Anda di halaman 1dari 70

Mutagenesis

Kelompok HG-7
Evania Hutasoit (1206248483)
Fhani Melliana (1206212413)
Haqqyana (1206262090)
Retno Ulfiah (1206262102)
Sharima Umaya (1206212325)

OUTLINE PRESENTASI
Pengertian dan Jenis Mutagenesis
Q5 Site-Directed Mutagenesis Kit
Kelebihan Q5 Site-Directed Mutagenesis Kit
Mencari Kode Basa Nitrogen Apoptin
Menentukan Letak Theorin 108
Membuat Primer PCR Sesuai Jenis Mutasi
Pelaksanaan Proses PCR
Transformasi Plasmid ke Host
Screening dari Hasil Transformasi
Permasalahan-Permasalahan yang Mungkin Terjadi dalam Penggunaan Site
Directed Mutagenesis
Quality Control Penggunaan Site Directed Mutagenesis

PROBLEM STATEMENT
Theorin 108 sangat
berpengaruh pada fungsi
apopin sebagai penginduksi
kematian sel pada sel kanker.
Untuk mengklarifikasi fungsi
Theorin 108, mutasi apoptin!
e

REKAYASA
GENETIKA

PENGERTIAN & JENIS

MUTAGENESIS

MUTAGENESIS
/mjutdnss/

Perubahan informasi genetik pada suatu


organisme yang disebabkan oleh
mutagen fisika dan kimia

JENIS MUTAGENESIS
Directed

Oligonuclotide
Oligonucleotide directed with Plasmid DNA
PCR Amplified Oligonucleotide

Random

Directed evolution or molecular breeding

Insertional

PCR

Signature tagged
Virus
Site Directed
Mismatched
5Add on
Cassette

our focus

SITE DIRECTED
MUTAGENESIS

Mutasi yang terjadi pada


lokasi spesifik suatu untai
DNA

Merupakan mutagenesis in vitro


Menggunakan primer oligonuklei2da yang
dimodikasi khusus

METODE YANG DIPILIH UNTUK


MEMUTASI THEORIN 108 DARI
GEN APOPTIN ADALAH

Q5 SITE-DIRECTED
MUTAGENESIS

REKAYASA
GENETIKA

Q5 SITE-DIRECTED

MUTAGENESIS KIT

Modifikasi standar basa tunggal serta


delesi dan adisi dengan panjang
berapapun, termasuk adisi sinyal
lokalisasi nuklir ke protein terkloning

Q5 Hot Start HighFidelity Polymerase


Mampu melakukan insersi dan delesi
panjang
dapat diaplikasikan
secara luas dalam percobaan laboratorium

non-overlapping primers
(1 mutagenic and 1 silent)

merupakan turunan dari


QuickChange

Q5 Site-Directed Mutagenesis Kit

DESCRIPTION

Q5 Site-Directed Mutagenesis Kit


Kit Components:
Q5 Hot Start High-Fidelity 2X Master Mix

Disimpan Konsentrasi
pada suhu
(C)
-20
2X

KLD Enzyme Mix

-20

10X

KLD Reac2on Buer

-20

2X

Control SDM Primer Mix

-20

10 M

Control SDM Plasmid

-20

5 g/ml

NEB 5-alpha Competent E. coli (High Eciency)

-80

pUC19 Transforma2on Control Plasmid

-20

SOC Outgrowth Medium

0.05 ng/l

REKAYASA
GENETIKA

KELEBIHAN
Q5 SITE-DIRECTED
MUTAGENESIS

DESAIN PRIMER

TIDAK

TUMPANG TINDIH

kuat
amplifikasi eksponensial
menghasilkan persentase yang tinggi dari mutasi yang
diinginkan dari berbagai template

2
LIGASI INTRAMOLEKUL DAN
TRANSFORMASI MENJADI
NEB EFISIENSI TINGGI YANG
KOMPETEN

MENGHASILKAN SEL
DALAM KOLONI TINGGI

TINGKAT
KESALAHAN
SANGAT RENDAH

Q5 Hot Start High-Fidelity DNA


Polymerase mengurangi waktu
screening

4
HOT START POLIMERASE
MEMUNGKINKAN SET UP
REAKSI PADA

SUHU KAMAR

5
REDUKSI DPNL

MEMUNGKINKAN
BERBAGAI
KONSENTRASI
TEMPLATE AWAL

6
PENGGUNAAN PRIMER
STANDAR

MENGHILANGKAN
BIAYA TAMBAHAN DARI
OLIGOS
TERFOSFORILASI
OLIGOS YANG
DIMURNIKAN

7
PCR MASTER MIX
MUDAH DIGUNAKAN
DAN MULTI-ENZIM KLD
CAMPURAN YANG UNIK

MENAWARKAN
KENYAMANAN DAN
KUALITAS

8
LANGKAH PERLAKUAN YANG

CEPAT DAN LANGSUNG


DILAKUKAN PADA SUHU
KAMAR DALAM 5 MENIT

REKAYASA
GENETIKA

MENCARI KODE BASA


NITROGEN

APOPTIN

Chicken anemia virus (CAV), merupakan virus non-envelopedyang resitant


terhadap inaktivasi termal dan perlakuan oleh pelarut lipid (von Bulow and
Schat, 1997). CAV merupakan agen kausatif dari penyakit anemia pada
ayam, penyakit ini menyebabkan anemia aplastik, atropi pada organ getah
bening, dan imunosupresi pada ayam.
MENCARI GEN
APOPTIN
Vir us ini mentranskripsi dan
mentranslasi protein protein viral,
VP1, VP2, dan VP3, yang masing
masing dikodekan oleh ORF3, ORF1,
dan ORF2 dari genom CAV. Protein
VP3, terdiri atas susunan 121 asam
amino
atau dengan kata lain
tersusun oleh 363 basa nukleotida.

TAHAPAN MENCARI KODE APOPTIN


Isolasi genom CAV
Alat-alat:
Larutan NaAc 3 M
Larutan 100% EtOH
Larutan etanol
Aquades
Sampel MDCC-MSB1
Larutan fenol
Kloroform
Bahan-bahan :
Tabung reaksi
Alat pendingin
Alat sentrifugasi
Labu erlenmeyer

Amplifikasi CAV
dengan kultur virus

Isolasi Virus

Kultur CAV

Subkultur CAV

Isolasi DNA/Plasmid
dengan metode
fenol - kloroform

TAHAPAN ISOLASI CAV


Menambahkan larutan fenol jenuh dengan volume yang sama
seperti sampel.
Mengocok sampel selama 3 menit kemudian melakukan sentrifugasi
pada 14000 rpm selama (5 menit)
Fenol akan terpisah pada bagian bawah tabung. Lapisan atas
dipisahkan dan dicampurkan dengan kloroform pada volume yang
sama dengan sampel.
Sampel disentrifugasi kembali pada 14000 rpm (5 menit). Supernatan
dipisahkan.
Menambahkan larutan NaAc 3 M pada sampel sebanyak 1/10 dari
volume sampel. Dan kemudian menambahkan juga 100% EtOH
sebanyak 2 kali volume sampel.

TAHAPAN ISOLASI CAV


Setelah mengocok sampel selama beberapa detik, sampel didinginkan pada
suhu -20oC selama 30 menit.
Sentrifugasi pada 14000 rpm (5 menit). Bila tidak terbentuk pelet pada sampel
lakukan ulang sentrifugasi.
Memisahkan pelet dari supernatan dengan pipet perlahan.
Menambahkan etanol untuk mengendapkan DNA (DNA bersifat yang sangat
polar struktur fosfat).

Setelah itu pelet dibiarkan kering sehingga tidak ada cairan lagi
didalam sampel.
Pelet kemudian disuspensikan didalam air. Sampel tersebut
mengandung DNA virus CAV yang murni untuk kemudian dilakukan
tahapan berikutnya.

REKAYASA
GENETIKA

MENENTUKAN LETAK

THEORIN 108

MENENTUKAN LETAK THEORIN 108

Terdapat 121 asam amino penyusun gen apoptin. Melalui urutan tersebut kita menentukan
posisi Threonin 108 dengan menghitung dari belakang susunan asam amino tersebut.
1 MNALQEDTPP
41 TITLSLCGCA
81 PKPPSKKRSC

GPSTVFRPPT
NARAPTLRSA
DPSEYRVSEL

SSRPLETPHC
ADNSESTGF
KESLITTTPS

Threonin 108

REIRIGIAGI
KNVPDLRTDQ
RPRTARRCIR L 121

Menerjemahkan asam amino ke susunan basa menggunakan converter pada : http://insilico.net/tools/biology/sequence_conversion

SETELAH DIPEROLEH SUSUNAN BASA THEORIN 108


(ACG) MAKA THEORIN 108 DIMUTASI MENJADI ASAM
AMINO LAIN DENGAN MENGUBAH POSISI BASA 322
MENJADI G, DAN URUTANNYA MENJADI GCG

Menjadi

GCG ADALAH ASAM AMINO ALANIN, MAKA THEORIN


DISUBSTITUSI OLEH ALANIN. PERUBAHAN 1 BASA
DIMAKSUDKAN SUPAYA TIDAK TERJADI PERUBAHAN
SIGNIFIKAN DAN UNTUK MENGKLARIFIKASI FUNGSI THEORIN
108 PADA APOPTIN DALAM INDUKSI SEL KANKER. OLEH
KARENA ITU, THEORIN DIMUTASI DENGAN ASAM AMINO LAIN

Threonin
(ACG)

Alanin
(GCG)
Substitusi

Klarifikasi

REKAYASA
GENETIKA

MEMBUAT PRIMER
PROSES PCR

SESUAI JENIS MUTASI

MENDESAIN PRIMER
Desain primer yang dipilih memiliki beberapa parameter yang harus diikuti untuk
menghasilkan primer yang cocok dan paling optimal dalam melakukan quick

change site directed mutagenesis.

Kedua primer mutagen harus


mengandung mutasi yang
diinginkan dan anneal ke
sekuen yang sama pada untai
yang komplemen pada
plasmid.

Panjang primer harus sekitar 25 sampai


45 basa, dengan suhu leleh (Tm) 780C.
Primer dengan panjang lebih dari 45 basa
dapat digunakan namun dapat
meningkatkan kemungkinan terbentuknya
struktur sekunder yang akan
mempengaruhi efisiensi reaksi
mutagenesis. Persamaan yang digunakan
untuk menentukan Tm primer.

Tm = 81,5 + 0,41(%GC) 675/N - %mismatch

(1)

N adalah panjang basa primer


Nilai %GC dan %mismatch adalah bilangan bulat
Untuk perhitungan Tm primer untuk proses yang melibatkan delesi dan insersi
menggunakan persamaan yang telah dimodifikasi berikut ini.
Tm = 81,5 + 0,41(%GC)-675/N

(2)

Dimana N tidak melibatkan basa yang akan diinsersi ataupun didelesi


Gen apoptin akan di-mutagenesis dengan menggunakan Q5 Site-Directed Mutagenesis
Kit dari New England Biolabs. Pada sistem tersebut DNA yang akan dimutasi diperlukan
dalam bentuk plasmid. Karena itu, tahapan awal sebelum dilakukan mutagenesis adalah
kloning gen apoptin ke dalam plasmid vektor.

MODIFIKASI GEN APOPTIN


ATGAACGCTC TCCAAGAAGA TACTCCACCC GGACCATCAA CGGTGTTCAG GCCACCAACAAGTTCACGGC
CGTTGGAAAC CCCTCACTGC AGAGAGATCC GGATTGGTAT CGCTGGAATTACAATCACTC TATCGCTGTG
TGGCTGCGCG AATGCTCGCG CTCCCACGCT AAGATCTGCAACTGCGGACA ATTCAGAAAG CACTGGTTTC
AAGAATGTGC CGGACTTGAG GACCGATCAACCCAAGCCTC CCTCGAAGAA GCGATCCTGC GACCCCTCCG
AGTACAGGGT AAGCGAGCTAAAAGAAAGCT TGATTACCAC TACTCCCAGC CGACCCCGAA CCGCAAGAAG
GTGTATAAGACTGTAA

Modifikasi gen apoptin akan dilakukan dengan cara PCR.


Oleh karena itu, perlu dilakukan desain primer untuk memperbanyak gen apoptin
serta memperpanjang gen tersebut dengan situs enzim restriksi.
(BamI apoptin HindII)

PRIMER YANG AKAN DIGUNAKAN


DALAM GEN APOPTIN
Forward

: 5-GGATCCATGCGCTGCAGGAGGATACC-3

Reverse

: 5-AAGCTTTTACAGTCTTATACACCTT-3

TRANSFORMASI GEN DAN VEKTOR


KE DALAM HOST CELL E. COLI
Vektor yang telah disisipkan gen apoptin akan dimasukkan ke sel
host E.Coli. Teknik transformasi yang digunakan adalah
elektroporasi karena DNA plasmid yang dibutuhkan untuk
transformasi tidak perlu terlalu banyak.
Elektroporasi dilakukan dengan cara membuat perbedaan potensial
(kejutan). Perbedaan potensial biasanya dibuat dengan charging
kapasitor kemudian discharging melintasi elektroda.
Perbedaan potensial menyebabkan pembentukan pori pada membran sel.Pori
tersebut membuat struktur membran sel menjadi permeable untuk proses
pemindahan DNA menuju sitoplasma dalam sel.

SCREENING SEBELUM
MENYISIPKAN GEN
Untuk seleksi klon rekombinan,
digunakan metode colony PCR.

Colony PCR adalah teknik untuk


mendeteksi ligasi yang sukses
dilakukan dalam vektor gen
kloning.

PERSIAPAN METODE COLONY PCR

Tabung PCR ditambahkan


komponen PCR yaitu, buffer enzim
Taq polimerase, dNTP mix, enzim
Taq polimerase, primer reverse
dan primer forward.

Campuran tersebut kemudian


dimasukkan ke dalam mesin PCR
dan memasuki tahap
predenaturasi dengan suhu 95 oC
selama 5 menit.

PELAKSANAAN METODE
COLONY PCR

Denaturasi
1 menit
pada 95 oC

Annealing
selama 30
detik pada
suhu 55 oC

Sintesis
selama 2
menit pada
72 oC

Siklus diulang 30 kali

Pasca sintesis
pada 72 oC
selama 5 menit
dan 15 oC
selama 10
menit.

Hasil PCR
dideteksi
dengan
elektroforesis.

MENYISIPKAN GEN APOPTIN


KE DALAM VEKTOR
Gen apoptin dimasukkan kedalam MCS pada vektor yang telah
disesuai dengan metode Q5 Site Directed Mutagenesis yaitu
pUC19. Vertor ini telah disediakan oleh perusahaan penyedia Q5 Site
Directed Mutagenesis.
Gen apoptin dimasukkan kedalam
daerah restriksi diantara EcoR1
dan BamH1. Pada daerah EcoR1
akan dimasukkan ujung N
Terminal, sedangkan pada daerah
BamH1 dimasukkan ujung C
Terminal dari gen apoptin.

Gen apoptin yang disisipkan adalah gen


apoptin yang belum dimutasi, hal ini
karena dengan menggunakan metode
Q5 site directed mutagenesis
dibutuhkan plasmid yang sudah tersisipi
gen apoptin yang nantinya akan di PCR
dengan primer yang sudah didesain
dengan jenis mutasi yang diinginkan.

Pemilihan daerah EcoR1 dan BamH1 karena ketersediaan enzim


restriksi yang dijual dan kedua daerah restriksi ini menghasilkan
sticky end sehingga akan meningkatkan kemungkinan adanya
penyisipan yang sempurna.
Penyisipan dilakukan dengan metode cut and ligase.

REKAYASA
GENETIKA

PELAKSANAAN

PROSES
PCR

BAHAN YANG DIGUNAKAN


UNTUK PROSES PCR
Q5 hot start high
fidelity 2X master
mix 12,5 L dengan
konsentrasi 1X

10M forward
primer 1,25L
dengan
konsentrasi 0,5M

Template DNA ( 1
25 ng/L ) 1L
dengan
konsentrasi 1
25 ng

10M reverse
primer 1,25L
dengan
konsentrasi 0,5M

Nuclease free
water

TAHAP PELAKSANAAN PCR


Initial Denaturation dengan suhu 980C
selama 30 detik
25 Cycles dengan suhu 980C selama 10 detik, kemudian 50
720C selama 10 30 detik selanjutnya 720C selama 20
30 detik/kb

Final Extension dengan suhu 720C selama


2 menit
Hold dengan suhu 4 100C

KLD TREATMENT

(KINASE, LIGASE, DPNI)


Bahan yang dibutuhkan:
Produk PCR 1L, 2X KLD Reaction Buffer sebanyak 5L
dengan konsentrasi 1X, 10X KLD Enzyme Mix sebanyak
1L dengan konsentrasi 1X dan nuclease free water
sebanyak 3L

Semua bahan yang sudah ada kemudian


dicampur dengan cara memipet naik dan
turun kemudian diinkubasi pada suhu
ruang selama 5 menit.

REKAYASA
GENETIKA

TRANSFORMASI
PLASMID KE

HOST

TAHAPAN TRANSFORMASI
Menyiapkan tabung dengan
NEB 5- dengan sel E.
Coli kompeten dalam es

Menambahkan 5L dari
campuran KLD pada tahap
sebelumnya yang berisi sel
yang dicairkan

Pelan-pelan mengocok
tabung 4-5 kali untuk
dicampurkan,

Dimasukkan kembali ke
dalam es selama 5 menit

Melakukan heat shock pada


suhu 420C selama 30 detik

Meletakkan pada es selama


30 menit

Memipet 950L pada


suhu ruang SOC dalam
campuran

Melakukan inkubasi selama

370C selama 60 menit


dengan pencocokan
(250 rpm)

Mencampur sel dengan


mengocok tabung dan
membolak-balik

SELEKSI HASIL AKHIR


SEBELUM SCREENING
Menyebar hasil
akhir sebanyak
50-100L ke
dalam plate untuk
menseleksi

OPSIONAL
Bisa juga dilakukan pengenceran dengan
10-40 untuk transformasi campuran di
SOC sebelum disebar di plate

Menginkubasi
semalaman pada
suhu 370C

TUJUAN
Untuk menghindari
keberadaan koloni
yang terlalu dekat

REKAYASA
GENETIKA

SCREENING
HASIL DARI
TRANSFORMASI

METODE SCREENING YANG DIPILIH


SESUAI JENIS VEKTOR YANG
DIGUNAKAN, MENGGUNAKAN:

BLUE WHITE SCREENING

MENGAPA BLUE WHITE


SCREENING?

Pemilihan ini dikarenakan


vektor memiliki area LacZ
yang merupakan
pengkode sintesis betagalaktosidase.

MENGAPA PROSES
SCREENING DILAKUKAN?
Screening ini baru membuktikan apakan tahapan penyisipan
dan transformasi berhasil atau tidak.
Untuk mengetahui apakah mutasi berhasil atau tidak dan
adakah pengaruh keberadaan Threonin 108 pada aktivitas
apoptosis maka perlu dilakukan langkah tambahan seperti
pengujian aktivitas apoptosis hasil mutasi pada sel tumor atau
dengan melakukan sekuensing untuk mengetahui urutan basa
nitrogen baru.

TAHAPAN SCREENING
Menebarkan sel pada plate LB (100 g/ml
ampicillin,40 g/ml X-gal, 50 g/ml IPTG) yang
dijaga pada suhu ruangan

Membiarkan plate tersebut semalaman pada suhu


370C hingga ditumbuhi sel

Membiarkan plate pada suhu 300C selama 24 jam


agar warna yang dihasilkan lebih terlihat

REKAYASA
GENETIKA

PERMASALAHAN YANG
MUNGKIN TERJADI DALAM

PENGGUNAAN

SITE-DIRECTED MUTAGENESIS

Efisiensi
mutageneis
rendah
Hasil PCR tidak
ada atau sedikit

Koloni hasil
transformasi tidak
ada atau sedikit

False Positive

PERMASALAHAN

Plasmid yang
dihasilkan tidak
mengandung
mutasi yang
diinginkan

KOLONI YANG DIHASILKAN


PROSES SANGAT MINIM
Mengecek primer
Memastikan hasil PCR
yang murni

Memastikan primer yang digunakan murni


Menggunakan annealing temperature
Mengecek mutasi yang diinginkan pada primer

Visualisasi template DNA dengan gel


agarosa

Produk PCR yang


digunakan untuk reaksi
KLD

Hanya 1 l, jika terlalu banyak dapat


mengurangi efisiensi transformasi

Hasil reaksi KLD yang


digunakan pada
transformasi

Kurang dari 5 l, jika lebih harus digunakan


sebelum proses transformasi

Mineral tidak terlibat dalam


transformasi ketika memipet DNA
yang sudah direaksikan dengan Dpn I

Menggunakan pipet yang berukuran sangat kecil,


dan memasukkan pipet ke bawah lapisan mineral

Memas2kan cukupnya DNA

Menambahkan jumlah DNA yang telah direaksikan


dengan enzim hingga 4l

Tanda yang terseleksi pada


plasmid

Sesuai dengan agen seleksi yang digunakan pada


plates

Sel kompeten (E. Coli) telah


disimpan dalam suhu rendah

Sel kompeten disimpan dalam suhu-80C

mutan yang disintesis pada


proses transformasi

Mengecek efisiensi trasnformasi Hasil transformasi dikatakan efisien jika mengandung 1 x


sel kompeten
109 Colony Farming Units (CFU) per g.

EFISIENSI MUTAGENESIS RENDAH


Dipengaruhi penggunaan thermal cyclers, oleh karena itu parameterparameter yang mempengaruhi perlu diperhatikan untuk meningkatkan
efisiensi mutagenesis dan mengontrol reaksi
Memastikan agar plate dipersiapkan dengan
benar, untuk blue-white screening plates
diinkubasi pada suhu 30C selama 24 jam

Campuran dNTP harus dihindarkan dari proses
freeze-thaw, siapkan single aliquot yang akan
digunakan lalu disimpan pada suhu -20C

Munculnya str uktur


sekunder yang dapat
menghibisi reaksi
mutagenesis. Struktur
sekunder tersebut dapat
dihilangkan dengan
meningkatkan annealing
temperature hingga 65C

HASIL PCR TIDAK ADA ATAU


SEDIKIT
Memastikan Ta
(optimal
annealing
temperature)

Memastikan waktu
elongasi cukup
untuk panjang
plasmid (10-20
detik per kb
plasmid)

Memastikan
konsentrasi
akhir tiap primer
0.5 m

Memurnikan
primer dengan
Polyacrylamide Gel
Electrophoresis
(PAGE)

Kualitas primer rendah

Mengecek degradasi
gel akrilamid atau
sintesis ulang primer

Pembuatan primer yang


salah

Meningkatkan
annealing temperature
hingga 68C

False Positives

MUTASI YANG DIINGINKAN


TIDAK ADA PADA PLASMID
Memastikan desain primer mutagenik sudah benar
Mengoptimasi kondisi PCR
Menggunakan sel kompeten yang didesain untuk mencegah adanya
rekombinasi plasmid DNA

Menggunakan 1-25 ng template pada tahapan PCR

REKAYASA
GENETIKA

QUALITY CONTROL

PENGGUNAAN

SITE-DIRECTED MUTAGENESIS

QUALITY CONTROL TRANSFORMERTM


SITE-DIRECTED MUTAGENESIS KIT
Tr a n s fo r m e r S i t e - D i r e c t e d
Mutagenesis Kit didesain untuk
melangsungkan mutagenesis dengan
metode site-directed pada rantai
ganda DNA
Sistem yang sangat efisien untuk sitedirected mutagenesis in-vitro
Mutasi Spesifik (Substitusi, delesi, atau
insersi dapat diperkenalkan ke gen target
atau daerah kloning dengan situs restriksi
yang unik dan dengan bacterial selection
marker)
Kit dapat digunakan untuk meningkatkan
delesi searah

Satu Kit terdiri dari 2 Box dengan konten sebagai


berikut:
Box 1:
200 l E. coli BMH 71-18 mutS
Box 2:
150 l 10 X Annealing buffer
100 l 10 X Synthesis buffer
30 l T4 DNA polymerase
30 l T4 DNA ligase
20 l Nde I endonuclease
20 l pUC19M plasmid DNA
20 l Control Selection Primer (25mer)
GAGTGCACCATGGGCGGTGTGAAAT
20 l Control Mutagenic Primer (22mer)
CAGGGTTTTCCCAGTCACGACG

QUALITY CONTROL
KONDISI
PENYIMPANAN

UMUR PENYIMPANAN
RAK

Kotak
penyimpanan 1:
-70C.
Kotak
penyimpanan 2:
-20C.

Disimpan dalam
kondisi
penyimpanan yang
sesuai hingga 1
tahun sejak
tanggal produksi

KONDISI SHIPPING
Kotak 1 dan Kotak
2: Dry Ice (70C)

Transformer Site-Directed Mutagenesis Kit diuji untuk menguji kesuksesan


mutagenesis menggunakan DNA pUC19M. Persen koloni biru yang
dihasilkan ialah 78.4%