Anda di halaman 1dari 16

MAKALAH ASUHAN KEPERAWATAN ANAK

DENGAN FLU SINGAPURA

Disusun oleh :
Dinda Kusumawati (11022)

AKADEMI KEPERAWATAN HANG TUAH JAKARTA


JL. BENDUNGAN HILIR RAYA NO.17 JAKARTA PUSAT
TA. 2013/2014

KATA PENGANTAR
Puji syukur penulis panjatkan kehadirat Tuhan Yang Maha Esa, atas segala Rahmat dan
hidayah-Nya yang telah dilimpahkan kepada penulis sehingga dapat menyelesaikan makalah
yang berjudul Asuhan Keperawatan Anak Dengan Flu Singapura. Adapun tujuan dan
maksud penyusunan makalah ini untuk memenuhi tugas mata ajar Keperawatan Anak I.
Dalam penyusunan makalah ini, penulis tidak luput dari kesulitan dan hambatan tetapi
berkat bantuan dan petunjuk serta kerja sama, maka makalah ini dapat diselesaikan sesuai
dengan waktu yang telah ditentukan, oleh karena itu pada kesempatan ini penulis
mengucapkan terima kasih kepada :
1

Kolonel Laut (K/W) Rita Wismajuwani, SKM. M. AP., selaku Direktur Akademi
Keperawatan Hang Tuah Jakarta.

Dwi Suryani, S. Kep., selaku wali kelas 2B.

Eny Susyanti, S. Kep., selaku koordinator mata ajar Keperawatan Anak.

Rekan-rekan mahasiswa yang turut membantu dalam pembuatan makalah ini.

Segala kemampuan dan daya upaya telah diusahakan semaksimal mungkin namun
penulis menyadari masih banyak kekurangan. Oleh karena itu, penulis sangat mengharapkan
kritik dan saran yang sifatnya membangun demi menyempurnakan makalah ini. Penulis
berharap semoga makalah ini dapat bermanfaat bagi pembaca khususnya di dunia
keperawatan.
Jakarta, Oktober 2014

Penulis

DAFTAR ISI
KATA PENGANTAR............................................................................................................................1
DAFTAR ISI.........................................................................................................................................2
BAB I PENDAHULUAN.....................................................................................................................1
A.

Latar Belakang...........................................................................................................................1

B.

Tujuan........................................................................................................................................1

C.

Manfaat......................................................................................................................................2

D.

Metode Penulisan......................................................................................................................2

E.

Sistematika Penulisan................................................................................................................2

BAB II TINJAUAN PUSTAKA...........................................................................................................3


A.

Pengertian..................................................................................................................................3

B.

Etiologi......................................................................................................................................4

C.

Patofisiologi...............................................................................................................................4

D.

Manifestasi Klinis......................................................................................................................5

E.

Pemeriksaan Penunjang.............................................................................................................7

F.

Komplikasi................................................................................................................................7

G.

Penatalaksanaan Medis..............................................................................................................8

H.

Pencegahan dan Pengendalian Penyakit....................................................................................8

I.

Asuhan Keperawatan.................................................................................................................9

BAB III PENUTUP............................................................................................................................11


A.

Simpulan..................................................................................................................................11

B.

Saran........................................................................................................................................11

DAFTAR PUSTAKA..........................................................................................................................13

BAB I
PENDAHULUAN

A. Latar Belakang
Flu Singapura adalah istilah untuk penyakit yang secara medis disebut penyakit tangan,
kaki, dan mulut (hand, foot and mouth disease/HFMD). Infeksi virus ini biasanya
memengaruhi balita dan anak di bawah 10 tahun. Kebanyakan orang dewasa telah
mengembangkan antibodi terhadap virus penyebabnya dari paparan di waktu kecil. Seperti
flu lainnya, flu Singapura paling sering muncul di pergantian musim dan musim hujan.
Penyakit yang sepanjang tahun selalu muncul ini, memiliki banyak sekali jenis virus. Salah
satu virus yang mematikan (seperti yang mewabah di Singapura) adalah Enterovirus 71.
Sedangkan virus flu Singapura yang sering dijumpai di Indonesia merupakan tipe
Coxsackie A dan Coxsackie A. Jenis ini tipenya lebih ringan. Pada tahun 2009, bahwa
delapan anak-anak DI Jakarta tertular penyakit ini. Pada akhir April 2009, lembaga-lembaga
kesehatan peringatan pusat kesehatan masyarakat Jakarta mendukung langkah-langkah
pencegahan, termasuk penggunaan termal scanner di bandara untuk menghindari perjalanan
ke Singapura.
Mengapa disebut flu singapura, karena pertengahan September tahun 2000 lalu,
penyakit tangan, kaki dan mulut pernah merebak di Singapura. Pemerintah Singapura bahkan
sampai menganjurkan agar seluruh restoran siap saji, kolam renang, dan tempat bermain
anak-anak ditutup sementara setelah tiga anak diberitakan meninggal karena diduga terkena
penyakit tersebut. Sebanyak 440 taman kanak-kanak (TK) dan 557 pusat perawatan anak
diliburkan.
B. Tujuan
1. Tujuan Umum
Maksud dari pembuatan karya tulis ini adalah untuk memenuhi tugas makalah
2.
c.
d.
e.

Keperawatan Anak I.
Tujuan Khusus
a. Untuk mengetahui penyebab penyakit tersebut.
b. Untuk mengetahui ciri-ciri penyakit tersebut.
Untuk mengetahi dampak penyakit tersebut.
Untuk mengetahui cara mencegah penyakit tersebut.
Untuk mengetahui asuhan keperawatan pada anak dengan penyakit tersebut.

C. Manfaat
1. Manfaat bagi penulis
i

Penulis jadi tahu cara menghindari dan mencegah penyakit flu singapura serta
mengetahui dampaknya.
2. Manfaat bagi institusi
Menambah referensi asuhan keperawatan anak dengan flu singapura.
3. Manfaat bagi masyarakat
Masyarakat jadi lebih waspada terhadap lingkungan dan semakin menjaga kesehatan
tubuh.
D. Metode Penulisan
Dalam pembuatan makalah ini, penulis menggunakan metode studi kepustakaan.
E. Sistematika Penulisan
Makalah ini disusun secara sistematis menjadi tiga bab dengan urutan sebagai berikut:
BAB I :PENDAHULAN, BAB II: TINJAUAN PUSTAKA, BAB III: PENUTUP, dan
DAFTAR PUSTAKA

BAB II
TINJAUAN PUSTAKA

A Pengertian
Flu singapura merupakan infeksi akibat virus. Infeksi ini mudah menular kepada orang
sekitar. Apalagi, anak-anak usia balita. Sebab, sistem kekebalan anak usia tersebut belum
cukup matang. Dilihat dari jenis kelamin, anak laki-laki dan

perempuan

berpeluang sama untuk terjangkit flu ini. (http://www.jawapos.com/baca/artikel/606/FluSingapura-Cepat-Menyebar-pada-Anak)


Flu Singapura adalah penyakit berjangkit infeksi yang disebabkan oleh virus RNA yang
masuk dalam famili Picornaviridae (bahasa SpanyolPico:kecil), Genus Enterovirus (non
Polio). Dalam dunia kedokteran, Flu Singapura dikenal sebagai Hand, Foot, and Mouth
Disease (HFMD) atau penyakit Kaki, Tangan, dan Mulut (KTM). Di dalam Genus
Enterovirus terdiri dari virus Coxsackie A, virus Coxsackie B, Echovirus dan
Enterovirus. Penyebab KTM yang paling sering pada pasien rawat jalan adalah
Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih
berat atau ada komplikasi sampai meninggal adalah Enterovirus 71.

Berbagai

enterovirus

penyakit

dapat

menyebabkan

berbagai

(http://id.wikipedia.org/wiki/Flu_Singapura)
hand-Foot-Mouth disease adalah penyakit anak-anak yang umum terjadi. Gejalanya
berupa luka pada mulut, demam, dan rash. Biasanya disebabkan oleh coxsackievirus
A16. Akan tetapi tidak semua anak-anak yang terinfeksi virus ini menunjukkan ketiga
gejala Hand-Foot-Mouth disease ini. HFMD sering keliru dengan penyakit Foot-andMouth disease (Hoof-and-Mouth disease) yang terjadi pada lembu, domba, dan babi;
padahal keduanya merupakan dua macam penyakit yang berbeda dan tidak berhubungan,
keduanya disebabkan oleh virus yang berbeda. Manusia tidak dapat tertular penyakit
yang

diderita

oleh

binatang

dan

demikian

juga

sebaliknya.

(http://childrenclinic.wordpress.com/2009/04/19/flu-singapura-atau-infeksi-ktm-kakitangan-dan-mulut/)

F.

Etiologi
Penyebab yang paling sering terjadi adalah Coxsackie A16. Sedangkan yang sering
memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai
meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai
penyakit.

G. Patofisiologi
Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah
penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anakanak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya
lebih kebal terhadap enterovirus, walau bisa juga terkena. Penularannya melalui jalur
fekal-oral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek,
air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau
ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan
makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada
pembawa (carrier) seperti lalat dan kecoa. Penyakit ini memberi imunitas spesifik,
namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya. Masa
Inkubasi 2 - 5 hari.
Infeksi ini paling menular pada satu minggu pertama. Virus yang menyebabkan HFMD
masih dapat tinggal di dalam tubuh selama berminggu-minggu setelah symptom
menghilang. Berarti penularan dari orang ke orang terjadi setelah pasien penyakit ini
beranjak sembuh. HFMD tidak ditransmisikan dari binatang ke manusia. Orang yang
belum pernah terinfeksi oleh virus yang menyebabkan HFMD beresiko untuk terinfeksi,
tapi tidak semua orang yang terinfeksi virus ini menderita HFMD.
HFMD paling banyak terjadi pada anak-anak berusia di bawah 10 tahun, tapi dapat pula
terjadi pada orang dewasa. Anak-anak lebih beeresiko untuk terkena penyakit ini karena
system imun dalam tubuh mereka masih lemah bila dibandingkan dengan orang dewasa.
Bila telah terinfeksi maka pasien akan mendapatkan immunitas terhadap virus yang
dapat menyebabkan HFMD ini. Tapi terdapat pula beberapa kasus dimana HFMD dapat
kembali muncul karena infeksi oleh virus golongan enterovirus lainnya.
Kasus HFMD terjadi di seluruh dunia. Pada daerah yang beriklim hangat/sejuk, kasus
lebih sering terjadi pada musim panas dan awal musim gugur. Sejak tahun 1997, kasuskasus HFMD yang disebabkan oleh enterovirus 71 telah dilaporkan terjadi di Asia dan
Australia.

HFMD yang disebabkan oleh infeksi coxsackievirus A16 merupakan penyakit yang
ringan. Umumnya pasien dapat sembuh setelah 7-10 hari tanpa penanganan medis.
HFMD yang disebabkan oleh enterovirus 71 menunjukkan insiden penyakit neurologis
(sistem saraf) yang lebih tinggi. Kasus encephalitis yang fatal dapat terjadi pada penyakit
yang disebabkan oleh infeksi enterovirus 71.
Implantasi awal virus pada mukosa buccal dan ileum akan diikuti dengan penyebaran ke
kelenjar getah bening dalam 24 jam. Viremia cepat terjadi, meluas ke mukosa mulut dari
kulit. Hari ke 7 terjadi peningkatan neutralizing antibody kemudian terjadi eliminasi
Virus.
H. Manifestasi Klinis
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu
makan, pilek, gejala seperti flu, pada umumnya yang tak mematikan. Timbul vesikel
yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah, gusi, pipi sebelah
dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan dengan itu timbul
rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang
tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) pada
bokong.
Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di
rumah sakit. Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah
sakit.
1. Gejala Prodromal (12-36 jam) :
a. Demam tidak tinggi38,3 derajat C selama 2-3 hari
b. Anoreksia
c. Malaise (feeling sick)
d. Nyeri perut
e. Sakit pada mulut dan tenggorokan
f. Batuk
g. Lesi pada tangan dan kaki; 5-7 hari
h. Lesi mukosa dan kulit sembuh spontan dalam 5-7 hari
i. Kadang-kadang : demam tinggi, sangat lemah, diare, atralgia, miokarditis dan
pneumonia, meaningoencephalitis.
2. Adapun gambaran klinik Lesi di mulut :
a. Macula, vesikel 2-3 mm dasar eritem
b. Vesikel jarang terlihat, segera menjadi ulkus
c. Ulkus terasa nyeri ditambah dengan rasa tidak nyaman ketika makan
d. Jumlah ulkus 5-10
e. Terlihat pada palatum, mukosa pipi, gusi, lidah, uvula, tonsil.
3. Adapun gambaran klinik lesi di kulit :
a. Lokasi khas yaitu tangan, kaki, bokong dan kadang-kadang di lengan.
i

b. Jumlah lesi di tangan > jumlah lesi di kaki


c. Jumlah lesi di dorsal dan sisi samping jari-jari>jumlah lesi di palmar
d. Makula eritem 2-10 mm kemudian berubah menjadi vesikel sentral oval
berwarna abu-abu
e. Lesi asimtomatik, hilang 3-7 hari
f. 22% cervikal/submandibular limfadenopati.
4. Gejala yang cukup berat tersebut antara lain :
a. Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39oC.
b. Demam tidak turun-turun
c. Takikardia (denyut nadi menjadi cepat)
d. Takipnea, yaitu napas jadi cepat dan sesak
e. Anoreksia, muntah, atau diare berulang disertai dehidrasi.
f. Letargi, lemas, dan terus mengantuk
g. Nyeri pada leher, lengan, dan kaki.
h. Kejang-kejang, atau terjadi kelumpuhan pada saraf cranial
i. Keringat dingin
j. Fotofobia (tidak tahan melihat sinar)
k. Ketegangan pada daerah perut
l. Halusinasi atau gangguan kesadaran

I.

Pemeriksaan Penunjang
Pemeriksaan laboratorium dengan pengambilan sampel (spesimen) dari tinja, usap rektal,
cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen
atau biopsi otak. Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi
strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan
antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1.
Deteksi Virus :
a. Immuno histochemistry (in situ)
b. Imunofluoresensi antibodi (indirek)
c. Isolasi dan identifikasi virus Isolasi virus dengan cara biakan sel dengan

2.

3.

suckling mouse inoculation.


d. Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr,
Nagoya) pada sel Vero.

Uji ELISA sedang dikembangkan.


Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat
mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
J.

Komplikasi
Komplikasi pada penyakit HFMD jarang terjadi, tetapi bila terdapat komplikasi harus
segera ditangani. Komplikasi penyakit ini adalah :
1. Viral atau aseptik meningitis (radang selaput otak)
Viral meningitis dapat menyebabkan demam, sakit kepala, leher dan punggung.
Kondisi ini biasanya ringan dan dapat sembuh tanpa penanganan.
2. Ensefalitis (radang otak)
Dapat menimbulkan radang otak dan mematikan jika penderitanya terkena virus
yang memiliki virulensi tinggi dan dapat menular jika bersentuhan dengan orang
yang berpenyakit flu Singapura.
3. Myocarditis (Coxsackie Virus Carditis) atau pericarditis
4. Acute Flaccid Paralysis / Lumpuh Layuh Akut (Polio-like illness)
5. Hilangnya kuku jari tangan dan kaki

K. Penatalaksanaan Medis
Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan
keadaan klinis yang ada, misalnya dapat diberikan :
1. Antiseptik di daerah mulut.
2. Antipiretik.
3. Analgesik misal parasetamol.
4. Antibiotika jika infeksi kulit.
5. Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam.
L.

Pencegahan dan Pengendalian Penyakit


Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik
Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan
lingkungan; kebersihan (Higienis dan Sanitasi) lingkungan maupun perorangan. Cara
yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan,
khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan,
handuk yang memungkinkan terkontaminasi. Bila perlu anak tidak bersekolah selama
satu minggu setelah timbul rash sampai panas hilang.
Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa
minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan. Di Rumah
i

sakit Universal Precaution harus dilaksanakan. Penyakit ini belum dapat dicegah dengan
vaksin (Imunisasi). Bila anak tidak dirawat, harus istirahat di rumah karena daya tahan
tubuhnya menurun dan agar tidak menularkan ke anak lainnya.
Berbagai upaya telah dan sedang dilakukan pemerintah dalam hal ini, seperti
meningkatkan survailans epidemiologi (perlu definisi klinik). Memberikan penyuluhan
tentang cara-cara penularan dan pencegahan HFMD untuk memotong rantai penularan.
Menyiapkan sarana kesehatan tentang tatalaksana HFMD termasuk pelaksanaan.
Memberikan penyuluhan tentang tanda-tanda dan gejala HFMD.
Jadi, dapat disimpulkan bahwa tidak terdapat pengobatan secara spesifik untuk penyakit
ini. Adapun hal hal yang dapat dilakukan antara lain:
1.
Menghindari kontak dengan anak-anak yang terinfeksi
2.
Tidak membawa anak yang sakit ke tempat yang padat pengunjung
3.
Tidak menggunakan peralatan makan,pakaian,sepatu anak yang sakit.
4.
Mencuci tangan sebelum dan sesudah makan, buang air besar dan kontak
dengan penderita
5.
Bintik yang melepuh/vesikel sebaiknya dibiarkan mengering alami, jangan
dipecah karena mengandung virus.
Penderita tutup mulut dan hidung saat batuk/bersin
Bersihkan lantai atau barang-barang yang terkontaminasi kotoran anak dengan

6.
7.

perklorin 0,5% karena virus berada dalam feses dan dapat hidup beberapa lama.
M. Asuhan Keperawatan
1.

2.

Pengkajian
a. Identitas klien.
b. Riwayat kesehatan klien dan keluarga.
c. Genogram keluarga.
d. Pola kebiasaan sehari-hari dan saat sakit.
1) Pola nutrisi
2) Pola istirahat.
3) Pola eliminasi.
4) Pola sosial.
5) Pola personal hygiene.
e. Pengkajian fisik
1) Sistem Penglihatan
2) Sistem Pendengaran
3) Sistem Wicara
4) Sistem Integumen
5) Sistem Respirasi
6) Sistem Kardiovaskuler
7) Sistem Pencernaan
8) Sistem Endokrin
Diagnosa Keperawatan

a. Resiko infeksi berhubungan dengan pejamu yang rentan dan agens infeksius.
b. Nyeri berhubungan dengan lesi kulit, malaise.
c. Kekurangan volume cairan berhubungan dengan keengganan untuk minum;
ketidakmampuan menelan sekunder akibat nyeri dan inflamasi.
d. Hambatan interaksi sosial berhubungan dengan isolasi dari teman sebaya.
e. Resiko gangguan integritas kulit berhubungan dengan garukan pada tempat
gatal.

a.

BAB III
PENUTUP
A Simpulan
Penyakit Hand,Foot, and Mouth (HMFD) lebih di kenal dengan Flu Singapura karena di
Singapura-lah penyakit ini menimbulkan kematian yang paling banyak. Penyakit ini
lebih sering menyerang anak-anak karena daya tahan tubuh di usia tersebut masih
rendah. Penyakit ini belum memiliki antivirus atau obat antibiotiknya, oleh karena itu
yang bisa mengatasi virus ini hanyalah tubuh kita sendiri.
N. Saran
Agar kita terbebas dari penyakit flu Singapura harus mengikuti cara-cara berikut ini:
1. Menjaga kebersihan perorangan. Misalnya rajin mencuci tangan dengan
menggunakan sabun (terutama sebelum dan sesudah makan juga sesudah buang air
kecil/besar).
2. Berikan anak gizi yang cukup .
3. Pemberian ASI ekslusif hingga enam bulan yang meneruskannya hingga usia dua
4.

tahun
Meski vaksinasi flu Singapura belum ada, anak tetap harus diberikan vaksinasi yang
lengkap agar daya tahan anak tetap kuat.. Jika anak sudah terkena penyakit flu
Singapura ikuti langkah-langkah berikut ini :
a. Ketika anak menderita flu singapura, usahakan isolasi ia dari lingkungan rumah
dan luar. Jika sudah sekolah, jangan sekolah dulu hingga benar-benar sembuh
(lesi-lesinya hilang) dan tidak bermain atau kontak fisik dengan teman juga
b.

saudara kandungnya.
Ajarkan anak untuk menutup mulutnya dengan masker, sapu tangan, atau tisu
ketika batuk atau bersin. Percikan cairan atau ludah yang keluar dari mulut nya

c.

bisa menulari orang sekitar melalui makanan dan udara.


Virus ini juga bisa menular melalui kotoran. Oleh karena itu, ketika anak usai
buang air besar atau ibu membersihkan popok bayinya (yang menderita flu
Singapura) segeralah mencuci tangan dedngan bersih agar tidak menyerbakan

d.

virus itu ke sekitarnya.


Pernyataan yang mengatakan penderita flu Singapura terkena angin dan mandi
adalah mitos. justru penderita harus mandi. Kalau tubuh penuh kuman padahal
disana terdapat banyak luka (lesi) di kulitnya, kuman itu malah akan membantu
penyebaran infeksi lukanya semakin luas. Jadi anak tidak demam tinggi, tidak
bermasalah terkena angin dan mandi.

DAFTAR PUSTAKA
Wong, Donna L, dkk. 2008. Buku Ajar Keperawatan Pediatrik Wong. Edisi 6. Jakarta:
EGC.
Engel, Joyce. 2008. Pengkajian Pediatrik. Edisi 4. Jakarta: EGC.
http://id.wikipedia.org/wiki/Flu_Singapura diunduh pada hari Jumat tanggal 3 Oktober
2014 jam 19.00 WIB.
http://klinikanakonline.com/2009/04/19/flu-singapura-atau-infeksi-ktm-kaki-tangan-danmulut/ diunduh pada hari Jumat tanggal 3 Oktober 2014 jam 19.00 WIB.
http://www.jawapos.com/baca/artikel/606/Flu-Singapura-Cepat-Menyebar-pada-Anak
diunduh pada hari Jumat tanggal 3 Oktober 2014 jam 19.00 WIB.