Anda di halaman 1dari 6

1.

Tinjauan Pustaka
2.1. Melastoma malabathricum
Kingdom : Plantae
(unranked): Angiosperms
(unranked): Eudicots
(unranked): Rosids
Order

: Myrtales

Family

: Melastomataceae

Genus

: Melastoma

Species

: M. malabathricum

Gambar 1. Melastoma malabathricum (wikipedia.com)

Melastoma adalah salah satu genus dari famili Melastomataceae yang termasuk
dalam ordo Myrtales. Genus ini terdiri dari 22 spesies yang tersebar di Asia Tenggara,
India, Cina Selatan, Jepang dan Australia Utara. Melastoma malabathricum L.
merupakan salah satu spesies tumbuhan berkayu yang tumbuh di tanah asam dengan
keasaman yang sangat tinggi dan miskin unsur hara (seperti N dan P), dan tersebar di
daerah tropis Asia, Australia, dan Polynesia. Di Indonesia tumbuhan ini juga banyak
ditemukan tumbuh di tanah asam, khususnya tanah Podsolik Merah Kuning dengan
kelarutan aluminium (Al) yang tinggi yang menjadi faktor pembatas bagi pertumbuhan
tanaman. Ketahanan tanaman M. malabathricum L. pada tanah asam berhubungan
dengan kemampuannya mengakumulasi Al di daun tanpa menyebabkan gejala keracunan
dan bahkan Al memacu pertumbuhannya, sehingga tanaman ini dikenal juga sebagai
akumulator Al.
2.2. mRNA
mRNA adalah salah satu jenis RNA yang berfungsi sebagai pembawa kode genetik
dari DNA (transkripsi) dan membawanya ke ribosom daris el, dimana tRNA dapat
membaca kodon dan mulai penerjemahan.
2.3. cDNA
cDNA merupakan terminology genetic yang mengacu pada untai DNA yang
disintesis dari template RNA melalui suatu reaksi yang dikatalisis oleh enzim reverse
transcriptase dan DNA polymerase. cDNA disebut juga DNA komplemen, beruntai
tunggal atau untai ganda, disintesis invitro dari template mRNA menggunakan enzim
reverse transcriptase
2.4. RACE-PCR
Rapid Amplification of cDNA Ends (RACE) PCR adalah jenis dari RT-PCR yang
mengamplifikasi sekuens cDNA yang tidak diketahui yang cocok dengan ujung 3- atau
5- pada RNA. Ada dua strategi proses RACE-PCR, yakni 5 RACE dan 3 RACE.

Pada 5RACE, reaksi sintesis strand pertama


cDNA dipancing dengan menggunakan sebuah
oligonukleotida yang komplemen dengan
sekuens yang sudah diketahui pada gen. Setelah
menghilangkan RNA template, sisi tambahan
pada ujung 3 dari single strand cDNA dibentuk
dengan menggunakan terminal deoxynucleotidyl
transferase, yang menambahkan ekor nukleotida.
Reaksi amplifikasi mengikuti primer sisi
tambahan yang komplemen dengan ekor
nukletida dan primer lain yang komplemen
dengan sekuens yang sudah diketahui pada gen

Gambar 2. Diagram skema proses 5


RACE. (worlwide.promega.com)

Pada 3RACE, proses menggunakan primer


oligo(dT) yang sudah dimodifikasi sebagai
primer reverse transcription. Primer oligo(dT) ini
terdiri dari sekuens oligo(dT) yang dipanjangkan
ke ekor poly(A)+ mRNA, dan sebuah sekuens
adaptor pada ujung 5. Residu tunggal G, C, atau
A pada ujung 3 memastikan bahwa sintesis
cDNA dimulai hanya ketika primer/adaptor
memanjangkan seketika menuju pertemuan
antara ekor poly(A)+ dan ujung 3 pada RNA.

Gambar 3. Diagram skema proses


3RACE (worldwide.promega.com)

2.5. Triparental Mating


Triparental mating adalah suatu bentuk dari konjugasi bakterial dimana plasmid
konjugatif yang terdapat pada sebuah strain bakteri membantu proses transfer sebuah plasmid
yang bisa dimobilisasi yang ada pada strain bakteri kedua ke strain bakteri ketiga. Triparental

mating dapat membantu dalam menghadapi beberapa halangan dalam mobilisasi plasmid
yang efisien.

Gambar 4. Skema triparental mating (wikipedia.com)

2.6. Agrobacterium tumifaciens

Kingdom

: Bacteria

Phylum

: proteobacteria

Class

: Alphaproteobacteria

Order

: Rhizobiales

Family

: Rhizobiaceae

Genus

: Agrobacterium

Species

: A. tumefaciens

Gambar 5. A. tumifaciens (www.cals.ncsu.edu)

Bakteri A. tumefaciens adalah bakteri yang dapat menginfeksi tanaman dikotil seperti
tomat dan tembakau serta tanaman monokotil, khususnya padi. Infeksi ini terjadi karena selsel tumbuhan tidak mengandung plasmid alami yang dapat digunakan sebagai vektor kloning.
Infeksi berlangsung pada bagian tertentu plasmid Ti, yang disebut T-DNA, yang akan
terintegrasi ke dalam DNA kromosom tanaman, mengakibatkan terjadinya pertumbuhan selsel tanaman yang tidak terkendali. Akibatnya, akan terbentuk tumor atau crown gall.

Plasmid Ti rekombinan dengan suatu gen target yang disisipkan pada daerah T-DNA
dapat mengintegrasikan gen tersebut ke dalam DNA tanaman. Gen target ini selanjutnya akan
dieskpresikan menggunakan sistem DNA tanaman.
Dalam prakteknya, ukuran plasmid Ti yang begitu besar sangat sulit untuk dimanipulasi.
Namun, ternyata apabila bagian T-DNA dipisahkan dari bagian-bagian lain plasmid Ti,
integrasi dengan DNA tanaman masih dapat terjadi asalkan T-DNA dan bagian lainnya
tersebut masih berada di dalam satu sel bakteri A. tumefaciens. Dengan demikian, manipulasi
atau penyisipan fragmen DNA asing hanya dilakukan pada T-DNA dengan cara seperti
halnya yang dilakukan pada plasmid E.coli. Selanjutnya, plasmid T-DNA rekombinan yang
dihasilkan ditransformasikan ke dalam sel A. tumefaciens yang membawa plasmid Ti tanpa
bagian T-DNA. Perbaikan prosedur berikutnya adalah pembuangan gen-gen pembentuk
tumor yang terdapat pada T-DNA.

Gambar 6. Ti plasmid (bio3400.nicerweb.com)

(Bagian Isi)
3.1.Isolasi Fragmen cDNA CuZn-SOD
Fragmen cDNA CuZn-SOD diisolasi dengan PCR menggunakan sepasang
primer degenerate
primer forward SODF3; 5-ATG GTG AAG GCT GTG GCW GTT YTK A- 3
primer reverse SODR4; 5-ADG GCT GCA RRC CAA TRA TAC CAC A-3
yang didesain berdasarkan cDNA copper/zinc superoxide dismutase (CuZn-SOD)
dari beberapa tumbuhan dikotiledon. Hasil PCR dielektroforesis pada gel agarose 1%
(w/v) dengan larutan penyangga 1x TAE (0,9 mM Tris-HCl dan 2 mM EDTA pH
7.6). Pengurutan DNA terhadap fragmen MmCuZn-SOD menghasilkan 457 pb.
1 TTGGTGAAGGCTGTGGCTGTTCTTGGCAACAGCGAGGGTGTGAGCGGCACTGTCTACTTC
61 ACTCAAGAAG GAGATGGACC CACTACTGTG ACTGGGAGTC TTTCAGGCTT GAAGCCTGGA
121 CTCCACGGTTTCCATGTCCATGCTCTTGGGGACACTACCAACGGCTGCAT GTCTACTGGA
181 CCTCACTTCAATCCTGCCGGAAAGGAGCATGGTGCCCCTGAAGATGAGAACCGGCATGCA
241 GGTGACTTGGGCAATGTCACCGTTGGAGATGACGGTACTGCTACATTCACCATCACAGAC
301 AAGCAGATTCCTCTCTTTGGACCTAACTCTATTATTGGAAGGGCTGTTGTTGTCCATGCT
361 GATCCTGATGATCTCGGAAAGGGTGGCCATGAACTCAGCAAGTCGACTGGCAATGCTGGT
421 GGAAGGATTGCTTGTGGTATCATTGGTCTGCAGCCTT

Gambar 7. Urutan basa fragmen MmCuZn (Hannum, 2012)

3.2. Isolasi Gen Utuh MmCuZn SOD dengan RACE-PCR


Berdasarkan fragmen MmCuZn-SOD yang telah diperoleh (Gambar 7),
dirancang primer untuk mengisolasi ujung 5 dan 3 gen MmCuZn-SOD, yaitu :
a) primer SOD-3race (ACT TCA CTA CAA GAA GGA GAT GGA C) dari
basa ke 56 sampai dengan 79
b) SOD-3race-nested (ATG TCT ACT GGA CCT CAC TTC AAT C) dari basa
ke 169 sampai dengan 193
c) SOD-5race1 (AGT CGA CTT GCT GAG TTC AT) reverse komplemen dari
basa ke 389 sampai dengan 408
d) SOD-5race2 (GTC TGT GAT GGT GAA TGT AGC AGT A ) dari basa ke
276 sampai dengan 300.
Gen utuh MmCuZn-SOD dari M.malabathricum telah berhasil diisolasi
dengan ukuran sebesar 824 pb dengan metode 5 RACE dan 3RACE (Gambar 8)
dan telah disisipkan di plasmid pGEMT-Easy yang dinamakan pGEM-MmCuZnSOD (Gambar 9)
TTGAACGAACGACACAACAACGACACAACAGTCCTCATCGTACTGCT
CGGCGTCGTCTTCCCATTTTCTCTTCGAACTCGATAAGGGGTGCTCTGAGAT
CACAGGATTAAGAGGATGGTGAAGGCTGTGGTTGTTCTTGGCAACAGCGAG
GGTGTGAGCGGCACTGTCTACTTCACTCAAGAAGGAGATGGACCCACTACT
GTGACTGGGAGTCTTTCAGGCTTGAAGCCTGGACTCCACGGTTTCCATGTC
CATGCTCTTGGGGACACTACCAACGGCTGCATGTCTACTGGACCTCACTTCA
ATCCTGCCGGAAAGGAGCATGGTGCCCCTGAAGATGAGAACCGGCATGCAG
GTGACTTGGGCAATGTCACCGTTGGAGATGACGGTACTGCTACATTCACCA
TCACAGACAAGCAGATTCCTCTCTTTGGACCTAACTCTATTATTGGAAGGGC
TGTTGTTGTCCATGCTGATCCTGATGATCTCGGAAAGGGTGGCCATGAACT
CAGCAAGTCGACTGGCAATGCTGGTGGAAGGATTGCTTGTGGGATCATTGG

TCTCCAGGGTTAAGCTACCTCTGCTACGCTTCCGCCATGTCTCCTAGAGGTG
CTATGTTGGACTGTTTACCTTGTCTCGAATAATTGTGGCACCCTGTCTCCCT
TATGCTTAGAACTTTCTGCTCTTGCGATTGTACAAAATGGTGCAAATGTGCT
GAGTATAATTTCAGTGTAAAACCAAACCGGGTGTTACTGATCTTGGGTTTAG
ACAAGTGGTTGTTGTTGGGTTGGATCTACTTTGCTTAGCTTAACAGTGGATC
ATGC

Gambar 8. Urutan basa gen utuh MmCuZn-SOD (Hannum, 2012)

Gambar 9. Peta plasmid pGEM-MmCuZn-SOD (3839 pb) yang terdiri dari


vektor pGEM-T Easy (3015 pb) dan cDNA MmCuZn-SOD (824pb). (Hannum,
2012)