Anda di halaman 1dari 18

TUGAS BIOTEKNOLOGI FARMASI

IDENTIFIKASI PENYAKIT GENETIK

Oleh :
KELOMPOK 5
Nama

NIM

Stephani Rehulina

J1E110027

Marisa Juliani

J1E111004

Aulia Rizali

J1E111020

Farah Diba Hasanah

J1E111069

Sofhia Rinayah Dinnanni

J1E111071

Irvan Ipandi

J1E111202

Rismaya Amini

J1E111215

Reza Taupik Makhlupi

J1E111217

Nurul Huda Ika Praditya

J1E112016

A. Hadi Azhari

J1E112029

Amalia Ananda Sari

J1E112042

Hj. Annisa

J1E112068

Nasrullah

J1E112205

PROGRAM STUDI FARMASI


FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM
UNIVERSITAS LAMBUNG MANGKURAT
BANJARBARU
2014
1

IDENTIFIKASI PENYAKIT GENETIKA

A. Penyakit Genetika
Penyakit genetika adalah sebuah kondisi yang disebabkan oleh
kelainan oleh satu atau lebih gen yang menyebabkan sebuah kondisi yang
mencakup berbagai tingkat dalam rangkaian proses penerjemahan
informasi (ekspresi gen) genetik dari suatu organisme (Ishak, 2010).
Kelainan dan Penyakit genetik merupakan penyimpangan dari sifat umum
atau sifat rata rata manusia, serta merupakan penyakit yang muncul
karena tidak berfungsinya faktor faktor genetik yang mengatur struktur
dan fungsi fisiologi tubuh manusia (Elvita et al., 2008).
Berdasarkan sifat alelnya maka kelainan dan penyakit genetik
dapat digolongkan sebagai berikut :
1. Kelainan dan penyakit genetik yang disebabkan faktor alel dominan
autosomal
2. Kelainan dan penyakit genetik yang disebabkan faktor alel resesif
autosomal
3. Kelainan dan penyakit genetik yang disebabkan alel tertaut dengan
kromosom seks / kelamin
4. Kelainan dan penyakit geetik yang disebabkan oleh pengaruh aberasi
kromosom
(Elvita et al., 2008).
B. Macam-macam Penyakit Genetik
Penyakit von Willebrand (vWD)
Penyakit von Willebrand (vWD) adalah kelainan yang diwariskan
secara otosomal dengan gejala perdarahan, disebabkan mutasi gen faktor
von Willebrand (vWF) sehingga terjadi defisiensi atau disfungsi vWF. vWD
merupakan penyakit yang diwariskan melalui mekanisme genetik multipel.
(Sindunata & Probohoesodo, 2006).
Pewarisan Alel Resesif Autosomal
1. Anemia sel sabit
Penyakit anemia sel sabit disebabkan oleh substitusi suatu asam
amino tunggal dalam protein hemoglobin berisi sel sel darah merah.
Ketika kandungan oksigen darah individu yang diserang, dalam keadaan
rendah (misalnya pada saat berada ditempat yang tinggi atau pada wktu
mengalami ketegangan fisik), hemoglobin sel sabit akan mengubah
bentuk sel-sel darah merah menjadi bentuk sabit. Individu yang menderita
2

anemia sel sabit disimbolkan dengan ss. Sedangkan individu normal


memiliki genotipe SS dan karier anemia sel sabit disimbolkan dengan Ss.
2. Fibrosis sistik
Fibrosis sistik disebabkan oleh tidak adanya protein yang
membantu transpor ion klorida melalui membran plasma. Oleh karenanya
dihasilkan

banyak

lendir

yang

mempengaruhi

pankreas,

saluran

pernapasan, kelenjar keringat, dll. Fibrosis sistik disebabkan oleh alel


homozigot resesif (cc). Individu heterozigot (Cc) tidak menderita gejala
penyakit ini, namun merupakan karier.Sedangkan individu normal
bergenotipe (CC).
3. Galaktosemia
Galaktosemia disebabkan tidak dapat menggunakan galaktosa
(laktosa dari ASI ibu) karena tidak dihasilkan enzim pemecah laktosa.
Pada keadaan normal seharusnya laktosa dirombak menjadi glukosa dan
galaktosa, kemudian menjadi glukosa-1-fosfat yang kemudian dirombak
melalui proses glikolisis atau diubah menjadi glikogen). Tingkat galaktosa
yang tinggi pada darah dapat menyebabkan kerusakan mata, hati dan
otak. Gejala galaktosemia adalah malnutrisi, diare dan muntah muntah.
Gejala ini dapat dideteksi dengan pemeriksaan sampel urin. Gejala
galaktosemia dapat dihindari dengan diet bebas laktosa. Alel homozigot
resesif yang menyebabkan galaktosemia (gg). Individu yang normal
mempunyai alel (GG), sedangkan individu karier dengan alel (Gg).
4. Albino
Kelainan terjadi karena tubuh tidak mampu membentuk enzim yang
diperlukan untuk merubah asam amino tirosin menjadi beta-3,4dihidroksipheylalanin untuk selanjutnya diubah menjadi pigmen melanin.
Pembentukan enzim yang mengubah tirosin menjadi melanin, ditentukan
oleh gen dominan A, sehingga orang normal mempunyai genotipe AA
atau Aa, dan albino aa
5. Phenylketonuria
Phenylketonuria

merupakan

suatu

penyakit

keturunan

yang

disebabkan oleh ketidakberesan metabolisme,dimana penderita tidak

mampu melakukan metabolisme fenilalanin dengan normal.


6. Thalassemia
Thalassemia merupakan kelainan genetik yang ditandai dengan
berkurangnya atau tidak sama sekali sintesa rantai hemoglobin, sehingga
hanya mempunyai kemampuan sedikit untuk mengikat oksigen. Pada
thalassemia dimana eritrosit mempunyai gambaran : microcytic (kecil),
leptocytic

(lonjong)

dan

polycythemic

(banyak),

bercampur

baur

membentuk apa yang disebut target cell.


(Elvita et al., 2008).
Pewarisan Alel Dominan Autosomal
1. Akondroplasia
Akondroplasia disebabkan oleh tidak terbentuknya komponen
tulang rawan pada kerangka tubuh secara benar. Individu akondroplasia
dewasa mempunyai kaki dan lengan yang tidak normal (pendek) dengan
tinggi tubuh kurang dari 1,2 meter. Namun intelejensi, ukuran kepala, dan
ukuran tubuh normal. Individu penderita akondroplasia mempunyai
genotipe KK atau Kk. Sedangkan individu normal bergenotipe homozigot
resesif (kk).
2. Brakidaktili
Brakidaktili adalah suatu kelainan yang dicirikan dengan jari tangan
atau kaki yanng memendek karena memendeknya ruas-ruas tulang jari.
Penderita brakidaktili memiliki gen dalam keadaan heterozigot (Bb).
Individu yang memiliki gen dalam keadaan homozigot dominan (BB)
menyebabkan kematian pada masa embrio, sedangkan dalam keadaan
heterozigot hanya mempunyai dua ruas jari , karena ruas jari yang tengah
sangat pendek dan tumbuh menyatu dengan ruas jari lain. Individu
dengan gen homozigot resesif (bb) merupakan individu normal.
3. Huntington
Huntington merupakan suatu penyakit karena terjadi degenerasi
sistem saraf yang cepat dan tidak dapat balik. Penderita menggelengkan
kepala pada satu arah. Huntington disebabkan oleh alel dominan (H).
Oleh karena itu, dengan satu alel H saja semua individu yang heterozigot
4

akan mendapatkan Huntington. Individu normal mempunyai alel resesif


(hh).
4. Polidaktili
Polydactyly ialah terdapatnya jari tambahan pada satu atau kedua
tangan / kaki. Tempat jari tambahan itu berbeda - beda , ada yang
terdapat dekat ibu jari dan ada pula yang terdapat dari jari kelingking.
(Elvita et al., 2008).
Kelainan Dan Penyakit Karena Alel Resesif Tertaut Kromosom
Sex X
1. Hemofilia
Hemofilia merupakan gangguan koagulasi herediter yang paling
sering dijumpai. Hemofilia disebabkan oleh mutasi gen faktor VIII atau
faktor IX sehingga dapat dikelompokkan menjadi hemofilia A dan hemofilia
B. Perempuan yang homozigot resesif untuk gen ini merupakan penderita
(XhXh), sedangkan perempuan yang heterozigot (XhXH) pembekuan
darahnya normal namun ia hanya berperan sebagai pembawa / carier.
Seorang laki laki penderita hanya mempunyai satu genotip yaitu (XhY).
2. Buta Warna
Penderita tidak dapat membedakan warna hijau dan merah , atau
semua warna. Individu yang buta terhadap warna hijau (tipe deutan) dan
merah (tipe protan) dikarenakan individu tersebut tidak mempunyai
reseptor yang dapat mendeteksi cahaya pada panjang gelombang hijau
atau merah. Buta warna merupakan penyakit yang disebabkan oleh gen
resesif c (color blind) yang terdapat pada kromosom X. Perempuan
normal mempunyai genotip homozigotik dominan CC dan heterozigotik
Cc, sedangkan yang buta warna adalah homozigotik resesif cc. Laki laki
hanya mempunyai sebuah kromosom-X, sehingga hanya dapat normal XY
atau buta warna XcY.
3. Distrofi Otot
Kelainan tersebut ditandai dengan makin melemahnya otot otot
dan hilangnya koordinasi. Kelainan ini terjadi karena tidak adanya satu
protein otot penting yang disebut distrofin, yang terletak pada lokus yang
5

spesifik pada kromosom X


4. Sindrom Fragile X
Bagian kromosom X yang mengalami konstriksi (pelekukan)
dibagian ujung lengan kromosom yang panjang. Dari semua bentuk
keterbelakangan mental yang disebabkan oleh faktor genetik, bentuk yang
paling umum adalah fragile.
5. Sindrom Lesch-Nyhan
Penyakit ini timbul karena adanya pembentukan purin yang
berlebihan. Penderita memperlihatkan kelakuan yang abnormal, yakni
kejang otak yang tidak disadari serta menggeliatkan anggota kaki dan jari
kari tangan.
(Elvita et al., 2008).
Kelainan Genetik Karena Tertaut Kromosom Y
1. Hypertrichosis
Hypertrichosis, tumbuh rambut pada bagian bagian tertentu ditepi
dan telinga. Pada laki laki normal, akan memiliki gen dominan H. Gen
resesif h menyebabkan hypertrichosis.
2. Weebed Toes
Disebabkan oleh gen resesif wt sehingga tumbuh kulit diantara
tangan atau kaki mirip dengan kaki katak atau burung air. Alel dominan Wt
menentukan keadaan normal.
3. Hystrixgravier
Gen resesif hg menyebabkan pertumbuhan rambut panjang dan
kaku dipermukaan tubuh, sehingga terlihat menyerupai hewan landak
yang tubuhnya berduri. Alel dominan Hg menentukan pertumbuhan
rambut normal.
Kelainan Genetik Karena Aberasi Kromosom
1. Sindrom Jacobs (47, XYY atau 44A + XYY)
Penderita mempunyai 44 Autosom dan 3 kromosom kelamin
(XYY).Kelainan ini ditemukan oleh P.A. Jacobs pada tahun 1965 dengan
ciri ciri pria bertubuh normal, berperawakan tinggi, bersifat antisosial,
6

perilaku kasar dan agresif, wajah menakutkan, memperlihatkan watak


kriminal, IQ dibawah normal.
2. Sindrom Down (47,XY + 21 dan 47,XX + 21 )
Penderita mengalami kelebihan satu autosom pada kromosom
nomor 21 dan dapat terjadi pada laki-laki dan perempuan. Ciri-ciri tinggi
badan sekitar 120 cm, kepala lebar dan pendek, bibir tebal, lidah besar
dan menjulur, liur selalu menetes, jari pendek dan gemuk terutama
kelingking, telapak tangan tebal, mata sempit miring kesamping, gigi kecil
kecil dan jarang, IQ rendah, umumnya steril.
3. Sindrom Klinefelter (47, XXY atau 44A + XXY)
Penderita mempunyai 44 Autosom dan 3 kromosom kelamin
(XXY).Kelainan ini ditemukan oleh H.F. Klinefelter tahun 1942. Penderita
berjenis kelamin laki-laki tetapi cenderung bersifat kewanitaan, testis
mengecil dan mandul, payudara membesar, dada sempit, pinggul lebar,
rambut badan tidak tumbuh, tubuhnya cenderung tinggi (lengan dan
kakinya panjang), mental terbelakang.
4. Sindrom Turner (45,XO atau 44A + X)
Penderita mempunyai 44 Autosom dan hanya 1 kromosom kelamin
yaitu X. Penderita sindrom Turner berkelamin wanita, namun tidak
memiliki ovarium, alat kelamin bagian dalam terlambat perkembangannya
(infatil) dan tidak sempurna, steril, kedua puting susu berjarak melebar,
payudara tidak berkembang, badan cenderung pendek (kurang lebih 120
cm), dada lebar , leher pendek, mempunyai gelambir pada leher, dan
mengalami keterbelakangan mental.
5. Sindrom Edward (47,XY + 18 dan 47, XX + 18)
Penderita mengalami trisomi atau kelebihan satu Autosom nomor
18. Ciri ciri penderita adalah memiliki kelainan pada alat tubuh telinga dan
rahang bawah kedudukannya rendah, mulut kecil, mental terbelakang,
tulang dada pendek, umumnya hanya mencapai umur 6 bulan saja.

6. Sindrom Patau (47,XY + 13 dan 47, XX + 13)


Penderita mempunyai 45 Autosom, sehingga disebut trisomi.

Trisomi dapat terjadi pada kromosom nomor 13, 14 atau 15. Ciri-ciri
penderita kepala kecil, mata kecil, sumbing celah langit-langit, tuli,
polidaktili, mempunyai kelainan otak, jantung, ginjal dan usus serta
pertumbuhan mentalnya terbelakang. Biasanya penderita meninggal pada
usia kurang dari 1 tahun.
7. Sindrom Cri du chat
Anak yan dilahirkan dengan delesi pada kromosom nomor 5 ini
mempunyai mental terbelakang, memiliki kepala yang kecil dengan
penampakan wajah yang tidak biasa, dan memiliki tangisan yang
suaranya seperti suara kucing. Penderita biasanya meninggal ketika
masih bayi atau anak-anak.
(Elvita et al., 2008).
C. Cara mengidentifikasi penyakit genetik
Berbagai pengamatan bersifat konsisten dengan gagasan bahwa
suatu penyakit disebabkan oleh, setidaknya sebagian, oleh pewarisan gen
mutan. Ketika peristiwa dari suatu penyakit berhubungan berbagai
pengamatan tersebut, para ahli genetika akan menjadi sangat yakin
bahwa penyakit tersebut memiliki basis genetik. Beberapa bentuk
pengamatan yang dapat mengarahkan bahwa suatu penyakit berasal dari
faktor genetik adalah diantaranya sebagai berikut. Ketika seseorang
menunjukkan suatu penyakit, gangguan ini lebih mungkin terjadi karena
berhubungan dengan genetik daripada dengan yang ditemui dalam
populasi umum. Misalnya, seseorang dengan cystic fibrosis lebih mungkin
memiliki hubungan genetik dengan penyakit ini daripada terpilih secara
acak dari populasi umum (Brooker, 2009).
Suatu penyakit tidak menyebar pada individu yang berada pada
situasi lingkungan yang sama. Gangguan yang diturunkan tidak menyebar
dari orang ke orang. Penyakit yang menggunakan jalur genetik hanya
dapat dipindahkan dari orang tua pada keturunannya selama reproduksi
seksual. Populasi-populasi yang berbeda memiliki frekuensi yang berbeda
dari suatu penyakit. Dengan adanya faktor-faktor evolusioner, frekuensi
dari penurunan sifat basanya beragam pada populasi yang berbeda.
Misalnya, frekuensi penyakit anemia sel bulan sabit pada orang Afrika dan
Asia tertentu adalah yang tertinggi dan relatif rendah pada belahan dunia
lain (Brooker, 2009).
Suatu penyakit hanya berkembang pada kelompok umur tertentu.
Banyak gangguan genetik menunjukkan waktu onset yang khas saat
penyakit tersebut nampak. Efek dari beberapa gen mutan bermula selama
8

perkembangan embrionik pada janin, sehingga efeknya akan baru terlihat


saat individu lahir. Gangguan-gangguan genetik lainnya juga hanya
berkembang pada waktu tertentu selama masa hidup. Gangguan pada
manusia yang menyerupai suatu gangguan yang sudah diketahui memiliki
basis genetik pada suatu spesies hewan. Pada hewan, yang dapat
dilakukan eksperimen terhadapnya, berbagai penurunan sifat diketahui
diatur oleh gen-gen. Misalnya, fenotip albino ditemukan pada manusia
sebagaimanya pada banyak hewan lainnya (Brooker, 2009).
Suatu korelasi yang teramati antara suatu penyakit dan suatu gen
mutan manusia atau perubahan kromosom. Bagian dari bukti yang
meyakinkan bahwa suatu penyakit memiliki basis penyakit adalah
identifikasi dari gen atau kromosom yang berubah terjadi hanya pada
orang-orang yang menunjukkan gangguan terkait. Ketika membandingkan
dua individu, satu yang mengalami penyakit dan satu yang tidak, kita
mengharapkan akan tampak perbedaan dalam hal materi genetik mereka
jika gangguan yang terjadi memang memiliki komponen genetik.
Perubahan dalam urutan gen dapat ditentukan dengan kloning gen dan
teknik sekuensi DNA. Perubahan dalam struktur dan jumlah kromosom
juga dapatg diteteksi dengan pemeriksaan mikroskopik dari kromosom
(Brooker, 2009).
Ada beberapa cara yang dapat digunakan dalam mengidentifikasi
penyakit genetik pada janin. Pemeriksaan dilakukan sejak dalam
kandungan agar penyakit sudah dapat dihindari saat sudah lahir. Caracara tersebut diantaranya amniocentesis, PGD, dan chorionic villus
sampling.
a. Amniocentesis
Dokter akan memasukkan jarum yang sangat kecil ke bagian
dinding perut sampai masuk ke bagian rahim untuk mengambil contoh
cairan ketuban dari kantong yang menyelimuti janin. Cairan ini kemudian
daianlisa di laboratorium untuk mengetahui ada tidaknya kelainan genetik
atau perubahan kromosom. Hasil tes amniocentesis bisa diketahui dua
minggu kemudian.
b. Preimplantetion Genetic Diagnosis (PGD)
Pendekatan ini, melibatkan pengecekan genetik terhadap embrio
yang dihasilkan dari fertilisasi in vitro (di luar tubuh). Fertilisasi ini dalam
prosesnya melibatkan kombinasi sperma dan sel telur di luar tubuh si ibu.
Tes ini khususnya dilakukan untuk memeriksa abnormalitas genetik
tertentu, seperti alel-alel yang menyebabkan penyakit Huntington. PGD
dapat juga menentukan apakah embrio mengandung jumlah kromosom
yang pas atau tidak (disebut juga aneuploidy screening).
c. Chorionic Villus Sampling (CVS)

Sejumlah kecil dari chorion (bagian dalam plasenta janin) diambil,


dan karyotipe diolah secara langsung dari sel-sel yang dikumpulkan. CVS
dapat dilakukan lebih awal selama kehamilan daripada amniocentesis,
biasanya sekitar delapan hingga sepuluh minggu, hasilnya pun dapat
diketahui lebih cepat. Namun, perlu dipertimbangkan resiko keguguran
yang dapat terjadi pada CVS sedikit lebih besar dibandingkan cara lainnya
(Brooker, 2009).
Indentifiksi penyakit genetik dapat dilakukan dengan pendekatan
melalui teknologi DNA rekombinan.
a. Diagnosis gen langsung yang meliputi deteksi gen yang mutan
Diagnosis ini didasarkan pada pada indetifikasi perbedaan
kualititatif antara rangkaian DNA dalam gen yang normal versus dalam
gen yang abnormal. Ada 3 metode yang digunakan:
Sebagian mutasi mengubah atau menghancurkan tempat retriksi DNA
yang normal.
Analisis pelajak oligonukleotida digunakan ketika mutasi titik
menghasilkan gen abnormal yang tidak mengubah setiap tempat
restriksi yang diketahui.
Mutasi yang mengenai panjang DNA (misalnya penghapusan atau
pemanjangan DNA) dapat pula dideteksi dengan PCR
b. Diagnosis gen tak lansung atau anlisis kolerasi
Diagnosis ini digunakan apabila penyaki genetic belum biasa
dilakukan indetifikasi sehingga digunakan analisis korelasi yaitu yang
menentukan apakah anggota keluaga atau janin mewarisi region
kromosom releva yang sama dengan keluarga terdahulu yang terkena
penyakit genetic tersebut (Robbin & Cotran, 2008).
D. Metode yang dapat digunakan untuk identifikasi penyakit genetik
beserta prosedurnya
Metode untuk identifikasi penyakit von Willebrand yaitu dengan Tes
Fungsi FVIII (FVIII:C) yaitu kadar FVIII:C plasma sangat rendah (15%)
pada penderita vWD tipe 3. Pada penderita vWD tipe 1 atau tipe 2, FVIII
dapat menurun hingga normal. FVIII:C dapat membantu membedakan
VWD tipe 2N dan hemofilia A. Kadar FVIII:C dapat diperiksa dengan
metode FVIII:C satu tahap (one-stage FVIII activity assay). Pemeriksaan
ini menilai kemampuan plasma penderita mengkoreksi APTT yang
memanjang pada plasma yang kurang FVIII. Derajat koreksi plasma
penderita dibandingkan dengan plasma standar yang telah diketahui
kadar FVIII sehingga kadar FVIII plasma penderita dapat dihitung.
Rentang normal FVIII:C adalah 0,52,0 IU/ml (Sindunata &
Probohoesodo, 2006).

10

Pada penyakit thalasemia, metode yang dapat digunakan untuk


identifikasi penyakit genetik thalassemia yaitu : Metode polymerase chain
reaction- restriction fragment length polymorphism (PCR-RFLP) dan
Amplification Refractory Mutation System-polymerase chain reaction
(ARMS PCR). Metode PCR-RFLP digunakan untuk mencari mutasi
thalassemia yang umum. Metode ARMS PCR digunakan untuk
mendeteksi adanya delesi besar gen globin (Tamam et al., 2010).
Prosedur Polymerase Chain Reaction (PCR) dan Restriction
Fragment Length Polymorphism (RFLP) yaitu : Seluruh sampel darah
yang diperoleh dilakukan isolasi DNA dan dilanjutkan dengan PCR.
Pemeriksaan PCR menggunakan primers TLR dan TLF untuk
memperoleh basa target polimorfisme C-509T gen TGF B1. Gambaran
elektroforesis produk PCR berupa pita DNA sebesar 418 pb. Produk PCR
tersebut selanjutnya didigesti dengan enzim restriksi Eco8II, apabila
terpotong, gambaran elektroforesis memperlihatkan pita DNA sebesar 230
pb dan 188 pb, keadaan tersebut menandakan terdapatnya alel 509T,
sedangkan apabila tidak terpotong maka hanya terlihat produk PCR
sebesar 418 pb. Hal itu menandakan adanya alel 509C (normal).
Metode RFLP merupakan metode analisis polimorfisme dengan
menggunakan enzim spesifik. Primers yang digunakan untuk C-509T
adalah:
Forward 5CAGACTCTAGAGACTGCTAG3
Reverse 3GCTACCAGAGAAAGAGGAC5
Tabung berisi campuran PCR dimasukkan ke dalam mesin PCR
(Corbette) dengan kondisi PCR sebagai berikut: denaturasi awal pada
suhu 950C selama 4 menit, dilanjutkan ke siklus suhu yang terdiri dari:
Denaturasi pada suhu 950C selama 1 menit
Annealing pada suhu 570C selama 1 menit
Ekstensi pada suhu 720C selama 1 menit. Tahapan tersebut dilakukan
selama 35 siklus dan dilanjutkan ekstensi akhir pada suhu 72 0C
selama 10 menit.
Pemeriksaan RFLP untuk polimorfisme C-509T gen TGF B1
dengan menggunakan enzim Eco8II yang mempunyai daerah pengenalan
CCTANGG. Alel T akan terpotong menghasilkan fragmen 230 pb dan 188
pb, sedangkan alel C tidak terpotong dengan menggunakan enzim
tersebut (418 pb). Campuran enzim restriksi untuk polimorfisme C-509T
gen TGF B1 (volume 10 L) adalah 1 L 10x Buffer tango, 0,3 L enzim
Eco8II konsentrasi 10 / L, serta sebanyak 8,7 L hasil PCR. Seluruh
campuran ini disentrifus selama 20 detik dengan kecepatan 13.000 rpm,
dan kemudian diinkubasi pada suhu 370C selama 24 jam. Hasil inkubasi
dilakukan elektroforesis selama 60 menit dengan voltase tetap 100 volt.

11

Tahap berikutnya adalah elektroforesis pada gen agarosa (Riyanti et al.,


2013).
Anemia sel sabit adalah anemia hemolitika berat akibat adanya
defek pada molekul hemoglobin dan disertai dengan serangan nyeri.
Anemia sel sabit merupakan sejenis anemia kongenital dimana sel darah
merah berbentuk menyerupai sabit, karena adanya hemoglobin abnormal
(Noer, 1999). Hal-hal yang dapat menjadi penyebab anemia sel sabit
antara lain infeksi, disfungsi jantung, disfungsi paru, anastesi umum,
dataran tinggi, dan menyelam (Price & Wilson, 1995).
Berikut ini adalah contoh metode untuk identifikasi adanya penyakit
genetik anemia sel sabit yaitu:
a. Perancangan Sistem
Sistem yang akan dibuat ini menggunakan dua metode, yaitu metode
Freeman Chain Code dan metode Region Properties. Secara garis besar,
tahap yang digunakan untuk mengidentifikasi sel darah berbentuk sabit
dapat digambarkan pada blok diagram berikut:

12

Gambar 1. Blok diagram system menggunakan metode Freeman Chain


Code
Berdasarkan gambar 1, tahap yang pertama dilakukan adalah
tahap preprocessing. Tahap preprocessing diawali dengan proses
konversi citra asli menjadi citra grayscale, kemudian diubah menjadi citra
biner. Kemudian dilakukan noise removal untuk menghilangkan objekobjek kecil yang dianggap noise pada citra biner. Kemudian dilakukan
erosi, untuk mempertajam objek yang bebentuk sabit. Seteleh tahap
preprocessing

selesai,

kemudian

dilakukan

menggunakan metode Freeman Chain Code.

processing

dengan

Tahap ini dilakukan

sebanyak 2 kali, hal ini bertujuan untuk mengurangi kesalahan dalam


proses pengenalan objek sel darah. Kesalahan dalam mengenali objek
disebabkan oleh bentuk objek yang tidak jelas. Untuk mengatasi
permasalahan ini, dilakukan dilasi dan erosi setelah proses pengenalan
yang pertama. Hal ini dilakukan untuk memperbaiki struktur objek sel
darah.

Hasil

dari

proses

dilasi

dan

erosi

diidentifikasi

kembali

menggunakan metode Freeman Chain Code. Proses yang dilakukan


untuk mengenali objek adalah menghitung selisih nilai antar piksel pada
tepi setiap objek sel darah. Proses pengenalan dilakukan satu persatu
pada semua objek sel darah. Jika selisih nilai piksel pada tepian objek sel
darah memiliki nilai lebih besar dari 2 maka, objek tersebut akan dikenali
sebagai sel sabit. Sedangkan jika selisih nilai pikselnya lebih kecil dari 3
maka akan dikenali sebagai sel darah normal.
b. Preprocessing
Sebelum dilakukan processing menggunakan metode Freeman
Chain Code dan Region Properties perlu dilakukan preprocessing, pada
tahap preprocessing ini ada beberapa tahapan proses yang harus
dilakukan, antara lain:
1) Konversi citra RGB ke Grayscale
Proses konversi citra RGB ke citra grayscale adalah dengan
mengubah bobot atau kekuatan intensitas dari setiap komponen warna

13

dasar pada citra ke nilai yang sudah ditentukan dan kemudian


dikombinasikan sehingga didapatkan citra gray scale. Citra RGB yang
dikonversi ke citra grayscale dapat dilihat pada gambar 2. dimana citra
yang ditandai dengan huruf (a) merupakan citra asli sedangkan citra yang
ditandai dengan (b) merupakan citra grayscale.

Gambar 2. Konversi citra RGB menjadi grayscale.


2) Thresholding
Thresholding adalah proses mengubah citra berderajat keabuan
menjadi citra biner atau hitam putih sehingga dapat diketahui daerah
mana yang termasuk obyek dan background dari citra. Setelah dilakukan
proses Thresholding maka citra sel darah berwarna hitam dan citra latar
berwarna putih, kemudian citra biner tersebut diinvers untuk menghasilkan
citra sel darah berwarna putih dan citra latar berwarna hitam. Pada
gambar 3. merupakan citra sel darah yang sudah diubah menjadi bentuk
biner menggunakan thresholding, dan dilakukan invers pada citra sel
darah tersebut.

Gambar 3. Citra biner yang sudah diinvers


3) Noise Removal
Untuk menghilangkan objek kecil pada matriks citra yang dihasilkan
pada

tahap

sebelumnya,

dilakukan

noise

removal

dengan

cara

14

menghilangkan area yang memiliki luasan lebih kecil dari piksel yang
diinginkan.
4) Erosi
Untuk mempertajam citra sel darah yang berbentuk sabit maka
perlu dilakukan erosi, yaitu pengurangan jumlah piksel di area terluar
suatu citra sel darah. Pada gambar 4. merupakan hasil citra sel darah
yang sudah dilakukan proses noise removal dan erosi.

c. Processing
Pada tahap ini citra sel darah yang telah melalui tahap
preprocessing akan diolah kembali. Pada tahapan ini digunakan 2 jenis
metode, yaitu metode Freeman Chain Code dan Region Properties.
1) Metode Freeman Chain Code
Algoritma Kode Freeman Chain Code pertama kali diperkenalkan
oleh Freeman pada tahun 1974. Tujuan dari algoritma ini adalah untuk
merepresentasikan kontur suatu objek [4]. Algoritma Freeman Chain Code
digunakan untuk merepresentasikan piksel-piksel tepi suatu objek yang
saling terhubung dengan ukuran dan arah tertentu. Freeman Chain Code
direpresentasikan dengan 4 arah atau 8 arah mata angin, pada setiap
arah mata angin tersebut memiliki nilai yang berbeda-beda. Arah dari
suatu mata angin dikodekan dengan menggunakan skema penomoran

15

seperti terlihat di gambar 5, merupakan skema kode rantai dengan 8 arah


mata angin (a), dan skema dengan 4 arah mata angin (b).
Gambar 5. Skema 8 arah mata angin (a) dan Skema 4-arah mata angin
kode rantai Freeman (b)
Proses yang dilakukan untuk mengenali objek adalah menghitung
selisih nilai antar piksel pada tepi setiap objek sel darah. Proses
pengenalan dilakukan satu persatu pada semua objek sel darah. Jika
selisih nilai piksel pada tepian citra sel darah memiliki nilai lebih besar dari
2 maka, objek tersebut akan dikenali sebagai sel sabit. Sedangkan jika
selisih nilai pikselnya lebih kecil dari 3 maka akan dikenali sebagai sel
darah normal. Objek dikenali sebagai sel sabit, akan langsung disimpan
ke dalam suatu variabel, kemudian objek yang disimpan pada variabel
akan ditampilkan sebagai citra hasil. Pada gambar 6. Merupakan hasil
identifikasi sel darah berbentuk sabit menggunakan metode Freeman
Chain Code

Gambar 6. Citra hasil identifikasi menggunakan metode Freeman Chain


Code
2) Metode Region Properties
Region Properties merupakan representasi suatu objek dengan
pendekatan bentuk elips. Dalam fungsi ini suatu objek diasumsikan
memiliki bentuk elips, sehingga setiap objek memiliki major axis length
dan minor axis length. Untuk mendapatkan nilai Major Axis Length adalah
dengan cara menghitung jarak terjauh antara centroid dengan koordinat
piksel terluar. Sedangkan untuk mencari nilai Minor Axis Length dengan

16

cara menghitung jarak terdekat antara centroid dengan koordinat piksel


terluar. Gambar 7 merupakan objek yang direpresentasikan dengan
pendekatan bentuk elips, sedangkan garis biru merupakan major axes
length dan minor axes length dari objek tersebut.

Proses pengenalan objek sel darah dilakukan dengan cara mencari


nilai hasil pembagian antara Major Axes Length dengan Minor Axes
Length dari suatu objek. Jika nilai hasil pembagian atara Major Axes
Length dan Minor Axes Length pada objek sel darah tersebut lebih besar
dari 1,25, maka dianggap sel sabit. Sedangkan jika nilai hasil pembagian
antara Major Axes Length dan Minor Axes Length dibawah 1,25 (nilai
minimal = 1) maka dianggap normal. Nilai sebesar 1,25 digunakan
sebagai patokan untuk membedakan antara objek yang berbentuk sabit
dan normal. Citra sel darah yang dianggap sabit kemudian ditampilkan
satu-persatu berupa citra yang dicrop. Gambar 8 adalah salah satu hasil
identifikasi menggunakan metode regionprops.

Gambar 8. Citra sel hasil identifikasi menggunakan metode Region


Properties

17

DAFTAR PUSTAKA
Brooker, R.J. 2009. Genetic Analysis and Principles. McGraw-Hill
Companies, Inc. New York.
Elvita, A., F. Widianto, H. Widiawati, Maimanah, M. Pradini, R.P. Sari, S.
Sumarlin, U. Saura, W. Yurisa & Y. Susantri. 2008. Genetika Dasar.
Faculty of Medicine, University of Riau, Riau.
Ishak. 2010. Gene Mutations, Genetic Disease and Pharmacogenetic
Genes Disorder. International Journal of Research in Ayurveda &
Pharmacy. 1: 273-286.
Noer S. H. M. 1999. Ilmu Penyakit Dalam jilid II. FKUI. Jakarta.
Riyanti, E., R. R. Oewen, E. R. Haroen, A. M. Maskoen, & M. H. Satari.
2013. Metoda Pemeriksaan Polymerase Chain Reaction Restriction
Fragment Length Polymorphism pada Deteksi Genotip
Polimorfisme C-509T Gen Transforming Growth Factor Beta 1
Penderita Thalassemia Beta Mayor. Bagian Kedokteran Gigi Anak
Fakultas Kedokteran Gigi Universitas Padjadjaran..
Robbins dan Cotran. 2008. Dasar patologis penyakit. Buku kedokteran
EGC, Jakarta.
Sindunata, R. & M.Y.Probohoesodo. 2006. Faktor Patogenesis dan
Diagnosis Penyakit von Willebrand. Indonesian Journal of Clinical
Pathology and Medical Laboratory. 13: 23-30.
Tamam, M., S. Hadisaputro, Sutaryo, I. Setianingsih, R. Astuti, & A.
Soemantri. 2010. Hubungan antara Tipe Mutasi Gen Globin dan
Manifestasi Klinis Penderita Talasemia. Jurnal Kedokteran
Brawijaya. 26.

18