Anda di halaman 1dari 109

PERAN POLIMORFISME GEN INSULIN RESEPTOR

SUBSTRAT-1 Gly972Arg TERHADAP


EFEK METFORMIN PADA PENDERITA SINDROM
OVARIUM POLIKISTIK
DENGAN RESISTENSI INSULIN

USULAN PENELITIAN

Oleh :
Wiryawan Permadi
L3J 03069

PROGRAM PASCASARJANA
UNIVERSITAS PADJADJARAN
BANDUNG
2007

BAB I
PENDAHULUAN

1.1 Latar Belakang Penelitian


Hingga kini pengendalian kependudukan di Indonesia masih merupakan
masalah nasional, tetapi pada sisi lain ada masalah yang juga besar, yakni
ketidakberhasilan memperoleh keturunan (infertilitas) pada sebagian pasangan
suami-istri (pasutri) usia subur (PUS). Infertilitas ini diperkirakan dialami oleh
sekitar 14-17% PUS, yang sekitar 60% di antaranya disebabkan oleh faktor
wanita, dan 20% di antaranya dikarenakan anovulasi. Selain itu, sekitar 5% dari
seluruh wanita usia subur (WUS) mengalami anovulasi akibat sindrom ovarium
polikistik (SOPK).1,2
Sindrom ovarium polikistik merupakan kelainan endokrinologis yang
banyak dijumpai pada WUS, dengan tanda klinis hiperandrogenisme dan
anovulasi kronis.3 Pada tahun 1935 Stein dan Levental menghubungkan kelainan
anatomi penderita SOPK ini dengan gejala klinik yang meliputi kelainan haid
seperti amenore atau oligomenore, infertilitas, hirsutisme dan obesitas.4
Penelitian yang melibatkan populasi khusus belum ditemukan hingga kini,
tetapi prevalensi pada WUS diperkirakan sekitar 5 10%. Angka ini didasarkan
pada kejadian 20% wanita normal dengan morfologi ovarium yang polikistik
secara ultrasonografis dan sebagian besar memiliki kelainan endokrinologis 5.
Prevalensi yang lebih rendah (3%) ditemukan pada penderita amenorea sekunder
tiga bulan lebih.6

Lebih jauh, belum ada kesepakatan kriteria diagnosis SOPK. Kriteria dari
Institut National Pengembangan Manusia dan Kesehatan Anak (National Institute
of Child Health and Human Development atau NICHD) tahun 1990 masih
menjadi pegangan bagi klinisi dan peneliti. Kriteria ini menggunakan gambaran
hiperandrogenisme klinis dan/atau biokimiawi, disfungsi haid dan menyingkirkan
penyebab-penyebab khas. Berdasarkan kriteria ini, temuan gambaran polikisitik
pada ovarium secara ultrasonografis bukan syarat untuk mendiagnosis kelainan
ini. Pandangan ini bertentangan dengan yang dianut para dokter spesialis yang
mensyaratkan temuan polikistik pada ovarium secara ultrasonografis sebagai
dasar diagnosis SOPK, sedangkan gambaran klinis disfungsi haid tidak menjadi
keharusan untuk menegakkan diagnosis.7
Konsensus terakhir tahun 2003 antara ESHRE (European Society for
Human Re-production and Embryology) dan ASRM (American Society for
Reproductive Medicine) menetapkan bahwa diagnosis SOPK harus memenuhi
sekurang-kurangnya dua dari tiga kriteria berikut8:
1.

Oligo dan/atau anovulasi

2.

Tanda-tanda klinis dan/atau biokimiawi dari hiperandrogenisme

3.

Gambaran ovarium yang polikistik, dengan menyingkirkan penyebab-

penyebab lain, yakni hiperplasia adrenal kongenital, tumor-tumor penghasil


androgen, dan sindrom Cushing.
Meski kriteria diagnosis SOPK sudah dapat ditetapkan tetapi hingga kini
patogenesis SOPK dan cara penanganan yang tepat belum seluruhnya terungkap.
Telah diketahui bahwa patogenesis SOPK melibatkan hiperandrogenemia dan

resistensi insulin,9,10 tetapi saling keterkaitan antara keduanya masih terus diteliti.
Anggapan bahwa hiperandrogenemia saja menjadi penyebab resistensi insulin
pada SOPK tidak dapat dipertahankan karena pemulihan kadar androgen pasca
ooforektomi atau pasca pemberian obat antiandrogen tidak berpengaruh terhadap
resistensi insulin. Pada pihak lain, dugaan bahwa resistensi insulin menyebabkan
hiperandrogenemia juga telah banyak diteliti11. Resistensi insulin hampir secara
menyeluruh dijumpai pada penderita yang gemuk, dan kerap ditemukan pada
penderita SOPK baik yang gemuk maupun nir-gemuk.
Produksi SHBG (sex hormone binding globulin) dihambat oleh insulin dan
tidak bergantung pada pengaruh hormon steroid seks, sehingga konsentrasi SHBG
lebih rendah pada penderita SOPK sehingga konsentrasi androgen bebas akan
meningkat di dalam peredaran darah.12,13
Penyebab resistensi insulin pada SOPK cukup beragam, antara lain faktorfaktor: genetik, etnis, lingkungan, olahraga, dan gaya-hidup. Sangat sedikit data
yang diperoleh tentang hubungan antara faktor lingkungan dengan perkembangan
hiperandrogenisme dan SOPK, selain dari faktor pencetus obesitas. Prevalensi
SOPK hampir serupa di beberapa negara, tetapi faktor etnis mempengaruhi
manifestasi klinis sindrom tersebut. Prevalensi SOPK pada wanita pramenopause
ras kaukasia berdasarkan kriteria NICHD berkisar dari 4,7- 6,8%, sedangkan pada
wanita Afro-Amerika 3,4 % yang kurang lebih sama bila dibandingkan dengan
wanita ras kaukasia pada umumnya.14,15
Telah ditemukan pula bahwa resistensi insulin lebih banyak pada penderita
SOPK etnis Hispanik-Karibia ketimbang ras kaukasia dan kelompok kontrol

normal dalam hal perbandingan usia, berat badan, komposisi tubuh, dan etnis.
Insidens obesitas, dislipidemia, dan infertilitas serta resistensi insulin ditemukan
lebih tinggi pada penderita SOPK etnis Maori dan kepulauan Pasifik
dibandingkan dengan penderita benua Eropa. Temuan ini didasarkan pada
gambaran ultrasonografis dan gejala-gejala klinis. Di Inggris, prevalensi ovarium
yang polikistik dan diabetes melitus tipe-2 (DM-2) bertambah pada etnis India
dibandingkan dengan etnis kaukasia. 16,17-20
Perbedaan etnis atas tampilan klinis SOPK tampaknya berhubungan dengan
faktor lingkungan seperti faktor diet, olahraga dan gaya-hidup. Pada pihak lain,
makanan dengan kandungan asam lemak tak-jenuh jamak (polyunsaturated) atau
tak-jenuh tunggal (mono-unsaturated) berpengaruh pada tampilan metabolik.
Oleh karena itu, bilamana ada perbedaan pada faktor lingkungan penyebab SOPK,
maka faktor genetiknya juga dapat berbeda bergantung pada kelompok etnis mana
yang dikaji. Pertimbangan ini dikemukakan karena adanya perbedaan hasil akibat
varian genetik pada SOPK.21
Faktor etnis dan lingkungan ini lebih terkait dengan resistensi insulin
sebagai penyebab SOPK. Bangkitnya resistensi insulin pada penderita SOPK
belum seluruhnya terungkap, dan diperkirakan akibat kerusakan pada tingkat
pasca-reseptor (post-receptor). Kerusakan pada tingkat pasca-reseptor tersebut
sedikit sekali dipahami, dan diperkirakan berlatar-belakang multifaktor.
Belakangan ini diduga bahwa peningkatan proses fosforilasi serin/treonin pada
reseptor insulin merupakan keadaan yang unik pada SOPK dan mencegah
fosforilasi tirosin pada reseptor insulin subunit . Selain itu prevalensi dan peran

varian IRS-1 terhadap resistensi insulin pada penderita SOPK masih


dipertentangkan. 22
Varian IRS-1 yang tersering dijumpai adalah perubahan glisin menjadi
arginin pada kodon nomor 972 (Gly972Arg), yang lebih banyak ditemukan pada
penderita sindrom resistensi insulin, khususnya penderita DM-2. Beberapa
gambaran fenotip Gly972Arg, seperti kegemukan dan hiperandrogenisme
memperlihatkan kesamaan dengan yang ada pada SOPK. Tampaknya Gly972Arg
lebih banyak dijumpai pada penderita SOPK dengan resistensi insulin.23-29
Sangkaan akan peran protein varian IRS-1 pada proses resistensi insulin
didasarkan dari penelitian atas penderita DM-2 (non-insulin dependent diabetes
mellitus, NIDDM). Namun demikian peran varian protein IRS-1 Gly972Arg itu
sebagai tipe varian terbanyak pada NIDDM masih dipertentangkan, dan umumnya
disepakati bahwa varian ini bertanggung jawab atas terjadinya resistensi insulin.30
Hilangnya pengaruh pengaruh insulin telah dikaji pada penelitian transfeksi
dengan menggunakan varian Gly972Arg. Mutasi yang terjadi diperkirakan
mempengaruhi struktur tersier IRS-1, yang menyebabkan kerusakan ikatan
dengan phosphatitydilinositol 3 kinase (PI3K). Keadaan ini menyebabkan
ketimpangan metabolisme glukosa tanpa mengganggu fungsi mitogenik insulin.
Varian Gly972Arg juga telah ditemukan lebih banyak pada penderita SOPK
dengan resistensi insulin. Selain itu, wanita dengan varian Gly972Arg ternyata
gemuk, memiliki kadar insulin puasa yang lebih tinggi, dan lebih resisten terhadap
insulin berdasarkan pemeriksaan homeostasis model assesment (HOMA).

Lebih jauh, kadar glukosa dua jam pasca-makan ternyata lebih tinggi pada
penderita dengan varian Gly972Arg, yang kadar insulin puasa dan HOMA-nya
sebanding dengan kelompok kontrol.31,32
Metformin telah secara luas digunakan untuk mengobati SOPK yang terkait
resistensi insulin, meski masih ada pula penderita SOPK yang resisten terhadap
pengobatan ini. Selain itu masih pula dipertanyakan tentang perbedaan hasil
pengobatan dengan metformin pada penderita SOPK yang gemuk dan nir-gemuk.
Hal ini dapat dipengaruhi oleh banyak faktor, baik terhadap kejadian resistensi
insulinnya sendiri maupun mekanisme kerja metformin terhadap resistensi insulin
yang masih belum jelas.
Penurunan absorpsi pada sistem intestinal merupakan mekanisme yang
diduga akan menurunkan kadar glukoneogenesis endogen dari hati, dan
meningkatkan ambilan glukosa perifer. Pada tingkat seluler makin banyak bukti
yang mendukung bahwa metformin dapat meningkatkan proses fosforilasi tirosin
dari reseptor insulin subunit- dan protein-protein IRS. Metformin juga mampu
meningkatkan proses ambilan glukosa sel baik yang bergantung insulin maupun
tak bergantung insulin dengan menggunakan protein-protein yang berperan dalam
pengangkutan glukosa.22
Telah ditemukan pula bahwa metformin memperlihatkan pengaruh yang
berbeda terhadap kadar insulin puasa dan komponen-komponen HOMA
berdasarkan genotip IRS. Perbaikan yang bermakna juga terlihat pada variabelvariabel metabolik lain dalam kelompok IRS-1 yang tidak mengalami
polimorfisme pasca pemberian metformin selama tiga bulan. Turunnya resistensi

insulin pada kelompok IRS-1 yang tidak mengalami polimorfisme dan tiadanya
perubahan pada kelompok varian yang mengalami polimorfisme telah
membangkitkan dugaan bahwa genotip IRS-1 sangat penting perannya.33
Peran insulin telah dipastikan dapat meningkatkan produksi androstenedion
(AS) dan 17-hydroxy progesteron (17-OHP) dari sel-sel teka, dan metformin
mampu menghambat produksinya pada keadaan ada atau tiadanya insulin.
Tambahan lagi, pengeluaran produk-produk ini lebih jelas menurun pada adanya
insulin. Ovarium memiliki semua komponen molekul pengisyarat (signal) insulin.
Beberapa gangguan telah dijumpai pada protein-protein IRS, baik di jaringan
granulosa ovarium maupun di sel-sel teka. Di dalam sel-sel granulosa, IRS-1
ditemukan meningkat sedangkan IRS-2 menurun, tetapi belakangan ini tidak
dijumpai perbedaan persebaran molekul IRS dalam sel-sel granulosa dan bahkan
kedua-dua IRS-1 dan IRS-2 meningkat di dalam sel-sel teka. Ketidakseimbangan
persebaran protein-protein IRS menyebabkan gangguan fungsi ovarium pada
penderita SOPK.34
Beragamnya pengaruh metformin terhadap hasil pengobatan resistensi
insulin, membangkitkan dugaan kuat untuk diteliti bahwa metformin akan
berpengaruh baik bilamana kerusakannya tidak pada pasca reseptor. Kerusakan
pasca reseptor yang banyak dijumpai adalah polimorfisme IRS-1Gly972Arg,
sehingga apabila terjadi polimorfisme gen tersebut, maka metformin tidak akan
bekerja dengan baik untuk mengatasi resistensi insulin. Oleh karena itu bagaimana
keterkaitan resistensi insulin yang diberikan pengobatan metformin dengan
polimorfisme IRS-1Gly972Arg perlu dikaji lebih jauh.

Lebih lanjut, penurunan kepekaan insulin telah ditemukan pada 50% wanita
gemuk dengan polimorfisme IRS-1Gly972Arg. Selain itu juga ditemukan bahwa
peningkatan penyakit arteri koroner pada polimorfisme IRS-1Gly972Arg,
khususnya pada penderita yang gemuk. Artinya, ada hubungan kuat antara
polimorfisme IRS-1 Gly972Arg dengan kegemukan. Penderita-penderita SOPK
nir gemuk memperlihatkan tanggapan yang lebih baik ketimbang pasien gemuk
terhadap pemberian metformin.35
Hal-hal yang telah diuraikan di atas membangkitkan pertanyaan-pertanyaan
berikut: (1) apa indikasi yang tepat penggunaan metformin?; (2) apakah wanita
gemuk dan nir-gemuk memberikan tanggapan yang sama terhadap pemberian
metformin?; (3) apakah ada perbedaan polimorfisme IRS-1Gly972Arg yang nyata
mengenai pada wanita gemuk dan nir-gemuk?
Dari latar belakang penelitian diatas, dirumuskan tema sentral sebagai
berikut:
Infertilitas merupakan masalah bagi 15% PUS. Penyebab terbanyak
infertilitas adalah kelainan pada wanita (60%), yang 20% di antaranya
disebabkan anovulasi. Lebih dari 5% WUS mengalami anovulasi karena SOPK.
Hingga kini etiologi dan patogenesis SOPK masih belum seluruhnya terungkap.
Patogenesis yang banyak dianut adalah adanya hiperandrogenemia dan
resistensi insulin. Salah satu jalur yang dapat menerangkan etiopatogenesis
SPOK adalah melalui pendekatan kelainan genetik yang terkait dengan etnis,
lingkungan dan gaya hidup. Walaupun demikian kelainan genetik dan gambaran
fenotip SOPK yang beragam sangat menyulitkan untuk menentukan faktor mana

yang paling berperan dalam etiologi SOPK. Terjadinya resistensi insulin belum
sepenuhnya terungkap, tetapi diperkirakan hal ini berasal dari kerusakan pada
tingkat pasca reseptor. Oleh karena itu peran IRS-1 sangat penting untuk
terjadinya resistensi insulin ini. IRS-1Gly972Arg merupakan varian yang
terbanyak dihubungkan dengan resistensi insulin, yang berperan penting dalam
mempengaruhi struktur tersier IRS-1, sebagai penyebab kerusakan ikatan dengan
PI3K. Hal ini juga menyebabkan ketimpangan metabolisme glukosa tanpa
mengganggu fungsi mitogenik insulin. Penanganan resistensi insulin dengan
metformin baik pada wanita gemuk maupun nir-gemuk masih memberikan
perbedaan pengaruh pengobatan pada penderita SOPK berdasarkan genotip IRS.

1.2 Rumusan Masalah


1.2.1

Apakah polimorfisme gen IRS-1Gly972Arg menyebabkan resistensi


insulin pada penderita SOPK?

1.2.2 Apakah

polimorfisme

gen

IRS-1Gly972Arg

berperan

dalam

keberhasilan pengobatan metformin pada SOPK dengan resistensi


insulin?

1.3 Tujuan Penelitian


1.3.1 Tujuan Umum
Mengetahui polimorfisme IRS-1Gly972Arg penyebab resistensi insulin pada
penderita SOPK, dan mengungkap peran polimorfisme gen IRS-1Gly972Arg

dalam keberhasilan pengobatan dengan metformin pada penderita SOPK yang


gemuk dan nir-gemuk.
1.3.2 Tujuan Khusus
1.3.2.1. Menyelidiki polimorfisme gen IRS-1Gly972Arg pada penderita
SOPK dengan resiitensi insulin.
1.3.2.2. Menganalisis pengaruh metformin dan gen IRS-1Gly972Arg
terhadap keberhasilan pengobatan penderita SOPK dengan
resistensi insulin.

1.4. Manfaat Penelitian


Hasil penelitian ini diharapkan dapat memberikan informasi yang
bermanfaat bagi pengembangan di bidang :
1.4.1. Akademis
Dapat memberikan informasi mengenai peran polimorfisme gen IRS1Gly972Arg pada kejadian resistensi insulin penderita SOPK gemuk dan nirgemuk di Indonesia, sehingga dapat memberikan gambaran yang lain mengenai
etiopatogenesis SOPK.
1.4.2. Penelitian
Dapat menggugah minat untuk melanjutkan penelitian dengan menelaah
kebena-ran etiopatogenesis lebih lanjut, sehingga benar-benar ditemukan mata
rantai patogenesis SOPK yang sempurna.

10

1.4.3. Pelayanan
1) Dapat mengundang minat pentingnya pemeriksaan petanda molekuler
pada penatalaksanaan penderita SOPK dan dapat memberikan pilihan
pandangan lain.
2) Dapat menemukan rasionalisasi pemberian metformin pada penderita
SOPK dengan resistensi insulin yang gemuk dan nir-gemuk.

11

BAB II
KAJIAN PUSTAKA, KERANGKA PEMIKIRAN DAN HIPOTESIS

2.1 Kajian Pustaka


2.1.1 Gambaran umum SOPK
Chereau pada awal 1844 telah memaparkan perubahan sklerokistik pada
ovarium manusia, yakni sekitar 90 tahun sebelum tulisan klasik oleh Stein dan
Levental pada tahun 1935, dan reseksi baji pada ovarium mulai dilakukan di
Eropa sebelum tahun 1897 oleh Gusserow, Martin, Wiedow Zweifel dkk. Di
Amerika, Findley pada awal 1904 melakukan reseksi baji degenerasi kistik pada
ovarium. Kelainan anatomik ini oleh Stein dan Levental dihubungkan dengan
gejala klinik yang meliputi kelainan haid seperti amenorea atau oligomenorea,
infertilitas, hirsutisme dan kegemukan.
Peningkatan kadar hormon luteinisasi (luteinizing hormone, LH) pertama
kali dilaporkan pada tahun 1958 dan dianut sebagai kriteria diagnosis. Pada tahun
1971 diperkenalkan teknik tera-radioimun (radioimunoassay) sebagai diagnosis
biokimiawi. Meskipun pada tahun 1962 sudah jelas diketahui keragaman
gambaran klinis, tetapi barulah pada tahun 1976 berkembang konsep konsentrasi
kadar LH normal pada SOPK.4
Pada tahun 1935 Stein dan Levental menerbitkan tulisan tentang tujuh
penderita yang menampilkan gejala amenorea, hirsutisme, obesitas, dan temuan
polikistik pada kedua ovarium. Sindrom ovarium polikistik merupakan sindrom
akibat disfungsi ovarium yang acapkali berhubungan dengan keadaan sistemik

12

resistensi insulin. Gambaran utamanya adalah hiperandrogenisme dan bentuk


ovarium yang polikistik dengan perwujudan klinis infertilitas, haid tak teratur atau
amenorea, tanda-tanda hiperandrogenemia dan obesitas. SOPK merupakan
kelainan endokrinologis tersering yang mempengaruhi usia reproduksi penderita,
tetapi definisi SOPK masih dipertentangkan, dan patofisiologinya masih belum
jelas.4
Penting pula dikemukakan adalah ditemukannya keterkaitan SOPK dengan
resistensi insulin oleh Khan dkk pada tahun 1976 dan Burghen dkk pada tahun
1980. Swanson pertama kali memperlihatkan SOPK dengan ultrasonografi pada
tahun 1981, tetapi diag-nosis SOPK dengan ultrasonografi baru diterima setelah
Adam dkk memperbaiki kriteria diagnostik USG pada tahun 1985.4

2.1.2 Definisi dan diagnosis SOPK


Sindrom ovarium polikistik adalah kumpulan gejala dan manifestasi klinis
yang secara bersamaan membentuk kelainan, mulai dari ringan hingga berat, yaitu
gangguan reproduksi, endokrin dan metabolik. Patofisiologi SOPK bersifat
multifaktorial dan poligenik. Definisi SOPK masih diperdebatkan, tetapi
gambaran penyakitnya mencakup gangguan siklus haid, hiperandrogenisme dan
obesitas. Sentral penyakit ini adalah aspek di luar ovarium yang berpengaruh
terhadap patofisiologi SOPK dan disfungsi ovarium. Pada pertemuan antara
ESHRE (European Society for Human Reproduction and Embryo-logy) dengan
ASRM (American Society for Reproductive Medicine) tahun 2003 telah disepakati definisi SOPK, yaitu dua dari kriteria berikut: (i) oligo dan/atau anovulasi;

13

(ii) hiperandrogenisme (klinis dan/atau biokimia); (iii) ovarium yang polikistik,


dengan menyingkirkan etiologi lain.8
Gambaran ultrasonografis memperlihatkan volume ovarium yang membesar
karena peningkatan jumlah stroma dan jumlah folikel ovarium serta gambaran
roda pedati. Ovarium dikatakan polikistik jika ovarium tersebut memperlihatkan
jumlah folikel 12 atau lebih dengan diameter 2-9 mm dan/atau volum ovarium
meningkat (> 10 cm3).36
Kadar LH tinggi dengan FSH (follicle stimulating hormone) rendah atau
normal diperlihatkan oleh penderita dengan anovulasi persisten. Peningkatan
kadar LH ini disebabkan peningkatan kepekaan hipofisis untuk melepaskan
rangsangan hormon, yakni peningkatan frekuensi dan amplitudo LH. Hal terakhir
ini disebabkan keterkaitan lingkungan dan kadar estrogen tinggi dengan sekresi
LH dan penekanan FSH oleh hipofisis anterior. Keadaan ini juga diakibatkan
peningkatan frekuensi sekresi berdenyut (pulsatil) GnRH karena berkurangnya
penghambatan opioid hipotalamus akibat ketiadaan progesteron yang kronis.37
Kini kriteria diagnosis SOPK yang dianut adalah hiperandrogenisme dan
disfungsi ovulasi dengan menyingkirkan kelainan spesifik lain (seperti defisiensi
21-hidroksilase adrenal nir-klasik, hiperprolaktinemia, atau neoplasma penghasil
androgen). Dasar diagnosis sindrom ini tidak semata-mata ovarium yang
polikistik.

Gambaran

polikistik

dari

ovarium

ditentukan

berdasarkan

ultrasonografi dengan ditemukannya delapan atau lebih kista folikel subkapsuler


berukuran 10 mm dan stroma ovarium yang bertambah. Perubahan ini juga
dapat dijumpai pada penderita yang endokrinologis normal. Dengan demikian

14

perubahan morfologis tersebut harus dibedakan dari sindrom endokrinologis yang


mengalami hiperandrogenisme dan anovulasi.8,36
Perubahan sekresi gonadotropin berupa LH yang relatif lebih tinggi daripada
FSH, memang banyak ditemukan pada SOPK. Dari percontoh (sampel) darah
yang diambil serial setiap 10 menit selama 12-24 jam ditemukan peningkatan
bermakna pada frekuensi dan amplitudo pelepasan LH dengan FSH normal pada
penderita SOPK. Frekuensi denyutan LH yang meningkat ini mencerminkan
adanya peningkatan pelepasan GnRH dan menafsirkan adanya cacat (defek) di
hipotalamus. Selain itu hiperandrogenisme juga dapat mengubah sekresi
gonadotropin yang sama, seperti pada neoplasma penghasil androgen, atau
hiperandrogenisme adrenal akibat defisiensi 21-hidroksilase nir-klasik. Penderita
SOPK ovulatorik juga dapat memperlihatkan nisbah LH/FSH yang meningkat.
Mengingat perangai denyutan gonadotropin yang alami, maka percontoh darah
yang hanya sewaktu akan gagal menasah peningkatan nisbah LH/FSH.
Rendahnya kekhasan ini, maka nisbah LH/FSH tidak dipakai untuk kriteria
diagnosis SOPK.
SOPK disebut juga sebagai anovulasi hiperandrogenik kronik. Sebagian
besar penderita hiperandrogenisme anovulatorik mengalami peningkatan dayatanggap steroidogenik ovarium terhadap rangsangan analog GnRH (a-GnRH),
sehingga acapkali disebut sebagai hiperandrogenisme ovarium fungsional.38
SOPK sering ditandai oleh awitan dini usia menars tetapi gagal mengalami
haid teratur. Hirsutisme acapkali pula dijumpai pada usia peripubertas, selama
usia dewasa, atau bahkan tidak bangkit hingga usia tigapuluhan. Tanda lain

15

hiperandrogenisme adalah seborea, akne, dan alopesia. Terkadang tidak


ditemukan hiperandrogenisme pada beberapa penderita karena perbedaan genetik
pada jumlah jaringan sasaran dan kepekaan terhadap androgen. Dampak klinis
anovulasi kronis adalah haid tak teratur mulai dari oligomenorea, amenorea,
hingga perdarahan uterus disfungsional. Anovulasi dapat membangkitkan
infertilitas. Bergantung pada populasi yang diteliti, 16-80% penderita SOPK
adalah wanita gemuk. Akantosis nigrikans ringan hingga berat dapat dijumpai
pada penderita SOPK. Pada SOPK jarang terjadi perberatan gejala androgenik
dan/atau virilisasi yang cepat (seperti peningkatan massa otot, klitoromegali,
botak temporal, dan/atau suara memberat).39,40,41,42
Berdasarkan konsensus Rotterdam (Mei 2003), setelah menyingkirkan
kemungkinan etiologi lain, maka diagnosis SOPK dapat ditegakkan jika
ditemukan dua dari tiga kriteria di bawah ini:8
1. Oligomenorea dan/atau anovulasi.
2. Hiperandrogenemia, baik klinis maupun biokimiawi.
3. Gambaran ultrasonografi transvaginal yang memperlihatkan gambaran
ovarium yang polikistik.

2.1.2.1 Hiperandrogenemia
Secara

fenotip

tampilan

klinis

SOPK

ditetapkan

bilamana

ada

hiperandrogenisme baik secara klinis maupun biokimiawi setelah menyingkirkan


kelainan terkait. Gejala klinis utama dari hiperandrogenemia adalah hirsutisme,
meski bersifat subyektif dan ada keragaman ras. Oleh karena itu penderita Asia

16

Barat memperlihatkan prevalensi yang rendah, tetapi lebih sering pada penderita
Asia Selatan. Petunjuk hiperandrogenemia lain yang cukup baik adalah akne,
sedangkan alopesia merupakan petunjuk yang buruk. Penelitian mengenai SOPK
sebagian besar menemukan hiperandrogenemia dan sebagian kecil lagi tidak.
Terlihat bahwa 30% penderita SOPK memperlihatkan peningkatan kadar
testosteron dengan titik-potong (cut off point) 4,8 nmol/l. Kadar testosteron yang
lebih dari 4,8 nmol/l mengarahkan perlunya pemeriksaan penyebab lain, seperti
tumor ovarium dan tumor adrenal penghasil androgen, hiperplasia adrenal
kongenital awitan lambat, atau sindrom Cushing.43

2.1.2.2 Hormon luteinisasi


Pada 40-60% penderita SOPK kadar hormon luteinisasi (luteinizing
hormone, LH) serum meningkat karena meningkatnya amplitudo dan frekuensi
denyutan LH. Peningkatan LH ini merendahkan peluang konsepsi dan
meningkatkan risiko keguguran. Kadar LH dipengaruhi berbagai faktor, antara
lain: ovulasi, dan penekanan progesteron. Peningkatan kadar LH ini khas untuk
SOPK, tetapi kadar LH tidak menjadi dasar untuk menegakkan diagnosis SOPK,
begitu pula halnya dengan nisbah LH/FSH.43

2.1.3 Patofisiologi sindrom ovarium polikistik


Guna memahami patofisiologi SOPK, maka terlebih dahulu perlu dipahami
dengan baik disfungsi yang terjadi di dalam ovarium dan pengaruh dari luar
ovarium yang ikut serta pada perubahan sifat ovarium.

17

2.1.3.1 Biokimia ovarium


Kadar androgen (testosteron) tertinggi diperlihatkan oleh penderita SOPK
klasik, meski penderita SOPK dengan gejala ringan atau tak bergejala juga
memperlihatkan kadar testosteron yang lebih tinggi daripada penderita normal.
Penyebab mengapa titik berat pada ovarium dapat menjadi sumber androgen yang
tinggi adalah karena terjadinya salah atur steroidogenesis.44,45
Telah diketahui bahwa ovarium dan korteks adrenal merupakan pusat
biosintesis steroid, yang pada penderita pramenopause normal akan terlihat
keseimbangan antara androstenedion dan testosteron. Kedua organ itu akan
mengeluarkan androsetenedion lebih tinggi daripada testosteron, dan sebesar 50%
testosteron berasal dari hasil metabolisme androstenedion di jaringan perifer.
Produksi androgen di ovarium terjadi di lapisan teka interna folikel ovarium,
sedangkan di adrenal berlangsung di zona fasikulata korteks adrenal. Bahan untuk
sumber androgen ini adalah kolesterol yang dimetabolisasikan dengan bantuan
enzim yang sama, baik di ovarium maupun di adrenal; di ovarium dikendalikan
oleh LH sedangkan di adrenal dikendalikan oleh hormon adrenokortikotropin
(ACTH).46,47,48
Tahap awal biosintesis semua hormon steroid adalah pengubahan kolesterol
menjadi pregnenolon, yang terdiri dari dua proses dan melibatkan enzim pemecah
rantai samping kolesterol dan protein pengatur steroidogenik. Pregnenolon
kemudian diubah menjadi dehidroepiandrostenedion (DHEA) oleh dua tahap
sepanjang jalur steroid-5 (5-steroid pathway) dengan bantuan katalisator enzim
P450c17, dan seiring dengan proses ini, progesteron juga mengalami perubahan

18

bentuk (transformasi) menjadi androstenedion pada jalur steroid-4. Pada


manusia, produk gen sitokrom P450c17 sedikit saja berperan pada aktivitas 17,20liase pada jalur steroid-4. Di adrenal 17-hidroksiprogesteron diubah menjadi
kortisol dan hormon seks, bergantung pada apakah terjadi 21-hidroksilasi
(menjadi kortisol) atau 17,20-lisis (menjadi 17-ketosteroid). Aktivitas 17-hidroksidehidrogenase

pada

17-ketosteroid

penting

untuk

testosteron, dihidrotestosteron dan estradiol (Gambar 1).

19

pengubahan

menjadi

CHOLESTEROL
StAR

Side chain cleavage

PREGNENOLON 3

PROGESTERONE

ALDOSTERONE

17-hydroxylase
17-HYDROXY

17-HYDROXY

PREGNENOLON 3

PROGESTERONE

CORTISOL

17, 20 lyase
DEHYDROEPI
ANDROSTENEDIONE 3

ANDROSTENEDIONE

17-hydroxydehydrogenase
DHEAS-SO4

TESTOSTERONE

Gambar 1. Biosintesis Steroid (Sumber: Ehrmann. Endocrine Reviews 1995;16:322-53)

Pada penderita normal sekresi androgen beragam sepanjang siklus dan


bersifat diurnal sampai dua kali nilai rerata. Tahap terbatas steroidogenesis adalah
pembentukan pregnenolon dari kolesterol yang diatur oleh hormon tropik. Tahap
terbatas pembentukan androgen adalah tampilan gen P450c17, yang sangat
bergantung pada hormon tropik, yaitu LH dalam ovarium dan ACTH dalam
20

korteks adrenal. Respons steroidogenik terhadap hormon tropik ini diatur oleh
susunan peptida kecil, antara lain insulin dan faktor pertumbuhan mirip insulin
(insulin-like growth factors, IGFs).
Androgen ovarium dalam jumlah tertentu diperlukan untuk pertumbuhan
folikel normal dan sintesis estradiol. Sebaliknya, bilamana androgen disintesis
tidak sesuai dengan kebutuhan perkembangan folikel dan berlebihan, maka
pematangan (maturasi) folikel menjadi buruk dan menyebabkan atresia folikel.
Pada ovarium normal, LH bekerja pada sel stroma interstisial teka sedangkan FSH
bekerja pada sel granulosa, sesuai dengan teori dua gonadotropin, dua sel (twogonadotrophin, two-cell theory) untuk biosintesis estrogen. Dalam hal ini lapisan
teka mengeluarkan androgen sebagai respons terhadap LH, dan androstenedion
yang terbentuk diubah menjadi estrogen dalam sel granulosa oleh aromatase di
bawah pengaruh FSH. Bilamana folikel dominan sudah terbentuk, maka estrogen
menjadi lebih dominan daripada androgen. Pengaturan sintesis androgen oleh LH
merupakan hal yang penting. Bilamana perangsangan LH berlebihan, maka akan
terjadi desensitisasi sehingga terjadi pengaturan turun (down-regulation) reseptor
LH, penguranan aktivitas pemecahan rantai samping kolesterol, dan pengurangan
aktivitas 17,20-liase dan 17-hidroksilase, sehingga nisbah 17-hidroksiprogesteron
terhadap androgen meningkat.49
Autokrin, parakrin dan faktor hormonal mengatur keselarasan fungsi sel teka
dan sel granulosa dalam sintesis androgen. Androgen dan estrogen bertindak
sebagai pengubah (modulator) negatif terhadap pengaruh LH, sedangkan IGF
bertindak sebagai modulator positif. Insulin meningkatkan perangsangan LH

21

terhadap produksi androgen, baik melalui reseptor insulin sendiri maupun melalui
reseptor IGF. Inhibin meningkatkan sintesis androgen; selanjutnya androgen akan
merangsang produksi inhibin, sedangkan aktivin bekerja bertolak-belakang
dengan inhibin. Prostaglandin dan angiotensin juga berperan sebagai pemicu,
sedangkan hormon pelepas kortikotropin (corticotropin releasing hormone,CRH),
faktor pengalih-bentuk pertumbuhan (transforming growth factor-, TGF-),
faktor pertumbuhan epidermis (epidermal growth factor, EGF), faktor nekrosis
tumor (tumor necrosis factor, TNF) dan sitokin menghambat biosintesis androgen.
Modulator positif (penambah) sintesis androgen antara lain adalah insulin, IGF,
inhibin, prostaglandin dan angiotensin. Modulator negatif (penghambat) sintesis
androgen antara lain adalah androgen, estrogen, aktivin, CRH, TGF-, EGF, TNF
dan sitokin.
Perkembangan sel granulosa dan peningkatkan aktivitas aromatase juga
menentukan produksi androgen. Folikel sehat dengan diameter 8 mm akan
mengubah androstenedion menjadi estradiol. Sebaliknya, folikel atretik dan/atau
kistik memiliki nisbah androstenedion terhadap estradiol yang tinggi. FSH pada
sel granulosa menentukan pertumbuhan folikel yang sehat dengan diameter 2-5
mm, dan sebagian diatur juga oleh sistem IGF dan insulin yang fisiologis, yang
merangsang produksi estradiol. Protein pengikat IGF (IGF-binding protein, IGFBP) menghambat bioaktivitas FSH dan ditemukan cukup banyak dalam folikel
atretik. TGF dan EGF menghambat aromatase, sedangkan aktivin menguatkan sel
granulosa untuk menghasilkan estrogen dan menghambat sekresi androgen teka.

22

Hampir separo testosteron dalam peredaran darah penderita dewasa normal


berasal dari pengubahan androstenedion di perifer, sedangkan sisanya berasal dari
ovarium dan korteks adrenal. Jaringan tempat pengubahan ini antara lain adalah
paru, hati, jaringan lemak, dan kulit. Jaringan lemak juga membentuk estron dari
androstenedion. Bukti ini menjelaskan mengapa penderita gemuk memiliki
estrogen yang lebih tinggi. Dihidrotestosteron plasma seluruhnya dihasilkan
berkat aktivitas 5-reduktase di perifer, dengan androstenedion plasma sebagai
pembakal utama.50
2.1.3.2 Fungsi ovarium pada SOPK
Ovarium polikistik yang besar menjadi dasar dugaan bahwa ovarium
merupakan tempat primer kelainan endokrin, khususnya hiperandrogen.
Diperkirakan perubahan aktivitas P450c17 berperan penting pada produksi
berlebihan androgen ovarium. Hal ini didukung oleh pemeriksaan terhadap
respons hipofisis dan ovarium atas penyuntikan agonis hormon pelepas
gonadotropin (gonadotropin releasing hormnone agonist, GnRH-a) yakni
nafarelin.
Pemberian a-GnRH pada penderita SOPK hiperandrogenik yang produksi
androgen adrenal terlebih dahulu ditekan dengan deksametason ternyata
meningkatkan androstenedion dan 17-hidroksiprogesteron. Penelitian yang lebih
luas terhadap penderita SOPK hiperandrogenik yang anovulatorik dan ovulatorik
memperlihatkan bahwa pemberian a-GnRHa menghasilkan peningkatan ringan
androstenedion dan 17-hidroksiprogesteron.

23

Pada penderita anovulatorik dijumpai peningkatan kadar 17-hidroksiprogesteron yang lebih tinggi. Juga ditemukan tiadanya peningkatan bermakna
kedua hormon terhadap pemberian ACTH, sehingga peran androgen adrenal dapat
disingkirkan. Dengan demikian dapat diperlihatkan bahwa hiperandrogenemia
pada penderita SOPK anovulatorik dan ovulatorik memang berasal dari ovarium;
dan bahwa penyebab primer hiperandrogenemia pada ovarium polikistik tidak
hanya hipersekresi LH tetapi juga cacat intrinsik akibat disfungsi sel interstisial
teka ovarium atau akibat pengaruh perangsang lain seperti insulin dan IGF-1.
Lebih lanjut, apabila penderita SOPK klasik disuntik a-GnRH dosis tunggal
maka akan terjadi lonjakan FSH dan LH praovulasi, respons berlebihan sekresi
17-hidroksiprogesteron, peningkatan ringan androstenedion, testosteron, estron,
dan estradiol. Temuan ini membuat dugaan adanya disregulasi umum sekresi
androgen ovarium, dan yang penting adalah bahwa P450c17 merupakan jalur bagi
disfungsi ini.
Data invivo dan invitro memperlihatkan bahwa sel teka penderita SOPK
mengalami steroidogenesis berlebihan. Penderita SOPK cenderung mengalami
kelebihan estradiol pada semua tingkatan pematangan folikel. Ini diakibatkan
tersedianya substrat androgen berlebihan untuk aktivitas aromatase, dan sebagian
lagi dikarenakan peningkatan respons terhadap perkembangan folikel serta sekresi
estradiol terhadap FSH. In vitro, sel granulosa SOPK juga tak berespons terhadap
FSH dan menghasilkan kadar progesteron yang rendah.
LH yang berlebih dipikirkan sebagai penyebab hiperandrogenisme ovarium
SOPK karena pengaruh rangsangan LH terhadap sel teka. Namun demikian,

24

hiperandrogenisme juga dapat ditemukan pada penderita SOPK dengan LH


normal. Penderita SOPK yang dilakukan pengaturan-turun dengan a-GnRH
jangka

panjang

ternyata

juga

memperlihatkan

respons

berlebihan

17-

hidroksiprogesteron terhadap penyuntikan hCG (human chorionic gonadotropin).


Temuan ini menentang peran tunggal LH dalam peningkatan androgen pada
penderita SOPK. Di sini lebih dititikberatkan bahwa sel teka penderita SOPK
mengalami respons berlebihan terhadap gonadotropin, produksi androgen
berlebihan akibat hilangnya pengaturan turun normal terhadap gonadotropin, dan
hubungan disregulasi ini dengan peningkatan insulin dan IGF-1. Pendapat ini
didukung oleh bukti yang memperlihatkan bahwa penekanan sekresi insulin oleh
analog somatostatin menurunkan kadar LH dan androgen serum pada penderita
SOPK. Insulin berperan sebagai kogonadotropin dan memperbesar pengaruh
testosteron dengan menekan globulin pengikat hormon seks (sex hormone binding
globulin, SHBG).
Inhibin merupakan faktor pemicu FSH yang mampu mempengaruhi
pengaturan turun steroidogenesis. Pada penderita SOPK kadar inhibin-B ini
meningkat dan ini berhubungan dengan androstenedion plasma. Bukti ini
menjelaskan mengapa pada penderita SOPK anovulatorik kadar FSH relatif lebih
rendah daripada LH. Perangsangan inhibin terhadap pembentukan androgen, dan
sebaliknya androgen merangsang sekresi inhibin, menghasilkan siklus di dalam
ovarium yang menghambat perkembangan folikel. Pada pihak lain, cacat pada
sistem IGF juga mengubah penentuan respons sel granulosa terhadap FSH.
Diduga LH bekerja pada sel granulosa yang mengandung insulin sehingga

25

menyebabkan luteinisasi dini, henti pematangan folikel, dan produksi androgen


berlebihan.51

2.1.3.3 Poros hipotalamus hipofisis ovarium


Gonadotrofin hipofisis merupakan pusat pengaturan fungsi reproduksi
melalui pembentukan dan pengeluaran FSH dan LH, yang dirangsang langsung
oleh GnRH hipotalamus dan dipengaruhi oleh mekanisme umpan balik. FSH
berperan sebagai perangsang awal perkembangan folikel dan pengubahan
androgen menjadi estrogen di dalam sel granulosa dengan cara merangsang enzim
aromatase. Telah dipahami bahwa LH sendiri berperan pada fase luteal untuk
merangsang pengeluaran progesteron, dan pada fase folikuler untuk memicu
produksi androgen sel-sel teka (substrat untuk sintesis estrogen) dan memulakan
pematangan oosit pada pertengahan siklus.
GnRH sebagai dekapeptida tunggal hipotalamus akan merangsang pelepasan
LH dan FSH dari gonadotrof. Perangsangan denyutan GnRH diperlukan untuk
mempertahankan sekresi gonadotropin, sedangkan pajanan malar GnRH terhadap
hipofisis akan menimbulkan desensitisasi dan penekanan sekresi gonadotropin.
Perubahan denyutan GnRH diperkirakan dapat mengubah nisbah sekresi dari
kedua gonadotropin hipofisis itu sepanjang siklus haid. Denyutan GnRH yang
lambat akan menghasilkan FSH yang lebih banyak, sedangkan denyutan GnRH
yang cepat menyebabkan sekresi LH yang lebih dominan. Kerja GnRH diatur di
tingkat hipofisis, yang akhirnya menyebabkan perbedaan produksi dan sekresi
kedua macam gonadotropin tersebut. GnRH menyebabkan pelepasan LH dan

26

FSH, dan berkhasiat potensiasi terhadap gonadotrof sendiri. Pelepasan


gonadotropin secara primer, dan sintesis serta penyimpanan secara sekunder
dikenal sebagai gonadotropinisme primer dan sekunder.52
Kepekaan hipofisis terhadap GnRH beragam sepanjang siklus haid
mengikuti perubahan kadar estradiol (E2) dalam peredaran darah. Pada fase
folikuler awal, ketika kadar E2 rendah, maka kepekaan hipofisis dan kandungan
gonadotropinnya berada pada tingkat terendah. Manakala kadar E 2 meningkat
akibat perkembangan folikel, maka kepekaan hipofisis dan kandungan
gonadotropin ikut meningkat pula. Estradiol berkhasiat merangsang sintesis dan
penyimpanan hipofisis, dan merangsang pengaruh GnRH pada hipofisis. Puncak
kepekaan terhadap GnRH terjadi pada pertengahan siklus, sehingga terjadi
pelepasan sejumlah besar gonadotropin. Estradiol juga meningkatkan respons
GnRH dan jumlah reseptor GnRH secara langsung dengan merangsang sintesis
protein pembentuk reseptor.53
Nukleus arkuatus hipotalamus bertindak sebagai penjejak sel saraf ke isyarat
endokrin, meski sel asal sebagai pembangkit denyutan GnRH belum diketahui.
Neuron penghasil GnRH dalam bentuk denyutan dengan frekuensi yang beragam
selama siklus haid normal menyebabkan pelbagai frekuensi dan amplitudo
pelepasan gonadotropin. Pengendalian irama pembangkit denyutan GnRH belum
dipahami. Meski di dalam hipofisis sendiri tidak ada umpan balik tetapi steroid
gonad dan faktor lain mengatur kerja GnRH pada tingkat hipofisis dan
hipotalamus.

27

Beberapa faktor berpengaruh terhadap aktivitas GnRH, yakni endorfin- dan


peptida opiat, angiotensin II, serotonin, neuropeptida-Y, neurotensin, somatostatin,
faktor pelepas kortikotropin (corticotropin releasing factor, CRF), dopamin,
melatonin, norepinefrin (noradrenalin), oksitosin, dan substansi-P. Namu
demikian, hubungan antara faktor-faktor ini belum jelas. Opioid endogen penting
dalam pengaturan sekresi LH dan prolaktin. Opiod seperti endorfin-
menghambat pelepasan GnRH dari hipotalamus mediobasal. Diperkirakan lucut
opioid endogen akibat adanya estradiol dalam jumlah cukup ikut serta memulakan
lonjakan LH. Penurunan opioid memulakan rangkaian neurosekresi. Pada tikus
percobaan hal tersebut mengaktifkan neuron neuropeptida-Y, yang selanjutnya
merangsang sekresi GnRH secara langsung atau bersama dengan penghantar
adrenergik. Pengaruh opioid bergantung pada lingkungan hormon steroid,
khususnya estrogen, yang khasiatnya ditambah oleh progesteron. Ini menerangkan
bahwa pemberian antagonis opioid, seperti nalokson, selama fase folikuler awal
berpengaruh kecil terhadap kadar gonadotropin, tetapi pengaruh itu lebih besar
pada pertengahan siklus, dan paling besar tampak pada fase luteal.54
Kadar steroid dalam peredaran darah juga mempengaruhi metabolisme
GnRH dengan mengubah aktivitas enzim proteolisis dalam hipofisis dan
peredaran darah perifer. Misalnya, estradiol menghambat penghancuran GnRH
pada hipofisis tikus dan kera, dan memperbesar aktivitas GnRH ketika kadar
estradiol tinggi. Peran steroid seperti ini juga mungkin terjadi pada penderita
SOPK.55

28

Hipersekresi LH pada penderita SOPK diduga sebagian disebabkan


penurunan gabungan opioid dan dopaminergik. Selain itu, perubahan aktivitas
adrenergik juga dijumpai pada penderita dengan hipersekresi LH. Penderita SOPK
sangat peka terhadap dopamin eksogen, dan diduga mengalami defisiensi
penghambatan dopamin endogen terhadap sekresi GnRH. Pada wanita normal,
antagonis dopamin (misalnya metoklopramid) dan antagonis opiat (nalokson)
meningkatkan kadar LH serum. Sebaliknya, pemberian endorfin- sintetik
menurunkan kadar LH serum. Pada penderita SOPK, pemberian metoklopramid,
nalokson dan endorfin-, tidak berpengaruh pada aktivitas sekresi LH. Diduga ini
diakibatkan oleh cacat hipotalamus yang mendasari dan menyebabkan
hipersekresi LH melalui penurunan dopamin endogen dan kendali opioid terhadap
sekresi Gn-RH.56,57,58,59
Pemberian infus nalokson pada penderita SOPK telah memperlihatkan
respons LH yang sama. Sebelum pengobatan dengan L-dopa-karbidopa selama
satu minggu ternyata perangsangan dengan nalokson tidak meningkatkan LH pada
wanita normal, berbeda dengan penderita SOPK yang memperlihatkan
peningkatan LH setelah pemberian nalokson. Diperkirakan opioid sentral tidak
menurun pada SOPK, tetapi kerja dopaminergik atau interaksi keduanya berubah.
Lebih lanjut, perubahan utama kerja dopaminergik otak penderita SOPK gagal
diperlihatkan, karena fisiologi dopamin otak sulit dipelajari. Pemberian
progesteron dan antagonis opioid pada penderita SOPK telah dicoba dan ditemukan bahwa pada hipersekresi LH gangguan opioid berhubungan dengan sekresi
progesteron. Selain itu ternyata pada penderita SOPK kelainannya tidak hanya

29

dijumpai pada metabolit dopamin melainkan juga pada metabolit adrenergik. Pada
pemberian naltrekson selama 4 minggu pada penderita SOPK juga terjadi
pengurangan kepekaan hipofisis terhadap GnRH, sedangkan peran opioid
endogen dalam pengendalian sekresi LH belum terungkap.59,60,61,62
Interaksi berbagai faktor ini pada tingkat hipotalamus bersifat kompleks dan
faktor dominan yang mempengaruhi sekresi LH belum diketahui. Telaah atas
kendali neuroendokrin terhadap SOPK memperlihatkan bahwa pusat gangguan
pada SOPK berada di hipotalamus dan hipofisis, dan merupakan akibat sekunder
dari satu atau lebih faktor perifer, yang antara lain berasal dari ovarium.63
Perihal peningkatan frekuensi denyutan GnRH pada penderita dengan
hipersekresi LH juga masih dipertentangkan. Apabila steroid yang merupakan
produk utama ovarium mempengaruhi sekresi LH, dan dapat menembus sawar
darah otak, maka ini diperkirakan juga dapat mempengaruhi denyutan GnRH.
Jika cacat primer terletak pada sekresi peptida ovarium, maka diperkirakan tidak
dapat menembus sawar darah otak untuk mempengaruhi frekuensi denyutan
GnRH. Peningkatan amplitudo denyutan tidak dipertentangkan, tetapi telah
digambarkan adanya peningkatan frekuensi denyutan LH. Peningkatan frekuensi
denyutan tidak selalu ada, tetapi lazimnya ditemukan perubahan irama sirkadian
sekresi LH, yang amplitudo denyutan LHnya meningkat pada malam hari.
Perbedaan ini dikarenakan perbedaan populasi penelitian, sehingga perbedaan
pada frekuensi denyutan diperkirakan kurang berperan atas gangguan hipotalamus
primer terhadap hipersekresi LH. Dalam hal keragaman pengukuran LH pada
penderita SOPK telah ditemukan perbaikan pada pemeriksaan ulang setelah satu

30

tahun. Denyutan LH juga diperiksa dengan analisis waktu, dan ternyata gambaran
sekresi LH cukup rumit dikarenakan denyutan superimposed yang frekuensinya
berbeda. Secara umum tidak ditemukan perbedaan frekuensi denyutan antara
penderita SOPK dan wanita normal.64-72
Pada penderita SOPK yang dilakukan elektrokauterisasi laparoskopik
terhadap ovarium ditemukan perubahan umpan balik ovarium terhadap hipofisis
yang menyebabkan hipersekresi LH. Amplitudo denyutan LH tampak menurun,
tetapi frekuensi denyutannya tetap normal. Pada pihak lain, ternyata pasca
elektrokauterisasi ovarium rangsangan GnRH terhadap sekresi LH menjadi
berkurang; ini mendukung pandangan bahwa sekresi LH diatur oleh kelainan
ovarium dan menyanggah pendapat yang mengatakan bahwa kelainan dimulai
pada tingkat hipotalamus dan hipofisis.73,74
Mekanisme pemicuan ovulasi dengan elektrokauterisasi laparoskopik
ovarium belum jelas; agaknya kerusakan minimal pada ovarium yang tak tanggap
terhadap pemulihan siklus ovulasi atau peningkatan kepekaan ovarium terhadap
rangsangan eksogen. Kenyataan tentang berkurangnya respons sekresi LH
terhadap rangsangan GnRH diperkirakan akibat pengaruh atas umpan balik
ovarium terhadap hipofisis yang mempengaruhi kepekaan hipofisis terhadap
GnRH. Elektrokauterisasi laparoskopik ovarium unilateral berpengaruh pada
aktivitas ovarium bilateral, dan disimpulkan bahwa ketika pertama kali
elektrokauterisasi ovarium dilakukan, maka pengaruhnya diperoleh melalui
perbaikan umpan balik ovarium terhadap hipofisis. Diperkirakan respons ovarium
terhadap trauma menyebabkan riam lokal bagi faktor pertumbuhan seperti IGF-1,

31

yang berinteraksi dengan FSH, dan merangsang pertumbuhan folikel dan


mekanisme ovarium-hipofisis selanjutnya dengan hasil menurunnya kadar LH
serum.

2.1.3.4 Glikosilasi LH
LH ditemukan dalam berbagai bentuk di hipofisis dan peredaran darah
perifer,

dikarenakan

beragamnya

rantai

samping

oligosakarida,

yang

menghasilkan sejumlah glikoform LH. Masing-masing subunit alfa dan beta dari
LH memiliki dua sisi glikosilasi terkait N (N-linked glycosylation site) dan bentuk
oligosakarida merupakan sekitar 30% dari molekul. Glikoform tidak dapat
diasingkan, meski ada gonadotropin rekombinan yang memiliki berbagai
glikoform. Glikosilasi isoform dengan isoform dasar yang bermasa hidup lebih
singkat dan invivo beraktivitas lebih rendah daripada isoform asidik. Pada pihak
lain isoform dasar memperlihatkan potensi biologik yang lebih tinggi, dengan
daya ikat reseptor yang lebih tinggi, steroidogenik, dan invitro mampu
merangsang c-AMP intraseluler. Perbedaan ini tak dapat dikenali dengan
teraimunologik

karena

antibodi

tidak

mengenali

oligosakarida,

maupun

terabiologik invitro, yang tak bergantung pada mekanisme bersihan invivo. Lektin
ter-ikat pada oligosakarida dan berperan pada dua tempat lektin/tera-antibodi.
LH mengalami pengubahan di dalam peredaran darah, misalnya karena
pemeca-han proteolisis rantai beta. LH berbeda dengan hCG karena hCG
memiliki peptida ujung-C tambahan. Ada bukti bahwa hCG pun disekresikan oleh

32

hipofisis normal dan masuk ke dalam peredaran darah dengan kadar sekitar 1%
dari LH.75
Pajanan steroid serum dengan kadar yang berbeda-beda terhadap hipofisis
dapat mempengaruhi glikosilasi dan juga aktivitas biologis LH, yang kemudian
mempengaruhi produksi steroid ovarium. Pada hewan, steroid gonad bekerja
langsung pada hipofisis untuk mengendalikan potensi biologis penyimpanan dan
sekresi gonadotropin, tetapi belum jelas apakah pada penderita SOPK aktivitas
biologis LH dipengaruhi oleh peruba-han kronis sekresi hormon steroid. Kadar
LH bioaktif serum meningkat pada penderita SOPK. Derajat bioaktivitas tidak
berhubungan dengan aktivitas dopaminergik atau kadar estradiol serum, tetapi
tampaknya kadar LH bioaktif berguna sebagai petanda kadar LH imunoaktif atau
nisbah LH/FSH. Telah ditemukan bahwa kadar LH bioaktif berkorelasi baik
dengan gejala SOPK (oligo/amenorea) ketimbang kadar LH serum yang diukur
secara tera-imunoradiometrik (immunoradiometric assay, IRMA). Diperkirakan
bahwa penderita SOPK menghasilkan isoform LH dengan aktivitas biologis
tinggi. Kejadian ini didukung bukti dari penelitian pemusatan isoelektrik
(isoelectric focusing) terhadap serum wanita normal dan penderita yang kadar
LH-nya meningkat. Ternyata wanita dengan kadar LH tinggi memiliki lebih
banyak isoform LH yang tersebar pada titik isoelek-trik alkalis, yang sesuai
dengan aktivitas biologis yang tinggi.76,77,78
Varian genetik LH (vLH) digambarkan dengan dua mutasi titik (point
mutation) pada gen LH (Trp8Arg dan Iie15Thr). Kejadian ini dikenal sebagai
polimorfisme umum yang kejadiannya tersebar di dunia dengan frekuensi

33

populasi pembawa (karier) sebesar rerata 18,5% (28,9% di Finlandia, 16,8% di


Inggris, 14,1% di Amerika Serikat dan 11,2% di Belanda). Aktivitas biologis vLH
lebih besar daripada jenis liar (wild type) LH secara invitro, tetapi waktu paronya
lebih singkat dan pengaruhnya secara keseluruhan terhadap bioaktivitas invivo
masih belum jelas. Frekuensi karier vLH ternyata sama, baik pada kontrol gemuk
maupun nir-gemuk, tetapi lebih rendah pada penderita SOPK gemuk. Tampaknya
penderita gemuk dengan vLH terlindung dari berkembangnya gejala SOPK
sedangkan penderita dengan LH-jenis liar lebih rentan untuk mengalami SOPK.
Hubu-ngan ini sebagian besar jelas, hanya sebagian kecil yang menunjukkan
frekuensi LH tinggi pada penderita SOPK gemuk dibandingkan dengan kontrol
wanita gemuk.79
Invitro, insulin merangsang hipofisis untuk mengeluarkan gonadotropin.
Dengan dasar ini dipikirkan bahwa hiperinsulinemia pada penderita SOPK
mempunyai hubungan sebab akibat dengan hipersekresi LH. Selanjutnya telah
ditemukan bahwa penderita SOPK yang gemuk dan nir-gemuk memiliki kadar LH
bioaktif serum yang tinggi, sedangkan yang gemuk kadar LH bioaktifnya
cenderung normal. Perbedaan ini tidak dapat digunakan untuk menggambarkan
kadar androgen serum. Artinya, yang berhubungan dengan kadar insulin serum
adalah kadar LH bioaktif dan bukan LH imunoaktif. Diperkirakan bahwa derajat
hiperinsulinemia pada penderita gemuk dengan resistensi insulin berpengaruh
langsung pada glikosilasi LH.80
Penderita SOPK lebih sering memperlihatkan hipersekresi LH dan
peningkatannya sekresi androgen sel teka. Namun demikian telah diperkirakan

34

pula bahwa penderita SOPK dengan kadar LH serum tertinggi tidak selalu
memiliki kadar testosteron serum tertinggi. Selain itu ditemukan kadar LH serum
lebih tinggi pada penderita SOPK kurus dan kadar insulin serum puasanya normal
dibandingkan penderita SOPK kurus atau gemuk dengan kadar insulin serum
puasa yang meningkat. Juga terlihat penderita SOPK baik yang kurus maupun
yang gemuk dengan kadar insulin puasa yang tinggi memiliki kadar testosteron
serum yang lebih tinggi daripada penderita SOPK dengan kadar insulin normal.
Ini menimbulkan dugaan adanya hubungan kuat antara sekresi androgen dengan
kadar insulin ketimbang dengan LH.81,82

2.1.3.5 Umpan-balik steroid terhadap sekresi LH


Kemampuan gonadotrof manusia dalam hubungannya dengan kepekaan
terhadap GnRH dan penyimpanan gonadotropin telah diteliti dengan memeriksa
pengaruh pemberian estradiol dan progesteron terhadap sekresi gonadotropin yang
dirangsang oleh GnRH pada penderita normal dalam fase folikuler siklus haid.
Ternyata estradiol meningkatkan sekresi gonadotropin hipofisis, yang dapat
diperkuat dengan tambahan progesteron. Pengaruh ini sama terhadap sekresi FSH
dan LH. Pengaruh penguatan progesteron terhadap estrogen di hipofisis masih
belum seluruhnya dipahami. Dari kajian tentang berbagai dosis estrogen eksogen
dalam memicu lonjakan LH pada kera dan wanita, ternyata estrogen dan
progesteron menghambat sekresi gonadotropin hipofisis, dan perbedaan pengaruh
ini bergantung pada dosis dan waktu pemberian. Tampaknya progesteron
pengaruh utama terhadap hipotalamus, meski reseptor progesteron ditemukan di

35

gonadotrof kera, yang menunjukkan adanya pengaruh langsung pada tingkat


hipofisis. Dengan demikian progesteron tidak berperan pada hipersekresi LH
karena pada fase folikuler progesteron hanya sedikit disekresikan, baik pada
penderita normal maupun pada penderita dengan kadar LH serum tinggi.83
Selanjutnya kadar LH serum ditemukan lebih rendah pada penderita SOPK
bilamana siklus ovulatorik dibandingkan yang anovulatorik. Dijumpai pula bahwa
penderita anovulatorik berespons terhadap GnRH eksogen dengan denyutan
sekresi yang lebih besar daripada penderita dengan ovarium normal. Dengan
demikian hipersekresi LH terjadi sekunder atas peningkatan sekresi steroid
ovarium selama kurun anovulasi, khususnya androgen, yang kemudian
dimetabolisasikan menjadi estron di lemak perifer.
Penderita SOPK ovulatorik juga memiliki kadar LH serum yang lebih tinggi
daripada wanita dengan ovarium normal yang ovulatorik. Penderita SOPK yang
diobati dengan gonadotropin untuk memicu ovulasi juga mengalami peningkatan
kadar LH serum padahal diharapkan kadar LH itu tertekan karena sekresi faktor
penghambat LH oleh ovarium. Temuan ini mendukung bahwa penderita SOPK
mempunyai

gangguan

umpan

balik

ovarium

terhadap

hipofisis

dalam

mengendalikan sekresi LH, meski ada gonadotropin eksogen.67


Estrogen

juga

menghambat

rangsangan

GnRH

terhadap

sekresi

gonadotropin, dengan pengaruh rangsangan berikutnya yang tampaknya juga


sekunder terhadap pengaruh langsung terhadap jumlah reseptor GnRH. Pada
biakan sel hipofisis yang terpajan penurunan estradiol tampak bahwa hipofisis
tikus berespons terhadap GnRH, dan pajanan yang lebih lama dari 24-48 jam

36

diperlukan sebelum respons GnRH bertambah. Mekanisme seluler dari pengaruh


penghambatan ini masih dipertentangkan. Kadar estradiol penting karena kadar
yang tinggi akan menurunkan respons, sehingga kurva respons dosis akan
berbentuk lonceng. Pemberian estradiol pada penderita SOPK hiperandrogenemik
yang anovulatorik dan ovulatorik tidak menghasilkan perbedaan dalam penekanan
kadar LH serum, dan juga tidak berbeda pada kontrol penderita normal.84
Androgen menghambat sekresi gonadotropin dengan menurunkan jumlah
reseptor GnRH pada biakan sel hipofisis dan kejadian pasca-reseptor dipengaruhi
oleh androgen. Penelitian pada waria (wanita-pria) transeksual terlihat bahwa
dosis testosteron gagal membendung pemicuan estradiol terhadap lonjakan LH.
Dengan demikian androgen kurang berperan dalam terjadinya lonjakan LH pada
keadaan normal sekalipun. SOPK mengeluarkan androgen berlebihan, yang
kemudian dimetabolisasikan menjadi estrogen. Pada keadaan fisiologis kadar
testosteron menekan sekresi LH. Pemberian androgen eksogen tidak berhasil
meningkatkan amplitudo dan frekuensi denyutan LH, baik pada pemberian yang
singkat maupun yang jangka panjang.85,86

2.1.3.6. Umpan-balik nir-steroid terhadap sekresi LH


Dari penelitian inhibin diketahui bahwa tak hanya sejumlah anggota
inhibin dari hormon glikoprotein melainkan juga isyarat nir-steroid gonad
mempengaruhi sekresi gonadotropin dan membuat fungsi reproduksi lebih baik.
Inhibin ovarium memberikan umpan balik negatif terhadap produksi gonadotropin
hipofisis, khususnya FSH. Cara umpan balik terhadap sekresi LH hipofisis telah

37

diteliti secara invitro dan invivo. Tampaknya ada peptida penghambat yang
dikenal sebagai faktor penghambat/pelemah gonadotropin (gonadotrophin surge
inhibiting atau attenuating factor, GnSIF/GnSAF). Dengan demikian GnSIF dan
GnSAF mempunnyai cara kerja yang sama, meski pemastiannya memerlukan
pemurnian.87
Sekarang

mekanisme

kompleks

endokrin

dan

parakrin

dalam

mengendalikan ovulasi sudah diketahui. Dahulu diperkirakan mekanisme lonjakan


gonadotropin pra ovulasi hanya berlangsung sederhana. Secara klasik diterangkan
bahwa bilamana estradiol yang disekresikan ovarium berada pada kadar kritis,
maka pengaruh hormon steroid berganti dari umpan balik negatif menjadi umpanbalik positif terhadap denyutan GnRH hipotalamus maupun gonadotropin
hipofisis.
Dari beragam ramu (regimen) superovulasi untuk tindakan konsepsi
berbantu (assisted conception procedure) dapat dikaji tentang bagaimana
sebenarnya mekanisme ovulasi. Meski estradiol pada fase folikuler awal dari
siklus rangsangan berada di atas kadar fisiologis, tetapi lonjakan LH praovulasi
tidak terjadi pada awal siklus. Seandainyapun terjadi, biasanya dengan kejadian
yang lemah. Artinya ada faktor tambahan penekan LH dari folikel ovarium yang
sedang berkembang.
Adanya peningkatan frekuensi denyutan GnRH pada penderita dengan
hipersekresi LH juga masih dipertentangkan. Ini penting karena bilamana steroid
merupakan produk utama ovarium dalam mempengaruhi sekresi LH, sehingga
berarti bahwa steroid ini mampu melintasi sawar darah-otak dan dapat

38

mempengaruhi denyutan GnRH. Apabila cacat primer terjadi pada sekresi peptida
ovarium, maka peptida ini diperkirakan tidak melintasi sawar darah-otak untuk
mempengaruhi frekuensi denyutan GnRH.
Sebagian penderita yang hipogonadisme hipogonadotropin juga mengalami
SOPK. Penanganannya dengan pemberian GnRH secara berdenyut untuk memicu
ovulasi, akan membuat kadar LH serumnya lebih tinggi daripada penderita
hipogonadisme-hipogonadotropin dengan ovarium normal. Peningkatan LH
serum juga ditemukan sebelum kadar estradiol serum meningkat. Pada penderita
ini hipersekresi LH terjadi manakala hipotalamus digantikan oleh pembangkit
denyutan GnRH buatan dengan interval denyutan yang tetap, yakni 90 menit
(sesuai dengan interval denyutan pada fase folikuler awal). Dengan demikian
penyebab hipersekresi LH adalah kelemahan umpan balik ovarium terhadap
hipofisis,

dan bukannnya

gangguan

primer

pada pengaturan

denyutan

hipotalamus. Hal ini sesuai dengan bukti bahwa faktor nir-steroid mengganggu
umpan balik ovarium-hipofisis dalam mengendalikan sekresi LH.
Hormon

peptida

ovarium

berpengaruh

penting

terhadap

sekresi

gonadotropin hipofisis. Inhibin dan peptida terkait terutama bekerja terhadap


sekresi FSH. Inbibin berpengaruh pada konsentrasi dan keadaan yang beragam,
yakni pada keadaan-keadaan sekresi FSH basal, serta sekresi FSH dan LH yang
dirangsang GnRH. Diperkirakan GnSAF membuat perbedaan pengaturan sekresi
LH. Berbeda dengan inhibin, GnSAF merupakan faktor penghambat, yang
dihasilkan oleh folikel ovarium, dan menekan perangsangan GnRH terhadap LH
dan FSH. Oleh karena itu, GnSAF dianggap sebagai antagonis GnRH di hipofisis

39

dan mencapai ambang kerja GnRH, dan mencegah lonjakan LH dini. Lonjakan
mungkin berlangsung ketika kadar estradiol serum meningkat, dan ini
meningkatkan kepekaan hipofisis terhadap GnRH, dan bekerja tumpang tindih
dengan faktor penghambat.88
Mengenai kemungkinan apakah sebenarnya GnSAF itu adalah inhibin,
masih dipertentangkan. Pemberian FSH pada tikus menyebabkan penghambatan
terhadap lonjakan gonadotropin (FSH dan LH) praovulasi. Selain itu, pemberian
antibodi antiinhibin lebih menegaskan bahwa inhibin bertanggung jawab atas
kejadian ini. Dengan antibodi anti-inhibin dapat diperlihatkan bahwa aktivitas
biologis GnSAF dalam cairan folikel manusia masih ada pasca pemberian antiinhibin. Dengan demikian diperkirakan inhibin dan hormon nir-steroid
berpengaruh pada berbagai fase siklus haid dan ragam kadar serum pada sekresi
gonadotropin yang baik.89
Gangguan sekresi inhibin mempengaruhi patogenesis SOPK, yakni
hipersekresi inhibin-B oleh ovarium akan menekan sekresi FSH oleh hipofisis
sehingga menyebabkan ketidakseimbangan gonadotropin. Telah dibuktikan pula
bahwa ada peningkatan yang bermakna kadar inhibin-B serum pada penderita
SOPK, yang bertanggung jawab terhadap nisbah FSH/LH dan peningkatan
kepekaan penderita SOPK terhadap FSH eksogen.90

2.1.3.7 Hiperinsulinemia
Adanya hubungan antara resistensi insulin, hiperinsulin dan hiperandrogen
telah mendorong kajian tentang patogenesis SOPK. Mekanisme seluler dan

40

molekuler resistensi insulin pada SOPK telah banyak diteliti, begitu pula cacat
utama penurunan kepekaan insulin yang sekunder atas kelainan pasca-ikatan pada
isyarat transduksi reseptor insulin, yang mengakibatkan penurunan respons
insulin. Penurunan kepekaan insulin pada SOPK merupakan cacat intrinsik yang
kuat pada penderita dengan kerentanan genetik, karena hal ini tidak tergantung
pada kegemukan, kelainan metabolik, topografi lemak dan kadar hormon seks.
Kemungkinan terdapat kelainan genetik dalam regulasi fosforilasi reseptor
insulin, menghasilkan peningkatan insulin yang tidak tergantung fosforilasi serine
dan menurunkan fosforilasi tirosin yang tergantung insulin.91,92
Walaupun kejadian resistensi insulin tidak berhubungan dengan body mass
index (BMI), umumnya terkait dengan SOPK dan kegemukan yang sinergistik
dan tidak berpengaruh terhadap hemostasis glukosa dan memburuk dengan
hiperandrogenisme dan anovulasi. Pemeriksaan BMI saja tidak dianjurkan untuk
memprediksi risiko kardiovaskuler. Hubungan BMI dan penyakit jantung koroner
hampir hilang dengan diterapinya dislipidemia, hiperglikemia dan hipertensi.
Beberapa penderita mempunyai kelainan metabolik dengan BMI normal dan
yang lain mempunyai sedikit risiko dengan peningkatan BMI. Diduga bahwa
daripada BMI, yang lebih penting adalah distribusi lemak, dengan kegemukan tipe
android yang paling berisiko dibandingkan tIpe ginekoid. Nilai pengukuran nisbah
pinggang : panggul atau lingkaran pinggang, untuk mendeteksi lemak viscera
yang aktif secara metabolik dan bila meningkat akan menghasilkan peningkatan
resistensi insulin, diabetes melitus tipe 2, dislipidemia, hipertensi dan pembesaran

41

ventrikel kiri (Lord dan Wilkin, 2002). Olahraga akan mengurangi lemak viscera
dan risiko kardiovaskuler.93
Lord dkk menemukan hubungan antara lingkaran pinggang dengan masa
lemak viscera, yang diperiksa dengan CT Scan, daripada nisbah pinggang :
panggul atau BMI. Lingkaran pinggang yang ideal bila kurang dari 79 cm dan bila
lebih dari 87 cm mempunyai risiko yang bermakna.
Insulin bekerja melalui berbagai tempat untuk meningkatkan kadar androgen
endogen. Peningkatan resistensi insulin perifer menyebabkan kadar insulin serum
meningkat. Insulin yang berlebih akan terikat pada reseptor IGF-1 dan
memperbesar produksi androgen sel theca sebagai respon rangsangan LH.
Hiperinsulinemia juga menurunkan sintesis SHBG oleh hepar. Terdapat
peningkatan kadar testosteron bebas dalam serum dengan konsekuensi aksi
androgen di perifer. Hiperinsulinemia juga menghambat sekresi IGF binding
protein (IGFBP-1) oleh hepar, menyebabkan peningkatan bioavibilitas IGF-1 dan
IGF-2, sebagai pengatur penting pada pematangan folikel ovarium dan
steroidogenesis. Bersama dengan sekresi IGF-2 dari sel theca yang lebih banyak,
IGF-1 dan IGF-2 akan menambah produksi androgen ovarium dengan bekerja
pada reseptor IGF-1.94,95
Insulin juga dapat meningkatkan kadar androgen endogen dengan
meningkatkan aktivitas enzim P450c17 sitokrom, yang penting dalam biosintesis
hormon steroid ovarium dan adrenal. Overaktivitas P450c17 yang dipemicuan
insulin

dan respon 17-hydroxyprogesterone (17-OHP) terhadap rangsangan

GnRH juga telah terbukti. Androgen intraovarian yang berlebih bertanggungjawab

42

terhadap anovulasi secara langsung di ovarium dengan menyebabkan proses


atresia folikuler. Proses ini ditandai oleh apoptosis sel granulosa. Sebagai
konsekuensinya, terdapat peningkatan kompartemen stromal yang lebih besar
dimana respon LH tertahan dan selanjutnya mensekresi androgen.96

2.1.3.8 Resistensi insulin


Resistensi insulin adalah berkurangnya respon glukosa terhadap pemberian
sejumlah insulin. Terjadi akibat sekunder dari resistensi pada reseptor insulin,
menurunnya klirens insulin dan atau meningkatnya kepekaan pankreas. Baik
penderita SOPK yang gemuk dan nir gemuk kebanyakan resistensi insulin dan
hiperinsulinemia dibandingkan penderita dengan ovarium yang normal. Terdapat
faktor pada SOPK yang menyebabkan resistensi insulin dan tidak tergantung pada
kegemukan. Disfungsi sel pankreas terjadi pada penderita SOPK, sehingga
sekresi insulin basal meningkat terutama pada respon postpandrial. Defek ini
menetap walaupun berat badan menurun, kecuali bila terdapat perbaikan dalam
toleransi glukosa.97
Insulin bekerja melalui reseptornya untuk memulai kaskade kejadian pasca
reseptor dalam sel target. Fosforilasi menyebabkan substrat reseptor insulin (IRS
I-4) merangsang ambilan glukosa melalui transporter glucose transmembrane
(GLUT4) dan juga sintesis protein intraseluler. Fosforilasi tirosin meningkatkan
aktivitas tyrosine kinase pada reseptor insulin, sedangkan fosforilasi serin
menghambat proses ini, dan kejadian ini terdapat pada sekitar 50% penderita
SOPK yang menunjukkan fosforilasi serin berlebih dan inhibisi isyarat normal.

43

Pengaruh ini hanya terdapat pada hemostasis glukosa dan tidak pada aksi
pleitrofik insulin lainnya, sehingga pertumbuhan sel dan sintesis protein berlanjut.
Fosforilasi serin juga meningkatkan aktivitas P450c17 baik pada ovarium maupun
kelenjar adrenal, yang merangsang sintesis adrogen dan merupakan mekanisme
resistensi insulin dan hiperandrogenisme pada penderita SOPK.98

2.1.3.8.1 Mekanisme seluler dan molekuler resistensi insulin


2.1.3.8.1.1 Mekanisme seluler kerja insulin
Insulin bekerja pada sel dengan terikat pada reseptor permukaan sel.
Reseptor insulin merupakan heterotetramer yang terdiri dari dua dimer , yang
terikat disulfida. Dimer , masing-masing merupakan produk dari satu gen
(Gambar 2). Subunit merupakan ekstraseluler dan mengandung domain yang
terikat ligand dimana subunit terentang sepanjang membran, dan bagaian
sitoplasmik mengandung protein intrinsik dengan aktivitas tirosin kinase, yang
diaktivasi oleh ligand yang menyebabkan autofosforilasi pada residu tirosin
spesifik. Reseptor insulin merupakan anggota reseptor protein tirosin kinase yang
termasuk reseptor insulin-like growth factor-I (IGF-I), yang homolog secara
struktural dengan epidermal growth factor (EGF), fibroblast growth factor (FGF),
platelet-derived growth factor (PDGF), colony-stimulating factor-1 receptors.
Sejumlah produk onkogen juga protein tirosin kinase.99

44

Gambar 2. Insulin Reseptor


(Sumber : C.R. Khan: Diabetes 1994:43;1066-84)

Ikatan ligand menginduksi autofosforilasi reseptor insulin pada residu tirosin


spesifik dan kemudian mengaktivasi kinase intrinsik (Gambar 3). Selanjutnya
reseptor insulin yang teraktivasi tirosin menfosforilasi substrat intraseluler untuk
memulai isyarat transduksi. Selama beberapa tahun belakangan jumlah substrat ini
telah dikenali. Yang pertama adalah insulin receptor substrate-1 (IRS-1), sebagai
molekul pelengkap untuk molekul isyarat dan adaptor.
Tirosin yang terfosforilasi reseptor insulin akan menfosforilasi IRS-1 pada
tempat spesifik, dan akan mengikat molekul isyarat, seperti domain SH-2 dari
phosphatidylinositol 3-kinase (PI3-K), atau molekul adaptor, Nck. Hal ini
membawa aktivasi jalur isyarat yang berikutnya, seperti transpor glukosa yang
dimediasi oleh insulin, yang dimodulasi melalui kaskade sinyal PI3-K. Insulin
receptor substrate-2 (IRS-2) yang merupakan substrat lain dari reseptor insulin

45

telah diidentifikasi. Shc (suatu molekul adaptor) juga dapat terikat langsung pada
reseptor insulin dan memulai sinyal transduksi.99

Gambar 3. Alur Fosforilasi Tirosin


(Sumber: C.R. Khan:Diabetes 1994:43;1066-84)

Insulin mempunyai beberapa mekanisme pada jaringan target, seperti


rangsangan ambilan glukosa, regulasi gen, sintesis DNA, ambilan asam amino.
Penelitian saat ini ditujukan untuk menyelidiki mekanisme isyarat reseptor insulin
spesifik. Mekanisme tersebut melibatkan jalur Ras-Raf-MEK dalam regulasi
pertumbuhan sel dan metabolisme dimana jalur PI3-K terlibat dalam ambilan
46

glukosa. Mekanisme berakhirnya isyarat insulin belum dimengerti seluruhnya.


Terjadinya endositosis dan daur ulang yang dimediasi reseptor penting saat
pengakhiran isyarat. Fosforilasi serin berguna untuk pengakhiran isyarat oleh
reseptor EGF, suatu bentuk lain reseptor tyrosine kinase growth factor, dan dalam
berbagai keadaan insulin reseptor yang terfosforilase serin akan menurunkan
aktivitas tirosin kinase-nya. Diduga bahwa protein kinase C (PKC) yang menjadi
media bagi fosforilasi serin dari reseptor insulin penting bagi patogenesis
hiperglikemia yang dipemicuan resistensi insulin. Studi mengenai tumor necrosis
factor (TNF-) yang menjadi mediator fosforilasi serine dari IRS-1
menghambat isyarat reseptor insulin dan merupakan mekanisme resistensi insulin
yang dipicu oleh TNF-. Penelitian mengenai hal tersebut terbatas karena
kekurangan antibodi anti-phosphoserine yang sensitif. Identifikasi residu
phosphoserine biasanya memerlukan analisis asam phosphoamino sesungguhnya
dari reseptor yang dilabel

32

P. Penggunaan label fluorofor dari fosfoserin

menjanjikan metodologi sensitif untuk memeriksa kejadian fosforilasi serin secara


invivo.99,100

2.1.3.8.1.2 Defek mekanisme kerja insulin molekuler pada SOPK


Penelitian pada sel lemak, sebagai jaringan target, gagal mencari laporan
awal pada sel darah mengenai penurunan jumlah reseptor insulin dan atau afinitas
reseptor pada SOPK. Penelitian mengenai sel lemak, penurunan jumlah reseptor
insulin dan penderita yang kurus digunakan sebagai kelompok kontrol. Penelitian
kerja insulin pada sel lemak SOPK menunjukkan adanya penurunan kepekaan

47

insulin bersamaan dengan angka maksimal transpor glukosa yang dimediasi oleh
insulin. Terdapat kejadian punurunan kadar lemak adenosin dari SOPK, tapi
apakah ini defek primer atau sekunder dari hiperinsulinemia masih belum jelas.
Penurunan angka maksimal ambilan glukosa oleh sel lemak adalah sekunder dari
menurunnya transporter glukosa GLUT4. Defek yang sama juga ditemukan pada
NIDDM dan kegemukan namun berkurang dengan pengendalian terhadap
hiperglikemia dan hiperinsulinemia dengan mengurangi berat badan, hal tersebut
diduga bahwa defek ini didapat dan bukan intrinsik. Tidak demikian yang
didapatkan pada SOPK, defek tersebut terjadi walaupun tidak terdapat obesitas,
intoleransi glukosa, atau perubahan nisbah pinggang-panggul. Kelainan ini
berhubungan dengan kadar hormon seks dan membuktikan bahwan kelainan kerja
insulin pada SOPK adalah intrinsik.101,102
Evaluasi mengenai defek pasaca ikatan kerja insulin pada SOPK, fungsi
reseptor insulin diperiksa dari kultur fibroblas, karena fibroblas diambil dari
lingkungan invivo untuk beberapa turunan, dan menjadi sumber bagi reseptor
insulin yang tidak terpengaruh keseimbangan hormonal pada SOPK. Sesuai
dengan penelitian sebelumnya pada sel lemak, fibroblas dari penderita SOPK
menunjukkan perubahan ikatan insulin atau afinitas reseptor. Sebanyak sekitar
50% fibroblas SOPK mengalami penurunan fosforilasi reseptor insulin. Hal ini
sekunder dari peningkatan fosforilasi basal dengan autofosforilasi berikutnya yang
minimal. Analisis asam fosfoamino menunjukkan penurunan fosforilasi tirosin
reseptor yang tergantung insulin dan meningkatnya fosforilasi serin reseptorr yang

48

tidak tergantung insulin. Kemampuan reseptor insulin pada SOPK untuk


menfosforilasi substrat artifisial juga menurun.
Fosforilasi serin dari reseptor insulin tampak pada sistim yang bebas sel dan
invivo untuk inhibisi aktivitas kinase tirosin reseptor, yang sesuai dengan temuan
dalam penelitian pada reseptor insulin SOPK. Defek ini sebagai tahap awal pada
jalur isyarat insulin yang menyebabkan resistensi insulin pada SOPK. Peningkatan
fosforilasi serin yang tidak tergantung insulin pada reseptor insulin SOPK
merupakan kelainan kerja insulin yang unik, sedangkan keadaan resistensi insulin
lain seperti kegemukan, NIDDM, sindrom tipe A, leprechaunism tidak
menunjukkan kelainan. Kelainan fosforilasi SOPK mempunyai relevansi
fisiologis karena muncul pada reseptor insulin yang diambil dari purifikasi otot
lurik, sebagai jaringan target klasik, dan gambaran fosforilasi abnormal terjadi
pada reseptor insulin yang terfosforilasi pada sel intak.
Fibroblas dari kira-kira 50% penderita SOPK tidak ditemukan kelainan pada
fosforilasi reseptor insulin. Walaupun penderita ini menunjukkan fenotip yang
sama dengan SOPK dan memiliki derajat resistensi insulin yang sama dengan sel
fibroblas yang memiliiki fosforilasi abnormal, fosforilasi reseptor insulin pada
fibroblas dan otot lurik penderita ini sama dengan kontrol. Fenomena ini
menunjukkan defek pada isyarat reseptor insulin seperti fosforilasi IRS-1 atau
aktivasi PI3-K, yang bertanggung jawab untuk resistensi insulin pada penderita
SOPK. Juga didapatkan penurunan aktivasi PI3-K otot selama infus insulin pada
penderita SOPK, sesuai dengan defek fisiologis pada tahap awal isyarat reseptor
insulin.103

49

2.1.4 Genetik pada SOPK


Pada penelitian genetik SOPK ditemukan berbagai kelainan genetik yang
dihubungkan dengan hiperandrogen dan resistensi insulin. Namun yang diduga
berkaitan erat hanya beberapa dan hal ini didukung oleh temuan yang meneliti
dengan teknik klasik baik analisis hubungan atau studi kasus-kontrol. Analisis
hubungan dengan marker polimorfisme difokuskan pada kelainan dengan area
kira-kira 1-2cM dan berlokasi di kelainan genetik pada 30-100 gen. Pada
penelitian studi kasus-kontrol marker genetik spesifik atau alel yang tersering
pada suatu individu dibandingkan dengan subyek yang tidak mempunyai penyakit
(tidak SOPK) pada populasi yang sama (kontrol).
Adanya hiperandrogen dan hiperinsulin fungsional dapat terdeteksi pada
penderita sejak awal, bahkan sebelum masa pubertas. Berat badan lahir rendah
pada neonatus merupakan hasil dari lingkungan intrauterin yang kurang baik,
sehingga menimbulkan resistensi insulin, gangguan toleransi glukosa, hipertensi
dan kelainan kardiovaskuler pada masa hidup selanjutnya. Hubungan berat badan
lahir rendah berhubungan dengan hiperinsulinisme dan diabetes melitus tipe 2,
yang akan mengalami pertumbuhan pesat dan peningkatan indeks masa tubuh saat
dewasa.
Fetus yang mengalami resistensi insulin akan menyebabkan pertumbuhan
janin terhambat dan perkembangan vaskuler menjadi abnormal, sehingga saat
dewasa akan meningkatkan resistensi vaskuler dan disfungsi endotel. Peningkatan
insulin yang merupakan kompensasi, akan menyebabkan penimbunan lemak,
sitokin inflamasi, dan mediator lain dari adiposit abdomen yang menambah

50

abnormalitas toleransi glukosa dan disfungsi endotel, menyebabkan kelainan


toleransi glukosa, atherosklerosis, dan penyakit kardiovaskuler.104
Terdapat hubungan antara resistensi insulin dengan hiperandrogenisme
fungsional, Ibanez dkk menduga adanya kaitan antara berat badan lahir rendah
dengan perkembangan pubarche prematur dan hiperandrogenisme pada saat
dewasa, resistensi insulin merupakan penyakit yang mendasari pada dua keadaan
tersebut di atas. Hubungan hiperandrogenisme fungsional dan resistensi insulin
pada anak dan dewasa banyak dipelajari beberapa varian gen yang berhubungan
dengan resistensi insulin dan sindrom metabolik.
Lokus VNTR pada gen insulin dipelajari pada gadis dengan pubarche
prematur. Pada penderita dengan alel klas I ternyata berat badan lahir rendah dan
kepekaan insulinnya menurun dibandingkan dengan penderita alel klas III. Gene
varian Gly972Arg yang mengkode insulin receptor substrate 1 (IRS-1), yang
berpengaruh terhadap resistensi insulin dan toleransi glukosa. Frekuensi
heterozigositas untuk alel Gly972Arg 31% di antara gadis dengan pubarce
prematur, 40% pada gadis dengan hiperandrogenisme ovarium hiperinsulinisme,
dan hanya 19% pada yang sehat. Karier alel Gly972Arg kadar sex hormone
binding menurun.105,106
Beragamnya gejala dan simptom SOPK, akan lebih mudah bila penelitian
genetik/molekuler mengacu pada klinis, reproduksi, dan kelainan metabolik yang
terkait pada hiperandrogenisme. Adanya interaksi faktor genetik dan lingkungan
merupakan patogenesis yang kompleks pada SOPK. Faktor lingkungan seperti
penambahan berat badan dapat menjadi triger bagi hiperandrogenisme fungsional

51

pada SOPK, sehingga dapat dicari protein spesifik atau gen yang terlibat pada
metabolik yang dipengaruhi oleh lingkungan.
Namun faktor lingkungan yang terlibat dalam kelainan metabolik kompleks
dapat berubah tergantung pada populasi yang diteliti, seperti diit,olah raga, dan
gaya hidup pada etnik tertentu. Tidak heran kiranya bahwa varian gen yang
terlibat dalam kelainan ini juga dapat berubah tergantung pada keadaan
lingkungan.
Fenotip SOPK yang heterogen dalam keluarga yang sama, merupakan
interaksi sejumlah kecil gen dengan lainnya dan dengan faktor lingkungan.
Penelitian varian gen terhadap hiperandrogenisme pada SOPK untuk mengetahui
interaksi antara gen dan antara gen dengan lingkungan.

2.1.4.1 Poliformisme IRS-1Gly972Arg pada SOPK


Mekanisme yang pasti dari keadaan resistensi insulin masih perlu diteliti,
meskipun demikian, terdapat dugaan

yang menyatakan bahwa berasal dari

kerusakan pada tingkat pasca reseptor.


Reseptor insulin merupakan senyawa glikoprotein berbentuk tetrametrik
pada membran yang terkomposisi atas 2 subunit dan , yang terikat satu dengan
yang lainnya melalui ikatan disulfida. Ketika berikatan dengan ligand-nya,
perubahan bentuk terjadi yang menyebabkan proses autofosforilasi dari subunit .
Langkah pertama setelah proses pengaktivan reseptor insulin adalah proses
fosforilasi dari protein sitoplasma, senyawa reseptor insulin (insulin receptor
substrate-1 / IRS-1) . IRS-1 adalah suatu protein penempel (docking protein) yang
52

terlebih dahulu harus menjalani proses fosforilasi agar dapat mengaktivasikan


enzim phosphatydilinosito 3 kinase (PI3K), yang merupakan langkah yang
diperlukan agar insulin dapat memulai kerja pengaruhnya seperti transportasi
glukosa. Pemindaian molekuler dari gen IRS-1 ini menemukan beberapa asam
amino pengganti. Varian IRS-1 yang paling sering dijumpai adalah perubahan dari
glycine menjadi Arginine pada codon nomor 972 (G972A), yang lebih banyak
ditemukan pada penderita-penderita dengan gambaran yang berhubungan dengan
sindrom resistensi insulin, atau paling tidak, pada penderita-penderita diabetes
melitus tipe 2. Beberapa gambaran fenotip G972A, seperti kegemukan dan hiperandrogenime memperlihatkan kesamaan gambaran seperti yang terjadi pada
SOPK. Beberapa tulisan melaporkan hasil yang berbeda mengenai peranan
G972A pada SOPK. Diduga G972A lebih banyak dijumpai pada penderitapenderita dengan SOPK yang memiliki resistensi insulin. Sebaliknya, Ehrmann
dan kawan-kawan tidak menemukan hubungan antara G972A dengan gambaran
fenotip SOPK.106
Pengetahuan mengenai peranan protein varian IRS-1 pada terjadinya proses
resistensi insulin pada umumnya didasarkan dari penelitian penderita-penderita
yang menderita non-insulin dependent diabetes melitus (NIDDM). Meskipun
peranan varian protein IRS-1, terutama tipe varian yang paling banyak,
Gly972Arg pada NIDDM masih kontroversial, pada umumnya disepakati bahwa
varian ini bertanggung jawab pada terjadinya resistensi insulin yang berhubungan
dengan kegemukan.

53

Almind dan kawan-kawan, meneliti hilangnya pengaruh pengaruh insulin


pada penelitian transfeksi dengan menggunakan varian G972A. Diduga mutasi
yang terjadi mempengaruhi struktur tersier dari IRS-1 yang menyebabkan
kerusakan ikatan dengan PI3K, dan hal ini juga menyebabkan ketimpangan dalam
metabolisme glukosa tanpa mengganggu fungsi mitogenik dari insulin.107
Alasan mengapa terjadi resistensi insulin pada penderita-penderita dengan
SOPK, masih belum dapat diungkapkan, tetapi hal ini diduga berasal dari
kerusakan pada tingkat pasca reseptor. Kerusakan pada tingkat pasca reseptor ini
masihlah sangat sedikit dimengerti, tetapi diduga akibat multifaktorial. Akhirakhir ini timbul suatu teori yang mengatakan bahwa terjadinya peningkatan proses
fosforilasi dari serine/threonine pada reseptor insulin merupakan suatu keadaan
yang unik yang terjadi pada SOPK dan hal ini mencegah terjadinya fosforilasi dari
tyrosine pada reseptor insulin subunit . Ada pula laporan yang memicu
kontroversi mengenai prevalensi dan peranan dari varian G972a pada resistensi
insulin pada penderita-penderita dengan SOPK. Ketika Ehrmann dan kawankawan (2002) tidak menemukan hubungan antara varian G972A dengan gambaran
metobolisme penderita-penderita dengan SOPK, sedangkan el Mkadem dan
kawan-kawan (2001) sebaliknya memberikan dugaan bahwa varian G972A ini
justru lebih banyak didapatkan pada penderita-penderita SOPK yang menderita
resistensi insulin. El Mkadem juga menemukan, penderita-penderita yang
memiliki varian G972A, ternyata lebih gemuk, dan memiliki kadar insulin puasa
yang lebih tinggi, dan juga lebih resisten terhadap insulin seperti yang
diperlihatkan oleh HOMA. Pada penelitian yang lain, nilai glukosa 2 jam post

54

prandial ternyata lebih tinggi pada penderita-penderita dengan varian G972A,


dimana kadar insulin puasa dan HOMA ternyata sebanding dengan kelompok
kontrol.108,109

2.1.5 Obesitas, resistensi insulin dan SOPK


Istilah overweight atau kelebihan berat badan merujuk pada pengertian
berat badan di atas ukuran normal, yaitu dengan body mass index (BMI) 2529.9 kg/m2, istilah obesitas didefinisikan sebagai suatu keadaan berat badan yang
memiliki BMI lebih dari 30 kg/m2 tergantung dari distribusi atau penyebaran
lemak tubuh, obesitas dibagi menjadi :
a. Obesitas abdominal (juga dikenal dengan istilah central, visceral, android
atau obesitas tipe laki-laki).
b. Obesitas peripheral.
Kegemukan sentral dapat didiagnosis secara klinis dengan mengukur
lingkaran pinggang (waist circumference/WC) ataupun dengan mengukur nisbah
lingkaran pinggang-panggul (waist-to-hip circumference ratio/WHR). Ukuran
lingkaran pinggang yang lebih dari 88 cm atau nisbah lingkaran pinggang-panggul
lebih dari 0.85 pada penderita memberikan risiko yang tinggi untuk terjadinya
komplikasi metabolik pada penderita-penderita gemuk dengan memiliki BMI
antara 25 hingga 34,9 kg/m.110
Resistensi Insulin hampir secara universal dijumpai pada penderita-penderita
yang gemuk, dan umum dijumpai pada penderita-penderita SOPK baik yang
gemuk maupun yang kurus.

55

Resistensi insulin yang umum terjadi pada penderita-penderita dengan


kegemukan secara teoritis diduga karena asam lemak bebas (free fatty acids/FFA),
yang dilepaskan dari sel-sel lemak melalui proses lipolisis trigliserida,
menyebabkan

terjadinya

hiperinsulinemia

dengan

mengintervensi

proses

pengambilan/ekstraksi insulin hepatik. FFA juga menghambat pemakaian glukosa


di perifer pada jaringan-jaringan lemak dan otot. Perubahan jumlah reseptor
insulin dan aktivitas reseptor postbinding telah dilaporkan sebelumnya pada
kasus-kasus dengan kegemukan. Tumor necrosis factor (TNF) adalah faktor
penyebab lain yang mungkin turut bertanggung jawab pada terjadinya resistensi
insulin dalam kegemukan, dimana senyawa ini meningkat jumlahnya pada sistem
peredaran darah orang-orang gemuk. TNF mengganggu proses signaling
reseptor insulin dengan cara menghambat aktivitas tyrosine kinase pada subunit
reseptor insulin.110

2.1.6 Metformin, resistensi insulin dan SOPK


Meskipun Metformin telah digunakan selama kurang lebih 40 tahun,
mekanisme kerjanya belum sepenuhnya dimengerti. Mekanisme yang diduga
terjadi adalah penurunan absorpsi yang terjadi pada sistem intestinal, akan
menurunkan kadar glukoneogenesis endogen dari hepar, dan akan meningkatkan
pengambilan glukosa perifer. Pada tingkat seluler, mulailah terlihat bukti-bukti
yang semakin banyak yang mendukung pengertian bahwa metformin dapat
meningkatkan proses fosforilasi tyrosine dari reseptor insulin subunit dan
proteinprotein IRS. Metformin juga mampu meningkatkan proses pengambilan
56

(uptake) glukosa sel baik insulin dependent maupun non-dependent dengan


menggunakan protein-protein pen-transport glukosa.
Ertunc D dkk. Dalam penelitiannya menemukan bahwa metformin memiliki
pengaruh yang membedakan/deferensial pada kadar insulin puasa dan komponenkomponen HOMA berdasarkan genotip IRS. Meskipun demikian, terjadi pula
perbaikan yang bermakna pada variabel-variabel metabolik lainnya dalam
kelompok IRS-1 setelah terapi metformin selama 6 bulan. Penurunan resistensi
insulin pada kelompok IRS-1 secara utuh dan tidak adanya perubahan pada
kelompok varian membuat dugaan bahwa genotip IRS-1 memainkan peranan
penting, tetapi peranan ini kemungkinan merupakan peranan yang sekunder pada
pengaruh diferensial ini. Pada penelitian mengenai mekanisme kerja metformin,
metformin mendorong proses fosforilasi tirosin pada reseptor insulin subunit
dan protein-protein IRS-2, dan bukan pada IRS-1. IRS-1 secara umum tersebar di
jaringan-jaringan otot dan sel-sel lemak, varian protein IRS-1 diduga tidak
mampu menjawab isyarat yang dikirimkan dari reseptor insulin subunit yang
terfosforilasi oleh tirosin, sehingga menyebabkan ketidak kemampuan untuk
meningkatkan proses pengambilan glukosa ke dalam jaringan otot maupun sel-sel
lemak. Meskipun demikian teori ini harus dibuktikan melalui penellitian in vitro
yang memenuhi syarat. Kadar gula darah puasa menurun secara bermakna pada
kedua kelompok dibandingkan kadar basalnya. Penurunan pada kadar glukosa
puasa pada kedua kelompok ini diduga diakibatkan terapi makanan (diet) atau
yang lebih penting lagi, karena pengaruh metformin pada produksi glukosa
endogen basal di hepar melalui proses fosforilasi reseptor insulin subunit dan
57

protein-protein IRS-2, dimana peptid C dan kadar gula darah 2 jam berbeda secara
bermakna dibandingkan dengan kadar basal pada penderita-penderita dengan IRS1 utuh, tidak terlihat adanya perbedaan parameter-parameter di atas pada
penderita-penderita PCOS dengan varian G972A.106
Adanya interaksi antara hiperinsulinemia dengan hiperandrogenemia telah
banyak ditemukan pada sebagian besar penelitian. Terlebih lagi, penurunan kadar
insulin dengan terapi obat-obat insulin sensitizing agents umumnya diikuti dengan
penurunan kadar androgen, meskipun mekanisme kerjanya masih belum dapat
diketahui dengan pasti. Hiperandrogenisme pada SOPK terutama berasal dari
ovarium; penderita-penderita dengan SOPK memperlihatkan produksi berlebih
dari 17-OHP dan AS setelah pemberian tantangan (challenge) GnRH agonist.
Meskipun demikian, 50-70% penderita-penderita ini juga memperlihatkan hiperandrogenisme yang berasal dari adrenal, karena terjadi hipersekresi AS dan
DHEA setelah pemberian hormon adrenocorticotrophic (ACTH) yang sering
dijumpai pada PCOS.108
Kadar 17-OHP dan AS sama-sama menurun dengan pemberian terapi
metformin bila kedua kelompok ini dibandingkan. Penurunan ini memberikan
dugaan bahwa mekanisme yang terjadi tidak hanya pada penurunan yang
disebabkan oleh penurunan kadar insulin operasional, tetapi juga mekanisme kerja
insulin yang lain perlu dicari. Secara nyata, beberapa penelitian memberikan hasil
dugaan bahwa metformin memiliki pengaruh terhadap ovarium secara langsung.
Diduga metformin juga mampu untuk menurunkan produksi AS paling tidak
sebanyak 40% dan produksi 17-OHP sebanyak 10% pada sel-sel teka. Penelitian
58

yang berikutnya mengkonfirmasi peranan insulin yang dapat meningkatkan


produksi AS dan 17-OHP dari sel-sel teka dan pemakaian metformin mempun
menghambat produksinya pada keadaan ada atau tidaknya insulin. Terlebih lagi,
penurunan pengeluaran produk-produk ini terlihat lebih jelas dengan adanya
insulin seperti yang dilaporkan baru-baru ini. Ovarium memiliki semua komponen
molekul pemberi isyarat-isyarat insulin.
Beberapa gangguan yang terjadi pada protein-protein IRS telah dilaporkan
baik pada jaringan granulosa ovarium maupun sel-sel teka. IRS-1 ditemukan
meningkat dalam sel-sel granulosa, dimana IRS-2 meunurun. Pada penelitian
yang paling baru, dilaporkan, tidak ada perbedaan dalam distribusi molekulmolekul IRS dalam sel-sel granulosa, bahkan kedua IRS-1 dan IRS-2 meningkat
di dalam sel-sel teka. Meskipun demikian, telah diterima umum, bahwa terjadinya
ketidak-seimbangan dalam penyebaran protein-protein IRS akan menyebabkan
gangguan dalam fungsi ovarium pada penderita-penderita dengan PCOS. Sebagai
catatan, meskipun diketahui thiazolidinediones bekerja melalui molekul-molekul
reseptor aktivator proxisome-proliferator, Wu dan kawan-kawan (2003),
mengamati troglitazone mampu membalikkan pola distribusi protein-protein IRS
di dalam sel-sel ovarium penderita SOPK seperti halnya pada sel-sel ovarium
penderita-penderita normal.109
Meskipun ada laporan-laporan penelitian yang melaporkan penurunan
sekresi DHEAS sebagai respon terhadap terapi metformin, banyak penelitianpenelitian yang telah dilakukan menyatakan terjadi peningkatan sekresi DHEAS
setelah pemberian terapi metformin. Banyak laporan-laporan yang membingung-

59

kan dikeluarkan, mengenai evaluasi dari produksi androgen adrenal setelah terapi
metformin. Setleh 1 bulan pemberian terapi metformin, uji rangsang ACTH
dilakukan pada penderita dengan SOPK, dimana aktivitas enzim C17-hydroxylase
dan 17,29 lyase ditemukan menurun. Sedangkan Unluhizarci dan kawan-kawan
menemukan tidak adanya perbedaan dalam respon AS atau 17-OHP dengan
rangsangan dengan ACTH setelah terapi metformin selama 3 bulan. Vribikova dan
kawan-kawan

(2001)

menemukan

adanya

peningkatan

aktivitas

enzim

3hydroxsteroid dehydrogenase dan C17-20-lyase dan juga penurunan yang


bermakna dari aktivitas 17-hydroxysteroid dehydrogenase.
Ketika tidak ditemukannya perbedaan yang bermakna dari kadar DHEAS
pada penderita-penderita dengan IRS-1 yang utuh setelah 3 bulan terapi dengan
metformin, didapatkan peningkatan DHEAS pada penderita-penderita dengan
varian G972A. Sebagaimana yang kita ketahui, DHEAS merupakan penanda yang
baik untuk fungsi adrenal, penulis menduga bahwa metformin bekerja secara
berbeda kelenjar tergantung dari genotip IRS. Meskipun kadar 17-OHP dan AS,
prekursor-prekursor dari androgen yang lebih potensial, menurun pada kedua
kelompok, kadar dari tetosterone total dan FTA tidak berubah setelah pemberian
terapi metformin pada penderita-penderita SOPK dengan varian G972A. Untuk
alasan ini, diduga bahwa peningkatan fungsi adrenal setelah pemberian terapi
metformin tidak diimbangi dengan penekanan dari produksi androgen ovarium
pada penderita-penderita tersebut. Penemuan ini yang kemungkinan berhubungan
dengan faktor-faktor lainnya yang belum diteliti, seperti peranan protein-protein

60

IRS pada fungsi kelenjar adrenal dan pada proses perubahan antara jenis androgen
yang lemah menjadi androgen yang lebih poten.106
Dari uraian di atas terlihat bahwa terdapat perbedaan pengaruh dari terapi
metformin pada penderita-penderita SOPK berdasarkan genotip IRS. Mekanisme
subseluler yang kompleks membutuhkan penelitian lebih lanjut untuk dapat
menjelaskan pengaruh perbedaan ini. Masih adanya perdebatan mengenai
pemilihan penderita yang akan mendapatkan keuntungan dari terapi metformin.

2.2 Kerangka Pemikiran, premis dan hipotesis


Sindrom ovarium polikistik merupakan suatu keadaan yang ditandai oleh
adanya anovulasi, hiperandrogen dan resistensi insulin, yang kesemuanya ini
merupakan kondisi endokrinopati yang umum dijumpai pada masa reproduksi,
baik pada wanita gemuk maupun nir-gemuk. SOPK sampai saat ini dikaitkan
dengan hiperandrogen dan resistensi insulin dengan berbagai penyebab, di
antaranya adalah kelainan genetik, faktor lingkungan, gaya hidup, dan olah raga.
Pada keadaan hiperandrogen, yang secara klinis bermanifestasi sebagai
hirsutisme, akne maupun secara biokimiawi meningkatnya serum testosteron
bebas dan penurunan konsentrasi SHBG, lebih banyak didapatkan pada wanita
gemuk maupun nir-gemuk. Demikian pula halnya dengan kadar LH,
peningkatannya lebih tinggi pada wanita gemuk.
Resistensi insulin dapat terjadi pada kegemukan, yang secara teoritis diduga
karena asam lemak bebas (free fatty acids / FFA), yang dilepaskan dari sel-sel
lemak

melalui

proses

lipolisis

trigliserida,

61

menyebabkan

terjadinya

hiperinsulinemia dengan mengintervensi proses pengambilan/ekstraksi insulin


hepatik. FFA juga menghambat pemakaian glukosa di perifer pada jaringanjaringan lemak dan otot. Perubahan jumlah reseptor insulin dan aktivitas reseptor
pasca ikatan telah dilaporkan sebelumnya pada kasus-kasus dengan kegemukan.
Tumor necrosis factor (TNF) adalah faktor penyebab lain yang mungkin turut
bertanggung jawab pada terjadinya resistensi insulin pada kegemukan, di mana
senyawa ini meningkat jumlahnya pada sistem sirkulasi orang gemuk. TNF
mengganggu proses pengisyaratan reseptor insulin dengan cara menghambat
aktivitas tirosin kinase pada subunit reseptor insulin. Hubungan sebab-akibat
antara resistensi insulin dengan hiperandrogen masih dalam perdebatan dan terus
diteliti.
Teori yang menyatakan hiperandrogenemia menyebabkan resistensi insulin
pada penderita-penderita SOPK tidak didukung dengan bukti-bukti yang ada,
karena pemulihan kadar androgen pasca ooforektomi atau pasca pemberian anti
androgen tidak berpengaruh terhadap resistensi insulin. Teori yang menyatakan
hiperinsulinemia memberikan sumbangan terjadinya hiperandrogenisme pada
penderita-penderita SOPK telah banyak diteliti. Produksi SHBG dihambat oleh
insulin dan tidak tergantung pada efek hormon seks steroid, sehingga konsentrasi
SHBG lebih rendah pada penderita SOPK sehingga konsentrasi androgen bebas
akan meningkat di dalam sirkulasi darah.
Lebih jauh lagi banyak peneliti telah melaporkan adanya efek rangsangan
langsung insulin terhadap produksi androgen, estrogen dan progesteron pada in
vitro jaringan sel-sel granulosa maupun sel-sel teka manusia atau binatang.

62

Terlebih lagi, telah dibuktikan bahwa sel-sel ovarium wanita dengan SOPK
ternyata sensitif terhadap insulin, meskipun terdapat resistensi insulin secara
sistemik. Hal ini diduga karena insulin bekerja melalui reseptor IGF tipe 1 atau
melalui alternatif lain, yaitu melalui jalan pengisyaratan reseptor insulin.
Sebaliknya penelitian lain yang menggunakan antibodi-antibodi reseptor IGF-1
memperlihatkan efek insulin di dalam ovarium dimediasi oleh reseptor insulin,
dibandingkan oleh reseptor IGF tipe 1 (Gambar 4).

Gambar 4. Patogenesis hiperandrogenisme pada wanita-wanita SOPK yang


gemuk maupun kurus. Resistensi insulin yang disebabkan oleh
kegemukan atau kerentanan wanita-wanita kurus menghasilkan
keadaan hiperandrogenisme melalui efek hiperinsulisme pada
SHBG, sistem IGF, gonadotropin dan proses steroidogenesis
yang terjadi pada ovarium/adrenal.
(Sumber : Salehi M.Obesity in Policystic Ovary Sybdrome: Two Diseases or One.
Turkish J Endocrinol Metab 2003: 4;149-57)

63

Mekanisme terjadinya resistensi insulin pada wanita gemuk dan nir-gemuk


hingga kini belum dapat dijelaskan secara baik dan masih benyak diteliti,
meskipun demikian, ada dugaan yang menyatakan berasal dari kerusakan pada
tingkat pasca reseptor.
Reseptor insulin merupakan senyawa glikoprotein berbentuk tetrametrik
pada membran yang terkomposisi atas 2 subunit dan , yang terikat satu dengan
yang lainnya melalui ikatan disulfida. Ketika berikatan dengan ligand-nya,
perubahan bentuk terjadi yang menyebabkan proses autophosphrylation dari
subunit . Langkah pertama setelah proses peng-aktivan reseptor insulin adalah
proses fosforilasi dari protein sitoplasma, senyawa reseptor insulin (insulin
receptor substrate-1 / IRS-1) (White, 1997).
IRS-1 adalah suatu protein penempel (docking protein) yang terlebih dahulu
harus

menjalani

proses

fosforilasi

agar

dapat

mengaktivasikan

enzim

phosphatydilinosito 3 kinase (PI3K), yang merupakan langkah yang diperlukan


agar insulin dapat memulai kerja efeknya seperti transportasi glukosa. Varian
IRS-1 yang paling sering dijumpai adalah perubahan dari glycine menjadi
Arginine pada codon nomor 972 (Gly972Arg), yang lebih banyak ditemukan pada
pasien-pasien yang gambaran yang berhubungan dengan sindrom resistensi
insulin, atau paling tidak, pada pasien-pasien diabetes melitus tipe 2. Beberapa
gambaran fenotipe Gly972Arg, seperti kegemukan dan hiper-androgenisme
memperlihatkan kesamaan gambaran seperti yang terjadi pada SOPK. Beberapa
tulisan melaporkan hasil yang berbeda mengenai peran IRS-1 Gly972Arg pada

64

SOPK. Diduga IRS-1 Gly972Arg lebih banyak dijumpai pada penderita-penderita


SOPK dengan resistensi insulin.
Pengetahuan mengenai peranan protein varian IRS-1 pada terjadinya proses
resistensi insulin umumnya didasarkan dari penelitian pasien-pasien yang
menderita non-insulin dependent diabetes melitus (NIDDM). Meskipun peranan
varian protein IRS-1, terutama tipe varian yang paling banyak yaitu Gly972Arg
pada NIDDM masih kontroversial, pada umumnya disepakati bahwa varian ini
bertanggung jawab pada terjadinya resistensi insulin yang berhubungan dengan
obesitas.
Almind dan kawan-kawan, meneliti hilangnya pengaruh efek insulin pada
penelitian transfeksi dengan menggunakan varian Gly972Arg. Diduga mutasi
yang terjadi mempengaruhi struktur tersier dari IRS-1 yang menyebabkan
kerusakan ikatan dengan PI3K, dan hal ini juga menyebabkan ketimpangan dalam
metabolisme glukosa tanpa mengganggu fungsi mitogenik dari insulin.
Alasan mengapa terjadi resistensi insulin pada wanita-wanita dengan SOPK,
masih belum dapat diungkap, tetapi hal ini diduga berasal dari kerusakan pada
tingkat pasca reseptor. Kerusakan pada tingkat pasca reseptor ini masih sangat
sedikit dimengerti, tetapi diduga akibat multifaktorial. Akhir-akhir ini mengemuka
suatu teori yang menyatakan bahwa terjadinya peningkatan proses fosforilasi dari
serine/threonine pada reseptor insulin merupakan suatu keadaan yang unik pada
SOPK dan hal ini mencegah terjadinya fosforilasi dari tirosin pada reseptor
insulin subunit . Ada pula laporan yang memicu kontroversi mengenai prevalensi
dan peranan dari varian Gly972Arg pada penderita SOPK dengan resistensi

65

insulin. Ehrmann dan kawan-kawan, 2002, tidak menemukan hubungan antara


varian Gly972Arg dengan gambaran metobolisme pasien-pasien dengan SOPK.
Sebaliknya peneliti lain menduga bahwa varian Gly972Arg ini justru lebih banyak
didapatkan pada penderita SOPK dengan resistensi insulin. El Mkadem juga
menemukan, wanita-wanita yang memiliki varian Gly972Arg, ternyata lebih
gemuk, dan memiliki kadar insulin puasa yang lebih tinggi, serta lebih resisten
terhadap insulin seperti yang diperlihatkan pada HOMA. Penelitian lain
mendapatkan nilai glukosa 2 jam pasca makan post prandial ternyata lebih tinggi
pada penderita dengan varian Gly972Arg.
Akibat masih belum jelasnya penyebab resistensi insulin pada SOPK
berpengaruh besar terhadap pengobatannya. Sampai saat ini metformin sudah
digunakan secara luas untuk terapi SOPK dengan resistensi insulin, namun
hasilnya masih bervariasi, ada yang sembuh dan ada pula yang resisten.
Berbagai penelitian telah dilakukan untuk menyelidiki peranan metformin
pada penderita SOPK dengan resistensi insulin. Dari hasil yang telah ada,
didapatkan bahwa penderita SOPK dengan resistensi insulin dan terdapat
polimorfisme IRS-1 Gly972Arg tidak ditemukan perubahan pada resistensi
insulin. Hal ini membuat penulis berkeyakinan bahwa gen IRS-1 memegang
peranan kunci pengaruh metformin terhadap penderita SOPK dengan resitensi
insulin.

66

Gambar 5. Alur Kerangka Pemikiran

Uraian dan alur kerangka pemikiran diatas menerangkan bahwa SOPK dapat
terjadi baik pada wanita gemuk maupun nir-gemuk. Sindrom ini sampai sekarang
penyebabnya belum diketahui dengan pasti, tetapi selalu dikaitkan dengan
resistensi insulin dan hiperandrogen.
Resistensi insulin itu sendiri menyebabkan hiperinsulin, hal ini mengakibatkan penurunan SHBG, sehingga meningkatkan kadar testosteron bebas, di
samping itu juga mengakibatkan peningkatan IGF1, sehingga kadar androgen juga
meningkat.
Penyebab resistensi insulin sampai saat ini masih terus diselidiki. Pada
wanita obese selain akibat polimorfisme gen, juga karena peningkatan TNF,
yang menyebabkan terhambatnya fosforilisasi tirosin, dan memacu fosforilisasi
67

serin, sehingga ambilan glukosa terganggu. Selain itu juga terjadi karena
peningkatan FFA yang menyebabkan lipolisis trigliserida, mengakibatkan
hiperinsulin. Pengobatan untuk resistensi insulin sampai saat ini menggunakan
metformin, tetapi ternyata pada sebagian kasus metformin ini tidak memberikan
respon yang baik. Hal ini terjadi karena diperkirakan bahwa penyebab resistensi
insulin akibat kelainan pada post reseptor dan paling banyak dijumpai adalah
adanya polimorfisme IRS-1Gly972Arg. Sehingga penulis menduga kuat bahwa
polimorfisme IRS-1Gly972Arg merupakan alur utama patogenesis resistensi
insulin dan menentukan berhasil atau tidaknya terapi dengan metformin.
Dari uraian di atas dapat diformulasikan ke dalam premis-premis sebagai
berikut:
1. Premis

Pada

wanita

SOPK

umumnya

ditemukan

resistensi

insulin.6,10,12,20,92,103
2.

Premis 2 : Resistensi insulin terdapat pada wanita obese maupun non


obese.13,21,30,93,97

3. Premis 3 : Resistensi insulin disebabkan oleh polimorfisme gen yang terkait


erat dengan faktor lingkungan, olah raga dan gaya hidup.14,15,16,20,21
4. Premis 4 : Resistensi insulin berkaitan dengan kerusakan pada tingkat post
reseptor.22-23,24
5. Premis 5 : Gen IRS-1 sangat berhubungan dengan terjadinya resistensi
insulin.22-29
6. Premis 6 : Gen IRS-1 merupakan kunci utama alur signal molekul baik untuk
reseptor insulin dan reseptor IGF-1. 22-29

68

7. Premis 7 : Terdapat peran polimorfisme IRS-1Gly972Arg pada resistensi


insulin. 22-29
8. Premis 8 : Keberhasilan terapi metformin dipengaruhi oleh polimorfisme IRS1Gly972Arg.13,30,106
Dari premis-premis di atas dapat dideduksi hipotesis-hipotesis yang pada
hakikatnya merupakan landasan teoritis dalam rangka memberi jawaban terhadap
masalah dalam penelitian ini, dengan perumusan sebagai berikut :
Hipotesis 1 : Polimorfisme gen IRS-1G972A dapat menyebabkan resistensi
insulin pada wanita yang menderita SOPK(1,2,3).
Hipotesis 2 : Polimorfisme gen IRS-1 G972A mempengaruhi respon metformin
terhadap SOPK dengan resistensi insulin(4,5,6,7,8).

69

BAB III
BAHAN DAN METODE PENELITIAN

3.1 Bahan/Objek Penelitian


Kasus yang termasuk ke dalam penelitian ini adalah :
Populasi Sasaran :
adalah ibu yang menderita SOPK dengan resistensi insulin.
Populasi Terjangkau :
Semua ibu yang datang ke Poliklinik Endokrinologi Reproduksi dan Fertilitas
FKUP/RSHS dan RS jejaring yang menderita SOPK dengan resistensi insulin.
Sampel yang dikehendaki :
Dipilih 45 ibu yang menderita SOPK dengan resistensi insulin yang memenuhi
kriteria inklusi dan eksklusi, serta memenuhi besar sampel minimal.
3.1.1 Kriteria inklusi :
Semua SOPK dengan resistensi insulin
Tidak mempunyai kelainan lain yang menyebabkan hiperandrogen
Bersedia ikut dalam penelitian (informed consent).
3.1.2 Kriteria eksklusi :

Menolak ikut terus dalam penelitian.

70

3.2 Desain Penelitian


Sesuai dengan tujuan penelitian, penelitian ini terdapat 2 tahapan, yaitu :
1. Penelitian dengan rancangan potong silang,yaitu memeriksa gen IRS-1 pada
semua kasus SOPK dengan resistensi insulin.
2. Penelitian kohort prospektif, yaitu mengamati hasil akhir pengaruh metformin
dan gen IRS-1 Gly972Arg pada penderita SOPK dengan resistensi insulin.
3.2.1 Besar sampel penelitian
Besar sampel ditentukan berdasarkan efek pemberian metformin pada
penderita SOPK dengan resistensi insulin pada kelompok polimorfisme IRS1Gly972Arg rata-rata penurunan insulin puasa sebesar 0,045 dan pada kelompok
IRS-1 yang tidak mengalami polimorfisme rata-rata penurunannya sebesar
0,401.106
Dengan menggunakan rumus besar sampel untuk menguji dua rata-rata, yaitu :
2(Z1-+Z1-)2
n=
2

Dengan = besarnya perbedaan rata-rata penurunan


= standar deviasi
Z1- dan Z1- diperoleh dari tabel distribusi normal, untuk taraf kepercayaan
(1-) dan power test (1-) yang dipilih. Pada penelitian ini dipilih taraf
kepercayaan 95% (Z1- = 1,96) dan power test 95% (Z1- = 1,65).
ditetapkan 0,2.

71

Berdasarkan rumus diatas didapat :


2(0,2)2 (1,96 + 1,65)2
n=
(0,401-0,045)
=9
Untuk mendapatkan polimorfisme gen sebanyak 9 berdasarkan prevalensi
polimorfisme gen (+) pada SOPK dengan resistensi insulin sebesar 23%, maka :
100 x 9
n=
23
= 40

Dengan memperhatikan besarnya drop out sebanayk 10%, maka :


1
n =

x 40 = 45
1-0,1

3.3 Tempat dan Waktu Penelitian


Kegiatan penelitian ini akan dilaksanakan di Bagian/UPF Obstetri dan
Ginekologi, Unit Penelitin Kesehatan FK UNPAD, dan Bagian Lab. Patologi
Klinik FKUP / RSHS. Penelitian ini dilaksanakan dalam waktu 12 bulan.

3.4 Variabel Penelitian

72

3.4.1 Variabel independen


Pemberian metformin
IRS-1Gly972Arg.

73

3.4.2 Variabel dependen

Hiperandrogen (hirsutisme,akne dan peningkatan kadar testosteron)

Insulin puasa

HOMA

Tingkat keberhasilan

diukur oleh terjadinya perubahan ovarium

polikistik secara USG dengan melihat perkembangan folikel, penurunan


testosterone, penurunan insulin puasa, HOMA,.
3.4.3 Variabel lain yang akan diteliti dan akan dijadikan sebagai variabel
perancu adalah
BMI
Wiest/Hip rasio

3.4.4 Definisi operasional variabel :


1. SOPK : merupakan kelainan endokrin yang ditandai dengan hiperandrogen dan
anovulasi kronis. Diagnosisnya didasarkan pada consensus Rotterdam, yaitu :
yang mana harus memenuhi 2 dari 3 kriteria sebagai berikut :
1. Oligo-dan/atau anovulation;
2. Tanda-tanda klinis dan atau biokimia dari hiperandrogenisme;
3 . Gambaran ovarium polikistik pada ultrasonografi.
2. Resistensi insulin : resistensi insulin adalah berkurangnya respon glukosa
terhadap insulin (baik endogen maupun eksogen), diukur berdasarkan
HOMA>2,16 dan nisbah GD puasa/insulin puasa.<10,1.
3. Obese : suatu keadaan dimana BMI > 30 Kg/m2.
74

4. Central obesity/abdominal obecity : suatu keadaan apabila W/H ratio >0.8


5. Tingkat keberhasilan : bila setelah pemberian terapi didapatkan : perbaikan
ovarium polikistik secara USG, didapatkan perkembangan folikel yang
diketahui dari pemeriksaan USG serial, kadar testosteron menurun, LH dan
insulin puasa menurun.

3.5 Tata Kerja Penelitian


3.5.1 Pesiapan
Setelah persiapan protokol, formulir penelitian, persiapan bahan obat, KIT
pemeriksaa gen dan laboratorium dan perizinan dari komite etik penelitian dan
Kepala Bagian/UPF Obstetri dan Ginekologi FKUP/RSHS, peneliti melakukan
persiapan sebagai berikut :

Memberi informasi cara pengisian formulir, pemeriksaan laboratorium, dan


criteria pemilihan pasien kepada berbagai pihak yang terlibat dalam kegiatan
penelitian.

Seleksi pasien dilakukan oleh peneliti, melalui anamnesis, pemeriksaan fisik,


USG transvaginal.

Pemeriksaan laboratorium dan pemeriksaan analisis gen dilakukan di unit


penelitian kedokteran(UPK) FK UNPAD dan bagian patologi klinik RSHS.

3.5.2 Pelaksanaan :
Dipilih 45 kasus SOPK dengan resistensi insulin berdasarkan konsensus
Retterdam tentang kriteria SOPK, dan resistensi insulin berdasarkan
HOMA dan nisbah GD puasa/insulin puasa.
75

Selanjutnya pasien-pasien tersebut dilakukan pemeriksaan gula darah


puasa, insulin puasa, FSH, LH, testosteron, USG basal dan pemeriksaan
varian IRS-1Gly972Arg.
Setiap pasien diberikan metformin 1500 mg/hari selama 3 bulan.
Setelah dilakukan terapi, diperiksa kembali insulin puasa, testosteron, LH
dan perkembangan folikel dengan USG, untuk menilai efek metformin.
Pengumpulan data dan analisis.
Bagan tata cara penelitian ini dapat dilihat pada gambar di bawah ini :

Gambar 6. Bagan Tata Cara Penelitian

76

Pemeriksaan biokimia dan hormonal


Setelah puasa 10-12 jam, contoh darah diambil untuk pemeriksaan glukosa puasa,
insulin puasa. Tingkat reseptor insulin ini diukur menggunakan analisis
homeostasis model assessment (HOMA), sebagai berikut : serum insulin puasa
(U/mL) x glukosa plasma puasa (mmol/L/22,5. metode HOMA telah akhir-akhir
ini diakui sebagai indeks resistensi insulin yang baik pada pasien-pasien dengan
tingkat sensitivitas insulin yang luas dan memiliki korelasi yang baik dengan
uptake glukosa yang dimediasi oleh insulin yang dihitung dengan the euglycemic
hyperinsulinemic glucose clamp.
Untuk hormon sex stroid, darah diambil pada hari kedua sampai hari
keempat haid yang terjadi secara spontan pada wanita-wanita normal. Pada
wanita-wanita dengan oligomenorrhea yang berkepanjangan, darah diambil pada
hari ke tujuh dari uji progesterone withdrawal bleeding untuk mencegah efek
progesteron pada parameter-parameter terukur. Penulis menggunakan 10 mg
medroxy-progesterone acetate selama 10 hari untuk tujuan tersebut. Serum yang
diambil dari setiap wanita untuk pengukuran kadar testosteron total, LH, FSH dan
insulin puasa.
Pemeriksaan glukosa
Bahan pemeriksaan

: Serum, plasma

Reagen

R1

: Enzim (GOD, POD, Phenol, Mutarotase, 4aminophenazone, buffer fosfat, stabilisator)

R2
Metode

: Standar 100 mg/dl

: GOD-PAP (glukose-oksidase-para amino phenazone)

77

Tujuan

: Mengukur kadar glukosa darah puasa/sewaktu/2 jam PP/


GTT

Prinsip

: Pembacaan secara end point


Glukosa + O2 + H2O Asam glukonat + H2O + O2
2H2O + 4 aminophenazone + phenol quinoneimine
(merah keunguan) + 4H2O

Prosedur pemeriksaan :
Blanko
1000 l
-

R1
Standar
BP

Standar
1000 l
10 l
-

Dicampur, diinkubasi selama 10 menit pada suhu 20-25oC

Ukur absorbansi standar dan BP terhadap blanko dan reagen

Perhitungan

BP
1000 l
10 l

C glukosa = OD sampel / OD standar x C standar mg/dl (100 mg/dl)


C glukosa = OD sample / OD standar x 5,55 mmol/l
Nilai Rujukan normal : kadar glukosa puasa : 75-115 mg/dl atau 4,2-6,4 mmol/l

78

Pemeriksaan testosteron
Bahan pemeriksaan

: Serum, plasma

Reagen

: Alkaline phosphatase, calf serum, gelatine (porcine),


sodium azide, Tris-NaCl 0,05 mol/l, sodium azide 0,9 g/l,
diethanolamine

1,1

mol/l,

4-methyl-umbelliferyl-

phosphate 0,6 mmol/l, diethanolamine 0,62 mol/l


Metode

: Enzyme

immunoassay

competition

dengan

final

fluorescent detection (ELFA)


Alat dan Bahan

: - VIDAS instrument
- Sarung tangan
- Mikropipet
- Reagent strip
- VIDAS Reagent kit

Prinsip

: Sampel dialirkan melalui reagen strip yang mengandung


alkaline phosphatase. Testosteron akan terdeteksi dalam
serum, dan derivate testosterone pada keadaan konjugasi
competitive untuk antitestosteron spesifik antibody akan
membungkus permukaan dalam SPR. Komponen yang
berada di luarnya akan tereliminasi pada saat proses
pencucian.

Pada

tahap

deteksi

akhir,

4-methyl-

umbelliferyl phosphate akan beredar di dalam dan luar


SPR. Enzim terkonjugasi akan mengkatalisa proses
hidrolisis substrat ini menjadi produk fluoresens (4-

79

methyl-umbelliferone), yang terdeteksi pada 450 nm.


Intensitas dari produk ini berbanding terbalik dengan
konsentrasi testosterone pada sampel. Hasil pada tahap
akhir pemeriksaan akan dihitung secara otomatis oleh alat
berdasarkan kurva yang telah dikalibrasi dalam memori.
Cara pemeriksaan

:-

Gunakan satu buah TES strip dan satu buah TES SPR
dari kit untuk masing-masing sample.

Tekan TES untuk memasuki kode.

Sampel diputar menggunakan mixer tipe Vortex

Ambil 200l sampel menggunakan pipet untuk


dikalibrasi.

Masukkan VIDAS SPRs dan strip pada layar.

Proses dapat dimulai secara otomatis dalam waktu 60


menit

Setelah pemeriksaan lengkap, pindahkan SPRs dan


strip dari dalam alat.

Nilai rujukan

: Wanita

: 0,1-0,9 ng/ml

Pria

: 3,0-10,6 ng/ml

Pemeriksaan insulin
Bahan Pemeriksaan

: serum, heparin, K3-EDTA, sodium plasma sitrat

Reagen

: M
R1

: Streptavidin-coated microparticles
: Anti insulin antibody biotin (gray cap)

80

Biotinylated monoclonal anti-insulin antibody


MES buffer 50 mmol/l
R2

: Anti insulin antibody Ruthenium (black cap)


Monoclonal anti-insulin antibody (mouse)
Ruthenium kompleks
MES buffer 50 mmol/l

Metode

: Sandwich ECLIA

Alat dan Bahan

: -

Prinsip

Roche Elecsys 1010/2010

Elecsys kit cat no 12017547-100 test

Streptavidin coated microparticles

Anti insulin antibodi biotin

Anti - Biotinylated monoclonal anti insulin antibodi

MES buffer

Procell, clean cell, sys wash, assay cup, assay tip

: -

Insulin,

biotin

monoclonal

spesifik

antibodi,

monoclonal insulin spesifik antibodi, dan kompleks


Ruthenium

akan

membentuk

suatu

kompleks

(Sandwich complex)
-

Penambahan

streptavidin

coated

microparticles

membuat kompleks tersebut semakin solid akibat


interaksi antara biotin dengan streptavidin
-

Reaksi tersebut akan masuk ke dalam sel dimana


mikropartikel

81

akan

menempel

pada permukaan

elektroda. Substansi di luarnya akan dikeluarkan


bersama

procell.

Tegangan

yang

timbul

pada

elektroda akan menginduksi emisi chemiluminescent


yang selanjutnya akan diukur oleh photomultiplier
Nilai rujukan

: 2,6-24,9 mIU/ml (17,8-173 mol/l)

Pemeriksaan L H
Bahan pemeriksaan

Serum, Plasma heparin/ K3- EDTA

Reagen

: Elecsys LH reagen kit

Metode

: Sandwich ECLIA

Alat dan bahan

: - Elecsys 2010 instrument


- Sarung tangan
- Micropipet
- Elecsys LH reagen kit :
Streptavidin Coated Mikro Partikel
Anti LH antibodi biotin
Anti LH antibodi Ruthenium
- LH cal set
- LH PCV 1 & 2
- Procell, Clean cell, sys wash, assay cup, assay tip

Prinsip

: -

LH dalam bahan pemeriksaan akan berikatan dengan


anti LH
antibody biotin dan antibodi Ruthenium membentuk
kompleks

82

Penambahan streptavidin coated micropartikel akan


menempel pada kompleks tersebut.

Kompleks

yang

permukaan

Emisi

akan

ditangkap

oleh

elektroda. Zat- zat yang tidak berikatan

akan di cuci oleh


-

terikat

procell.

chemiluminescent

akan

diukur

oleh

photomultiplier dan hasil ditentukan menggunakan


kurva kalibrasi.
Cara pemeriksaan

: -

Bahan pemeriksaan di masukkan dalam cuvett


sebanyak 200 L

Cuvett dimasukkan pada disk Elecsys 2010

Masukkan nomer posisi sample di disk position, lalu


tekan enter. Bila diperlukan, ganti nomer sequence
dan tentukan faktor pengenceran set dilution factor.
Posisi dan nomer sequence akan bertambah secara
otomatis.

Nilai rujukan

Tandai tes yang dipilih dengan menekan nama tes

Tekan new simple untuk simple selanjutnya

Tekan start

: Pria

: 1,7 8,6

mIU/ml

Wanita :
- Fase folikuler

: 2,4 12,6 mIU/ml

- Ovulasi

: 14,0 95,6 mIU/ml

83

- Luteal

: 1,0 11,4 mUI/ml

- Post menopause

: 7,7- 58,5

mIU/ml

Sensitivitas Pemeriksaan : 0,100 mIU/ml


Pemeriksaan FSH
Bahan Pemeriksaan

: Serum, Plasma heparin/ K3- EDTA

Reagen

: Elecsys FSH reagen kit

Metode

: Sandwich ECLIA

Alat dan bahan

:-

Elecsys 2010 instrument

- Sarung tangan
- Micropipet
- Elecsys FSH reagen kit:
Streptavidin coated microparticle
Anti FSH antibodi biotin
Anti FSH antibodi Ruthenium
- FSH cal set
- FSH PCV 1 & 2
- Procell, Clean cell, sys wash, assay cup, assay tip.
Prinsip

: -

FSH dalam bahan pemeriksaan akan berikatan dengan


anti FSH Antibody biotin dan FSH antibody
Ruthenium membentuk kompleks

Penambahan streptavidin coated microparticle akan


menempel pada kompleks tersebut.

84

Kompleks

yang

terikat

akan

ditangkap

oleh

permukaan elektroda. Zat-zat yang tidak berikatan


akan dicuci oleh procell.
-

Emisi

chemiluminescent

akan

diukur

oleh

photomultiplier dan hasil ditentukan menggunakan


kurva kalibrasi.
Cara pemeriksaan

: -

Bahan

pemeriksaan

dimasukkan

dalam

cuvett

sebanyak 200l
-

Cuvett dimasukkan pada disk Elecsys 2010

Masukkan sample ID di sample ID, lalu tekan enter.

Masukkan nomer posisi sample di disk position, lalu


tekan enter. Bila perlu ganti nomor sequence dan
tentukan faktor pengenceran set dilution faktor. Posisi
dan nomor sequence akan bertambah secara otomatis

Nilai Rujukan

Tandai test yang dipilih dengan menekan nama test.

Tekan New simple untuk simple selanjutnya.

Tekan Start.

: Laki-laki

: 1,5- 12,4

mIU/ml

Wanita :
-

Fase folikuler

: 3,5- 12,5

mIU/ml

Fase Ovulasi

: 4,7- 21,5

mlIU/ ml

Fase luteal

: 1,7- 7,7

mlIU/ ml

Post menopause

: 25,8- 134,8

mlIU/ml

85

Sensitivitas pemeriksaan

: 0,10 mlIU/ml

Pemeriksaan polimorfisme Gly972Arg pada gen IRS-1


A. DNA diisolasi dari darah tepi dengan menggunakan metoda Isolation Kit dari
Pharmacia. Kemudian 200 ng DNA digunakan sebagai templat untuk PCR.
B. Analisis genotip IRS-1
Genotip G972A dianalisis dengan metode PCR-RFLP menggunakan primer
5CTTCTGTCAGGTGTCCATCC3

(forward)

and

5TGGCGAGGTGTCCACGTAGC3 (reverse), Produk PCR didapat adalah


sebesar 263 pb, diikuti digesti dengan enzim SmaI (3). Apabila ada
polimorfisme (GGGCGG) akan didapat fragmen 183 pb dan 80 pb, apabila
tidak ada polimorfisme akan didapat fragmen sebesar 115 pb, 28 pb, dan 80
pb. Fragmen-fragmen ini akan dipisahkan dengan elektrophoresis gel agarosa,
dan dideteksi dengan pewarnaan ethidium bromid.
Dibuat campuran PCR sebagai berikut :
Larutan DNA (100 ng)

ul

dNTP 10 mmol

ul

MgCl2

2.5 ul

Bufer PCR

ul

Taq polimerase 5 Unit

0.25 ul

Primer Sense 20 pmol

Primer Antisense 20 pmol

ul
ul

Tambahkan ddH2O sampai 50 ul

86

Campuran PCR itu kemudian masukkan ke dalam mesin PCR dengan


program sebagai berikut:
Denaturasi permulaan pada 930C selama 5 menit.
Kemudian masuk ke siklus sebagai berikut :

Temperatu

r denaturasi pada 930C selama 1 menit

Temperatu

r annealing pada 590C selama 1 menit

Temperatu
ekstensi pada 720C selama 1,5 menit. Dilakukan 30 siklus. Terakhir

ditambah temperatur ekstensi pada 720C selama 3 menit.


Produk PCR sebanyak 10 ul di inkubasi dengan enzim restriksi SmaI,
overnight pada temp 370C.

Frekuensi alel nya kemudian dihitung dari genotip yang telah dianalisis.
Perbedaan antara populasi diukur dengan menggunakan analisis chi-square
untuk menentukan heterogeneiti.

C. Elektroforesis
Hasil PCR dan hasil digesti dengan enzim restriksi dielektroforesis untuk
menentukan polimorfismenya

3.6 Rancangan Analisis

87

Analisis statistik yang digunakan pada penelitian ini adalah :


1. Uji Z : digunakan untuk menguji adanya polimorfisme gen pada penderita
SOPK.
2. Uji X2 (Chi-kuadrat) : digunakan untuk mengetahui hubungan data katagori
(data kualitatif) antara proporsi polimorfisme IRS-1Gly972Arg dengan
keberhasilan terapi metformin.
3. Untuk membandingkan perbedaan rata-rata kadar insulin puasa,LH,
testosteron dan perkembangan folikel sebelum setelah terapi metformin pada
polimorfisme IRS-1 digunakan anlisis varian (ANOVA for repetead measures)
Seluruh perhitungan statistik dikerjakan dengan menggunakan, piranti lunak paket
program SPSS/PC for window versi 14.0
Kemaknaan uji statistik ditentukan dengan nilai p < 0.005.

88

3.7 Aspek Etik


Penelitian ini melibatkan/menggunakan subjek manusia. Oleh sebab itu
terdapat kemungkinan untuk timbulnya masalah etik. Adapun masalah etik yang
mungkin timbul dari upaya mengatasinya akan dibahas di bawah ini :
Bahan obat yang digunakan di sini, telah memenuhi prinsip penelitian yang telah
diakui karena :

Sudah melewati eksperimen laboratonium dan binatang percobaan

Sudah dijual di pasaran bebas

Efek samping yang dapat timbul, biasanya ringan saja (mual, muntah, sakit
kepala, insomnia, perut kembung, dan lain-lain) akibat perangsangan pada
sistim pencernaan, yang akan menghilang pada pemberian antasida

Ketidaknyamanan yang mungkin timbul antara lain, pengambilan contoh


darah.

89

DAFTAR PUSTAKA

1. Kousta E, Whita DM, Cela E, McCarthy, Franks. The prevalence of polycystic


ovaries in women with infertility. Hum Reprod 1999; 14:2720-3.
2. Hart R, Hickey M, Franks. Definition, prevalence and symptoms of polycystic
ovaries and polycystic ovary syndrome. Clin Obstet Gynecol 2004; 18:671-83.
3. Franks S. Polycystic ovary syndrome. N Engl J Med 1995; 333:85361.
4. Homburg R. Polycystic ovary syndrome: consensus and controversy. In
Homburg R Ed. Polycystic ovary syndrome. Martin Dunitz Ltd. London
2001:1-3.
5. Polson DW, Wadsworth J, Adams J, Franks S. Polycystic ovaries a
common finding in normal women. Lancet 1988; 1:8702.
6. Pettersson F, Fries H, Nillius SJ. Epidemiology of secondary amenorrhea. Am
J Obstet Gynecol 1973; 117:806.
7. Zawadzki JK, Dunaif A. Diagnostic criteria for polycystic ovary syndrome:
toward a rational approach. In Duniaf A, Given JR, Merriam GR(eds).
Polycistic ovary Syndrome. Blackwell, Boston 1992:377-84.
8. Rotterdam ESHRE/ASRM-sponsored SOPKS consensus workshop group
2004 Revised 2003 consensus on diagnostic criteria and long term health
risks related to polycystic ovary syndrome (SOPKS). Hum Reprod 2004;
19: 41-7.
9. Goldzieher JW, green JA. The polycystic ovary. Clinical and histologic
features. J Clin Endrocinol Metab 1962; 22:325-8.

90

10.

Dunaif A, Futterweit W, Segal KR, Dobrjansky A, Profound peripheral

insulin resistance, independent of obesity, in the polycystic ovary syndrome.


Diabetes 1989; 38:1165-74.
11.

Kitabchi DE, Buffington CK, Given JR, Inouye H. The role of

testosterone and dehidroepiandrosterone on insulin resistance and


sensitivity in hyperandrogenic female. Polycystic ovary syndrome. Current
issues in Endocrinology and Metabolism. Eds:Dunaif A,Givens JR,
Hasetline FP, Merriam GR. Blackwell Scientific, Boston 1992:289-305.
12.

Poretsky L, Cataldo N, Rosenwks Z, Giudice L. The insulin related

ovarian regulatory system in health and diseases. Endocr Rev. 1999; 4:53582.
13.

Salehi,Vera RB, Sheikh A, Gouller A, Poretsky L. Obesity in Polycystic

Ovary Syndrome: Ywo Diseases or One? Turkish Endocr Metab J 2003;


4:147-57.
14.

Gambineri A, Pelusi C, Vicennati V, Pagotto U, Pasquali R.Obesity and the

polycystic ovary syndrome. Int J Obes Relat Metab Disord 2002; 26:88396.
15.

Knochenhauer ES, Key TJ, Kahsar-Miller M, Waggoner W, Boots LR,

Azziz R. Prevalence of the polycystic ovary syndrome in unselected black and


white women of the southeastern United States: a prospective study. J Clin
Endocrinol Metab 1998; 83:307882.
16.

Carmina E, Koyama T, Chang L, Stanczyk FZ, Lobo RA. Does ethnicity

influence the prevalence of adrenal hyperandrogenism and insulin resistance


in polycystic ovary syndrome? Am J Obstet Gynecol 1992; 167:180712.

91

17.

Dunaif A, Sorbara L, Delson R, Green G. Ethnicity and polycystic ovary

syndrome are associated with independent and additive decreases in insulin


action in Caribbean-Hispanic women. Diabetes 1993; 42:146268.
18.

Williamson K, Gunn AJ, Johnson N, Milsom SR. The impact of ethnicity

on the presentation of polycystic ovarian syndrome. Aust NZ J Obstet


Gynaecol 2001; 41:2026.
19.

Rodin DA, Bano G, Bland JM, Taylor K, Nussey SS. Polycystic ovaries

and associated metabolic abnormalities in Indian subcontinent Asian women.


Clin Endocrinol 1998; 49:919.
20.

Wijeyaratne

CN, Balen AH, Barth JH, Belchetz PE. Clinical

manifestations and insulin resistance (IR) in polycystic ovary syndrome


(PCOS) among South Asians and Caucasians: is there a difference? Clin
Endocrinol 2002; 57:34350.
21.

Kasim-Karakas SE, Almario RU, Gregory L, Wong R, Todd H, Lasley BL.

Metabolic and endocrine effects of a polyunsaturated fatty acid-rich diet in


polycystic ovary syndrome. J Clin Endocrinol Metab 2004; 89:61520.
22.

Myers MG, White MF. The new elements in in insulin signaling. Insulin

Reseptor Substrate-1 and protein SH2 domains.Diabetes 1993; 42:643-50.


23.

Laakso M, Malkki M, Kekalainen P, Kuusisto J, Deeb S.

Insulin receptor substrate-1 variants in non-insulin dependent


diabetes. J Clin Invest 1994; 94:1141 6.
24.

Zhang Y, Wat N, Stratton IM, Warren-Perry MG, Orho M,

Groop L, et al. UKPDS 19: heterogeneity in NIDDM: separate

92

contributions of IRS-1 and 3-adrenergic-receptor mutations to


insulin resistance and obesity respectively with no evidence
for glycogen synthase gene mutations. Diabetologia 1996;
39:150511.
25.

Baroni MG, DAndrea MP, Montali A, Pannitteri G, Barilla F,

Campagna F, et al. A common mutation of the insulin receptor


substrate-1 gene is a risk factor for coronary artery disease.
Arterioscler Thromb Vasc Biol 1999; 19:297580.
26.

Sigal RJ, Doria A, Warram JH, Krolewski AS. Codon 972

polymorphism in the insulin receptor substrate-1 gene,


obesity, and risk for noninsulin-dependent diabetes mellitus. J
Clin Endocrinol Metab 1996; 81:16579.
27.

Witchel SF, Smith R, Tomboc M, Aston CE. Candidate gene

analysis

in

premature

pubarche

and

adolescent

hyperandrogenism. Fertil Steril 2001; 75:724 30.


28.

El Mkadem SA, Lautier C, Macari F, Molinari N, Lefebvre P,

Renard E, et al. Role of allelic variants Gly927Arg of IRS-1 and


Gly1057Asp of IRS-2 in moderate-to-severe insulin resistance
of women with polycystic ovary syndrome. Diabetes 2001;
50:21648.
29.

Ehrmann DA, Tang X, Yoshiuchi I, Cox NJ, Bell GI.

Relationship of insulin receptor substrate-1 and -2 genotypes

93

to phenotypic features of polycystic ovary syndrome. J Clin


Endocrinol Metab 2002; 87:4297300.
30.

Clausen JO,Bjorbaek C, Erchwald SM,Urhammers SA et al.

Insulin resistance: interaction between obesity and acommon


variant of insulin substrat-1. Lancet 1995; 346:397-402.
31.

Almind K, Inoue G, Pedersen O, Kahn CR. A common amino

acid poly-morphism in insulin receptor substrate-1 causes


impaired insulin signaling. Evidence from transfection studies.
J Clin Invest 1996; 97:256975.
32.

El Mkadem SA, Lautier C, Makasi F, Molinari N et al. Role of

allelic variants Gly972Arg of IRS-1 and Gly1057Asp of IRS-2 in


moderate

to

severe

insulin

resistance

of

women

with

polycystic ovary syndrome. Diabetes 2001; 50: 2164-8.


33.

Gunton JE, Delhanti PJ, Baxter RC. Metformin rapidly

increases insulin reseptor activation in human liver and


signals preferentially through insulin reseptor substrat -1. J
Clin Endocrinol Metab 2003; 8:1323-32.
34.

Yen HW, Jakimiuk AJ, Munir I, Magoffin. Selective alterations

in insulin reseptor substrat-1,-2 and -4 in theca but not


granulose cellfrom polycystic avaries. Mol Hum Reprod 2004;
10:473-9.
35.

Baroni MG, Arca M, Sentinelli, Buzzetti R et al. The G972R

variant of the Insulin Receptor Substrat-1 (IRS-1) gene, body


94

fat distribution and insulin-resistance. Diabetologia 2001;


44:367-72.
36.

Balen AH, Laven JSE, Tan SL, Dewailli D. Ultrasound

assessment of

the polycystic ovary:International consensus

definition. Hum Reprod Update 2003; 9:505-14.


37.

Fauser BJCM,Pache TD, Lamberts WJ et al. Serum bioactive

and

immuno-reactive

lutenizing

hormone

and

follicle

stimulating hormone in women with cicle abnormalities, with


or without polycystic ovary disease. J Clin Endocrinol 1991;
73:811-7.
38.

Dunaif A, Givens JR, Haseltine F, Merriam GR (eds) . The Polycystic

Ovary Syndrome. Blackwell Scientific, Cambridge 1992:254-8.


39.

Yen SSC. The polycystic ovary syndrome. Clin Endocrinol 1980; 12:177

208.
40.

McKenna TJ, Moore A, Magee F, Cunningham S. Amenorrhea with

cryptic hyperandrogenemia. J Clin Endocrinol Metab 1983; 56:89396.


41.

Mechanick J, Dunaif A. Masculinization: a clinical approach to the

diagnosis and treatment of hyperandrogenic women. In: Mazzaferri E (ed)


Advances in Endocrinology and Metabolism. Mosley Year Book, Inc, Chicago
1990:
42.

12973.

Futterweit W, Dunaif A, Yeh H, Kingsley P The prevalence of hyper-

androgenism in 109 consecutive women presenting with diffuse alopecia.


J Am Acad Dermatol 1988; 19:83136.

95

43.

Balen AH, Conway GS, Kaltsas G et al. Polycystic ovary syndrome: The

spectrum of the disorder in 1741 patients. Hum Reprod 1995; 10: 2705-12.
44.

Franks S, White D, Gilling-Smith C, Carey A, Waterworth D &

Williamson R. Hypersecretion of androgens by polycystic ovaries: the role of


genetic factors in the regulation of cytochrome P450c17.. Balliere's Clinical
Endocrinology and Metabolism 1996; 10(2): 193-203.
45.

Rosenfield RL, Barnes RB, Cara JF & Lucky AW. Dysregulation of

cytochrome P450c17 as the cause of polycystic ovarian syndrome. Fertil Steril


1990; 53(5): 785-91.
46.

Ehrmann DA, Barnes RB & Rosenfield RL. Polycystic ovary syndrome

as a form of functional ovarian hypernadrogenism due to dysregulation of


androgen secretion. Endocrine Reviews 1995; 16:322-53.
47.

Kirschner MA & Bardin CW. Androgen production and metabolism in

normal and virilized women. Metabolism 1972; 21: 667-88.


48.

Rivarola M, Singleton R & Migoen C. Splanchnic extraction and inter-

conversion of testosterone and androstenedione in man. J Clin Invest 1967;


46: 2095-99.
49.

White DW, Leigh A, Wilson C, et al. Gonadotrophin and gonadal steriod

response to a single dose of a long-acting agonist of gonadotrophin-releasing


hormone in ovulatory and anovutatory women with polycystic ovary
syndrome. Clin Endocrinol 1995; 42: 475-81.

96

50.

Barnes RB, Rosenfield RL, Burstein S, at al. Pituitary-ovarian response to

nafarelin testing in the polycystic ovary syndrome. N Eng J Med 1989; 320:55969.
51.

Mason HD, Willis DS, Beard RW, et al. Estradiol production by granulosa cells

of normal and polycystic ovaries (PCO): Relationship to menstrual cycle


history and to concentrations of gonadotrophins and sex steroids in follicular
fluid. J Clin Endocrinol Metab 1994; 79:1355.
52.

Aiyer MS, Chiappa SA & Fink G. A priming effect of luteinizing releasing

factor on the pituitary gland in the female rat. J Endocrinol 1974; 62:573-88.
53.

Wang CF. Lasley BL, Lein A & Yen SSC. The functional changes of the

pituitary gonadotrophs during the menstrual cycle.J clin endocrinol metab


1976; 42: 718-28.
54.

Rosmanith WG, Wirth U, Sterzik K & Yen SS. The effects of prolonged

opioidergic blockade on LH pulsatile secretion during the menstrual cycle. J


Endocrinol Invest 1989; 12: 245-52.
55.

Danforth DR, Elkind-Hirsch K & Hodgen G. In-vivo and in-vitro

modulation

of

GnRH

metabolism

by

estradiol

and

progesterone.

Endocrinology 1990; 127: 319-24.


56.

Quigley M, Rakoff J & Yen SSC. Increased luteinising hormone sensitivity

to dopamine inhibition in the polycystic ovary syndrome. J clin endocrinol


metab. 1981; 52: 23 1.
57.

Cumming DC, Reid RL, Quigley ME, Rebar RW & Yen SS. Evidence for

decreased endogenous dopamine and opioid inhibitory influences on LH

97

secretion in polycystic ovary syndrome. Clin Endocrin (Oxf) 1984; 20: 64348.
58.

Shoupe D &Lobo RA. Evidence for altered catecholamine metabolism in

polycystic ovary syndrome. Am J Obstet Gynecol 1984; 150: 566-70.


59.

Yoshino K, Takahashi K, Shirai T, Nishigaki A, Araki Y & Kitao M. Changes in

plasma catecholamines and pulsatile patterns of gonadotropins in subjects with a


normal ovulatory cycle and with polycystic ovary syndrome. Int J Fertil 1990;
35: 34-39.
60.

Barnes R & Lobo R. Central opioid activity in the polycystic ovary

syndrome with and without dopaminergic modulation. J Clin Endocrin Metab


1985; 61: 779.
61.

Barnes RB, Mileikowsky GN, Cha KY, Spencer CA & Lobo RA. Effects of

dopamine and metoclopramide in polycystic ovary syndrome. J Clin Endocrin


Metab 1986; 63; 506-09.
62.

Berga SL & Yen SSC. Opioidergic regulation of LH pulsatility in women with

polycystic ovary syndrome. Clin Endocrin 1989; 30: 177-84.


63.

Schoemaker J. Neuroendocrine control in polycystic ovary-like

syndrome. Gynecological Endocrinology: J Int Society of Gynecol Endocrinol


1991; 5: 277-88.
64.

Waldstreicher J, Santoro NF, Hall HJE, Filicori M & Crowley WF.

Hyperfunction of the hypothalamic pituitary axis in women with polycystic


ovarian disease: Indirect evidence of partial gonadotraph desensitization. J Clin
Endocrinol Metab 1988; 66:165-72.

98

65.

Rebar R, Judd HL, Yen SCC, Rakoff J. Vandenberg G & Naftolin F.

Characterization of the inappropriate gonadotropin secretion in polycystic ovary


syndrome. J Clin Invest 1976; 57:1320-29.
66.

Burger CW, Korsen T, Van Kessel H, Van Dop PA, Caron FJM &

Schoemaker J. Pulsatile luteinizing hormone patterns in the follicular phase of the


menstrual cycle, polycystic ovarian disease (PCOD) and non PCOD secondary
amenorrhoea. J Clin Endocrinol Metab 1985; 61: 1126-32.
67.

Baird DT, Corker CS, Davison DW, Hunter WM, Michie EA & Van Look

PFA. Pituitary ovarian relationships in polycystic ovary syndrome. J Clin


Endocrino Metab 1977; 45: 798-809.
68.

Kazer RR, Kessel B & Yen SS. Circulating luteinizing hormone pulse

frequency in women with polycystic ovary syndrome. J Clin Endocrinol Metab


1987; 65: 233-35.
69.

Sagle M, Kiddy D, Mason HD, et al. Evidence for normal hypothalamic

regulation of LH in ovulatory women with the polycystic ovary syndrome. In


Rolland R & Heineman MJ (eds) Neuroendocrinology of Reproduction, Excerpta
Medica Amsterdam; 1987.
70.

Venturoli S, Purcu E, Fabbri R, Magrini O, Gammi L, Paradisi R, Forcacci M,

Bolzani R & Flamigni C. Episodic pulsatile secretion of FSH, LH, prolactin,


oestradiol, oestrone and LH circadian variations in polycystic ovary syndrome.
Clin Endocrinol 1988; 28: 93-107.

99

71.

Couzinet B, Thomas G, Thalabard JC, Brally S & Schaison G. Effects of a

pure antiandrogen on gonadotropin secretion in normal women and in


polycystic ovarian disease. Fertil Steril 1989; 52: 42-47.
72.

Murdoch AP, Diggle PJ, White MC, Kendall-Taylor P & Dunlop W. LH in

polycystic avary syndrome: reproducibility and pulsatile secretion. J


Endocrinol 1989, 121: 185-91.
73.

Gadir AA, Mowafi RS, Alnaser HMI, Alnaser HMI, Alrashid AH &

Shaw RW. Ovarian electrocautery versus hMG and pure FSH therapy in
the treatment of patients with polycystic ovarian disease. Clin Endocrinol
1994; 33: 585-92.
74.

Rossmanith WG, Keckstein J, Spatzier K & Lauritzen C. The impact of

ovarian laser surgery on the gonadotrophin secretion in women with PCOD.


Clin Endocrinol 1991; 34:223-30.
75.

Jeffcoate SL. Analytical and clinical significance of peptide hormone

heterogeneity with particular reference to growth hormone and luteinising


hormone in serum. Clin Endocrinol 1993; 38: 113-21.
76.

Fauser BCJM, Pache TD. Lamberts WJ, Hop HCJ, de Jong FH & Dahl

KD. Serum bioactve and immunoreactive luteinising hormone and follicle


stimulating hormone levels in women with cycle abnormalities, with or
without polycystic ovary disease. J Clin Endocrinol Metab 1991; 73:811-17.
77.

Lobo RA, Kletzky OA, Campeau J & diZerega G. Elevated bioactive

luteinising hormone in women with polysystic ovary syndrome. Fertil Steril


1983; 39: 674-79.

100

78.

Ding YQ & Huhtaniemi I. Preponderance of basic isoforms of serum LH

is associated with the high bio/immuno ratio of LH in healthy women and in


women with polycystic ovarian disease. Hum Reprod 1991; 6: 346-50.
79.

Tapanainen JS, Riitta K, Fauser BCJM, et al. A new contributing factor to

polycystic ovary syndrome: The genetic variant of luteinizing hormone. J


Clin Endocrinol Metab 1999; 84: 1711-15.
80.

Antilla L, Ding Y-Q, Ruutiainen K, Erkkola R, Irjala K & Huhtaniemi R.

Clinical features and circulating gonadotropin, insulin and androgen


interactions in women with polycystic ovarian disease. Fertil Steril 1991; 55:
1057-61.
81.

Conway GS, Honour JW & Jacobs HS. Heterogeneity of the polycystic

ovary syndrome: clinical, endocrine and ultrasound features in 556 patients.


Clin Endocrinol 1989; 30: 459-70.
82.

Conway GS, Clark PMS & Wong D. Hyperinsulinaemea in the polycystic

ovary syndrome confirmed with a specific immunoradiometric assay for


insulin. Clin Endocrinol 1993; 38: 2l4-22.
83.

Lasley BL, Wang CF & Yen SSC. The effects of estrogen and

progesterone on the functional capacity of the gonadotrophs. J Clin


Endocrinol Metab 1975; 41:820-26.
84.

Menon Pi, Peegel H & Katta V. Estradiol potentiation of gonadotrophin-

releasing hormone responsiveness in the anterior pituitary is mediated by an


increase in gonadotrophin-releasing hormone receptors. Am J Obstet Gynecol
1985; 151: 534-40.

101

85.

Emons G, Hoffmann HG, Brack C, Ortmann Q, Sturm R, Ball P &

Knuppen R. Modulation of GnRH receptor concentration in cultured female


pituitary cells by estradiol treatment. Biochemistry 1988; 31: 751 -56.
86.

Pemberton P, White DM & Franks S. The feedback effect of oestradiol

on secretion of LH in ovulatory and anovulatory women with polycystic


ovary syndrome. J Endocrinol 1992; 135(supplement:P97).
87.

Sopelak VM & Hodgen GD. Blockade of the estrogen-induced LH surge

in monkeys: a nonsteroidal, antigenic factor in porcine follicular fluid. Fertil


Steril 1984; 41: 108-113.
88.

Burger HG. Inhibin: review. Reprod Med Rev 1992; 1:1-20.

89.

Culler MD. In-vivo evidence that inhibin is a gonado-trophin surge-

inhibiting factor. Endocrinology 1992; 131:1556-58.


90.

Lockwood GM. The role of inhibin in PCOS. Hum Fertil 2000; 3:86-92.

91.

Dunaif A. Insulin resistance and the palycystic ovary syndrome:

mechanisms and implication for pathogenesis. Endocrine Review 1997; 18:774800.


92.

Franks S. Palycystic ovary syndrome. N Engl J Med 1995: 333: 853-61.

93.

Lord J & Wilkin T. Polycystic ovary syndrome and fat distribution: the

central issue? Hum Fertil 2002,5: 67-71.


94.

Bergh C, Carlsson B, Olsson JH, Selleskog U & Hillensjo T. Regulation of

androgen production in cultured human thecal cells by insulin-like growth factor I and
insulin. Fertil Steril 1993; 59:323-31.

102

95.

Adashi E. Intraovarian regulation: the proposed role of insulin-like growth

factors. Annals of the New York Academy of Sciences 1993; 687,10-12.


96.

Ia Marca A, Egbe TO, Morgante G, Paglia T, Ciani A & De Leo V. Metformin

treatment reduces ovarian cytochrome P450c17(response to human chorionic


gonadotrophin in women with insulin resistance-related polycystic ovary
syndrome. Hum Reprod 2000; 15: 21-23.
97.

Dunaif A, Segal KR, Futterweit W & Dobrjansky A. Profound peripheral

insulin resistance, independent of obesity in polycystic ovary syndrome.


Diabetes 1989; 38: 1165-74.
98.

Tsilchorozidou T, Overton C & Conway GS. The pathophysiology of

polycystic ovary syndrome. Clin Endocrinol 2004; 60:1-17.


99.

Kahn CR. Insulin action, diabetogenes, and the cause of Type II

diabetes. Diabetes 1994; 43:1066-84.


100.

Cheatham B, Kahn CR. Insulin action and the insulin signaling network.

Endocr Rev 16:117-142.


101.

Ciaraldi TALI PUSAT, El-Roeiy A, Madar Z, Reichart D, Olefsky JM, Yen

SSC. Cellular mechanisms of insulin resistance in polycystic ovarian


syndrome. J Clin Endocrinol Metab 1992; 75: 577-83.
102.

Rosenbaum D, Haber RS, Dunaif A. Insulin resistance in polycystic ovary

syndrome: decreased expression of GLUT-4 glucose transporters in


adipocytes. Am J Physiol 1993; 264: E197-E202.
103.

Dunaif A. Xia J, Book C, Schenker E and Tang Z. Excessive insulin

receptor serine phosphorylation in cultured fibroblasts and in skeletal

103

muscle: a potential mechanism for insulin resistance in the polycystic ovary


syndrome. J Clin Invest 1995; 96,801-10.
104.

Hattersley AT, Tooke JE. The fetal insulin hypothesis: an alternative

explanation of the association of low birthweight with diabetes and vascular


disease. Lancet 1999; 353:1789-92.
105.

El Mkadem SA, Lautier C, Macari F, Molinari N, Lefebvre P,

Renard E, Gris JC, Cros G, Daures JP, Bringer J, White MF, Grigorescu F.
Role of allelic variants Gly972Arg of IRS-1 and Giy1057Asp of IRS-2 in
moderate-to-severe insulin resistance of women with polycystic ovary
syndrome. Diabetes 2001; 50: 2164-68.
106.

Maciel GA, Soares JM, Motta EL, Haidar MA, Baracat EC. Nonobese

women with polycystic ovary syndrome respond better than obese


women to treatment with metformin.Fertil Steril 2004;81:355-9.
107.

Almind K, Inoue G, Pedersen O and Kahn CR (1996) A common amino acid

polymorphism in insulin receptor substrate-1 causes impaired insulin


signaling, evidence from transfection studies. J Clin Invest 97, 2569-75.
108.

Carmina E, Koyama T, Chang L, Stanczyk FZ and Lobo RA. Does

ethnicity influence the prevalence of adrenal hyperandrogenism and insulin


resistance in polycystic ovary syndrome? Am J Obstet Gynecol 1992;
167:1807-12.
109.

Wu KK, Zhou SY, Liu JX, Pollanen P, Sallinen K, Makinen M and

Erkkola R. Selective ovary resistance to insulin signaling in women with


polycystic ovary syndrome. Fertil Steril 2003; 80:954-65.

104

DAFTAR ISI
Halaman
DAFTAR ISI .............................................................................................

DAFTAR GAMBAR .....................................................................................

iii

BAB I. PENDAHULUAN
1.1 Latar Belakang Penelitian ......................................................

1.2 Rumusan masalah ...................................................

11

1.3 Maksud dan Tujuan Penelitian ...............................................

12

1.3.1 Maksud penelitian ........................................................

12

1.3.2 Tujuan khusus.......................................................

12

1.4 Manfaat Penelitian .............................................................

12

1.4.1 Akademis .................................................................

12

1.4.2 Penelitian .................................................................

13

1.4.3 Pelayanan..................................................................

13

BAB II. KAJIAN PUSTAKA, KERANGKA PEMIKIRAN DAN HIPOTESIS


2.1 Kajian Pustaka ..................................................................

14

2.1.1 Sejarah ...................................................................

14

2.1.2 Definisi dan diagnosis SOPK ................................

15

2.1.3 Patofisiologi sindrom ovarium polikistik.................

20

2.1.4 Genetik pada SOPK ..............................................

52

2.1.5 Obesitas, resistensi insulin dan SOPK ..................

57

2.1.6 Metformin, resistensi insulin dan SOPK ................

58

2.2 Kerangka Pemikiran ..........................................................

63

BAB III. BAHAN DAN METODE PENELITIAN


3.1 Bahan/Objek Penelitian .....................................................

78

3.2 Desain Penelitian .......................................................

79

3.3 Tempat dan Waktu Penelitian ............................................

80

3.4 Variabel Penelitian ........................................................

80

3.5 Tata Kerja Penelitian .......................................................

82

Halaman
3.6 Rancangan Analisis .......................................................

95

3.7 Aspek Etik..................................................................

96

DAFTAR PUSTAKA ..................................................................

97

ii

DAFTAR GAMBAR
Halaman
Gambar 1. Biosintesis Steroid ........

21

Gambar 2. Insulin Reseptor ........................................................................

47

Gambar 3. Alur Fosforilasi Tirosin ............................................................

48

Gambar 4. Patogenesis hiperandrogenisme pada wanita SOPK yang


gemuk maupun kurus.................................................................

66

Gambar 5. Alur Kerangka Pemikiran.........................................................

74

Gambar 6. Bagan Tata Cara Penelitian....................................................

83

iii

DAFTAR LAMPIRAN
Halaman
Lampiran 1. Lembar Informasi Penelitian ..........

113

Lampiran 2. Surat Persetujuan Mengikuti Penelitian .........

115

Lampiran 3. Status Penelitian ................

116

Lampiran 4. Pemeriksaan Polimorfisme Gen IRS-1 G972A .........

117

Lampiran 5. Hasil Penelitian ...............

118

iv