dengan cara ini kekuatan alat grafik
membuatnya mungkin untuk mempelajari lebih banyak detail.
Bab 3 Protein 117
Protein
Biokimia: Struktur dan Fungsi Biomolekul 112
(b-d) Diagram skematik yang dibuat komputer dengan derajat
penyederhanaan berbeda untuk struktur mioglobin.
Gambar dua dimensi model seperti ini tidak mungkin diinterpretasikan.
Bahkan jika atom-atom rantai samping dilepaskan, masih sulit untuk mendapat
informasi berarti dari gambar datar model seperti itu, terutama karena sulit
untuk melihat hubungan antara unsur-unsur struktur sekunder. Karena elemen-
elemen ini mendominasi struktur, gambar akan menjadi lebih jelas jika
disederhanakan dan ditandai dengan suatu cara. Hal ini biasanya dilakukan
dengan menggambarkan jalur rantai polipeptida dengan tiga macam simbol:
silinder untuk -heliks; panah untuk untai , yang memberikan arah untai dari
ujung amino ke ujung karboksi; dan pita untuk bagian sisanya. Diagram
skematik seperti ini memberikan gambar yang bagus dan sangat berguna akan
struktur protein, tetapi tanpa informasi detil. Detilnya paling baik dipelajari
dengan sistem grafik yang bisa dimanipulasi modelnya yang dibuat oleh
komputer pada layar; dengan cara ini kekuatan alat grafik membuatnya
mungkin untuk mempelajari lebih banyak detail.
Gambar 3-18 Contoh diagram skematik untuk tipe yang dipelopori oleh Jane
Richardson. Diagram (a) mengilustrasikan struktur mioglobin dalam
orientasi yang sama seperti diagram buatan komputer pada Gambar
2.9b-d. Diagram (b), yang diambil dari J. Richardson, mengilustrasikan
struktur enzim triosefosfat isomerase, yang ditentukan pada resolusi 2,5
dalam laboratorium David Phillips, Oxford University. Diagram seperti
ini bisa dengan mudah didapat dari database struktur protein, seperti
PDB, SCOP atau CATH.
A
B
Gambar 3-18 Contoh diagram skematik untuk tipe yang dipelopori
oleh Jane Richardson. Diagram (a) mengilustrasikan struktur mioglobin
dalam orientasi yang sama seperti diagram buatan komputer pada
Gambar 2.9b-d. Diagram (b), yang diambil dari J. Richardson,
mengilustrasikan struktur enzim triosefosfat isomerase, yang ditentukan
pada resolusi 2,5 dalam laboratorium David Phillips, Oxford
University. Diagram seperti ini bisa dengan mudah didapat dari database
struktur protein, seperti PDB, SCOP atau CATH.
Diagram topologi berguna untuk klasifikasi struktur protein
Untuk tujuan tertentu lebih enak jika melihat penggambaran skematik
yang lebih sederhana untuk elemen struktur sekunder, terutama
untuk b -sheet. Fitur paling karakteristik dari b-sheet adalah jumlah
untai, arah relatif (paralel atau antiparalel), dan bagaimana untai-
untai dihubungkan sepanjang rantai polipeptida. Informasi ini bisa
dengan mudah didapat melalui diagram sederhana panah-panah yang
berhubungan seperti dalam Gambar 3.19, yang diagram topologi
sederhana seperti itu dibandingkan dengan diagram Richardson yang
lebih lengkap. Pilinan b-sheet tidak digambarkan dalam diagram
topologi ini. Namun demikian, diagram ini sangat membantu jika
digunakan untuk membandingkan struktur b dan untuk analisa dan
menampilkan data dalam pencarian database komputer untuk struktur-
struktur serupa.
BIOKIMIA: Struktur dan Fungsi Biomolekul 118
Protein
Biokimia: Struktur dan Fungsi Biomolekul 114
Gambar 3-19 -Sheet biasanya digambarkan hanya dengan panah dalam diagram
topologi yang menunjukkan arah tiap untai dan bagaimana untai
tersebut dihubungkan satu sama lain sepanjang rantai polipeptida.
Diagram topologi seperti ini di sini dibandingkan dengan diagram
skematik yang lebih lengkap untuk berbagai tipe -sheet. (a) Empat
untai. -Sheet antiparalel dalam satu domain dari enzim aspartat
transkarbamoilase. Struktur enzim ini telah ditentukan pada resolusi 2,8
. (b) Lima untai. -Sheet paralel dalam protein redoks flavodoksin,
yang strukturnya telah ditentukan pada resolusi 1,8 . (c) Delapan
untai. Dinding antiparalel dalam pembawa elektron plastosianin.
Motif hairpin sering muncul dalam struktur protein
Motif paling sederhana yang melibatkan untai , lebih sederhana
daripada motif pengikat kalsium -heliks, yakni dua untai antiparalel
bersebelahan dihubungkan oleh satu loop. Motif ini, yang disebut hairpin atau
unit -, muncul cukup sering; yang terdapat dalam kebanyakan struktur
Gambar 3-19 b -Sheet biasanya digambarkan hanya dengan panah
dalam diagram topologi yang menunjukkan arah tiap untai b dan
bagaimana untai tersebut dihubungkan satu sama lain sepanjang
rantai polipeptida. Diagram topologi seperti ini di sini dibandingkan
dengan diagram skematik yang lebih lengkap untuk berbagai tipe b -
sheet. (a) Empat untai. b -Sheet antiparalel dalam satu domain dari
enzim aspartat transkarbamoilase. Struktur enzim ini telah ditentukan
pada resolusi 2,8 . (b) Lima untai. b -Sheet paralel dalam protein
redoks flavodoksin, yang strukturnya telah ditentukan pada resolusi 1,8
. (c) Delapan untai. Dinding antiparalel dalam pembawa elektron
plastosianin.
Bab 3 Protein 119
Motif hairpin b sering muncul dalam struktur protein
Motif paling sederhana yang melibatkan untai b , lebih sederhana
daripada motif pengikat kalsium a-heliks, yakni dua untai antiparalel
bersebelahan dihubungkan oleh satu loop. Motif ini, yang disebut
hairpin atau unit b-b, muncul cukup sering; yang terdapat dalam
kebanyakan struktur b antiparalel baik sebagai pita terisolasi maupun
sebagai bagian dari b -sheet yang lebih kompleks. Terdapat pemilihan
kuat untuk untai-untaib untuk bersebelahan dalam b-sheet ketika
bersebelahan dalam urutan asam amino dan untuk membentuk motif
hairpin b (atau b hairpin). Panjang daerah loop antara untai b bervariasi
tetapi biasanya sepanjang dua sampai lima residu. Tidak ada fungsi
khusus yang berkaitan dengan motif ini.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 115
antiparalel baik sebagai pita terisolasi maupun sebagai bagian dari -sheet
yang lebih kompleks. Terdapat pemilihan kuat untuk untai-untai untuk
bersebelahan dalam -sheet ketika bersebelahan dalam urutan asam amino
dan untuk membentuk motif hairpin (atau hairpin). Panjang daerah loop
antara untai bervariasi tetapi biasanya sepanjang dua sampai lima residu.
Tidak ada fungsi khusus yang berkaitan dengan motif ini.
Gambar 3.20 menunjukkan contoh dari kedua kasus, pita terisolasi dan
sheet. Pita terisolasi diilustrasikan oleh struktur inhibitor bovine tripsin (Gambar
3.20a), suatu polipeptida kecil yang sangat stabil sepanjang 58 asam amino
yang menginhibisi aktivitas tripsin protease pencernaan. Struktur ini telah
ditentukan pada resolusi 1,0 dalam laboratorium Robert Huber di Munich,
Jerman. Motif hairpin sebagai bagian dari sheet diperlihatkan oleh struktur
bisa ular, erabutoxin (Gambar 3.20b), yang mengikat dan menginhibisi reseptor
asetilkolin dalam sel syaraf. Strukturnya telah ditentukan pada resolusi 1,4 .
Inti struktur ini adalah sheet yang terdiri atas lima untai yang mengandung
dua motif hairpin dan satu untai tambahan.
Gambar 3-20 Motif hairpin sangat sering dalam -sheet dan dibangun dari dua untai
bersebelahan yang dihubungkan oleh daerah loop. Dua contoh motif
seperti ini diperlihatkan. (a) Diagram skematik struktur inhibitor bovine
tripsin. Motif hairpin (b) Diagram skematik struktur bisa ular
erabutoksin. Dua motif hairpin di dalam -sheet.
A
B
Gambar 3-20 Motif hairpin sangat sering dalam b -sheet dan dibangun
dari dua untai b bersebelahan yang dihubungkan oleh daerah loop. Dua
contoh motif seperti ini diperlihatkan. (a) Diagram skematik struktur
inhibitor bovine tripsin. Motif hairpin (b) Diagram skematik struktur
bisa ular erabutoksin. Dua motif hairpin di dalam b -sheet.
Gambar 3.20 menunjukkan contoh dari kedua kasus, pita terisolasi
dan b sheet. Pita terisolasi diilustrasikan oleh struktur inhibitor bovine
tripsin (Gambar 3.20a), suatu polipeptida kecil yang sangat stabil
sepanjang 58 asam amino yang menginhibisi aktivitas tripsin protease
pencernaan. Struktur ini telah ditentukan pada resolusi 1,0 dalam
laboratorium Robert Huber di Munich, Jerman. Motif hairpin sebagai
BIOKIMIA: Struktur dan Fungsi Biomolekul 120
bagian dari b sheet diperlihatkan oleh struktur bisa ular, erabutoxin
(Gambar 3.20b), yang mengikat dan menginhibisi reseptor asetilkolin
dalam sel syaraf. Strukturnya telah ditentukan pada resolusi 1,4 . Inti
struktur ini adalah b sheet yang terdiri atas lima untai yang mengandung
dua motif hairpin dan satu untai b tambahan.
Motif b-a-b terdiri atas dua untai b paralel
Motif hairpin adalah cara sederhana dan sering digunakan untuk
menghubungkan dua untai b antiparalel, karena ujung-ujung yang
terhubung dalam untai b terletak berdekatan pada ujung yang sama
dari b -sheet. Bagaimana untai b paralel terhubung? Jika dua untai
bersebelahan dalam urutan asam amino, kedua ujungnya yang harus
terhubung berada pada ujung berlawanan dari b -sheet. Rantai
polipeptida harus melintasi b -sheet dari satu ujung ke ujung lainnya
dan menghubungkan untai b berikutnya dekat dengan titik di mana
untai b pertama dimulai. Koneksi crossover seperti ini seringkali dibuat
oleh a -heliks. Rantai polipeptida harus berputar dua kali menggunakan
daerah loop, dan motif yang terbentk yakni untai b diikuti oleh loop, b
-heliks, loop lagi, dan, akhirnya, untai b kedua.
Motif ini disebut motif beta-alpha-beta, b-a-b (Gambar 3.21)
dan ditemukan sebagai bagian dari hampir semua struktur protein yang
memiliki b-sheet paralel. Sebagai contoh, molekul yang diperlihatkan
dalam triosefosfat isomerase, seluruhnya dibangun oleh perulangan
kombinasi motif ini, dengan dua motif membagi satu untai b. Ini bisa
juga disebut sebagai dibangun dari empat motif b-a-b-a berurutan.
a-Heliks dalam motif b-a-b menghubungkan ujung karboksi
dari satu untai b dengan ujung amino dari untai b berikutnya (lihat
Gambar 3.21) dan biasanya terorientasi sedemikian rupa sehingga
sumbu heliks kira-kira paralel terhadap untai b. a-Heliks terkemas
terhadap untai b sehingga melindungi residu hidrofob pada untai b
dari larutan. Maka motif b-a-b terdiri atas dua untai b paralel, satu
a-heliks, dan dua daerah loop (kecuali dalam beberapa kasus hubungan
antara dua untai b-paralel bukan a-heliks melainkan rantai polipeptida
dengan struktur tak beraturan). Daerah loop bisa memiliki panjang
Bab 3 Protein 121
yang sangat berbeda, dari satu atau dua residu sampai lebih dari seratus.
Kedua loop memiliki fungsi yang berbeda. Loop (Gambar 3.21) yang
menghubungkan ujung karboksi dari untai b dengan ujung amino dari
a-heliks sering terlibat dalam pembentukan sisi ikatan fungsional, atau
sisi aktif, dari struktur-struktur ini. Daerah-daerah loop ini biasanya
memiliki urutan asam amino tertentu dalam protein homolog.
Sebaliknya, loop lainnya belum diketahui terlibat dalam sisi aktif.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 116
Motif -- terdiri atas dua untai paralel
Motif hairpin adalah cara sederhana dan sering digunakan untuk
menghubungkan dua untai antiparalel, karena ujung-ujung yang terhubung
dalam untai terletak berdekatan pada ujung yang sama dari -sheet.
Bagaimana untai paralel terhubung? Jika dua untai bersebelahan dalam
urutan asam amino, kedua ujungnya yang harus terhubung berada pada ujung
berlawanan dari -sheet. Rantai polipeptida harus melintasi -sheet dari satu
ujung ke ujung lainnya dan menghubungkan untai berikutnya dekat dengan
titik di mana untai pertama dimulai. Koneksi crossover seperti ini seringkali
dibuat oleh -heliks. Rantai polipeptida harus berputar dua kali menggunakan
daerah loop, dan motif yang terbentk yakni untai diikuti oleh loop, -heliks,
loop lagi, dan, akhirnya, untai kedua.
Motif ini disebut motif beta-alpha-beta, -- (Gambar 3.21) dan
ditemukan sebagai bagian dari hampir semua struktur protein yang memiliki -
sheet paralel. Sebagai contoh, molekul yang diperlihatkan dalam triosefosfat
isomerase, seluruhnya dibangun oleh perulangan kombinasi motif ini, dengan
dua motif membagi satu untai . Ini bisa juga disebut sebagai dibangun dari
empat motif --- berurutan.
Gambar 3-21 Dua untai paralel yang bersebelahan biasanya dihubungkan oleh satu
-heliks dari ujung-C untai 1 kepada ujung-N untai 2. Kebanyakan
struktur protein yang mengandung -sheet paralel dibangun dari
kombinasi motif -- seperti ini. Anak panah menunjukkan untai ,
dan silinder menunjukkan heliks. (a) Diagram skematik jalur rantai
utama. (b) Diagram topologi motif --.
-Heliks dalam motif -- menghubungkan ujung karboksi dari satu
untai dengan ujung amino dari untai berikutnya (lihat Gambar 3.21) dan
A
B
Gambar 3-21 Dua untai b paralel yang bersebelahan biasanya
dihubungkan oleh satu a-heliks dari ujung-C untai 1 kepada ujung-
N untai 2. Kebanyakan struktur protein yang mengandung b-sheet
paralel dibangun dari kombinasi motif b-a-b seperti ini. Anak panah
menunjukkan untai b, dan silinder menunjukkan heliks. (a) Diagram
skematik jalur rantai utama. (b) Diagram topologi motif b-a-b.
Motif b-a-b bisa dikatakan sebagai putaran heliks longgar dari
satu untai b, mengelilingi ikatan, dan masuk ke untai b berikutnya.
Maka motif ini pada prinsipnya bisa mempunyai dua macam tangan
(Gambar 3.22). Intinya, tiap motif b-a-b dalam struktur protein yang
diketahui ternyata memiliki tangan yang sama sebagai a-heliks tangan
kanan sehingga disebut tangan kanan. Tidak ada penjelasan meyakinkan
untuk keteraturan ini, meskipun itulah satu-satunya aturan umum yang
menjelaskan bagaimana tiga elemen struktur sekunder disusun relatif
satu dengan lainnya. Aturan tangan ini memiliki akibat fungsional dan
struktural penting ketika beberapa motif ini dihubungkan menjadi
struktur domain.
BIOKIMIA: Struktur dan Fungsi Biomolekul 122
Protein
Biokimia: Struktur dan Fungsi Biomolekul 117
biasanya terorientasi sedemikian rupa sehingga sumbu heliks kira-kira paralel
terhadap untai . -Heliks terkemas terhadap untai sehingga melindungi
residu hidrofob pada untai dari larutan. Maka motif -- terdiri atas dua untai
paralel, satu -heliks, dan dua daerah loop (kecuali dalam beberapa kasus
hubungan antara dua untai -paralel bukan -heliks melainkan rantai
polipeptida dengan struktur tak beraturan). Daerah loop bisa memiliki panjang
yang sangat berbeda, dari satu atau dua residu sampai lebih dari seratus.
Kedua loop memiliki fungsi yang berbeda. Loop (Gambar 3.21) yang
menghubungkan ujung karboksi dari untai dengan ujung amino dari -heliks
sering terlibat dalam pembentukan sisi ikatan fungsional, atau sisi aktif, dari
struktur-struktur ini. Daerah-daerah loop ini biasanya memiliki urutan asam
amino tertentu dalam protein homolog. Sebaliknya, loop lainnya belum
diketahui terlibat dalam sisi aktif.
Motif -- bisa dikatakan sebagai putaran heliks longgar dari satu untai
, mengelilingi ikatan, dan masuk ke untai berikutnya. Maka motif ini pada
prinsipnya bisa mempunyai dua macam tangan (Gambar 3.22). Intinya, tiap
motif -- dalam struktur protein yang diketahui ternyata memiliki tangan yang
sama sebagai -heliks tangan kanan sehingga disebut tangan kanan. Tidak
ada penjelasan meyakinkan untuk keteraturan ini, meskipun itulah satu-satunya
aturan umum yang menjelaskan bagaimana tiga elemen struktur sekunder
disusun relatif satu dengan lainnya. Aturan tangan ini memiliki akibat
fungsional dan struktural penting ketika beberapa motif ini dihubungkan menjadi
struktur domain.
Gambar 3-22 Motif -- pada prinsipnya bisa memiliki dua tangan. (a) Hubungan
ini dengan heliks di atas sheet ditemukan dalam hampir semua protein
dan disebut tangan kanan karena memiliki tangan yang sama seperti -
A
B
Gambar 3-22 Motif b-a-b pada prinsipnya bisa memiliki dua
tangan. (a) Hubungan ini dengan heliks di atas sheet ditemukan dalam
hampir semua protein dan disebut tangan kanan karena memiliki tangan
yang sama seperti a-heliks tangan kanan. (b) Hubungan tangan kiri
dengan heliks di bawah sheet.
Molekul protein diorganisasikan dalam hierarki struktur
Biokimiawan Denmark Kai Linderstrm-Lang memberikan istilah
struktur primer, sekunder, dan tertier untuk menekankan hierarki
struktur dalam protein. Struktur primer adalah urutan asam amino,
atau dengan kata lain, susunan asam amino sepanjang rantai polipeptida
linier. Dua macam protein yang memiliki banyak persamaan dalam
struktur primernya dikatakan homolog satu sama lain, dan karena
urutan DNAnya juga sangat mirip, biasanya diasumsikan bahwa kedua
protein tersebut berkaitan secara evolusionaritas, bahwa keduanya telah
berevolusi dari suatu gen leluhur yang sama.
Struktur sekunder terdapat sebagian besar sebagai a-heliks dan
untai b. Pembentukan struktur sekunder dalam daerah lokal pada
rantai polipeptida untuk tujuan tertentu ditentukan oleh struktur
primer. Urutan asam amino tertentu memilih a-heliks atau untai b;
yang lainnya memilih pembentukan daerah loop. Elemen-elemen
struktur sekunder biasanya menata dirinya sendiri dalam motif
sederhana, seperti yang telah dijelaskan sebelumnya. Motif dibentuk
dengan mengemas rantai samping dari b-heliks atau untai b berdekatan
satu sama lain.
Bab 3 Protein 123
Beberapa motif biasanya bergabung untuk membentuk struktur
globular kompak, yang disebut domain. Dalam buku ini kita akan
menggunakan istilah struktur tertier sebagai istilah umum baik untuk
cara motif disusun menjadi struktur domain maupun untuk cara suatu
rantai polipeptida tunggal melipat menjadi satu atau beberapa domain.
Dalam penelitian telah ditemukan bahwa jika terdapat homologi
urutan asam amino yang besar dalam dua domain di protein yang
berbeda, domain-domain ini memiliki struktur tertier serupa.
Molekul protein yang hanya memiliki satu rantai disebut protein
monomer. Namun sejumlah besar protein memiliki struktur kuaterner,
yang terdiri atas beberapa rantai polipeptida identik (subunit) yang
bergabung menjadi molekul multimer dengan cara tertentu. Subunit-
subunit ini bisa berfungsi secara independen satu sama lain maupun
secara kerjasama sehingga fungsi satu subunit tergantung pada keadaan
fungsional subunit lain. Molekul protein lain disusun dari beberapa
macam subunit dengan fungsi yang berbeda; sebagai contoh, RNA
polymerase dari E. coli mengandung lima macam rantai polipeptida.
Domain dibangun dari motif struktur
Domain dibentuk oleh bermacam kombinasi elemen struktur sekunder
dan motif. a-Heliks dan untai b dari motif berdekatan satu sama lain
dalam struktur tiga dimensi dan dihubungkan oleh daerah loop. Motif
bersebelahan, atau motif yang dibentuk dari daerah struktur primer
berurutan dari suatu rantai polipeptida, biasanya saling berdekatan
dalam struktur tiga dimensinya (Gambar 3.23). Maka untuk pendekatan
pertama suatu rantai polipeptida bisa dianggap sebagai penataan
berurutan dari motif-motif sederhana ini. Jumlah kombinasi seperti
ini yang ditemukan dalam protein terbatas, dan sebagian kombinasi
tampak disukai secara struktural. Maka struktur domain serupa sering
muncul dalam protein berbeda dengan fungsi yang berbeda pula dan
dengan urutan asam amino yang sama sekali berbeda.
BIOKIMIA: Struktur dan Fungsi Biomolekul 124
Protein
Biokimia: Struktur dan Fungsi Biomolekul 119
Molekul protein lain disusun dari beberapa macam subunit dengan fungsi yang
berbeda; sebagai contoh, RNA polymerase dari E. coli mengandung lima
macam rantai polipeptida.
Domain dibangun dari motif struktur
Domain dibentuk oleh bermacam kombinasi elemen struktur sekunder
dan motif. -Heliks dan untai dari motif berdekatan satu sama lain dalam
struktur tiga dimensi dan dihubungkan oleh daerah loop. Motif bersebelahan,
atau motif yang dibentuk dari daerah struktur primer berurutan dari suatu rantai
polipeptida, biasanya saling berdekatan dalam struktur tiga dimensinya
(Gambar 3.23). Maka untuk pendekatan pertama suatu rantai polipeptida bisa
dianggap sebagai penataan berurutan dari motif-motif sederhana ini. Jumlah
kombinasi seperti ini yang ditemukan dalam protein terbatas, dan sebagian
kombinasi tampak disukai secara struktural. Maka struktur domain serupa
sering muncul dalam protein berbeda dengan fungsi yang berbeda pula dan
dengan urutan asam amino yang sama sekali berbeda.
Gambar 3-23 Motif yang bersebelahan dalam urutan asam amino juga biasanya
bersebelahan dalam struktur tiga dimensi. Triosefosfat isomerase
dibangun dari empat motif --- yang berurutan baik dalam urutan
asam amino (a) maupun dalam struktur tiga dimensi (b).
A
B
Gambar 3-23 Motif yang bersebelahan dalam urutan asam amino juga
biasanya bersebelahan dalam struktur tiga dimensi. Triosefosfat isomerase
dibangun dari empat motif b-a-b-a yang berurutan baik dalam
urutan asam amino (a) maupun dalam struktur tiga dimensi (b).
Struktur protein bisa dibagi ke dalam tiga kelompok utama
Atas dasar pertimbangan sederhana motif yang berhubungan, Michael
Levitt dan Cyrus Chothia dari MRC Laboratory of Molecular Biology
menurunkan taksonomi struktur protein dan mengelompokkan
struktur domain ke dalam tiga kelompok utama: domain a, domain b,
dan domain a/b. Dalam struktur a, inti dibangun hanya dari a heliks;
dalam struktur b, inti terdiri atas b sheet antiparalel dan biasanya
merupakan dua b sheet dikemas berhadapan satu sama lain. Struktur
a/b dibuat dari kombinasi motif b-a-b yang membentuk dominasi b
sheet paralel dikelilingi oleh a-heliks.
Sebagian protein dibangun dari kombinasi motif a dan b yang
terpisah dan biasanya membentuk satu b sheet antiparalel kecil di satu
bagian domain yang dikemas terhadap sejumlah a heliks. Struktur
ini bisa dianggap termasuk dalam kelompok keempat yang kecil yang
Bab 3 Protein 125
disebut a + b. Selain kelompok-kelompok ini, terdapat sejumlah
protein kecil yang kaya akan ikatan disulfida atau atom logam dan
membentuk kelompok khusus. Struktur protein ini tampak sangat
dipengaruhi oleh adanya logam atau disulfida dan seringkali seperti
versi distorsi dari protein yang lebih umum.
Dalam buku ini domain dengan struktur protein yang diketahui
dikelompokkan menurut skema Levitt dan Chothia. Pengelompokkan
Cyrus Chothia telah membuat suatu database di mana semua struktur
protein yang tersedia disusun menurut hierarki ini. Di dalam tiap
kelompok, struktur disusun dalam superfamili menurut struktur
tertiernya dan, di dalam superfamili, dalam famili menurut fungsi dan
homologi urutan.
6. HOMOLOGI URUTAN DAN EVOLUSI PROTEIN
Protein myoglobin berfungsi sebagai pengikat oksigen dalam otot.
Protein ini termasuk yang pertama kali dipelajari dengan bantuan
kristalografi sinar-x, yang menunjukkan struktur globular yang kompak
yang terdiri atas delapan segmen a heliks dihubungkan melalui segmen
nonheliks pendek.
Hemoglobin adalah protein pembawa oksigen dalam darah
vertebrata. Struktur hemoglobin serupa dengan struktur myoglobin.
Bedanya, hemoglobin tersusun oleh empat rantai dengan struktur
kuaterner. Keempat rantai tersebut ditahan oleh interaksi-interaksi
nonkovalen dalam suatu penataan geometris tertentu. Terdapat dua
tipe utama rantai polipeptida hemoglobin, yaitu rantai a dan rantai b.
Rantai polipeptida myoglobin dan kedua tipe rantai hemoglobin
sangatlah mirip baik dalam struktur primer maupun struktur
tertiernya. Kedua protein tersebut dikatakan homolog. Myoglobin
memiliki 153 residu, rantai a hemoglobin memiliki 141 residu, dan
rantai b hemoglobin memiliki146 residu. Urutan ini identik di 24 dari
141 posisi dalam protein manusia, dengan banyak perbedaan yang
menunjukkan conservative replacement. Hal ini berarti suatu residu
asam amino dalam salah satu rantai telah diganti oleh residu yang
BIOKIMIA: Struktur dan Fungsi Biomolekul 126
mirip pada posisi yang sesuai dalam rantai lain, misalnya penggantian
glutamat oleh aspartat.
Perbandingan urutan asam amino rantai hemoglobin dan myoglobin
dari berbagai spesies hewan menunjukkan bahwa rantai-rantai yang
berasal dari spesies yang berkerabat adalah serupa. Jumlah perbedaan
meningkat seiring makin terpisahnya spesies menurut filogenetik.
Dengan asumsi bahwa protein berkembang dengan laju konstan, maka
jumlah perbedaan antara dua protein homolog akan sebanding dengan
waktu penyimpangan dalam evolusi spesies tersebut.
7. PREDIKSI, REKAYASA, DAN RANCANGAN STRUKTUR PROTEIN
Dalam waktu lebih dari 3 milyar tahun, berbagai macam molekul
protein telah berevolusi menjadi mesin kompleks dari sel dan organisme.
Molekul-molekul ini telah berkembang dengan perubahan acak pada
gen oleh mutasi titik, exon shuffling, rekombinasi dan transfer gen
antar spesies, dalam kombinasi dengan seleksi alam untuk produk gen
yang telah memiliki keuntungan fungsional yang membantu dalam
keselamatan organisme individu.
Jauh sebelum Darwin dan Wallace mengajukan teori evolusi dan
Mendel menemukan hukum genetika, petani dan peternak telah mulai
mencampuri proses evolusi dalam spesies yang menghasilkan hewan
ternak dan tanaman pangan. Dengan kurangnya pengetahuan mengenai
teori evolusi dan genetika, pencapaian mereka, dengan mendorong
kecepatan dan menggulingkan seleksi alam, adalah hasil mengesankan.
Dengan munculnya genetika molekul dan dalam teknik-teknik
tertentu untuk manipulasi gen, kini kita telah memasuki era eksploitasi
genetik pada organisme yang tidak pernah dibayangkan 50 tahun yang
lalu. Kini kita dapat merancang gen-gen untuk memproduksi, dalam
organisme peliharaan, produk gen baru untuk keuntungan manusia;
kita tidak lagi terbatas untuk menyeleksi gen-gen yang berguna dari
mutasi. Akan tetapi, kita hanya pada awal era baru ini, dan sejauh ini
kita baru menggores permukaan pengetahuan yang diperlukan untuk
rekayasa sebenarnya dan rancangan molekul protein. Kita membedakan
Bab 3 Protein 127
rekayasa protein, yang diartikan memutasikan gen suatu protein yang
ada sebagai usaha untuk mengubah fungsinya dengan cara yang bisa
diperkirakan, dari rancangan protein, yang mempunyai tujuan lebih
ambisius untuk merancang de novo suatu protein untuk memenuhi
fungsi yang diinginkan.
Proyek genom kini telah menyediakan penjelasan urutan lengkap
semua gen dalam lebih dari selusin organisme, dan akan menyediakan
lebih banyak lagi urutan genom lengkap dalam dekade berikutnya,
termasuk genom manusia. Database ini memberian kesempatan
besar untuk analisis dan eksploitasi gen serta proteinnya. Inti dari
keuntungan komersil dan intelektual dari informasi genetika ini adalah
kemampuan untuk menentukan fungsi produk gen individu. Hampir
semua peranan fungsional kini didasarkan atas persamaan urutan
dengan protein yang fungsinya telah diketahui.
Pengetahuan akan struktur tertier protein adalah penting untuk
mengerti dan merekayasa fungsinya. Sayangnya, selain dari keuntungan
teknologi tinggi masa kini, penentuan secara eksperimen suatu struktur
tertier masih berlangsung lambat dibanding dengan laju akumulasi
data urutan asam amino. Hal ini membuat masalah pelipatan, prediksi
tepat struktur tertier protein dari urutan asam aminonya, menjadi
inti bagi kecepatan progres dalam post-genomic biologi. Karena itu,
dalam pembahasan ini kita pertama-tama akan menjelaskan implikasi
homologi protein dan metode untuk prediksi struktur sekunder dan
tertier sebelum memberikan contoh-contoh rekayasa protein dan
rancangan protein.
Protein homolog memiliki struktur dan fungsi serupa
Istilah homologi seperti digunakan dalam konteks biologi didefinisikan
sebagai kesamaan struktur, fisiologi, perkembangan, dan evolusi
organisme berdasarkan atas faktor-faktor genetika yang sama.
Pernyataan bahwa dua protein merupakan homolog menandakan
bahwa gen keduanya telah berevolusi dari satu gen leluhur yang sama.
Protein-protein homolog sebagian besar dikenali oleh kesamaan
yang begitu banyak dalam urutan asam aminonya. Biasanya, mereka
BIOKIMIA: Struktur dan Fungsi Biomolekul 128
juga memiliki fungsi yang serupa meskipun terdapat beberapa penge-
cualian, yang mana gen untuk enzim-enzim leluhur telah diambil pada
tahap akhir dalam evolusi untuk menghasilkan protein dengan fungsi
yang berbeda. Suatu contoh diberikan oleh salah satu komponen struk-
tur dalam lensa mata yang homolog dengan enzim glikolisis leluhur
laktat dehidrogenase. Sekali gen baru telah dikloning dan diurutkan,
pencarian kesamaan urutan asam amino di antara protein yang sesuai
dan urutan protein lain harus dilakukan. Biasanya, hal ini dilakukan
dengan membandingkan dengan database urutan protein yang dike-
tahui menggunakan salah satu program komputer pengurutan standar.
Dua protein dianggap homolog jika memiliki residu asam amino
identik dalam sejumlah besar posisi berurutan sepanjang rantai
polipeptida. Menggunakan metode statistik berdasar atas perbandingan
urutan acak yang dihasilkan komputer, relatif langsung bisa mengetahui
berapa posisi yang harus identik untuk identitas statistik antara dua
urutan. Akan tetapi, sering ditemukan dua protein dengan identitas
urutan di bawah level statistik memiliki fungsi serupa dan struktur
tiga dimensi juga serupa. Dalam hal ini, residu-residu yang penting
secara fungsional adalah identik dan biasanya residu-residu seperti
ini membentuk pola urutan atau motif yang bisa digunakan untuk
mengidentifikasi protein lain yang termasuk dalam famili fungsional
yang sama. Seringkali, anggota famili seperti ini juga dianggap homolog,
meskipun identitasnya tidak statistik, hanya fungsional. Database
untuk famili seperti ini, berdasarkan pada motif urutan identik atau
serupa, tersedia dalam World Wide Web dan sangat berguna untuk
menentukan fungsi protein baru.
Jika urutan asam amino identitas ditemukan dalam protein yang
struktur kristalnya diketahui, model tiga dimensi untuk protein baru
bisa disusun, menggunakan pemodelan komputer, atas dasar urutan
dan struktur tiga dimensi yang diketahui. Model ini lalu dapat berperan
sebagai dasar yang bagus untuk identifikasi residu asam amino yang
terlibat dalam sisi aktif atau dalam epitop antigen, dan model ini bisa
digunakan untuk rekayasa protein, rancangan obat, atau penelitian
imunologi.
Bab 3 Protein 129
Karena database urutan berukuran besar dan tumbuh secara
eksponensial, saat ini memiliki lebih dari 500.000 urutan protein,
maka program pengurutan standar telah dirancang untuk memberikan
pilihan antara kecepatan dan ketepatan pencarian. Hasilnya, hanya
bekerja dengan baik ketika terdapat identitas urutan derajat tinggi,
biasanya 30% atau lebih. Program yang jauh lebih sensitif yang telah
dibuat dapat mencari identitas maupun sifat struktur serta untuk
keterkaitan dalam sifat fisik berbeda, namun membutuhkan jauh lebih
banyak waktu di depan komputer. Penggunaan hati-hati, program
seperti ini dapat mengidentifikasi kesamaan struktur dan fungsi yang
gagal dilakukan oleh program standar.
Pengetahuan mengenai struktur sekunder diperlukan untuk prediksi struktur
tertier
Apa yang bisa dilakukan oleh metode prediktif jika pencarian urutan
gagal untuk mengungkapkan homologi apapun dalam suatu protein
dengan struktur tertier yang sudah diketahui? Mungkinkah untuk
memodelkan struktur tertier dari urutan asam amino saja? Tidak ada
metode masa kini untuk melakukan hal ini dan memperoleh model
yang cukup detil untuk bisa digunakan, sebagai contoh, dalam rancangan
obat dan rekayasa protein. Akan tetapi, hal ini merupakan area yang
sangat aktif dalam penelitian dan hasil yang cukup menjanjikan sedang
diperoleh; dalam beberapa kasus dimungkinkan untuk memprediksi
tepat tipe protein, a, b, atau a/b, dan bahkan untuk menurunkan
perkiraan lipatan yang tepat.
Metode prediktif saat ini bergantung pada prediksi struktur
sekunder: dengan kata lain, yang mana residu asam amino a-heliks dan
mana yang merupakan untai b. Struktur sekunder secara umum tidak
bisa diprediksi dengan derajat keyakinan tinggi dengan pengecualian
yang mungkin pada heliks transmembran dan kumparan a-heliks. Hal
ini menimbulkan keterbatasan dasar dalam prediksi struktur tertier.
Sekali struktur sekunder tepat diketahui, kita cukup mengetahui
tentang aturan untuk mengemas elemen-elemen struktur sekunder
BIOKIMIA: Struktur dan Fungsi Biomolekul 130
satu sama lain untuk menurunkan dengan jumlah yang sangat terbatas
kemungkinan lipatan globular stabil. Akibatnya, prediksi struktur
sekunder terdapat pada jantung prediksi struktur tertier dari urutan
asam amino.
Sayangnya untuk metode prediktif, struktur sekunder dan tertier
berkaitan erat dalam hal bahwa struktur tertier global mempengaruhi
struktur sekunder lokal setidaknya di sebagian daerah rantai polipeptida.
Kemampuan urutan pendek tertentu asam amino untuk membentuk
heliks, untai b, atau daerah loop tergantung bukan hanya pada urutan
daerah tersebut tetapi juga pada lingkungannya dalam struktur tiga
dimensi. Sebagai contoh, dengan menganalisis semua struktur tertier
yang telah diketahui, terlihat bahwa daerah peptida sampai sepanjang
lima residu dengan urutan asam amino identik merupakan a-heliks
dalam satu struktur dan untai b atau loop dalam struktur yang lain.
Meskipun saling ketergantungan antara struktur sekunder dan tertier
ini menyulitkan prediksi struktur sekunder, namun kadangkala bisa
digunakan untuk mengembangkan prediksi seperti itu, dengan suatu
skema di mana penentuan awal struktur sekunder digunakan untuk
memprediksi tipe struktur domain, sebagai contoh, kumpulan empat
heliks atau lapisan a/b. Tipe struktur domain menyebabkan tambahan
kecocokan pada kemungkinan struktur sekunder, yang bisa digunakan
untuk memperbaiki prediksi struktur sekunder.
Metode prediksi untuk keuntungan struktur sekunder dari jajaran protein
homolog
Lebih dari 20 macam metode telah diajukan untuk prediksi struktur
sekunder; yang bisa dikategorikan dalam dua kelompok besar. Metode
statistik empiris menggunakan parameter yang diperoleh dari analisis
struktur tertier dan urutan yang diketahui. Semua metode seperti ini
berdasarkan atas asumsi bahwa urutan lokal dalam daerah pendek
pada rantai polipeptida menentukan struktur lokal; seperti yang telah
kita lihat, ini bukanlah asumsi yang bisa diterapkan secara universal.
Kelompok metode kedua berdasarkan atas kriteria stereokimia, seperti
Bab 3 Protein 131
kekompakan bentuk dengan inti hidrofob yang dikemas rapat dan
permukaan polar.
Meskipun ketiga metode ini menggunakan pendekatan yang cukup
berbeda pada masalah tersebut, namun keakuratan prediksi struktur
sekundernya kurang lebih sama. Ketiga metode bisa digunakan untuk
menentukan salah satu dari tiga keadaan pada tiap residu: a heliks,
untai b, atau loop. Penentuan acak ketiga keadaan ini pada residu dalam
rantai polipeptida akan menghasilkan nilai rata-rata 33% keadaan yang
diprediksi tepat. Metode-metode ini telah digunakan dalam analisis
urutan tunggal dari sejumlah besar struktur sinar-x yang diketahui
yang terdiri atas lebih dari 10.000 residu. Untuk definisi tiga keadaan
struktur sekunder, keakuratan keseluruhan prediksi adalah sekitar 55%.
Penentuan objektif lain juga memberikan hasil yang sama.
Akan tetapi, ketika metode prediktif ini digunakan pada
serangkaian protein homolog, kekuatan prediktifnya jadi lebih tinggi.
Asumsi yang mendasari yakni bahwa struktur sekunder dan tertier lebih
dipertahankan selama evolusi daripada urutan asam amino; dengan
kata lain, hanya perubahan seperti itu yang tersisa selama evolusi yang
mempertahankan struktur tersebut. Akibatnya, pola perubahan residu
di dalam protein homolog mengandung informasi spesifik mengenai
struktur tersebut. Residu hidrofob yang dipertahankan biasanya berada
dalam interior protein dengan probabilitas tinggi sebagai heliks atau
untai sheet. Insersi dan delesi hampir selalu terjadi dalam daerah loop
dan bukan dalam lipatan yang dibangun dari heliks dan untai.
Beberapa program kini tersedia menggunakan jajaran protein
homolog untuk prediksi struktur sekunder. Salah satu program, yang
disebut PHD, yang dikembangkan oleh Chris Sander dan kawan-
kawan, EMBL, Heidelberg, telah mencapai rata-rata akurasi prediksi
sebesar 72% untuk struktur baru.
Bagian besar kesalahan (error) yang tersisa berada pada ujung a-
heliks untai b dan sebagai tambahan, sebagian error muncul karena
kesulitan dalam membedakan antara a-heliks dan untai b. Error
seperti ini bisa dikoreksi jika kelompok struktur, a, b, atau a/b,
bisa didapat dari kombinasi penelitian fisik, sebagai contoh, spektra
BIOKIMIA: Struktur dan Fungsi Biomolekul 132
dikroisme sirkular, dan fitur umum prediksi struktur sekunder. Sebagai
contoh, jika skema prediksi menetapkan satu atau dua a- heliks
pendek di antara banyak untai dalam suatu protein dari kelompok
b, maka terdapat probabilitas tinggi bahwa daerah struktur sekunder
tersebut intinya diprediksi dengan tepat namun seharusnya semuanya
merupakan untai b.
Metode-metode prediktif ini sangat berguna dalam banyak
konteks; sebagai contoh, dalam perancangan polipeptida baru untuk
identifikasi kemungkinan epitop antigen, dalam analisis motif yang
sama dalam urutan yang mengarahkan protein menjadi organel
tertentu (misalnya, mitokondria), dan untuk menyediakan model awal
untuk prediksi struktur tertier.
Banyak urutan asam amino berbeda membentuk struktur tiga dimensi yang
serupa
Berapa banyak urutan asam amino yang sama sekali berbeda yang dapat
membentuk struktur tiga dimensi serupa untuk domain berukuran
rata-rata dari 150 residu asam amino? Perhitungan kombinasi
sederhana menunjukkan bahwa terdapat total 20150 atau kasarnya
10200 kemungkinan urutan asam amino untuk domain seperti itu,
dari 20 macam asam amino dalam protein alami. Jumlah ini jauh
lebih besar daripada jumlah atom dalam alam semesta yang diketahui.
Perhitungan lebih luas menunjukkan bahwa dari 10200 kemungkinan
kombinasi ini kita bisa mengambil sekitar 1038 anggotanya yang
memiliki kurang dari 20% identitas urutan asam amino satu sama lain
sehingga bisa dianggap memiliki urutan yang berbeda. Dengan kata
lain, terdapat 1038 macam cara untuk membangun suatu domain
dari 150 asam amino menggunakan 20 asam amino standar sebagai
penyusunnya (building blocks). Kita tidak tahu berapa banyak dari
jumlah ini yang bisa membentuk struktur tiga dimensi stabil, namun
dengan asumsi bahwa satu dari semilyar (109) itu bisa, maka tinggal
1029 kemungkinan lipatan protein. Pada bagian sebelumnya kita telah
melihat bahwa motif struktur sederhana menata dirinya sendiri menjadi
Bab 3 Protein 133
sejumlah terbatas struktur domain yang berbeda secara topologi. Telah
diperkirakan dengan alasan yang masuk akal bahwa terdapat sekitar
1000 struktur domain yang berbeda secara topologi. Karena terdapat
1029 kemungkinan urutan berbeda yang dapat melipat menjadi
103 macam struktur, maka terdapat 1026 macam penataan rantai
samping dengan kurang dari 20% identitas urutan asam amino yang
bisa membentuk lipatan polipeptida serupa. Hanya bagian kecil dari
kemungkinan protein ini yang akan ditemukan di alam.
Untuk setiap 500 atau lebih macam struktur domain yang
sejauh ini telah diamati, kita bisa mengetahui sekitar selusin dari
kemungkinan urutan berbeda ini. Bukanlah trivial untuk mengenali
pola urutan umum yang sama untuk struktur domain tertentu dari
dasar pengetahuan yang terbatas seperti ini.
Prediksi struktur protein dari urutan adalah masalah tak terpecahkan
Bagaimana memprediksi struktur tiga dimensi suatu protein dari
urutan asam aminonya adalah masalah utama yang tak terpecahkan
dalam struktur biologi molekul. Kita akan menggunakan program
komputer yang bisa memberikan simulasi proses yang berjalan dalam
tabung reaksi atau sel hidup ketika suatu rantai polipeptida dengan
urutan asam amino tertentu melipat menjadi struktur tiga dimensi yang
tepat. Mengapa prediksi pelipatan protein ini begitu sulit? Jawabannya
biasanya diformulasikan dalam istilah kompleksitas pencarian melalui
semua kemungkinan konformasi rantai polipeptida untuk menemukan
yang berenergi rendah. Membutuhkan begitu banyak waktu di depan
komputer, selain dari kesulitan yang dibahas dalam perbedaan energi
antara molekul terlipat yang stabil dan keadaan tak terlipatnya adalah
angka yang kecil tetapi mengandung error yang besar.
Dengan realisasi bahwa hanya terdapat jumlah terbatas lipatan
stabil dan banyak urutan tak berkaitan yang memiliki lipatan yang
sama, para ilmuwan komputasi yang berorientasi biologi mulai melirik
apa yang disebut masalah pelipatan kebalikan; pola urutan mana yang
cocok dengan lipatan tertentu? Jika pertanyaan ini bisa dijawab, pola
BIOKIMIA: Struktur dan Fungsi Biomolekul 134
seperti ini bisa digunakan untuk mencari melalui database urutan
genom dan mengambil urutan-urutan yang memiliki lipatan tertentu,
seperti lapisan a/b atau lipatan imunoglobulin.
Akan tetapi, dengan sejumlah besar kemungkinan urutan yang tak
berkaitan untuk tiap lipatan dan jumlah terbatas urutan yang diketahui,
variasi dari masalah ini kini dialami oleh banyak kelompok; misalnya,
yang mana dari lipatan yang telah diketahui, jika ada, yang paling cocok
dengan urutan tertentu? Metodologi yang digunakan disebut sebagai
threading karena melibatkan pengaluran urutan tertentu melalui
semua lipatan yang diketahui dan untuk tiap lipatan memperkirakan
probabilitas bahwa urutan tersebut mempunyai lipatan itu. Progres
besar kini telah diraih dalam threading, dan dalam blind test beberapa
struktur telah diprediksikan dengan tepat oleh kelompok-kelompok
yang berbeda.
Metode threading bisa menentukan urutan asam amino kepada lipatan tiga
dimensi yang diketahui
Metode threading, yang juga disebut sebagai penentuan lipatan
protein atau pengenalan lipatan, merupakan area yang menjanjikan
dan berkembang dengan cepat dalam komputasi struktur biologi.
Tujuannya yakni untuk menentukan bagi tiap urutan protein yang
diturunkan dari genom untuk melipat menjadi lipatan yang paling
cocok, atau untuk menentukan ada tidaknya lipatan yang diketahui
yang cocok dengan urutan tersebut. Tujuan selanjutnya yakni untuk
menjajarkan urutan baru dengan tepat pada struktur tiga dimensi
lipatan yang cocok untuk menghasilkan model resolusi rendah. Untuk
menguji berbagai metode threading, blind test disiapkan, yang disebut
sebagai Critical Assessment of Structure Prediction (CASP), di mana
partisipan diberikan urutan dan diundang untuk memprediksi lipatan
dan membuat penjajaran sebelum struktur tersebut ditentukan secara
eksperimen. Di sini kita akan menjelaskan metode yang digunakan
oleh salah satu partisipan yang berhasil dalam uji ini, kelompok David
Eisenberg dari University of California, Los Angeles.
Bab 3 Protein 135
Kebutuhan yang pertama untuk threading adalah memiliki
database semua macam lipatan protein yang telah diketahui. Eisenberg
telah menggunakan pustakanya sendiri yang berisi sekitar 800 lipatan,
yang merepresentasikan setidaknya lebih dari 6000 simpanan struktur
di Protein Data Bank. Kelompok lain menggunakan database yang
tersedia di World Wide Web, di mana lipatan disusun secara hierarki
menurut kesamaan struktur dan fungsi, seperti SCOP, yang dirancang
oleh Alexey Murzin dan Cyrus Chothia di Cambridge, Inggris.
Untuk tiap lipatan dicari penjajaran terbaik dari urutan target yang
cocok dengan lipatan tersebut; inti harus memiliki residu hidrofob dan
residu polar harus berada di luar, daerah heliks dan untai yang diprediksi
harus dijajarkan sesuai dengan elemen-elemen struktur sekunder dalam
lipatan, dan seterusnya. Untuk mencocokkan penjajaran urutan dengan
lipatan, Eisenberg mengembangkan metode cepat yang disebut sebagai
metode 3D profil. Lingkungan tiap posisi residu dalam struktur 3D
yang diketahui dikarakterisasi atas dasar tiga sifat:
(1) Area rantai samping yang ditutupi oleh atom-atom protein lain,
(2) Bagian dari area rantai samping yang ditutupi oleh atom-atom
polar, dan
(3) Struktur sekunder, yang dikelompokkan dalam tiga keadaan:
heliks, sheet, dan coil.
Posisi residu kemudian dapat dibagi menjadi enam kelompok
oleh sifat 1 dan 2, yang berkombinasi dengan sifat 3 menghasilkan
18 kelompok lingkungan. Klasifikasi lingkungan ini memungkinkan
struktur protein untuk dikode oleh urutan dalam 18 huruf alfabet,
yang tiap hurufnya melambangkan kelompok lingkungan dari suatu
posisi residu.
Masing-masing dari 20 macam asam amino memiliki pemilihan
yang berbeda untuk masing-masing dari 18 kelompok lingkungan;
misalnya Leu lebih memilih berada dalam kelompok heliks dengan
bagian besar area rantai samping terkubur, sedangkan Asp sangat
tidak memilih posisi tersebut. Nilai numerik untuk pemilihan ini,
disebut nilai 3D-1D, diturunkan dari serangkaian struktur protein
BIOKIMIA: Struktur dan Fungsi Biomolekul 136
resolusi tinggi, bersama dengan rangkaian urutan yang serupa dengan
urutan struktur 3D. Ini menghasilkan tabel penilaian yang untuk
tiap kelompok lingkungan suatu nilai numerik pemilihan dikaitkan
dengan masing-masing dari 20 asam amino. Tabel ini digunakan untuk
membuat tabel 3D profil dari struktur protein, di mana tiap posisi
residu berada dalam kelompok lingkungan dengan nilai numeriknya
untuk pemilihan untuk tiap tipe asam amino. Inti dari metode ini
yakni struktur tiga dimensi direduksi menjadi susunan satu dimensi,
yang memfasilitasi pencocokan pada urutan satu dimensi.
Urutan asam amino target dijajarkan terhadap profil struktur ini
sedemikian rupa sehingga pasangan yang paling mungkin nilai total
tertinggi diperoleh, memungkinkan gaps dan insersi. Penjajaran
seperti ini secara konseptual serupa dengan penjajaran dua urutan dan
metode serupa telah digunakan. Pencocokan urutan dengan profil
struktur 3D untuk lipatan tertentu diekspresikan secara kuantitatif
oleh suatu nilai yang disebut sebagai Z-score, yang merupakan angka
standar deviasi di atas rata-rata nilai penjajaran untuk urutan lain yang
panjangnya sama. Nilai Z-score tinggi berarti terdapat probabilitas
tinggi bahwa urutan tersebut memiliki lipatan itu.
Metode-metode yang dijelaskan di sini selanjutnya telah dikem-
bangkan dan diperluas oleh Eisenberg, namun pada prinsipnya tetap
sama. Kelompok lain menggunakan metode berbeda untuk screening
penjajaran urutan-urutan dan kriteria berbeda untuk menilai kecoco-
kan. Manfred Sippl dari University of Salzburg, Austria, telah mengem-
bangkan serangkaian potensial untuk screening dan penilaian penja-
jaran, intinya yakni untuk memaksimalkan jumlah interaksi hidrofob
dan untuk meminimalkan jumlah atom polar terkubur yang tidak ber-
partisipasi dalam ikatan hidrogen. Potensial ini dan potensial yang se-
rupa kini digunakan oleh banyak kelompok dalam program threading
mereka. Lipatan yang tepat dapat diprediksi dengan probabilitas cukup
tinggi untuk protein berukuran kecil dan sedang. Namun penjajaran
yang tepat suatu urutan pada lipatan yang terpilih kurang akurat.
Bab 3 Protein 137
Protein bisa dibuat lebih stabil melalui rekayasa
Rekayasa protein, melalui site-directed mutagenesis DNA, bisa
digunakan untuk menjawab pertanyaan yang sangat spesifik tentang
stabilitas protein, dan hasil dari penelitian ini kini sedang digunakan
untuk meningkatkan stabilitas enzim yang penting dalam industri.
Untuk mengilustrasikan sebagian faktor yang penting untuk stabilitas
protein yang telah diungkapkan dalam penelitian rekayasa protein.
Lisozim dari bakteriofag T4 merupakan rantai polipeptida
sepanjang 164 asam amino yang melipat menjadi dua domain. Tidak
ada jembatan disulfida; dua residu sistein dalam urutan asam amino,
Cys 54 dan Cys 97, jauh terpisah dalam struktur terlipat. Stabilitas
protein wild-type maupun protein mutan diekspresikan sebagai titik
leleh, Tm, yang merupakan suhu ketika 50% enzim terinaktivasi selama
denaturasi panas reversibel. Untuk lisozim T4 wild-type Tm-nya yakni
41,90 C.
Kita akan membahas tiga macam pendekatan untuk merekayasa
protein yang lebih termostabil daripada lisozim T4 wild-type, yakni (1)
mengurangi perbedaan entropi antara protein terlipat dan tak terlipat,
yang dalam prakteknya berarti mengurangi jumlah konformasi dalam
keadaan tak terlipat, (2) menstabilkan a-heliks, dan (3) meningkatkan
jumlah interaksi hidrofob dalam inti interior.
Jembatan disulfida meningkatkan stabilitas protein
Semakin besar jumlah konformasi tak terlipat dari suatu protein, maka
makin tinggi energi entropi pelipatan protein itu menjadi keadaan
dasar tunggalnya. Dengan demikian, mengurangi jumlah konformasi
tak terlipat meningkatkan stabilitas keadaan dasar. Cara yang paling
jelas untuk menurunkan jumlah konformasi tak terlipat adalah dengan
memasukkan ikatan disulfida baru atas dasar pengetahuan akan
struktur tertier protein terlipat. Semakin panjang loop di antara residu-
residu sistein, maka makin terbatas rantai polipeptida tak terlipat,
memberikan lebih banyak stabilisasi struktur terlipat. Namun untuk
merancang jembatan seperti itu bukanlah pekerjaan sederhana, karena
BIOKIMIA: Struktur dan Fungsi Biomolekul 138
geometri jembatan CH
2
-S-S-CH
2
- dalam protein memiliki batasan
konformasi yang cukup sempit, dan deviasi dari geometri ini akan
menyebabkan untai menjadi struktur terlipat sehingga mengurangi
stabilitas dan bukan meningkatkannya. Karena itu, tidak cukup untuk
memilih acak dua residu yang berdekatan dalam ruang untuk membuat
jembatan, namun perekayasa protein harus hati-hati memilih pasangan
residu dengan konformasi rantai utama yang memenuhi kondisi yang
dibutuhkan untuk jembatan disulfida.
Mathews membuat perbandingan yang sangat hati-hati antara
geometri 295 jembatan disulfida dalam struktur sinar-x yang sudah
diketahui dengan kemungkinan pasangan residu asam amino yang cukup
dekat satu sama lain dalam struktur lisozim T4 untuk mempermudah
jembatan disulfida. Hal ini diikuti dengan minimalisasi energi pada
kandidat jembatan disulfida yang paling baik serta analisis stabilisasi
interaksi yang terdapat dalam struktur wild-type yang akan hilang oleh
mutasi pada residu Cys. Kehilangan seperti ini harus diminimalkan.
Tiga kandidat jembatan disulfida tersisa setelah penyaringan ini,
salah satunya, Cys 3 Cys 97, memiliki salah satu residu sistein (Cys
97) yang terdapat dalam wild type. Lima residu asam amino Ile 3,
Ile 9, Thr 21, Thr 142, dan Leu 164 (lihat Gambar 3.24 berikut)
dimutasi menjadi residu Cys dalam eksperimen terpisah sehingga
semua jembatan disulfida tunggal (3-97, 9-164, dan 21-142) dan juga
kombinasi ikatan disulfida double dan triple dapat terbentuk. Selain
itu, residu Cys kedua dari enzim wild-type, Cys 54, dimutasi menjadi
Thr untuk menghindari pembentukan jembatan disulfida yang salah
selama pelipatan.
Bab 3 Protein 139
Protein
Biokimia: Struktur dan Fungsi Biomolekul 133
diminimalkan. Tiga kandidat jembatan disulfida tersisa setelah penyaringan ini,
salah satunya, Cys 3 Cys 97, memiliki salah satu residu sistein (Cys 97) yang
terdapat dalam wild type. Lima residu asam amino Ile 3, Ile 9, Thr 21, Thr
142, dan Leu 164 (lihat Gambar 3.24 berikut) dimutasi menjadi residu Cys
dalam eksperimen terpisah sehingga semua jembatan disulfida tunggal (3-97,
9-164, dan 21-142) dan juga kombinasi ikatan disulfida double dan triple dapat
terbentuk. Selain itu, residu Cys kedua dari enzim wild-type, Cys 54, dimutasi
menjadi Thr untuk menghindari pembentukan jembatan disulfida yang salah
selama pelipatan.
Gambar 3-24. Rantai peptida lisozim dari bakteriofage T4 yang melipat menjadi 2
domain. Domain terminal N merupakan tipe + .
Glisin dan prolin memiliki efek berlawanan pada stabilitas
Residu glisin memiliki lebih banyak kebebasan konformasi daripada
asam amino yang lain. Residu glisin pada posisi tertentu dalam protein
biasanya hanya memiliki satu konformasi dalam struktur terlipat namun bisa
memilii banyak konformasi berbeda dalam struktur tak terlipat yang berbeda
Gambar 3-24. Rantai peptida lisozim dari bakteriofage T4 yang melipat
menjadi 2 domain. Domain terminal N merupakan tipe a + b.
Glisin dan prolin memiliki efek berlawanan pada stabilitas
Residu glisin memiliki lebih banyak kebebasan konformasi daripada
asam amino yang lain. Residu glisin pada posisi tertentu dalam protein
biasanya hanya memiliki satu konformasi dalam struktur terlipat
namun bisa memilii banyak konformasi berbeda dalam struktur tak
terlipat yang berbeda pula dari protein yang sama sehingga berperan
dalam keanekaragaman konformasi tak terlipat. Di sisi lain, residu
prolin memiliki lebih sedikit kebebasan konformasi dalam struktur tak
terlipat daripada residu lainnya karena rantai samping prolin kaku oleh
adanya tambahan ikatan kovalen pada rantai utama. Cara lain untuk
menurunkan jumlah kemungkinan struktur tak terlipat suatu protein,
sehingga menstabilkan struktur awal yakni dengan mutasi residu glisin
menjadi residu lain dan meningkatkan jumlah residu prolin. Mutasi
seperti ini hanya dapat dibuat pada posisi yang tidak mengubah
konformasi rantai utama struktur terlipat maupun menyebabkan
kontak tak disukai, atau menyebabkan hilangnya kontak yang disukai
dengan rantai samping yang bersebelahan.
BIOKIMIA: Struktur dan Fungsi Biomolekul 140
Kedua tipe mutasi telah dibuat dalam lisozim T4. Mutasi terpilih
yakni Gly 77 Ala, yang menyebabkan meningkatnya Tm sebesar 10
C, dan Ala 82 Pro, yang meningkatkan Tm sebesar 20 C. Struktur
tiga dimensi enzim mutan ini juga ditentukan: mutan Ala 82 Pro
memiliki struktur yang pada dasarnya identik dengan wild type kecuali
untuk rantai samping residu 82; hal ini sangat mengindikasikan bahwa
efek pada Tm dari Ala 82 Pro adalah dikarenakan perubahan entropi.
Efek seperti ini diharapkan bersifat aditif, sehingga meskipun tiap
mutasi hanya memberikan sedikit kontribusi untuk meningkatkan
stabilitas, tetapi efek gabungan dari sejumlah mutasi seperti ini akan
sangat meningkatkan stabilitas protein.
Menstabilkan dipol-dipol pada a-heliks meningkatkan stabilitas
Dalam pembahasan sebelumnya kita telah dijelaskan a-heliks sebagai
dipol dengan muatan positif pada ujung N dan muatan negatif pada
ujung C. Ion negatif, seperti gugus fosfat dalam koenzim atau substrat,
biasanya terikat pada ujung positif dipol heliks. a-Heliks yang bukan
bagian dari sisi ikatan sering memiliki rantai samping bermuatan
negatif pada ujung N atau residu bermuatan positif pada ujung C
yang berinteraksi dengan dipole heliks tersebut. Residu dengan dipol
menstabilkan bentuk heliks pada peptida sintetik kecil dalam larutan.
Apakah residu penstabil heliks ini juga berperan dalam keseluruhan
stabilitas protein globular? Dari 11 a-heliks pada lisozim T4, 7 heliks
memiliki residu bermuatan negatif dekat dengan ujung N; dua dari
empat a-heliks sisanya dipilih untuk penelitian rekayasa untuk
menjawab pertanyaan ini (Gambar 3.25).
Dua macam protein mutan dengan substitusi tunggal pada ujung
N dari masing-masing heliks Ser 38 Asp dan Asn 144 Asp, dibuat
seperti juga mutan double. Mutan tunggal keduanya menunjukkan
peningkatan Tm sekitar 2
0
C; efeknya aditif karena mutan double me-
miliki Tm kira-kira 4
0
C lebih tinggi daripada wild type. Nilai ini se-
banding dengan 1,6 kcal/mol energi stabilisasi. Dari struktur sinar-x
mutan-mutan ini tampak bahwa stabilisasi tersebut dikarenakan in-
Bab 3 Protein 141
teraksi elektrostatik dan bukan karena ikatan hidrogen spesifik antara
asam amino tersubstitusi dan ujung heliks. Alan Fersht di Cambridge,
Inggris, telah menunjukkan, menggunakan sistem yang berbeda, ribo-
nuklease bakteri kecil, barnase, bahwa residu histidin pada ujung C he-
liks menstabilkan struktur barnase sebesar sekitar 2,1 kca/mol. Dengan
demikian, stabilisasi tinggi pada struktur a-heliks mungkin diperoleh
dengan menggabungkan beberapa mutasi penstabil heliks seperti ini.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 135
-heliks sisanya dipilih untuk penelitian rekayasa untuk menjawab pertanyaan
ini (Gambar 3.25).
Gambar 3-25 Struktur lisozim T4 yang menunjukkan lokasi terjadinya 2 mutasi yang
menstabilkan struktur protein melalui interaksi elektrostatik dengan
dipol-dipol pada -heliks.
Dua macam protein mutan dengan substitusi tunggal pada ujung N dari
masing-masing heliks Ser 38 Asp dan Asn 144 Asp, dibuat seperti juga
mutan double. Mutan tunggal keduanya menunjukkan peningkatan Tm sekitar
2
0
C; efeknya aditif karena mutan double memiliki Tm kira-kira 4
0
C lebih tinggi
daripada wild type. Nilai ini sebanding dengan 1,6 kcal/mol energi stabilisasi.
Dari struktur sinar-x mutan-mutan ini tampak bahwa stabilisasi tersebut
dikarenakan interaksi elektrostatik dan bukan karena ikatan hidrogen spesifik
antara asam amino tersubstitusi dan ujung heliks. Alan Fersht di Cambridge,
Inggris, telah menunjukkan, menggunakan sistem yang berbeda, ribonuklease
bakteri kecil, barnase, bahwa residu histidin pada ujung C heliks menstabilkan
struktur barnase sebesar sekitar 2,1 kca/mol. Dengan demikian, stabilisasi
tinggi pada struktur -heliks mungkin diperoleh dengan menggabungkan
beberapa mutasi penstabil heliks seperti ini.
Gambar 3-25 Struktur lisozim T4 yang menunjukkan lokasi terjadinya
2 mutasi yang menstabilkan struktur protein melalui interaksi
elektrostatik dengan dipol-dipol pada a-heliks.
Lipatan struktur bisa dikurangi ukurannya dengan fungsi tetap
sama.
Dalam sebagian besar protein, hanya sedikit residu yang
langsung terlibat dalam ikatan ligan atau reseptor; sisa dari proteinnya
membentuk struktur tiga dimensi pada posisi yang tepat bagian
fungsional dari molekul. James Wells dan kawan-kawan di Genentech
telah menggunakan phage display untuk mengetahui apakah ikatan
epitop bisa ditransfer pada lipatan yang lebih kecil. Ini merupakan
pertanyaan yang menarik karena lipatan protein seringkali terlihat
BIOKIMIA: Struktur dan Fungsi Biomolekul 142
lebih besar daripada yang diperlukan, dan juga produksi protein yang
berguna paling efisien jika protein tersebut berukuran kecil. Residu
ke-59 domain Z membentuk kumpulan tiga-heliks antiparalel yang
mengikat pada bagian Fc dari IgG dengan tetapan disosiasi (Kd)
sebesar 20 nM. Epitop pengikat Fc bersifat diskontinu, melibatkan
residu dari heliks 1 serta heliks 2. Heliks ketiga tidak berhubungan
dengan Fc, tetapi diperlukan untuk menjaga struktur domain pengikat.
Minimisasi domain Z mempunyai masalah rancangan yang sulit: versi
yang lebih kecil harus menjaga penempatan tiga dimensi yang tepat
untuk gugus fungsional yang tidak berdekatan dalam urutan. Terlebih
lagi, struktur protein yang lebih kecil dari 50 residu relatif jarang, dan
hanya baru-baru ini terdapat peptida 30 residu yang dirancang sebagai
domain stabil (lihat gambar 3-26).
Protein
Biokimia: Struktur dan Fungsi Biomolekul 136
Lipatan struktur bisa dikurangi ukurannya dengan fungsi tetap sama
Dalam sebagian besar protein, hanya sedikit residu yang langsung
terlibat dalam ikatan ligan atau reseptor; sisa dari proteinnya membentuk
struktur tiga dimensi pada posisi yang tepat bagian fungsional dari molekul.
James Wells dan kawan-kawan di Genentech telah menggunakan phage
display untuk mengetahui apakah ikatan epitop bisa ditransfer pada lipatan
yang lebih kecil. Ini merupakan pertanyaan yang menarik karena lipatan
protein seringkali terlihat lebih besar daripada yang diperlukan, dan juga
produksi protein yang berguna paling efisien jika protein tersebut berukuran
kecil. Residu ke-59 domain Z membentuk kumpulan tiga-heliks antiparalel yang
mengikat pada bagian Fc dari IgG dengan tetapan disosiasi (Kd) sebesar 20
nM. Epitop pengikat Fc bersifat diskontinu, melibatkan residu dari heliks 1 serta
heliks 2. Heliks ketiga tidak berhubungan dengan Fc, tetapi diperlukan untuk
menjaga struktur domain pengikat. Minimisasi domain Z mempunyai masalah
rancangan yang sulit: versi yang lebih kecil harus menjaga penempatan tiga
dimensi yang tepat untuk gugus fungsional yang tidak berdekatan dalam
urutan. Terlebih lagi, struktur protein yang lebih kecil dari 50 residu relatif
jarang, dan hanya baru-baru ini terdapat peptida 30 residu yang dirancang
sebagai domain stabil (lihat gambar 3-26, berikut ini).
Gambar 3-26 Konstruksi 2 heliks pada domain Z.
.
A
B
heliks 1
heliks 2
heliks 3
IgG-Fc
exoface intraface
interface
Gambar 3-26 Konstruksi 2 heliks pada domain Z.
Andrew Braisted dan J.A. Wells membuat phage yang mengandung
heliks 1 dan 2 domain Z dan mengembalikan ikatan Fc dari minidomain
38 residu ini dalam tiga tahap (lihat Gambar 3-26). Peptida pertama-
tama diacak di empat residu hidrofob yang menghubungkan heliks
3 dalam domain Z lengkap. Urutan konsensus dari pustaka ini
mempertahankan residu wild type Ile 17 dan Leu 23 sedangkan residu
hidrofob Leu 20 dan Phe 31 termutasi menjadi residu bermuatan Asp
dan Lys. Mutan ganda ini mengikat Fc dengan Kd sebesar 3,4 M,
lebih besar daripada peningkatan seratus kali lipat atas fragmen tak
Bab 3 Protein 143
termutasi, dan mempunyai kenaikan besar dalam kandungan a- heliks
seperti diperlihatkan oleh spektroskopi sirkular dikroisme. Permukaan
peptida dua heliks ini lalu diubah dari inti protein menjadi permukaan
protein. Pustaka kedua menetapkan Asp 20 dan Lys 31 dan mengacak
lima posisi pada intraface heliks 1 dan heliks 2. Dari pustaka ini,
tiga residu baru dipilih pada ujung terbuka dari interface intraheliks,
dan Kd untuk peptida ini sekitar 300 nM, meningkat sepuluh kali
lipat atas pustaka pertama. Akhirnya, lima pustaka diacak pada bagian
ikatan Fc dari kumpulan dua heliks dan mutasi konsensus digabung.
Beberapa pustaka menghasilkan mutasi yang meningkatkan ikatan
sebesar 2-3 kali lipat, dan keseluruhan kumpulan dua heliks memiliki
12 mutasi dari urutan domain Z. Penyambungan akhir kelima residu
ujung-N menghasilkan peptida 33 residu dengan Kd sebesar 40 nM,
sangat dekat dengan nilai wild-type yakni 20 nM. Kristalografi sinar-
x dan spektroskopi NMR menandakan bahwa kedua kumpulan heliks
memiliki struktur tiga dimensi yang sama dan epitop pengikat Fc yang
sama seperti domain Z. Maka, siklus phage display digunakan untuk
membuat permukaan protein yang lebih stabil dan untuk mengemas
kembali inti protein. Lipatan yang dihasilkan berukuran setengah kali
ukuran domain awalnya tetapi mempertahankan penataan tiga dimensi
residu pengikat Fc pada interface.
Suatu struktur b telah diubah menjadi struktur a hanya dengan mengubah
setengah urutannya
Pada tahun 1994 hadiah sebesar $1000 yang disebut tantangan Par-
acelsus ditawarkan bagi perancang struktur protein yang bisa men-
gubah satu lipatan protein menjadi yang lainnya dengan tetap memper-
tahankan 50% urutan aslinya. Kekuatan tantangan ini yakni untuk
mengambil satu langkah penting untuk memecahkan masalah pelipatan
dengan menentukan fraksi urutan asam amino dari suatu protein yang
cukup untuk spesifikasi strukturnya. Atas dasar pengetahuan kita akan
protein yang ada di alam, tantangan ini tidak tampak seperti proyek
yang dapat dikerjakan dengan mudah: semua protein dengan struktur
BIOKIMIA: Struktur dan Fungsi Biomolekul 144
yang diketahui dengan lebih dari 30% identitas urutan terlihat memi-
liki lipatan identik. Namun, tidak lebih dari tiga tahun sebelum hadiah
itu dimenangkan. Pada tahun 1997 kelompok Lynne Regan dari Yale
University mengubah protein yang melipat menjadi terutama struktur
b-sheet menjadi struktur a-heliks dengan mengubah 50% urutannya.
Mereka mulai dari urutan suatu domain, B1, dari protein pengikat
IgG yang disebut Protein G. Domain berukuran 56 residu asam amino
ini melipat menjadi b sheet empat untai dan satu a heliks (Gambar
3-27). Tujuan mereka yakni untuk mengubah struktur ini menjadi
seluruhnya struktur a-heliks yang serupa dengan milik Rop. Tiap
subunit Rop adalah sepanjang 63 asam amino dan melipat menjadi dua
a heliks yang dihubungkan oleh loop pendek. Tujuh residu terakhir
tak berstruktur dan tidak diperhitungkan dalam prosedur rancangan.
Dua subunit Rop membentuk kumpulan empat-heliks.
Dengan menjajarkan kedua urutan dari ujung aminonya hanya
menghasilkan tiga residu identik dalam 56 posisi berjajar. Untuk mem-
pertahankan 50% urutan aslinya, 28 residu bisa diubah dalam do-
main B1 agar lipatan berubah menjadi struktur mirip Rop. Rasional-
isasi untuk perubahan-perubahan ini yakni penggunaan pengetahuan
masa kini akan pembentukan heliks dan stabilitas untuk identifikasi
dan mengubah subset residu yang merupakan determinan kunci lipa-
tan, dengan mempertimbangkan interaksi lokal dan jarak jauh. Residu
dalam domain B1 yang sangat memilih pembentukan b sheet diganti
dengan residu yang sangat memilih pembentukan a-heliks, seperti
Tyr menjadi Lys dan Leu menjadi Ala, dalam daerah yang dibutuhkan
untuk mengubah konformasi. Karena Rop merupakan protein coiled-
coil, residu hidrofob dimasukkan dalam posisi a dan d yang cocok pada
pengulangan heptad. Di antara perubahan lain terdapat pemasukkan
jembatan garam intramonomer antara Arg 16 dan Asp 46 yang ada di
antara kedua heliks pada Rop.
Protein-protein homolog memiliki struktur tiga dimensi yang
serupa. Mereka memiliki daerah inti, lipatan elemen struktur sekunder,
dengan lipatan rantai polipeptida yang sangat mirip. Daerah loop yang
menghubungkan building block lipatan bisa sangat bervariasi baik
Bab 3 Protein 145
panjangnya maupun strukturnya. Dari database struktur imunoglobulin
yang telah diketahui, mungkin saja untuk memprediksi dengan tepat
konformasi daerah loop hipervariabel dari antibodi dengan urutan
asam amino yang diketahui.
Protein
Biokimia: Struktur dan Fungsi Biomolekul 139
Gambar 3-27 Diagram ribbon struktur domain B1 dari protein G (biru) dan dimer
Rop merah).
Protein-protein homolog memiliki struktur tiga dimensi yang serupa.
Mereka memiliki daerah inti, lipatan elemen struktur sekunder, dengan lipatan
rantai polipeptida yang sangat mirip. Daerah loop yang menghubungkan
building block lipatan bisa sangat bervariasi baik panjangnya maupun
strukturnya. Dari database struktur imunoglobulin yang telah diketahui,
mungkin saja untuk memprediksi dengan tepat konformasi daerah loop
hipervariabel dari antibodi dengan urutan asam amino yang diketahui.
Metoda untuk prediksi struktur sekunder dari serangkaian protein
homolog bisa mencapai akurasi sekitar 75%, sebagian besar error terdapat
pada ujung -heliks dan untai . Daerah pusat elemen struktur sekunder ini
seringkali diprediksi dengan tepat namun metodanya tidak selalu dengan tepat
membedakan antara -heliks dan untai .
Prediksi struktur tertier dari urutan asam amino adalah problem utama
yang tak terpecahkan dalam struktur biologi molekul. Masalah sebaliknya,
yakni untuk memprediksi urutan asam amino mana yang bisa memiliki suatu
lipatan yang diinginkan tampak lebih mudah untuk dipecahkan. Progres besar
telah dibuat di tahun-tahun terakhir dalam metoda threading, yang menentukan
Gambar 3-27 Diagram ribbon struktur domain B1 dari protein G
(biru) dan dimer Rop merah.
Metode untuk prediksi struktur sekunder dari serangkaian protein
homolog bisa mencapai akurasi sekitar 75%, sebagian besar error
terdapat pada ujung a-heliks dan untai b. Daerah pusat elemen struktur
sekunder ini seringkali diprediksi dengan tepat namun metodenya
tidak selalu dengan tepat membedakan antara a-heliks dan untai b.
Prediksi struktur tertier dari urutan asam amino adalah problem
utama yang tak terpecahkan dalam struktur biologi molekul. Masalah
sebaliknya, yakni untuk memprediksi urutan asam amino mana yang
bisa memiliki suatu lipatan yang diinginkan tampak lebih mudah
untuk dipecahkan. Progres besar telah dibuat di tahun-tahun terakhir
dalam metode threading, yang menentukan suatu lipatan yang telah
diketahui pada suatu urutan yang diberikan dengan mengalurkan
urutan tersebut melalui semua lipatan yang diketahui.
BIOKIMIA: Struktur dan Fungsi Biomolekul 146
Rekayasa protein kini digunakan secara rutin untuk modifikasi
molekul protein baik melalui site-directed mutagenesis maupun
melalui metode kombinasi. Faktor-faktor yang penting untuk stabilitas
protein telah dipelajari, seperti stabilisasi a-heliks dan mengurangi
jumlah konformasi dalam keadaan tak terlipat. Metode kombinasi
menghasilkan sejumlah besar mutan acak yang jika memiliki sifat-sifat
yang diinginkan akan terseleksi in vitro menggunakan phage display.
Inhibitor enzim spesifik, meningkatkan aktivitas enzim dan agonis
molekul reseptor merupakan contoh-contoh penggunaan metode ini.
Molekul protein kecil dengan lipatan yang telah ditentukan
sebelumnya bisa dirancang in silico dengan perhitungan energi untuk
semua kemungkinan kombinasi dari serangkaian residu asam amino.
Suatu lipatan zinc finger yang dirancang stabil tanpa adanya seng
menunjukkan tidak adanya kesamaan urutan signifikan dengan urutan
protein yang telah diketahui. Progres penting telah dibuat dalam
menentukan fraksi dari urutan asam amino suatu protein yang cukup
untuk spesifikasi strukturnya. Suatu protein yang melipat menjadi
terutama struktur b-sheet telah diubah menjadi struktur a-heliks hanya
dengan mengubah 50% urutannya.
8. METODE PENENTUAN STRUKTUR PROTEIN
Sebagian besar informasi struktur protein didapat dari analisis
kristalografi sinar-x pada kristal protein, serta dari analisis spektroskopi
resonansi magnetik inti (nuclear magnetic resonance, NMR) pada
larutan protein. Masing-masing teknik tersebut memiliki kelebihan
dan kekurangan. Struktur myoglobin adalah struktur protein pertama
yang ditentukan dengan resolusi yang cukup untuk melacak jejak
rantai polipeptida, yakni pada tahun 1960. Sejak saat itu, beribu-ribu
struktur yang sesuai dengan ratusan protein kemudian ditentukan.
Koordinat atom-atom dalam struktur protein dan asam nukleat kini
banyak tersedia di Protein Data Bank, yang dapat diakses via internet
(http://www.pdb.bnl.gov).
Bab 3 Protein 147
Persamaan atau aturan pelipatan yang dapat disimpulkan dari data base
struktur protein antara lain:
1. Sebagian besar gugus bermuatan berada pada permukaan molekul
dan berinteraksi dengan air. Pengecualian untuk aturan ini bi-
asanya adalah pada residu katalis yang penting dalam enzim, yang
mungkin terstabilkan secara parsial oleh interaksi polar tertentu di
dalam bagian hidrofob molekul.
2. Kebanyakan gugus nonpolar (misalnya hidrokarbon) berada di
dalam interior molekul, sehingga menghindari kontak dengan
air yang tidak disukai secara termodinamika. Pengecualian untuk
aturan ini mungkin berfungsi sebagai sisi pengikat spesifik (specific
binding sites) pada permukaan molekul untuk protein atau ligan
lain.
3. Ikatan hidrogen maksimal terjadi di dalam molekul.
4. Prolin seringkali mengakhiri segmen a-heliks.
Sinar-x mempunyai panjang gelombang yang mendekati panjang
jarak antara atom-atom yang berikatan dalam molekul (misalnya,
ikatan tunggal karbon-karbon berjarak 1,5 , sedangkan panjang
gelombang sinar-x dari suatu tabung dengan target tembaga adalah
1,54 ). Bila sinar monokromatik sinar-x berinteraksi dengan suatu
molekul, maka molekul tersebut akan terdifraksi dengan pola difraksi
yang menunjukkan informasi mengenai lokasi atom dalam molekul
tersebut. Akan tetapi jika sampel berada di dalam larutan, maka molekul
tunggal protein akan berorientasi secara acak sehingga akan diperoleh
informasi bentuk molekul lengkap dengan resolusi yang sangat rendah.
Protein serat dan asam nukleat bisa diinduksikan untuk membentuk
gel atau serat yang terorientasi. Difraksi sinar-x pada sampel semacam
ini digunakan untuk menentukan jarak segmen yang berulang secara
teratur, yakni yang dikarakterisasikan sebagai a-heliks dan b sheet
dalam protein serta bentuk A dan B untuk DNA dan RNA. Dalam
hal ini, difraksi sinar-x hanya bisa dipakai untuk memeriksa model
geometrik yang diusulkan, tetapi bukan untuk menentukan struktur
secara objektif.
BIOKIMIA: Struktur dan Fungsi Biomolekul 148
Penggunaan sinar-x yang paling utama adalah pada sampel kristal
tunggal. Struktur molekul yang telah ditemukan terdapat dalam ber-
macam-macam ukuran, mulai dari beberapa atom sampai virus yang
memiliki puluhan ribu atom. Dalam kristal tunggal, semua molekul
berada pada kisi-kisi tiga dimensi dengan posisi relatif dan orientasi
yang tetap. Intensitas tiap titik dalam pola difraksi dapat diukur, se-
hingga informasi mengenai struktur tiga dimensi lengkap dapat di-
peroleh.
Kelebihan dan kekurangan kristalografi protein:
1. Teknik ini bisa diterapkan untuk bermacam-macam sampel, antara
lain protein, enzim, asam nukleat, dan virus. Teknik ini tidak
tergantung pada ukuran molekul.
2. Tidak semua protein bisa dikristalkan, terutama protein membran
intrinsik yang harus dilarutkan dalam larutan detergen.
3. Kebanyakan kristal protein tidak berdifraksi membentuk resolusi
atom yang sesungguhnya. Untuk itu, urutan protein harus
diketahui terlebih dahulu.
Struktur tiga dimensi protein lengkap yang pertama kali dipecah-
kan menggunakan teknik spektroskopi NMR adalah pada tahun 1986.
Fenomena NMR berasal dari fakta bahwa tingkat energi inti dengan
spin nonzero akan menjadi tak seimbang ketika inti tersebut diletakkan
dalam medan magnet. Dengan demikian, energi inti dapat dikacaukan
(digerak-gerakkan di antara tingkat-tingkat energi) dengan menerap-
kan getaran frekuensi radio yang panjang gelombangnya sesuai dengan
celah di antara tingkat-tingkat energi tersebut. Pengacauan inti seperti
ini memungkinkan pengamatan interaksi skalar dan dipolar inti. Inter-
aksi skalar dapat memberikan informasi mengenai sudut torsi protein,
sedangkan interaksi dipolar memberikan informasi mengenai jarak in-
terproton. Struktur protein dihitung menggunakan data urutan asam
amino yang dikombinasikan dengan hasil pengukuran sudut-sudut di-
hedral dan jarak interproton.
NMR menganalisis protein dalam bentuk larutan. Molekul-
molekul protein bergerak-gerak dalam larutan, sehingga teknik NMR
Bab 3 Protein 149
ini dapat mengukur kuantitas skalar (sudut torsi dan jarak interproton).
Hal ini sangat berbeda dengan kristalografi sinar-x yang menganalisis
kisi kristal untuk memperoleh gambaran vektor molekul. Karena
NMR menganalisis protein dalam larutan, maka teknik ini bisa
digunakan untuk melacak detil yang rumit dalam dinamika protein.
Kelebihan dan kekurangan spektroskopi NMR protein:
1. Teknik ini dapat diterapkan untuk protein dan asam nukleat dalam
bentuk larutan.
2. Terdapat batas ukuran, yakni hanya sampai 35 40 kDa. Namun
hal ini berarti bahwa kebanyakan domain protein dapat dianalisis
menggunakan spektroskopi NMR.
3. Resolusi akhir tidak sebagus kristalografi sinar-x, tetapi dapat
diperoleh banyak informasi berguna mengenai dinamika protein.
Pengetahuan kita sekarang akan hubungan antara struktur dan
fungsi molekul protein tidaklah cukup untuk menentukan fungsi
protein dari strukturnya saja, meskipun, seperti yang telah kita lihat,
homologi struktur dengan protein yang fungsinya telah diketahui
kadangkala bisa memungkinkan hal ini. Perlu untuk menggabungkan
penelitian biokimia dengan informasi struktur. Penelitian biokimia
dan biologi sel bisa memberitahukan pada kita apakah suatu protein
merupakan reseptor, molekul transpor, atau suatu enzim serta ligan
mana yang bisa terikat padanya, juga efek fungsional dari pengikatan
ligan seperti ini. Penelitian struktur tiga dimensi kompleks antara
ligan spesifik dan protein kemudian akan memberikan informasi detil
tentang bagaimana sisi aktif dibangun dan residu asam amino mana
yang terlibat dalam pengikatan ligan. Contoh-contoh yang telah kita
jelaskan antara lain interaksi protein-DNA, pengikatan gula pada
protein pengangkut gula, dan pengikatan inhibitor pada enzim yang
memotong ikatan peptide.
Peran spesifik tiap residu asam amino untuk fungsi protein bisa diuji
dengan membuat mutasi spesifik pada residu yang dipertanyakan dan
memeriksa sifat-sifat protein mutan. Dengan menggabungkan dengan
cara ini penelitian fungsi dalam larutan, site-directed mutagenesis oleh
BIOKIMIA: Struktur dan Fungsi Biomolekul 150
teknik DNA rekombinan, dan penentuan struktur tiga dimensi, kita
kini berada dalam posisi untuk mendapat wawasan segar ke dalam cara
kerja molekul protein.
Struktur tiga dimensi molekul protein bisa ditentukan secara
eksperimen dengan dua macam metode, kristalografi sinar-x dan
NMR. Interaksi sinar-x dengan elektron dalam molekul yang tersusun
dalam kristal digunakan untuk memperoleh peta densitas-elektron
molekul tersebut, yang bisa diinterpretasikan dalam suatu model atom.
Kelebihan teknik masa kini, seperti kekuatan komputer termasuk
kerja grafis, detektor area elektronik, dan sumber sinar-x yang sangat
kuat dari radiasi synchrotron, telah sangat memudahkan penggunaan
kristalografi sinar-x.
Kristalisasi protein bisa sulit dicapai dan biasanya membutuhkan
banyak eksperimen berbeda dengan variasi sejumlah parameter, seperti
pH, suhu, konsentrasi protein, dan sifat pelarut dan endapan. Kristal
protein mengandung saluran-saluran besar dan lubang-lubang yang
dipenuhi oleh pelarut, yang bisa digunakan untuk difusi logam berat ke
dalam kristal. Penambahan logam berat diperlukan untuk penentuan
fasa pancaran terdifraksi.
Struktur sinar-x ditentukan pada berbagai level resolusi. Pada
resolusi rendah hanya bentuk molekul yang diperoleh, sedangkan
pada resolusi tinggi sebagian besar posisi atom bisa ditentukan dengan
akurasi berderajat tinggi. Pada resolusi sedang lipatan rantai polipepitda
biasanya terungkap dengan tepat serta juga perkiraan posisi rantai
samping, termasuk yang berada pada sisi aktif. Kualitas model tiga
dimensi akhir protein tersebut tergantung pada resolusi data sinar-
x dan pada derajat perbaikan. Dalam struktur yang telah diperbaiki
dengan baik, dengan nilai R kurang dari 0,20 pada resolusi sebesar 2,0
, perkiraan error dalam posisi atom adalah sekitar 0,1 hingga 0,2 ,
sehingga urutan asam amino diketahui.
Serat biologis, seperti yang bisa dibentuk oleh DNA dan protein
serat, bisa mengandung kristalit dengan molekul yang sangat teratur
yang strukturnya pada prinsipnya bisa didapatkan pada resolusi atom
dengan kristalografi sinar-x. Namun dalam prakteknya, kristalit ini
Bab 3 Protein 151
jarang seteratur kristal sebenarnya, dan untuk menemukan atom
individu perlu untuk memasukkan kecocokan stereokimia dalam
analisis sinar-x sehingga strukturnya dapat diperbaiki oleh pemodelan
molekul.
Dalam NMR, sifat-sifat spin magnet inti atom di dalam suatu
molekul digunakan untuk memperoleh daftar kecocokan jarak antara
atom-atom dalam molekul, yang dari sini struktur tiga dimensi molekul
protein bisa diperoleh. Metode ini tidak membutuhkan kristal protein
dan dapat digunakan pada molekul protein dalam larutan pekat.
Namun, penggunaannya terbatas pada molekul protein kecil.
-oo0oo-
Bab
LIPID, MEMBRAN,
TRANSPOR, DAN
PENSINYALAN
4
1. PENGANTAR
Lipid didefinisikan sebagai senyawa yang tak larut dalam air
yang diekstrak dari organisme hidup menggunakan pelarut yang
kepolarannya lemah atau pelarut nonpolar. Definisi ini berdasarkan
atas sifat fisik, berlawanan dengan definisi protein, karbohidrat,
maupun asam nukleat yang berdasarkan atas struktur kimianya. Istilah
lipid mencakup berbagai macam kelompok senyawa yang berbeda-
beda strukturnya.
Perhatikan contoh senyawa-senyawa pada hal 154, yang sebagian besar
merupakan lipid.
Senyawa 1, 3, dan 5 sampai 9 merupakan lipid karena berasal dari
suatu organisme dan larut dalam pelarut organik. Lipid larut dalam
pelarut organik karena mengandung karbon dan hidrogen dengan
proporsi tinggi sehingga tidak larut dalam air. Senyawa 4 bukan
merupakan lipid karena tidak terdapat bebas dalam organisme hidup.
Senyawa 2 larut dalam air, tetapi karena senyawa ini adalah anggota
kelompok senyawa yang sama seperti senyawa 1, maka biasanya
senyawa ini dianggap sebagai lipid.
BIOKIMIA: Struktur dan Fungsi Biomolekul 154
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 146
BAB IV
LIPID, MEMBRAN, TRANSPOR, DAN
PENSINYALAN
1. PENGANTAR
Lipid didefinisikan sebagai senyawa yang tak larut dalam air yang
diekstrak dari organisme hidup menggunakan pelarut yang kepolarannya lemah
atau pelarut nonpolar. Definisi ini berdasarkan atas sifat fisik, berlawanan
dengan definisi protein, karbohidrat, maupun asam nukleat yang berdasarkan
atas struktur kimianya. Istilah lipid mencakup berbagai macam kelompok
senyawa yang berbeda-beda strukturnya.
Perhatikan contoh senyawa-senyawa berikut, yang sebagian besar merupakan
lipid:
CH
3
(CH
2
)
14
COO
-
CH
3
CH
2
COO
-
(1) Palmitat (2) Propionat
CH
3
(CH
2
)
14
CH
2
OH
(3) Setil Alkohol
(4) Benzen
(5) Limonen
(6) Skualen
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 147
O
O OH
HO
(7) Krisin
O
HO
(8) Vitamin E
O
OH
COO
OH
(9) Prostaglandin E
2
Senyawa 1, 3, dan 5 sampai 9 merupakan lipid karena berasal dari suatu
organisme dan larut dalam pelarut organik. Lipid larut dalam pelarut organik
karena mengandung karbon dan hidrogen dengan proporsi tinggi sehingga
tidak larut dalam air. Senyawa 4 bukan merupakan lipid karena tidak terdapat
bebas dalam organisme hidup. Senyawa 2 larut dalam air, tetapi karena
senyawa ini adalah anggota kelompok senyawa yang sama seperti senyawa 1,
maka biasanya senyawa ini dianggap sebagai lipid.
2. KELOMPOK-KELOMPOK LIPID
Kandungan hidrokarbon dalam lipid diturunkan dari polimerisasi asetat
yang diikuti dengan reduksi rantai yang terbentuk. Misalnya, polimerisasi asetat
menghasilkan senyawa-senyawa berikut:
1. Rantai hidrokarbon panjang dan linear:
nCH
3
COO
-
CH
3
COCH
2
CO CH
3
CH
2
CH
2
CH
2

2. KELOMPOK-KELOMPOK LIPID
Kandungan hidrokarbon dalam lipid diturunkan dari polimerisasi
asetat yang diikuti dengan reduksi rantai yang terbentuk. Misalnya,
polimerisasi asetat menghasilkan senyawa-senyawa berikut:
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 155
1. Rantai hidrokarbon panjang dan linear:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 147
O
O OH
HO
(7) Krisin
O
HO
(8) Vitamin E
O
OH
COO
OH
(9) Prostaglandin E
2
Senyawa 1, 3, dan 5 sampai 9 merupakan lipid karena berasal dari suatu
organisme dan larut dalam pelarut organik. Lipid larut dalam pelarut organik
karena mengandung karbon dan hidrogen dengan proporsi tinggi sehingga
tidak larut dalam air. Senyawa 4 bukan merupakan lipid karena tidak terdapat
bebas dalam organisme hidup. Senyawa 2 larut dalam air, tetapi karena
senyawa ini adalah anggota kelompok senyawa yang sama seperti senyawa 1,
maka biasanya senyawa ini dianggap sebagai lipid.
2. KELOMPOK-KELOMPOK LIPID
Kandungan hidrokarbon dalam lipid diturunkan dari polimerisasi asetat
yang diikuti dengan reduksi rantai yang terbentuk. Misalnya, polimerisasi asetat
menghasilkan senyawa-senyawa berikut:
1. Rantai hidrokarbon panjang dan linear:
nCH
3
COO
-
CH
3
COCH
2
CO CH
3
CH
2
CH
2
CH
2

Produk ini merupakan asam lemak, CH
3
(CH
2
)nCOOH, yang
selanjutnya bisa menghasilkan amina dan alkohol. Lipid yang
mengandung asam lemak antara lain gliserolipid, sfingolipid, serta
lilin.
2. Hidrokarbon rantai bercabang melalui intermediet karbon-lima
yakni isopentena (isopren):
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 148
Produk ini merupakan asam lemak, CH
3
(CH
2
)
n
COOH, yang selanjutnya
bisa menghasilkan amina dan alkohol. Lipid yang mengandung asam
lemak antara lain gliserolipid, sfingolipid, serta lilin.
2. Hidrokarbon rantai bercabang melalui intermediet karbon-lima yakni
isopentena (isopren):
3CH
3
COO
-
(CH
3
CH C CH
2
CH
3
)
terpen
(termasuk steroid
dan karotenoid)
3. Struktur linear atau siklik yang hanya tereduksi secara parsial:
nCH
3
COO
-
CH
3
COO
-
O O
O
n-3
Produk ini disebut asetogenin (atau disebut juga poliketida). Banyak
senyawa ini yang merupakan aromatik, yang jalur pembentukannya
merupakan jalur utama untuk sintesis cincin benzen di alam. Tidak
semua senyawa ini termasuk lipid, karena reduksi parsial seringkali
meninggalkan gugus yang mengandung oksigen sehingga membuatnya
larut dalam air.
Rute sintesis untuk lipid-lipid dalam contoh sebelumnya adalah sebagai berikut:
Senyawa 1, 3, dan 9 dibuat melalui rute (1).
Senyawa 5 dan 6 dibuat melalui rute (2).
Senyawa 7 dibuat melalui rute (3), dan senyawa 8 melalui rute (2) dan (3).
Untuk lipid yang disintesis melalui rute (2), unit-unit isopren dihubungkan
dengan cara seperti yang ditunjukkan oleh garis putus-putus dalam struktur
molekul berikut:
3. Struktur linear atau siklik yang hanya tereduksi secara parsial:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 148
Produk ini merupakan asam lemak, CH
3
(CH
2
)
n
COOH, yang selanjutnya
bisa menghasilkan amina dan alkohol. Lipid yang mengandung asam
lemak antara lain gliserolipid, sfingolipid, serta lilin.
2. Hidrokarbon rantai bercabang melalui intermediet karbon-lima yakni
isopentena (isopren):
3CH
3
COO
-
(CH
3
CH C CH
2
CH
3
)
terpen
(termasuk steroid
dan karotenoid)
3. Struktur linear atau siklik yang hanya tereduksi secara parsial:
nCH
3
COO
-
CH
3
COO
-
O O
O
n-3
Produk ini disebut asetogenin (atau disebut juga poliketida). Banyak
senyawa ini yang merupakan aromatik, yang jalur pembentukannya
merupakan jalur utama untuk sintesis cincin benzen di alam. Tidak
semua senyawa ini termasuk lipid, karena reduksi parsial seringkali
meninggalkan gugus yang mengandung oksigen sehingga membuatnya
larut dalam air.
Rute sintesis untuk lipid-lipid dalam contoh sebelumnya adalah sebagai berikut:
Senyawa 1, 3, dan 9 dibuat melalui rute (1).
Senyawa 5 dan 6 dibuat melalui rute (2).
Senyawa 7 dibuat melalui rute (3), dan senyawa 8 melalui rute (2) dan (3).
Untuk lipid yang disintesis melalui rute (2), unit-unit isopren dihubungkan
dengan cara seperti yang ditunjukkan oleh garis putus-putus dalam struktur
molekul berikut:
Produk ini disebut asetogenin (atau disebut juga poliketida). Ba-
nyak senyawa ini yang merupakan aromatik, yang jalur pemben-
tukannya merupakan jalur utama untuk sintesis cincin benzen
di alam. Tidak semua senyawa ini termasuk lipid, karena reduksi
parsial seringkali meninggalkan gugus yang mengandung oksigen
sehingga membuatnya larut dalam air.
Rute sintesis untuk lipid-lipid dalam contoh sebelumnya adalah
sebagai berikut:
Senyawa 1, 3, dan 9 dibuat melalui rute (1).
Senyawa 5 dan 6 dibuat melalui rute (2).
Senyawa 7 dibuat melalui rute (3), dan senyawa 8 melalui rute (2)
dan (3).
BIOKIMIA: Struktur dan Fungsi Biomolekul 156
Untuk lipid yang disintesis melalui rute (2), unit-unit isopren
dihubungkan dengan cara seperti yang ditunjukkan oleh garis putus-
putus dalam struktur molekul berikut:
Limonen
O
HO
Vitamin E
Skualen
3. ASAM LEMAK
Lebih dari 100 asam lemak terdapat secara alami. Asam lemak ini
bervariasi panjang rantainya serta derajat ketidakjenuhannya. Hampir
semua asam lemak mempunyai atom-atom karbon yang berjumlah
genap. Sebagian besar terdiri atas atom-atom karbon rantai linear,
tetapi beberapa memiliki rantai bercabang. Asam lemak dalam keadaan
bebas terdapat dalam jumlah sangat sedikit. Kebanyakan asam lemak
ditemukan dalam keadaan teresterifikasi sebagai komponen dari lipid
lainnya. pKa gugus asam karboksilat adalah sekitar 5. Dalam kondisi
fisiologis, gugus asam karboksilat terdapat dalam keadaan terionisasi
yang disebut ion asilat, misalnya ion dari asam palmitat adalah palmitat,
CH
3
(CH
2
)
14
COO
-
.
Berikut ini adalah beberapa asam lemak yang penting untuk
tubuh.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 157
(a) Jenuh:
CH
3
(CH
2
)
14
COOH CH
3
(CH
2
)
16
COOH
Asam palmitat Asam stearat
(asam heksadekanoat) (asam oktadekanoat)
16:0 18:0
(b) Dalam asam lemak tak jenuh, ikatan rangkap hampir selalu
memiliki konformasi cis:
CH
3
(CH
2
)
5
CH=CH(CH
2
)
7
COOH
Asam palmitoleat
(asam cis-9-heksadekenoat)
16:1
D9
(c) Dalam asam lemak poli tak jenuh (polyunsaturated), ikatan
rangkap jarang yang terkonjugasi:
CH
3
(CH
2
)
4
CH=CHCH
2
CH=CH(CH
2
)
7
COOH
Asam linoleat
(asam cis,cis-9,12-oktadekadienoat)
18:2
D9,12
Notasi angka digunakan untuk menandai struktur asam lemak.
Sebelah kiri tanda titik dua (:) menunjukkan jumlah atom C dalam
asam, sedangkan yang sebelah kanan menunjukkan jumlah ikatan
rangkap. Posisi ikatan rangkap ditunjukkan oleh superscript D diikuti
oleh jumlah karbon di antara ikatan rangkap dengan ujung rantai,
dengan karbon pada gugus asam karboksilat diberi nomor 1.
Notasi angka, nama sistematis, serta nama trivial untuk tiga asam lemak
adalah sebagai berikut:
CH
3
(CH
2
)
7
CH=CH(CH
2
)
7
COOH
18:1
D9
asam cis-9-oktadekenoat (asam oleat)
CH
3
CH
2
CH=CHCH
2
CH=CHCH
2
CH=CH(CH
2
)
7
COOH
18:3
D9,12,15
seluruhnya cis asam cis-9,12,15,oktadekatrienoat
(asam a-linoleat)
BIOKIMIA: Struktur dan Fungsi Biomolekul 158
CH
3
(CH
2
)
4
CH=CHCH
2
CH=CHCH
2
CH=CHCH
2

CH=CH(CH
2
)
3
COOH
20:4
D5,8,11,14
seluruhnya cis asam cis-5,8,11,14-eikosatetraenoat
(asam arakhidonat)
Asam-asam lemak yang berbeda memiliki titik leleh yang berbeda pula,
misalnya:
Asam palmitat, 63
0
C; asam stearat, 70
0
C; asam oleat, 13
0
C
Asam elaidat (asam trans-9-oktadekanoat), 44
0
C
Asam linoleat, 5
0
C; asam a-linoleat, 11
0
C
Perbedaan titik leleh asam lemak juga terjadi pada asam-asam
lemak yang jumlah atom karbonnya sama. Konformasi yang lebih
disukai untuk rantai atom C jenuh adalah struktur yang panjang dan
lurus. Suatu ikatan rangkap cis akan menimbulkan bengkokan pada
struktur, sehingga lebih sukar untuk tersusun membentuk kristal
daripada molekul jenuh yang panjangnya sama. Ikatan rangkap trans
tidak menimbulkan bengkokan pada rantai. Contohnya:
1. Rantai jenuh
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 151
Asam elaidat (asam trans-9-oktadekanoat), 44
0
C
Asam linoleat, 5
0
C; asam a-linoleat, 11
0
C
Perbedaan titik leleh asam lemak juga terjadi pada asam-asam lemak yang
jumlah atom karbonnya sama. Konformasi yang lebih disukai untuk rantai atom
C jenuh adalah struktur yang panjang dan lurus. Suatu ikatan rangkap cis akan
menimbulkan bengkokan pada struktur, sehingga lebih sukar untuk tersusun
membentuk kristal daripada molekul jenuh yang panjangnya sama. Ikatan
rangkap trans tidak menimbulkan bengkokan pada rantai. Contohnya:
1. Rantai jenuh
COOH
2. Rantai dengan satu ikatan rangkap trans
COOH
3. Rantai dengan satu ikatan rangkap cis
COOH
Molekul lurus dapat disusun lebih rapat dan membentuk kristal yang
titik lelehnya lebih tinggi daripada titik leleh molekul bengkok yang ukurannya
sama. Dengan kata lain, lebih banyak energi yang dibutuhkan untuk
memisahkan molekul-molekul lurus ketika dipanaskan.
2. Rantai dengan satu ikatan rangkap trans
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 151
Asam elaidat (asam trans-9-oktadekanoat), 44
0
C
Asam linoleat, 5
0
C; asam a-linoleat, 11
0
C
Perbedaan titik leleh asam lemak juga terjadi pada asam-asam lemak yang
jumlah atom karbonnya sama. Konformasi yang lebih disukai untuk rantai atom
C jenuh adalah struktur yang panjang dan lurus. Suatu ikatan rangkap cis akan
menimbulkan bengkokan pada struktur, sehingga lebih sukar untuk tersusun
membentuk kristal daripada molekul jenuh yang panjangnya sama. Ikatan
rangkap trans tidak menimbulkan bengkokan pada rantai. Contohnya:
1. Rantai jenuh
COOH
2. Rantai dengan satu ikatan rangkap trans
COOH
3. Rantai dengan satu ikatan rangkap cis
COOH
Molekul lurus dapat disusun lebih rapat dan membentuk kristal yang
titik lelehnya lebih tinggi daripada titik leleh molekul bengkok yang ukurannya
sama. Dengan kata lain, lebih banyak energi yang dibutuhkan untuk
memisahkan molekul-molekul lurus ketika dipanaskan.
3. Rantai dengan satu ikatan rangkap cis
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 151
Asam elaidat (asam trans-9-oktadekanoat), 44
0
C
Asam linoleat, 5
0
C; asam a-linoleat, 11
0
C
Perbedaan titik leleh asam lemak juga terjadi pada asam-asam lemak yang
jumlah atom karbonnya sama. Konformasi yang lebih disukai untuk rantai atom
C jenuh adalah struktur yang panjang dan lurus. Suatu ikatan rangkap cis akan
menimbulkan bengkokan pada struktur, sehingga lebih sukar untuk tersusun
membentuk kristal daripada molekul jenuh yang panjangnya sama. Ikatan
rangkap trans tidak menimbulkan bengkokan pada rantai. Contohnya:
1. Rantai jenuh
COOH
2. Rantai dengan satu ikatan rangkap trans
COOH
3. Rantai dengan satu ikatan rangkap cis
COOH
Molekul lurus dapat disusun lebih rapat dan membentuk kristal yang
titik lelehnya lebih tinggi daripada titik leleh molekul bengkok yang ukurannya
sama. Dengan kata lain, lebih banyak energi yang dibutuhkan untuk
memisahkan molekul-molekul lurus ketika dipanaskan.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 159
Molekul lurus dapat disusun lebih rapat dan membentuk kristal
yang titik lelehnya lebih tinggi daripada titik leleh molekul bengkok
yang ukurannya sama. Dengan kata lain, lebih banyak energi yang
dibutuhkan untuk memisahkan molekul-molekul lurus ketika dipanas-
kan.
Ikatan rangkap cis terdapat lebih banyak daripada ikatan rangkap
trans dalam asam lemak tak jenuh. Hal ini memastikan bahwa lipid
yang mengandung asam lemak memiliki titik leleh rendah dan
berwujud cair pada suhu fisiologisnya.
Selain ketidakjenuhan, titik leleh asam lemak juga dipengaruhi
oleh adanya percabangan. Misalnya, asam stearat (18 karbon) dan asam
arakhidat (20 karbon) keduanya jenuh dan linear. Titik leleh asam
stearat adalah 70
0
C, dan titik leleh asam arakhidat 75
0
C. Sedangkan
asam 10-metilstearat meleleh pada suhu 10
0
C. Akan tetapi asam lemak
bercabang jarang terdapat dalam sistem hidup.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 152
Ikatan rangkap cis terdapat lebih banyak daripada ikatan rangkap trans
dalam asam lemak tak jenuh. Hal ini memastikan bahwa lipid yang
mengandung asam lemak memiliki titik leleh rendah dan berwujud cair pada
suhu fisiologisnya.
Selain ketidakjenuhan, titik leleh asam lemak juga dipengaruhi oleh
adanya percabangan. Misalnya, asam stearat (18 karbon) dan asam arakhidat
(20 karbon) keduanya jenuh dan linear. Titik leleh asam stearat adalah 70
0
C,
dan titik leleh asam arakhidat 75
0
C. Sedangkan asam 10-metilstearat meleleh
pada suhu 10
0
C. Akan tetapi asam lemak bercabang jarang terdapat dalam
sistem hidup.
CH
3
(CH
2
)
7
CH(CH
2
)
8
COOH
CH
3
Asam 10-metilstearat
4. GLISEROLIPID
Gliserolipid adalah lipid yang mengandung gliserol dengan gugus
hidroksil yang tersubstitusi. Gliserolipid merupakan lipid yang paling melimpah
di dalam tubuh hewan. Lipid yang mengandung diol (misalnya etilen glikol
(etana diol) dan 1,2-propanadiol serta 1,3-propanadiol) memiliki struktur yang
mirip dengan gliserolipid, tetapi hanya tersedia kurang dari 1 persen dari jumlah
gliserolipid.
CH
2
OH
HOCH
CH
2
OH
CH
2
OH
CH
2
OH
CH
2
OH
HOCH
CH
3
Gliserol
Etilen glikol
1,2-Propanadiol
Triasilgliserol (TAGs) adalah gliserolipid netral yang juga dikenal
sebagai trigliserida. Dalam TAGs, tiga gugus hidroksil dari gliserol telah
teresterifikasi, biasanya oleh asam-asam lemak yang berbeda. Hal ini
membuat atom karbon kedua pada gliserol menjadi separuh kiral. Awalan sn-
(stereospecifically numbered) mendahului nama gliserol. Contohnya,
4. GLISEROLIPID
Gliserolipid adalah lipid yang mengandung gliserol dengan gugus
hidroksil yang tersubstitusi. Gliserolipid merupakan lipid yang paling
melimpah di dalam tubuh hewan. Lipid yang mengandung diol
(misalnya etilen glikol (etana diol) dan 1,2-propanadiol serta 1,3-
propanadiol) memiliki struktur yang mirip dengan gliserolipid, tetapi
hanya tersedia kurang dari 1 persen dari jumlah gliserolipid.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 152
Ikatan rangkap cis terdapat lebih banyak daripada ikatan rangkap trans
dalam asam lemak tak jenuh. Hal ini memastikan bahwa lipid yang
mengandung asam lemak memiliki titik leleh rendah dan berwujud cair pada
suhu fisiologisnya.
Selain ketidakjenuhan, titik leleh asam lemak juga dipengaruhi oleh
adanya percabangan. Misalnya, asam stearat (18 karbon) dan asam arakhidat
(20 karbon) keduanya jenuh dan linear. Titik leleh asam stearat adalah 70
0
C,
dan titik leleh asam arakhidat 75
0
C. Sedangkan asam 10-metilstearat meleleh
pada suhu 10
0
C. Akan tetapi asam lemak bercabang jarang terdapat dalam
sistem hidup.
CH
3
(CH
2
)
7
CH(CH
2
)
8
COOH
CH
3
Asam 10-metilstearat
4. GLISEROLIPID
Gliserolipid adalah lipid yang mengandung gliserol dengan gugus
hidroksil yang tersubstitusi. Gliserolipid merupakan lipid yang paling melimpah
di dalam tubuh hewan. Lipid yang mengandung diol (misalnya etilen glikol
(etana diol) dan 1,2-propanadiol serta 1,3-propanadiol) memiliki struktur yang
mirip dengan gliserolipid, tetapi hanya tersedia kurang dari 1 persen dari jumlah
gliserolipid.
CH
2
OH
HOCH
CH
2
OH
CH
2
OH
CH
2
OH
CH
2
OH
HOCH
CH
3
Gliserol Etilen glikol 1,2-Propanadiol
Triasilgliserol (TAGs) adalah gliserolipid netral yang juga dikenal
sebagai trigliserida. Dalam TAGs, tiga gugus hidroksil dari gliserol telah
teresterifikasi, biasanya oleh asam-asam lemak yang berbeda. Hal ini
membuat atom karbon kedua pada gliserol menjadi separuh kiral. Awalan sn-
(stereospecifically numbered) mendahului nama gliserol. Contohnya,
BIOKIMIA: Struktur dan Fungsi Biomolekul 160
Triasilgliserol (TAGs) adalah gliserolipid netral yang juga dikenal
sebagai trigliserida. Dalam TAGs, tiga gugus hidroksil dari gliserol
telah teresterifikasi, biasanya oleh asam-asam lemak yang berbeda. Hal
ini membuat atom karbon kedua pada gliserol menjadi separuh kiral.
Awalan sn- (stereospecifically numbered) mendahului nama gliserol.
Contohnya,
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 153
CH
2
O.OCR
C
CH
2
O.OCR"
H R'CO.O
1,2,3-Triasil-sn-gliserol
Struktur 1-oleoil-2-palmitoil-sn-gliserol adalah
CH
3
(CH
2
)
14
CO.OCH
CH
2
OH
CH
2
O.OC(CH
2
)
7
CH CH(CH
2
)
7
CH
3
Molekul ini merupakan diasilgliserol. Diasilgliserol dan monoasilgliserol
ditemukan dalam sel dengan jumlah sedikit. Keduanya merupakan metabolit
untuk TAGs dan fosfolipid.
TAGs adalah lipid yang paling banyak dalam tubuh hewan. Hal ini
dikarenakan TAGs berfungsi sebagai penyimpanan makanan. TAGs ditemukan
dalam sebagian besar sel, tetapi terutama terdapat dalam sel jaringan adiposa
di mana TAGs membentuk lemak depot (depot fat). Hidrolisis ikatan ester pada
TAGs serta pelepasan gliserol dan asam lemak dari jaringan adiposa disebut
mobilisasi lemak. Depot fat merupakan campuran bebas air dari TAGs yang
berbeda-beda satu sama lain menurut ketiga gugus asil lemaknya.
Depot fat mengandung banyak asam lemak tak jenuh. Lemak tersebut
terdapat dalam wujud cair. Lemak padat hanya terdapat pada daerah
permukaan kecil pada enzim dalam cairan sitoplasma yang memobilisasi lemak
tersebut. Lemak padat juga akan membuat jaringan adiposa menjadi kaku dan
tidak produktif selama tekanan mekanik.
Biasanya titik leleh depot fat hanya beberapa derajat di bawah suhu
tubuh. Komposisi asam lemak dalam depot fat merupakan hasil perpaduan
antara kebutuhan untuk menjaga lemak tetap cair dengan kemampuan untuk
menyimpan energi sebanyak mungkin. Ketika teroksidasi, asam lemak tak
jenuh menghasilkan energi yang lebih kecil daripada asam lemak jenuh yang
berukuran sama.
Struktur 1-oleoil-2-palmitoil-sn-gliserol adalah
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 153
CH
2
O.OCR
C
CH
2
O.OCR"
H R'CO.O
1,2,3-Triasil-sn-gliserol
Struktur 1-oleoil-2-palmitoil-sn-gliserol adalah
CH
3
(CH
2
)
14
CO.OCH
CH
2
OH
CH
2
O.OC(CH
2
)
7
CH CH(CH
2
)
7
CH
3
Molekul ini merupakan diasilgliserol. Diasilgliserol dan monoasilgliserol
ditemukan dalam sel dengan jumlah sedikit. Keduanya merupakan metabolit
untuk TAGs dan fosfolipid.
TAGs adalah lipid yang paling banyak dalam tubuh hewan. Hal ini
dikarenakan TAGs berfungsi sebagai penyimpanan makanan. TAGs ditemukan
dalam sebagian besar sel, tetapi terutama terdapat dalam sel jaringan adiposa
di mana TAGs membentuk lemak depot (depot fat). Hidrolisis ikatan ester pada
TAGs serta pelepasan gliserol dan asam lemak dari jaringan adiposa disebut
mobilisasi lemak. Depot fat merupakan campuran bebas air dari TAGs yang
berbeda-beda satu sama lain menurut ketiga gugus asil lemaknya.
Depot fat mengandung banyak asam lemak tak jenuh. Lemak tersebut
terdapat dalam wujud cair. Lemak padat hanya terdapat pada daerah
permukaan kecil pada enzim dalam cairan sitoplasma yang memobilisasi lemak
tersebut. Lemak padat juga akan membuat jaringan adiposa menjadi kaku dan
tidak produktif selama tekanan mekanik.
Biasanya titik leleh depot fat hanya beberapa derajat di bawah suhu
tubuh. Komposisi asam lemak dalam depot fat merupakan hasil perpaduan
antara kebutuhan untuk menjaga lemak tetap cair dengan kemampuan untuk
menyimpan energi sebanyak mungkin. Ketika teroksidasi, asam lemak tak
jenuh menghasilkan energi yang lebih kecil daripada asam lemak jenuh yang
berukuran sama.
Molekul ini merupakan diasilgliserol. Diasilgliserol dan monoasil-
gliserol ditemukan dalam sel dengan jumlah sedikit. Keduanya meru-
pakan metabolit untuk TAGs dan fosfolipid.
TAGs adalah lipid yang paling banyak dalam tubuh hewan. Hal
ini dikarenakan TAGs berfungsi sebagai penyimpanan makanan.
TAGs ditemukan dalam sebagian besar sel, tetapi terutama terdapat
dalam sel jaringan adiposa di mana TAGs membentuk lemak depot
(depot fat). Hidrolisis ikatan ester pada TAGs serta pelepasan gliserol
dan asam lemak dari jaringan adiposa disebut mobilisasi lemak. Depot
fat merupakan campuran bebas air dari TAGs yang berbeda-beda satu
sama lain menurut ketiga gugus asil lemaknya.
Depot fat mengandung banyak asam lemak tak jenuh. Lemak
tersebut terdapat dalam wujud cair. Lemak padat hanya terdapat pada
daerah permukaan kecil pada enzim dalam cairan sitoplasma yang
memobilisasi lemak tersebut. Lemak padat juga akan membuat jaringan
adiposa menjadi kaku dan tidak produktif selama tekanan mekanik.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 161
Biasanya titik leleh depot fat hanya beberapa derajat di bawah
suhu tubuh. Komposisi asam lemak dalam depot fat merupakan hasil
perpaduan antara kebutuhan untuk menjaga lemak tetap cair dengan
kemampuan untuk menyimpan energi sebanyak mungkin. Ketika
teroksidasi, asam lemak tak jenuh menghasilkan energi yang lebih kecil
daripada asam lemak jenuh yang berukuran sama.
Fosfogliserida adalah gliserolipid polar yang sering juga disebut
fosfolipid. Akan tetapi, lipid lain yang mengandung fosfor tetapi tidak
mengandung gliserol juga disebut fosfolipid.
Semua fosfogliserida diturunkan dari asam sn-gliserol-3-fosfat,
yakni separuh asam fosfat teresterifikasi oleh alkohol tertentu dan
gugus hidroksil pada C-1 dan C-2 teresterifikasi oleh asam lemak.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 154
CH
2
O.R
R'CO.OCH
CH
2
O P OX
O
O
-
Fosfogliserida adalah gliserolipid polar yang sering juga disebut
fosfolipid. Akan tetapi, lipid lain yang mengandung fosfor tetapi tidak
mengandung gliserol juga disebut fosfolipid.
Semua fosfogliserida diturunkan dari asam sn-gliserol-3-fosfat, yakni separuh
asam fosfat teresterifikasi oleh alkohol tertentu dan gugus hidroksil pada C-1
dan C-2 teresterifikasi oleh asam lemak.
CH
2
OH
HOCH
CH
2
O P OH
O
OH
asam sn-Gliserol-3-fosfat
Nilai pK
a
untuk fosfomonoester adalah ~1 dan ~6. Karena itu pada pH fisiologis
akan terdapat dua bentuk ionik untuk asam sn-gliserol-3-fosfat, dengan
didominasi oleh dianion:
CH
2
OH
HOCH
CH
2
O P O
-
O
OH
CH
2
OH
HOCH
CH
2
O P O
-
O
O
-
Penamaan dan pengelompokkan fosfogliserida adalah berdasarkan sifat
alkohol yang mengesterifikasi gliserol fosfat (Tabel 4-1).
Dalam kebanyakan fosfogliserida, asam lemak yang tersubstitusi pada
C-1 adalah asam lemak jenuh, sedangkan pada C-2 adalah asam lemak tak
jenuh. Meskipun fosfogliserida dinamai dalam bentuk tunggal, tetapi
sebenarnya merupakan campuran senyawa-senyawa dengan gugus X yang
sama teresterifikasi oleh berbagai macam asam lemak yang berbeda. Bisa
juga terjadi C-1 tereterifikasi (bukan teresterifikasi) oleh alkohol lemak rantai
panjang. Fosfogliserida seperti ini dikenal sebagai plasmalogen:
Nilai pKa untuk fosfomonoester adalah ~1 dan ~6. Karena itu
pada pH fisiologis akan terdapat dua bentuk ionik untuk asam sn-
gliserol-3-fosfat, dengan didominasi oleh dianion:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 154
CH
2
O.R
R'CO.OCH
CH
2
O P OX
O
O
-
Fosfogliserida adalah gliserolipid polar yang sering juga disebut
fosfolipid. Akan tetapi, lipid lain yang mengandung fosfor tetapi tidak
mengandung gliserol juga disebut fosfolipid.
Semua fosfogliserida diturunkan dari asam sn-gliserol-3-fosfat, yakni separuh
asam fosfat teresterifikasi oleh alkohol tertentu dan gugus hidroksil pada C-1
dan C-2 teresterifikasi oleh asam lemak.
CH
2
OH
HOCH
CH
2
O P OH
O
OH
asam sn-Gliserol-3-fosfat
Nilai pK
a
untuk fosfomonoester adalah ~1 dan ~6. Karena itu pada pH fisiologis
akan terdapat dua bentuk ionik untuk asam sn-gliserol-3-fosfat, dengan
didominasi oleh dianion:
CH
2
OH
HOCH
CH
2
O P O
-
O
OH
CH
2
OH
HOCH
CH
2
O P O
-
O
O
-
Penamaan dan pengelompokkan fosfogliserida adalah berdasarkan sifat
alkohol yang mengesterifikasi gliserol fosfat (Tabel 4-1).
Dalam kebanyakan fosfogliserida, asam lemak yang tersubstitusi pada
C-1 adalah asam lemak jenuh, sedangkan pada C-2 adalah asam lemak tak
jenuh. Meskipun fosfogliserida dinamai dalam bentuk tunggal, tetapi
sebenarnya merupakan campuran senyawa-senyawa dengan gugus X yang
sama teresterifikasi oleh berbagai macam asam lemak yang berbeda. Bisa
juga terjadi C-1 tereterifikasi (bukan teresterifikasi) oleh alkohol lemak rantai
panjang. Fosfogliserida seperti ini dikenal sebagai plasmalogen:
Penamaan dan pengelompokkan fosfogliserida adalah berdasarkan
sifat alkohol yang mengesterifikasi gliserol fosfat (Tabel 4-1).
Dalam kebanyakan fosfogliserida, asam lemak yang tersubstitusi
pada C-1 adalah asam lemak jenuh, sedangkan pada C-2 adalah asam
lemak tak jenuh. Meskipun fosfogliserida dinamai dalam bentuk tung-
BIOKIMIA: Struktur dan Fungsi Biomolekul 162
gal, tetapi sebenarnya merupakan campuran senyawa-senyawa dengan
gugus X yang sama teresterifikasi oleh berbagai macam asam lemak
yang berbeda. Bisa juga terjadi C-1 tereterifikasi (bukan teresterifikasi)
oleh alkohol lemak rantai panjang. Fosfogliserida seperti ini dikenal se-
bagai plasmalogen:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 155
Tabel 4-1 Beberapa Kelompok Utama Fosfogliserida
CH
2
O.OCR
R'CO.OCH
CH
2
O P OX
O
O
-
Nama XOH Struktur X
Nama Fosfogliserida
(Simbol)
Air
H
Fosfatidat
[ion dari asam fosfatidat]
(PA)
Etanolamin
CH
2
CH
2
NH
3
Fosfatidiletanolamin
(PE)
Kolin
CH
2
CH
2
N(CH
3
)
3
Fosfatidilkolin (PC)
Serin
CH
2
CHNH
3
COO
-
Fosfatidilserin (PS)
Gliserol CH
2
CH(OH)CH
2
OH Fosfatidilgliserol (PG)
Fosfatidilgliserol
CH
2
CH(OH)CH
2
OPOCH
2
-
O
O
HCO.OCR
R'CO.OCH
2
Difosfatidilgliserol
[kardiolipin] (DPG)
Inositol
OH
OH
OHHO
OH
Fosfatidilinositol (PI)
Sekitar 1 persen dari seluruh fosfogliserida yang terdapat dalam sel hewan
berada dalam bentuk lisofosfogliserida, yakni dengan hilangnya salah satu
substituen asil (biasanya dari C-2). Penamaan lisofosfogliserida adalah dengan
menambahkan awalan liso- pada nama fosfogliserida asalnya. Contoh struktur
berikut ini adalah molekul lisofosfatidilkolin:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 154
CH
2
O.R
R'CO.OCH
CH
2
O P OX
O
O
-
Fosfogliserida adalah gliserolipid polar yang sering juga disebut
fosfolipid. Akan tetapi, lipid lain yang mengandung fosfor tetapi tidak
mengandung gliserol juga disebut fosfolipid.
Semua fosfogliserida diturunkan dari asam sn-gliserol-3-fosfat, yakni separuh
asam fosfat teresterifikasi oleh alkohol tertentu dan gugus hidroksil pada C-1
dan C-2 teresterifikasi oleh asam lemak.
CH
2
OH
HOCH
CH
2
O P OH
O
OH
asam sn-Gliserol-3-fosfat
Nilai pK
a
untuk fosfomonoester adalah ~1 dan ~6. Karena itu pada pH fisiologis
akan terdapat dua bentuk ionik untuk asam sn-gliserol-3-fosfat, dengan
didominasi oleh dianion:
CH
2
OH
HOCH
CH
2
O P O
-
O
OH
CH
2
OH
HOCH
CH
2
O P O
-
O
O
-
Penamaan dan pengelompokkan fosfogliserida adalah berdasarkan sifat
alkohol yang mengesterifikasi gliserol fosfat (Tabel 4-1).
Dalam kebanyakan fosfogliserida, asam lemak yang tersubstitusi pada
C-1 adalah asam lemak jenuh, sedangkan pada C-2 adalah asam lemak tak
jenuh. Meskipun fosfogliserida dinamai dalam bentuk tunggal, tetapi
sebenarnya merupakan campuran senyawa-senyawa dengan gugus X yang
sama teresterifikasi oleh berbagai macam asam lemak yang berbeda. Bisa
juga terjadi C-1 tereterifikasi (bukan teresterifikasi) oleh alkohol lemak rantai
panjang. Fosfogliserida seperti ini dikenal sebagai plasmalogen:
Tabel 4-1 Beberapa Kelompok Utama Fosfogliserida
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 163
Sekitar 1 persen dari seluruh fosfogliserida yang terdapat dalam sel
hewan berada dalam bentuk lisofosfogliserida, yakni dengan hilangnya
salah satu substituen asil (biasanya dari C-2). Penamaan lisofosfogli-
serida adalah dengan menambahkan awalan liso- pada nama fosfogli-
serida asalnya. Contoh struktur berikut ini adalah molekul lisofosfati-
dilkolin:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 156
CH
2
O.OCR
HOCH
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
CH
3
(CH
2
)
12
CH
CHCH CH
OH
CH
2
OH
+
NH
3
Sfingosin
CH
3
(CH
2
)
12
CH
2
CH
2
CH CH
OH
CH
2
OH
+
NH
3
Sfinganin
Glikogliserolipid serupa dengan fosfogliserida dalam beberapa hal. Misalnya,
keduanya sama-sama memiliki bagian hidrofob dan bagian polar (hidrofil).
Bagian polar disebabkan oleh separuh karbohidrat, bukan oleh fosfat yang
teresterifikasi.
Glikogliserolipid yang khas yakni 6--D-galaktopiranosil--D-
galaktopiranosildigliserida, yang strukturnya adalah sebagai berikut:
O
CH
2
OH
HO
OH
OH
O CH
2
O
HO
OH
OH
CH
2
O
R'CO.OCH
CH
2
O.OCR
5. SFINGOLIPID
Sfingolipid dibangun dari basa terhidroksilasi rantai panjang. Dua basa
seperti ini ditemukan dalam hewan, yakni basa sfingosin dan dihidrosfingosin
(sfinganin). Sfingosin terdapat jauh lebih banyak.
Reaksi antara senyawa serin (a) dengan senyawa palmitat (b) akan
mengeluarkan CO
2
, kemudian diikuti dengan reaksi reduksi yang akan
menghasilkan sfinganin. Rangkaian reaksi ini merupakan sintesis sfinganin
dalam sistem hidup.
Glikogliserolipid serupa dengan fosfogliserida dalam beberapa hal.
Misalnya, keduanya sama-sama memiliki bagian hidrofob dan bagian
polar (hidrofil). Bagian polar disebabkan oleh separuh karbohidrat,
bukan oleh fosfat yang teresterifikasi.
Glikogliserolipid yang khas yakni 6-a-D-galaktopiranosil-b-D-
galaktopiranosildigliserida, yang strukturnya adalah sebagai berikut:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 156
CH
2
O.OCR
HOCH
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
CH
3
(CH
2
)
12
CH
CHCH CH
OH
CH
2
OH
+
NH
3
Sfingosin
CH
3
(CH
2
)
12
CH
2
CH
2
CH CH
OH
CH
2
OH
+
NH
3
Sfinganin
Glikogliserolipid serupa dengan fosfogliserida dalam beberapa hal. Misalnya,
keduanya sama-sama memiliki bagian hidrofob dan bagian polar (hidrofil).
Bagian polar disebabkan oleh separuh karbohidrat, bukan oleh fosfat yang
teresterifikasi.
Glikogliserolipid yang khas yakni 6--D-galaktopiranosil--D-
galaktopiranosildigliserida, yang strukturnya adalah sebagai berikut:
O
CH
2
OH
HO
OH
OH
O CH
2
O
HO
OH
OH
CH
2
O
R'CO.OCH
CH
2
O.OCR
5. SFINGOLIPID
Sfingolipid dibangun dari basa terhidroksilasi rantai panjang. Dua basa
seperti ini ditemukan dalam hewan, yakni basa sfingosin dan dihidrosfingosin
(sfinganin). Sfingosin terdapat jauh lebih banyak.
Reaksi antara senyawa serin (a) dengan senyawa palmitat (b) akan
mengeluarkan CO
2
, kemudian diikuti dengan reaksi reduksi yang akan
menghasilkan sfinganin. Rangkaian reaksi ini merupakan sintesis sfinganin
dalam sistem hidup.
5. SFINGOLIPID
Sfingolipid dibangun dari basa terhidroksilasi rantai panjang. Dua
basa seperti ini ditemukan dalam hewan, yakni basa sfingosin dan
dihidrosfingosin (sfinganin). Sfingosin terdapat jauh lebih banyak.
BIOKIMIA: Struktur dan Fungsi Biomolekul 164
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 156
CH
2
O.OCR
HOCH
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
CH
3
(CH
2
)
12
CH
CHCH CH
OH
CH
2
OH
+
NH
3
Sfingosin
CH
3
(CH
2
)
12
CH
2
CH
2
CH CH
OH
CH
2
OH
+
NH
3
Sfinganin
Glikogliserolipid serupa dengan fosfogliserida dalam beberapa hal. Misalnya,
keduanya sama-sama memiliki bagian hidrofob dan bagian polar (hidrofil).
Bagian polar disebabkan oleh separuh karbohidrat, bukan oleh fosfat yang
teresterifikasi.
Glikogliserolipid yang khas yakni 6--D-galaktopiranosil--D-
galaktopiranosildigliserida, yang strukturnya adalah sebagai berikut:
O
CH
2
OH
HO
OH
OH
O CH
2
O
HO
OH
OH
CH
2
O
R'CO.OCH
CH
2
O.OCR
5. SFINGOLIPID
Sfingolipid dibangun dari basa terhidroksilasi rantai panjang. Dua basa
seperti ini ditemukan dalam hewan, yakni basa sfingosin dan dihidrosfingosin
(sfinganin). Sfingosin terdapat jauh lebih banyak.
Reaksi antara senyawa serin (a) dengan senyawa palmitat (b) akan
mengeluarkan CO
2
, kemudian diikuti dengan reaksi reduksi yang akan
menghasilkan sfinganin. Rangkaian reaksi ini merupakan sintesis sfinganin
dalam sistem hidup.
Reaksi antara senyawa serin (a) dengan senyawa palmitat (b) akan
mengeluarkan CO
2
, kemudian diikuti dengan reaksi reduksi yang
akan menghasilkan sfinganin. Rangkaian reaksi ini merupakan sintesis
sfinganin dalam sistem hidup.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 157
-
OOCCHCH
2
OH
+
NH
3
CH
3
(CH
2
)
14
COO
-
(a) (b)
Ketika gugus amino pada sfingosin atau sfinganin diasilasi oleh asam lemak,
maka produk yang dihasilkan adalah suatu seramida,
CH
3
(CH
2
)
12
CH
CHCH
CH
OH
NH
CO
R
CH
2
OH
Gugus hidroksi primer dapat disubstitusi dengan dua cara, yang menghasilkan
dua kelompok sfingolipid yakni fosfosfingolipid dan glikosfingolipid.
Dalam fosfosfingolipid, gugus hidroksil primer diesterifikasi oleh kolin fosfat.
Lipid ini dikenal sebagai sfingomyelin:
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
Sfingomyelin
Gugus asil lemak (R) yang ditemukan dalam sfingomyelin yakni:
Lignoserat 24:0
Nervonat 24:1
15
Serebronat 24:0, C-2 terhidroksilasi
Dalam glikosfingolipid, gugus hidroksil primer terglikosilasi, yakni
tersubstitusi oleh karbohidrat, baik monosakarida atau oligosakarida.
Glikosfingolipid yang mengandung gula asam sialat di dalam bagian
karbohidratnya disebut gangliosida. Setidaknya telah ditemukan 50 tipe
glikosfingolipid, yang berdasarkan atas perbedaan bagian karbohidrat pada
molekul. Setiap tipe glikosfingolipid menunjukkan variasi tipe asam lemak yang
ditemukan di dalam bagian seramidanya.
Ketika gugus amino pada sfingosin atau sfinganin diasilasi oleh
asam lemak, maka produk yang dihasilkan adalah suatu seramida,
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 157
-
OOCCHCH
2
OH
+
NH
3
CH
3
(CH
2
)
14
COO
-
(a) (b)
Ketika gugus amino pada sfingosin atau sfinganin diasilasi oleh asam lemak,
maka produk yang dihasilkan adalah suatu seramida,
CH
3
(CH
2
)
12
CH
CHCH
CH
OH
NH
CO
R
CH
2
OH
Gugus hidroksi primer dapat disubstitusi dengan dua cara, yang menghasilkan
dua kelompok sfingolipid yakni fosfosfingolipid dan glikosfingolipid.
Dalam fosfosfingolipid, gugus hidroksil primer diesterifikasi oleh kolin fosfat.
Lipid ini dikenal sebagai sfingomyelin:
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
Sfingomyelin
Gugus asil lemak (R) yang ditemukan dalam sfingomyelin yakni:
Lignoserat 24:0
Nervonat 24:1
15
Serebronat 24:0, C-2 terhidroksilasi
Dalam glikosfingolipid, gugus hidroksil primer terglikosilasi, yakni
tersubstitusi oleh karbohidrat, baik monosakarida atau oligosakarida.
Glikosfingolipid yang mengandung gula asam sialat di dalam bagian
karbohidratnya disebut gangliosida. Setidaknya telah ditemukan 50 tipe
glikosfingolipid, yang berdasarkan atas perbedaan bagian karbohidrat pada
molekul. Setiap tipe glikosfingolipid menunjukkan variasi tipe asam lemak yang
ditemukan di dalam bagian seramidanya.
Gugus hidroksi primer dapat disubstitusi dengan dua cara, yang
menghasilkan dua kelompok sfingolipid yakni fosfosfingolipid dan
glikosfingolipid.
Dalam fosfosfingolipid, gugus hidroksil primer diesterifikasi oleh
kolin fosfat. Lipid ini dikenal sebagai sfingomyelin:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 157
-
OOCCHCH
2
OH
+
NH
3
CH
3
(CH
2
)
14
COO
-
(a) (b)
Ketika gugus amino pada sfingosin atau sfinganin diasilasi oleh asam lemak,
maka produk yang dihasilkan adalah suatu seramida,
CH
3
(CH
2
)
12
CH
CHCH
CH
OH
NH
CO
R
CH
2
OH
Gugus hidroksi primer dapat disubstitusi dengan dua cara, yang menghasilkan
dua kelompok sfingolipid yakni fosfosfingolipid dan glikosfingolipid.
Dalam fosfosfingolipid, gugus hidroksil primer diesterifikasi oleh kolin fosfat.
Lipid ini dikenal sebagai sfingomyelin:
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
O P O(CH
2
)
2
N(CH
3
)
3
O
O
-
Sfingomyelin
Gugus asil lemak (R) yang ditemukan dalam sfingomyelin yakni:
Lignoserat 24:0
Nervonat 24:1
15
Serebronat 24:0, C-2 terhidroksilasi
Dalam glikosfingolipid, gugus hidroksil primer terglikosilasi, yakni
tersubstitusi oleh karbohidrat, baik monosakarida atau oligosakarida.
Glikosfingolipid yang mengandung gula asam sialat di dalam bagian
karbohidratnya disebut gangliosida. Setidaknya telah ditemukan 50 tipe
glikosfingolipid, yang berdasarkan atas perbedaan bagian karbohidrat pada
molekul. Setiap tipe glikosfingolipid menunjukkan variasi tipe asam lemak yang
ditemukan di dalam bagian seramidanya.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 165
Gugus asil lemak (R) yang ditemukan dalam sfingomyelin yakni:
Lignoserat 24:0
Nervonat 24:1
D15
Serebronat 24:0, C-2 terhidroksilasi
Dalam glikosfingolipid, gugus hidroksil primer terglikosilasi, yakni
tersubstitusi oleh karbohidrat, baik monosakarida atau oligosakarida.
Glikosfingolipid yang mengandung gula asam sialat di dalam bagian
karbohidratnya disebut gangliosida. Setidaknya telah ditemukan 50 tipe
glikosfingolipid, yang berdasarkan atas perbedaan bagian karbohidrat
pada molekul. Setiap tipe glikosfingolipid menunjukkan variasi tipe
asam lemak yang ditemukan di dalam bagian seramidanya.
Beberapa glikosfingolipid yang biasa ditemukan adalah:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 158
Beberapa glikosfingolipid yang biasa ditemukan adalah:
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
1
Gal

Galaktosilseramida
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
1
Glc
4 1
Gal
3 1
Gal
3 1
GalNAc

Globosida
CH
3
(CH
2
)
12
CH
CHCH CH
OH NH
CO
R
CH
2
1
Glc
4

1
Gal
4 1
GalNAc
NeuNAc

Tay-Sachs gangliosida
Catatan : Glc glukosil; Gal galaktosil; GalNac N-Asetilgalaktosaminil;
NeuNAc sialil.
6. LIPID YANG DITURUNKAN DARI ISOPREN (TERPEN)
Nama terpen pada mulanya digunakan untuk minyak yang bisa
didestilasi uap, yang diperoleh dari terpentin (ekstrak cemara). Diketahui
bahwa:
1. Sebagian besar senyawa yang terdapat dalam minyak tersebut memiliki
rumus C
10
H
15
.
2. Terpen yang memiliki lebih dari 10 karbon, jumlah karbon tersebut
biasanya merupakan kelipatan dari lima. Struktur terpen luar biasa
beragam.
3. Banyak senyawa serupa yang tak larut dalam air terdistribusi sangat
luas, terutama ditemukan dalam banyak tanaman dengan jumlah besar,
tetapi juga terdapat dalam sebagian besar organisme hidup lainnya.
Catatan : Glc glukosil; Gal galaktosil; GalNac N-Asetilgalaktosaminil; NeuNAc sialil.
BIOKIMIA: Struktur dan Fungsi Biomolekul 166
6. LIPID YANG DITURUNKAN DARI ISOPREN (TERPEN)
Nama terpen pada mulanya digunakan untuk minyak yang bisa
didestilasi uap, yang diperoleh dari terpentin (ekstrak cemara).
Diketahui bahwa:
1. Sebagian besar senyawa yang terdapat dalam minyak tersebut
memiliki rumus C
10
H
15
.
2. Terpen yang memiliki lebih dari 10 karbon, jumlah karbon tersebut
biasanya merupakan kelipatan dari lima. Struktur terpen luar biasa
beragam.
3. Banyak senyawa serupa yang tak larut dalam air terdistribusi sangat
luas, terutama ditemukan dalam banyak tanaman dengan jumlah
besar, tetapi juga terdapat dalam sebagian besar organisme hidup
lainnya.
Terpen dengan 10 atom karbon dikenal sebagai monoterpen.
Contohnya:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 159
O
CH
3
O
CH
3
O
O
CH
2
H
6 - 10
Ubikuinon
CH
2
CH
2
CH
2
OH H
18 - 20
Dolikol
Terpen dengan 10 atom karbon dikenal sebagai monoterpen. Contohnya:
CH
2
OH
Limonen Geraniol
Seskuiterpen memiliki 15 atom karbon, sedangkan diterpen memiliki 20 atom
karbon. Contohnya:
HOCH
2
Farnesol
CH
2
OH
Vitamin A
Triterpen (30 atom karbon) dan tetraterpen (40 atom karbon) dapat membentuk
steroid dan karotenoid. Contohnya adalah skualen (triterpen) dan -karoten
(tetraterpen).
-Karoten
Poliisoprenoid terdapat antara lain dalam bentuk karet. Tetapi dalam konteks
biokimia, ubikuinon dan dolikol lebih penting.
Seskuiterpen memiliki 15 atom karbon, sedangkan diterpen
memiliki 20 atom karbon. Contohnya:
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 167
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 159
O
CH
3
O
CH
3
O
O
CH
2
H
6 - 10
Ubikuinon
CH
2
CH
2
CH
2
OH H
18 - 20
Dolikol
Terpen dengan 10 atom karbon dikenal sebagai monoterpen. Contohnya:
CH
2
OH
Limonen Geraniol
Seskuiterpen memiliki 15 atom karbon, sedangkan diterpen memiliki 20 atom
karbon. Contohnya:
HOCH
2
Farnesol
CH
2
OH
Vitamin A
Triterpen (30 atom karbon) dan tetraterpen (40 atom karbon) dapat membentuk
steroid dan karotenoid. Contohnya adalah skualen (triterpen) dan -karoten
(tetraterpen).
-Karoten
Poliisoprenoid terdapat antara lain dalam bentuk karet. Tetapi dalam konteks
biokimia, ubikuinon dan dolikol lebih penting.
Triterpen (30 atom karbon) dan tetraterpen (40 atom karbon)
dapat membentuk steroid dan karotenoid. Contohnya adalah skualen
(triterpen) dan b-karoten (tetraterpen).
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 159
O
CH
3
O
CH
3
O
O
CH
2
H
6 - 10
Ubikuinon
CH
2
CH
2
CH
2
OH H
18 - 20
Dolikol
Terpen dengan 10 atom karbon dikenal sebagai monoterpen. Contohnya:
CH
2
OH
Limonen Geraniol
Seskuiterpen memiliki 15 atom karbon, sedangkan diterpen memiliki 20 atom
karbon. Contohnya:
HOCH
2
Farnesol
CH
2
OH
Vitamin A
Triterpen (30 atom karbon) dan tetraterpen (40 atom karbon) dapat membentuk
steroid dan karotenoid. Contohnya adalah skualen (triterpen) dan -karoten
(tetraterpen).
-Karoten
Poliisoprenoid terdapat antara lain dalam bentuk karet. Tetapi dalam konteks
biokimia, ubikuinon dan dolikol lebih penting.
Poliisoprenoid terdapat antara lain dalam bentuk karet. Tetapi
dalam konteks biokimia, ubikuinon dan dolikol lebih penting.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 159
O
CH
3
O
CH
3
O
O
CH
2
H
6 - 10
Ubikuinon
CH
2
CH
2
CH
2
OH H
18 - 20
Dolikol
Terpen dengan 10 atom karbon dikenal sebagai monoterpen. Contohnya:
CH
2
OH
Limonen Geraniol
Seskuiterpen memiliki 15 atom karbon, sedangkan diterpen memiliki 20 atom
karbon. Contohnya:
HOCH
2
Farnesol
CH
2
OH
Vitamin A
Triterpen (30 atom karbon) dan tetraterpen (40 atom karbon) dapat membentuk
steroid dan karotenoid. Contohnya adalah skualen (triterpen) dan -karoten
(tetraterpen).
-Karoten
Poliisoprenoid terdapat antara lain dalam bentuk karet. Tetapi dalam konteks
biokimia, ubikuinon dan dolikol lebih penting.
Menurut strukturnya, steroid merupakan turunan dari hidrokarbon
aromatik tereduksi yakni perhidrosiklopentanofenantren.
BIOKIMIA: Struktur dan Fungsi Biomolekul 168
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 160
Menurut strukturnya, steroid merupakan turunan dari hidrokarbon aromatik
tereduksi yakni perhidrosiklopentanofenantren.
A B
C
D
1
2
3
4
5
6
7
8
14
15
16
17
13
12
11
9
10
Perhidrosiklopentanofenantren
Meskipun strukturnya berkaitan dengan fenantren, namun senyawa ini bukan
asetogenin melainkan terpen yang disintesis dalam sistem hidup dari isopren
via skualen.
Fenantren
Sterol adalah steroid yang memiliki satu atau lebih gugus hidroksil. Contohnya
antara lain kolesterol, yakni komponen dari membran sitoplasma dalam sel
hewan; testosteron, suatu hormon; dan asam kolat, suatu konstituen dalam
empedu.
HO
CH
3
H
CH
3
H H
Kolesterol
Meskipun strukturnya berkaitan dengan fenantren, namun
senyawa ini bukan asetogenin melainkan terpen yang disintesis dalam
sistem hidup dari isopren via skualen.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 160
Menurut strukturnya, steroid merupakan turunan dari hidrokarbon aromatik
tereduksi yakni perhidrosiklopentanofenantren.
A B
C
D
1
2
3
4
5
6
7
8
14
15
16
17
13
12
11
9
10
Perhidrosiklopentanofenantren
Meskipun strukturnya berkaitan dengan fenantren, namun senyawa ini bukan
asetogenin melainkan terpen yang disintesis dalam sistem hidup dari isopren
via skualen.
Fenantren
Sterol adalah steroid yang memiliki satu atau lebih gugus hidroksil. Contohnya
antara lain kolesterol, yakni komponen dari membran sitoplasma dalam sel
hewan; testosteron, suatu hormon; dan asam kolat, suatu konstituen dalam
empedu.
HO
CH
3
H
CH
3
H H
Kolesterol
Sterol adalah steroid yang memiliki satu atau lebih gugus hidroksil.
Contohnya antara lain kolesterol, yakni komponen dari membran
sitoplasma dalam sel hewan; testosteron, suatu hormon; dan asam
kolat, suatu konstituen dalam empedu.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 160
Menurut strukturnya, steroid merupakan turunan dari hidrokarbon aromatik
tereduksi yakni perhidrosiklopentanofenantren.
A B
C
D
1
2
3
4
5
6
7
8
14
15
16
17
13
12
11
9
10
Perhidrosiklopentanofenantren
Meskipun strukturnya berkaitan dengan fenantren, namun senyawa ini bukan
asetogenin melainkan terpen yang disintesis dalam sistem hidup dari isopren
via skualen.
Fenantren
Sterol adalah steroid yang memiliki satu atau lebih gugus hidroksil. Contohnya
antara lain kolesterol, yakni komponen dari membran sitoplasma dalam sel
hewan; testosteron, suatu hormon; dan asam kolat, suatu konstituen dalam
empedu.
HO
CH
3
H
CH
3
H H
Kolesterol
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 169
Sistem cincin fusi (fused-ring) merupakan struktur planar yang
sangat penting. Ikatan yang ditunjukkan oleh
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 161
C
4
H
8
COOH
CH
3
H
CH
3
H
OH
OH
H
H
OH
CH
3
H
CH
3
H H
O
OH
Testosteron
CH
3
H
CH
3
H H
COOH
HO
OH HO
H
Asam Kolat
Sistem cincin fusi (fused-ring) merupakan struktur planar yang sangat penting.
Ikatan yang ditunjukkan oleh dan menunjukkan substituen yang
terletak di depan () dan belakang () bidang sterol. Konfigurasi substituen dua
atom karbon antara kedua cincin fusi menentukan apakah cincin memiliki
konformasi cis atau trans. Cincin fusi trans merupakan struktur yang rata,
sedangkan cincin fusi cis merupakan struktur yang bengkok. Kolesterol dan
testosteron memiliki cincin fusi trans.
H
H
H
H
Cincin fusi trans Cincin fusi cis
Contoh penataan tiga dimensi cincin-cincin pada asam kolat:
dan
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 161
C
4
H
8
COOH
CH
3
H
CH
3
H
OH
OH
H
H
OH
CH
3
H
CH
3
H H
O
OH
Testosteron
CH
3
H
CH
3
H H
COOH
HO
OH HO
H
Asam Kolat
Sistem cincin fusi (fused-ring) merupakan struktur planar yang sangat penting.
Ikatan yang ditunjukkan oleh dan menunjukkan substituen yang
terletak di depan () dan belakang () bidang sterol. Konfigurasi substituen dua
atom karbon antara kedua cincin fusi menentukan apakah cincin memiliki
konformasi cis atau trans. Cincin fusi trans merupakan struktur yang rata,
sedangkan cincin fusi cis merupakan struktur yang bengkok. Kolesterol dan
testosteron memiliki cincin fusi trans.
H
H
H
H
Cincin fusi trans Cincin fusi cis
Contoh penataan tiga dimensi cincin-cincin pada asam kolat:
menunjukkan substituen yang terletak di depan (b) dan belakang (a)
bidang sterol. Konfigurasi substituen dua atom karbon antara kedua
cincin fusi menentukan apakah cincin memiliki konformasi cis atau
trans. Cincin fusi trans merupakan struktur yang rata, sedangkan cincin
fusi cis merupakan struktur yang bengkok. Kolesterol dan testosteron
memiliki cincin fusi trans.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 161
C
4
H
8
COOH
CH
3
H
CH
3
H
OH
OH
H
H
OH
CH
3
H
CH
3
H H
O
OH
Testosteron
CH
3
H
CH
3
H H
COOH
HO
OH HO
H
Asam Kolat
Sistem cincin fusi (fused-ring) merupakan struktur planar yang sangat penting.
Ikatan yang ditunjukkan oleh dan menunjukkan substituen yang
terletak di depan () dan belakang () bidang sterol. Konfigurasi substituen dua
atom karbon antara kedua cincin fusi menentukan apakah cincin memiliki
konformasi cis atau trans. Cincin fusi trans merupakan struktur yang rata,
sedangkan cincin fusi cis merupakan struktur yang bengkok. Kolesterol dan
testosteron memiliki cincin fusi trans.
H
H
H
H
Cincin fusi trans Cincin fusi cis
Contoh penataan tiga dimensi cincin-cincin pada asam kolat:
Contoh penataan tiga dimensi cincin-cincin pada asam kolat:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 161
C
4
H
8
COOH
CH
3
H
CH
3
H
OH
OH
H
H
OH
CH
3
H
CH
3
H H
O
OH
Testosteron
CH
3
H
CH
3
H H
COOH
HO
OH HO
H
Asam Kolat
Sistem cincin fusi (fused-ring) merupakan struktur planar yang sangat penting.
Ikatan yang ditunjukkan oleh dan menunjukkan substituen yang
terletak di depan () dan belakang () bidang sterol. Konfigurasi substituen dua
atom karbon antara kedua cincin fusi menentukan apakah cincin memiliki
konformasi cis atau trans. Cincin fusi trans merupakan struktur yang rata,
sedangkan cincin fusi cis merupakan struktur yang bengkok. Kolesterol dan
testosteron memiliki cincin fusi trans.
H
H
H
H
Cincin fusi trans Cincin fusi cis
Contoh penataan tiga dimensi cincin-cincin pada asam kolat:
Karotenoid adalah turunan terhidroksilasi dari suatu hidrokarbon
yang disebut karoten (40 ataom karbon). Senyawa ini sangat
terkonjugasi sehingga menyerap sinar tampak. Sebagian besar pigmen
kuning dan merah yang terdapat secara alami merupakan karoten dan
karotenoid. Pigmen-pigmen ini seringkali terlibat dalam interaksi
antara suatu sistem hidup dengan cahaya. Dalam tubuh hewan, b-
karoten (tetraterpen) diubah secara metabolis menjadi vitamin A yang
diperlukan untuk aktivitas visual.
BIOKIMIA: Struktur dan Fungsi Biomolekul 170
7. SIFAT LIPID DALAM AIR
Dari definisinya diketahui bahwa lipid tidak larut dalam air. Namun
kenyataannya lipid terdapat dalam lingkungan air, sehingga sifatnya
di dalam air sangat penting dalam sistem biologis. Banyak tipe lipid
yang bersifat amfifilik, yang berarti terdiri atas dua bagian yakni daerah
hidrokarbon yang nonpolar dan daerah yang polar atau ionik atau
keduanya. Istilah amfifilik ini menggantikan istilah amfifatik yang
digunakan sebelumnya.
Lipid-lipid seperti asam lemak, TAGs, dan kolesterol bukanlah
amfifilik karena kepolaran molekul-molekul ini sangat lemah.
Sedangkan lipid-lipid seperti ion asilat, fosfogliserida, fosfosfingolipid,
dan glikosfingolipid merupakan amfifilik, karena senyawa-senyawa ini
memiliki setidaknya satu muatan formal atau banyak gugus hidroksil
di salah satu bagian molekulnya.
Ketika molekul amfifilik terdispersi dalam air, bagian hidrofobnya
(yakni rantai hidrokarbon) memisah dari pelarut dan menyatu dengan
bagian-bagian hidrofob molekul lainnya. Hasil pengumpulan ini dise-
but micelle (untuk kumpulan yang terdispersi dalam air) dan mono-
layer (untuk yang mengumpul pada perbatasan air-udara). Gambar 4-
1 menunjukkan bagaimana suatu amfifil membentuk suatu monolayer
pada permukaan air (molekul amfifilik digambarkan dengan O ,
dengan O merupakan bagian polar dan merupakan ekor hidrokar-
bon). Kepala polar bersentuhan dengan air yang polar, sehingga me-
mastikan bahwa ekor nonpolar berada sejauh mungkin dari air.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 163
Gambar 4-1 Suatu amfifil membentuk suatu monolayer pada permukaan air
Kecenderungan rantai hidrokarbon untuk menjauh dari pelarut polar
(yakni air) dikenal sebagai efek hidrofob. Hidrokarbon tidak membentuk ikatan
hidrogen dengan air, dan suatu hidrokarbon yang dikelilingi oleh air akan
memudahkan pembentukan ikatan hidrogen di antara molekul-molekul air itu
sendiri. Kumpulan air akan lebih terstruktur daripada tanpa adanya
hidrokarbon. Tanpa hidrokarbon, air akan kehilangan entropi sehingga secara
termodinamika keadaannya kurang disukai. Keadaan seperti ini diubah oleh
adanya hidrokarbon yang tersusun sedemikian rupa sehingga menjauh dari air,
menyebabkan molekul-molekul air yang ada di dekatnya menjadi lebih tak
teratur. Efek hidrofob seperti ini dikatakan sebagai diarahkan secara entropi
(entropically driven).
Hanya sejumlah kecil dari lipid amfifilik terdispersi dalam air yang dapat
membentuk suatu monolayer (kecuali air menyebar berupa lapisan yang sangat
tipis). Sebagian besar kumpulan lipid akan membentuk micelle. Micelle bisa
berbentuk macam-macam, semuanya memuaskan efek hidrofobnya. Gambar
4-2 menunjukkan salah satu bentuk micelle, yakni micelle bentuk bola. Bentuk
micelle lain yang dapat terbentuk adalah elips, diskoidal, serta silinder.
Gambar 4-2 Satu bentuk micelle, yakni micelle bentuk bola
H
2
O
H
2
O
H
2
O
H
2
O
Gambar 4-1 Suatu amfifil membentuk suatu monolayer pada
permukaan air
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 171
Kecenderungan rantai hidrokarbon untuk menjauh dari pelarut
polar (yakni air) dikenal sebagai efek hidrofob. Hidrokarbon tidak
membentuk ikatan hidrogen dengan air, dan suatu hidrokarbon yang
dikelilingi oleh air akan memudahkan pembentukan ikatan hidrogen
di antara molekul-molekul air itu sendiri. Kumpulan air akan lebih
terstruktur daripada tanpa adanya hidrokarbon. Tanpa hidrokarbon,
air akan kehilangan entropi sehingga secara termodinamika keadaannya
kurang disukai. Keadaan seperti ini diubah oleh adanya hidrokarbon
yang tersusun sedemikian rupa sehingga menjauh dari air, menyebabkan
molekul-molekul air yang ada di dekatnya menjadi lebih tak teratur.
Efek hidrofob seperti ini dikatakan sebagai diarahkan secara entropi
(entropically driven).
Hanya sejumlah kecil dari lipid amfifilik terdispersi dalam air
yang dapat membentuk suatu monolayer (kecuali air menyebar
berupa lapisan yang sangat tipis). Sebagian besar kumpulan lipid akan
membentuk micelle. Micelle bisa berbentuk macam-macam, semuanya
memuaskan efek hidrofobnya. Gambar 4-2 menunjukkan salah satu
bentuk micelle, yakni micelle bentuk bola. Bentuk micelle lain yang
dapat terbentuk adalah elips, diskoidal, serta silinder.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 163
Gambar 4-1 Suatu amfifil membentuk suatu monolayer pada permukaan air
Kecenderungan rantai hidrokarbon untuk menjauh dari pelarut polar
(yakni air) dikenal sebagai efek hidrofob. Hidrokarbon tidak membentuk ikatan
hidrogen dengan air, dan suatu hidrokarbon yang dikelilingi oleh air akan
memudahkan pembentukan ikatan hidrogen di antara molekul-molekul air itu
sendiri. Kumpulan air akan lebih terstruktur daripada tanpa adanya
hidrokarbon. Tanpa hidrokarbon, air akan kehilangan entropi sehingga secara
termodinamika keadaannya kurang disukai. Keadaan seperti ini diubah oleh
adanya hidrokarbon yang tersusun sedemikian rupa sehingga menjauh dari air,
menyebabkan molekul-molekul air yang ada di dekatnya menjadi lebih tak
teratur. Efek hidrofob seperti ini dikatakan sebagai diarahkan secara entropi
(entropically driven).
Hanya sejumlah kecil dari lipid amfifilik terdispersi dalam air yang dapat
membentuk suatu monolayer (kecuali air menyebar berupa lapisan yang sangat
tipis). Sebagian besar kumpulan lipid akan membentuk micelle. Micelle bisa
berbentuk macam-macam, semuanya memuaskan efek hidrofobnya. Gambar
4-2 menunjukkan salah satu bentuk micelle, yakni micelle bentuk bola. Bentuk
micelle lain yang dapat terbentuk adalah elips, diskoidal, serta silinder.
Gambar 4-2 Satu bentuk micelle, yakni micelle bentuk bola
H
2
O
H
2
O
H
2
O
H
2
O
Gambar 4-2 Satu bentuk micelle, yakni micelle bentuk bola
Selain micelle dan monolayer, lipid amfifilik dalam air juga bisa
membentuk struktur bilayer berupa bola berongga yang tertutup
(Gambar 4-3-a). Struktur seperti ini disebut vesicle. Vesicle yakni dua
lapis lipid yang rantai-rantai hidrokarbonnya terletak saling berlawnan
(Gambar 4-3-b). Bilayer berbentuk lembaran tidak terdapat dalam air,
BIOKIMIA: Struktur dan Fungsi Biomolekul 172
karena ekor hidrokarbon akan berada di pinggir-pinggir lembaran. Hal
ini diatasi dengan melingkarnya lembaran membentuk bola berongga
yang menutup sendiri.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 164
Selain micelle dan monolayer, lipid amfifilik dalam air juga bisa
membentuk struktur bilayer berupa bola berongga yang tertutup (Gambar 4-3-
a). Struktur seperti ini disebut vesicle. Vesicle yakni dua lapis lipid yang rantai-
rantai hidrokarbonnya terletak saling berlawnan (Gambar 4-3-b). Bilayer
berbentuk lembaran tidak terdapat dalam air, karena ekor hidrokarbon akan
berada di pinggir-pinggir lembaran. Hal ini diatasi dengan melingkarnya
lembaran membentuk bola berongga yang menutup sendiri.
Gambar 4-3 Bentuk-bentuk lipid bilayer
Struktur micelle maupun bilayer terbentuk melalui gaya-gaya yang
bekerja berlawanan, yakni: (1) gaya tarik antara rantai-rantai hidrokarbon (gaya
van der Waals) yang disebabkan oleh efek hidrofob; dan (2) gaya tolakan
antara gugus-gugus kepala polar.
Batas bawah ukuran micelle ditentukan oleh efek hidrofob. Terdapat
jumlah minimum rantai-rantai hidrokarbon yang harus bersatu sebelum kontak
air-hidrokarbon bisa dihilangkan. Proses penyatuan ini merupakan suatu
kerjasama, sehingga micelle memiliki ukuran minimum. Batas atas ukuran
micelle ditentukan oleh tolakan kepala-kepala polar. Jika terdapat dua rantai
hidrokarbon di tiap gugus kepala polar, maka volume nonpolar di setiap gugus
kepala adalah dua kali lipat dari suatu lipid amfifilik yang hanya memiliki satu
rantai hidrokarbon. Lipid amfifilik dengan satu rantai hidrokarbon memiliki gaya
tolakan yang lebih besar, yang mencegah molekul-molekul lipid berkumpul
H
2
O
H
2
O
H
2
O
H
2
O
H
2
O
H
2
O
(a) Bentuk lapisan berongga (b) Bentuk lembaran (sheet)
Gambar 4-3 Bentuk-bentuk lipid bilayer
Struktur micelle maupun bilayer terbentuk melalui gaya-gaya
yang bekerja berlawanan, yakni: (1) gaya tarik antara rantai-rantai
hidrokarbon (gaya van der Waals) yang disebabkan oleh efek hidrofob;
dan (2) gaya tolakan antara gugus-gugus kepala polar.
Batas bawah ukuran micelle ditentukan oleh efek hidrofob.
Terdapat jumlah minimum rantai-rantai hidrokarbon yang harus
bersatu sebelum kontak air-hidrokarbon bisa dihilangkan. Proses
penyatuan ini merupakan suatu kerjasama, sehingga micelle memiliki
ukuran minimum. Batas atas ukuran micelle ditentukan oleh tolakan
kepala-kepala polar. Jika terdapat dua rantai hidrokarbon di tiap gugus
kepala polar, maka volume nonpolar di setiap gugus kepala adalah dua
kali lipat dari suatu lipid amfifilik yang hanya memiliki satu rantai
hidrokarbon. Lipid amfifilik dengan satu rantai hidrokarbon memiliki
gaya tolakan yang lebih besar, yang mencegah molekul-molekul lipid
berkumpul terlalu dekat sehingga akan membentuk micelle berukuran
kecil. Gaya tolakan yang lebih kecil dan volume hidrokarbon yang
lebih besar menyebabkan terbentuknya struktur yang jauh lebih besar,
yakni bilayer dan vesicle.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 173
Panjang rantai hidrokarbon relatif terhadap ukuran gugus kepala
polar suatu amfifilik mempengaruhi apakah akan terbentuk micelle atau
vesicle di dalam pelarut polar seperti air. Ion asilat dan lisofosfogliserida
akan membentuk micelle kecil. Fosfogliserida, fosfosfingolipid, plasma-
logen, glikogliserolipid, dan glikosfingolipid akan membentuk vesicle
dan bilayer.
Lipid yang memiliki rantai hidrokarbon lebih panjang akan mem-
bentuk micelle berukuran lebih besar. Hal ini dikarenakan perband-
ingan volume hidrokarbon terhadap kepala akan lebih besar sehingga
gaya tarik antara ekor-ekor (gaya van der Waals) lebih besar daripada
gaya tolak ionik antara gugus-gugus kepala.
Peningkatan kekuatan ion pada medium cair akan menyebabkan
terbentuknya micelle yang lebih besar. Kekuatan ionik yang lebih
besar ini akan menurunkan gaya tolak ionik antara gugus-gugus kepala
sehingga lebih banyak molekul lipid yang akan menyatu.
Micelle tidak akan terbentuk pada konsentrasi amfifil yang sangat
rendah. Transisi dari molekul yang terpisah-pisah menjadi suatu micelle
terjadi pada interval konsentrasi yang sempit yang dikenal sebagai
konsentrasi micelle kritis.
Kolesterol tidak akan membentuk micelle karena (1) bukan meru-
pakan amfifilik, dan (2) strukturnya berbentuk cincin fusi yang datar
dan kaku, sehinggal lebih membentuk suatu padatan daripada cairan,
padahal fasa hidrokarbon yang bergerak bebas diperlukan dalam pem-
bentukan micelle. Akan tetapi kolesterol dapat membentuk micelle
campuran dengan lipid amfifilik serta dapat memasuki monolayer.
8. ASAM EMPEDU DAN GARAM EMPEDU
Asam empedu diproduksi di dalam hati oleh metabolisme kolesterol.
Asam empedu merupakan steroid yang terdihidroksilasi atau
tertrihidroksilasi dengan 24 atom karbon. Yang termasuk asam empedu
antara lain asam kolat, asam deoksikolat, dan asam kenodeoksikolat.
Dalam asam empedu, semua gugus hidroksil memiliki orientasi a
sedangkan kedua gugus metilnya berorientasi b. Karena itu, salah
BIOKIMIA: Struktur dan Fungsi Biomolekul 174
satu sisi molekul akan lebih polar daripada sisi lainnya. Akan tetapi,
molekul asam empedu tidak berbentuk planar melainkan berbentuk
bengkok karena cincin A dan B berkonformasi cis.
Asam empedu yang diproduksi oleh hati akan berakumulasi di dalam
kantung empedu dalam bentuk garam empedu, yakni asam empedu
dengan gugus asam karboksilat yang berkonjugasi dengan glisin atau
taurin.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 166
CONHCH
2
COO
-
HO
OH
OH
Glikokolat
asam deoksikolat, dan asam kenodeoksikolat. Dalam asam empedu, semua
gugus hidroksil memiliki orientasi sedangkan kedua gugus metilnya
berorientasi . Karena itu, salah satu sisi molekul akan lebih polar daripada sisi
lainnya. Akan tetapi, molekul asam empedu tidak berbentuk planar melainkan
berbentuk bengkok karena cincin A dan B berkonformasi cis.
Asam empedu yang diproduksi oleh hati akan berakumulasi di dalam
kantung empedu dalam bentuk garam empedu, yakni asam empedu dengan
gugus asam karboksilat yang berkonjugasi dengan glisin atau taurin.
+
NH
3
CH
2
COO
- +
NH
3
CH
2
CH
2
SO
3
-
Glisin Taurin
Contoh struktur garam dari asam glikokolat dan asam taurokolat adalah
sebagai berikut:
CONH(CH
2
)
2
SO
3
-
HO
OH
OH
Taurokolat
Garam empedu mempunyai sifat detergen, tetapi tidak membentuk micelle
tertentu.
Garam empedu tidak membentuk micelle. Meskipun garam empedu
memiliki suatu kepala polar, tetapi ekor hidrokarbonnya bukanlah hidrokarbon
murni karena ada dua atau tiga gugus hidroksil pada salah satu sisi molekul.
Contoh struktur garam dari asam glikokolat dan asam taurokolat
adalah sebagai berikut:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 166
CONHCH
2
COO
-
HO OH
OH
Glikokolat
asam deoksikolat, dan asam kenodeoksikolat. Dalam asam empedu, semua
gugus hidroksil memiliki orientasi sedangkan kedua gugus metilnya
berorientasi . Karena itu, salah satu sisi molekul akan lebih polar daripada sisi
lainnya. Akan tetapi, molekul asam empedu tidak berbentuk planar melainkan
berbentuk bengkok karena cincin A dan B berkonformasi cis.
Asam empedu yang diproduksi oleh hati akan berakumulasi di dalam
kantung empedu dalam bentuk garam empedu, yakni asam empedu dengan
gugus asam karboksilat yang berkonjugasi dengan glisin atau taurin.
+
NH
3
CH
2
COO
- +
NH
3
CH
2
CH
2
SO
3
-
Glisin Taurin
Contoh struktur garam dari asam glikokolat dan asam taurokolat adalah
sebagai berikut:
CONH(CH
2
)
2
SO
3
-
HO OH
OH
Taurokolat
Garam empedu mempunyai sifat detergen, tetapi tidak membentuk micelle
tertentu.
Garam empedu tidak membentuk micelle. Meskipun garam empedu
memiliki suatu kepala polar, tetapi ekor hidrokarbonnya bukanlah hidrokarbon
murni karena ada dua atau tiga gugus hidroksil pada salah satu sisi molekul.
Garam empedu mempunyai sifat detergen, tetapi tidak membentuk
micelle tertentu.
Garam empedu tidak membentuk micelle. Meskipun garam
empedu memiliki suatu kepala polar, tetapi ekor hidrokarbonnya
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 175
bukanlah hidrokarbon murni karena ada dua atau tiga gugus hidroksil
pada salah satu sisi molekul. Selain itu, seperti kolesterol (yang juga
tidak membentuk micelle), sistem cincin yang kaku akan membentuk
fasa nonpolar yang hampir padat, bukan fasa nonpolar cair. Akan
tetapi garam empedu juga dapat membentuk micelle campuran dengan
fosfolipid.
Struktur kumpulan garam empedu yang sebenarnya belum
diketahui, tetapi hampir pasti melibatkan ikatan hidrogen di antara gugus-
gugus hidroksil dalam molekul yang berdekatan. Namun begitu, garam
empedu merupakan detergen yang kuat, dan mampu mengemulsikan
lipid makanan di dalam usus untuk membuat lipid tersebut lebih mudah
diserang oleh enzim pencernaan. Garam empedu juga diperlukan untuk
penyerapan lipid makanan yang sudah dicerna ke dalam sel pada mukosa
usus.
9. LIPOPROTEIN PLASMA
Plasma darah mengandung sejumlah lipoprotein terlarut, yang
diklasifikasikan menurut kerapatannya menjadi empat tipe utama.
Kompleks lipid-protein ini berfungsi sebagai sistem transpor lipid.
Lipid yang terisolasi tidaklah larut dalam darah, tetapi bisa dibuat larut
dan bisa diangkut dengan cara kombinasi dengan protein tertentu
membentuk lipoprotein. Terdapat tipe utama lipoprotein dalam darah
manusia: (1) kilomikron; (2) very low density lipoprotein (VLDL); (3)
low-density lipoprotein (LDL); dan (4) high-density lipoprotein (HDL).
Sifat-sifat keempat lipoprotein ini dapat dilihat dalam Tabel 4.2.
Komposisi lipoprotein plasma yang berbeda-beda menentukan
fungsinya. Yang pasti, lipoprotein yang kaya akan TAGs disintesis
oleh hati (yakni VLDL) maupun usus halus (yakni kilomikron), dan
mengantarkan lemak netral ke jaringan ekstrahepatik, terutama jaringan
adiposa. Lipoprotein yang kehabisan lemak memiliki kerapatan lebih
tinggi, yang penting dalam transfer kolesterol.
BIOKIMIA: Struktur dan Fungsi Biomolekul 176
Tabel 4-2 Lipoprotein Plasma
Kilomikron VLDL LDL HDL
Kerapatan (g mL
-1
) <0,95 0,951,006 1,0061,063 1,0631,21
Diameter maksimum (nm) 500 70 25 15
% komposisi:*
Protein 2 10 22 33
TAG 83 50 10 8
Fosfolipid 7 18 22 29
Kolesterol dan ester
kolesterol
8 22 46 30
*Berdasarkan berat kering lipoprotein utuh
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 169
Gambar 4-4 Struktur umum partikel lipoprotein
10. VESICLE
Apabila air ditambahkan pada fosfolipid kering tertentu dengan rantai
hidrokarbon panjang, maka fosfolipid tersebut akan membengkak. Lalu ketika
fosfolipid itu terdispersi dalam air yang lebih banyak, maka terbentuklah struktur
yang dikenal sebagai liposom. Liposom adalah vesicle yang memiliki banyak
lapisan fosfolipid (Gambar 4-5). Ketika dilakukan vibrasi ultrasonik (sonikasi),
liposom berubah menjadi vesicle yang hanya memiliki satu bilayer fosfolipid.
Gambar 4-5 Liposom adalah vesicle yang memiliki banyak lapisan fosfolipid
Vesicle juga bisa dibuat dengan dialisis larutan fosfolipid dalam
detergen. Fosfolipid dan detergen ini membentuk micelle campuran yang
Permukaan : fosfolipid
Protein
kolesterol
Inti : TAG, ester kolesterol
= Fosfolipid
= Kolesterol
= Protein
H
2
O
H
2
O
Gambar 4-4 Struktur umum partikel lipoprotein
Struktur umum partikel lipoprotein dapat dilihat pada Gambar
4-4. Permukaan polar pada partikel bola membuat kumpulan tersebut
larut dalam air. Struktur ini hanya bersifat sementara. Jumlah material
polar dalam kilomikron dan VLDL sangatlah kecil. Lebih dari itu, ketika
lipoprotein ini menyentuh membran sel jaringan target, protein ini tetap
terlarut dan tidak bisa masuk ke dalam membran. Hal ini menunjukkan
bahwa protein pada lipoprotein memiliki sifat-sifat unik. Diketahui
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 177
bahwa ada beberapa jenis protein, yakni apoprotein: AI, AII, B48, B100,
CI, CII, CIII, D, dan E. Urutan asam amino dari beberapa protein ini
telah ditentukan, dan terlihat bahwa protein-protein tersebut memiliki
daerah hidrofob. Hal ini berarti protein-protein tersebut memiliki sifat
yang menunjukkan bahwa bagian dari strukturnya kompatibel dengan
hidrokarbon (misalnya TAGs dan ekor fosfolipid).
10. VESICLE
Apabila air ditambahkan pada fosfolipid kering tertentu dengan rantai
hidrokarbon panjang, maka fosfolipid tersebut akan membengkak.
Lalu ketika fosfolipid itu terdispersi dalam air yang lebih banyak, maka
terbentuklah struktur yang dikenal sebagai liposom. Liposom adalah
vesicle yang memiliki banyak lapisan fosfolipid (Gambar 4-5). Ketika
dilakukan vibrasi ultrasonik (sonikasi), liposom berubah menjadi vesicle
yang hanya memiliki satu bilayer fosfolipid.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 169
Gambar 4-4 Struktur umum partikel lipoprotein
10. VESICLE
Apabila air ditambahkan pada fosfolipid kering tertentu dengan rantai
hidrokarbon panjang, maka fosfolipid tersebut akan membengkak. Lalu ketika
fosfolipid itu terdispersi dalam air yang lebih banyak, maka terbentuklah struktur
yang dikenal sebagai liposom. Liposom adalah vesicle yang memiliki banyak
lapisan fosfolipid (Gambar 4-5). Ketika dilakukan vibrasi ultrasonik (sonikasi),
liposom berubah menjadi vesicle yang hanya memiliki satu bilayer fosfolipid.
Gambar 4-5 Liposom adalah vesicle yang memiliki banyak lapisan fosfolipid
Vesicle juga bisa dibuat dengan dialisis larutan fosfolipid dalam
detergen. Fosfolipid dan detergen ini membentuk micelle campuran yang
Permukaan : fosfolipid
Protein
kolesterol
Inti : TAG, ester kolesterol
= Fosfolipid
= Kolesterol
= Protein
H
2
O
H
2
O
Gambar 4-5 Liposom adalah vesicle yang memiliki banyak lapisan
fosfolipid
BIOKIMIA: Struktur dan Fungsi Biomolekul 178
Vesicle juga bisa dibuat dengan dialisis larutan fosfolipid dalam
detergen. Fosfolipid dan detergen ini membentuk micelle campuran
yang didominasi oleh detergen yang memiliki rantai hidrokarbon
tunggal. Micelle yang terbentuk berukuran kecil. Dialisis menurunkan
konsentrasi detergen yang larut dalam air sehingga micelle jadi
terdominasi oleh fosfolipid yang memiliki dua rantai hidrokarbon.
Bersatunya micelle-micelle menyebabkan terbentuknya bilayer.
Vesicle yang dibuat dari campuran fosfolipid memiliki distribusi
lipid yang tak merata antara kedua lapis bilayer. Lengkungan vesicle
dapat membuat daerah permukaan eksternal meluas hingga sekitar tiga
kali lipat luas permukaan internal. Karena itu terdapat lebih dari dua
kali lipat jumlah molekul lipid pada lapisan luar. Fosfopipid dengan
kepala yang besar (misalnya PC) cenderung berpartisi ke dalam lapisan
luar di mana tolakannya lebih lemah (Gambar 4-6).
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 170
didominasi oleh detergen yang memiliki rantai hidrokarbon tunggal. Micelle
yang terbentuk berukuran kecil. Dialisis menurunkan konsentrasi detergen
yang larut dalam air sehingga micelle jadi terdominasi oleh fosfolipid yang
memiliki dua rantai hidrokarbon. Bersatunya micelle-micelle menyebabkan
terbentuknya bilayer.
Vesicle yang dibuat dari campuran fosfolipid memiliki distribusi lipid
yang tak merata antara kedua lapis bilayer. Lengkungan vesicle dapat
membuat daerah permukaan eksternal meluas hingga sekitar tiga kali lipat luas
permukaan internal. Karena itu terdapat lebih dari dua kali lipat jumlah molekul
lipid pada lapisan luar. Fosfopipid dengan kepala yang besar (misalnya PC)
cenderung berpartisi ke dalam lapisan luar di mana tolakannya lebih lemah
(Gambar 4-6).
Gambar 4-6 Fosfopipid dengan kepala yang besar cenderung berpartisi ke dalam
lapisan luar di mana tolakannya lebih lemah
Vesicle yang dibuat dengan dialisis hampir tak dapat ditembus oleh
kation kecil dan sebagian besar molekul polar besar. Vesicle ini sedikit dapat
menyerap Cl
-
, dan sangat menyerap air karena kelarutan air dalam hidrokarbon
cair sangat besar. Bila terdapat protein pada saat terjadinya pembentukan
vesicle, protein ini bisa masuk ke dalam bilayer fosfolipid, membentuk vesicle
yang dikenal sebagai proteoliposom.
Selain dari fosfolipid dan protein, vesicle juga bisa dibuat dari membran
sitoplasma sel, biasanya melalui prosedur sonikasi. Vesicle buatan dan vesicle
yang berasal dari membran alami sangat berguna dalam mempelajari
fenomena transpor lintas membran. Vesicle juga terbentuk secara alami,
misalnya dalam sel eukariot.
Gambar 4-6 Fosfopipid dengan kepala yang besar cenderung berpartisi ke
dalam lapisan luar di mana tolakannya lebih lemah
Vesicle yang dibuat dengan dialisis hampir tak dapat ditembus
oleh kation kecil dan sebagian besar molekul polar besar. Vesicle ini
sedikit dapat menyerap Cl-, dan sangat menyerap air karena kelarutan
air dalam hidrokarbon cair sangat besar. Bila terdapat protein pada saat
terjadinya pembentukan vesicle, protein ini bisa masuk ke dalam bilayer
fosfolipid, membentuk vesicle yang dikenal sebagai proteoliposom.
Selain dari fosfolipid dan protein, vesicle juga bisa dibuat dari
membran sitoplasma sel, biasanya melalui prosedur sonikasi. Vesicle
buatan dan vesicle yang berasal dari membran alami sangat berguna
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 179
dalam mempelajari fenomena transpor lintas membran. Vesicle juga
terbentuk secara alami, misalnya dalam sel eukariot.
11. MEMBRAN
Sitoplasma dalam sel dikelilingi oleh membran plasma. Struktur-
struktur subseluler seperti inti, lisosom, dan mitokondria juga dibatasi
oleh membran. Membran pada retikulum endoplasma dalam eukariot
memagari ruang intrasel yang besar di dalam sitoplasma. Sedangkan
mitokondria memiliki membran internal yang terlipat.
Membran-membran ini berfungsi memisahkan sel dari lingkung-
annya, serta memisahkan bagian-bagian berbeda dalam sel sehingga
aktivitas di dalamnya dapat berlangsung secara independen. Dengan
demikian, suatu membran merupakan pembatas fisik yang menjaga
ruangan yang dipagarinya agar dapat mengambil atau mengeluarkan
zat-zat yang berguna atau berbahaya. Membran juga menyediakan
lingkungan tempat berlangsungnya reaksi kimia yang membutuhkan
kondisi bebas air.
Membran terdiri atas lipid, protein, dan sedikit karbohidrat. Per-
bandingan massa kandungan membran ini bervariasi menurut tipe
membran. Karbohidrat dalam membran terdapat sebagai glikoglisero-
lipid, glikosfingolipid, dan glikoprotein. Tipe lipid yang paling ban-
yak ditemukan dalam semua jenis membran yakni fosfogliserida dan
fosfosfingolipid (sfingomyelin). Kolesterol ditemukan dalam membran
plasma hewan tetapi jarang pada tanaman. Glikosfingolipid ditemu-
kan dalam membran syaraf dan jaringan otot. Jenis dan jumlah ke-
pala polar sangat bervariasi, tetapi rantai hidrokarbon yang ditemukan
dalam semua jenis membran adalah serupa. Komposisi beberapa mem-
bran dapat dilihat dalam Tabel 4.3.
BIOKIMIA: Struktur dan Fungsi Biomolekul 180
Tabel 6-3 Komposisi Membran
Komponen
(persen dari berat
membran)
Komposisi Lipid*
(persen dari total lipid)**
Membran Protein Lipid
Karbohidrat
PA PC PE PI PS PG DPG SM GS Chol
Eritrosit manusia 49 43 8 2 19 18 1 8 18 10 25
Myelin manusia 18 79 3 1 10 20 1 9 8 26 26
Hati tikus:
Plasma 55 40 5 1 19 12 4 9 14 30
Mitokon-dria luar 50 47 3 1 48 22 12 2 2 3 5 5
Mitokon-dria
dalam
75 23 2 1 43 24 6 1 2 18 2 3
Plasma Escherichia
coli
75 25 tr*** 65 tr 18 12
* SM sfingomyelin
GS glikosfingolipid
Chol kolesterol
** Beberapa analisa lipid tidak memberikan total 100% karena tidak semua lipid yang ada dicatat
di sini.
***tr trace (sangat sedikit sekali).
Molekul lipid dalam membran tersusun dalam bentuk bilayer
tertutup, sama seperti vesicle buatan (Gambar 4-3). Membran
yang terbentuk secara alami kadangkala disebut biomembran untuk
membedakannya dari membran yang terdapat dalam vesicle buatan
maupun vesicle yang dibuat secara eksperimen dari membran alami.
Sebagian protein dalam membran dapat dihilangkan oleh pereaksi
yang mengganggu ikatan polar dan ionik (misalnya urea atau larutan
garam berkonsentrasi tinggi). Protein ini dikenal sebagai protein
ekstrinsik atau peripheral. Protein lain yang disebut sebagai protein
intrinsik atau integral dapat dihilangkan hanya dengan mereaksikan
membran dengan detergen atau pelarut organik.
Jika suatu membran merupakan bilayer lipid yang polar, makan
protein peripheral terdapat pada permukaan bilayer dan menempel
pada kepala polar lipid atau protein integral melalui ikatan polar dan
ikatan ionik. Protein integral terbungkus di dalam bilayer dan terikat
dalam membran oleh ikatan van der Waals dan interaksi hidrofob.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 181
Beberapa protein integral yang diisolasi dari membran memiliki
berat molekul besar. Protein seperti ini masuk ke dalam bilayer lipid
dengan cara memutar bilayer (Gambar 4-7). Bagian yang berproyeksi
pada kedua sisi adalah polar, sedangkan bagian yang terbungkus dalam
bilayer terdiri atas residu-residu asam amino yang memiliki rantai
samping hidrofob atau terlipat sedemikian rupa sehingga rantai-rantai
samping hidrofil berproyeksi ke tengah struktur yang jauh dari lipid.
Protein integral dapat melewati membran sampai 12 kali atau lebih.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 173
Gambar 4-7 Beberapa protein integral yang diisolasi dari membran memiliki berat
molekul besar. Protein seperti ini masuk ke dalam bilayer lipid dengan
cara memutar bilayer
Relatif sedikit protein membran integral yang telah berhasil dimurnikan, tetapi
banyak protein integral yang sekarang telah ditentukan urutannya. Dalam
protein-protein ini teridentifikasi domain transmembran dalam urutan 20 asam
amino yang banyak mengandung asam amino hidrofob.
Sejauh ini belum ada protein yang ditemukan sebagai konstituen umum
untuk semua membran. Karena sepertinya tidak ada struktur protein yang
universal dalam membran. Jumlah protein yang berbeda dalam membran
bervariasi menurut tipe membran. Membran plasma pada bakteri
Halobacterium halobium hanya mengandung 1 protein (bakteriorodopsin),
sedangkan membran bakteri Escherichia coli mengandung sekitar 100 protein.
Membran plasma sel darah manusia mengandung setidaknya 17 macam
protein.
S.J. Singer dan G.L. Nicolson pada tahun 1972 mengusulkan model
mosaik cair sebagai skema universal untuk struktur membran (Gambar 4-8).
Gambar 4-8 Model mosaik fluida struktur membran. Mosaik bilayer lipid polar
mempunyai ketebalan kira-kira 5 nm. Protein-protein, termasuk
transmembran protein seperti yang ditunjukkan adalah berapa
gumpalan yang tidak beraturan.
Gambar 4-7 Beberapa protein integral yang diisolasi dari membran
memiliki berat molekul besar. Protein seperti ini masuk ke dalam bilayer
lipid dengan cara memutar bilayer
Relatif sedikit protein membran integral yang telah berhasil
dimurnikan, tetapi banyak protein integral yang sekarang telah diten-
tukan urutannya. Dalam protein-protein ini teridentifikasi domain
transmembran dalam urutan 20 asam amino yang banyak mengand-
ung asam amino hidrofob.
Sejauh ini belum ada protein yang ditemukan sebagai konstituen
umum untuk semua membran. Karena sepertinya tidak ada struktur
protein yang universal dalam membran. Jumlah protein yang berbeda
dalam membran bervariasi menurut tipe membran. Membran plasma
pada bakteri Halobacterium halobium hanya mengandung 1 protein
(bakteriorodopsin), sedangkan membran bakteri Escherichia coli
mengandung sekitar 100 protein. Membran plasma sel darah manusia
mengandung setidaknya 17 macam protein.
BIOKIMIA: Struktur dan Fungsi Biomolekul 182
S.J. Singer dan G.L. Nicolson pada tahun 1972 mengusulkan
model mosaik cair sebagai skema universal untuk struktur membran
(Gambar 4-8).
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 173
Gambar 4-7 Beberapa protein integral yang diisolasi dari membran memiliki berat
molekul besar. Protein seperti ini masuk ke dalam bilayer lipid dengan
cara memutar bilayer
Relatif sedikit protein membran integral yang telah berhasil dimurnikan, tetapi
banyak protein integral yang sekarang telah ditentukan urutannya. Dalam
protein-protein ini teridentifikasi domain transmembran dalam urutan 20 asam
amino yang banyak mengandung asam amino hidrofob.
Sejauh ini belum ada protein yang ditemukan sebagai konstituen umum
untuk semua membran. Karena sepertinya tidak ada struktur protein yang
universal dalam membran. Jumlah protein yang berbeda dalam membran
bervariasi menurut tipe membran. Membran plasma pada bakteri
Halobacterium halobium hanya mengandung 1 protein (bakteriorodopsin),
sedangkan membran bakteri Escherichia coli mengandung sekitar 100 protein.
Membran plasma sel darah manusia mengandung setidaknya 17 macam
protein.
S.J. Singer dan G.L. Nicolson pada tahun 1972 mengusulkan model
mosaik cair sebagai skema universal untuk struktur membran (Gambar 4-8).
Gambar 4-8 Model mosaik fluida struktur membran. Mosaik bilayer lipid polar
mempunyai ketebalan kira-kira 5 nm. Protein-protein, termasuk
transmembran protein seperti yang ditunjukkan adalah berapa
gumpalan yang tidak beraturan.
Gambar 4-8 Model mosaik fluida struktur membran. Mosaik bilayer
lipid polar mempunyai ketebalan kira-kira 5 nm. Protein-protein,
termasuk transmembran protein seperti yang ditunjukkan adalah berapa
gumpalan yang tidak beraturan.
Model dalam Gambar 4-8 menunjukkan bahwa struktur membran
tidak kaku melainkan cair dan dinamis. Karena daerah hidrokarbon
berwujud cair, maka terjadi difusi lateral dan gerakan rotasi yang cepat
(sekitar sumbu yang tegak lurus terhadap bilayer) pada komponen-
komponen lipid dan protein.
Pergerakan komponen dari satu lapisan ke lapisan lainnya
(flip-flop) dibatasi dalam model pada Gambar 4-8. Pergerakan ini
berlangsung bila daerah polar pada lipid atau protein melewati inti
hidrofob pada bilayer. Hal ini tidak disukai secara termodinamika.
Membran memiliki distribusi asimetrik untuk komponen lipid
dan proteinnya di antara kedua lapis bilayer. Buktinya, misalnya PC
dan sfingomyelin ditemukan dalam lapisan luar, sedangkan PE dan PS
lebih mendominasi lapisan dalam. Adanya transpor membran searah
menandakan bahwa protein yang terlibat pasti terdistribusi secara
asimetris antar membran. Lebih dari itu, lapisan luar membran plasma
mengandung molekul glikoprotein dan glikolipid yang mengidentifi-
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 183
kasi sel sebagai suatu tipe tertentu sehingga dapat dikenali dari kom-
ponen dalam peredaran. Glikoprotein dan glikolipid ini tidak terdapat
dalam lapisan dalam. Bukti lainnya yakni fosfolipid tertentu (misalnya
PS) terdistribusi asimetris oleh reaksi translokase fosfolipid yang me-
merlukan energi.
Pada suhu rendah, bilayer lipid tidak akan berwujud cair. Pada
transisi reversibel, biasanya pada interval ~100C, terjadi seiring
kenaikan suhu, dan rantai hidrokarbon menjadi tak teratur sehingga
membran menjadi cair. Titik tengah transisi ini dikenal sebagai titik
leleh atau suhu transisi. Besarnya suhu ini dalam organisme tertentu
dijaga beberapa derajat di bawah suhu lingkungan dan tergantung
pada: (1) panjang rantai hidrokarbon dan derajat ketidakjenuhannya;
dan (2) sifat gugus kepala dari lipid.
Ketergantungan titik leleh pada sifat gugus kepala lipid
menandakan bahwa interaksi terjadi di antara gugus-gugus kepala yang
beraneka ragam. Hal ini didukung oleh pengamatan bahwa PE jauh
lebih pendiam daripada PC dalam membran buatan. Pada PE, ikatan
hidrogen dapat terjadi antara NH3+ dengan fosfat pada molekul yang
bersebelahan, sedangkan gugus
+
N(CH3)3 dalam molekul PC yang
lebih besar relatif terhadap NH3+ membuat
+
N(CH3)3 sulit untuk
masuk ke dalam susunan teratur tanpa menciptakan gaya tolak yang
lebih kuat; hal ini menimbulkan mobilitas yang lebih besar.
Ketika diisolasi, sejumlah protein integral menyimpan molekul
lipid yang terikat. Mungkin dalam membran utuh mobilitas protein
dan lapisan lipid yang mengelilinginya dibatasi oleh penggabungan
fisik antara keduanya. Penghilangan lipid dari larutan menyebabkan
hilangnya integritas struktural dan fungsional protein.
Kolesterol menurunkan kebebasan gerak lipid yang mengelilinginya
karena kolesterol merupakan struktur kaku yang memiliki afinitas
tinggi untuk rantai hidrokarbon terhadap tetangganya. Lebih dari
itu, kolesterol terbungkus begitu dalam sehingga gugus hidroksilnya
setingkat dengan ikatan ester pada lipid tetangga serta terdapat ikatan
hidrogen antara gugus hidroksil dengan kepala polar. Pada umumnya,
membran yang kaya akan kolesterol akan mereduksi permeabilitas air.
BIOKIMIA: Struktur dan Fungsi Biomolekul 184
Pengenalan sel oleh sel lain sering melibatkan karbohidrat yang
menempel pada protein di permukaan membran sel. Karbohidrat
seperti ini kerapkali menempel pada residu serin atau treonin melalui
ikatan O-glikosida, atau pada rantai samping residu asparagin melalui
ikatan N-glikosida. Oligosakarida berikatan-N kerapkali mengandung
inti umum 5 residu, yakni dua N-asetilglukosamin dan tiga manosa,
seperti diperlihatkan dalam Gambar 4-9. pada inti ini bisa menempel
residu manosa lainnya (tipe manosa) atau berbagai kombinasi N-
asetilglukosamin, galaktosa, asam N-asetilneuraminat, dan fukosa (tipe
kompleks). Dengan sejumlah unit monosakarida yang berbeda-beda,
beberapa kemungkinan ikatan, dan dua konfigurasi anomer, maka
jumlah kemungkinan strukturnya luar biasa banyak.
Derajat keanekaragaman kemungkinan yang besar dapat menyediakan
banyak kandungan informasi, sehingga sel dapat membangun
mekanisme kompleks untuk pengenalan.
Diyakini bahwa senescence sel mamalia atau glikoprotein
yang beredar bisa dikenali dari hilangnya asam N-asetilneuraminat
(asam sialat) yang disebabkan oleh sialilase dalam jaringan vaskuler.
Ujung residu galaktosa bisa dikenali dan diikat oleh suatu reseptor
asialoglikoprotein pada sel-sel tertentu yang kemudian dapat
menginternalisasi dan mendegradasi sel atau protein yang membawa
glikoprotein terasialilasi atas pertolongan endositosis.
Tanaman dan beberapa bakteri menghasilkan protein lektin,
yang mampu membentuk ikatan spesifik pada kelompok-kelompok
oligosakarida tertentu. Lektin dari kacang jack bean (yakni
konkanavalin A) mengenali dan mengikat unit a-manosa nonpereduksi
dari oligosakarida. Bakteri seperti E. coli menempel pada jaringan inang
melalui lektin bakteri yang mengenali dan mengikat unit karbohidrat
tertentu pada permukaan sel inang. Mekanisme pengenalan jenis
ini menjelaskan spesifitas jaringan terhadap beberapa penyakit yang
disebabkan oleh bakteri.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 185
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 176
NeuNAc
Gal
GlcNAc
Man
NeuNAc
Gal
GlcNAc
Man
Man
GlcNAc
GlcNAc
-Asn-
GlcNAc
Fuc
"Inti" biasa
(common "core")
(a) Tipe kompleks
Man
Man
Man Man
Man
GlcNAc
GlcNAc
-Asn-
"Inti" biasa
(common "core")
(b) Tipe manosa tinggi
Man
Man
Man
Man
Gambar 4-9 Oligosakarida berikatan-N dalam glikoprotein: (a) tipe
kompleks, dan (b) tipe manosa tinggi.
Diyakini bahwa senescence sel mamalia atau glikoprotein yang
beredar bisa dikenali dari hilangnya asam N-asetilneuraminat (asam sialat)
yang disebabkan oleh sialilase dalam jaringan vaskuler. Ujung residu galaktosa
bisa dikenali dan diikat oleh suatu reseptor asialoglikoprotein pada sel-sel
tertentu yang kemudian dapat menginternalisasi dan mendegradasi sel atau
protein yang membawa glikoprotein terasialilasi atas pertolongan endositosis.
Gambar 4-9 Oligosakarida berikatan-N dalam glikoprotein: (a) tipe
kompleks, dan (b) tipe manosa tinggi.
BIOKIMIA: Struktur dan Fungsi Biomolekul 186
12. STRUKTUR DAN FUNGSI MEMBRAN
Membran membentuk perbatasan di sekeliling sel dan sekeliling
kompartemen subsel yang berbeda. Mereka berperan sebagai pembatas
permeabel selektif dan terlibat dalam prose sinyal. Semua membran berisi
berbagai jumlah lipid dan protein dan beberapa mengandung sedikit
karbohidrat.
Dalam membran, tiga kelompok utama lipid yakni gliserofosfolipid,
sfingolifid, dan sterol. Gliserofofolid memiliki tulang punggung gliserol
yang menempel pad dua rantai hidrikarbon asamlemak dan satu gugus
kepalaterfosforilasi. Ini antara lain fosfatidilinositol, fosfadiserin, dan
difosfatridilgliserol. Sfingolifid berdasarkan atas sfingosin tempat
rantai asam lemak tunggal menempel dan suatu gugus kepala
terfosforilasi (sfingomielin) atau satu atau lebih residu gula (serebrosida
dan gangliosida, yakni glikosfingolifid). Sterol utama dalam membran
plasma hewan yakni kolesterol, sedangkan stigmasterol dan -sitosterol
yang strukturnya berkaitan ditemukan pada tumbuhan.
Rantai asam lemak gliserofosfolipid dan sfingolipid terdiri atas
rantai panjang atom karbon yang biasanya tak bercabang dan memiliki
jumlah atom karbon yang biasanya tak bercabang dan memiliki jumlah
atom karbon genap (misalnya palmitat C16, stearat C18). Rantai ini
bisa bersifat jenuh sepenuhnya dengan atom hydrogen atau bisa juga
memiliki satu atau lebih ikatan rangkap tak jenuh yang berada dalam
konfigurasi cis (misalnya oleat C18:L dengan satu ikatan rangkap).
Membran bersifat amfipatik (amfifilik) karena memiliki daerah
hidrofil dan juga hidrofob. Dalam gliserofosfolipid dan sfingolipid,
rantai hidrokarbon asam lemak bersifat hidrofob sedangkan gugus
kepala polarnya bersifat hidrofil. Dalam kolesterol, seluruh molekul
kecuali gugus hidroksil pada karbon-3 adalah hidrofob. Dalam larutan
encer, lipid amfipatik menyusun sendiri menjadi sel atau menjadi
lembaran bimolekul (bilayer) yang lebih luas untuk mencegah daerah
hidrofob bersentuhan dengan molekul air yang mengelilingi struktur
bilayer dipertahankan oleh banyak interaksi nonkovalen antara rantai-
rantai asam lemak yang bersebelahan dan antara gugus-gugus kepala
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 187
polar pada lipid tersebut. Dalam membran biologis, bilayer lipid
mempunyai distribusi lipid tak simetris antara lembaran dalam dan
luar.
Lipid relatif bebas bergerak di dalam bidang bilayer dengan gerakan
rotasi atau lateral, tetapi tidak mudah membalik dari satu sisi bilayer
ke sisi lainnya (gerakan trnaverse). Memanaskan bilayer mengubahnya
dari keadaan mirip gel menjadi keadaan yang lebih mirip cairan.
Menambah panjang rantai asam lemak atau mengurangi jumlah ikatan
rangkap tak jenuh dalam rantai asam lemak menyebabkan penurunan
fluiditas membran. Pada membran hewan, menambah jumlah
kolesterol dengan sistem cincin gabungan kakunya juga menurunkan
fluiditas membran.
Membran dan Lipid Membran
Membran membentuk perbatasan baik di sekeliling sel (membran
plasma maupun di sekeliling kompartemen subsel yang berbeda
(misalnya inti, mitikondria, lisosom, dan lain-lain). Mereka berperan
sebagai pembatas permeabel selektif yang memungkinkan lingkungan
dalam sel atau organel untuk dibedakan dari yang berada di luar.
Membran terlibat dalam proses sinyal; mereka memiliki reseptor
spesifik untuk stimuli eksternal dan terlibat dalam pembentukan
sinyal listrik maupun kimia. Semua membran berisi dua komponen
dasar: lipid, protein, dan karbohidrat bervariasi dari satu membran
ke membran lainnya. Contohnya, membran dalam mitokondria
mempunyai protein yang lebih banyak daripada lipid karena adanya
kmpleks-kompleks protein yang sangat banyak yang terlibat dalam
fosforilasi oksidatif dan transfer elektron, sedangkan membran sheath
myelin dari sel syaraf, yang bekerja untuk insulate sel secara elektrik,
mempunyai proporsi lipid yang lebih banyak.
Lipid pada awalnya dikelompokkan sebagai zat biologis yang tak
larut dalam air namun larut dalam pelarut organik seperti kloroform
danm methanol. Selain sebagai komponen struktur dari membran,
lipid mempunyai beberapa peran biologis lainnya. Mereka berperan
BIOKIMIA: Struktur dan Fungsi Biomolekul 188
sebagai molekul bahan baker, sebagai simpanan energi pekat (misalnya
triasilgliserol), dan sebagai molekul sinyal. Di dalam membran terdapat
tiga tipe utama lipid : gliserofosfolipid, sfingolifid, dan sterol.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 180
Gambar 4.10 Struktur membran gliserofosfolipid. R
1
dan R
2
adalah rantai
hidrokarbon dari asam lemak
b. Sfingolipid
Sfingomyelin, yakni sfingolipid yang paling umum, memiliki tulang punggung
sfingosin (Gambar 4.11a) menggantikan gliserol dalam gliserofosfolipid.
Seperti gliserofosfolipid, mereka yang memiliki gugus kepala terfosforilasi
(kolin ataupun etanolamin) dan dua rantai hidrokarbon (Gambar 4.11a).
Salah satu rantai hidrokarbon datang dari molekul sfingosin, yang satunya
lagi merupakan asam lemak seperti yang ditemukan dalam gliserofosfolipid
kecuali bahwa ia terikat via ikatan amida dalam sfingolipid. Sfingomyelin
terutama melimpah dalam myelin sheath yang mengelilingi sell syaraf.
C
O
R
1
O CH
2
CH C R
2
O
O
H
2
C O P O
-
O
-
O
C
O
R
1
O CH
2
CH C R
2
O
O
H
2
C O P O
O
-
O
CH
2
C
H
COO
-
NH
3
+
C
O
R
1
O CH
2
CH
H
2
C O P O
O
-
O
CH
2
CH
2
NH
3
+
C R
2
O
O
C
O
R
1
O CH
2
CH
H
2
C O P O
O
-
O
CH
2
CH
2
N
+
CH
3
CH
3
CH
3
C R
2
O
O
C
O
R
1
O CH
2
CH
H
2
C O P O
O
-
O
CH
2
C
H
OH
CH
2
OH
C R
2
O
O
C
O
R
1
O CH
2
CH C R
2
O
O
H
2
C O P O
O
-
O
OH
H
OH
H
H
OH
OH
H
H
OH
H
C
O
R
1
O CH
2
CH C R
2
O
O
H
2
C O P O
O
-
O
CH
2
C
OH
H
CH
2
O P O
O
-
O
CH
2
HC
H
2
C O
O C R
4
O
C R
3
O
Fosfatidat
Fosfatidilserin
Fosfatidiletanolamin Fosfatidilinositol
Fosfatidilkolin Fosfatidilgliserol
Difosfatidilgliserol
Gambar 4.10 Struktur membran gliserofosfolipid. R1 dan R2 adalah
rantai hidrokarbon dari asam lemak
a. Gliserol fosfolifid
Gliserolfosfolifid dibuat dari tiga komponen: Gugus kepala fesfo-
folirasi, tulang punggung tiga-karbon, dan dua rantai asam lemah
hidrokarbon (Gambar 4.10). Gugus kepala ferfosfolirasi menem-
pel pada karbon -3 dari tulang punggung gliserol, sedangkan kedua
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 189
rantai asam lemak menempel pada dua atom karbon lainnya. Gli-
serofosfolipid yang paling sederhana yakni fosfatidat (diasilgliserol
3-fosfat) yang hanya memilki satu gugus asam fosfat teresterifikai
pada karbon-3 gliserol. Meskipun fosfatidat itu sendiri terdapat
dalam jumlah sedikit dalam membran, namun gliserofosfolipid ke-
banyakan diturunkan darinya. Dalam lipid-lipid yang lain ini fosfat
selanjutnya diesterifikasi ke gugus hidroksil dari salah datu dari be-
berapa alcohol (kolin, etanolamin, gliserol, inositol, atau serin). Gli-
serofifosfolipid utama yang ditemukan dalam membran antara lain:
Fosfatidilkolin, fosfatidiletanol/amin, fosfatidilgliserol, fosfatidilino-
sil, dan fosfatidilserin (Gambar 4.10). Difosfatidilgliserol (atau kar-
diolipin) ditemukan mendominasi membran dalam mitokondria.
b. Sfingolipid
Sfingomyelin, yakni sfingolipid yang paling umum, memiliki tulang
punggung sfingosin (Gambar 4.11a) menggantikan gliserol dalam
gliserofosfolipid. Seperti gliserofosfolipid, mereka yang memiliki
gugus kepala terfosforilasi (kolin ataupun etanolamin) dan dua
rantai hidrokarbon (Gambar 4.11a). Salah satu rantai hidrokarbon
datang dari molekul sfingosin, yang satunya lagi merupakan asam
lemak seperti yang ditemukan dalam gliserofosfolipid kecuali
bahwa ia terikat via ikatan amida dalam sfingolipid. Sfingomyelin
terutama melimpah dalam myelin sheath yang mengelilingi sell
syaraf. Glikosfingolipid seperti serebrosida dan gongliosida, juga
diturunkan dari sfingosin, tetapi untuk menggantikan gugus
kepala terfoforilasi mereka memiliki satu atau lebih residu gula.
Galaktoserebrosida mempunyai satu residu galaktosa (gambar
4.11a) dan ditemukan mendominasi dalam membran sel neuron
pada otak.
BIOKIMIA: Struktur dan Fungsi Biomolekul 190
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 181
Glikosfingolipid seperti serebrosida dan gongliosida, juga diturunkan dari
sfingosin, tetapi untuk menggantikan gugus kepala terfoforilasi mereka
memiliki satu atau lebih residu gula. Galaktoserebrosida mempunyai satu
residu galaktosa (gambar 4.11a) dan ditemukan mendominasi dalam
membran sel neuron pada otak.
Gambar 4-11. Struktur dari (a) spingolipid spingomielin dan galaktoserebrosida; (b)
kolesterol. R
1
adalah rantai hidrokarbon dari asam lemak
c. Sterol
Sterol kolesterol (Gambar 4-11b) merupakan konstituen utama dalam
membran plasma hewan tetapi tidak ada dari prokariot. Sistem cincin
gabungan pada kolesterol berarti bahwa ia lebih kaku daripada lipid
membran lainnya. Selain merupakan komponen penting dari membran
lainnya. Selain merupakan komponen penting dari membran, kolesterol
yang merupakan precursor metabolisme hormone steroid. Tumbuhan
H
3
C (CH
2
)
12
C C
H
H
C
H
OH
C
N
H
CH
2
C
H
O
R
1
O P O
O
-
O
CH
2
CH
2
N
+
CH
3
CH
3
CH
3
Spingosin
H
3
C (CH
2
)
12
C C
H
H
C
H
OH
C
N
H
CH
2
C
H
O
R
1
O galaktosa
Spingosin
Spingiomielin
Galaktoserebrosida
A
CH
2
CH
2
CH
2
C
CH
3
CH
3
CH
3
C
CH
3
H
HO
CH
3
CH
3
3
Kolesterol
B
Gambar 4-11. Struktur dari (a) spingolipid spingomielin dan
galaktoserebrosida; (b) kolesterol. R1 adalah rantai hidrokarbon dari
asam lemak
c. Sterol
Sterol kolesterol (Gambar 4-11b) merupakan konstituen utama
dalam membran plasma hewan tetapi tidak ada dari prokariot.
Sistem cincin gabungan pada kolesterol berarti bahwa ia lebih
kaku daripada lipid membran lainnya. Selain merupakan kompo-
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 191
nen penting dari membran lainnya. Selain merupakan komponen
penting dari membran, kolesterol yang merupakan precursor me-
tabolisme hormone steroid. Tumbuhan mengandung sedikit koles-
terol tetapi memiliki sejumlah sterol lain, terutama stigmasterol
dan sitoterol yang berbeda dari kolesterol hanya pada rantai sam-
ping alifatiknya.
13. TRANSPOR
Suatu membran merupakan pembatas mekanik yang memisahkan dua
fasa cair. Fungsi ini berdasar atas bilayer hidrofob dua dimensi dari
lipid polar yang mencegah pergerakan bebas zat terlarut dari satu fasa
ke fasa lainnya. Pergerakan bebas melintasi suatu membran disebut
difusi sederhana. Laju difusi sederhana berbeda-beda tergantung
zatnya. Misalnya, zat-zat berikut ini disusun menurut penurunan laju
difusi sederhana melintasi membran tertentu: oksigen, benzen, gliserol,
glukosa, aspartat, hemoglobin. Laju difusi sederhana tergantung pada
wujud zat (gas paling cepat berdifusi), ukuran (yang lebih kecil akan
lebih cepat), dan kepolaran (semakin polar akan semakin lambat).
Secara kuantitatif untuk selain gas, difusi sederhana hanya penting
dalam transpor molekul yang memiliki karakter hidrofob besar.
Namun beberapa membran dapat dilalui difusi sederhana yang cepat
untuk berbagai macam zat termasuk senyawa polar.
Beberapa membran memiliki pori-pori, misalnya membran
luar mitokondria dan bakteri Gram-negatif. Pori-pori ini membuat
senyawa hidrofil yang biasanya memiliki Mr kurang dari 600 dapat
lewat dengan bebas. Pori-pori membran dibentuk oleh protein yang
disebut porin.
Kebanyakan membran tidak mempunyai pori-pori nonspesifik
yang memungkinkan difusi zat terlarut berlangsung dengan cepat.
Untuk membran-membran ini, difusi sederhana zat terlarut merupakan
proses yang sangat lambat. Zat terlarut dapat melewati membran seperti
ini dengan jauh lebih cepat oleh carrier-mediated transport. Komponen
BIOKIMIA: Struktur dan Fungsi Biomolekul 192
membran yang membantu transpor merupakan protein yang dikenal
sebagai carrier atau permease atau protein transpor. Istilah translokase
terkadang digunakan, tetapi mesti dihindari karena istilah ini juga
digunakan untuk enzim yang terlibat dalam biosintesis protein.
Carrier adalah spesifik untuk zat terlarut yang ditranspor. Suatu
set carrier akan membuat sel dapat mengambil zat-zat yang diinginkan
dengan cepat dan menyingkirkan zat-zat yang tak diinginkan dengan
cepat pula. Tanpa adanya carrier yang sesuai, senyawa-senyawa yang
tak diinginkan tetap bisa dijaga agar tidak memasuki sel dan senyawa-
senyawa yang berguna disimpan. Dalam hal ini difusi sederhana
merupakan satu-satunya cara agar senyawa-senyawa tersebut bisa
melewati membran.
Secara eksperimen, penentuan karakteristik pergerakan senyawa
tertentu melintasi membran cukup sederhana (misalnya pengaruh pH
dan suhu pada laju). Namun sulit untuk menganalisa bagaimana suatu
carrier bekerja pada tingkat molekul.
Penentuan mekanisme transpor carrier begitu sulit, karena suatau
carrier yang akan dipelajari secara efektif harus dimurnikan terlebih
dahulu. Tetapi memurnikan carrier berarti memindahkannya dari
membran di mana carrier tersebut terdapat secara alami. Membran
tersebut harus diganggu, dan akibatnya aktivitas biologis carrier yang
bisa diukur kualitasnya menjadi hilang. Masalah ini bisa diatasi dengan
memasukkan carrier yang sudah dimurnikan ke dalam vesicle buatan.
Untuk mengukur laju transpor suatu zat terlarut ke dalam sel (atau
vesicle buatan), digunakan zat terlarut yang diberi label radioaktif.
Suatu suspensi sel diinkubasi dalam medium yang mengandung zat
terlarut radioaktif. Bagian demi bagian suspensi diangkat pada waktu-
waktu yang berbeda, kemudian diukur radioaktivitas sel yang telah
dicuci dan disaring. Gambar 4-12 menunjukkan plot radioaktivitas sel
yang telah dicuci pada waktu-waktu yang berbeda. Kemiringan awal
kurva menunjukkan laju pengambilan zat terlarut (setelah konsentrasi
zat terlarut dihitung dari pengukuran radioaktivitas) yang sesuai dengan
konsentrasi zat terlarut pada waktu = 0, [S]
o
.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 193 Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 184
Gambar 4-12 Plot radioaktivitas sel yang telah dicuci pada waktu-waktu yang berbeda
Di dalam sel, zat terlarut bisa saja dicerna. Karena itu, konsentrasi zat
terlarut sebenarnya di dalam sel akan lebih kecil daripada yang ditunjukkan
oleh pengukuran radioaktivitas sel. Selain itu, jika di dalam sel sudah ada zat
terlarut, maka laju yang diukur merupakan nilai totalnya karena pasti ada suatu
pergerakan zat terlarut keluar dari sel (oleh difusi sederhana maupun transpor
carrier). Masalah ini diatasi dengan menggunakan analog yang tak dapat
dicerna, misalnya untuk mempelajari transpor glukosa digunakan radioaktif 2-
deoksiglukosa atau -metilglukosida.
Dalam mempelajari transpor dalam bakteri, digunakan metode lain
untuk mengatasi masalah metabolisme zat terlarut, yakni memakai bakteri
mutan yang akan mentranspor zat terlarut tetapi kekurangan satu atau lebih
enzim untuk mencerna zat terlarut itu.
Kelemahan penggunaan analog yakni laju transpor senyawa yang diamati
sebenarnya (misalnya glukosa) tidak bisa ditentukan meskipun dapat dianggap
sama dengan analog.
Bila v adalah laju transpor zat terlarut ke dalam sel, maka v bervariasi
menurut konsentrasi zat terlarut [S]
o
. Untuk transpor oleh carrier, (Gambar 4-
13-a) terdapat batasan jumlah molekul carrier dalam membran. Pada [S]
o
rendah, hanya sebagian kecil dari molekul-molekul ini yang akan terikat pada
zat terlarut. Tetapi pada [S]
o
tinggi, sebagian besar molekul carrier akan
bekerja, sehingga terdapat nilai maksimal untuk v (V
maks
). Dalam difusi
sederhana (Gambar 4-13-b), tidak ada carrier untuk dijenuhkan, sehingga v
akan lebih tinggi pada [S]
o
tinggi karena gradien konsentrasi zat terlarut yang
Waktu (detik)
K
e
r
a
d
i
o
a
k
t
i
f
a
n

d
a
l
a
m

s
e
l

Gambar 4-12 Plot radioaktivitas sel yang telah dicuci pada waktu-waktu
yang berbeda
Di dalam sel, zat terlarut bisa saja dicerna. Karena itu, konsentrasi
zat terlarut sebenarnya di dalam sel akan lebih kecil daripada yang
ditunjukkan oleh pengukuran radioaktivitas sel. Selain itu, jika di
dalam sel sudah ada zat terlarut, maka laju yang diukur merupakan
nilai totalnya karena pasti ada suatu pergerakan zat terlarut keluar dari
sel (oleh difusi sederhana maupun transpor carrier). Masalah ini diatasi
dengan menggunakan analog yang tak dapat dicerna, misalnya untuk
mempelajari transpor glukosa digunakan radioaktif 2-deoksiglukosa
atau a-metilglukosida.
Dalam mempelajari transpor dalam bakteri, digunakan metode
lain untuk mengatasi masalah metabolisme zat terlarut, yakni memakai
bakteri mutan yang akan mentranspor zat terlarut tetapi kekurangan
satu atau lebih enzim untuk mencerna zat terlarut itu.
Kelemahan penggunaan analog yakni laju transpor senyawa yang
diamati sebenarnya (misalnya glukosa) tidak bisa ditentukan meskipun
dapat dianggap sama dengan analog.
Bila v adalah laju transpor zat terlarut ke dalam sel, maka v
bervariasi menurut konsentrasi zat terlarut [S]o. Untuk transpor oleh
carrier, (Gambar 4-13-a) terdapat batasan jumlah molekul carrier
dalam membran. Pada [S]o rendah, hanya sebagian kecil dari molekul-
molekul ini yang akan terikat pada zat terlarut. Tetapi pada [S]o tinggi,
BIOKIMIA: Struktur dan Fungsi Biomolekul 194
sebagian besar molekul carrier akan bekerja, sehingga terdapat nilai
maksimal untuk v (Vmaks). Dalam difusi sederhana (Gambar 4-13-
b), tidak ada carrier untuk dijenuhkan, sehingga v akan lebih tinggi
pada [S]o tinggi karena gradien konsentrasi zat terlarut yang melewati
membran lebih besar daripada gradien konsentrasinya pada [S]o
rendah. Gradien konsentrasi ini menentukan laju difusi.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 185
melewati membran lebih besar daripada gradien konsentrasinya pada [S]
o
rendah. Gradien konsentrasi ini menentukan laju difusi.
Gambar 4-13 Ketergantungan kecepatan transport pada konsentrasi zat terlarut.
Persamaan matematik bisa diturunkan untuk menjelaskan kurva yang
ditunjukkan dalam Gambar 4-13. Kurva dalam Gambar 4-13-a digambarkan
oleh persamaan untuk hiperbola persegi.
a tetapan [S]
[S]
0
0 maks

V
v
Persamaan untuk grafik dalam Gambar 6-11-b adalah
0
[S]
a tetapan
l
v
dengan l adalah ketebalan membran. Dalam penurunan persamaan-
persamaan ini dianggap tidak ada zat terlarut pada salah satu sisi membran
ketika konsentrasi [S]
o
dimasukkan pada sisi lainnya.
Bila seandainya transpor carrier serta difusi sederhana muncul secara
serempak dalam suatu eksperimen mengenai transpor, maka plot v terhadap
[S]
o
tidak akan menunjukkan kejenuhan kecuali jika difusi sederhana dianggap
sepele dibandingkan transpor carrier (Gambar 4-14). Akan tetapi seringkali tak
mungkin untuk menentukan v pada [S]
o
tinggi; yakni zat terlarut mungkin
kelarutannya tidak cukup besar untuk dapat mencapai [S]
o
tinggi. Proses
campuran pada pergerakan zat terlarut melintasi membran bisa
[S]
0
v
[S]
0
v
(a) Transpor oleh Carrier (b) Difusi sederhana
Gambar 4-13 Ketergantungan kecepatan transport pada konsentrasi
zat terlarut
Persamaan matematik bisa diturunkan untuk menjelaskan kurva
yang ditunjukkan dalam Gambar 4-13. Kurva dalam Gambar 4-13-a
digambarkan oleh persamaan untuk hiperbola persegi.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 185
melewati membran lebih besar daripada gradien konsentrasinya pada [S]
o
rendah. Gradien konsentrasi ini menentukan laju difusi.
Gambar 4-13 Ketergantungan kecepatan transport pada konsentrasi zat terlarut.
Persamaan matematik bisa diturunkan untuk menjelaskan kurva yang
ditunjukkan dalam Gambar 4-13. Kurva dalam Gambar 4-13-a digambarkan
oleh persamaan untuk hiperbola persegi.
a tetapan [S]
[S]
0
0 maks

V
v
Persamaan untuk grafik dalam Gambar 6-11-b adalah
0
[S]
a tetapan
l
v
dengan l adalah ketebalan membran. Dalam penurunan persamaan-
persamaan ini dianggap tidak ada zat terlarut pada salah satu sisi membran
ketika konsentrasi [S]
o
dimasukkan pada sisi lainnya.
Bila seandainya transpor carrier serta difusi sederhana muncul secara
serempak dalam suatu eksperimen mengenai transpor, maka plot v terhadap
[S]
o
tidak akan menunjukkan kejenuhan kecuali jika difusi sederhana dianggap
sepele dibandingkan transpor carrier (Gambar 4-14). Akan tetapi seringkali tak
mungkin untuk menentukan v pada [S]
o
tinggi; yakni zat terlarut mungkin
kelarutannya tidak cukup besar untuk dapat mencapai [S]
o
tinggi. Proses
campuran pada pergerakan zat terlarut melintasi membran bisa
[S]
0
v
[S]
0
v
(a) Transpor oleh Carrier (b) Difusi sederhana
Persamaan untuk grafik dalam Gambar 6-11-b adalah
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 185
melewati membran lebih besar daripada gradien konsentrasinya pada [S]
o
rendah. Gradien konsentrasi ini menentukan laju difusi.
Gambar 4-13 Ketergantungan kecepatan transport pada konsentrasi zat terlarut.
Persamaan matematik bisa diturunkan untuk menjelaskan kurva yang
ditunjukkan dalam Gambar 4-13. Kurva dalam Gambar 4-13-a digambarkan
oleh persamaan untuk hiperbola persegi.
a tetapan [S]
[S]
0
0 maks

V
v
Persamaan untuk grafik dalam Gambar 6-11-b adalah
0
[S]
a tetapan
l
v
dengan l adalah ketebalan membran. Dalam penurunan persamaan-
persamaan ini dianggap tidak ada zat terlarut pada salah satu sisi membran
ketika konsentrasi [S]
o
dimasukkan pada sisi lainnya.
Bila seandainya transpor carrier serta difusi sederhana muncul secara
serempak dalam suatu eksperimen mengenai transpor, maka plot v terhadap
[S]
o
tidak akan menunjukkan kejenuhan kecuali jika difusi sederhana dianggap
sepele dibandingkan transpor carrier (Gambar 4-14). Akan tetapi seringkali tak
mungkin untuk menentukan v pada [S]
o
tinggi; yakni zat terlarut mungkin
kelarutannya tidak cukup besar untuk dapat mencapai [S]
o
tinggi. Proses
campuran pada pergerakan zat terlarut melintasi membran bisa
[S]
0
v
[S]
0
v
(a) Transpor oleh Carrier (b) Difusi sederhana
dengan l adalah ketebalan membran. Dalam penurunan persamaan-
persamaan ini dianggap tidak ada zat terlarut pada salah satu sisi
membran ketika konsentrasi [S]o dimasukkan pada sisi lainnya.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 195
Bila seandainya transpor carrier serta difusi sederhana muncul
secara serempak dalam suatu eksperimen mengenai transpor, maka plot
v terhadap [S]o tidak akan menunjukkan kejenuhan kecuali jika difusi
sederhana dianggap sepele dibandingkan transpor carrier (Gambar 4-
14). Akan tetapi seringkali tak mungkin untuk menentukan v pada
[S]o tinggi; yakni zat terlarut mungkin kelarutannya tidak cukup besar
untuk dapat mencapai [S]o tinggi. Proses campuran pada pergerakan
zat terlarut melintasi membran bisa didemonstrasikan menggunakan
plot timbal balik ganda (double-reciprocal plot).
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 186
didemonstrasikan menggunakan plot timbal balik ganda (double-reciprocal
plot).
Gambar 4-14 Plot v terhadap [S]
o
tidak akan menunjukkan kejenuhan
kecuali jika difusi sederhana dianggap sepele dibandingkan
transpor carrier
Dari persamaan untuk Gambar 4-13, diperoleh persamaan berikut:
0 0 maks maks
[S]
1
a tetapan
1
dan
[S]
1 a tetapan 1 1 l
v V V v

Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis lurus
(Gambar 4-15-a). Untuk difusi sederhana dan transpor memakai carrier yang
berlangsung serempak, plot timbal balik ganda diperlihatkan dalam Gambar 4-
15-b.
Gambar 4-15 Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis
lurus (Gambar a). Untuk difusi sederhana dan transpor memakai carrier
yang berlangsung serempak, plot timbal balik ganda diperlihatkan dalam
(Gambar b).
[S]
0
v
1/[S]
0
1/v
Difusi
sederhana
Transpor oleh
carrier
(a)
1/[S]
0
1/v
(b)
Gambar 4-14 Plot v terhadap [S]o tidak akan menunjukkan kejenuhan
kecuali jika difusi sederhana dianggap sepele dibandingkan transpor
carrier
Dari persamaan untuk Gambar 4-13, diperoleh persamaan berikut:
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 186
didemonstrasikan menggunakan plot timbal balik ganda (double-reciprocal
plot).
Gambar 4-14 Plot v terhadap [S]
o
tidak akan menunjukkan kejenuhan
kecuali jika difusi sederhana dianggap sepele dibandingkan
transpor carrier
Dari persamaan untuk Gambar 4-13, diperoleh persamaan berikut:
0 0 maks maks
[S]
1
a tetapan
1
dan
[S]
1 a tetapan 1 1 l
v V V v

Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis lurus
(Gambar 4-15-a). Untuk difusi sederhana dan transpor memakai carrier yang
berlangsung serempak, plot timbal balik ganda diperlihatkan dalam Gambar 4-
15-b.
Gambar 4-15 Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis
lurus (Gambar a). Untuk difusi sederhana dan transpor memakai carrier
yang berlangsung serempak, plot timbal balik ganda diperlihatkan dalam
(Gambar b).
[S]
0
v
1/[S]
0
1/v
Difusi
sederhana
Transpor oleh
carrier
(a)
1/[S]
0
1/v
(b)
Plot 1/v terhadap 1/[S]o untuk kedua persamaan di atas berupa
garis lurus (Gambar 4-15-a). Untuk difusi sederhana dan transpor
memakai carrier yang berlangsung serempak, plot timbal balik ganda
diperlihatkan dalam Gambar 4-15-b.
BIOKIMIA: Struktur dan Fungsi Biomolekul 196
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 186
didemonstrasikan menggunakan plot timbal balik ganda (double-reciprocal
plot).
Gambar 4-14 Plot v terhadap [S]
o
tidak akan menunjukkan kejenuhan
kecuali jika difusi sederhana dianggap sepele dibandingkan
transpor carrier
Dari persamaan untuk Gambar 4-13, diperoleh persamaan berikut:
0 0 maks maks
[S]
1
a tetapan
1
dan
[S]
1 a tetapan 1 1 l
v V V v

Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis lurus
(Gambar 4-15-a). Untuk difusi sederhana dan transpor memakai carrier yang
berlangsung serempak, plot timbal balik ganda diperlihatkan dalam Gambar 4-
15-b.
Gambar 4-15 Plot 1/v terhadap 1/[S]
o
untuk kedua persamaan di atas berupa garis
lurus (Gambar a). Untuk difusi sederhana dan transpor memakai carrier
yang berlangsung serempak, plot timbal balik ganda diperlihatkan dalam
(Gambar b).
[S]
0
v
1/[S]
0
1/v
Difusi
sederhana
Transpor oleh
carrier
(a)
1/[S]
0
1/v
(b)
Gambar 4-15 Plot 1/v terhadap 1/[S]o untuk kedua persamaan di atas
berupa garis lurus (Gambar a). Untuk difusi sederhana dan transpor
memakai carrier yang berlangsung serempak, plot timbal balik ganda
diperlihatkan dalam (Gambar b).
Suatu metode alternatif untuk membedakan antara difusi
sederhana dengan transpor memakai carrier dapat digunakan bila zat
terlarut mengandung atom kiral. Difusi sederhana akan terjadi untuk
kedua enansiomer dengan laju yang sama, sedangkan transpor memakai
carrier tak terpengaruh oleh stereospesifik, yakni carrier hanya akan
mengenali salah satu enansiomer.
Bila terdapat D-glukosa dan L-glukosa, carrier dalam membran
sel akan mengenali (mengikat) D-glukosa. Hal ini dikarenakan isomer
tersebut terdapat secara alami, sedangkan Isomer lainnya tidak.
Total difusi sederhana akan berhenti ketika konsentrasi zat terlarut
pada kedua sisi membran adalah sama. Dalam sebagian sistem transpor
memakai carrier ditemukan bahwa total transpor berhenti ketika
konsentrasi zat terlarut adalah sama pada kedua sisi membran (sama
seperti dalam difusi sederhana). Sedangkan dalam sebagian sistem
transpor carrier lainnya, zat terlarut terus menerus ditranspor bahkan
setelah konsentrasi zat terlarut pada kedua sisi telah sama.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 197
Terdapat dua tipe transpor carrier: (1) difusi terfasilitasi, yang
memungkinkan konsentrasi zat terlarut sama pada kedua sisi membran;
dan (2) transpor aktif, yang memungkinkan zat terlarut untuk bergerak
naik , atau berlawanan dengan gradien konsentrasi.
Gambar 4-16 menunjukkan cara zat terlarut bergerak melintasi
membran. [S] dan [s] menggambarkan konsentrasi zat terlarut yang tinggi
dan rendah.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 187
Suatu metode alternatif untuk membedakan antara difusi sederhana
dengan transpor memakai carrier dapat digunakan bila zat terlarut mengandung
atom kiral. Difusi sederhana akan terjadi untuk kedua enansiomer dengan laju
yang sama, sedangkan transpor memakai carrier tak terpengaruh oleh
stereospesifik, yakni carrier hanya akan mengenali salah satu enansiomer.
Bila terdapat D-glukosa dan L-glukosa, carrier dalam membran sel
akan mengenali (mengikat) D-glukosa. Hal ini dikarenakan isomer tersebut
terdapat secara alami, sedangkan Isomer lainnya tidak.
Total difusi sederhana akan berhenti ketika konsentrasi zat terlarut
pada kedua sisi membran adalah sama. Dalam sebagian sistem transpor
memakai carrier ditemukan bahwa total transpor berhenti ketika konsentrasi zat
terlarut adalah sama pada kedua sisi membran (sama seperti dalam difusi
sederhana). Sedangkan dalam sebagian sistem transpor carrier lainnya, zat
terlarut terus menerus ditranspor bahkan setelah konsentrasi zat terlarut pada
kedua sisi telah sama.
Terdapat dua tipe transpor carrier: (1) difusi terfasilitasi, yang
memungkinkan konsentrasi zat terlarut sama pada kedua sisi membran ; dan
(2) transpor aktif, yang memungkinkan zat terlarut untuk bergerak naik , atau
berlawanan, dengan gradien konsentrasi.
Gambar 4-16 menunjukkan cara zat terlarut bergerak melintasi membran. [S]
dan [s] menggambarkan konsentrasi zat terlarut yang tinggi dan rendah.
Gambar 4-16 Cara zat terlarut bergerak melintasi membran. [S] dan [s]
menggambarkan konsentrasi zat terlarut yang tinggi dan rendah
Difusi sederhana dan difusi terfasilitasi merupakan proses yang berlangsung
secara spontan. Zat terlarut akan bergerak menuruni gradien konsentrasi
(yakni, [S] [s]) sampai kesetimbangan dicapai. Perubahan energi bebas
[S] [s]
Carrier Carrier
[s] [S] [s] [S]
Difusi sederhana
Transport aktif
Difusi terfasilitasi
Gambar 4-16 Cara zat terlarut bergerak melintasi membran. [S] dan [s]
menggambarkan konsentrasi zat terlarut yang tinggi dan rendah
Difusi sederhana dan difusi terfasilitasi merupakan proses yang
berlangsung secara spontan. Zat terlarut akan bergerak menuruni
gradien konsentrasi (yakni, [S] [s]) sampai kesetimbangan dicapai.
Perubahan energi bebas (DG) untuk proses ini adalah negatif karena
zat terlarut akan terdistribusi lebih teracak. Karena itu tidak ada
pemasukan energi yang diperlukan untuk proses tersebut.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 188
(G) untuk proses ini adalah negatif karena zat terlarut akan terdistribusi lebih
teracak. Karena itu tidak ada pemasukan energi yang diperlukan untuk proses
tersebut.
[S]
[s]
log 3 2 RT G ,
Pada kesetimbangan, [s] = [S] dan G adalah nol.
Dalam transpor aktif, zat terlarut terkonsentrasi pada salah satu sisi
membran. Proses ini tidak berlangsung spontan karena G adalah positif dan
suatu bentuk energi harus disediakan untuk menjalankan reaksi transpor carrier
tersebut. Karena itulah proses ini disebut transpor aktif.
Kemampuan untuk mengkonsentrasikan zat terlarut tertentu oleh
transpor aktif memiliki batasan. Jika konsentrasi zat terlarut naik sampai tingkat
tinggi pada salah satu sisi membran, maka zat terlarut akan kembali ke sisi lain
dengan cara difusi sederhana. Semakin tinggi perbedaan konsentrasi antar
membran maka semakin besar laju difusi sederhana tersebut. Kenyataannya,
rasio konsentrasi yang lebih besar daripada beberapa ratus banding satu jarang
terjadi, dan rasio tersebut biasanya jauh lebih kecil.
Zat terlarut juga akan berdifusi kembali melintasi membran bila membran
tersebut mengandung suatu carrier untuk memudahkan difusi. Dengan
demikian, difusi sederhana dan difusi terfsilitasi berjalan dua arah, sedangkan
transpor aktif berjalan searah.
Pergerakan zat terlarut yang terionisasi melintasi jenis-jenis membran
tertentu tidak selalu menaikkan konsentrasi ion hingga sama pada kedua sisi
membran meskipun hanya terjadi difusi sederhana, difusi terfasilitasi, atau
keduanya. Jika suatu perbedaan potensial listrik terdapat antar membran,
maka zat terlarut yang terionisasi akan terdistribusi tidak sama rata pada
kesetimbangan (Gambar 4-17). G tidak hanya tergantung pada konsentrasi
zat terlarut, tetapi juga pada perbedaan potensial antar membran.

ZF RT G
] [S
] [s
log 3 2,
Pada kesetimbangan, [s] = [S] dan DG adalah nol.
Dalam transpor aktif, zat terlarut terkonsentrasi pada salah satu
sisi membran. Proses ini tidak berlangsung spontan karena DG adalah
positif dan suatu bentuk energi harus disediakan untuk menjalankan
reaksi transpor carrier tersebut. Karena itulah proses ini disebut
transpor aktif.
Kemampuan untuk mengkonsentrasikan zat terlarut tertentu
oleh transpor aktif memiliki batasan. Jika konsentrasi zat terlarut naik
sampai tingkat tinggi pada salah satu sisi membran, maka zat terlarut
BIOKIMIA: Struktur dan Fungsi Biomolekul 198
akan kembali ke sisi lain dengan cara difusi sederhana. Semakin tinggi
perbedaan konsentrasi antar membran maka semakin besar laju difusi
sederhana tersebut. Kenyataannya, rasio konsentrasi yang lebih besar
daripada beberapa ratus banding satu jarang terjadi, dan rasio tersebut
biasanya jauh lebih kecil.
Zat terlarut juga akan berdifusi kembali melintasi membran bila
membran tersebut mengandung suatu carrier untuk memudahkan
difusi. Dengan demikian, difusi sederhana dan difusi terfsilitasi berjalan
dua arah, sedangkan transpor aktif berjalan searah.
Pergerakan zat terlarut yang terionisasi melintasi jenis-jenis membran
tertentu tidak selalu menaikkan konsentrasi ion hingga sama pada kedua
sisi membran meskipun hanya terjadi difusi sederhana, difusi terfasilitasi,
atau keduanya. Jika suatu perbedaan potensial listrik terdapat antar
membran, maka zat terlarut yang terionisasi akan terdistribusi tidak sama
rata pada kesetimbangan (Gambar 4-17). DG tidak hanya tergantung
pada konsentrasi zat terlarut, tetapi juga pada perbedaan potensial DY
antar membran.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 188
(G) untuk proses ini adalah negatif karena zat terlarut akan terdistribusi lebih
teracak. Karena itu tidak ada pemasukan energi yang diperlukan untuk proses
tersebut.
[S]
[s]
log 3 2 RT G ,
Pada kesetimbangan, [s] = [S] dan G adalah nol.
Dalam transpor aktif, zat terlarut terkonsentrasi pada salah satu sisi
membran. Proses ini tidak berlangsung spontan karena G adalah positif dan
suatu bentuk energi harus disediakan untuk menjalankan reaksi transpor carrier
tersebut. Karena itulah proses ini disebut transpor aktif.
Kemampuan untuk mengkonsentrasikan zat terlarut tertentu oleh
transpor aktif memiliki batasan. Jika konsentrasi zat terlarut naik sampai tingkat
tinggi pada salah satu sisi membran, maka zat terlarut akan kembali ke sisi lain
dengan cara difusi sederhana. Semakin tinggi perbedaan konsentrasi antar
membran maka semakin besar laju difusi sederhana tersebut. Kenyataannya,
rasio konsentrasi yang lebih besar daripada beberapa ratus banding satu jarang
terjadi, dan rasio tersebut biasanya jauh lebih kecil.
Zat terlarut juga akan berdifusi kembali melintasi membran bila membran
tersebut mengandung suatu carrier untuk memudahkan difusi. Dengan
demikian, difusi sederhana dan difusi terfsilitasi berjalan dua arah, sedangkan
transpor aktif berjalan searah.
Pergerakan zat terlarut yang terionisasi melintasi jenis-jenis membran
tertentu tidak selalu menaikkan konsentrasi ion hingga sama pada kedua sisi
membran meskipun hanya terjadi difusi sederhana, difusi terfasilitasi, atau
keduanya. Jika suatu perbedaan potensial listrik terdapat antar membran,
maka zat terlarut yang terionisasi akan terdistribusi tidak sama rata pada
kesetimbangan (Gambar 4-17). G tidak hanya tergantung pada konsentrasi
zat terlarut, tetapi juga pada perbedaan potensial antar membran.

ZF RT G
] [S
] [s
log 3 2,
dengan Z adalah muatan total pada zat terlarut, dan F adalah tetapan
Faraday.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 189
dengan Z adalah muatan total pada zat terlarut, dan F adalah tetapan Faraday.
[S
+
] [s
+
]
Gambar 4-17 [S
+
] dan [s
+
] = konsentrasi kesetimbangan. Terlihat bahwa
terdapat lebih banyak muatan negatif daripada positif pada
membran.
Agar transpor aktif dapat terjadi, energi harus disediakan. Dalam
transpor aktif primer, energi disediakan oleh hidrolisis ATP atau oleh
pemanfaatan elektron yang menuruni suatu rantai transpor-elektron. Dalam
transpor aktif sekunder, energi disediakan oleh ion yang menuruni gradien
konsentrasi yang digabungkan dengan pergerakan zat terlarut melawan gradien
konsentrasinya. Gradien ion disediakan oleh transpor aktif primer. Suatu tipe
khusus dari transpor aktif yakni translokasi gugus. Dalam translokasi gugus,
zat yang ditranspor dimodifikasi secara kimia pada saat melintasi membran,
misalnya dengan menerima suatu gugus kimia. Energi dihabiskan ketika gugus
kimia ditranser, sebagai hasil pemecahan senyawa berenergi tinggi.
Gambar 4-18 menunjukkan ketiga tipe transpor aktif. Sumber energi
diasumsikan dari ATP. Simbol [s], [i
+
] dan [S]. [I
+
] menggambarkan konsentrasi
zat terlarut dan ion yang rendah dan tinggi. AX adalah senyawa tempat asal
gugus kimia X (misalnya fosfat) yang ditransfer kepada zat terlarut untuk
membentuk SX.
Gambar 4-17 [S+] dan [s+] = konsentrasi kesetimbangan. Terlihat
bahwa terdapat lebih banyak muatan negatif daripada positif pada
membran.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 199
Agar transpor aktif dapat terjadi, energi harus disediakan. Dalam
transpor aktif primer, energi disediakan oleh hidrolisis ATP atau oleh
pemanfaatan elektron yang menuruni suatu rantai transpor-elektron.
Dalam transpor aktif sekunder, energi disediakan oleh ion yang
menuruni gradien konsentrasi yang digabungkan dengan pergerakan
zat terlarut melawan gradien konsentrasinya. Gradien ion disediakan
oleh transpor aktif primer. Suatu tipe khusus dari transpor aktif
yakni translokasi gugus. Dalam translokasi gugus, zat yang ditranspor
dimodifikasi secara kimia pada saat melintasi membran, misalnya
dengan menerima suatu gugus kimia. Energi dihabiskan ketika gugus
kimia ditransfer, sebagai hasil pemecahan senyawa berenergi tinggi.
Gambar 4-18 menunjukkan ketiga tipe transpor aktif.
Sumber energi diasumsikan dari ATP. Simbol [s], [i+] dan [S]. [I+]
menggambarkan konsentrasi zat terlarut dan ion yang rendah dan
tinggi. AX adalah senyawa tempat asal gugus kimia X (misalnya fosfat)
yang ditransfer kepada zat terlarut untuk membentuk SX.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 190
Gambar 6-18 Tipe-tipe transpor aktif
Beberapa contoh sistem carrier diberikan dalam Tabel 4-4.
Tabel 4-4 Sistem Transpor Carrier
Zat Terlarut Tipe Transpor Lokasi
Glukosa Difusi terfasilitasi Kebanyakan sel hewan
ATP keluarADP masuk Difusi terfasilitasi Mitokondria
H
+
Aktif primer
(menggunakan ATP)
Epitelia perut
Na
+
keluarK
+
masuk Aktif primer
(menggunakan ATP)
Sel hewan
Glukosa Aktif sekunder (Na
+
kotranspor)
Sebagian sel hewan
Glukosa Translokasi gugus Banyak bakteri
14. MEKANISME MOLEKUL TRANSPOR LINTAS MEMBRAN
Protein yang terlibat dalam transpor suatu zat terlarut tertentu melintasi
membran harus memiliki dua sifat: (1) kemampuan untuk mengikat zat terlarut;
dan (2) kemampuan untuk menjalankan proses vektorial, yakni suatu proses
terarah yang mengantarkan zat terlarut dari satu sisi membran ke sisi lainnya.
Proses vektorial dapat terjadi bila:
1. Protein transpor bisa berperan sebagai carrier yang dapat bergerak.
Misalnya protein transmembran yang besar dapat berotasi seperti
dalam Gambar 4-19-a, atau protein kecil bisa menyilang membran
seperti dalam Gambar 4-19-b.
ATP
[S]
ADP
+
P
i
[s]
AX
[SX]
A
[s]
ATP
[i
+
]
ADP
+
P
i
[I
+
]
[s] [S]
[I
+
]
[i
+
]
Aktif primer
Aktif sekunder Kelompok translokasi
Gambar 6-18 Tipe-tipe transpor aktif
BIOKIMIA: Struktur dan Fungsi Biomolekul 200
Beberapa contoh sistem carrier diberikan dalam Tabel 4-4.
Tabel 4-4 Sistem Transpor Carrier
Zat Terlarut Tipe Transpor Lokasi
Glukosa Difusi terfasilitasi Kebanyakan sel hewan
ATP keluarADP masuk Difusi terfasilitasi Mitokondria
H+ Aktif primer (menggunakan ATP) Epitelia perut
Na+ keluarK+ masuk Aktif primer (menggunakan ATP) Sel hewan
Glukosa Aktif sekunder (Na+ kotranspor) Sebagian sel hewan
Glukosa Translokasi gugus Banyak bakteri
14. MEKANISME MOLEKUL TRANSPOR LINTAS MEMBRAN
Protein yang terlibat dalam transpor suatu zat terlarut tertentu melintasi
membran harus memiliki dua sifat: (1) kemampuan untuk mengikat
zat terlarut; dan (2) kemampuan untuk menjalankan proses vektorial,
yakni suatu proses terarah yang mengantarkan zat terlarut dari satu sisi
membran ke sisi lainnya.
Proses vektorial dapat terjadi bila:
1. Protein transpor bisa berperan sebagai carrier yang dapat bergerak.
Misalnya protein transmembran yang besar dapat berotasi seperti
dalam Gambar 4-19-a, atau protein kecil bisa menyilang membran
seperti dalam Gambar 4-19-b.
2. Protein transpor bisa membentuk pori-pori atau saluran seperti
dalam Gambar 4-19-c.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 201
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 191
2. Protein transpor bisa membentuk pori-pori atau saluran seperti dalam
Gambar 4-19-c.
Gambar 4-19 Protein transpor bisa berperan sebagai carrier yang dapat bergerak,
misalnya protein transmembran besar dapat berotasi (gambar a),
protein kecil bisa menyilang membran (Gambar b), dan protein
transpor bisa membentuk pori-pori atau saluran (Gambar c).
Terdapat kesulitan pada kedua konsep proses vektorial di atas.
Pergerakan segmen polar suatu molekul melalui bagian nonpolar pada bilayer
lipid merupakan peristiwa yang jarang terjadi, sehingga konsep carrier bergerak
tidak disukai menurut termodinamika. Adanya saluran nonspesifik dalam
beberapa membran telah terbukti. Namun konsep pori-pori hanya bisa diterima
bila pori-pori tersebut memiliki gerbang yang memungkinkan protein transpor
menjadi spesifik serta untuk memungkinkan zat terlarut bergerak dalam arah
yang diinginkan oleh tipe transpor tertentu. Konsep pori-pori bisa dimodifikasi
dengan mengusulkan bahwa protein transpor adalah suatu protein oligomer
yang ruang di antara subunitnya membentuk suatu saluran berisi air yang
ditutup oleh kontak subunit-subunit tersebut (Gambar 4-20). Pengikatan zat
terlarut pada protein memicu perubahan konformasi yang mengubah posisi
relatif subunit tersebut sehingga membuka saluran. Yang terjadi adalah difusi
terfasilitasi. Jika energi metabolik dihabiskan untuk membuat perubahan
konformasi (bukan dengan hanya mengikat zat terlarut), maka yang terjadi
adalah transpor aktif. Sejauh ini, penelitian terhadap struktur sistem transpor
S
S
S
S
S
(a) (b) (c)
Gambar 4-19 Protein transpor bisa berperan sebagai carrier yang dapat
bergerak, misalnya protein transmembran besar dapat berotasi (gambar a), protein
kecil bisa menyilang membran (Gambar b), dan protein transpor bisa membentuk
pori-pori atau saluran (Gambar c).
Terdapat kesulitan pada kedua konsep proses vektorial di atas.
Pergerakan segmen polar suatu molekul melalui bagian nonpolar
pada bilayer lipid merupakan peristiwa yang jarang terjadi, sehingga
konsep carrier bergerak tidak disukai menurut termodinamika.
Adanya saluran nonspesifik dalam beberapa membran telah terbukti.
Namun konsep pori-pori hanya bisa diterima bila pori-pori tersebut
memiliki gerbang yang memungkinkan protein transpor menjadi
spesifik serta untuk memungkinkan zat terlarut bergerak dalam arah
yang diinginkan oleh tipe transpor tertentu. Konsep pori-pori bisa
dimodifikasi dengan mengusulkan bahwa protein transpor adalah
suatu protein oligomer yang ruang di antara subunitnya membentuk
suatu saluran berisi air yang ditutup oleh kontak subunit-subunit
tersebut (Gambar 4-20). Pengikatan zat terlarut pada protein memicu
perubahan konformasi yang mengubah posisi relatif subunit tersebut
sehingga membuka saluran. Yang terjadi adalah difusi terfasilitasi. Jika
energi metabolik dihabiskan untuk membuat perubahan konformasi
(bukan dengan hanya mengikat zat terlarut), maka yang terjadi adalah
transpor aktif. Sejauh ini, penelitian terhadap struktur sistem transpor
telah mendukung konsep pori-pori untuk kasus saluran ion, serta
mendukung hipotesis carrier bergerak untuk kasus transpor ATPase
tertentu.
BIOKIMIA: Struktur dan Fungsi Biomolekul 202
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 192
telah mendukung konsep pori-pori untuk kasus saluran ion, serta mendukung
hipotesis carrier bergerak untuk kasus transpor ATPase tertentu.
Gambar 4-20 Perubahan konformasi dalam suatu pori-pori protein sebagai tempat
transpor zat terlarut.
Sistem buatan yang memungkinkan terjadinya transpor kation telah
dimasukkan ke dalam membran alami serta ke dalam vesicle buatan. Sistem
buatan ini dikenal sebagai ionofor, yang terdiri atas dua tipe yakni gramisidin A
dan valinomisin.
1. Gramisidin A adalah antibiotik yang disusun oleh 15 asam amino:
CHONHL-ValGlyL-AlaD-LeuL-AlaD-ValL-Val
D-ValL-TrpD-LeuL-TrpD-LeuL-TrpD-LeuL-Trp
CONH(CH
2
)OH
Karena sifat hidrofobnya, gramisidin A menembus bilayer lipid, yakni dua
molekul membentuk dimer head-to-tail yang dapat membelit untuk
membentuk heliks berongga dengan enam putaran dan panjang total 3
nm di sekitar jarak lintas daerah hidrofob bilayer lipid. Heliks ini
distabilkan oleh ikatan hidrogen intramolekul antara ikatan-ikatan peptida
dalam rantai polipeptidanya. Rantai samping hidrofob berada di luar
heliks, meninggalkan saluran air hidrofil turun melalui pusat heliks yang
dapat dilewati kation. Ionofor tipe ini adalah nonspesifik, dan kation tidak
mengikat gramisidin A dengan kuat.
2. Valinomisin adalah suatu ionofor tetapi memiliki sifat yang berbeda dari
gramisidin A, yakni: (a) mentranspor K
+
secara spesifik (tidak berlaku
untuk ion-ion lainnya) ketika dimasukkan ke dalam membran atau
vesicle; (b) hanya dapat mentranspor K
+
pada suhu di atas suhu transisi
fasa membran, sedangkan kation yang ditranspor oleh gramisidin A tidak
terpengaruh oleh suhu.
S
S
Gambar 4-20 Perubahan konformasi dalam suatu pori-pori protein
sebagai tempat transpor zat terlarut.
Sistem buatan yang memungkinkan terjadinya transpor kation
telah dimasukkan ke dalam membran alami serta ke dalam vesicle
buatan. Sistem buatan ini dikenal sebagai ionofor, yang terdiri atas dua
tipe yakni gramisidin A dan valinomisin.
1. Gramisidin A adalah antibiotik yang disusun oleh 15 asam amino:
CHONHL-ValGlyL-AlaD-LeuL-AlaD-ValL-
Val
D-ValL-TrpD-LeuL-TrpD-LeuL-TrpD-LeuL-
TrpCONH(CH
2
)OH
Karena sifat hidrofobnya, gramisidin A menembus bilayer lipid,
yakni dua molekul membentuk dimer head-to-tail yang dapat
membelit untuk membentuk heliks berongga dengan enam
putaran dan panjang total 3 nm di sekitar jarak lintas daerah hi-
drofob bilayer lipid. Heliks ini distabilkan oleh ikatan hidrogen
intramolekul antara ikatan-ikatan peptida dalam rantai polipep-
tidanya. Rantai samping hidrofob berada di luar heliks, mening-
galkan saluran air hidrofil turun melalui pusat heliks yang dapat
dilewati kation. Ionofor tipe ini adalah nonspesifik, dan kation
tidak mengikat gramisidin A dengan kuat.
2. Valinomisin adalah suatu ionofor tetapi memiliki sifat yang ber-
beda dari gramisidin A, yakni: (a) mentranspor K
+
secara spesifik
(tidak berlaku untuk ion-ion lainnya) ketika dimasukkan ke dalam
membran atau vesicle; (b) hanya dapat mentranspor K
+
pada suhu
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 203
di atas suhu transisi fasa membran, sedangkan kation yang di-
transpor oleh gramisidin A tidak terpengaruh oleh suhu.
Valinomisin mempunyai struktur spesifik menyerupai suatu rantai
peptida yang mengandung 12 residu asam amino, tetapi pada
dasarnya adalah suatu struktur empat-unit yang diulangi tiga kali:
NH(L-ValD-HyVD-ValL-Lac)3CO
dengan D-HyV adalah D-hidroksiisovalerat dan L-Lac adalah L-
laktat. Struktur ini distabilkan oleh urutan amida dan ikatan ester.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 193
Valinomisin mempunyai struktur spesifik menyerupai suatu rantai peptida
yang mengandung 12 residu asam amino, tetapi pada dasarnya adalah
suatu struktur empat-unit yang diulangi tiga kali:
NH(L-ValD-HyVD-ValL-Lac)
3
CO
dengan D-HyV adalah D-hidroksiisovalerat dan L-Lac adalah L-laktat.
Struktur ini distabilkan oleh urutan amida dan ikatan ester.
Valinomisin mentranspor K
+
secara spesifik, karena itu valinomisin
pasti mengikat ion tersebut dan bukannya menyediakan suatu saluran seperti
gramisidin. Transpor hanya dapat terjadi ketika membran berwujud cair.
Karena valinomisin merupakan molekul kecil, maka hal ini menandakan bahwa
kompleks valinomisin-K
+
pasti bergerak melalui membran, yakni berperan
sebagai carrier bergerak. Rantai samping hidrokarbon pada struktur sikliknya
bisa digambarkan di luar struktur tersebut, sehingga kompatibel dengan bagian
hidrokarbon pada bilayer lipid. Bagian dalam mengandung 12 gugus karbonil
pada ikatan ester dan ikatan amida, enam di antaranya mengatur penempatan
K
+
dalam ruang di pusat struktur (Gambar 4-21).
K
+
O
O
O
O
O
O
C
C
C
C
C
N
O
O
O
O
O
O
C
C
C
C
C
C
O
O
O
C
O
O
O
N
N
N
N
N
Gambar 4-21 Pengikatan K
+
oleh Valinomisin
Gambar 4-21 Pengikatan K+ oleh Valinomisin
Valinomisin mentranspor K
+
secara spesifik, karena itu valinomisin
pasti mengikat ion tersebut dan bukannya menyediakan suatu saluran
seperti gramisidin. Transpor hanya dapat terjadi ketika membran
berwujud cair. Karena valinomisin merupakan molekul kecil, maka hal
ini menandakan bahwa kompleks valinomisin-K+ pasti bergerak melalui
membran, yakni berperan sebagai carrier bergerak. Rantai samping
hidrokarbon pada struktur sikliknya bisa digambarkan di luar struktur
tersebut, sehingga kompatibel dengan bagian hidrokarbon pada bilayer
lipid. Bagian dalam mengandung 12 gugus karbonil pada ikatan ester
BIOKIMIA: Struktur dan Fungsi Biomolekul 204
dan ikatan amida, enam di antaranya mengatur penempatan K+ dalam
ruang di pusat struktur (Gambar 4-21).
15. PENSINYALAN
Membran plasma merupakan penghalang penting antara cairan intrasel
dan cairan ekstrasel. Mekanisme pensinyalan telah dikembangkan
sedemikian rupa sehingga sel bisa merespon pesan-pesan kimia yang
berasal dari terminal syaraf (transmisi neurocrine), kelenjar endokrin
(transmisi endocrine), atau sel tetangga (transmisi paracrine).
Terdapat dua bentuk dasar pensinyalan:
1. Pembawa pesan kimia amfifilik berdifusi melewati membran
plasma. Di dalam sel, molekul pembawa pesan berinteraksi dengan
reseptor tertentu (pengikat protein). Dalam keadaan terikat ligan,
reseptor-reseptor ini mengatur transkripsi mRNA spesifik dan
dengan demikian mengendalikan ekspresi enzim kunci, reseptor,
atau transporter.
2. Pembawa pesan kimia tidak dapat melewati membran plasma
karena rendahnya kelarutan lipid. Pembawa pesan mengikat
reseptor membran plasma tertentu (protein membran integral).
Dalam keadaan terikat ligan, reseptor mengaktivasi salah satu
dari (1) suatu saluran ion intrinsik (reseptor ionotropik), atau (2)
urutan tertentu pada enzim (reseptor metabotropik). Tabel 4.5
menunjukkan contoh-contoh reseptor membran plasma.
Reseptor inti terutama bertanggung jawab atas pengaruh fisiologis
hormon steroid seperti kortisol, hormon tiroid, atau vitamin A.
Reseptor ini merupakan protein yang memiliki struktur dasar umum
terdiri atas suatu domain pengikat ligan dan domain pengikat DNA
(terdiri atas motif jari seng). Reseptor ini bekerja sebagai faktor
transkripsi responsif-ligan.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 205
Tabel 4-5 Reseptor Membran Plasma

Tabel 4-5 Reseptor Membran Plasma
Tipe Reseptor Contoh-contoh Ligan Alami Fungsi
Saluran ion gerbang-ligan Nikotinat
(saluran Na
+
, Ca
2+
)
Asetilkolin Aktivasi sambungan
neuromuskular
) A ( A B A G
(saluran Cl
-
)
-Aminobutirat Inhibisi transmisi syaraf di
otak
r o t a t i s k e o n i m a m a s A
(saluran Na
+
, Ca
2+
)
Glutamat Aktivasi transmisi syaraf di
otak
P n i r u p a d i t o e l k u n r o t p e s e R
2X
(saluran Na
+
, Ca
2+
)
ATP Aktivasi transmisi syaraf di
otak
Reseptor gabungan G-
protein
(suatu protein pengikat GTP
berikatan dengan reseptor
untuk aktivasi enzim
intrasel)
Reseptor muskarinik
(lima subtipe)
Asetilkolin Memperlambat detak
jantung;
melepaskan enzim
pencernaan pankreatik
t a g r e n e r d a r o t p e s e R
(tiga subtipe 1; tiga subtipe 2;
tiga subtipe )
Epinefrin, norepinefrin Meningkatkan tekanan darah
(1); mempercepat detak
jantung (1); mempercepat
aliran udara keluar masuk
paru-paru (2)
i s n e t o i g n A n i s n e t o i g n a r o t p e s e R n II Meningkatkan tekanan darah
(dengan konstriksi arteri
kecil
B n e i r t o k u e l r o t p e s e R
4
Leukotrien B
4
Neutrofil; memicu
pembunuhan bakteri intrasel
P n i r u p a d i t o e l k u n r o t p e s e R
2U
ATP, UTP Relaksasi bergantung-
endotelia pada otot halus
vaskuler
Reseptor faktor
pertumbuhan
(Reseptor ini terbagi ke
dalam dua kelompok utama:
reseptor tirosin kinase
1
dan
reseptor yang bergabung
dengan tirosin kinase
sitoplasma
2
)
Insulin
1
; h a r a d a s o k u l g n a k n u r u n e M n i l u s n I
memicu penyimpanan
glukosa seperti glikogen
dalam hati maupun otot
skeletal dan seperti lemak
dalam sel lemak
l a m r e d i p e n a h u b m u t r e p r o t k a F
1
(epidermal growth factor, EGF)
EGF Memicu diferensiasi sel
dalam usus
) F N I ( n o r e f r e t n I
2
(beberapa
subtipe)
INF Memicu diferensiasi dan
perkembangbiakan limfosit
n a h u b m u t r e p n o m r o H
2
Hormon pertumbuhan Memicu pertumbuhan
berbagai jaringan
Reseptor glukokortikoid adalah protein inti yang memiliki tiga
domain fungsional yang penting, yakni: domain pada ujung C yang
mengikat hormon steroid (ligan), domain pengikat DNA yang disusun
oleh dua motif jari seng, dan domain ujung-N yang terlibat dalam
regulasi transkripsi gen (Gambar 4-22).
BIOKIMIA: Struktur dan Fungsi Biomolekul 206
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 196
Hormon
pertumbuhan
2
Hormon
pertumbuhan
Memicu
pertumbuhan
berbagai jaringan
Reseptor inti terutama bertanggung jawab atas pengaruh fisiologis hormon
steroid seperti kortisol, hormon tiroid, atau vitamin A. Reseptor ini merupakan
protein yang memiliki struktur dasar umum terdiri atas suatu domain pengikat
ligan dan domain pengikat DNA (terdiri atas motif jari seng). Reseptor ini
bekerja sebagai faktor transkripsi responsif-ligan.
Reseptor glukokortikoid adalah protein inti yang memiliki tiga domain
fungsional yang penting, yakni: domain pada ujung C yang mengikat hormon
steroid (ligan), domain pengikat DNA yang disusun oleh dua motif jari seng, dan
domain ujung-N yang terlibat dalam regulasi transkripsi gen (Gambar 4-22).
Gambar 4-22 Struktur reseptor Glucocorticoid
Pada reseptor ionotropik (saluran ion gerbang-ligan), pembawa pesan
kimia mengubah keadaan konformasi suatu protein membran integral yang
bekerja sebagai suatu saluran untuk pergerakan ion-ion melewati membran
plasma (misalnya Na
+
, K
+
, Ca
2+
, Cl
-
). Neurotransmiter eksitator seperti
glutamat, asetilkolin, serta ATP mengaktivasi saluran ion gerbang-ligan yang
memicu pemasukan ion-ion Na
+
dan Ca
2+
untuk mendepolarisasi
(mengaktivasi) neuron. Sebaliknya, neurotransmiter inhibitor -aminobutirat
(GABA) memicu pemasukan ion Cl
-
yang menghiperpolarisasi (mendeaktivasi)
neuron.
Reseptor metabotropik (reseptor yang bergabung dengan G-protein,
reseptor faktor pertumbuhan) merespon berbagai macam penggerak
(pengaktivasi) termasuk peptida pendek, protein, amina biogenik, nukleotida,
lipid, dan bahkan foton dari cahaya. Reseptor ini merupakan subunit tunggal
protein membran integral yang mempunyai struktur domain tujuh-transmembran
Regulasi transkripsi
N
Pengikatan DNA
Pengikatan ligan
C
Gambar 4-22 Struktur reseptor Glucocorticoid
Pada reseptor ionotropik (saluran ion gerbang-ligan), pembawa
pesan kimia mengubah keadaan konformasi suatu protein membran
integral yang bekerja sebagai suatu saluran untuk pergerakan ion-
ion melewati membran plasma (misalnya Na
+
, K
+
, Ca
2+
, Cl
-
).
Neurotransmiter eksitator seperti glutamat, asetilkolin, serta ATP
mengaktivasi saluran ion gerbang-ligan yang memicu pemasukan
ion-ion Na
+
dan Ca
2+
untuk mendepolarisasi (mengaktivasi) neuron.
Sebaliknya, neurotransmiter inhibitor g-aminobutirat (GABA) memicu
pemasukan ion Cl- yang menghiperpolarisasi (mendeaktivasi) neuron.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 197
umum dalam bentuk yang disebut roda heliks (helical wheel), yang
ditunjukkan oleh Gambar 4-23-b.
Gambar 4-23 Kajian skematis dari reseptor-reseptor yang bergabung dengan
protein G. (a) Kajian bagian yang berseberangan pada suatu reseptor
yang terikat pada protein G yang menunjukkan ujung N pada ruang
ekstraseluler, 7 domain transmembran dan ujung C pada sitoplasma.
(b) Suatu kajian domain transmembran dari reseptor yang terikat
pada protein G yang menunjukkan bagaimana rantai samping asam
amino dapat membentuk suatu sisi pengikatan ligan yang tepat.
Dalam contoh ini sisi pengikat ligan yang ditunjukkan terbentuk oleh
suatu rantai samping gugus karboksilat, 2 rantai samping gugus
amino dan 3 rantai samping gugus hidroksil.
Sisi pengikat ligan dibentuk pada permukaan membran atau di
dekatnya oleh rantai samping asam amino yang berproyeksi ke dalam rongga
tengah yang dibentuk oleh domain transmembran (Gambar 4-23-b). Dalam
keadaan terikat ligan, reseptor ini mengaktivasi protein pengikat nukleotida
guanin sitosolat (yakni G-protein). G-protein ini kemudian akan meregulasi
aktivitas satu atau lebih enzim kunci. G-protein terdiri atas tiga subunit
nonidentik (). Subunit mengikat salah satu molekul GDP atau GTP.
Bentuk terikat GDP tidaklah aktif (inaktif). Pengisian sisi pengikat ligan pada
reseptor memulai reaksi pertukaran nukleotida guanin, yakni GDP digantikan
oleh GTP (Gambar 4-24). Subunit- yang teraktivasi kemudian memisah dari
subunit . Ini merupakan peristiwa kunci dalam proses transduksi sinyal
karena subunit yang dibebaskan dan subunit mengikat dan mengaktivasi
enzim ke arah muara reseptor. Subunit juga memiliki aktivitas enzim.
N
C
Sitoplasma
Membran
Ruang
ekstraseluler
VII
IV
III
V
II
I
VII
OH
NH3
+
NH3
+
HO
OH
COO
-
(a)
(b)
Gambar 4-23 Kajian skematis dari reseptor-reseptor yang bergabung
dengan protein G. (a) Kajian bagian yang berseberangan pada suatu
reseptor yang terikat pada protein G yang menunjukkan ujung N
pada ruang ekstraseluler, 7 domain transmembran dan ujung C pada
sitoplasma. (b) Suatu kajian domain transmembran dari reseptor yang
terikat pada protein G yang menunjukkan bagaimana rantai samping
asam amino dapat membentuk suatu sisi pengikatan ligan yang tepat.
Dalam contoh ini sisi pengikat ligan yang ditunjukkan terbentuk oleh
suatu rantai samping gugus karboksilat, 2 rantai samping gugus amino
dan 3 rantai samping gugus hidroksil.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 207
Reseptor metabotropik (reseptor yang bergabung dengan G-pro-
tein, reseptor faktor pertumbuhan) merespon berbagai macam peng-
gerak (pengaktivasi) termasuk peptida pendek, protein, amina bio-
genik, nukleotida, lipid, dan bahkan foton dari cahaya. Reseptor ini
merupakan subunit tunggal protein membran integral yang mempu-
nyai struktur domain tujuh-transmembran umum dalam bentuk yang
disebut roda heliks (helical wheel), yang ditunjukkan oleh Gambar
4-23-b.
Sisi pengikat ligan dibentuk pada permukaan membran atau di
dekatnya oleh rantai samping asam amino yang berproyeksi ke dalam
rongga tengah yang dibentuk oleh domain transmembran (Gambar 4-
23-b). Dalam keadaan terikat ligan, reseptor ini mengaktivasi protein
pengikat nukleotida guanin sitosolat (yakni G-protein). G-protein ini
kemudian akan meregulasi aktivitas satu atau lebih enzim kunci. G-
protein terdiri atas tiga subunit nonidentik (abg). Subunit a mengikat
salah satu molekul GDP atau GTP. Bentuk terikat GDP tidaklah aktif
(inaktif ). Pengisian sisi pengikat ligan pada reseptor memulai reaksi per-
tukaran nukleotida guanin, yakni GDP digantikan oleh GTP (Gambar
4-24). Subunit-a yang teraktivasi kemudian memisah dari subunit bg.
Ini merupakan peristiwa kunci dalam proses transduksi sinyal karena
subunit a yang dibebaskan dan subunit bg mengikat dan mengakti-
vasi enzim ke arah muara reseptor. Subunit a juga memiliki aktivitas
enzim. GTPase intrinsiknya membatasi jangka waktu aktivasinya send-
iri dengan cara mengubah GTP menjadi GDP pada sisi pengikat nuk-
leotida guanin.
Toksin kolera mengganggu fungsi G-protein kunci dalam usus
halus dengan cara mendeaktivasi aktivitas GTPase intrinsik. Hasilnya
yakni aktivasi jalur transduksi sinyal menjadi tak terkendali yang mem-
produksi pembawa pesan kedua 3,5-siklik AMP yang menimbulkan
diare setelah aktivasi pengeluaran ion dan air.
Belum diketahui berapa banyak reseptor metabolik yang ada.
Namun, teknik kloning molekul berbasis homolog telah memung-
kinkan identifikasi ratusan reseptor tersebut yang masing-masing sesuai
dengan pola domain tujuh transmembran. Banyak fungsi reseptor dan
BIOKIMIA: Struktur dan Fungsi Biomolekul 208
ligannya yang belum diketahui, seperti misalnya reseptor yang disebut
sebagai reseptor yatim piatu (orphan). Dengan cara yang sama, ter-
dapat juga keanekaragaman G-protein yang pantas dipertimbangkan.
Khususnya, lebih dari 30 tipe subunit-a yang berbeda-beda telah ber-
hasil digambarkan.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 198
GTPase intrinsiknya membatasi jangka waktu aktivasinya sendiri dengan cara
mengubah GTP menjadi GDP pada sisi pengikat nukleotida guanin.
Gambar 4-24 Siklus aktivasi dan deaktivasi heterotrimerik protein G. Reseptor
pengikat ligan berperan sebagai suatu faktor guanidin penukar
nukleotida yang mengganti GDP dengan GTP pada sub unit .
Subunit -GTP dan -GTP kemudian dipisahkan menjadi enzim-
enzim target yang aktif. Siklus tersebut adalah dilengkapi melalui aksi
dari aktivitas instrinsik GTPase pada subunit . Subunit -GDP bebas
siap digabungkan kembali dengan subunit bebas untuk membentuk
heterotrimerik inaktif. Aktivasi protein G menunjukkan suatu sisi
amplifikasi (pemanjangan) pada jalur penyinalan : untuk setiap
molekul reseptor yang mengikat ligan, ini akan di perkirakan bahwa
ratusan atau ribuan molekul protein G yang teraktivasi.
Toksin kolera mengganggu fungsi G-protein kunci dalam usus halus
dengan cara mendeaktivasi aktivitas GTPase intrinsik. Hasilnya yakni aktivasi
jalur transduksi sinyal menjadi tak terkendali yang memproduksi pembawa
pesan kedua 3,5-siklik AMP yang menimbulkan diare setelah aktivasi
pengeluaran ion dan air.
Belum diketahui berapa banyak reseptor metabolik yang ada. Namun,
teknik kloning molekul berbasis homolog telah memungkinkan identifikasi
ratusan reseptor tersebut yang masing-masing sesuai dengan pola domain
tujuh transmembran. Banyak fungsi reseptor dan ligannya yang belum
diketahui, seperti misalnya reseptor yang disebut sebagai reseptor yatim piatu
(orphan). Dengan cara yang sama, terdapat juga keanekaragaman G-protein
yang pantas dipertimbangkan. Khususnya, lebih dari 30 tipe subunit- yang
berbeda-beda telah berhasil digambarkan.


GDP
GTP GDP
P
i
GDP
Reseptor pengikat
ligan
GTP
Gambar 4-24 Siklus aktivasi dan deaktivasi heterotrimerik protein
G. Reseptor pengikat ligan berperan sebagai suatu faktor guanidin
penukar nukleotida yang mengganti GDP dengan GTP pada sub unit
a. Subunit a-GTP dan bg-GTP kemudian dipisahkan menjadi enzim-
enzim target yang aktif. Siklus tersebut adalah dilengkapi melalui aksi
dari aktivitas instrinsik GTPase pada subunit a. Subunit a-GDP bebas
siap digabungkan kembali dengan subunit bg bebas untuk membentuk
heterotrimerik abg inaktif. Aktivasi protein G menunjukkan suatu sisi
amplifikasi (pemanjangan) pada jalur penyinalan : untuk setiap molekul
reseptor yang mengikat ligan, ini akan di perkirakan bahwa ratusan atau
ribuan molekul protein G yang teraktivasi.
Dalam regulasi enzim oleh G-protein, G-protein mengaktivasi
enzim yang bebas bergabung dengan permukaan sitoplasma membran
atau yang terdapat bebas dalam sitoplasma. Protein ini terutama
berperan pada dua bentuk substrat, yakni: (1) nukleotida sitoplasma,
atau (2) fosfolipid gliserol pada lapisan dalam membran plasma.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 209
Enzim metabolisme nukleotida yang diregulasi oleh reseptor
metabotropik yakni adenilat siklase dan cGMP fosfodiesterase.
Adenilat siklase berfungsi mengubah ATP menjadi adenosin 3,5-
siklik monofosfat (cAMP). Enzim ini diaktivasi oleh reseptor yang
mengaktivasi G-protein yang dikenal sebagai Gs (untuk G-protein
stimulator), dan diinhibisi oleh reeptor yang mengaktivasi G-protein
yang dikenal sebagai Gi (untuk G-protein inhibitor). Tingginya level
cAMP mendasari pelepasan glukosa dari glikogen yang disebabkan
oleh epinefrin dan glukagon.
cGMP fosfodiesterase berfungsi mengubah guanosin 3,5-siklik
monofosfat (cGMP) menjadi GMP. Enzim ini diaktivasi oleh G-
protein transducin (Gt) sebagai respon terhadap aktivasi fotoreseptor
di dalam membran plasma sel tangkai retina. Penekanan level cGMP
yang disebabkan oleh cahaya dengan cara ini menutup saluran
penyerap-Na+ dalam membran sel tangkai, yang mengakibatkan
hiperpolarisasi membran dan penurunan transmisi syaraf dari retina.
Otak menginterpretasikan penekanan transmisi syaraf ini sebagai suatu
letusan cahaya.
Gliserol fosfolipid menjadi peka terhadap serangan melalui enzim
karena adanya fosfolipase pada berbagai posisi. Dalam beberapa
kasus, fosfolipase sangat spesifik untuk gugus kepala tertentu yang
larut dalam air, misalnya PI-spesifik fosfolipase C. Akan tetapi, dalam
kasus lainnya fosfolipase yang terlibat dapat menyerang fosfolipid dari
berbagai kelompok, misalnya fosfolipase A2. Isoform tertentu pada
fosfolipase A2, C, dan D diaktivasi oleh G-protein (Gi, Go, Gq).
Hasilnya, lapisan bagian dalam membran plasma menjadi sumber
berbagai mediator komia yang dilepas sebagai konsekuensi aktivasi
reseptor. Mediator-mediator ini antara lain: inositol 1,4,5-trifosfat (IP
3
)
dan 1,2-diasilgliserol (DAG), yang keduanya memproduksi PI-spesifik
fosfolipase C (Gambar 4-25); serta asam arakhidonat yang merupakan
produk asam lemak tak jenuh dari fosfolipase A
2
dan fosfatidat (produk
dari fosfolipase D). IP3 menyebabkan pelepasan ion Ca
2+
dari gudang
retikulum endoplasma intrasel. DAG dikenal sebagai pengaktivasi
serin/treonin protein kinase yang tergantung lipid (protein kinase C).
BIOKIMIA: Struktur dan Fungsi Biomolekul 210
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 200
menyebabkan pelepasan ion Ca
2+
dari gudang retikulum endoplasma intrasel.
DAG dikenal sebagai pengaktivasi serin/treonin protein kinase yang tergantung
lipid (protein kinase C).
H
2
C O C R
1
O
HCC
H
2
C
O C R
2
O
O P O
O
-
O
HO
OH
HO
O
O
P O
-
O
O
-
P O
-
O
O
-
H
2
C O C R
1
O
HC C O C R
2
O
H
2
C OH
O
-
P O
O
-
O
HO
OH
HO
O
O
P O
-
O
O
-
P O
-
O
O
-
PIP
2
DAG
IP
3
PL-C
(G
i
atau G
q
Gambar 4-25 Hidrolisis fosfatidilinositol 4,5-bifosfat (PIP
2
) oleh fosfolipase C.
Fosfolipase C (PL-C) diaktivasi oleh subunit- dan/atau G-
protein. Sisi hidrolisis ditandai dengan panah terbuka.
Diperoleh dua produk: 1,2-diasilgliserol (DAG) yang
mengaktivasi protein kinase C, dan inositol 1,4,5-trifosfat (IP
3
)
yang menyebabkan pelepasan Ca
2+
dari gudang intrasel.
Faktor-faktor pertumbuhan tertentu seperti faktor pertumbuhan
epidermal (epidermal growth factor, EGF) dan platelet-derived growth factor
(PDGF) yang meregulasi metabolisme sel dan transkripsi gen, dapat
mengaktivasi reseptor yang memiliki aktivitas protein kinase intrinsik di dalam
domain sitoplasmanya (Gambar 4-26). Aktivitas protein kinase intrinsik ini
secara spesifik memfosforilasi residu tirosin dalam protein. Aktivitas reseptor
tirosin kinase akan diam tanpa adanya ligan tetapi teraktivasi dengan adanya
pengikatan ligan pada permukaan ekstraselular, yang mengakibatkan fosforilasi
residu tirosin di dalam (1) domain sitoplasma pada reseptor itu sendiri
(autofosforilasi), dan (2) protein sitoplasma kunci. Beberapa reseptor tipe ini
merupakan subunit tunggal yang ketika terjadi aktivasi akan membentuk dimer
Gambar 4-25 Hidrolisis fosfatidilinositol 4,5-bifosfat (PIP
2
) oleh
fosfolipase C. Fosfolipase C (PL-C) diaktivasi oleh subunit-a dan/atau
bg G-protein. Sisi hidrolisis ditandai dengan panah terbuka. Diperoleh
dua produk: 1,2-diasilgliserol (DAG) yang mengaktivasi protein kinase
C, dan inositol 1,4,5-trifosfat (IP3) yang menyebabkan pelepasan Ca2+
dari gudang intrasel.
Faktor-faktor pertumbuhan tertentu seperti faktor pertumbuhan
epidermal (epidermal growth factor, EGF) dan platelet-derived growth
factor (PDGF) yang meregulasi metabolisme sel dan transkripsi gen,
dapat mengaktivasi reseptor yang memiliki aktivitas protein kinase
intrinsik di dalam domain sitoplasmanya (Gambar 4-26). Aktivitas
protein kinase intrinsik ini secara spesifik memfosforilasi residu tirosin
dalam protein. Aktivitas reseptor tirosin kinase akan diam tanpa adanya
ligan tetapi teraktivasi dengan adanya pengikatan ligan pada permukaan
ekstraselular, yang mengakibatkan fosforilasi residu tirosin di dalam
(1) domain sitoplasma pada reseptor itu sendiri (autofosforilasi), dan
(2) protein sitoplasma kunci. Beberapa reseptor tipe ini merupakan
subunit tunggal yang ketika terjadi aktivasi akan membentuk dimer
(contohnya reseptor EGF). Reseptor lainnya terdiri atas subunit banyak
yang distabilkan oleh ikatan disulfida (contohnya reseptor insulin).
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 211
Fosforilasi domain sitosolik pada reseptor akan menciptakan templat
untuk berkumpulnya alat-alat protein yang mengaktivasi G-protein
monomer kunci yang disebut ras. Aktivasi ras ini mendahului aktivasi
rangkaian protein kinase serin- dan treonin-spesifik yang mempengaruhi
transkripsi gen dan penataan ulang sitoskeletal. Peristiwa-peristiwa ini
mendasari diferensiasi dan perkembangbiakan sel.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 201
(contohnya reseptor EGF). Reseptor lainnya terdiri atas subunit banyak yang
distabilkan oleh ikatan disulfida (contohnya reseptor insulin). Fosforilasi domain
sitosolik pada reseptor akan menciptakan templat untuk berkumpulnya alat-alat
protein yang mengaktivasi G-protein monomer kunci yang disebut ras. Aktivasi
ras ini mendahului aktivasi rangkaian protein kinase serin- dan treonin-spesifik
yang mempengaruhi transkripsi gen dan penataan ulang sitoskeletal.
Peristiwa-peristiwa ini mendasari diferensiasi dan perkembangbiakan sel.
Gambar 4-26 Skema reseptor faktor pertumbuhan epidermal / epidermal growth
factor (EGF). Reseptor adalah suatu protein membran integral dengan
suatu domain transmembran. Sisi pengikatan ligan berada dalam suatu
domain ekstraseluler dan di sana terdapat suatu domain tirosin kinase
yang berdekatan dengan ujung C pada sitoplasma. (a) Reseptor
terdapat sebagai subunit tunggal. (b) Pada pengikatan EGF, reseptor
membentuk dimer yang distabilkan malalui penggabungan nonkovalen.
Setelah dimerisasi aktivasi tirosin kinase memfosforilasi residu tirosin
pada domain sitoplasma untuk mengambil protein berikut untuk
mengikat pada reseptor. Pembentukkan suatu protein dirancang pada
domain sitoplasma yang diperlukan untuk aktivasi enzim enzim yang
mengatur metabolisme sel dan transkripsi gen.
Fosforilasi adalah alat yang biasa digunakan di alam untuk meregulasi
aktivitas enzim kunci. Protein kinase adalah ATP fosfotransferase yang bekerja
pada substrat protein atau peptida. Pada umumnya protein kinase dibagi
menjadi dua kelompok, yakni: kelompok yang memfosforilasi residu serin atau
treonin (contohnya protein kinase yang tergantung cAMP), dan kelompok yang
P
P
P
Ruang ekstraseluler
Domain tirosin kinase
Sitoplasma
(a)
(b)
Gambar 4-26 Skema reseptor faktor pertumbuhan epidermal /epidermal
growth factor (EGF). Reseptor adalah suatu protein membran integral
dengan suatu domain transmembran. Sisi pengikatan ligan berada dalam
suatu domain ekstraseluler dan di sana terdapat suatu domain tirosin
kinase yang berdekatan dengan ujung C pada sitoplasma. (a) Reseptor
terdapat sebagai subunit tunggal. (b) Pada pengikatan EGF, reseptor
membentuk dimer yang distabilkan malalui penggabungan nonkovalen.
Setelah dimerisasi aktivasi tirosin kinase memfosforilasi residu tirosin
pada domain sitoplasma untuk mengambil protein berikut untuk
mengikat pada reseptor. Pembentukkan suatu protein dirancang pada
domain sitoplasma yang diperlukan untuk aktivasi enzim enzim yang
mengatur metabolisme sel dan transkripsi gen.
Fosforilasi adalah alat yang biasa digunakan di alam untuk mere-
gulasi aktivitas enzim kunci. Protein kinase adalah ATP fosfotransfer-
ase yang bekerja pada substrat protein atau peptida. Pada umumnya
BIOKIMIA: Struktur dan Fungsi Biomolekul 212
protein kinase dibagi menjadi dua kelompok, yakni: kelompok yang
memfosforilasi residu serin atau treonin (contohnya protein kinase
yang tergantung cAMP), dan kelompok yang memfosforilasi residu
tirosin (contohnya EGF atau reseptor insulin). Dalam serin/treonin ki-
nase, ujung fosfat dari ATP ditransfer kepada hidroksil serin dan tre-
onin. Dalam tirosin kinase, ujung fosfat dari ATP ditransfer kepada
gugus hidroksil tirosil tertentu.
Urutan peptida tertentu yang dikenal sebagai domain src
homologi-2 (SH-2) mengikat pada urutan yang kaya akan fosfotirosil.
Reaksi pengikatan ini memungkinkan interaksi protein kunci dengan
reseptor tirosin kinase teraktivasi serta perakitan kompleks pengaktivasi
ras.
Faktor pertumbuhan yang lain memberi sinyal dengan suatu kelompok
reseptor domain transmembran tunggal yang mengaktivasi tirosin
kinase intrasel tetapi dirinya sendiri tidak mengekspresikan aktivitas
tirosin kinase dalam domain sitoplasmanya. Yang termasuk kelompok
ini antara lain: reseptor untuk beberapa sitokin (regulator peptida pada
fungsi sel limfoid dan myeloid); serta beberapa hormon seperti hormon
pertumbuhan, prolaktin, dan eritropoietin. Pada pengikatan ligan,
tirosin kinase sitoplasma dari keluarga JAK (Janus kinase) bergabung
dengan domain sitoplasma dari reseptor dan teraktivasi. JAK tirosin
kinase meregulasi enzim sitoplasma kunci dan keluarga STAT pada
faktor transkripsi.
Reseptor membran plasma sangat penting untuk proses transmisi
informasi yang dibawa oleh ligan atau pembawa pesan pertama
(neurotransmiter, hormon, dan sebagainya) dari ruang ekstrasel
ke dalam interior sel. Namun, pensinyalan sel juga membutuhkan
informasi yang mengalir di dalam sel tersebut. Molekul yang membawa
informasi ini untuk mengatur aktivitas saluran ion, enzim, atau
reseptor, kadangkala disebut sebagai pembawa pesan kedua (second
messenger). Akan tetapi, berkaitan dengan kompleksitas rangkaian
transduksi sinyal yang di dalamnya satu pembawa pesan kedua dapat
meregulasi pembawa pesan kedua yang lain, maka istilah mediator
intrasel mungkin akan lebih cocok.
Bab 4 Lipid, Membran, Transpor, dan Pensinyalan 213
Mediator intrasel untuk reseptor faktor pertumbuhan antara
lain tirosin kinase (misalnya reseptor tirosin kinase atau JAK kinase),
protein pengikat kunci, enzim pemodifikasi fosfolipid dan produknya,
monomer G-protein (seperti ras), dan protein kinase serin/treonin
arah muara (seperti MAP kinase) yang meregulasi sitoskeleton dan
transkripsi gen. Aktivasi ras oleh penukaran nukleotida guanin adalah
peristiwa kunci dalam aktivasi jalur pensinyalan arah muara untuk
banyak faktor pertumbuhan.
Mediator intrasel untuk G-protein yang bergabung dengan
reseptor antara lain cAMP, cGMP, ion Ca2+, IP3, DAG, arakhidonat,
dan fosfatidat. Mediator-mediator ini meregulasi metabolisme sel
dengan cara mengatur aktivitas saluran ion (yakni cAMP, cGMP, ion
Ca
2+
, arakhidonat), serin/treonin kinase (yakni cAMP, cGMP, ion Ca
2+
,
DAG, fosfatidat, arakhidonat), atau transporter intrasel (yakni IP3).
Mediator intrasel meregulasi dan berpartisipasi dalam jalur transduksi
sinyal. Sebagai contoh, ion Ca
2+
bersama dengan protein pengikat Ca2+
kalmodulin mengaktivasi penguraian cAMP dan cGMP melalui enzim
intrasel fosfodiesterase (PDE). Dengan cara yang sama, reseptor protein
kinase teraktivasi bekerja mendeaktivasi reseptor (regulasi ke bawah,
down-regulate). Sebagai contoh, fosforilasi reseptor b-adrenergat oleh
b-adrenergat reseptor kinase (BARK) mengurangi kemampuan reseptor
b-adrenergat untuk merespon epinefrin.
Ion kalsium bekerja sebagai mediator intrasel, yakni konsentrasi
ion Ca
2+
bebas dalam sitoplasma dipertahankan pada level yang sangat
rendah (sekitar 0,1 M) dalam kondisi istirahat. Nilai ini adalah sekitar
1/10.000 dari level yang teramati dalam plasma (1,1 mM). Namun,
konsentrasi Ca
2+
bebas dalam sitoplasma bisa meningkat 10 atau 100
kali lipat setelah terjadi aktivasi reseptor tertentu. Pelepasan IP3 dari
membran fosfolipid sebagai respon pada aktivasi reseptor gabungan G-
protein tertentu merupakan salah satu mekanisme untuk meningkatkan
[Ca
2+
]i, yakni IP3 mengosongkan gudang penyimpanan Ca
2+
vesikular
intrasel. Aktivasi reseptor ionotropik tertentu juga meningkatkan
[Ca
2+
]i dengan cara merangsang pemasukan Ca
2+
dari eksterior. Sekali
ditingkatkan, Ca
2+
mengaktivasi enzim intrasel kunci secara langsung
BIOKIMIA: Struktur dan Fungsi Biomolekul 214
(misalnya protein kinase C) atau secara tak langsung setelah mengikat
protein pengikat Ca
2+
afinitas tinggi kalmodulin (16.700 kDa). Ca
2+
-
kalmodulin mengaktivasi enzim-enzim kunci termasuk protein-protein
kinase tertentu. Level Ca
2+
bisa dikembalikan menjadi normal dengan
beberapa cara yakni reaksi (1) transpor ATPase dalam membran plasma
yang memompa ion Ca
2+
keluar sel, atau (2) transpor ATPase yang
mengakumulasi ion Ca
2+
ke dalam interior retikulum endoplasma.
cAMP mengaktivasi protein kinase-nya. Siklik AMP protein
kinase (PK-A) mempunyai struktur subunit a
2
b
2
(Gambar 4-27).
Aktivitas katalis berada dalam subunit a yang inaktif dalam kompleks
tetramer a
2
b
2
. Tiap subunit b mempunyai dua sisi pengikat cAMP.
Dengan adanya cAMP, dua subunit a bebas dilepaskan, dan empat
molekul cAMP mengikat homodimer b2 sisanya untuk membentuk
b
2
(cAMP)
4
. Subunit a bebas dari PK-A memfosforilasi protein target
dengan adanya MgATP.
Lipid, Membran, Transpor, dan Pensinyalan
Biokimia: Struktur dan Fungsi Biomolekul 204
cAMP mengaktivasi protein kinase-nya. Siklik AMP protein kinase (PK-
A) mempunyai struktur subunit
2

2
(Gambar 4-27). Aktivitas katalis berada
dalam subunit yang inaktif dalam kompleks tetramer
2

2
. Tiap subunit
mempunyai dua sisi pengikat cAMP. Dengan adanya cAMP, dua subunit
bebas dilepaskan, dan empat molekul cAMP mengikat homodimer
2
sisanya
untuk membentuk
2
(cAMP)
4
. Subunit bebas dari PK-A memfosforilasi
protein target dengan adanya MgATP.
Gambar 4.27 Aktivasi cAMP protein kinase oleh cAMP

Subunit katalitik
cAMP cAMP
cAMP cAMP


Kompleks inaktif
4 cAMP
Subunit regulator
Gambar 4.27 Aktivasi cAMP protein kinase oleh cAMP
-oo0oo-
Bab
ASAM NUKLEAT
5
1. PENGANTAR
Pada tahun 1868, Friederich Miescher mengisolasi suatu zat dari inti
sel nanah. Zat tersebut dianggap sebagai karakteristik inti (nucleus),
dan Miescher menyebutnya nuklein. Tidak lama kemudian, zat yang
serupa diisolasi dari kepala sperma ikan salmon. Belakangan nuklein
ditemukan sebagai campuran suatu protein dasar dan asam organik
yang mengandung fosfor, yang kini disebut sebagai asam nukleat. Asam
nukleat terdiri atas DNA (deoxyribonucleic acid) dan RNA (ribonucleic
acid).
DNA adalah material genetik dari sel, yakni yang mengandung gen.
Suatu gen digambarkan sebagai segmen DNA (sampai beberapa kb)
yang dengan cepat diekspresikan sebagai polipeptida, seringkali sebagai
protein atau enzim. DNA terdapat dalam kromosom sel, dengan satu
atau lebih kromosom berisikan genom. Genom menggambarkan suatu
komponen tunggal akan informasi genetik suatu sel. Setiap kromosom
mengandung banyak gen. Selama pembelahan sel, DNA kromosom
harus memproduksi replika (duplikat) dirinya sendiri yang persis sama
untuk pemisahan dan partisi ke dalam sel turunan. Produksi duplikat
DNA ini dikenal sebagai replikasi, yang melibatkan sintesis rantai DNA
baru.
BIOKIMIA: Struktur dan Fungsi Biomolekul 216
Untuk pertumbuhan dan perkembangbiakan sel normal, DNA
harus dilindungi dari berbagai jenis kerusakan. Kerusakan bisa disebab-
kan misalnya oleh radiasi uv, yang dapat melibatkan perubahan kimia
pada DNA sehingga terjadi mutasi yang mengganggu. Sel memiliki ke-
mampuan untuk membetulkan atau memperbaiki kerusakan seperti
itu. Salah satu mekanisme perbaikan yang paling dipahami melibat-
kan sintesis DNA baru yang menggantikan bagian yang rusak. Proses
ini disebut sintesis perbaikan (repair synthesis) DNA. Tingkat sintesis
perbaikan sangat kecil dibandingkan dengan sintesis DNA yang me-
nyertai replikasi kromosom.
Sebagian besar sel (bakteri, tumbuhan, dan hewan) mengandung
satu, dua, atau sejumlah kecil dari kebanyakan gen. Namun, untuk
menghadapi situasi tertentu, beberapa sel akan memproduksi banyak
duplikat suatu gen. Proses ini dikenal sebagai amplifikasi gen atau
amplifikasi DNA, yang melibatkan beberapa kali lipat replikasi segmen
tertentu dari suatu DNA.
Kesalahan dalam replikasi dan perbaikan DNA pada sel hewan
bisa menyebabkan kecenderungan terbentuknya kanker. Hal ini
menekankan pentingnya proses tersebut dalam biologi. Namun, ban-
yak pemahaman mengenai bagaimana hal itu terjadi pada level molekul,
telah tergantung pada penelitian dengan bakteri sederhana.
DNA di dalam kromosom sebagian besar organisme merupakan
heliks ganda (double-helix), yakni terdiri atas dua rantai (atau untai)
polideoksinukleotida yang melilit mengelilingi satu sama lain dalam
bentuk heliks. Informasi genetik terkandung di dalam urutan nukleotida
di sepanjang salah satu rantai, dengan urutan rantai itu komplementer
terhadap rantai yang lainnya. Suatu replika DNA merupakan duplikat
yang persis sama dari DNA itu sendiri.
Setiap rantai dari heliks ganda DNA terikat pada rantai yang sa-
tunya melalui pasangan basa komplementer, yakni adenin (A) di salah
satu rantai berikatan hidrogen dengan timin (T) pada rantai lainnya,
dan guanin (G) dengan sitosin (C). Watson dan Crick mengusulkan
bahwa untuk mendapatkan duplikat persis suatu urutan nukleotida
(basa), kedua rantai DNA harus dilepas gulungannya dari satu sama
Bab 5 Asam Nukleat 217
lain untuk memungkinkan masing-masing rantai tunggal berperan se-
bagai templat untuk sintesis yang baru. Dengan demikian, penyusunan
urutan dalam rantai yang baru disintesis adalah ditentukan oleh spesi-
fisitas pasangan basa pada urutan dalam templat. Hal ini dilukiskan
dalam Gambar 5-1 (dupleks DNA diperlihatkan sebagai struktur lad-
der-type).

Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 207
Gambar 5-1 Untai DNA yang berperan sebagai templat untuk replikasi.
Huruf yang tercetak miring menandakan DNA yang baru
disintesis.
2. ASAM NUKLEAT DAN KONSTITUEN KIMIANYA
Asam nukleat utama dalam inti sel adalah asam deoksiribonukleat
(atau DNA). Molekul ini memiliki gula pentosa deoksiribosa sebagai salah satu
konstituen kimianya. Kini telah diketahui bahwa DNA adalah material genetik.
Tipe lain asam nukleat yakni asam ribonukleat (atau RNA), yang memiliki ribosa
menggantikan deoksiribosa. RNA berperan utama dalam transmisi informasi
genetik dari DNA menjadi protein.
Molekul DNA sangat besar, jauh lebih besar daripada protein. Ukuran
RNA masih bisa dibandingkan dengan ukuran protein. Hidrolisis sempurna
pada DNA (atau RNA) oleh asam membelah molekul tersebut menjadi
campuran basa nitrogen, 2-deoksi-D-ribosa (atau D-ribosa pada RNA), dan
ortofosfat. Terdapat dua tipe umum basa nitrogen dalam DNA maupun RNA,
yakni pirimidin dan purin.
A T
G C
C G
T A
T A
A T
A T
G C
C G
C G
C G
G C
T A
A T
C G
G C
A T
AT AT
GC GC
CG CG
TA TA
TA TA
AT AT
AT AT
GC GC
C G
C G
C G
G C
T A
A T
C G
G C
A T
A T
G C
C G
T A
T A
A T
A T
G C
C G
C G
C G
G C
T A
A T
C G
G C
A T
+
(b)
(c)
A T
G C
C G
T A
T A
A T
A T
G C
C G
C G
C G
G C
T A
A T
C G
G C
A T
(a)
Gambar 5-1 Untai DNA yang berperan sebagai templat untuk replikasi.
Huruf yang tercetak miring menandakan DNA yang baru disintesis.
2. ASAM NUKLEAT DAN KONSTITUEN KIMIANYA
Asam nukleat utama dalam inti sel adalah asam deoksiribonukleat (atau
DNA). Molekul ini memiliki gula pentosa deoksiribosa sebagai salah
satu konstituen kimianya. Kini telah diketahui bahwa DNA adalah
material genetik. Tipe lain asam nukleat yakni asam ribonukleat (atau
BIOKIMIA: Struktur dan Fungsi Biomolekul 218
RNA), yang memiliki ribosa menggantikan deoksiribosa. RNA berperan
utama dalam transmisi informasi genetik dari DNA menjadi protein.
Molekul DNA sangat besar, jauh lebih besar daripada protein.
Ukuran RNA masih bisa dibandingkan dengan ukuran protein. Hidro-
lisis sempurna pada DNA (atau RNA) oleh asam membelah molekul
tersebut menjadi campuran basa nitrogen, 2-deoksi-D-ribosa (atau D-
ribosa pada RNA), dan ortofosfat. Terdapat dua tipe umum basa nitro-
gen dalam DNA maupun RNA, yakni pirimidin dan purin.
Pirimidin adalah turunan dari senyawa heterosiklik pirimidin:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 208
H
C
N
HC
N
C
C
3
2
1
6
5
4
N
H
CH
N
7
8
9
Purin
Pirimidin adalah turunan dari senyawa heterosiklik pirimidin:
Purin adalah turunan dari senyawa cincin-fusi purin:
N
N
N
N
NH
2
H
Adenin
(6-aminopurin)
N
N
N
N
O
H
H
H
2
N
Guanin
(2-amino-6-oksipurin)
H
C
N
HC
N
CH
CH
1
2
3
4
5
6
Pirimidin
N
N
NH
2
H
O
Sitosin
(2-oksi-4-aminopirimidin)
N
N
O
H
O
CH
3
H
Timin
(2,4-dioksi-5-metilpirimidin)
N
N
O
H
O
H
Urasil
(2,4-dioksipirimidin)
Bab 5 Asam Nukleat 219
Purin adalah turunan dari senyawa cincin-fusi purin:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 208
H
C
N
HC
N
C
C
3
2
1
6
5
4
N
H
CH
N
7
8
9
Purin
Pirimidin adalah turunan dari senyawa heterosiklik pirimidin:
Purin adalah turunan dari senyawa cincin-fusi purin:
N
N
N
N
NH
2
H
Adenin
(6-aminopurin)
N
N
N
N
O
H
H
H
2
N
Guanin
(2-amino-6-oksipurin)
H
C
N
HC
N
CH
CH
1
2
3
4
5
6
Pirimidin
N
N
NH
2
H
O
Sitosin
(2-oksi-4-aminopirimidin)
N
N
O
H
O
CH
3
H
Timin
(2,4-dioksi-5-metilpirimidin)
N
N
O
H
O
H
Urasil
(2,4-dioksipirimidin)
Penomoran posisi dalam cincin dibuat berdasarkan konvensi
(IUPAC).
Pirimidin utama yang ditemukan dalam DNA adalah timin dan
citosin. Sedangkan dalam RNA yakni urasil dan citosin. Ketiga pirimidin
ini berbeda dalam tipe dan posisi gugus kimia yang menempel pada
cincin.
Timin adalah 5-metil-2,4-dioksipirimidin.
Citosin adalah 2-oksi-4-aminopirimidin.
Urasil adalah 2,4-dioksipirimidin.
Struktur untuk (a) timin, (b) citosin, dan (c) urasil, adalah sebagai
berikut:
BIOKIMIA: Struktur dan Fungsi Biomolekul 220
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 209
Penomoran posisi dalam cincin dibuat berdasarkan konvensi (IUPAC).
Pirimidin utama yang ditemukan dalam DNA adalah timin dan citosin.
Sedangkan dalam RNA yakni urasil dan citosin. Ketiga pirimidin ini berbeda
dalam tipe dan posisi gugus kimia yang menempel pada cincin.
Timin adalah 5-metil-2,4-dioksipirimidin.
Citosin adalah 2-oksi-4-aminopirimidin.
Urasil adalah 2,4-dioksipirimidin.
Struktur untuk (a) timin, (b) citosin, dan (c) urasil, adalah sebagai berikut:
C
HN
C
N
H
CH
C
C
N
C
N
H
CH
CH
O
O
CH
3
NH
2
O
C
HN
C
N
H
CH
CH
O
O
Timin Citosin Urasil
Timin juga bisa digambarkan sebagai 5-metilurasil. Pirimidin termetilasi lainnya
ditemukan dalam sebagian asam nukleat.
Sedangkan struktur 5-metilcitosin adalah :
C
N
C
N
H
CH
C
NH
2
O
CH
3
5-Metilcitosin
Metilasi citosin dalam DNA maupun RNA mempunyai implikasi biologis penting
yang berkaitan dengan perlindungan material genetik dan ekspresinya.
5-Bromourasil adalah analog dari timin, yang berbeda hanya pada
substituen C-5 (Br menggantikan CH
3
). Kedua macam substituen ini mengisi
ruang yang kurang lebih sama, dan enzim yang bertanggung jawab untuk
membuat DNA dapat mengakomodasi keduanya sehingga memungkinkan 5-
Timin juga bisa digambarkan sebagai 5-metilurasil. Pirimidin
termetilasi lainnya ditemukan dalam sebagian asam nukleat.
Sedangkan struktur 5-metilcitosin adalah.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 209
Penomoran posisi dalam cincin dibuat berdasarkan konvensi (IUPAC).
Pirimidin utama yang ditemukan dalam DNA adalah timin dan citosin.
Sedangkan dalam RNA yakni urasil dan citosin. Ketiga pirimidin ini berbeda
dalam tipe dan posisi gugus kimia yang menempel pada cincin.
Timin adalah 5-metil-2,4-dioksipirimidin.
Citosin adalah 2-oksi-4-aminopirimidin.
Urasil adalah 2,4-dioksipirimidin.
Struktur untuk (a) timin, (b) citosin, dan (c) urasil, adalah sebagai berikut:
C
HN
C
N
H
CH
C
C
N
C
N
H
CH
CH
O
O
CH
3
NH
2
O
C
HN
C
N
H
CH
CH
O
O
Timin Citosin Urasil
Timin juga bisa digambarkan sebagai 5-metilurasil. Pirimidin termetilasi lainnya
ditemukan dalam sebagian asam nukleat.
Sedangkan struktur 5-metilcitosin adalah :
C
N
C
N
H
CH
C
NH
2
O
CH
3
5-Metilcitosin
Metilasi citosin dalam DNA maupun RNA mempunyai implikasi biologis penting
yang berkaitan dengan perlindungan material genetik dan ekspresinya.
5-Bromourasil adalah analog dari timin, yang berbeda hanya pada
substituen C-5 (Br menggantikan CH
3
). Kedua macam substituen ini mengisi
ruang yang kurang lebih sama, dan enzim yang bertanggung jawab untuk
membuat DNA dapat mengakomodasi keduanya sehingga memungkinkan 5-
Metilasi citosin dalam DNA maupun RNA mempunyai implikasi
biologis penting yang berkaitan dengan perlindungan material genetik
dan ekspresinya.
5-Bromourasil adalah analog dari timin, yang berbeda hanya pada
substituen C-5 (Br menggantikan CH3). Kedua macam substituen ini
mengisi ruang yang kurang lebih sama, dan enzim yang bertanggung
jawab untuk membuat DNA dapat mengakomodasi keduanya
sehingga memungkinkan 5-bromourasil masuk ke dalam DNA dalam
beberapa sel dan virus tipe tertentu. Sifat ini bisa dimanfaatkan untuk
mempelajari sintesis DNA.
Bab 5 Asam Nukleat 221
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 210
bromourasil masuk ke dalam DNA dalam beberapa sel dan virus tipe tertentu.
Sifat ini bisa dimanfaatkan untuk mempelajari sintesis DNA.
C
HN
C
N
H
CH
C
O
O
Br
5-Bromourasil
Purin utama yang ditemukan dalam DNA dan RNA adalah adenin dan
guanin. Keduanya memiliki perbedaan dalam tipe dan posisi gugus kimia yang
menempel pada cincin purin, seperti terlihat di bawah ini:
C
N
HC
N
C
C
N
H
CH
N
NH
2
C
HN
C
N
C
C
N
H
CH
N
O
H
2
N
Adenin Guanin
Semua pirimidin maupun purin bisa terdapat dalam bentuk isomer
alternatif yang disebut tautomer. Misalnya, urasil bisa terdapat dalam bentuk
keto atau enol.
C
HN
C
N
H
CH
CH
O
O
C
N
C
N
CH
CH
OH
HO
Keto
Enol
(Panah besar menunjukkan bahwa bentuk keto lebih dipilih pada pH netral).
Bentuk enol dari guanine adalah sebagai berikut:
Purin utama yang ditemukan dalam DNA dan RNA adalah adenin
dan guanin. Keduanya memiliki perbedaan dalam tipe dan posisi gugus
kimia yang menempel pada cincin purin, seperti terlihat di bawah ini:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 210
bromourasil masuk ke dalam DNA dalam beberapa sel dan virus tipe tertentu.
Sifat ini bisa dimanfaatkan untuk mempelajari sintesis DNA.
C
HN
C
N
H
CH
C
O
O
Br
5-Bromourasil
Purin utama yang ditemukan dalam DNA dan RNA adalah adenin dan
guanin. Keduanya memiliki perbedaan dalam tipe dan posisi gugus kimia yang
menempel pada cincin purin, seperti terlihat di bawah ini:
C
N
HC
N
C
C
N
H
CH
N
NH
2
C
HN
C
N
C
C
N
H
CH
N
O
H
2
N
Adenin Guanin
Semua pirimidin maupun purin bisa terdapat dalam bentuk isomer
alternatif yang disebut tautomer. Misalnya, urasil bisa terdapat dalam bentuk
keto atau enol.
C
HN
C
N
H
CH
CH
O
O
C
N
C
N
CH
CH
OH
HO
Keto
Enol
(Panah besar menunjukkan bahwa bentuk keto lebih dipilih pada pH netral).
Bentuk enol dari guanine adalah sebagai berikut:
Semua pirimidin maupun purin bisa terdapat dalam bentuk
isomer alternatif yang disebut tautomer. Misalnya, urasil bisa terdapat
dalam bentuk keto atau enol.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 210
bromourasil masuk ke dalam DNA dalam beberapa sel dan virus tipe tertentu.
Sifat ini bisa dimanfaatkan untuk mempelajari sintesis DNA.
C
HN
C
N
H
CH
C
O
O
Br
5-Bromourasil
Purin utama yang ditemukan dalam DNA dan RNA adalah adenin dan
guanin. Keduanya memiliki perbedaan dalam tipe dan posisi gugus kimia yang
menempel pada cincin purin, seperti terlihat di bawah ini:
C
N
HC
N
C
C
N
H
CH
N
NH
2
C
HN
C
N
C
C
N
H
CH
N
O
H
2
N
Adenin Guanin
Semua pirimidin maupun purin bisa terdapat dalam bentuk isomer
alternatif yang disebut tautomer. Misalnya, urasil bisa terdapat dalam bentuk
keto atau enol.
C
HN
C
N
H
CH
CH
O
O
C
N
C
N
CH
CH
OH
HO
Keto
Enol
(Panah besar menunjukkan bahwa bentuk keto lebih dipilih pada pH netral).
Bentuk enol dari guanine adalah sebagai berikut:
BIOKIMIA: Struktur dan Fungsi Biomolekul 222
(Panah besar menunjukkan bahwa bentuk keto lebih dipilih pada pH netral).
Bentuk enol dari guanine adalah sebagai berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 211
C
N
C
N
C
C
N
H
CH
N
OH
NH
2
Guanin dalam bentuk enol
Adenin tidak bisa ditulis dalam bentuk enol, karena adenin tidak memiliki gugus
keto. Namun demikian, adenin bisa berisomerisasi menjadi bentuk tautomer
imino, tetapi bentuk amino lebih mendominasi.
Gula dalam DNA adalah 2-deoksi-D-ribosa, sedangkan dalam RNA yakni D-
ribosa.
Bentuk gula seperti terdapat dalam DNA dan RNA adalah sebagai berikut:
C
H
OH
H
HOCH
2
OH
H
H C C
C
H
O
1
2 3
4
5
C
H
OH
H
HOCH
2
OH
OH
H C C
C
H
O
1
2 3
4
5
2-Deoksi--D-ribosa
(2-deoksi--D-ribofuranosa)
-D-Ribosa
(-D-ribofuranosa)
Perhatikan bahwa dalam asam nukleat hanya terdapat anomer .
3. NUKLEOSIDA
Di dalam struktur asam nukleat, pirimidin atau purin berikatan dengan
gula (2-deoksi-D-ribosa atau D-ribosa) membentuk suatu nukleosida.
Nukleosida yang mengandung deoksiribosa disebut deoksiribonukleosida, dan
yang mengandung ribosa disebut ribonukleosida. Nukleosida purin memiliki
ikatan -glikosida dari N-9 pada basa ke C-1 pada gula. Dalam nukleosida
pirimidin, ikatan ini yakni dari N-1 pada basa ke C-1 pada gula.
Berikut ini digambarkan struktur dari ribonukleosida yang mengandung
adenin, dan deoksiribonukleosida yang mengandung citosin.
Adenin tidak bisa ditulis dalam bentuk enol, karena adenin tidak
memiliki gugus keto. Namun demikian, adenin bisa berisomerisasi
menjadi bentuk tautomer imino, tetapi bentuk amino lebih
mendominasi.
Gula dalam DNA adalah 2-deoksi-D-ribosa, sedangkan dalam
RNA yakni D-ribosa.
Bentuk gula seperti terdapat dalam DNA dan RNA adalah sebagai
berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 211
C
N
C
N
C
C
N
H
CH
N
OH
NH
2
Guanin dalam bentuk enol
Adenin tidak bisa ditulis dalam bentuk enol, karena adenin tidak memiliki gugus
keto. Namun demikian, adenin bisa berisomerisasi menjadi bentuk tautomer
imino, tetapi bentuk amino lebih mendominasi.
Gula dalam DNA adalah 2-deoksi-D-ribosa, sedangkan dalam RNA yakni D-
ribosa.
Bentuk gula seperti terdapat dalam DNA dan RNA adalah sebagai berikut:
C
H
OH
H
HOCH
2
OH
H
H C C
C
H
O
1
2 3
4
5
C
H
OH
H
HOCH
2
OH
OH
H C C
C
H
O
1
2 3
4
5
2-Deoksi--D-ribosa
(2-deoksi--D-ribofuranosa)
-D-Ribosa
(-D-ribofuranosa)
Perhatikan bahwa dalam asam nukleat hanya terdapat anomer .
3. NUKLEOSIDA
Di dalam struktur asam nukleat, pirimidin atau purin berikatan dengan
gula (2-deoksi-D-ribosa atau D-ribosa) membentuk suatu nukleosida.
Nukleosida yang mengandung deoksiribosa disebut deoksiribonukleosida, dan
yang mengandung ribosa disebut ribonukleosida. Nukleosida purin memiliki
ikatan -glikosida dari N-9 pada basa ke C-1 pada gula. Dalam nukleosida
pirimidin, ikatan ini yakni dari N-1 pada basa ke C-1 pada gula.
Berikut ini digambarkan struktur dari ribonukleosida yang mengandung
adenin, dan deoksiribonukleosida yang mengandung citosin.
Perhatikan bahwa dalam asam nukleat hanya terdapat anomer b.
3. NUKLEOSIDA
Di dalam struktur asam nukleat, pirimidin atau purin berikatan dengan
gula (2-deoksi-D-ribosa atau D-ribosa) membentuk suatu nukleosida.
Bab 5 Asam Nukleat 223
Nukleosida yang mengandung deoksiribosa disebut deoksiribonukleosida,
dan yang mengandung ribosa disebut ribonukleosida. Nukleosida purin
memiliki ikatan b-glikosida dari N-9 pada basa ke C-1 pada gula. Dalam
nukleosida pirimidin, ikatan ini yakni dari N-1 pada basa ke C-1 pada
gula.
Berikut ini digambarkan struktur dari ribonukleosida yang men-
gandung adenin, dan deoksiribonukleosida yang mengandung citosin.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 212
C
H
H
HOCH
2
OH
OH
H C C
C
H
O
1'
2' 3'
4'
5'
C
N
HC
N
C
C
N
CH
N
NH
2
C
H
H
HOCH
2
OH
H
H C C
C
H
O
1'
2' 3'
4'
5'
C
N
C
N
CH
CH
NH
2
O
(a) 9--D-Ribofuranosil
adenin (adenosin)
(b) 1,2'-Deoksi--D-ribofuranosil
citosin (deoksicitidin)
Oleh karena ikatan glikosida menuju ke nitrogen pada pirimidin atau
purin, maka nukleosida-nukleosida ini disebut N-glikosida. Atom-atom dalam
cincin furanosa pada gula ditandai dengan 1, 2, , 5 untuk membedakannya
dengan atom-atom dalam cincin basa. Penamaan akan lebih mudah bila
menggunakan istilah sederhana, yakni:
Adenin berikatan pada ribosa adenosin
Urasil berikatan pada ribosa uridin
Guanin berikatan pada ribosa guanosin
Guanin berikatan pada deoksiribosa deoksiguanosin
Citosin berikatan pada deoksiribosa deoksicitidin
Timin berikatan pada deoksiribosa deoksitimidin
Struktur dari deoksiguanosin dan citidin adalah sebagai berikut:
Oleh karena ikatan glikosida menuju ke nitrogen pada pirimidin
atau purin, maka nukleosida-nukleosida ini disebut N-glikosida.
Atom-atom dalam cincin furanosa pada gula ditandai dengan 1, 2,
, 5 untuk membedakannya dengan atom-atom dalam cincin basa.
Penamaan akan lebih mudah bila menggunakan istilah sederhana,
yakni:
Adenin berikatan pada ribosa adenosin
Urasil berikatan pada ribosa uridin
Guanin berikatan pada ribosa guanosin
Guanin berikatan pada deoksiribosa deoksiguanosin
Citosin berikatan pada deoksiribosa deoksicitidin
Timin berikatan pada deoksiribosa deoksitimidin
BIOKIMIA: Struktur dan Fungsi Biomolekul 224
Struktur dari deoksiguanosin dan citidin adalah sebagai berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 213
C
H
H
HOCH
2
OH
H
H C C
C
H
O
C
HN
C
N
C
C
N
CH
N
O
NH
2
C
H
H
HOCH
2
OH
OH
H C C
C
H
O
C
N
C
N
CH
CH
NH
2
O
(a) Deoksiguanosin
(b) Citidin
4. NUKLEOTIDA
Nukleotida adalah ester asam fosfat dari nukleosida, dengan fosfat
pada posisi C-5. Nukleotida dengan fosforilasi pada posisi lain telah diketahui,
tetapi bukan merupakan komponen asam nukleat. Nukleotida yang
mengandung deoksiribosa disebut deoksiribonukleotida, sedangkan yang
mengandung ribosa disebut sebagai ribonukleotida. Berikut gambar backbone
(tulang punggung) dari nukleotida:
4. NUKLEOTIDA
Nukleotida adalah ester asam fosfat dari nukleosida, dengan fosfat
pada posisi C-5. Nukleotida dengan fosforilasi pada posisi lain telah
diketahui, tetapi bukan merupakan komponen asam nukleat. Nukleotida
yang mengandung deoksiribosa disebut deoksiribonukleotida, sedangkan
yang mengandung ribosa disebut sebagai ribonukleotida. Berikut
gambar backbone (tulang punggung) dari nukleotida:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 214
C
H
H
OCH
2
OH
OH
H C C
C
H
O
C
N
HC
N
C
C
N
CH
N
NH
2
P HO
OH
O
5'
(a) Adenosin 5'-fosfat (AMP)
C
H
H
OCH
2
OH
H
H C C
C
H
O
5'
C
HN
C
N
CH
C
O
O
CH
3
P HO
OH
O
(b) Deoksitimidin 5'-fosfat (dTMP)
Sedangkan struktur dari ribonukleotida yang mengandung adenin, dan
deoksiribonukleotida yang mengandung timin adalah sebagai berikut:
Unit
nukleotida
Bab 5 Asam Nukleat 225
Sedangkan struktur dari ribonukleotida yang mengandung adenin,
dan deoksiribonukleotida yang mengandung timin adalah sebagai beri-
kut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 214
C
H
H
OCH
2
OH
OH
H C C
C
H
O
C
N
HC
N
C
C
N
CH
N
NH
2
P HO
OH
O
5'
(a) Adenosin 5'-fosfat (AMP)
C
H
H
OCH
2
OH
H
H C C
C
H
O
5'
C
HN
C
N
CH
C
O
O
CH
3
P HO
OH
O
(b) Deoksitimidin 5'-fosfat (dTMP)
Sedangkan struktur dari ribonukleotida yang mengandung adenin, dan
deoksiribonukleotida yang mengandung timin adalah sebagai berikut:
Unit
nukleotida
Adenosin 5-fosfat juga dikenal sebagai AMP (adenosin
monofosfat) atau asam adenilat. Jika deoksiribosa menggantikan ribosa
dalam adenosin 5-fosfat, maka istilahnya menjadi dAMP atau asam
deoksiadenilat. Singkatan nama untuk beberapa ribonukleotida dan
deoksiribonukleotida ditulis dalam daftar di bawah ini.
Basa Ribonukleotida Deoksiribonukleotida
Adenin, A Asam adenilat, AMP Asam deoksiadenilat, dAMP
Guanin, G Asam guanilat, GMP Asam deoksiguanilat, dGMP
Citosin, C Asam citidilat, CMP Asam deoksicitidilat, dCMP
Urasil, U Asam uridilat, UMP Asam deoksiuridilat, dUMP
Timin, T Asam timidilat, TMP Asam deoksitimidilat, dTMP
Istilah di atas menunjukkan bahwa nukleotida merupakan suatu
asam. Sifat ini berasal dari ionisasi fosfat primer, yang memiliki nilai
pKa sekitar 1. karena itu nukleotida memiliki muatan negatif pada pH
netral. Muatan negatif ini juga disumbang oleh ionisasi fosfat sekunder,
yang memiliki nilai pKa sekitar 6. Pada pH netral, tidak ada muatan
pada basa apapun.
BIOKIMIA: Struktur dan Fungsi Biomolekul 226
Struktur AMP pada pH 7 dalam bentuk bermuatan adalah:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 215
Adenosin 5-fosfat juga dikenal sebagai AMP (adenosin monofosfat)
atau asam adenilat. Jika deoksiribosa menggantikan ribosa dalam adenosin 5-
fosfat, maka istilahnya menjadi dAMP atau asam deoksiadenilat. Singkatan
nama untuk beberapa ribonukleotida dan deoksiribonukleotida ditulis dalam
daftar di bawah ini.
Basa Ribonukleotida Deoksiribonukleotida
Adenin, A Asam adenilat, AMP Asam deoksiadenilat, dAMP
Guanin, G Asam guanilat, GMP Asam deoksiguanilat, dGMP
Citosin, C Asam citidilat, CMP Asam deoksicitidilat, dCMP
Urasil, U Asam uridilat, UMP Asam deoksiuridilat, dUMP
Timin, T Asam timidilat, TMP Asam deoksitimidilat, dTMP
Istilah di atas menunjukkan bahwa nukleotida merupakan suatu asam.
Sifat ini berasal dari ionisasi fosfat primer, yang memiliki nilai pK
a
sekitar 1.
karena itu nukleotida memiliki muatan negatif pada pH netral. Muatan negatif
ini juga disumbang oleh ionisasi fosfat sekunder, yang memiliki nilai pK
a
sekitar
6. Pada pH netral, tidak ada muatan pada basa apapun.
Struktur AMP pada pH 7 dalam bentuk bermuatan adalah:
C
H
H
H
2
C
OH
OH
H C C
C
H
O
O P
-
O
O
-
O
A
AMP (bentuk bermuatan)
Perhatikan bahwa dua muatan negatif berada pada fosfat. Dalam struktur ini, A
menggambarkan adenin, yang tidak memiliki muatan apapun.
Semua 5-nukleotida juga terdapat sebagai 5-difosfat dan 5trifosfat, yang
memiliki dua dan tiga fosfat. Adenosin 5-nukleotida yang bersesuaian dengan
kedua molekul tersebut dikenal sebagai ADP dan ATP.
Struktur Adenosin Trifosfat adalah seperti yang digambarkan berikut:
Perhatikan bahwa dua muatan negatif berada pada fosfat. Dalam
struktur ini, A menggambarkan adenin, yang tidak memiliki muatan
apapun.
Semua 5-nukleotida juga terdapat sebagai 5-difosfat dan 5trifosfat,
yang memiliki dua dan tiga fosfat. Adenosin 5-nukleotida yang
bersesuaian dengan kedua molekul tersebut dikenal sebagai ADP dan
ATP.
Struktur Adenosin Trifosfat adalah seperti yang digambarkan berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 216
C
H
H
H
2
C
OH
OH
H C C
C
H
O
O P

O
OH
O
A
P

O P

HO
OH
O
OH
O
5'
ATP
Perhatikan bahwa molekul di atas digambarkan dalam bentuk tak
bermuatan. Atom fosfor ditandai dengan , , dan , dengan fosfor
menempel pada C 5 dari ribosa. ADP hanya memiliki fosfat dan .
Pada pH netral, ATP mempunyai muatan total negatif, yakni antara 2
sampai 4. Hal ini dikarenakan ATP (dan semua nukleosida trifosfat) bisa
melepaskan empat proton dari gugus fosfat. Yang pertama memiliki nilai pK
a
~1, yang kedua, ketiga, dan keempat bernilai antara 6 sampai 7.
Ribonukleosida di- dan trifosfat (NDP, NTP) maupun
deoksiribonukleosida di- dan trifosfat (dNDP, dNTP) memiliki fungsi penting
dalam sel. Molekul-molekul ini bekerja sebagai pembawa energi dalam
berbagai reaksi, serta sebagai prekursor untuk sintesis asam nukleat.
5. POLINUKLEOTIDA
Asam nukleat DNA maupun RNA merupakan polinukleotida, yakni
merupakan polimer dari berbagai tipe nukleotida (sebagai subunit yang
berulang). Nukleotida-nukleotida ini bergabung satu sama lain melalui ikatan
fosfodiester antara C 3 pada satu nukleotida dengan C 5 pada nukleotida
sebelahnya. Ikatan ini terjadi berulang-ulang untuk membangun struktur besar
(rantai atau untai) yang mengandung ratusan sampai jutaan nukleotida di dalam
suatu molekul tunggal raksasa.
Bab 5 Asam Nukleat 227
Perhatikan bahwa molekul di atas digambarkan dalam bentuk tak
bermuatan. Atom fosfor ditandai dengan a, b, dan g, dengan fosfor a
menempel pada C 5 dari ribosa. ADP hanya memiliki fosfat a dan b.
Pada pH netral, ATP mempunyai muatan total negatif, yakni
antara 2 sampai 4. Hal ini dikarenakan ATP (dan semua nukleosida
trifosfat) bisa melepaskan empat proton dari gugus fosfat. Yang pertama
memiliki nilai pKa ~1, yang kedua, ketiga, dan keempat bernilai antara
6 sampai 7.
Ribonukleosida di- dan trifosfat (NDP, NTP) maupun deoksiri-
bonukleosida di- dan trifosfat (dNDP, dNTP) memiliki fungsi penting
dalam sel. Molekul-molekul ini bekerja sebagai pembawa energi dalam
berbagai reaksi, serta sebagai prekursor untuk sintesis asam nukleat.
5. POLINUKLEOTIDA
Asam nukleat DNA maupun RNA merupakan polinukleotida, yakni
merupakan polimer dari berbagai tipe nukleotida (sebagai subunit
yang berulang). Nukleotida-nukleotida ini bergabung satu sama lain
melalui ikatan fosfodiester antara C 3 pada satu nukleotida dengan C
5 pada nukleotida sebelahnya. Ikatan ini terjadi berulang-ulang untuk
membangun struktur besar (rantai atau untai) yang mengandung
ratusan sampai jutaan nukleotida di dalam suatu molekul tunggal
raksasa.
Berikut ini adalah struktur suatu bagian rantai poliribonukleotida
(RNA) yang mengandung adenin, guanin, dan citosin.
BIOKIMIA: Struktur dan Fungsi Biomolekul 228
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 217
Berikut ini adalah struktur suatu bagian rantai poliribonukleotida (RNA)
yang mengandung adenin, guanin, dan citosin.
H
H
H
2
C
O
OH
H H
O
Adenin
O
P
O
O
-
O
P
O
O
-
O
1'
2'
3'
4'
5'
H
H
H
2
C
O
OH
H H
O
Guanin
P
O
O
-
O
1'
2'
3'
4'
5'
H
H
H
2
C
O
OH
H H
O
Citosin
P
O
O
-
O
1'
2'
3'
4'
5'
5'
3'
Arah rantai
Perhatikan bahwa struktur di atas ditulis dalam bentuk bermuatan.
Ikatan fosfodiester menggabungkan karbon-karbon yang berbeda yakni 3 dan
5 pada nukleotida-nukleotida yang bersebelahan. Hal ini menyebabkan rantai
tersebut memiliki arah kimia, atau polaritas. Menurut konvensi, struktur yang
digambarkan di atas memiliki arah 5 3 ke arah bawah (atau 3 5 ke arah
Perhatikan bahwa struktur di atas ditulis dalam bentuk bermuatan.
Ikatan fosfodiester menggabungkan karbon-karbon yang berbeda
yakni 3 dan 5 pada nukleotida-nukleotida yang bersebelahan. Hal
ini menyebabkan rantai tersebut memiliki arah kimia, atau polaritas.
Menurut konvensi, struktur yang digambarkan di atas memiliki arah
5 3 ke arah bawah (atau 3 5 ke arah atas). Berdasarkan konvensi,
semua urutan nukleotida ditulis dalam arah 5 3. Dengan demikian,
Bab 5 Asam Nukleat 229
bagian yang diperlihatkan di atas memiliki urutan adenin, guanin,
citosin; yang disingkat AGC. Untuk menunjukkan terdapatnya fosfat
yang menempel pada ujung 5 dan 3 dalam struktur di atas, akan lebih
tepat dituliskan pApGpCp. Bentuk singkatan ini tidak menunjukkan
bahwa urutan tiga nukleotida tersebut hanyalah bagian dari struktur
yang jauh lebih panjang, karena pApGpCp bisa jadi merupakan suatu
molekul yang hanya memiliki tiga unit nukleotida (trinukleotida)
dengan ujung 5 dan 3 yang terfosforilasi. Jika urutan AGC terdapat
dalam suatu polideoksinukleotida, maka struktur tersebut ditulis dalam
bentuk singkatan d-pApGpCp atau dAGC.
Sedangkan struktur dinukleotida d-ApTp adalah sebagai berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 218
atas). Berdasarkan konvensi, semua urutan nukleotida ditulis dalam arah 5
3. Dengan demikian, bagian yang diperlihatkan di atas memiliki urutan adenin,
guanin, citosin; yang disingkat AGC. Untuk menunjukkan terdapatnya fosfat
yang menempel pada ujung 5 dan 3 dalam struktur di atas, akan lebih tepat
dituliskan pApGpCp. Bentuk singkatan ini tidak menunjukkan bahwa urutan
tiga nukleotida tersebut hanyalah bagian dari struktur yang jauh lebih panjang,
karena pApGpCp bisa jadi merupakan suatu molekul yang hanya memiliki tiga
unit nukleotida (trinukleotida) dengan ujung 5 dan 3 yang terfosforilasi. Jika
urutan AGC terdapat dalam suatu polideoksinukleotida, maka struktur tersebut
ditulis dalam bentuk singkatan d-pApGpCp atau dAGC.
Sedangkan struktur dinukleotida d-ApTp adalah sebagai berikut:
H
H
HOH
2
C
O
H
H H
O
Adenin
P
O
O
-
O
1'
2'
3'
4'
5'
H
H
H
2
C
O
H
H H
O
Timin
P
O
-
O
-
O
1'
2'
3'
4'
5'
Perhatikan bahwa tidak terdapat fosfat pada ujung 5, dan adanya deoksiribosa.
Bentuk singkat lain yang umum digunakan untuk menggambarkan struktur ini
adalah
Perhatikan bahwa tidak terdapat fosfat pada ujung 5, dan adanya
deoksiribosa. Bentuk singkat lain yang umum digunakan untuk
menggambarkan struktur ini adalah
BIOKIMIA: Struktur dan Fungsi Biomolekul 230
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 219
P
HO P
A
T
5' 3'
3'
3'
Perhatikan bahwa bentuk singkat di atas tidak menggambarkan sifat gula.
Sedangkan struktur pApUpGpCpApCp dalam bentuk singkat adalah sebagai
berikut:
P
P P P P
P
A U
G C A
C
5'
3'
P
3'
3' 3' 3'
3'
5'
5' 5'
5'
5'
Struktur ini memiliki enam unit nukleotida sehingga disebut sebagai suatu
heksanukleotida. Istilah umum untuk struktur yang mengandung beberapa
nukleotida (10 atau kurang) adalah oligonukleotida.
6. STRUKTUR DNA
DNA merupakan suatu polideoksinukleotida yang termasuk
makromolekul biologis yang paling besar. Sebagian molekul DNA terdiri atas
lebih dari 10
8
nukleotida. DNA mengandung adenin, timin, guanin, dan citosin
sebagai basa. Informasi genetik dikode di dalam urutan nukleotida DNA, yang
ditentukan dengan tepat sepanjang molekul tersebut. Salah satu metoda paling
sederhana untuk menentukan urutan nukleotida dari DNA adalah dengan
menggunakan enzim DNA polimerase yang mengkatalisis sintesis DNA.
Komposisi basa DNA dari berbagai spesies telah berhasil ditentukan.
Komposisi ini bervariasi satu dengan lainnya (Lihat tabel 5-1 berikut ini).
Perhatikan bahwa bentuk singkat di atas tidak menggambarkan
sifat gula. Sedangkan struktur pApUpGpCpApCp dalam bentuk
singkat adalah sebagai berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 219
P
HO P
A
T
5' 3'
3'
3'
Perhatikan bahwa bentuk singkat di atas tidak menggambarkan sifat gula.
Sedangkan struktur pApUpGpCpApCp dalam bentuk singkat adalah sebagai
berikut:
P
P P P P
P
A U
G C A
C
5'
3'
P
3'
3' 3' 3'
3'
5'
5' 5'
5'
5'
Struktur ini memiliki enam unit nukleotida sehingga disebut sebagai suatu
heksanukleotida. Istilah umum untuk struktur yang mengandung beberapa
nukleotida (10 atau kurang) adalah oligonukleotida.
6. STRUKTUR DNA
DNA merupakan suatu polideoksinukleotida yang termasuk
makromolekul biologis yang paling besar. Sebagian molekul DNA terdiri atas
lebih dari 10
8
nukleotida. DNA mengandung adenin, timin, guanin, dan citosin
sebagai basa. Informasi genetik dikode di dalam urutan nukleotida DNA, yang
ditentukan dengan tepat sepanjang molekul tersebut. Salah satu metoda paling
sederhana untuk menentukan urutan nukleotida dari DNA adalah dengan
menggunakan enzim DNA polimerase yang mengkatalisis sintesis DNA.
Komposisi basa DNA dari berbagai spesies telah berhasil ditentukan.
Komposisi ini bervariasi satu dengan lainnya (Lihat tabel 5-1 berikut ini).
Struktur ini memiliki enam unit nukleotida sehingga disebut sebagai
suatu heksanukleotida. Istilah umum untuk struktur yang mengandung
beberapa nukleotida (10 atau kurang) adalah oligonukleotida.
6. STRUKTUR DNA
DNA merupakan suatu polideoksinukleotida yang termasuk makro-
molekul biologis yang paling besar. Sebagian molekul DNA terdiri atas
lebih dari 10
8
nukleotida. DNA mengandung adenin, timin, guanin,
dan citosin sebagai basa. Informasi genetik dikode di dalam urutan nuk-
leotida DNA, yang ditentukan dengan tepat sepanjang molekul terse-
but. Salah satu metode paling sederhana untuk menentukan urutan
Bab 5 Asam Nukleat 231
nukleotida dari DNA adalah dengan menggunakan enzim DNA po-
limerase yang mengkatalisis sintesis DNA.
Komposisi basa DNA dari berbagai spesies telah berhasil
ditentukan. Komposisi ini bervariasi satu dengan lainnya (Lihat tabel
5-1 berikut ini).
Tabel 5-1 Komposisi Basa DNA dalam Berbagai Spesies
Komposisi Basa (mol %)
Spesies G A C T
Sarcina lutea 37,1 13,4 37,1 12,4
Alcaligenes faecalis 33,9 16,5 32,8 16,8
E. coli K12 24,9 26,0 25,2 23,9
Biji gandum 22,7 27,3 22,8* 27,1
Bovine thymus 21,5 28,2 22,5* 27,8
Hati manusia 19,5 30,3 19,9 30,3
Saccharomyces cerevisiae 18,3 31,7 17,4 32,6
Clostridium perfringens 14,0 36,9 12,8 36,3
*Citosin + metilcitosin.
Komposisi basa DNA ginjal manusia adalah sama seperti untuk
hati manusia, yang ditunjukkan dalam tabel 5-1 di atas, karena
komposisi basa DNA merupakan karakteristik dari spesies tertentu
dan tidak bervariasi antara satu tipe sel dengan tipe sel lainnya. Hal ini
menunjukkan fakta bahwa urutan nukleotida dan informasi genetiknya
pada tiap tipe sel di dalam suatu organisme adalah persis sama. Akan
tetapi, informasi ini diekspresikan secara berbeda-beda dalam berbagai
tipe sel dari suatu organisme.
Perbandingan purin (A + G) terhadap pirimidin (T + C) adalah
hampir sama di semua spesies. Mungkin yang lebih luar biasa adalah
bahwa perbandingan A terhadap T dan perbandingan G terhadap C
masing-masing juga hampir sama. Kedua fakta ini menunjukkan corak
struktur yang penting dalam kebanyakan DNA.
BIOKIMIA: Struktur dan Fungsi Biomolekul 232
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 221
N N
H
H
O
N
N
N
N
N
CH
3
O
Gula
H
Gula
T A
(a)
N N
H
H
N
N
O
N
N
N
O
Gula
Gula
H
N
H
H
C G
(b)
diperlihatkan dalam gambar. Terdapat dua ikatan H pada pasangan A : T dan
tiga pada pasangan G : C.
Gambar 5-2 Pasangan Basa dalam DNA. (a) Basa A dari satu nukleotida selalu
berikatan dengan basa T dari nukleotida lainnya, sedangkan (b) basa G
selalu berpasangan dengan basa C. Pasangan A dan T terbentuk
dengan dua ikatan hidrogen, sedangkan pasangan G dan C terbentuk
dengan tiga ikatan hidrogen. Oleh karena itu, pasangan G-C lebih stabil
daripada pasangan A-T.
Gambar 5-2 Pasangan Basa dalam DNA. (a) Basa A dari satu
nukleotida selalu berikatan dengan basa T dari nukleotida lainnya,
sedangkan (b) basa G selalu berpasangan dengan basa C. Pasangan A
dan T terbentuk dengan dua ikatan hidrogen, sedangkan pasangan G
dan C terbentuk dengan tiga ikatan hidrogen. Oleh karena itu, pasangan
G-C lebih stabil daripada pasangan A-T.
DNA merupakan molekul rangkap, yakni dua rantai (atau untai)
polinukleotida dihubungkan satu sama lain melalui pasangan basa
tertentu (Gambar 5-2, dibawah ini). Adenin dalam salah satu untai
berpasangan dengan timin dalam untai yang lain, sedangkan guanin
Bab 5 Asam Nukleat 233
berpasangan dengan citosin. Kedua rantai ini disebut komplementer.
Ini merupakan salah satu hal penting dari usulan Watson dan Crick
mengenai struktur DNA. Ikatan hidrogen terbentuk di antara basa-
basa yang berhadapan di dalam suatu pasangan. Dalam struktur
yang diusulkan oleh Watson dan Crick, pasangan basa A : T dan G
: C kurang lebih planar, dengan ikatan H (garis putus-putus) seperti
diperlihatkan dalam gambar. Terdapat dua ikatan H pada pasangan A :
T dan tiga pada pasangan G : C.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 222
Pasangan basa DNA tersusun di atas satu sama lain, dengan bidang
pasangan basa yang tegak lurus terhadap panjang molekul rangkap tersebut.
Hal ini ditunjukkan dalam diagram struktur tipe tangga pada Gambar 5-3.
P
P
P
P
P
OH
3
1
3
1
3
1
3
1
3
1
5
1
5
1
5
1
5
1
5
1
OH
P
3
1
3
1
5
1
5
1
P
P
3
1
3
1
5
1
5
1
P
P
3
1
5
1
Ujung 5' Ujung 3'
Ujung 3' Ujung 5'
5
1
5
1
3
1
3
1
A
C
T
G
A T
C
A
G
T
Gambar 5-3 Tumpukkan pasangan basa dalam dupleks DNA
Kedua rantai DNA terorientasi dalam arah yang berlawanan. Suatu
model DNA yang menunjukkan pasangan basa antara untai-untai
komplementer dan konsisten dengan data difraksi sinar-x telah dikembangkan
oleh James Dewey Watson dan Francis Crick pada tahun 1953. Dasar struktur
Ujung 5
Ujung 3
Ujung 3
Ujung 5
Gambar 5-3 Tumpukkan pasangan basa dalam dupleks DNA
BIOKIMIA: Struktur dan Fungsi Biomolekul 234
Pasangan basa DNA tersusun di atas satu sama lain, dengan bidang
pasangan basa yang tegak lurus terhadap panjang molekul rangkap
tersebut. Hal ini ditunjukkan dalam diagram struktur tipe tangga pada
Gambar 5-3.
Kedua rantai DNA terorientasi dalam arah yang berlawanan.
Suatu model DNA yang menunjukkan pasangan basa antara untai-
untai komplementer dan konsisten dengan data difraksi sinar-x telah
dikembangkan oleh James Dewey Watson dan Francis Crick pada tahun
1953. Dasar struktur ini adalah membelitnya kedua untai mengelilingi
satu sama lain membentuk suatu untai ganda (heliks ganda, double
heliks). Untuk mendapatkan struktur yang konsisten dengan data yang
tersedia pada saat itu, diperlukan orientasi rantai-rantai komplementer
dalam arah yang berlawanan (Gambar 5-3). Bukti nyata untuk
polaritas berlawanan dalam arah rantai ini didapatkan sekitar 10 tahun
kemudian.
Pembentukan heliks DNA menyumbang kestabilan struktur DNA
keseluruhan. Salah satu efek besar dari pembelitan untai membentuk
heliks adalah menggiring pasangan basa menjadi sangat dekat satu
sama lain. Dalam bentuk B (Gambar 5-4), jarak pasangan basa adalah
0,34 nm (jarak ini disebut rise). Dengan demikian, air dikeluarkan dari
inti hidrofob, dan fosfat bermuatan berada pada permukaan. Interaksi
hidrofob di dalam inti serta ikatan H antara pasangan basa turut
menyumbang kestabilan heliks keseluruhan. Terjadi satu belitan heliks
sempurna di setiap 10 pasang basa atau 3,4 nm. Jarak ini disebut pitch
heliks. Permukaan heliks menunjukkan alur mayor dan alur minor, yang
mengikuti sepanjang belitan molekul untai-ganda. Alur mayor kini
diketahui mengakomodasi interaksi dengan protein yang mengenali dan
mengikat urutan-urutan nukleotida tertentu.
Struktur heliks ganda dalam Gambar 5-4 disebut bentuk B. Data
difraksi sinar-x yang dipakai oleh Watson dan Crick diperoleh dari
serat DNA yang dalam kondisi kelembaban tinggi. Pada kelembaban
yang lebih rendah (<75 persen), serat DNA akan memendek. Hal ini
mengakibatkan perubahan menjadi bentuk A, yang pasangan basanya
tidak tegak lurus terhadap sumbu heliks, melainkan dimiringkan sekitar
Bab 5 Asam Nukleat 235
20
0
, dan jarak pitch memendek menjadi 2,8 nm dengan 11 pasang basa
per putaran. Bentuk-B heliks mendominasi di dalam sel, tetapi molekul
hibrid untai ganda RNA dan DNA/RNA menghasilkan bentuk A
heliks.
Suatu bentuk heliks ganda yang sangat berbeda ditemukan dalam
DNA yang mengandung pertukaran urutan purinpirimidin, terutama
d(CG)n serta d(TG)n. Heliks ini berbentuk heliks tangan-kiri, bukan
heliks tangan-kanan seperti biasanya. Bentuk heliks tangan-kiri ini
dikenal sebagai DNA bentuk Z. Parameter heliks dapat diperbandingkan
seperti dalam Tabel 5.2, sedangkan model ruang untuk DNA bentuk Z
dan bentuk B dapat diperbandingkan dalam Gambar 5-5.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 224
Gambar 5-4 Gambar DNA Heliks ganda (disebut juga bentuk B)
Struktur heliks ganda dalam gambar 5-4 disebut bentuk B. Data
difraksi sinar-x yang dipakai oleh Watson dan Crick diperoleh dari serat DNA
yang dalam kondisi kelembaban tinggi. Pada kelembaban yang lebih rendah
(<75 persen), serat DNA akan memendek. Hal ini mengakibatkan perubahan
menjadi bentuk A, yang pasangan basanya tidak tegak lurus terhadap sumbu
heliks, melainkan dimiringkan sekitar 20
0
, dan jarak pitch memendek menjadi
2,8 nm dengan 11 pasang basa per putaran. Bentuk-B heliks mendominasi di
dalam sel, tetapi molekul hibrid untai ganda RNA dan DNA/RNA menghasilkan
bentuk A heliks.
Suatu bentuk heliks ganda yang sangat berbeda ditemukan dalam
DNA yang mengandung pertukaran urutan purinpirimidin, terutama d(CG)n
Pasangan
Basa
Tulang Punggung
DNA
Pasangan
Basa
Alur Kecil
Alur Besar
Pasanga
n Basa
Tulang Punggung
DNA
Tulang Punggung
DNA
Gambar 5-4 Gambar DNA Heliks ganda (disebut juga bentuk B)
BIOKIMIA: Struktur dan Fungsi Biomolekul 236
Dalam bentuk Z, unit yang berulang adalah suatu dinukleotida
sehingga struktur yang dihasilkan berbentuk tangga zig-zag pada
tulang punggung gula-fosfat, karena itulah dinamakan Z. Mungkin
saja DNA bentuk Z ini memiliki peran biologis yang penting, tetapi
sampai saat ini hal tersebut belum pasti. Urutan d(TG)n dengan n>25
biasa ditemukan dalam DNA eukariot (10
5
salinan dalam genom
manusia), tetapi tidak terlihat dalam bentuk Z in vivo.
Tabel 5-2 Perbandingan Heliks-heliks DNA
Parameter Heliks A-DNA B-DNA Z-DNA
Kaidah Kanan Kanan Kiri
Pasang basa per putaran 11 10 12
Rise (nm) 0,29 0,34 0,37
Pitch (nm) 3,2 3,4 3,5
Difraksi sinar-x pada serat DNA hanya dapat menghasilkan data
yang merupakan rata-rata dari pengaruh variasi urutan pada konformasi
DNA. Penelitian dengan resolusi yang lebih tinggi memerlukan analisis
difraksi sinar-x pada kristal DNA tunggal, dan hal ini hanya mungkin
dilakukan dengan sintesis kimia DNA murni yang memiliki panjang
dan urutan tertentu.
Pemeriksaan pada fragmen DNA kristal dari berbagai komposisi
basa menunjukkan variasi bergantung urutan (sequence-dependent)
dalam heliks ganda. Selain itu juga terlihat penekanan bentuk A, B,
dan Z sebagai struktur yang berbeda. Variasi terjadi dalam orientasi
tiap pasang basa ke pasang basa berikutnya oleh rotasi di sekitar sumbu
X atau tilt, sumbu Y atau roll, atau sumbu Z atau twist, pada heliks.
Basa-basa dalam pasangan juga bisa berotasi berlawanan, membentuk
variasi bentuk buckle, propeller, dan opening (gambar 5-6).
Parameter dalam tabel 5.2 merupakan nilai rata-rata. Sebagai
contoh, rata-rata rise untuk bentuk B adalah 0,34 nm, tetapi sebenarnya
nilai ini bervariasi dari 0,25 nm sampai 0,44 nm.
Bab 5 Asam Nukleat 237
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 226
Parameter dalam tabel 5.2 merupakan nilai rata-rata. Sebagai contoh,
rata-rata rise untuk bentuk B adalah 0,34 nm, tetapi sebenarnya nilai ini
bervariasi dari 0,25 nm sampai 0,44 nm.
Gambar 5-5 Bentuk Z dan bentuk B dari DNA
Gambar 5-6 Variasi yang tergantung pada urutan dalam geometri pasangan basa
DNA.
(a) Bentuk Z (b) Bentuk B
Miring Gesper Gulung
Baling-baling Twist
Membuka
Sumbu heliks
Gambar 5-5 Bentuk Z dan bentuk B DNA.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 226
Parameter dalam tabel 5.2 merupakan nilai rata-rata. Sebagai contoh,
rata-rata rise untuk bentuk B adalah 0,34 nm, tetapi sebenarnya nilai ini
bervariasi dari 0,25 nm sampai 0,44 nm.
Gambar 5-5 Bentuk Z dan bentuk B dari DNA
Gambar 5-6 Variasi yang tergantung pada urutan dalam geometri pasangan basa
DNA.
(a) Bentuk Z (b) Bentuk B
Miring Gesper Gulung
Baling-baling Twist
Membuka
Sumbu heliks
Gambar 5-6 Variasi yang tergantung pada urutan dalam geometri
pasangan basa DNA.
BIOKIMIA: Struktur dan Fungsi Biomolekul 238
Rangkaian dAn dengan n = 46 terdapat pada heliks yang berulang
setiap 1011 pasang basa, menimbulkan pelengkungan sumbu heliks
dalam bentuk B. Dengan cara yang sama, urutan berulang purin-
pirimidin-x-x-x-pirimidin-purin-x-x-x dengan x merupakan basa
apapun, juga menimbulkan lengkungan.
Penemuan heliks bentuk Z dihasilkan dari penelitian kristal yang
dibentuk dari urutan dCGCGCG. Bagian dari DNA yang mem-
perlihatkan alternatif urutan purin-pirimidin ini dapat menimbul-
kan pengerutan heliks bentuk B, yang menghasilkan alur minor
lebih dalam. Selain itu, bisa saja terjadi transformasi menjadi heliks
bentuk Z.
Oligonukleotida dapat disintesis dalam laboratorium. Metode
umum untuk sintesis DNA yakni metode fosfit triester (Gambar
5-7). Suatu untai tunggal oligonukleotida dibentuk dengan menciptakan
bagian ikatan diester antara 5-hidroksil pada satu residu dengan 3-
fosfat pada residu berikutnya. 3-Fosfat diaktivasi oleh substitusi dialkil
fosfoamidit (DPA) sehingga mudah bereaksi dengan 5-OH bebas pada
nukleotida pertama. Untuk mencegah pembentukan ikatan yang tak
diinginkan, nukleotida pertama diikat oleh 3-OH pada pendukung
padat (sering dipakai silika gel) dalam suatu kolom atau corong. 5-
OH pada nukleotida kedua dicegah bereaksi oleh gugus dimetoksitritil
(DMT).
Reaksi yang terjadi menghasilkan fosfit triester, yang kemudian di-
oksidasi dengan cara membilas kolom memakai yodium sehingga ter-
bentuk fosfodiester. Setelah itu, gugus DMT dihilangkan dari nukleo-
tida kedua dengan memakai asam asetat 80% (detritilasi), untuk me-
nyiapkan reaksi dengan monomer DPA-teraktivasi berikutnya. Siklus
ini terus berlangsung sampai oligonukleotida terbentuk sempurna.
Metode ini dapat membuat urutan sampai 150 residu.
Pengurutan DNA dilakukan dengan metode pengurutan rantai
terminasi (chain-termination sequencing) yang paling banyak digunakan.
Metode ini disebut juga sebagai metode dideoksi.
Bab 5 Asam Nukleat 239 Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 228
O
Basa
H
H O
H
O DMT
P
H
3
CO
DPA
O
Basa
H
H O
H
O DMT
P
H
3
CO
O
O
Basa
H
H O
H
Pendukung
HO
O
Basa
H
H O
H
Pendukung
O
Basa
H
H O
H
O DMT
P H
3
CO O
O
Basa
H
H O
H
Pendukung
O
O
Basa
H
H O
H
HO
P H
3
CO O
O
Basa
H
H O
H
Pendukung
O
2
2
2
2
1
1
1
1
+ Katalis
Dioksidasi
Detritilasi
5'
Gambar 5-7 Sistesis oligonukleotida fase padat
Pengurutan DNA dilakukan dengan metoda pengurutan rantai
terminasi (chain-termination sequencing) yang paling banyak digunakan.
Metoda ini disebut juga sebagai metoda dideoksi.
7. DENATURASI DNA
Heliks ganda merupakan molekul yang kaku dan diperpanjang. Karena
itulah larutan DNA mempunyai viskositas tinggi. Jika larutan DNA dipanaskan
sampai ~95
0
C, maka viskositasnya akan turun drastis, menandakan terjadinya
kehancuran struktur heliks ganda. Peristiwa ini disebut sebagai denaturasi
yang diiringi dengan pemisahan untai rangkap menjadi untai-untai tunggalnya
yang sedikit fleksibel. Denaturasi dan renaturasi menyediakan informasi
berharga mengenai sifat-sifat penting DNA yang diperoleh dari berbagai
Gambar 5-7 Sistesis oligonukleotida fase padat
7. DENATURASI DNA
Heliks ganda merupakan molekul yang kaku dan diperpanjang. Karena
itulah larutan DNA mempunyai viskositas tinggi. Jika larutan DNA
dipanaskan sampai ~950C, maka viskositasnya akan turun drastis,
menandakan terjadinya kehancuran struktur heliks ganda. Peristiwa
ini disebut sebagai denaturasi yang diiringi dengan pemisahan untai
rangkap menjadi untai-untai tunggalnya yang sedikit fleksibel.
Denaturasi dan renaturasi menyediakan informasi berharga mengenai
BIOKIMIA: Struktur dan Fungsi Biomolekul 240
sifat-sifat penting DNA yang diperoleh dari berbagai sumber.
Denaturasi juga menyediakan dasar pendekatan yang sangat tepat dan
sensitif untuk identifikasi urutan tertentu dalam DNA maupun RNA.
Hal ini merupakan inti dari perkembangan pesat genetika molekul.
Denaturasi bisa dideteksi dengan cepat melalui perubahan viskositas,
tetapi cara lain yang jauh lebih mudah adalah dengan pengukuran absorpsi
ultraviolet (uv). Perbedaan spektrum uv untuk bentuk DNA aslinya
(heliks ganda) dan bentuk terdenaturasi (untai tunggal) diperlihatkan
dalam Gambar 5-8. Pada panjang gelombang absorpsi maksimum (260
nm), absorpsi oleh DNA untai tunggal kira-kira 40 persen lebih tinggi
daripada DNA untai ganda. Hal ini disebut sebagai efek hiperkromat
yang diakibatkan oleh terbongkarnya tumpukan pasangan basa dalam
heliks.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 229
sumber. Denaturasi juga menyediakan dasar pendekatan yang sangat tepat
dan sensitif untuk identifikasi urutan tertentu dalam DNA maupun RNA. Hal ini
merupakan inti dari perkembangan pesat genetika molekul.
Denaturasi bisa dideteksi dengan cepat melalui perubahan viskositas,
tetapi cara lain yang jauh lebih mudah adalah dengan pengukuran absorpsi
ultraviolet (uv). Perbedaan spektrum uv untuk bentuk DNA aslinya (heliks
ganda) dan bentuk terdenaturasi (untai tunggal) diperlihatkan dalam Gambar 5-
8. Pada panjang gelombang absorpsi maksimum (260 nm), absorpsi oleh DNA
untai tunggal kira-kira 40 persen lebih tinggi daripada DNA untai ganda. Hal ini
disebut sebagai efek hiperkromat yang diakibatkan oleh terbongkarnya
tumpukan pasangan basa dalam heliks.
Gambar 5-8 Perbedaan spektra absorbansi uv dalam bentuk native (heliks ganda),
dan bentuk terdenaturasi (untai tunggal).
Heliks DNA distabilkan oleh ikatan H antara pasang-pasang basa
individu dan oleh gaya hidrofob antara pasang-pasang basa yang bertumpuk.
Pereaksi yang bisa mereduksi ikatan H serta menurunkan polaritas medium
A
b
s
o
r
b
a
n
s
i

Untai-
Tunggal
Heliks-
ganda
Panjang gelombang (nm)
Gambar 5-8 Perbedaan spektra absorbansi uv dalam bentuk native
(heliks ganda), dan bentuk terdenaturasi (untai tunggal).
Heliks DNA distabilkan oleh ikatan H antara pasang-pasang
basa individu dan oleh gaya hidrofob antara pasang-pasang basa yang
bertumpuk. Pereaksi yang bisa mereduksi ikatan H serta menurunkan
polaritas medium yang mengelilinginya akan menyebabkan denaturasi,
Bab 5 Asam Nukleat 241
contohnya adalah pereaksi formamida. pH ekstrim yang memberi
muatan pada basa juga efektif untuk mendenaturasi DNA. Karena
itulah pada pH 12 DNA menunjukkan absorpsi (pada 260 nm) 40
persen lebih tinggi daripada bentuk aslinya.
Jika suhu larutan DNA ditingkatkan secara berangsur-angsur, pe-
rubahan menjadi bentuk terdenaturasi bisa dipantau dengan melihat
perubahan absorbansi pada panjang gelombang 260 nm. Hasil peman-
tauan untuk beberapa tipe DNA diperlihatkan dalam Gambar 5-9.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 230
yang mengelilinginya akan menyebabkan denaturasi, contohnya adalah
pereaksi formamida. pH ekstrim yang memberi muatan pada basa juga efektif
untuk mendenaturasi DNA. Karena itulah pada pH 12 DNA menunjukkan
absorpsi (pada 260 nm) 40 persen lebih tinggi daripada bentuk aslinya.
Jika suhu larutan DNA ditingkatkan secara berangsur-angsur,
perubahan menjadi bentuk terdenaturasi bisa dipantau dengan melihat
perubahan absorbansi pada panjang gelombang 260 nm. Hasil pemantauan
untuk beberapa tipe DNA diperlihatkan dalam Gambar 5-9.
Gambar 5-9 Kurva pelelehan untuk DNA pada beberapa jenis spesies.
Kurva dalam gambar 5-9 disebut sebagai kurva pelelehan (melting curves),
karena daerah di atas yang absorbansinya meningkat menandakan robohnya
(atau melelehnya) heliks ganda DNA yang sangat terorganisir dan berbentuk
semikristal. Suhu pada saat terjadi 50 persen pelelehan disebut suhu
pelelehan, atau T
m
.
Selain panas, faktor lain yang mempengaruhi T
m
pada DNA tertentu
adalah pada pH netral, T
m
tergantung pada konsentrasi garam (atau kekuatan
ionik) medium. Kurva yang diperlihatkan dalam Gambar 5-9 diperoleh pada
kekuatan ionik sedikit di atas 0,15. Bila dikurangi 90 persen, maka semua nilai
62 68 74 80
86 92 98
1,0
1,12
1,24
1,36
1,40
Suhu (
0
C)
Pneumococcus
A
b
s
o
r
b
a
n
s

r
e
l
a
t
i
f


p
a
d
a

2
6
0

n
m

S. marcescens
M. phlei
E. coli
Gambar 5-9 Kurva pelelehan untuk DNA pada beberapa jenis spesies.
Kurva dalam gambar 5-9 disebut sebagai kurva pelelehan (melting
curves), karena daerah di atas yang absorbansinya meningkat menan-
dakan robohnya (atau melelehnya) heliks ganda DNA yang sangat ter-
organisir dan berbentuk semikristal. Suhu pada saat terjadi 50 persen
pelelehan disebut suhu pelelehan, atau Tm.
BIOKIMIA: Struktur dan Fungsi Biomolekul 242
Selain panas, faktor lain yang mempengaruhi Tm pada DNA
tertentu adalah pada pH netral, Tm tergantung pada konsentrasi
garam (atau kekuatan ionik) medium. Kurva yang diperlihatkan dalam
Gambar 5-9 diperoleh pada kekuatan ionik sedikit di atas 0,15. Bila
dikurangi 90 persen, maka semua nilai Tm akan turun sekitar 20
0
C.
Nilai ini diakibatkan oleh penambahan muatan negatif dan tolakan
elektrostatik yang lebih besar (yang menambah gangguan pada heliks)
dalam struktur DNA pada kekuatan ionik yang lebih rendah.
DNA dari sumber yang berbeda memiliki nilai Tm yang berbeda
pula. Hal ini dikarenakan DNA-DNA tersebut memiliki jumlah
pasangan basa G : C dan A : T yang berbeda. Pasangan basa G : C
memberikan stabilitas yang lebih besar pada heliks, mungkin melalui
adanya tiga ikatan H di setiap pasangan basa (Gambar 5-1). Dengan
demikian, semakin tinggi kandungan GC maka semakin tinggi pula
nilai Tm. Karena itu, nilai Tm dalam kondisi standar bisa dipakai untuk
mendapatkan perkiraan kandungan G + C dalam DNA tak dikenal.
Hal ini ditunjukkan dalam Gambar 5-10 yang memperlihatkan plot
T
m
terhadap kandungan G + C dalam sejumlah DNA.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 231
T
m
akan turun sekitar 20
0
C. Nilai ini diakibatkan oleh penambahan muatan
negatif dan tolakan elektrostatik yang lebih besar (yang menambah gangguan
pada heliks) dalam struktur DNA pada kekuatan ionik yang lebih rendah.
DNA dari sumber yang berbeda memiliki nilai T
m
yang berbeda pula.
Hal ini dikarenakan DNA-DNA tersebut memiliki jumlah pasangan basa G : C
dan A : T yang berbeda. Pasangan basa G : C memberikan stabilitas yang
lebih besar pada heliks, mungkin melalui adanya tiga ikatan H di setiap
pasangan basa (Gambar 5-1). Dengan demikian, semakin tinggi kandungan
GC maka semakin tinggi pula nilai T
m
. Karena itu, nilai T
m
dalam kondisi
standar bisa dipakai untuk mendapatkan perkiraan kandungan G + C dalam
DNA tak dikenal. Hal ini ditunjukkan dalam Gambar 5-10 yang memperlihatkan
plot T
m
terhadap kandungan G + C dalam sejumlah DNA.
Gambar 5-10 Suhu pelelehan DNA sebagai fungsi dari kandungan G + C
Untai DNA komplementer yang dipisahkan oleh panas akan bergabung
kembali secara spontan ketika suhu diturunkan sampai di bawah nilai T
m
.
Renaturasi ini disebut juga annealing (pendinginan).
T
m
(
0
C)
60 70 80 90 100 110
0
20
40
60
80
100
P
e
r
s
e
n

m
o
l

G

+

C

Gambar 5-10 Suhu pelelehan DNA sebagai fungsi dari
kandungan G + C
Bab 5 Asam Nukleat 243
Untai DNA komplementer yang dipisahkan oleh panas akan
bergabung kembali secara spontan ketika suhu diturunkan sampai di
bawah nilai Tm. Renaturasi ini disebut juga annealing (pendinginan).
Laju renaturasi tergantung pada konsentrasi urutan komplementer.
DNA virus memiliki variasi urutan yang lebih kecil dari pada DNA
bakteri, yang menandakan lebih tingginya tingkatan kompleksitas
genetik dalam bakteri. Untuk fragmen DNA virus dan bakteri dengan
ukuran rata-rata yang sama dan pada konsentrasi molar yang sama,
akan terdapat konsentrasi urutan komplementer yang lebih tinggi
pada fragmen DNA virus. Karena itu DNA virus akan berenaturasi
lebih cepat daripada DNA bakteri. Dengan kata lain, DNA bakteri
mempunyai heterogenitas urutan yang lebih besar.
Laju renaturasi dan heterogenitas urutan (atau kompleksitas)
bisa diperoleh secara kuantitatif melalui analisis COT. Jika C0 adalah
konsentrasi awal DNA (mol per liter DNA fosfat) dan k adalah tetapan
laju untuk penggabungan untai-untai komplementer, maka fraksi f
molekul untai tunggal akan mengalami penurunan seiring dengan
waktu t (s) menurut persamaan berikut:
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 232
Laju renaturasi tergantung pada konsentrasi urutan komplementer.
DNA virus memiliki variasi urutan yang lebih kecil dari pada DNA bakteri, yang
menandakan lebih tingginya tingkatan kompleksitas genetik dalam bakteri.
Untuk fragmen DNA virus dan bakteri dengan ukuran rata-rata yang sama dan
pada konsentrasi molar yang sama, akan terdapat konsentrasi urutan
komplementer yang lebih tinggi pada fragmen DNA virus. Karena itu DNA virus
akan berenaturasi lebih cepat daripada DNA bakteri. Dengan kata lain, DNA
bakteri mempunyai heterogenitas urutan yang lebih besar.
Laju renaturasi dan heterogenitas urutan (atau kompleksitas) bisa
diperoleh secara kuantitatif melalui analisis COT. Jika C
0
adalah konsentrasi
awal DNA (mol per liter DNA fosfat) dan k adalah tetapan laju untuk
penggabungan untai-untai komplementer, maka fraksi f molekul untai tunggal
akan mengalami penurunan seiring dengan waktu t (s) menurut persamaan
berikut:
t kC
f
0
1
1

Hasil analisis COT diplotkan sebagai f terhadap C


0
t. Plot beberapa DNA dalam
kondisi tertentu (ukuran fragmen DNA, suhu, pH, kekuatan ionik) diperlihatkan
dalam Gambar 5-11. Nilai C
0
t pada f = 0,5 disebut sebagai C
0
t
1/2
.
Gambar 5-11 Analisis COT pada berbagai DNA
Tetapan laju k merupakan karakteristik dari DNA tertentu dan berkaitan dengan
kompleksitas komposisi urutannya. C
0
t
1/2
merupakan resiprok dari k sehingga
10
-4
10
-3
10
-2
10
-1
1 10 10
2
10
3
10
4
f
0,5
1,0
Banyak DNA
berulang pada
Tikus
DNA
Virus
DNA
Bakteri
Sedikit terdapat DNA
berulang pada anak sapi
C
o
t (M s)
Hasil analisis COT diplotkan sebagai f terhadap C0t. Plot
beberapa DNA dalam kondisi tertentu (ukuran fragmen DNA, suhu,
pH, kekuatan ionik) diperlihatkan dalam Gambar 5-11. Nilai C0t
pada f = 0,5 disebut sebagai C
0
t
1/2
.
Tetapan laju k merupakan karakteristik dari DNA tertentu dan
berkaitan dengan kompleksitas komposisi urutannya. C
0
t
1/2
merupakan
resiprok dari k sehingga bisa digunakan sebagai ukuran kompleksitas
urutan. Semakin tinggi nilai C
0
t
1/2
maka semakin kompleks DNA
tersebut.
BIOKIMIA: Struktur dan Fungsi Biomolekul 244
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 232
Laju renaturasi tergantung pada konsentrasi urutan komplementer.
DNA virus memiliki variasi urutan yang lebih kecil dari pada DNA bakteri, yang
menandakan lebih tingginya tingkatan kompleksitas genetik dalam bakteri.
Untuk fragmen DNA virus dan bakteri dengan ukuran rata-rata yang sama dan
pada konsentrasi molar yang sama, akan terdapat konsentrasi urutan
komplementer yang lebih tinggi pada fragmen DNA virus. Karena itu DNA virus
akan berenaturasi lebih cepat daripada DNA bakteri. Dengan kata lain, DNA
bakteri mempunyai heterogenitas urutan yang lebih besar.
Laju renaturasi dan heterogenitas urutan (atau kompleksitas) bisa
diperoleh secara kuantitatif melalui analisis COT. Jika C
0
adalah konsentrasi
awal DNA (mol per liter DNA fosfat) dan k adalah tetapan laju untuk
penggabungan untai-untai komplementer, maka fraksi f molekul untai tunggal
akan mengalami penurunan seiring dengan waktu t (s) menurut persamaan
berikut:
t kC
f
0
1
1

Hasil analisis COT diplotkan sebagai f terhadap C


0
t. Plot beberapa DNA dalam
kondisi tertentu (ukuran fragmen DNA, suhu, pH, kekuatan ionik) diperlihatkan
dalam Gambar 5-11. Nilai C
0
t pada f = 0,5 disebut sebagai C
0
t
1/2
.
Gambar 5-11 Analisis COT pada berbagai DNA
Tetapan laju k merupakan karakteristik dari DNA tertentu dan berkaitan dengan
kompleksitas komposisi urutannya. C
0
t
1/2
merupakan resiprok dari k sehingga
10
-4
10
-3
10
-2
10
-1
1 10 10
2
10
3
10
4
f
0,5
1,0
Banyak DNA
berulang pada
Tikus
DNA
Virus
DNA
Bakteri
Sedikit terdapat DNA
berulang pada anak sapi
C
o
t (M s)
Gambar 5-11 Analisis COT pada berbagai DNA
Dalam gambar 5-11, terlihat bahwa highly repeated DNA pada
tikus memiliki C0t1/2 sebesar ~10
-3
M s, yang menunjukkan renaturasi
DNA paling cepat daripada yang lain. Genom tikus mengandung
sekitar 10
6
salinan urutan berulang ~300 pasang basa; hal ini dikenal
sebagai highly repeated DNA. Karena itu, fraksi DNA ini strukturnya
sederhana, dengan konsentrasi molar relatif tinggi, dan mampu
berenaturasi dengan cepat. Kurva paling kanan pada gambar 5-11,
yakni nonrepeated DNA pada thymus anak sapi memiliki nilai C0t1/2
yang sangat tinggi. Nilai ini menandakan penggabungan kembali
salinan-salinan urutan yang unik dalam genom yang cukup kompleks.
Bila DNA total dari sel hewan telah dianalisis dengan analisis COT,
maka biasanya ditemukan kurva tiga-langkah yang berasal dari urutan
highly repeated, moderately repeated, dan nonrepeated (unik). Urutan
unik adalah urutan yang mengkode suatu produk protein. Urutan
highly repeated terdapat dalam daerah sentromer kromosom, yang bisa
terlibat dalam pengenalan kromosom-kromosom. Hanya sedikit yang
diketahui mengenai urutan moderately repeated. DNA virus dan bakteri
tidak menunjukkan banyak langkah dalam analisis COT dan tidak
mengandung urutan highly repeated atau moderately repeated.
Bab 5 Asam Nukleat 245
8. UKURAN, ORGANISASI, DAN TOPOLOGI DNA
Molekul DNA berukuran sangat panjang. Misalnya, DNA dalam sel
bakteri yang berupa satu molekul heliks ganda, bila dibentangkan
akan berukuran sekitar 1.000 kali lebih panjang dari diameter sel itu
sendiri. Molekul ini membawa semua informasi genetik dari sel yang
menggambarkan genom (komplemen tunggal dari material genetik).
Kromosom adalah unit fisik atau unit tersusun yang di dalamnya
terdapat sebagian atau keseluruhan genom. Seluruh genom E. coli
terdapat di dalam satu kromosom, yang berisikan suatu molekul DNA
tunggal berukuran 2,5 x 10
9
Da dan mengandung sekitar 4,6 x 106
pasang basa. Ukuran molekul DNA lebih sering dituliskan dalam
pasangan kilobasa (kilobase pairs), yakni 1 kb = 1.000 pasang basa.
Kromosom E. coli berukuran 4.639 kb. Ciri lain dari kromosom E.
coli yakni molekul tersebut berupa struktur tertutup (atau lingkar)
yang tidak memiliki ujung bebas.
Informasi untuk virus, bakteri, dan eukariot dapat dilihat dalam tabel
di bawah ini.
Organisme Ukuran Genom
(kilobasa)
Kromosom per
Genom
Topologi DNA
Virus
Virus simian 40 (SV40) 5,1 1 Lingkar
Bakteriofag fX174 5,4 1 Lingkar, untai tunggal
Bakteriofag l 48,6 1 Linear
Bakteri Escherichia coli 4.639 1 Lingkar
Eukariot
Ragi 13.500 17 Linear
Manusia 2.900.000 23 Linear
Dalam contoh di atas, terlihat bahwa DNA bakteriofag fX174
merupakan untai tunggal, bukan untai ganda. Dalam hal ini, ukuran
genom dalam kb merupakan jumlah pasang basa dalam bentuk rang-
kap yang ekuivalen. Jumlah informasi dalam genom meningkat mulai
dari virus sederhana sampai eukariot. Sebagai perkiraan kasar, jumlah
BIOKIMIA: Struktur dan Fungsi Biomolekul 246
kilobasa dalam genom virus dan bakteri dapat dianggap ekuivalen den-
gan jumlah gen yang masing-masing mengkode suatu produk protein.
Namun hal ini tidak berlaku untuk eukariot karena adanya urutan basa
yang tidak diekspresikan. Dalam virus dan bakteri (prokariot) banyak
terdapat DNA lingkar. Dalam eukariot biasanya dianggap setiap kro-
mosom berisi molekul linear tunggal DNA heliks ganda.
Molekul DNA yang sangat panjang berkondensasi menjadi struktur
yang lebih padat di dalam kromosom. Dalam eukariot, DNA tidak
terdapat bebas. DNA membentuk kompleks dengan suatu protein basa
yang memiliki massa kurang lebih sama, yang disebut histon. Dahulu
disangka bahwa DNA bakteri tidak membentuk kompleks seperti
itu. Jika histon tidak ada dalam bakteri, maka terdapat bukti adanya
protein mirip histon dalam bakteri yang memungkinkan kondensasi
DNA membentuk nukleoid yang padat.
Terdapat lima tipe histon yang diberi nama H1, H2A, H2B, H3,
dan H4. Histon memiliki berat molekul sedikit rendah (Mr = 11.000
23.000) dan mengandung bagian besar asam amino basa arginin dan
lisin. Distribusi asam-asam amino dalam molekul histon tergolong
unik. Di sepanjang rantai polipeptida tunggalnya, asam amino basa
cenderung berkumpul di setengah bagian, sedangkan setengah bagian
lainnya relatif hidrofob. Selain itu, histon banyak mengandung rantai
samping asam amino modifikasi, misalnya arginin termetilasi dan lisin
terasetilasi.
Kompleks nukleoprotein yang terbentuk disebut kromatin.
Kromatin bisa diisolasi sebagai serat dari inti. Ketika dibentangkan dan
dianalisis menggunakan mikroskop elektron, serat-serat ini tampak
seperti butiran manik-manik pada senar. Kebanyakan histon terdapat
dalam butiran tersebut, yang disebut nukleosom. Butiran nukleosom
terdiri atas suatu rangkaian delapan histon (dua kali dari H2A, H2B,
H3, dan H4) yang dibungkus oleh sekitar 200 pasang basa DNA yang
mengelilinginya. Pencernaan kromatin oleh nuklease menghasilkan
partikel inti yang masih mengandung delapan histon dan hanya
140 pasang basa DNA. Sisa DNA berfungsi sebagai penghubung
antara inti-inti tersebut, dan sepertinya histon H1 bergabung dengan
Bab 5 Asam Nukleat 247
penghubung ini. Struktur partikel inti telah dianalisis oleh difraksi
sinar-x. Gambar 5-12 menunjukkan penataan DNA dengan oktamer
histon. Untuk memadatkan DNA dalam nukleus, nukleosom disusun
menjadi struktur terkondensasi.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 235
mengandung bagian besar asam amino basa arginin dan lisin. Distribusi asam-
asam amino dalam molekul histon tergolong unik. Di sepanjang rantai
polipeptida tunggalnya, asam amino basa cenderung berkumpul di setengah
bagian, sedangkan setengah bagian lainnya relatif hidrofob. Selain itu, histon
banyak mengandung rantai samping asam amino modifikasi, misalnya arginin
termetilasi dan lisin terasetilasi.
Kompleks nukleoprotein yang terbentuk disebut kromatin. Kromatin
bisa diisolasi sebagai serat dari inti. Ketika dibentangkan dan dianalisis
menggunakan mikroskop elektron, serat-serat ini tampak seperti butiran manik-
manik pada senar. Kebanyakan histon terdapat dalam butiran tersebut, yang
disebut nukleosom. Butiran nukleosom terdiri atas suatu rangkaian delapan
histon (dua kali dari H2A, H2B, H3, dan H4) yang dibungkus oleh sekitar 200
pasang basa DNA yang mengelilinginya. Pencernaan kromatin oleh nuklease
menghasilkan partikel inti yang masih mengandung delapan histon dan hanya
140 pasang basa DNA. Sisa DNA berfungsi sebagai penghubung antara inti-
inti tersebut, dan sepertinya histon H1 bergabung dengan penghubung ini.
Struktur partikel inti telah dianalisis oleh difraksi sinar-x. Gambar 5-12
menunjukkan penataan DNA dengan oktamer histon. Untuk memadatkan DNA
dalam nukleus, nukleosom disusun menjadi struktur terkondensasi.
Gambar 5-12 Penyusunan histon dan DNA dalam suatu nukleosom
Inti DNA Penghubung DNA
Penghubung DNA
Histon H1
Histon
H2A, H2B, H3, H4
Gambar 5-12 Penyusunan histon dan DNA dalam suatu nukleosom
Sel bakteri seringkali mengandung molekul DNA tambahan yang
disebut plasmid. Molekul ini relatif kecil (sampai 200 kb), dan terdapat
dalam bentuk lingkar rangkap. Plasmid bisa bereplikasi sendiri dan
tidak tergantung pada kromosom bakteri. Dalam satu sel bisa terdapat
banyak salinan plasmid. Normalnya, plasmid terdapat dalam suatu sel
dalam konformasi supercoiled negatif, sama seperti semua DNA. Sel
eukariot juga bisa mengandung DNA tambahan selain yang terdapat
dalam nukleus. DNA ekstrakromosomal seperti itu terdapat dalam
mitokondria dan kloroplas.
DNA supercoiled adalah heliks ganda DNA yang membelit
dirinya sendiri. Hal ini terjadi dalam DNA lingkar dan dalam DNA
yang dibatasi secara topologi untuk membentuk kompleks dengan
protein. Jika molekul DNA lingkar dalam konformasi rileks (tidak
ada supercoil) diputuskan kedua untainya secara melintang, lalu satu
putaran heliks tangan kanan tambahan atau lebih dimasukkan sebelum
BIOKIMIA: Struktur dan Fungsi Biomolekul 248
penggabungan kembali ujung-ujung untai, maka molekul akan
membelit dirinya sendiri membentuk supercoil positif. Sebaliknya,
jika yang dimasukkan adalah putaran heliks tangan kiri, maka akan
dihasilkan supercoil negatif. Bentuk-bentuk ini disebut topoisomer,
yang diperlihatkan dalam gambar 5-13. Masing-masing supercoil yang
dilukiskan di sini mengandung supertwist tunggal. Jumlah supertwist
dalam suatu molekul bisa sangat besar. DNA supercoiled mudah
diubah menjadi bentuk rileksnya dengan memasukkan suatu retakan
(atau torehan) di antara nukleotida-nukleotida yang bersebelahan
dalam salah satu untai. Bentuk ini tidak lagi dibatasi secara topologi.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 236
Sel bakteri seringkali mengandung molekul DNA tambahan yang
disebut plasmid. Molekul ini relatif kecil (sampai 200 kb), dan terdapat dalam
bentuk lingkar rangkap. Plasmid bisa bereplikasi sendiri dan tidak tergantung
pada kromosom bakteri. Dalam satu sel bisa terdapat banyak salinan plasmid.
Normalnya, plasmid terdapat dalam suatu sel dalam konformasi supercoiled
negatif, sama seperti semua DNA. Sel eukariot juga bisa mengandung DNA
tambahan selain yang terdapat dalam nukleus. DNA ekstrakromosomal seperti
itu terdapat dalam mitokondria dan kloroplas.
DNA supercoiled adalah heliks ganda DNA yang membelit dirinya
sendiri. Hal ini terjadi dalam DNA lingkar dan dalam DNA yang dibatasi secara
topologi untuk membentuk kompleks dengan protein. Jika molekul DNA lingkar
dalam konformasi rileks (tidak ada supercoil) diputuskan kedua untainya secara
melintang, lalu satu putaran heliks tangan kanan tambahan atau lebih
dimasukkan sebelum penggabungan kembali ujung-ujung untai, maka molekul
akan membelit dirinya sendiri membentuk supercoil positif. Sebaliknya, jika
yang dimasukkan adalah putaran heliks tangan kiri, maka akan dihasilkan
supercoil negatif. Bentuk-bentuk ini disebut topoisomer, yang diperlihatkan
dalam gambar 5-13. Masing-masing supercoil yang dilukiskan di sini
mengandung supertwist tunggal. Jumlah supertwist dalam suatu molekul bisa
sangat besar. DNA supercoiled mudah diubah menjadi bentuk rileksnya
dengan memasukkan suatu retakan (atau torehan) di antara nukleotida-
nukleotida yang bersebelahan dalam salah satu untai. Bentuk ini tidak lagi
dibatasi secara topologi.
Gambar 5-13 Bentuk-bentuk topoisomer
Supercoil negatif
Konformasi longgar Supercoil positif
Gambar 5-13 Bentuk-bentuk topoisomer
9. STRUKTUR DAN TIPE RNA
RNA terdiri atas rantai poliribonukleotida yang basa-basanya biasanya
adalah adenin, guanin, urasil, dan citosin. RNA ditemukan dalam
nukleus maupun sitoplasma sel. Variasi bentuk RNA lebih banyak
daripada DNA. RNA memiliki berat molekul antara 25.000 sampai
beberapa juta. Kebanyakan RNA berisi rantai polinukleotida tunggal,
tetapi rantai ini bisa terlipat sedemikian rupa membentuk daerah heliks
ganda yang mengandung pasangan basa A : U dan G : C.
Terdapat tiga tipe utama RNA, yakni transfer RNA (tRNA), ribo-
somal RNA (r@RNA), dan messenger RNA (mRNA). RNA berperan
dalam ekspresi informasi genetik. tRNA (Mr25.000) berfungsi sebagai
suatu adapter dalam sintesis rantai polipeptida. tRNA meliputi 10 20
Bab 5 Asam Nukleat 249
persen total RNA dalam sel. Setidaknya terdapat satu tipe tRNA untuk
setiap tipe asam amino. tRNA memiliki proporsi nukleosida yang rela-
tif tinggi. Nukleosida ini memiliki struktur unik, misalnya adenin, ci-
tosin, guanin, serta urasil yang termetilasi atau terasetilasi. Sebagai con-
toh, struktur pseudouridin dan inosin adalah seperti di bawah ini. Ino-
sin memiliki peranan penting dalam pasangan kodon-antikodon.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 237
9. STRUKTUR DAN TIPE RNA
RNA terdiri atas rantai poliribonukleotida yang basa-basanya biasanya
adalah adenin, guanin, urasil, dan citosin. RNA ditemukan dalam nukleus
maupun sitoplasma sel. Variasi bentuk RNA lebih banyak daripada DNA. RNA
memiliki berat molekul antara 25.000 sampai beberapa juta. Kebanyakan RNA
berisi rantai polinukleotida tunggal, tetapi rantai ini bisa terlipat sedemikian rupa
membentuk daerah heliks ganda yang mengandung pasangan basa A : U dan
G : C.
Terdapat tiga tipe utama RNA, yakni transfer RNA (tRNA), ribosomal
RNA (rRNA), dan messenger RNA (mRNA). RNA berperan dalam ekspresi
informasi genetik. tRNA (M
r
25.000) berfungsi sebagai suatu adapter dalam
sintesis rantai polipeptida. tRNA meliputi 10 20 persen total RNA dalam sel.
Setidaknya terdapat satu tipe tRNA untuk setiap tipe asam amino. tRNA
memiliki proporsi nukleosida yang relatif tinggi. Nukleosida ini memiliki struktur
unik, misalnya adenin, citosin, guanin, serta urasil yang termetilasi atau
terasetilasi. Sebagai contoh, struktur pseudouridin dan inosin adalah seperti di
bawah ini. Inosin memiliki peranan penting dalam pasangan kodon-antikodon.
C
H
H
HOCH
2
OH
OH
H C C
C
H
O
C
HN
C
C
CH
NH
O
O
1
5
Pseudouridin
(5-Ribosilurasil)
C
H
H
HOCH
2
OH
OH
H C C
C
H
O
C
HN
HC
N
C
C
N
CH
N
O
Inosin
rRNA terdapat dalam ribosom, yang mengandung protein yang massanya
kurang lebih sama. rRNA meliputi sekitar 80 persen total RNA dalam sel dan
terdiri atas beberapa tipe. Tipe-tipe RNA bisa dibedakan satu sama lain melalui
rRNA terdapat dalam ribosom, yang mengandung protein yang
massanya kurang lebih sama. rRNA meliputi sekitar 80 persen total
RNA dalam sel dan terdiri atas beberapa tipe. Tipe-tipe RNA bisa
dibedakan satu sama lain melalui laju sedimentasinya dalam suatu
ultrasentrifuga. Sebagai contoh, ribosom bakteri mengandung tiga tipe
RNA: 5S, 16S, dan 23S.
mRNA adalah jenis RNA yang sangat heterogen. Setiap molekul
membawa salinan urutan DNA, yang ditranslasikan dalam sitoplasma
menjadi satu rantai polipeptida atau lebih.
10. NUKLEASE
Nuklease adalah enzim yang mendegradasi asam nukleat dengan
memotong ikatan fosfodiester. Enzim ini ada yang spesifik untuk DNA
BIOKIMIA: Struktur dan Fungsi Biomolekul 250
atau RNA, dan ada juga yang bisa memotong keduanya. Nuklease yang
spesifik untuk DNA disebut deoksiribonuklease (DNase), dan yang
spesifik untuk RNA disebut ribonuklease (RNase).
Nuklease terbagi ke dalam dua kelompok: (1) eksonuklease, dan (2)
endonuklease. Eksonuklease mengikat pada ujung rantai (5 atau 3),
dan memindahkan satu atau beberapa nukleotida. Sebagian molekul
bekerja pada ujung 5 dalam arah 5 3 (5 3 eksonuklease;
sedangkan yang lain (3 5 eksonuklease) mulai pada ujung 3 dan
mendegradasi dalam arah berlawanan. Terdapat beberapa eksonuklease
yang bisa bekerja pada salah satu dari kedua ujung. Eksonuklease tidak
menunjukkan spesifisitas basa atau urutan. Endonuklease tidak hanya
bekerja pada ujung rantai, dan akan mengkatalisis pemotongan rantai
polinukleotida pada satu sisi atau lebih. Seringkali molekul ini spesifik
untuk sisi-sisi tertentu (urutan basa tertentu) di dalam polinukleotida.
Banyak nuklease yang membedakan bentuk asam nukleat untai
tunggal dengan untai ganda, tetapi beberapa nuklease bisa mengkatalisis
atau menghidrolisis keduanya. Contohnya, DNase I (bovin pankreas)
dan DNase II (thymus anak sapi) menghidrolisis kedua bentuk asam
nukleat tersebut. Perbedaan antara kedua enzim ini yakni DNase
I menghasilkan oligonukleotida ujung-P-5 sedangkan DNase II
menghasilkan oligonukleotida ujung-P-3. Enzim nuklease lain, yakni
eksonuklease III (E. coli) yang merupakan 3 5 eksonuklease
memilih DNA untai ganda sebagai substratnya.
Endonuklease restriksi adalah bagian dari sistem kekebalan DNA
dalam bakteri. Enzim ini melindungi sel terhadap masuknya DNA
asing dengan cara mengkatalisis pemotongan untai ganda, sehingga
DNA sel itu sendiri terlindungi. Terdapat tiga tipe endonuklease re-
striksi. Endonuklease restriksi tipe II sangat berguna dalam analisis dan
pembuatan molekul DNA. Enzim ini memotong DNA untai ganda
pada sisi spesifik yang terdiri atas urutan empat sampai delapan nuk-
leotida. Urutan ini bersifat simetri putar lipat dua (twofold rotational
symmetry). Sisi-sisi hasil potongan oleh hampir 300 endonuklease re-
striksi tipe II kini telah ditentukan urutannya, dan banyak potongan
yang disusun overlap pada ujung 3-hidroksil atau 5fosfat. Pengenalan
Bab 5 Asam Nukleat 251
urutan dan sisi pemotongan oleh endonuklease EcoRI yang banyak di-
gunakan adalah seperti di bawah ini. Tanda panah menunjukkan sisi
pemotongan pada tiap untai.
5 G A A T T C
C T T A A G 5
11. DNA REKOMBINAN DAN ISOLASI GEN
Dengan perkembangan teknologi DNA rekombinan, telah dimung-
kinkan untuk mengisolasi segmen DNA tertentu yang terkadang men-
gandung seluruh atau sebagian gen, lalu memeriksa struktur dan sifat-
sifat lainnya secara rinci. Hal ini telah memberikan keuntungan yang
sangat besar untuk pemahaman berbagai aspek replikasi dan ekspresi
material genetik pada tingkat molekul yang sangat terperinci. DNA
rekombinan merupakan molekul yang dibentuk secara buatan yang
mengandung segmen-segmen DNA dari organisme-organisme yang
berbeda. Jika salah satu segmen membawa origin of replication, maka
molekul rekombinan (atau molekul gabungan) memiliki potensi untuk
direplikasi di dalam organisme yang mampu mengenali origin terse-
but. Dalam situasi seperti ini, segmen yang membawa origin (yang me-
mungkinkan terjadinya replikasi) disebut sebagai vektor.
Terdapat beberapa metode yang tersedia untuk membuat molekul
DNA rekombinan. Salah satu pendekatan yang paling banyak digu-
nakan memanfaatkan ujung untai tunggal segmen DNA yang diben-
tuk oleh endonuklease restriksi tipe II seperti EcoRI. Fragmen-fragmen
yang dihasilkan oleh enzim ini mengandung ujung-ujung 5 yang over-
lap. Ujung-ujung untai tunggal pendek ini secara spontan bergabung
satu sama lain dalam kondisi suhu dan kekuatan ionik yang sesuai,
melalui pemasangan basa komplementer. Proses ini disebut annealing
BIOKIMIA: Struktur dan Fungsi Biomolekul 252
(Gambar 5-14). Molekul yang bergabung kembali ini diikat melalui
empat pasang basa, tetapi terdapat nick pada setiap untai. Nick ini bisa
di gabung kembali oleh DNA ligase.
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 240
tersebut. Dalam situasi seperti ini, segmen yang membawa origin (yang
memungkinkan terjadinya replikasi) disebut sebagai vektor.
Terdapat beberapa metode yang tersedia untuk membuat molekul DNA
rekombinan. Salah satu pendekatan yang paling banyak digunakan
memanfaatkan ujung untai tunggal segmen DNA yang dibentuk oleh
endonuklease restriksi tipe II seperti EcoRI. Fragmen-fragmen yang dihasilkan
oleh enzim ini mengandung ujung-ujung 5 yang overlap. Ujung-ujung untai
tunggal pendek ini secara spontan bergabung satu sama lain dalam kondisi
suhu dan kekuatan ionik yang sesuai, melalui pemasangan basa
komplementer. Proses ini disebut annealing (Gambar 5-14). Molekul yang
bergabung kembali ini diikat melalui empat pasang basa, tetapi terdapat nick
pada setiap untai. Nick ini bisa di gabung kembali oleh DNA ligase.
Gambar 5-14 Pemanjangan DNA melalui pasangan basa yang ujungnya
overlapping yang dilakukan oleh EcoRI.
Vektor yang sering digunakan yakni plasmid bakteri. Plasmid ini
merupakan molekul DNA lingkar kecil berukuran 3 100 kb. Bentuk lingkar
sangat penting untuk replikasinya. Jika suatu plasmid dipotong secara
enzimatik hanya pada satu sisi oleh misalnya EcoRI, maka fragmen linear yang
diperoleh bisa di-anneal oleh fragmen yang telah dibentuk dengan memotong
DNA lain dengan EcoRI. Proses ini menghasilkan molekul gabungan lingkar
yang disegel oleh DNA ligase. Molekul gabungan lingkar ini kemudian
dimasukkan ke dalam inang yang sesuai, misalnya E. coli melalui suatu proses
yang disebut sebagai transformasi. Proses ini melibatkan reaksi sel bakteri
dengan CaCl
2
pada suhu rendah (untuk memungkinkan pengambilan DNA),
G A A T T C
C T T A A G
5
G
C T T A A
A A T T C
G
+
5
5
5
5
5
3
3
3
3
3
3
EcoRI
Annealing
Gambar 5-14 Pemanjangan DNA melalui pasangan basa yang ujungnya
overlapping yang dilakukan oleh EcoRI.
Vektor yang sering digunakan yakni plasmid bakteri. Plasmid
ini merupakan molekul DNA lingkar kecil berukuran 3 100 kb.
Bentuk lingkar sangat penting untuk replikasinya. Jika suatu plasmid
dipotong secara enzimatik hanya pada satu sisi oleh misalnya EcoRI,
maka fragmen linear yang diperoleh bisa di-anneal oleh fragmen yang
telah dibentuk dengan memotong DNA lain dengan EcoRI. Proses ini
menghasilkan molekul gabungan lingkar yang disegel oleh DNA ligase.
Molekul gabungan lingkar ini kemudian dimasukkan ke dalam inang
yang sesuai, misalnya E. coli melalui suatu proses yang disebut sebagai
transformasi. Proses ini melibatkan reaksi sel bakteri dengan CaCl2
pada suhu rendah (untuk memungkinkan pengambilan DNA), diikuti
dengan inkubasi bersama DNA dalam kondisi yang sesuai. DNA asing
bereplikasi dalam kendali vektor. Jika DNA asing membawa suatu
gen utuh, maka kemungkinan gen tersebut akan diekspresikan dalam
bakteri. Jenis pendekatan ini telah bermanfaat dalam produksi insulin
manusia dalam sel bakteri. Keseluruhan teknik tersebut kadangkala
disebut kloning gen.
Bab 5 Asam Nukleat 253
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 241
diikuti dengan inkubasi bersama DNA dalam kondisi yang sesuai. DNA asing
bereplikasi dalam kendali vektor. Jika DNA asing membawa suatu gen utuh,
maka kemungkinan gen tersebut akan diekspresikan dalam bakteri. Jenis
pendekatan ini telah bermanfaat dalam produksi insulin manusia dalam sel
bakteri. Keseluruhan teknik tersebut kadangkala disebut kloning gen.
Gambar 5-15 Langkah-langkah pembentukkan suatu sambungan, atau rekombinasi
dari molekul DNA.
12. POLYMERASE CHAIN REACTION
Suatu sampel DNA tertentu dalam jumlah yang cukup diperlukan untuk
memungkinkan penentuan sifat-sifatnya. Jumlah ini bisa didapat dengan
menggunakan polymerase chain reaction (PCR) yang tentu saja merupakan
suatu tipe reaksi rantai. PCR menyediakan cara untuk menghasilkan duplikat
untai ganda urutan DNA tertentu dalam jumlah banyak. Duplikat ini biasanya
DNA yang mau diklon DNA yang mau diklon
DNA rekombinan
Tempel dan sambung
dengan DNA ligase
Gambar 5-15 Langkah-langkah pembentukkan suatu sambungan, atau
rekombinasi dari molekul DNA.
12. POLYMERASE CHAIN REACTION
Suatu sampel DNA tertentu dalam jumlah yang cukup diperlukan
untuk memungkinkan penentuan sifat-sifatnya. Jumlah ini bisa di-
dapat dengan menggunakan polymerase chain reaction (PCR) yang
tentu saja merupakan suatu tipe reaksi rantai. PCR menyediakan cara
untuk menghasilkan duplikat untai ganda urutan DNA tertentu dalam
jumlah banyak. Duplikat ini biasanya sepanjang ~1 kb, namun dengan
BIOKIMIA: Struktur dan Fungsi Biomolekul 254
memodifikasi reaksi secara khusus maka produk yang lebih panjang
bisa dibuat.
Polymerase chain reaction menggunakan: (1) DNA polimerase
termostabil seperti Taq polimerase yang diambil dari bakteri termofil
Thermus aquaticus, (2) templat DNA yang akan diamplifikasi, (3) dua
primer yang masing-masing sepanjang 20 nukleotida, yang menempel
pada bagian-bagian berbeda pada untai komplementer pada target
dan berperan sebagai sisi untuk memulai reaksi DNA polimerase, (4)
larutan yang mengandung keempat deoksinukleosida trifosfat dATP,
dCTP, dGTP, dan dTTP, Mg2+, garam, dan penyangga pH.
PCR menggunakan DNA polimerase untuk membuat duplikat
DNA komplementer yang sesuai dengan daerah yang diamati. Untuk
mengarahkan enzim pada urutan yang tepat, PCR tergantung pada
primer yang menempel pada urutan komplementer dalam target DNA
untai tunggal. DNA polimerase tidak bisa memulai sintesis DNA de
novo, dan dapat memperpanjang rantai hanya dari primer yang me-
nempel. Primer berlebih disediakan dalam campuran reaksi untuk
memberikan material yang cukup untuk menghasilkan produk ampli-
fikasi.
Reaksi PCR antara lain penggunaan suhu tinggi siklis yang bisa
menyebabkan denaturasi enzim yang termolabil. Karena itulah digu-
nakan DNA polimerase termostabil yakni Taq polimerase.
Untuk PCR, terdapat hanya tiga langkah yang melibatkan DNA,
yakni (1) denaturasi untai ganda DNA, (2) annealing DNA, dan (3)
perpanjangan DNA. Setiap langkah biasanya dilakukan pada suhu yang
berbeda dalam suatu mesin yang dapat diprogram yang disebut thermal
cycler. Satu langkah dalam reaksi rantai memakan waktu kurang dari
beberapa menit, dan ketiga langkah digambarkan sebagai suatu siklus.
Tiap siklus menghasilkan kira-kira dua kali lipat dari jumlah molekul
DNA target. Biasanya lebih dari 30 putaran dilakukan. Jika setiap siklus
dimisalkan menghasilkan dua kali lipat duplikat urutan target, maka
30 putaran akan menghasilkan lebih dari satu miliar (>109) duplikat
DNA untai ganda dengan urutan tertentu.
Bab 5 Asam Nukleat 255
Selama proses denaturasi, DNA target untai ganda dipanaskan
sampai sekitar 95
0
C untuk memisahkan untai-untai dan menyediakan
target DNA untai tunggal. Untuk langkah annealing, campuran reaksi
didinginkan untuk membiarkan primer menempel (mengikat) pada
tiap untai di lokasi yang spesifik oleh urutannya. Primer ini dipilih
dengan hati-hati (dan dibuat dengan alat sintesis DNA otomatis) agar
komplementer terhadap urutan target, dan suhu annealing tergantung
pada kandungan basa dalam urutan. Suhu yang dipilih biasanya sekitar
500C. Kedua primer menempel pada untai-untai yang berhadapan,
mengapit daerah untuk diamplifikasi yang jauhnya kurang dari
beberapa kilobasa (meskipun tidak selalu). Primer-primer inilah yang
menentukan spesifisitas PCR. Jika dipilih urutan yang berbeda, maka
urutan target yang lainlah yang akan diamplifikasi.
Selama langkah perpanjangan yang berlangsung pada sekitar
720C, Taq polimerase memperpanjang ujung 3 hidroksil pada tiap
primer dan membuat DNA dengan cara yang tergantung pada templat.
Produk yang dihasilkan yakni DNA untai ganda dengan satu untai
yang merupakan templat dan untai yang lain merupakan produk yang
baru disintesis. Jika kurang dari beberapa menit yang diberikan untuk
reaksi ini, maka sintesis DNA terbatas sebanyak kurang dari beberapa
kilobasa. Hal ini menjelaskan pilihan pemisahan sisi primer, karena
material yang diamplifikasi harus memiliki sisi yang memungkinkan
annealing selanjutnya pada primer kedua jika amplifikasi eksponensial
adalah yang diinginkan.
Diagram dalam Gambar 5-16 melukiskan proses denaturasi, an-
nealing, dan perpanjangan yang menggunakan urutan DNA sampel.
Ujung 5 dan 3 ditandai, dan urutan di antara sisi-sisi primer digam-
barkan oleh serangkaian garis putus-putus.
BIOKIMIA: Struktur dan Fungsi Biomolekul 256
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 244
Gambar 5-16 Proses denaturasi, penempelan primer, dan pemanjangan
dalam Polymerase Chain Reactin (PCR)
Molekul DNA untai ganda (di atas, pada Gambar 5-16) bisa terdiri atas
hampir semua urutan apapun dan dengan panjang yang bervariasi (ditunjukkan
oleh garis putus-putus), dan PCR masih tetap bisa membuat banyak duplikat
molekul tersebut. DNA didenaturasi dengan menaikkan suhu, kemudian primer
menempel untuk mengapit lokasi yang mengurung daerah tersebut untuk
diamplifikasi. Suhu annealing tergantung pada urutan oligonukleotida. Jika
kandungan G+C kurang lebih sama untuk kedua primer, maka primer-primer ini
TGACGATACGAGCCAGTGCC - - - - - - GGCTGTGGTCCAAGTGTTGG
ACTGCTATGCTCGGTCACGG - - - - - - CCGACACCAGGTTCACAACC
TGACGATACGAGCCAGTGCC - - - - - - GGCTGTGGTCCAAGTGTTGG
ACTGCTATGCTCGGTCACGG - - - - - - CCGACACCAGGTTCACAACC
5
I
5
I
5
I
5
I
3
I
3
I
3
I
3
I
TGACGATACGAGCCAGTGCC
ACTGCTATGCTCGGTCACGG - - - - - - CCGACACCAGGTTCACAACC
5
I
3
I
3
I
5
I
TGACGATACGAGCCAGTGCC - - - - - - GGCTGTGGTCCAAGTGTTGG
5
I
3
I
CCGACACCAGGTTCACAACC
3
I
5
I
TGACGATACGAGCCAGTGCC - - - - - - GGCTGTGGTCCAAGTGTTGG
ACTGCTATGCTCGGTCACGG - - - - - - CCGACACCAGGTTCACAACC
TGACGATACGAGCCAGTGCC - - - - - - GGCTGTGGTCCAAGTGTTGG
ACTGCTATGCTCGGTCACGG - - - - - - CCGACACCAGGTTCACAACC
5
I
3
I
3
I
5
I
5
I
5
I
3
I
3
I
Penempelan primer
Denaturasi
Pemanjangan
Gambar 5-16 Proses denaturasi, penempelan primer, dan pemanjangan
dalam Polymerase Chain Reactin (PCR)
Molekul DNA untai ganda (di atas, pada Gambar 5-16) bisa
terdiri atas hampir semua urutan apapun dan dengan panjang yang
bervariasi (ditunjukkan oleh garis putus-putus), dan PCR masih tetap
bisa membuat banyak duplikat molekul tersebut. DNA didenaturasi
Bab 5 Asam Nukleat 257
dengan menaikkan suhu, kemudian primer menempel untuk mengapit
lokasi yang mengurung daerah tersebut untuk diamplifikasi. Suhu
annealing tergantung pada urutan oligonukleotida. Jika kandungan
G+C kurang lebih sama untuk kedua primer, maka primer-primer
ini harus menempel dengan kuat pada suhu yang kira-kira sama pula.
Primer masing-masing mempunyai ujung 3 yang diarahkan untuk
diperpanjang oleh Taq DNA polimerase untuk menyelesaikan sintesis
pada tiap templat untai tunggal. Proses ini (disebut siklus) kemudian
diulangi beberapa kali. Putaran berulang menghasilkan jumlah besar
produk DNA untai ganda hasil amplifikasi dengan panjang yang tepat,
yang digambarkan oleh jarak antara ujung-ujung 5 kedua primer.
Diagram dalam Gambar 5-17 menunjukkan langkah-langkah
yang terlibat dalam produksi produk DNA untai ganda yang menyertai
dua siklus PCR. Tiap untai DNA dan primer digambarkan dengan
garis. Dengan mengulangi perputaran melalui kombinasi ketiga
langkah (denaturasi, annealing, dan perpanjangan), maka diperoleh
peningkatan molekul produk secara eksponensial.
Metode PCR digunakan dalam penerapan yang membutuhkan
deteksi atau analisis dari sejumlah kecil urutan target asli. Karena itu
PCR sangat berguna dalam identifikasi cepat untuk bahan penginfeksi
seperti virus dan bakteri, dalam pekerjaan forensik yang sampel buktinya
cukup terbatas, dan dalam penelitian yang produk PCR tertentunya bisa
diurutkan dan digunakan untuk tujuan-tujuan tertentu. RNA juga bisa
diteliti menggunakan PCR dengan menyediakan langkah transkripsi
kebalikan (duplikasi RNA menjadi DNA) untuk menghasilkan DNA
komplementer yang kemudian diproses dengan PCR.
Penempelan primer sangatlah penting karena tahap ini menentukan
spesifisitas reaksi PCR dan menentukan urutan DNA yang akan
diamplifikasi. Jika tidak ada primer yang bisa berikatan, maka DNA
polimerase tidak bisa memperpanjang DNA sehingga tidak ada DNA
yang disintesis. Jika hanya satu primer yang berikatan, maka amplifikasi
tidak akan eksponensial. Agar PCR dapat berhasil, kedua primer harus
menempel.
BIOKIMIA: Struktur dan Fungsi Biomolekul 258
Asam Nukleat
Biokimia: Struktur dan Fungsi Biomolekul 246
Gambar 5-17 Reaksi PCR
Metoda PCR digunakan dalam penerapan yang membutuhkan
deteksi atau analisis dari sejumlah kecil urutan target asli. Karena itu PCR
sangat berguna dalam identifikasi cepat untuk bahan penginfeksi seperti virus
dan bakteri, dalam pekerjaan forensik yang sampel buktinya cukup terbatas,
Denaturasi
Penempelan primer
Pemanjangan
Pengulangan : denaturasi, penempelan primer, pemanjangan
Gambar 5-17 Reaksi PCR
Bab 5 Asam Nukleat 259
DNA polimerase termostabil digunakan dalam PCR. Putaran
melalui cakupan suhu tinggi akan mendenaturasi banyak enzim labo-
ratorium yang umum. Hal ini terutama terjadi ketika suhu tertinggi
(~950C) digunakan untuk memisahkan untai-untai DNA. Jika DNA
polimerase tidak termostabil maka akan terdenaturasi. DNA polim-
erase termostabil bisa berasal dari organisme seperti bakteri Thermus
aquaticus yang tumbuh pada suhu tinggi.
-oo0oo-
Bab KATALIS DAN
KINETIKA ENZIM
6
1. KONSEP DASAR KATALISIS ENZIM
Enzim adalah protein yang mengkatalisis reaksi biokimia. Enzim
biasanya terdapat dalam konsentrasi yang sangat rendah di dalam
sel, di mana mereka meningkatkan laju reaksi tanpa mengubah
posisi kesetimbangan. Laju reaksi ke depan maupun reaksi kebalikan
ditingkatkan oleh faktor yang sama. Faktor ini biasanya sekitar 10
3

10
12
.
Meskipun fenomena fermentasi dan pencernaan telah lama
dikenal, tetapi penjelasan pertama tentang enzim baru dibuat
oleh Payen dan Persoz ketika mereka menemukan bahwa endapan
alkohol dari ekstrak ragi mengandung suatu zat yang tidak tahan
panas yang dapat mengubah tepung menjadi gula.
Zat dalam penjelasan di atas disebut diastase (dari bahasa
Yunani yang berarti pemisahan) karena kemampuannya untuk
memisahkan dekstrin yang dapat larut dengan butiran tepung
yang tidak larut. Diastase menjadi istilah yang biasa digunakan
untuk campuran enzim ini sampai tahun 1898, ketika Duclaux
mengusulkan penggunaan akhiran ase dalam nama enzim.
Banyak enzim yang dimurnikan dari berbagai sumber, tetapi
yang pertama kali mengkristalkan enzim adalah J.B. Sumner.
Enzim yang dikristalkan ini berasal dari jack beans. Untuk hasil
yang memakan waktu 6 tahun penelitian ini (1924 1930),
BIOKIMIA: Struktur dan Fungsi Biomolekul 262
Sumner mendapatkan hadiah Nobel pada tahun 1946. Pekerjaannya
didemonstrasikan sekali saja meskipun enzim-enzim merupakan
kesatuan kimia yang berbeda.
Gas karbon dioksida mudah larut dalam air dan terhidrasi secara
spontan membentuk asam karbonat, yang terdisosiasi dengan cepat
menjadi suatu proton dan ion bikarbonat:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 248
BAB VI
KATALIS DAN KINETIKA ENZIM
1. KONSEP DASAR KATALISIS ENZIM
Enzim adalah protein yang mengkatalisis reaksi biokimia. Enzim
biasanya terdapat dalam konsentrasi yang sangat rendah di dalam sel, di mana
mereka meningkatkan laju reaksi tanpa mengubah posisi kesetimbangan. Laju
reaksi ke depan maupun reaksi kebalikan ditingkatkan oleh faktor yang sama.
Faktor ini biasanya sekitar 10
3
10
12
.
Meskipun fenomena fermentasi dan pencernaan telah lama dikenal,
tetapi penjelasan pertama tentang enzim baru dibuat oleh Payen dan Persoz
ketika mereka menemukan bahwa endapan alkohol dari ekstrak ragi
mengandung suatu zat yang tidak tahan panas yang dapat mengubah tepung
menjadi gula.
Zat dalam penjelasan di atas disebut diastase (dari bahasa Yunani
yang berarti pemisahan) karena kemampuannya untuk memisahkan dekstrin
yang dapat larut dengan butiran tepung yang tidak larut. Diastase menjadi
istilah yang biasa digunakan untuk campuran enzim ini sampai tahun 1898,
ketika Duclaux mengusulkan penggunaan akhiran ase dalam nama enzim.
Banyak enzim yang dimurnikan dari berbagai sumber, tetapi yang
pertama kali mengkristalkan enzim adalah J.B. Sumner. Enzim yang
dikristalkan ini berasal dari jack beans. Untuk hasil yang memakan waktu 6
tahun penelitian ini (1924 1930), Sumner mendapatkan hadiah Nobel pada
tahun 1946. Pekerjaannya didemonstrasikan sekali saja meskipun enzim-
enzim merupakan kesatuan kimia yang berbeda.
Gas karbon dioksida mudah larut dalam air dan terhidrasi secara
spontan membentuk asam karbonat, yang terdisosiasi dengan cepat menjadi
suatu proton dan ion bikarbonat:
CO
2
+ H
2
O H
+
+ HCO
3
-
Laju reaksi hidrasi untuk 20 mmol L
-1
CO
2
pada 25
0
C dan pH 7,2 adalah ~0,6
mmol L
-1
s
-1
.
Laju reaksi hidrasi untuk 20 mmol L-1 CO
2
pada 250C dan pH
7,2 adalah ~0,6 mmol L-1 s-1.
Dalam sel darah merah mamalia, enzim karbonat anhidrase
terdapat dalam konsentrasi 1 2 g per liter sel (Mr = 30.000), sehingga
konsentrasi molarnya ~50 x 10
-6
. Laju reaksi hidrasi dengan adanya
enzim karbonat anhidrase dalam kondisi seperti di atas adalah ~50
mol L-1 s-1, yakni mengalami peningkatan laju 8 x 104 kali lipat dari
proses tanpa katalis.
Terdapat lebih dari 2.500 macam reaksi biokimia dengan enzim
spesifik yang membantu peningkatan laju reaksi. Spesies organisme
yang berbeda memproduksi variasi struktur enzim yang berbeda pula,
sehingga jumlah macam protein enzim dalam seluruh sistem biologis
adalah lebih dari 106. Setiap enzim dikarakterisasi oleh spesifisitas
substrat kimia (reaktan) serta molekul lain yang mengatur aktivitasnya.
Molekul lain ini disebut efektor, yang bisa merupakan aktivator,
inhibitor, atau keduanya. Dalam enzim yang lebih kompleks, satu
senyawa bisa memiliki salah satu efek, yang tergantung pada kondisi
fisik atau kimia lainnya. Enzim berukuran mulai dari kompleks subunit
banyak yang besar (disebut enzim multimer, Mr @106) sampai bentuk
subunit tunggal yang kecil.
Aspartat karbomoiltransferase mengkatalisis pembentukan kar-
bamoil aspartat dari karbamoil fosfat dan aspartat, dalam langkah per-
tama yang dilakukan untuk biosintesis pirimidin. Enzim yang berasal
dari bakteri E. coli ini (Mr = 310.000) terdiri atas 12 subunit, yakni
Bab 6 Katalis dan Kinetika Enzim 263
enam regulator dan enam katalis. CTP adalah efektor negatif, yakni
menginhibisi enzim tersebut melalui pengikatan pada subunit regula-
tor. ATP adalah efektor positif yang bekerja melalui subunit regula-
tor, sedangkan suksinat menginhibisi reaksi yang terjadi dengan cara
berkompetisi langsung dengan aspartat pada sisi aktif.
Luas permukaan enzim yang paling kecil sekalipun (seperti ribonuk-
lease, Mr = 12.000) yang ditempati oleh gugus kimia yang akan diikat oleh
reaktan, adalah kurang dari 5 persen dari luas total. Daerah ini disebut sisi
aktif.
Penataan tertentu pada rantai samping asam amino suatu enzim di
sisi aktifnya menentukan tipe molekul yang bisa terikat dan bereaksi di
situ. Biasanya ada sekitar lima rantai samping seperti itu dalam enzim
apapun. Selain itu, banyak enzim yang memiliki molekul-molekul
nonprotein kecil yang terhubung dengan sisi aktif atau di dekatnya,
yang menentukan spesifisitas substrat. Molekul-molekul ini disebut
kofaktor jika terikat secara nonkovalen pada protein, atau disebut
gugus prostetik jika terikat secara kovalen. Dalam beberapa enzim, ion
logam tertentu diperlukan untuk aktivitasnya.
Karbonat anhidrase memiliki satu ion Zn
2+
per molekul enzim.
Ion logam tersebut berada pada sisi aktif. Aspartat karbamoiltransferase
memiliki enam ion Zn
2+
per dodekamer, yang diperlukan untuk
stabilisasi kompleks. Tanpa Zn
2+
, heksamer ini akan terdisosiasi.
2. KLASIFIKASI ENZIM
Semua enzim diberi nama menurut sistem yang dirancang oleh Komisi
Enzim (Enzyme Commission, EC) dari International Union of Pure
and Applied Chemistry (IUPAC), dan berdasarkan pada tipe reaksi
yang dikatalisis enzim tersebut. Setiap tipe enzim mempunyai empat
digit nomor EC yang spesifik, serta nama yang kompleks namun jelas
dan bisa menepis kebingungan tentang enzim-enzim yang mengkatalisis
reaksi yang serupa tetapi tidak identik. Dalam prakteknya, banyak
enzim yang lebih dikenal dengan nama umum, yang biasanya berasal
dari nama reaktan utamanya yang spesifik, dengan ditambahkan
BIOKIMIA: Struktur dan Fungsi Biomolekul 264
akhiran ase. Beberapa nama umum tidak memiliki akhiran ase, yang
biasanya merupakan enzim yang dipelajari dan diberi nama sebelum
klasifikasi sistematik enzim dibuat.
Contoh nama-nama enzim yang lazim yakni arginase, yang
bekerja pada arginin; dan urease, yang bekerja pada urea. Dua nama
umum yang tidak lazim yakni pepsin, suatu enzim proteolitik dalam
jalur pencernaan (nomor EC 3.4.23.1); dan rodanese (tiosulfat: sianida
sulfurtransferase, EC 2.8.1.1), yang berada dalam hati dan ginjal
mamalia untuk mengkatalisis penghilangan sianida dan tiosulfat dari
tubuh.
Digit pertama dalam nomor EC menunjukkan termasuk kelas
mana enzim tersebut, dari enam kelas utama yang ada (Tabel 6-1).
Tabel 6-1 Kelas-kelas Utama Enzim
Digit Pertama EC Kelas Enzim Tipe Reaksi yang Dikatalisis
1. Oksidoreduktase Oksidasi-reduksi. Pendonor hidrogen atau
elektron adalah salah satu substratnya.
2 Tranferase Transfer gugus kimia dari bentuk umum
AX + B A + BX.
3. Tranferase Pemotongan hidrolitik pada CC,
CN, CO, dan ikatan lainnya.
4. Liase Pemotongan (bukan hidrolitik) pada
CC, CN, CO, dan ikatan lainnya,
meninggalkan ikatan rangkap; atau
alternatifnya yakni penambahan gugus
pada suatu ikatan rangkap.
5. Isomerase Perubahan penataan geometris (spasial)
suatu molekul.
6. Ligase Ligasi (menghubungkan) dua molekul
dengan mengikutsertakan hidrolisis
senyawa yang memiliki DG besar untuk
hidrolisis.
Digit kedua dalam nomor enzim EC menandakan sub-kelas;
sedangkan untuk hidrolase, digit kedua ini menandakan tipe ikatan
target kerja enzim (Tabel 6-2).
Bab 6 Katalis dan Kinetika Enzim 265
Tabel 6-2 Subklasifikasi Hidrolase
Dua Digit Pertama EC Tipe Ikatan Target
3.1
Ester,
C O
O
R
, atau dengan S atau P menggantikan C, atau
C S
O
R
3.2
Glikolisil, gula
C O R
, atau dengan N atau S menggantikan
O
3.3 Eter,
R O R'
, atau dengan S menggantikan O
3.4 Peptida,
C N
3.5 Nonpeptida,
C N
3.6 Anhidrida asam,
R C O
O
C
O
R'
3.7 C C
3.8 Halida (X),
C X
, atau dengan P menggantikan C
3.9 P N
3.10 S N
3.11 C P
Arginase adalah suatu hidrolase yang ada dalam hati organisme
penghasil urea (ureoteles). Enzim ini mengkatalisis reaksi:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 252
3.5 Nonpeptida,
C N
3.6 Anhidrida asam,
R C O
O
C
O
R'
3.7
C C
3.8
Halida (X),
C X
, atau dengan P menggantikan
C
3.9
P N
3.10
S N
3.11
C P
Arginase adalah suatu hidrolase yang ada dalam hati organisme
penghasil urea (ureoteles). Enzim ini mengkatalisis reaksi:
NH
3
C
NH
(CH
2
)
3
C
COO
-
NH
2
NH
3
H
H
2
O
C
NH
2
NH
2
O + (CH
2
)
3
NH
3
C
COO
-
NH
3
H
Arginin Urea Ornitin
Nama EC resmi untuk enzim ini adalah L-arginin amidinohidrolase,
yang kata terakhirnya berasal dari reaksi pemotongan gugus amidino pada
arginin (lingkaran putus-putus dalam persamaan di atas) dengan memasukkan
molekul air pada ikatan CN. Dalam reaksi, ikatan CN nonpeptida
dipotong, sehingga didapat nomor kedua EC untuk arginase adalah 5. Nomor
klasifikasi lengkapnya adalah 3.5.3.1.
Angka ketiga adalah subklasifikasi tipe ikatan target enzim, atau gugus yang
ditransfer dalam reaksi, atau keduanya. Kategori angka ini bervariasi dari satu
kelas EC utama ke kelas berikutnya. Nomor keempat adalah nomor seri enzim.
BIOKIMIA: Struktur dan Fungsi Biomolekul 266
Nama EC resmi untuk enzim ini adalah L-arginin amidinohidrolase,
yang kata terakhirnya berasal dari reaksi pemotongan gugus amidino
pada arginin (lingkaran putus-putus dalam persamaan di atas) dengan
memasukkan molekul air pada ikatan CN. Dalam reaksi, ikatan C
N nonpeptida dipotong, sehingga didapat nomor kedua EC untuk
arginase adalah 5. Nomor klasifikasi lengkapnya adalah 3.5.3.1.
Angka ketiga adalah subklasifikasi tipe ikatan target enzim, atau
gugus yang ditransfer dalam reaksi, atau keduanya. Kategori angka
ini bervariasi dari satu kelas EC utama ke kelas berikutnya. Nomor
keempat adalah nomor seri enzim.
3. MODE PENINGKATAN LAJU PEMOTONGAN IKATAN
Mekanisme dasar suatu enzim dalam meningkatkan laju reaksi kimia
dapat diklasifikasikan ke dalam empat kelompok.
Facilitation of proximity, atau kemudahan kedekatan, yang disebut
juga sebagai efek keakraban, yang berarti bahwa laju reaksi antara dua
molekul ditingkatkan bila dalam larutan encer keduanya dijaga dalam
jarak dekat satu sama lain dalam sisi aktif enzim, sehingga menaikkan
konsentrasi efektif reaktan.
Katalisis kovalen, yakni rantai-rantai samping asam amino me-
nyediakan sejumlah gugus nukleofilik untuk katalisis. Gugus-gugus
nukleofilik ini antara lain RCOO, RNH
2
, aromatikOH, histi-
dil, ROH, dan RS. Gugus-gugus ini menyerang bagian elektrofilik
(kekurangan elektron) pada substran untuk membentuk ikatan kova-
len antara substran dengan enzim, yakni membentuk suatu reaksi in-
termediet. Tipe proses ini terutama terbukti pada enzim pentransfer
gugus (EC Kelas 2). Dalam pembentukan intermediet yang berikatan
kovalen, penyerangan oleh enzim nukleofil (Enz-X dalam contoh di
bawah) pada substrat bisa menghasilkan asilasi, fosforilasi, atau glikosi-
lasi pada nukleofil.
Menuliskan mekanisme kimia suatu reaksi berarti menggambarkan
penataan ulang elektron pada saat substrat diubah menjadi produk
melalui suatu keadaan transisi. Cara yang biasanya digunakan untuk
Bab 6 Katalis dan Kinetika Enzim 267
melukiskan alur penataan ulang ikatan adalah dengan memakai panah
lengkung yang menandakan arah aliran elektron.
Diagram aliran elektron untuk hidrolisis ikatan peptida adalah
seperti berikut:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 253
3. MODE PENINGKATAN LAJU PEMOTONGAN IKATAN
Mekanisme dasar suatu enzim dalam meningkatkan laju reaksi kimia
dapat diklasifikasikan ke dalam empat kelompok.
Facilitation of proximity, atau kemudahan kedekatan, yang disebut juga
sebagai efek keakraban, yang berarti bahwa laju reaksi antara dua molekul
ditingkatkan bila dalam larutan encer keduanya dijaga dalam jarak dekat satu
sama lain dalam sisi aktif enzim, sehingga menaikkan konsentrasi efektif
reaktan.
Katalisis kovalen, yakni rantai-rantai samping asam amino menyediakan
sejumlah gugus nukleofilik untuk katalisis. Gugus-gugus nukleofilik ini antara
lain RCOO

, RNH
2
, aromatikOH, histidil, ROH, dan RS

. Gugus-gugus
ini menyerang bagian elektrofilik (kekurangan elektron) pada substran untuk
membentuk ikatan kovalen antara substran dengan enzim, yakni membentuk
suatu reaksi intermediet. Tipe proses ini terutama terbukti pada enzim
pentransfer gugus (EC Kelas 2). Dalam pembentukan intermediet yang
berikatan kovalen, penyerangan oleh enzim nukleofil (Enz-X dalam contoh di
bawah) pada substrat bisa menghasilkan asilasi, fosforilasi, atau glikosilasi
pada nukleofil.
Menuliskan mekanisme kimia suatu reaksi berarti menggambarkan
penataan ulang elektron pada saat substrat diubah menjadi produk melalui
suatu keadaan transisi. Cara yang biasanya digunakan untuk melukiskan alur
penataan ulang ikatan adalah dengan memakai panah lengkung yang
menandakan arah aliran elektron.
Diagram aliran elektron untuk hidrolisis ikatan peptida adalah seperti berikut:
R C N
O
R'
H
H
+
O
H H
R C N
+
-
O
R'
H
O
H H
H
R C N
+
-
O
R'
H
O H
H H
+
R C N
+
O
R'
H
O H
H
+
H
2
O nukleofilik menyerang karbon karbonil elektrofilik, yang menjadi
kekurangan elektron karena penarikan elektron kepada oksigen karbonil.
H
2
O nukleofilik menyerang karbon karbonil elektrofilik, yang
menjadi kekurangan elektron karena penarikan elektron kepada
oksigen karbonil. Perhatikan bahwa dalam intermediet tetrahedral pada
struktur yang kedua dan ketiga, karbon memiliki penataan tetrahedral
biasa yang terdiri atas empat ikatan.
Suatu intermediet fosfoenzim dibentuk dalam salah satu tipe
katalisis kovalen enzim:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 254
Perhatikan bahwa dalam intermediet tetrahedral pada struktur yang kedua dan
ketiga, karbon memiliki penataan tetrahedral biasa yang terdiri atas empat
ikatan.
Suatu intermediet fosfoenzim dibentuk dalam salah satu tipe katalisis
kovalen enzim:
R
O
P
O
-
O
O
R'
Enz-X
R
O
P
O
-
-
O
O
R'
Enz-X
R
O
P
O
-
Enz-X
O
-
O R' +
Banyak contoh mekanisme dasar katalisis ini yang bisa ditemukan dalam
enzim-enzim EC Kelas 2. Salah satu contohnya yakni heksokinase.
Intermediet kovalen bisa diserang oleh nukleofil kedua yang
menyebabkan pelepasan produk. Bila nukleofil kedua adalah air, maka reaksi
keseluruhan dinamakan hidrolisis. Banyak nukleofil yang bukan hanya suatu
rantai samping asam amino pada enzim, tetapi merupakan suatu gugus
prostetik, misalnya piridoksal fosfat dalam transaminase.
Katalisis asam-basa umum didefinisikan sebagai proses pemindahan proton
dalam keadaan transisi. Proses ini tidak melibatkan pembentukan ikatan
kovalen di dalamnya, tetapi reaksi enzimatik keseluruhan bisa melibatkan ini
juga.
Contoh katalisis asam-basa umum dari kimia organik adalah seperti ilustrasi
berikut, tetapi perhatikan bahwa hemiasetal juga terbentuk dalam beberapa
reaksi enzimatik.
Reaksi keseluruhan:
CH
3
C
H
O CH
3
OH HO C OCH
3
CH
3
H
+
Asetaldehid Metanol Hemiasetal
Banyak contoh mekanisme dasar katalisis ini yang bisa ditemukan
dalam enzim-enzim EC Kelas 2. Salah satu contohnya yakni
heksokinase.
Intermediet kovalen bisa diserang oleh nukleofil kedua yang
menyebabkan pelepasan produk. Bila nukleofil kedua adalah air, maka
reaksi keseluruhan dinamakan hidrolisis. Banyak nukleofil yang bukan
hanya suatu rantai samping asam amino pada enzim, tetapi merupakan
suatu gugus prostetik, misalnya piridoksal fosfat dalam transaminase.
Katalisis asam-basa umum didefinisikan sebagai proses peminda-
han proton dalam keadaan transisi. Proses ini tidak melibatkan pem-
bentukan ikatan kovalen di dalamnya, tetapi reaksi enzimatik keseluru-
han bisa melibatkan ini juga.
BIOKIMIA: Struktur dan Fungsi Biomolekul 268
Contoh katalisis asam-basa umum dari kimia organik adalah
seperti ilustrasi berikut, tetapi perhatikan bahwa hemiasetal juga
terbentuk dalam beberapa reaksi enzimatik.
Reaksi keseluruhan:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 254
Perhatikan bahwa dalam intermediet tetrahedral pada struktur yang kedua dan
ketiga, karbon memiliki penataan tetrahedral biasa yang terdiri atas empat
ikatan.
Suatu intermediet fosfoenzim dibentuk dalam salah satu tipe katalisis
kovalen enzim:
R
O
P
O
-
O
O
R'
Enz-X
R
O
P
O
-
-
O
O
R'
Enz-X
R
O
P
O
-
Enz-X
O
-
O R' +
Banyak contoh mekanisme dasar katalisis ini yang bisa ditemukan dalam
enzim-enzim EC Kelas 2. Salah satu contohnya yakni heksokinase.
Intermediet kovalen bisa diserang oleh nukleofil kedua yang
menyebabkan pelepasan produk. Bila nukleofil kedua adalah air, maka reaksi
keseluruhan dinamakan hidrolisis. Banyak nukleofil yang bukan hanya suatu
rantai samping asam amino pada enzim, tetapi merupakan suatu gugus
prostetik, misalnya piridoksal fosfat dalam transaminase.
Katalisis asam-basa umum didefinisikan sebagai proses pemindahan proton
dalam keadaan transisi. Proses ini tidak melibatkan pembentukan ikatan
kovalen di dalamnya, tetapi reaksi enzimatik keseluruhan bisa melibatkan ini
juga.
Contoh katalisis asam-basa umum dari kimia organik adalah seperti ilustrasi
berikut, tetapi perhatikan bahwa hemiasetal juga terbentuk dalam beberapa
reaksi enzimatik.
Reaksi keseluruhan:
CH
3
C
H
O CH
3
OH HO C OCH
3
CH
3
H
+
Asetaldehid Metanol Hemiasetal
Mekanisme reaksi A: Suatu basa (OH-) mempercepat pembentukan
hemiasetal seperti berikut:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 255
Mekanisme reaksi A: Suatu basa (OH
-
) mempercepat pembentukan hemiasetal
seperti berikut:
CH
3
C
H
O
-
O CH
3
CH
3
C
O
-
OCH
3
H
CH
3
C
OH
OCH
3
H
+ OH
-
+
H
2
O
H
2
O
Serangan
nukleofilik
CH
3
OH + OH
-
CH
3
O
-
H
2
O +
Nukleofil
Catatan: OH
-
didaur ulang dalam reaksi ini, sehingga bisa dianggap sebagai
suatu katalis dalam arti sebenarnya.
Mekanisme reaksi B: Katalis asam juga terdapat dalam reaksi, yang
melibatkan pembentukan garam oksonium, diikuti oleh reaksi dengan alkohol
seperti berikut:
CH
3
C
H
O
CH
3
C
H
O
+
H
+
+ H
Oksonium
CH
3
C
H
O
+
H O CH
3
H
+
CH
3
C
OH
+
O
H
CH
3
H
CH
3
C
OH
O
H
CH
3
H
+
+
Dalam contoh di atas, laju pembentukan hemiasetal ditingkatkan dalam asam
kuat atau basa kuat. Dalam reaksi lain bisa saja hanya salah satu (basa atau
asam) yang menjadi katalis.
Hidrolisis nitramida adalah peka terhadap katalis basa, tetapi tidak
peka terhadap katalis asam. Peningkatan pH menimbulkan peningkatan laju
reaksi yang totalnya tanpa pemakaian basa, seperti ditunjukkan dalam reaksi
berikut:
NH
2
NO
2
+ OH
-
H
2
O + NHNO
2
-
NHNO
2
-
N
2
O + OH
-
Catatan: OH
-
didaur ulang dalam reaksi ini, sehingga bisa dianggap
sebagai suatu katalis dalam arti sebenarnya.
Mekanisme reaksi B: Katalis asam juga terdapat dalam reaksi, yang
melibatkan pembentukan garam oksonium, diikuti oleh reaksi dengan
alkohol seperti berikut:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 255
Mekanisme reaksi A: Suatu basa (OH
-
) mempercepat pembentukan hemiasetal
seperti berikut:
CH
3
C
H
O
-
O CH
3
CH
3
C
O
-
OCH
3
H
CH
3
C
OH
OCH
3
H
+ OH
-
+
H
2
O
H
2
O
Serangan
nukleofilik
CH
3
OH + OH
-
CH
3
O
-
H
2
O +
Nukleofil
Catatan: OH
-
didaur ulang dalam reaksi ini, sehingga bisa dianggap sebagai
suatu katalis dalam arti sebenarnya.
Mekanisme reaksi B: Katalis asam juga terdapat dalam reaksi, yang
melibatkan pembentukan garam oksonium, diikuti oleh reaksi dengan alkohol
seperti berikut:
CH
3
C
H
O
CH
3
C
H
O
+
H
+
+ H
Oksonium
CH
3
C
H
O
+
H O CH
3
H
+
CH
3
C
OH
+
O
H
CH
3
H
CH
3
C
OH
O
H
CH
3
H
+
+
Dalam contoh di atas, laju pembentukan hemiasetal ditingkatkan dalam asam
kuat atau basa kuat. Dalam reaksi lain bisa saja hanya salah satu (basa atau
asam) yang menjadi katalis.
Hidrolisis nitramida adalah peka terhadap katalis basa, tetapi tidak
peka terhadap katalis asam. Peningkatan pH menimbulkan peningkatan laju
reaksi yang totalnya tanpa pemakaian basa, seperti ditunjukkan dalam reaksi
berikut:
NH
2
NO
2
+ OH
-
H
2
O + NHNO
2
-
NHNO
2
-
N
2
O + OH
-
Bab 6 Katalis dan Kinetika Enzim 269
Dalam contoh di atas, laju pembentukan hemiasetal ditingkatkan
dalam asam kuat atau basa kuat. Dalam reaksi lain bisa saja hanya salah
satu (basa atau asam) yang menjadi katalis.
Hidrolisis nitramida adalah peka terhadap katalis basa, tetapi
tidak peka terhadap katalis asam. Peningkatan pH menimbulkan
peningkatan laju reaksi yang totalnya tanpa pemakaian basa, seperti
ditunjukkan dalam reaksi berikut:
NH
2
NO
2
+ OH
-
H
2
O + NHNO
2
-
NHNO
2
-
N
2
O + OH
-
OH- bukanlah satu-satunya basa yang dapat mengkatalisis hidrolisis
ini. Basa-basa lain seperti asetat juga bereaksi, misalnya,
NH
2
NO
2
+ CH
3
COO
-
CH
3
COOH + NHNO
2
-
NHNO2- N2O + OH-
OH
-
+ CH
3
COOH H
2
O + CH
3
COO
-
Menurut definisi Brnsted-Lowry (dan seperti dalam contoh di
atas), suatu asam adalah bagian apapun yang mendonorkan proton,
sedangkan basa adalah yang akan menerima proton dari bagian lain.
Katalisis asam-basa tidak meningkatkan laju oleh faktor yang lebih
besar dari ~100, tetapi bersama dengan mekanisme lain yang bekerja
dalam sisi aktif suatu enzim, maka peningkatan laju reaksi enzimatik
akan sangat berarti. Rantai samping asam amino asam glutamat, his-
tidin, asam aspartat, lisin, tirosin, dan sistein dalam bentuk terproton-
asinya bisa berperan sebagai katalis asam, sedangkan bentuk tidak ter-
protonasinya sebagai katalis basa. Keefektifan rantai samping sebagai
suatu katalis tergantung pada pKa dalam lingkungan sisi aktif, serta
pada pH bekerjanya enzim.
Perubahan tegangan, distorsi molekul, dan bentuk. Tegangan
dalam sistem ikatan reaktan serta pelepasan tegangan ketika keadaan
transisi berubah menjadi produk dapat memberikan peningkatan laju
reaksi kimia.
BIOKIMIA: Struktur dan Fungsi Biomolekul 270
Dua reaksi kimia berikut ini melibatkan hidrolisis ikatan fosfat
ester.
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 256
OH
-
bukanlah satu-satunya basa yang dapat mengkatalisis hidrolisis ini. Basa-
basa lain seperti asetat juga bereaksi, misalnya,
NH
2
NO
2
+ CH
3
COO
-
CH
3
COOH + NHNO
2
-
NHNO
2
-
N
2
O + OH
-
OH
-
+ CH
3
COOH H
2
O + CH
3
COO
-
Menurut definisi Brnsted-Lowry (dan seperti dalam contoh di atas),
suatu asam adalah bagian apapun yang mendonorkan proton, sedangkan basa
adalah yang akan menerima proton dari bagian lain.
Katalisis asam-basa tidak meningkatkan laju oleh faktor yang lebih
besar dari ~100, tetapi bersama dengan mekanisme lain yang bekerja dalam
sisi aktif suatu enzim, maka peningkatan laju reaksi enzimatik akan sangat
berarti. Rantai samping asam amino asam glutamat, histidin, asam aspartat,
lisin, tirosin, dan sistein dalam bentuk terprotonasinya bisa berperan sebagai
katalis asam, sedangkan bentuk tidak terprotonasinya sebagai katalis basa.
Keefektifan rantai samping sebagai suatu katalis tergantung pada pK
a
dalam
lingkungan sisi aktif, serta pada pH bekerjanya enzim.
Perubahan tegangan, distorsi molekul, dan bentuk. Tegangan dalam
sistem ikatan reaktan serta pelepasan tegangan ketika keadaan transisi
berubah menjadi produk dapat memberikan peningkatan laju reaksi kimia.
Dua reaksi kimia berikut ini melibatkan hidrolisis ikatan fosfat ester.
O
P
O
-
O
O
CH
2
CH
2
H
2
O O
P
O
-
OH
O
CH
2
CH
2
OH
(a)
O
P
O
-
O
O
CH
3
CH
3
H
2
O O
P
O
-
OH
O
CH
3
+
CH
3
OH
(b)
Dalam kondisi standar, reaksi (a) berlangsung 108 kali lebih cepat
daripada reaksi (b). Senyawa siklik pada (a) memiliki tegangan ikatan
yang cukup besar (energi potensial dalam konfigurasi ini tinggi), yang
dilepaskan saat pembukaan cincin selama hidrolisis. Tipe tegangan ini
tidak terdapat dalam diester pada (b).
Pada enzim, substrat tidak saja bisa terdistorsi (memiliki tegangan),
tetapi suatu derajat kebebasan ekstra juga dimasukkan, yakni enzim
dengan semua rantai samping asam aminonya. Pengikatan substrat pada
enzim melibatkan energi interaksi yang bisa memudahkan katalisis.
Untuk peningkatan laju katalitik, harus ada juga suatu destabilisasi
keseluruhan pada kompleks enzim-substrat serta suatu peningkatan
stabilitas keadaan transisi. Hal ini dilukiskan dalam gambar 6-1.
Dalam reaksi tanpa katalis (Gambar 6-1-a), reaktan memiliki
probabilitas rendah untuk mengasumsikan konformasi bertegangan
yang diperlukan untuk interaksi antara dua gugus reaktif. Agar reaksi
bisa berlangsung, molekul harus melewati yang disebut batas energi
aktivasi. Dalam reaksi dengan katalis (Gambar 6-1-b), pengikatan
Bab 6 Katalis dan Kinetika Enzim 271
reaktan pada enzim menyebabkan pembentukan struktur gabungan
(kompleks enzim-substrat) dengan kecenderungan substrat yang lebih
besar untuk membentuk keadaan transisi, yakni lebih sedikit energi
yang terlibat untuk menyatukan gugus-gugus reaktif. Karena itulah
reaksi berlangsung lebih cepat.
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 257
Dalam kondisi standar, reaksi (a) berlangsung 10
8
kali lebih cepat daripada
reaksi (b). Senyawa siklik pada (a) memiliki tegangan ikatan yang cukup besar
(energi potensial dalam konfigurasi ini tinggi), yang dilepaskan saat pembukaan
cincin selama hidrolisis. Tipe tegangan ini tidak terdapat dalam diester pada
(b).
Pada enzim, substrat tidak saja bisa terdistorsi (memiliki tegangan),
tetapi suatu derajat kebebasan ekstra juga dimasukkan, yakni enzim dengan
semua rantai samping asam aminonya. Pengikatan substrat pada enzim
melibatkan energi interaksi yang bisa memudahkan katalisis. Untuk
peningkatan laju katalitik, harus ada juga suatu destabilisasi keseluruhan pada
kompleks enzim-substrat serta suatu peningkatan stabilitas keadaan transisi.
Hal ini dilukiskan dalam gambar 6-1.
G
0
S P
S

Koordinat reaksi
E
n
e
r
g
i

b
e
b
a
s

(
k
J

m
o
l
-
1
)
-
+ +
-
Gugus-gugus
reaktif
(a) Reaksi yang tidak dikatalisis
Gambar 6-1 Energi aktivasi adalah energi yang lebih rendah untuk
reaksi-reaksi yang dikatalisis. Grafik-grafik di atas, tiap skema reaksi
menunjukkan energi substrat (yang dilukiskan disini adalah energi
potensial dari substrat yang dibengkokkan) pada tiap tahap reaksi.
Panah menunjukkan, sesuai dengan panjang dan ketebalan, dalam
hal ini yakni kecepatan reaksi. DG merupakan energi aktivasi dari
keadaan-keadaan transisi molekul, dan DG
0
adalah keseluruhan energi
bebas dari reaksi. Perubahan-perubahan pada enzim dan substrat
menghasilkan pengikatan yang lebih kuat pada keadaan transisi daripada
keadaan E.S atau keadaan E.P.
BIOKIMIA: Struktur dan Fungsi Biomolekul 272
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 258
Gambar 6-1 Energi aktivasi adalah energi yang lebih rendah untuk reaksi-reaksi yang
dikatalisis. Grafik-grafik di atas, tiap skema reaksi menunjukkan energi
substrat (yang dilukiskan disini adalah energi potensial dari substrat yang
dibengkokkan) pada tiap tahap reaksi. Panah menunjukkan, sesuai
dengan panjang dan ketebalan, dalam hal ini yakni kecepatan reaksi.
G

merupakan energi aktivasi dari keadaan-keadaan transisi molekul,


dan G
0
adalah keseluruhan energi bebas dari reaksi. Perubahan-
perubahan pada enzim dan substrat menghasilkan pengikatan yang lebih
kuat pada keadaan transisi daripada keadaan E.S atau keadaan E.P.
Dalam reaksi tanpa katalis (Gambar 6-1-a), reaktan memiliki
probabilitas rendah untuk mengasumsikan konformasi bertegangan yang
diperlukan untuk interaksi antara dua gugus reaktif. Agar reaksi bisa
berlangsung, molekul harus melewati yang disebut batas energi aktivasi.
Dalam reaksi dengan katalis (Gambar 6-1-b), pengikatan reaktan pada enzim
menyebabkan pembentukan struktur gabungan (kompleks enzim-substrat)
dengan kecenderungan substrat yang lebih besar untuk membentuk keadaan
transisi, yakni lebih sedikit energi yang terlibat untuk menyatukan gugus-gugus
reaktif. Karena itulah reaksi berlangsung lebih cepat.
G
0
E+S E+P
ES

Koordinat reaksi
E
n
e
r
g
i

b
e
b
a
s

(
k
J

m
o
l
-
1
)
E.S E.P
-
+ +
-
Kompleks E.S
+
+
-
-
+
+
-
+
Keadaan transisi E. S

Kompleks E.P
(b) Reaksi yang dikatalisis
Destabilisasi kompleks enzim-substrat bisa dibayangkan sebagai
distorsi panjang dan sudut ikatan dari konfigurasi sebelumnya yang
lebih stabil. Hal ini bisa dicapai dengan tarikan atau tolakan elektro-
statik oleh gugus pada substrat dan enzim. Atau, bisa juga melibatkan
desolvasi (penghilangan air) dari gugus bermuatan pada sisi aktif hi-
drofob.
Jika suatu substrat diikat tanpa tranformasi yang penting pada en-
ergi ikatan untuk membentuk tegangan distorsi, maka pengikatan ini
akan lebih kuat. Akan tetapi hal ini tidak terlalu mempengaruhi DG
(Gambar 6-1). Namun bila sebagian energi bebas ikatan digunakan
untuk mendistorsi enzim agar bisa lebih komplementer terhadap ben-
tuk keadaan transisi, maka pengikatan enzim pada substrat akan men-
jadi lebih lemah, sedangkan pengikatan pada keadaan transisi substrat
akan lebih kuat. Karena itu, pengikatan substrat yang kuat tidak terlalu
berguna dalam meningkatkan laju reaksi enzim.
Misalkan suatu substrat dengan konsentrasi 10
-7
mol L
-1
menjenuh-
kan setengah bagian sisi aktif dalam larutan enzim (yakni Kd = 10-7
mol L-1). Tetapi konsentrasi dalam kondisi fisiologis adalah 10
-3
mol
L-1. Sisi-sisi enzim jenuh sempurna dalam konsisi fisiologis (yakni
Bab 6 Katalis dan Kinetika Enzim 273
semua sisi telah terisi), sehingga peningkatan laju enzim bukanlah yang
akan diperoleh bila energi pengikatan yang besar digunakan untuk
mendestabilisasi kompleks enzim-substrat (E.S).
Jika sebagian energi ikatan digunakan untuk memasukkan
tegangan atau distorsi ke dalam molekul enzim atau substrat, maka
ikatan keadaan transisi yang lebih kuat dicapai, dan afinitas ikatan
enzim pada substrat akan berkurang.
Banyak enzim yang mempunyai afinitas ikatan pada substratnya
yang besarnya sekitar rata-rata konsentrasi fisiologis, kemungkinan
sebagai akibat dari tekanan evolusioner untuk katalisis efisien.
Analisis sinar-x pada kristal karboksipeptidase A (suatu eksopeptidase
pankreatik) yang berikatan dengan pseudo substrat (substrat palsu yang
tidak didegradasi oleh enzim, yakni suatu inhibitor), menunjukkan
bahwa ikatan peptida yang peka telah berputar, menyimpang dari
konfigurasi planar normal yang biasa terlihat dalam ikatan peptida.
Distorsi ini menimbulkan hilangnya energi resonansi dalam ikatan,
yang meningkatkan kepekaannya terhadap serangan hidrolisis.
Dalam katalisis, kompleks enzim-substrat didestabilisasi dan energi
dilepaskan ketika pembentukan keadaan transisi. Hal ini menyebabkan
enzim mengikat substrat dengan sangat kuat dalam keadaan transisi.
Beberapa enzim bisa terinhibisi secara dramatis oleh yang disebut
analog keadaan transisi. Keadaan transisi normalnya berumur sangat
pendek (<10-13 s), tetapi analognya merupakan struktur stabil yang
menyerupai kompleks keadaan transisi yang sebenarnya.
Prolin rasemase adalah suatu enzim bakteri yang mengkatalisis
perubahan timbal balik isomer D dan L prolin:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 260
Dalam katalisis, kompleks enzim-substrat didestabilisasi dan energi
dilepaskan ketika pembentukan keadaan transisi. Hal ini menyebabkan enzim
mengikat substrat dengan sangat kuat dalam keadaan transisi. Beberapa
enzim bisa terinhibisi secara dramatis oleh yang disebut analog keadaan
transisi. Keadaan transisi normalnya berumur sangat pendek (<10
-13
s), tetapi
analognya merupakan struktur stabil yang menyerupai kompleks keadaan
transisi yang sebenarnya.
Prolin rasemase adalah suatu enzim bakteri yang mengkatalisis
perubahan timbal balik isomer D dan L prolin:
N
H H
H H
H
H
H
H
COO
-
N
H H
H H
H
H
H
COO
-
H
L-Prolin D-Prolin
Dalam perubahan dari isomer L menjadi isomer D, suatu konfigurasi planar
(bukan tetrahedral seperti biasanya) molekul terdapat hanya sesaat pada
karbon .
N
H H
COO
-
H
H
Pirol 2-karboksilat
Analog planar dari prolin adalah pirol 2-karboksilat, yang merupakan inhibitor
kuat untuk rasemase, yakni menaikkan inhibisi sebesar 50 persen pada
konsentrasi yang 160 kali lebih rendah daripada konsentrasi D- atau L-prolin
yang membentuk 50 persen ikatan. Ini adalah contoh yang baik untuk suatu
analog keadaan transisi.
Ketika berinteraksi, baik enzim maupun substrat akan mengalami
perubahan. Konsep induced fit (kecocokan pemasukan) suatu sisi aktif pada
substrat menekankan adaptasi sisi aktif untuk mencocokkan gugus fungsi pada
BIOKIMIA: Struktur dan Fungsi Biomolekul 274
Dalam perubahan dari isomer L menjadi isomer D, suatu kon-
figurasi planar (bukan tetrahedral seperti biasanya) molekul terdapat
hanya sesaat pada karbon a.
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 260
Dalam katalisis, kompleks enzim-substrat didestabilisasi dan energi
dilepaskan ketika pembentukan keadaan transisi. Hal ini menyebabkan enzim
mengikat substrat dengan sangat kuat dalam keadaan transisi. Beberapa
enzim bisa terinhibisi secara dramatis oleh yang disebut analog keadaan
transisi. Keadaan transisi normalnya berumur sangat pendek (<10
-13
s), tetapi
analognya merupakan struktur stabil yang menyerupai kompleks keadaan
transisi yang sebenarnya.
Prolin rasemase adalah suatu enzim bakteri yang mengkatalisis
perubahan timbal balik isomer D dan L prolin:
N
H H
H H
H
H
H
H
COO
-
N
H H
H H
H
H
H
COO
-
H
L-Prolin D-Prolin
Dalam perubahan dari isomer L menjadi isomer D, suatu konfigurasi planar
(bukan tetrahedral seperti biasanya) molekul terdapat hanya sesaat pada
karbon .
N
H H
COO
-
H
H
Pirol 2-karboksilat
Analog planar dari prolin adalah pirol 2-karboksilat, yang merupakan inhibitor
kuat untuk rasemase, yakni menaikkan inhibisi sebesar 50 persen pada
konsentrasi yang 160 kali lebih rendah daripada konsentrasi D- atau L-prolin
yang membentuk 50 persen ikatan. Ini adalah contoh yang baik untuk suatu
analog keadaan transisi.
Ketika berinteraksi, baik enzim maupun substrat akan mengalami
perubahan. Konsep induced fit (kecocokan pemasukan) suatu sisi aktif pada
substrat menekankan adaptasi sisi aktif untuk mencocokkan gugus fungsi pada
Analog planar dari prolin adalah pirol 2-karboksilat, yang
merupakan inhibitor kuat untuk rasemase, yakni menaikkan inhibisi
sebesar 50 persen pada konsentrasi yang 160 kali lebih rendah daripada
konsentrasi D- atau L-prolin yang membentuk 50 persen ikatan. Ini
adalah contoh yang baik untuk suatu analog keadaan transisi.
Ketika berinteraksi, baik enzim maupun substrat akan mengalami
perubahan. Konsep induced fit (kecocokan pemasukan) suatu sisi aktif
pada substrat menekankan adaptasi sisi aktif untuk mencocokkan
gugus fungsi pada substrat. Substrat yang lemah atau inhibitor tidak
memasukkan konformasi yang benar pada sisi aktif.
Heksokinase menunjukkan fenomena induced fit. Enzim ini
mengkatalisis transfer fosforil dari ATP ke C-6 pada glukosa seperti
berikut:
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 261
substrat. Substrat yang lemah atau inhibitor tidak memasukkan konformasi
yang benar pada sisi aktif.
Heksokinase menunjukkan fenomena induced fit. Enzim ini mengkatalisis
transfer fosforil dari ATP ke C-6 pada glukosa seperti berikut:
O
H
HO
H
OH H
OH
CH
2
OH
H
H
OH
ATP ADP
O
H
HO
H
OH H
OH
CH
2
OPO
3
2-
H
H
OH
Glukosa Glukosa 6-fosfat
Enzim ini juga bisa mengkatalisis transfer fosforil ujung dari ATP kepada air.
Dalam hal ini enzim tersebut bekerja sebagai ATPase, tetapi dengan laju 5 x
10
6
kali lebih lambat daripada reaksi pada persamaan di atas. Sifat basa dan
sifat nukleofilik pada air dibandingkan dengan hidroksil pada C-6 glukosa
adalah cukup mirip sehingga dikira tidak ada perbedaan besar pada laju
reaksinya. Karena itu, penjelasan mengenai perbedaan laju adalah bahwa
glukosa menyebabkan perubahan konformasi hingga membentuk geometri sisi
aktif yang tepat pada enzim, sedangkan molekul air terlalu kecil untuk
melakukan hal yang sama.
Terbentuknya geometri yang tepat dalam sisi aktif enzim menyebabkan
substrat yang baik dapat terikat dengan energi ikatan. Penjelasan lain
mengenai induced fit adalah bahwa beberapa molekul kecil (seperti H
2
O dalam
contoh heksokinase) terikat secara non produktif, yakni ukurannya yang kecil
menyebabkan banyaknya kemungkinan orientasi dengan substrat lain (ATP
dalam contoh heksokinase) yang tidak menimbulkan reaksi. Substrat besar
pergerakannya terbatas dan terdapat dalam orientasi yang tepat jutaan kali
lebih sering selama vibrasi molekul daripada molekul kecil seperti air.
Bab 6 Katalis dan Kinetika Enzim 275
Enzim ini juga bisa mengkatalisis transfer fosforil ujung dari ATP
kepada air. Dalam hal ini enzim tersebut bekerja sebagai ATPase, tetapi
dengan laju 5 x 106 kali lebih lambat daripada reaksi pada persamaan
di atas. Sifat basa dan sifat nukleofilik pada air dibandingkan dengan
hidroksil pada C-6 glukosa adalah cukup mirip sehingga dikira tidak ada
perbedaan besar pada laju reaksinya. Karena itu, penjelasan mengenai
perbedaan laju adalah bahwa glukosa menyebabkan perubahan
konformasi hingga membentuk geometri sisi aktif yang tepat pada enzim,
sedangkan molekul air terlalu kecil untuk melakukan hal yang sama.
Terbentuknya geometri yang tepat dalam sisi aktif enzim menye-
babkan substrat yang baik dapat terikat dengan energi ikatan. Penjela-
san lain mengenai induced fit adalah bahwa beberapa molekul kecil
(seperti H
2
O dalam contoh heksokinase) terikat secara non produktif,
yakni ukurannya yang kecil menyebabkan banyaknya kemungkinan
orientasi dengan substrat lain (ATP dalam contoh heksokinase) yang
tidak menimbulkan reaksi. Substrat besar pergerakannya terbatas dan
terdapat dalam orientasi yang tepat jutaan kali lebih sering selama vi-
brasi molekul daripada molekul kecil seperti air.
4. PENINGKATAN LAJU DAN ENERGI AKTIVASI
Sebagian zat biokimia bersifat stabil dalam bentuk murni, tetapi terurai
dengan cepat bila terdapat enzim. Ada perbedaan penting antara
stabilitas termodinamik (dilukiskan sebagai tetapan kesetimbangan
reaksi) dan stabilitas kinetik suatu zat. Stabilitas kinetik yakni seberapa
cepat reaksi berlangsung, sedangkan stabilitas termodinamik yakni
posisi akhir reaksi yang dilukiskan dalam bentuk jumlah relatif substrat
dan produk pada kesetimbangan. Enzim mempengaruhi stabilitas
kinetik suatu zat.
Kebanyakan molekul organik pereduksi (misalnya glukosa) tidak
stabil menurut termodinamika dalam atmosfir bumi yang cenderung
mengoksidasi.
glukosa + 6O
2
6CO
2
+ 6H
2
O DG0 = 2.872 kJ mol
-1
BIOKIMIA: Struktur dan Fungsi Biomolekul 276
Karena itu, oksidasi sangatlah eksergonik (menghasilkan panas),
dan reaksinya memiliki DG0 reaksi yang besar. Tetapi seperti diketa-
hui, glukosa bersifat stabil ketika dibiarkan. Dengan demikian, glukosa
tidak stabil menurut termodinamika, tetapi stabil menurut kinetika.
Perbedaan antara stabilitas kinetika dan stabilitas termodinamika
sangatlah penting. Perbedaan ini dijelaskan dengan konsep energi bebas
aktivasi yang diperlukan untuk mengubah substrat ke dalam keadaan
transisinya, yakni substrat harus melampaui suatu batasan energi.
Batasan energi adalah energi bebas pada keadaan transisi, DG. Teori
keadaan transisi ini diperkenalkan oleh H. Eyring yang mengkaitkan
laju reaksi dengan besarnya DG.
Pada tahun 1880-an, Arrhenius mengamati bahwa tetapan laju
k untuk reaksi kimia sederhana bervariasi tergantung suhu menurut
persamaan berikut:
k = Ae
Ea/RT
dengan E
z
adalah yang disebut sebagai energi aktivasi Arrhenius pada
reaksi, A adakah faktor preeksponensial, R adalah tetapan gas universal,
dan T adalah suhu (K). Akan tetapi kemudian menjadi jelas bahwa
A bisa saja bergantung suhu, terutama dalam reaksi dengan katalis.
Karena itu Eyring mengusulkan bahwa semua keadaan transisi terurai
dengan tetapan laju yang sama, yaitu kT/h; dengan k adalah tetapan
Boltzmann dan h adalah tetapan Planck. Eyring mengusulkan bahwa
untuk reaksi apapun,
/RT G
kT
k e
h

=
dengan DG adalah energi aktivasi kompleks keadaan transisi.
Energi bebas Gibbs suatu sistem diperoleh dari dua komponen, yakni
DG = DH TDS
dengan DS adalah perubahan entropi dan DH adalah perubahan
entalpi dalam sistem reaksi. Dengan demikian, bisa ditulis persamaan
Bab 6 Katalis dan Kinetika Enzim 277
/RT H
kT
k e
h


=


Entropi merupakan kesatuan termodinamik kesetimbangan yang
ditafsirkan secara mekanik sebagai derajat ketidakteraturan dalam suatu
sistem. Dari persamaan di atas, terlihat bahwa (1) faktor preeksponensial
A bisa ditafsirkan memiliki kaitan dengan penyusunan suatu reaktan
dalam enzim sebagai kompleks keadaan transisi yang terbentuk, dan
(2) faktor eksponensial berkaitan dengan entalpi (panas) reaksi.
Faktor molekul apapun yang cenderung menstabilkan keadaan
transisi akan menurunkan DG sehingga meningkatkan laju reaksi.
Dengan demikian, peningkatan laju ini bisa berasal dari efek entropi
atau entalpi, atau dari keduanya.
5. MUTAGENESIS SISI-TERARAH (SITE-DIRECTED MUTAGENESIS)
Pemahaman mengenai mekanisme reaksi enzim telah berhasil diperoleh
melalui studi perbandingan enzim-enzim dari berbagai sumber,
misalnya isoenzim yang berbeda, atau enzim dari spesies yang berbeda.
Namun, jumlah variasi yang tersedia dari sumber ini seringkali terbatas.
Modifikasi lebih lanjut pada aktivitas enzimatik telah ditemukan
melalui penelitian efek aktivitas enzimatik dari suatu modifikasi kimia
tertentu. Dengan adanya metode untuk kloning dan ekspresi DNA,
telah dikembangkan metode-metode untuk modifikasi tertentu pada
enzim melalui site-directed mutagenesis, yakni pengubahan suatu
gen untuk menghasilkan protein dengan perubahan tertentu dalam
urutannya. Studi perbandingan pada enzim-enzim mutan seperti ini
di antara satu sama lain, serta dengan wild type enzim tersebut, telah
memungkinkan diperolehnya informasi bernilai mengenai peranan
residu asam amino tertentu dalam proses pengikatan substrat, katalisis,
stabilitas enzim, serta regulasi.
Spesifisitas tripsin terhadap ikatan peptida yang bersebelahan
dengan lisin dan arginin telah diubah dengan menggantikan residu glisin
dalam sisi aktif enzim dengan residu alanin, yang membawa gugus metil
BIOKIMIA: Struktur dan Fungsi Biomolekul 278
tambahan. Penggantian ini memilih pengikatan lisin daripada arginin
yang lebih besar.
Dalam mekanisme katalisis serin protease subtilisin, interme-
diet tetrahedral diyakini terstabilkan oleh ikatan hidrogen pada rantai
samping Asn 155. Penggantian Asn 155 dengan Gly tidak mempenga-
ruhi pengikatan substrat, tetapi menginhibisi langkah katalisis. Hal ini
menguatkan mekanisme yang diusulkan.
Berdasarkan penelitian mengenai modifikasi kimia, Tyr 198 dari
karboksipeptidase A dahulu disangka berperan sebagai donor proton
(yakni asam pada umumnya) dalam mekanisme katalisis. Akan tetapi,
ketika Tyr 198 digantikan dengan Phe dengan cara site-directed
mutagenesis, enzim modifikasi ini tetap memiliki aktivitas enzimatik
aslinya. Hal ini menandakan bahwa tirosil hidroksil kemungkinan
tidak memiliki peran spesifik dalam katalisis.
Penghilangan aktivitas dengan cara mutagenesis tidak selalu
menandakan peranan katalisis residu yang termutasi. Penggantian satu
asam amino dengan asam amino lainnya mungkin saja menghapus in-
teraksi spesifik yang penting untuk pelipatan lokal atau bahkan stabili-
tas protein keseluruhan. Dalam penelitian mengenai hal ini, penting
untuk memantau konformasi protein setelah mutagenesis. Akan lebih
membantu bila tersedia struktur detil bentuk enzim wild-type serta
enzim mutan, baik yang berasal dari kristalografi sinar-x atau yang be-
rasal dari analisis NMR.
6. KINETIKA ENZIM
Kinetika enzim berkaitan dengan pengukuran laju reaksi enzimatik, serta
dengan faktor-faktor yang mempengaruhi laju tersebut. Faktor-faktor
penting yang mempengaruhi laju reaksi enzimatik adalah konsentrasi
substrat dan enzim, pH, suhu, dan adanya kofaktor serta ion logam.
Penting untuk mempelajari mengenai faktor-faktor ini. Ada kalanya
diperlukan optimalisasi laju reaksi tertentu. Laju yang tergantung pada
variabel percobaan juga memungkinkan untuk memilih model-model
Bab 6 Katalis dan Kinetika Enzim 279
yang mungkin untuk memperkirakan bagaimana enzim berfungsi
(mekanismenya).
Selain aspek-aspek percobaan kinetika enzim, rancangan perco-
baan, dan metode penentuan kemajuan reaksi enzimatik, aspek pent-
ing lainnya adalah penafsiran data. Aspek ini biasanya tergantung pada
penulisan matematik untuk skema model reaksi, yang meramalkan
bagaimana laju tergantung pada variabel reaksi. Persamaan-persamaan
matematik ini kemudian diuji konsistensinya dengan data percobaan,
yang mungkin menghasilkan penolakan model-model yang tidak ses-
uai dengan sifat-sifat yang diukur.
Untuk langkah tunggal yang irreversibel dalam suatu reaksi kimia
(yakni suatu proses kimia dasar), laju reaksi sebanding dengan kon-
sentrasi reaktan yang terlibat dalam proses tersebut. Tetapan keseband-
ingan ini disebut tetapan laju, atau kesatuan tetapan laju untuk me-
nyoroti fakta bahwa tetapan ini diterapkan pada proses dasar. Ungka-
pan laju juga menggunakan aktivitas kimia dan bukan hanya konsen-
trasi, melainkan koefisien aktivitas dalam sistem biologis yang biasanya
mendekati 1.
Penerapan prinsip reaksi massa pada skema reaksi
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 265
6. KINETIKA ENZIM
Kinetika enzim berkaitan dengan pengukuran laju reaksi enzimatik,
serta dengan faktor-faktor yang mempengaruhi laju tersebut. Faktor-faktor
penting yang mempengaruhi laju reaksi enzimatik adalah konsentrasi substrat
dan enzim, pH, suhu, dan adanya kofaktor serta ion logam. Penting untuk
mempelajari mengenai faktor-faktor ini. Ada kalanya diperlukan optimalisasi laju
reaksi tertentu. Laju yang tergantung pada variabel percobaan juga
memungkinkan untuk memilih model-model yang mungkin untuk
memperkirakan bagaimana enzim berfungsi (mekanismenya).
Selain aspek-aspek percobaan kinetika enzim, rancangan percobaan,
dan metoda penentuan kemajuan reaksi enzimatik, aspek penting lainnya
adalah penafsiran data. Aspek ini biasanya tergantung pada penulisan
matematik untuk skema model reaksi, yang meramalkan bagaimana laju
tergantung pada variabel reaksi. Persamaan-persamaan matematik ini
kemudian diuji konsistensinya dengan data percobaan, yang mungkin
menghasilkan penolakan model-model yang tidak sesuai dengan sifat-sifat
yang diukur.
Untuk langkah tunggal yang irreversibel dalam suatu reaksi kimia
(yakni suatu proses kimia dasar), laju reaksi sebanding dengan konsentrasi
reaktan yang terlibat dalam proses tersebut. Tetapan kesebandingan ini
disebut tetapan laju, atau kesatuan tetapan laju untuk menyoroti fakta bahwa
tetapan ini diterapkan pada proses dasar. Ungkapan laju juga menggunakan
aktivitas kimia dan bukan hanya konsentrasi, melainkan koefisien aktivitas
dalam sistem biologis yang biasanya mendekati 1.
Penerapan prinsip reaksi massa pada skema reaksi
A + B P + Q
k
1
k
-1
dengan tetapan laju reaksi ke depan k
1
dan tetapan laju reaksi kebalikannya k
-1
memberikan ungkapan laju reaksi ke depan dan kebalikan:
laju ke depan = k
1
[A][B]
laju kebalikan = k
-1
[P][Q]
dengan tetapan laju reaksi ke depan k1 dan tetapan laju reaksi
kebalikannya k-1 memberikan ungkapan laju reaksi ke depan dan
kebalikan:
laju ke depan = k1[A][B]
laju kebalikan = k-1[P][Q]
dengan kurung kotak menandakan konsentrasi dalam mol L
-1
. Pada
kesetimbangan kimia, kedua laju reaksi ini besarnya sama sehingga
tidak ada hasil akhir dari reaktan apapun. Sehingga,
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 266
dengan kurung kotak menandakan konsentrasi dalam mol L
-1
. Pada
kesetimbangan kimia, kedua laju reaksi ini besarnya sama sehingga tidak ada
hasil akhir dari reaktan apapun. Sehingga,
e
e e
e e
K
k
k

[B] [A]
[Q] [P]
1
1
dengan K
e
adalah tetapan kesetimbangan dan subscript e menandakan besar
konsentrasi kesetimbangan.
Secara sederhana, laju reaksi adalah perubahan konsentrasi suatu
jenis per satuan waktu, sehingga dapat ditulis secara matematik sebagai
turunan. Namun, ungkapan matematik untuk laju keseluruhan perubahan
tersebut (misalnya [A]) harus termasuk fluxes (dari bahasa Yunani yang berarti
mengalir) ke depan dan sebaliknya, misalnya
[P][Q] [A][B]
[A]
1 1
k k
dt
d
Molekularitas adalah jumlah molekul yang terlibat dalam reaksi dasar.
Biasanya hanya dua molekul yang bergabung membentuk produk
(molekularitas = 2) atau satu molekul tunggal mengalami reaksi fisi
(molekularitas = 1). Contoh soal di atas menunjukkan reaksi yang dalam
proses ke depan maupun kebalikannya mempunyai molekularitas sebesar dua.
Orde reaksi adalah jumlah kekuatan, yakni konsentrasi (atau aktivitas kimia)
yang meningkat dalam suatu ungkapan laju.
Dalam reaksi orde pertama
A P
k
ungkapan untuk perubahan laju [A] adalah
[A]
[A]
k
dt
d

Sisi sebelah kiri pada ungkapan di atas mempunyai satuan laju reaksi (mol L
-1
s
-1
), sehingga satuan ini juga harus diterapkan pada sisi sebelah kanan
(keseimbangan dimensi). Karena itu, satuan k[A] haruslah mol L
-1
s
-1
, yang
BIOKIMIA: Struktur dan Fungsi Biomolekul 280
dengan Ke adalah tetapan kesetimbangan dan subscript e menandakan
besar konsentrasi kesetimbangan.
Secara sederhana, laju reaksi adalah perubahan konsentrasi suatu
jenis per satuan waktu, sehingga dapat ditulis secara matematik sebagai
turunan. Namun, ungkapan matematik untuk laju keseluruhan
perubahan tersebut (misalnya [A]) harus termasuk fluxes (dari bahasa
Yunani yang berarti mengalir) ke depan dan sebaliknya, misalnya
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 266
dengan kurung kotak menandakan konsentrasi dalam mol L
-1
. Pada
kesetimbangan kimia, kedua laju reaksi ini besarnya sama sehingga tidak ada
hasil akhir dari reaktan apapun. Sehingga,
e
e e
e e
K
k
k

[B] [A]
[Q] [P]
1
1
dengan K
e
adalah tetapan kesetimbangan dan subscript e menandakan besar
konsentrasi kesetimbangan.
Secara sederhana, laju reaksi adalah perubahan konsentrasi suatu
jenis per satuan waktu, sehingga dapat ditulis secara matematik sebagai
turunan. Namun, ungkapan matematik untuk laju keseluruhan perubahan
tersebut (misalnya [A]) harus termasuk fluxes (dari bahasa Yunani yang berarti
mengalir) ke depan dan sebaliknya, misalnya
[P][Q] [A][B]
[A]
1 1
k k
dt
d
Molekularitas adalah jumlah molekul yang terlibat dalam reaksi dasar.
Biasanya hanya dua molekul yang bergabung membentuk produk
(molekularitas = 2) atau satu molekul tunggal mengalami reaksi fisi
(molekularitas = 1). Contoh soal di atas menunjukkan reaksi yang dalam
proses ke depan maupun kebalikannya mempunyai molekularitas sebesar dua.
Orde reaksi adalah jumlah kekuatan, yakni konsentrasi (atau aktivitas kimia)
yang meningkat dalam suatu ungkapan laju.
Dalam reaksi orde pertama
A P
k
ungkapan untuk perubahan laju [A] adalah
[A]
[A]
k
dt
d

Sisi sebelah kiri pada ungkapan di atas mempunyai satuan laju reaksi (mol L
-1
s
-1
), sehingga satuan ini juga harus diterapkan pada sisi sebelah kanan
(keseimbangan dimensi). Karena itu, satuan k[A] haruslah mol L
-1
s
-1
, yang
Molekularitas adalah jumlah molekul yang terlibat dalam reaksi
dasar. Biasanya hanya dua molekul yang bergabung membentuk
produk (molekularitas = 2) atau satu molekul tunggal mengalami
reaksi fisi (molekularitas = 1). Contoh soal di atas menunjukkan
reaksi yang dalam proses ke depan maupun kebalikannya mempunyai
molekularitas sebesar dua.
Orde reaksi adalah jumlah kekuatan, yakni konsentrasi (atau
aktivitas kimia) yang meningkat dalam suatu ungkapan laju.
Dalam reaksi orde pertama
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 266
dengan kurung kotak menandakan konsentrasi dalam mol L
-1
. Pada
kesetimbangan kimia, kedua laju reaksi ini besarnya sama sehingga tidak ada
hasil akhir dari reaktan apapun. Sehingga,
e
e e
e e
K
k
k

[B] [A]
[Q] [P]
1
1
dengan K
e
adalah tetapan kesetimbangan dan subscript e menandakan besar
konsentrasi kesetimbangan.
Secara sederhana, laju reaksi adalah perubahan konsentrasi suatu
jenis per satuan waktu, sehingga dapat ditulis secara matematik sebagai
turunan. Namun, ungkapan matematik untuk laju keseluruhan perubahan
tersebut (misalnya [A]) harus termasuk fluxes (dari bahasa Yunani yang berarti
mengalir) ke depan dan sebaliknya, misalnya
[P][Q] [A][B]
[A]
1 1
k k
dt
d
Molekularitas adalah jumlah molekul yang terlibat dalam reaksi dasar.
Biasanya hanya dua molekul yang bergabung membentuk produk
(molekularitas = 2) atau satu molekul tunggal mengalami reaksi fisi
(molekularitas = 1). Contoh soal di atas menunjukkan reaksi yang dalam
proses ke depan maupun kebalikannya mempunyai molekularitas sebesar dua.
Orde reaksi adalah jumlah kekuatan, yakni konsentrasi (atau aktivitas kimia)
yang meningkat dalam suatu ungkapan laju.
Dalam reaksi orde pertama
A P
k
ungkapan untuk perubahan laju [A] adalah
[A]
[A]
k
dt
d

Sisi sebelah kiri pada ungkapan di atas mempunyai satuan laju reaksi (mol L
-1
s
-1
), sehingga satuan ini juga harus diterapkan pada sisi sebelah kanan
(keseimbangan dimensi). Karena itu, satuan k[A] haruslah mol L
-1
s
-1
, yang
ungkapan untuk perubahan laju [A] adalah
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 266
dengan kurung kotak menandakan konsentrasi dalam mol L
-1
. Pada
kesetimbangan kimia, kedua laju reaksi ini besarnya sama sehingga tidak ada
hasil akhir dari reaktan apapun. Sehingga,
e
e e
e e
K
k
k

[B] [A]
[Q] [P]
1
1
dengan K
e
adalah tetapan kesetimbangan dan subscript e menandakan besar
konsentrasi kesetimbangan.
Secara sederhana, laju reaksi adalah perubahan konsentrasi suatu
jenis per satuan waktu, sehingga dapat ditulis secara matematik sebagai
turunan. Namun, ungkapan matematik untuk laju keseluruhan perubahan
tersebut (misalnya [A]) harus termasuk fluxes (dari bahasa Yunani yang berarti
mengalir) ke depan dan sebaliknya, misalnya
[P][Q] [A][B]
[A]
1 1
k k
dt
d
Molekularitas adalah jumlah molekul yang terlibat dalam reaksi dasar.
Biasanya hanya dua molekul yang bergabung membentuk produk
(molekularitas = 2) atau satu molekul tunggal mengalami reaksi fisi
(molekularitas = 1). Contoh soal di atas menunjukkan reaksi yang dalam
proses ke depan maupun kebalikannya mempunyai molekularitas sebesar dua.
Orde reaksi adalah jumlah kekuatan, yakni konsentrasi (atau aktivitas kimia)
yang meningkat dalam suatu ungkapan laju.
Dalam reaksi orde pertama
A P
k
ungkapan untuk perubahan laju [A] adalah
[A]
[A]
k
dt
d

Sisi sebelah kiri pada ungkapan di atas mempunyai satuan laju reaksi (mol L
-1
s
-1
), sehingga satuan ini juga harus diterapkan pada sisi sebelah kanan
(keseimbangan dimensi). Karena itu, satuan k[A] haruslah mol L
-1
s
-1
, yang
Sisi sebelah kiri pada ungkapan di atas mempunyai satuan laju
reaksi (mol L
-1
s
-1
), sehingga satuan ini juga harus diterapkan pada
sisi sebelah kanan (keseimbangan dimensi). Karena itu, satuan k[A]
haruslah mol L
-1
s
-1
, yang menandakan bahwa k mempunyai satuan
s
-1
. Dengann demikian, analisis dimensional sederhana secara langsung
mengarah pada ungkapan umum untuk satuan-satuan bagi tetapan
tertentu dalam skema reaksi tertentu.
Bab 6 Katalis dan Kinetika Enzim 281
7. KETERGANTUNGAN LAJU REAKSI ENZIM PADA KONSENTRASI
SUBSTRAT
Dalam percobaan, pengaruh konsentrasi substrat pada laju reaksi
enzim dipelajari dengan mencatat kemajuan reaksi katalis enzim,
dengan menggunakan konsentrasi enzim yang tetap dan serangkaian
konsentrasi substrat yang berbeda-beda. Kecepatan awal (v0) diukur
sebagai kemiringan tangen dalam kurva kemajuan pada waktu t = 0.
Kecepatan awal ini digunakan, karena bisa saja terjadi degradasi enzim
selama reaksi atau inhibisi oleh produk reaksi, sehingga menimbulkan
hasil yang mungkin sulit untuk ditafsirkan.
Ketika [S]0 >> konsentrasi enzim, v
0
biasanya berbanding lurus
dengan konsentrasi enzim dalam campuran reaksi. Untuk kebanyakan
enzim, v0 adalah fungsi hiperbola dari [S]0 (Gambar 6-2). Jika terdapat
substrat-substrat lain (ko-substrat), maka konsentrasinya biasanya
dijaga tetap konstan selama rangkaian percobaan dengan [S]0 yang
bervariasi.
Katalis Enzim
Biokimia: Struktur dan Fungsi Biomolekul 267
menandakan bahwa k memp