Anda di halaman 1dari 15

Nama

: Ulya Alviredieta

NIM

: 10413012

Kelompok : 10
1. HBV Complete Genome:

2. Gen target: S gene


Letak gen: 1.3,215

Berdasarkan fitur highlight sequence features, diketahui gen pengode


large surface protein yang ditarget ada dalam genom virus. Bagian gen
tersebut ditandai dengan highlight warna cokelat pada complete genome.

Karena bentuknya yang sirkuler, dapat disimpulkan sekuens gen tersebut


adalah:
ATGGGAGGTTGGTCTTCCAAACCTCGACAAGGCATGGGGACGAATCTTTCTGTTCCCAATCCTCTGGGA
TTCTTTCCCGATCACCAGTTGGACCCTGCGTTCGGAGCCAACTCAAACAATCCAGATTGGGACTTCAAC
CCCAACAAGGATCACTGGCCAGAGGCAAATCAGGTAGGAGCGGGAGCATTTGGTCCAGGGTTCACCCCA

CCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATATTGACAACACTGCCAGCAGCACCT
CCTCCTGCCTCCACCAATCGGCAGTCAGGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGT
CATCCTCAGGCCATGCAGTGGAACTCCACAACATTCCACCAAGCTCTGCTAGATCCCAGAGTGAGGGGC
CTATATTTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTAAACCCTGTTCCGACTACTGCCTCACCCATA
TCGTCAATCTTCTCGAGGACTGGGGACCCTGCACCGAACATGGAGAGCACAACATCAGGATTCCTAGGA
CCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCACAGAGTCTAGAC
TCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTCGCAGTCCCCA
ACCTCCAATCACTCACCAACCTCTTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGT
TTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGT
ATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAACTACCAGCACGGGACCATGCAGAACCTGCACG
ATTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAACTGCACT
TGTATTCCCATCCCATCATCCTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCC
TGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGCT
ATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTTTACCTCTATTACCA
ATTTTCTTTTGTCTTTGGGTATACATTTGA

3. Perancangan primer dilakukan dengan situs NCBI Primer-BLAST Tool


dengan spesifikasi khusus berikut untuk mendapatkan primer dengan
kualitas terbaik:
Parameter
Isi
Keterangan
PCR Product Size
300 (min) 1000 (max)
Merupakan rentang
ideal produk PCR
untuk menghindari
patah, re-annealing
dengan sesame
DNA, dan crosslink
Database
Genome (chromosomes
for all organisms),
selected for HBV complete
genome
Organism
10407
Kode HBV
Primer Size
18 (min) 24 (max)
Merupakan rentang
ideal ukuran primer
dengan spesifisitas
terbaik
Primer GC Content
40% (min) 60% (max)
Merupakan rentang
ideal primer dengan
kemampuan
penempelan baik
(tidak terlalu lemah
dan tidak terlalun
kuat)

Sekuens yang dipilih adalah database HBV Complete Genome.

Maka, akan dihasilkan hasil sebagai berikut.

Dari 10 primer yang dirancang oleh situs, pemilihan pasangan primer


dilakukan berdasarkan kriteria berikut:
a. Panjang produk. Panjang produk ideal adalah 300-1000 bp. Hal
ini dimaksudkan untuk mencegah terjadinya patah, re-annealing
dengan sesama DNA (bukan dengan primer), dan terbentuknya
cross-link (NEB, 2015). Seluruh pasangan primer memenuhi
kriteria panjang produk. Menurut Harvard Medical School, primer
terbaik adalah primer yang menghasilkan ukuran produk antara
500 bp. Semakin kecil ukuran produk, efisiensi amplifikasi
mendekati 100% sehingga kualitas produk semakin baik.

Pri
Size
Rank

1
392
2,5

2
437
8,5

3
384
4

4
396
6

5
388
1

6
393
5

7
436
7

8
439
9

9
392
2,5

10
437
8,5

Diantara 10 pasangan primer, primer 5 menghasilkan panjang


produk terkecil sehingga, dilihat dari parameter panjang produk,
primer 5 adalah yang terbaik. Primer lain yang dapat dijadikan
alternative adalah primer 1 dan 9 dengan panjang produk 392 bp.
b. Panjang pasangan primer. Semua pasangan primer memiliki
panjang masing-masing sebesar 20 bp. Panjang primer berada
dalam rentang wajar, yaitu 18 24 bp. Artinya, pasangan primer
10 memiliki spesifisitas yang tinggi: tidak terlalu pendek untuk
penempelan acak dan tidak terlalu panjang sehingga menyulitkan
proses penempelan dengan template yang menjadikan amplifikasi
kurang efektif (Judelson, 2006).
c. TM. Selisih TM yang kecil mencegah misprime, kondisi saat salah
satu primer lepas dari template sementara primer yang lain masih
menempel, sehingga amplifikasi berjalan efisien (Judelson, 2006).
Idealnya, selisih TM antarprimer tidak lebih dari 5C, semakin kecil
semakin baik (Judelson, 2006). Karena memiliki TM yang mirip,
maka temperatur penempelannya mirip sehingga waktu
penempelannya dapat dikatan mirip. Hal ini meningkatkan efisiensi
waktu dan energi reaksi PCR (Judelson, 2006)
Pri
1
2
3
4
5
6
7
8
9
TM
1,51
1,5
1,43
1,86
1,93
1,21
1,21
1,21
0,86

10
0,87

Pasangan primer 5 yang merupakan pasangan primer terbaik dari


segi panjang produk memiliki selisih TM sebesar 1,93C, tertinggi di
antara 9 pasangan primer lain. Pasangan primer dengan selisih Tm
terendah adalah pasangan primer 9. Secara efisiensi reaksi akibat
perbedaan TM, pasangan primer 9 adalah pasangan primer terbaik.
Pasangan primer yang dapat menjadi alternative adalah pasangan
primer 10.
d. Presentase GC. Jika presentase GC terlalu rendah, stabilitas
ikatan primer-template juga rendah sehingga ada kemungkinan
primer sering terlepas dari template. Jika presentase GC terlalu
tinggi, ada kemungkinan spesifisitas primer menjadi rendah,
disebabkan oleh ikatan sembarang antara GC pada primer dengan
GC dengan template. Ikatan ini cenderung stabil karena ikatan GC
membutuhkan energi lebih tinggi untuk dilepaskan. Akibatnya,
efisiensi reaksi menurun. Kesepuluh pasangan primer memiliki
konten %GC yang baik, berada pada rentang optimum yaitu 4060%. Persentase GC yang baik meningkatkan stabilitas ikatan
template-primer sehingga reaksi berjalan efisien.
e. Self-complementary. Self complementary merujuk pada
kemampuan basa nitrogen primer untuk berikatan dengan basa

nitrogen lainnya membentuk struktur yang disebut hairpin


(Judelson, 2006).

Keberadaan hairpin menurunkan kemampuan primer berikatan


dengan template sehingga efisiensi PCR berkurang. Hal ini sangat
dihindari. Untuk itu, primer harus dirancang sedemikian rupa
dengan nilai self complementary sekecil mungkin (Ye et al., 2012).
Pasangan
Self
Rata-Rata
Keterangan
Primer
Complementary
1
2
3
4
5
6
7
8
9
10

Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.

=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=

8
4
8
3
8
4
8
3
8
4
8
4
8
3
8
3
8
4
8
3

6
5,5

Terendah

6
5,5

Terendah

6
6
5,5

Terendah

5,5

Terendah

6
5,5

Terendah

Pasangan primer 2, 4, 7, 8, dan 10 memiliki nilai self


complementary paling kecil dibanding pasangan primer lain.
Artinya, pasangan primer 2, 4, 7, 8, dan 10 memiliki kemungkinan
membentuk dimer selama reaksi paling kecil dibanding pasangan
primer lain sehingga efisiensi reaksi yang relatif lebih tinggi
dibanding pasangan primer lain (dari segi pembentukan hairpin).
Alternatif pasangan primer lain adalah pasangan primer 1, 3, 5, 6,
dan 9.
f. Self 3 complementary. Adalah kemungkinan basa nitrogen pada
bagian 3 pasangan primer berikatan satu sama lain dan
membentuk struktur yang disebut primer-dimer (Ye et al., 2012;
Judelson, 2006).

Seperti halnya hairpin, keberadaan primer-dimer juga menurunkan


efisiensi reaksi. Hanya saja, keberadaan primer-dimer menurunkan
laju reaksi lebih besar dari keberadaan hairpin. Hal ini dikarenakan
primer-dimer mengonsumsi primer forward dan reverse pada saat
bersamaan, bukan salah satunya saja seperti pada pembentukan
hairpin.
Pasangan
Self 3
Rata-Rata
Keterangan
Primer
Complementary
1
2
3
4
5
6
7
8
9
10

Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.

=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=

2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2

2
2
2
2
2
2
2
2
2
2

Self 3 complementarity semua pasangan primer bernilai 2,


sehingga dapat disimpulkan kemungkinan pembentukan primerdimer pada seluruh pasangan primer adalah sama.
g. Di antara 9 primer lainnya, keberadaan poli-X pada pasangan
primer 10 relatif lebih rendah. Poli-X merupakan salah satu
parameter perancangan primer yang kemungkinannya harus
ditekan serendah mungkin (Judelson, 2006). Poli-X adalah daerah
dimana basa nitrogen yang sama berada berdampingan pada
primer. Keberadaan poli-C dan poli-G dapat menurunkan
spesifisitas primer (Judelson, 2006). Hal ini disebabkan oleh
kemungkinan poli-C dan poli-G bertemu dengan daerah selain
target yang kaya akan GC. Jika hal ini terjadi, akan terbentuk
ikatan kuat antara daerah nontarget dengan primer yang
menyebabkan primer menempel pada target yang salah.
Keberadaan poli-A dan poli-T, karena memiliki energi ikatan lemah,
dapat menyebabkan breath, suatu keadaan ketika sebagian
primer terlepas dari template (Judelson, 2006). Keberadaan poli-A,

poli-G, poli-C, dan poli-T pada semua pasangan primer telah diteka
hingga maksimal 2 nukleotida berurutan saja. A
Berdasarkan analisis tersebut, dapat disimpulkan bahwa pasangan
primer 10 merupakan pasangan primer terbaik yang dapat digunakan
untuk mengamplifikasi sekuens 1 menggunakan PCR.
Untuk sekuens 2, didapatkan hasil sebagai berikut.

Dengan detil sebagai berikut.

Dari 10 primer yang dirancang oleh situs, pasangan primer 10


sebenarnya merupakan primer yang paling baik untuk mengamplifikasi
sekuens 1 menggunakan PCR. Hal ini disebabkan oleh beberapa faktor:
a. Pasangan primer 10 memiliki panjang produk amplifikasi 306 bp.
Panjang produk ini berada dalam rentang 300 1000 bp sehingga
tidak terlalu panjang untuk menyebabkan produk patah, terjadinya
crosslink, dan re-annealing sebelum reaksi selesai. Panjang produk
yang dihasilkan oleh reaksi relatif lebih kecil dibanding panjang
produk primer lain. Artinya, kemungkinan terjadinya patah, cross
link, dan re-annealing sebelum reaksi selesai lebih sedikit. Selain
itu, karena berukuran pendek, tidak perlu banyak dilakukan
optimasi reaksi dari segi suhu, mastermix, dan enzim sehingga
menekan biaya operasional.
b. Pasangan primer 10 memiliki panjang primer 20 bp. Panjang ini
masih berada dalam rentang wajar. Karena panjang primer lebih
besar dari 18 bp dan lebih kecil dari 24 bp, panjang primer tidak
terlalu pendek sehingga memungkinkan penempelan tidak spesifik
dan tidak terlalu panjang sehingga meningkatkan waktu dan

temperatur penempelan. Hal ini menjadikan reaksi lebih efisien dan


cost-effective.
c. TM kedua primer relatif sama (TM = 0,38C). Hal ini menyebabkan
kedua primer memiliki temperatur dan waktu annealing yang dapat
dikatakan serupa. Menempelnya primer pada suhu dan waktu yang
serupa meningkatkan efektivitas dan efisiensi reaksi sehingga
mengurangi biaya operasional.
d. Presentase GC kedua pasangan primer berada dalam rentang 40%
hingga 60%. Presentase GC yang berada dalam rentang ideal ini
cukup kuat untuk menghindari breathing dan cukup lemah untuk
mencegah terlalu kuatnya ikatan antarDNA yang berakibat pada
menurunnya efisiensi reaksi pada setiap siklus. Hal ini otomatis
menekan operational cost reaksi.
e. Self-complementary pasangan primer relatif lebih rendah dari
pasangan lain. Artinya, kemungkinan pasangan primer 10
membentuk hairpin lebih rendah dari pasangan lain. Hal ini berarti
efektivitas dan efisiensi reaksi yang dilakukan dengan pasangan
primer 10 lebih tinggi dari reaksi dengan primer lain.
Pasangan
Self
Rata-Rata
Keterangan
Primer
Complementary
1
2
3
4
5
6
7
8
9
10

Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.

=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=

4
5
5
3
4
5
4
5
5
5
6
4
5
3
5
3
4
4
4
2

4,5
4
4,5
4,5
5
5
4
4
4
3

Terendah

f. Self 3 complementary pada pasangan primer 10 merupakan yang


terendah, meski nilai rata-ratanya sama dengan pasangan primer
nomor 9. Karena pasangan primer nomor 9 memiliki nilai
kemungkinan pembentukan self complementary atau hairpin lebih
besar dari pasangan nomor 10, maka pasangan nomor 10 lebih
unggul dari pasangan nomor 9 dalam hal efektivitas dan efisiensi

reaksi. Memiliki nilai terendahberarti kemungkinan terjadinya


primer-dimer pada reaksi dengan primer 10 cukup kecil dibanding
pasangan primer lain. Karena primer-dimer menurunkan efektivitas
reaksi, maka nilai kemungkinan munculnya primer-dimer harus
ditekan serendah mungkin agar reaksi berjalan efektif dan efisien.
Pasangan
Self
Rata-Rata
Keterangan
Primer
Complementary
1
2
3
4
5
6
7
8
9
10

Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.
Forw.
Revs.

=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=
=

1
3
1
3
3
3
2
1
3
1
2
2
3
1
0
3
2
0
1
1

2
2
3
1,5
2
2
2
1,5
1

Terendah

Terendah

Namun, analisis poli-X menunjukkan keberadaan poli-G dan poli-purin


pada pasangan primer. Poli-G dapat menurunkan spesifisitas pasangan
primer karena dapat berikatan kuat dengan sekuens nontarget dan
pemutusan ikatannya memerlukan energi tinggi. Pada sekuens juga
teramati poli-purin berupa deretan basa nitorgen A-G yang beresiko
membuat bentuk produk tampak sebagai dobel heliks yang ganjil
(Judelson, 2006). Untuk mencegah hal tersebut, maka perlu dipilih primer
dengan spesifikasi tidak jauh berbeda dengan pasangan primer 10 namun
tidak memiliki banyak poli-X. Pasangan primer tersebut adalah pasangan
primer 9.
Pasangan primer 9 memiliki Tm =1,55C. Selisih tersebut masih di
bawah nilai 5C sehingga dapat diabaikan dan waktu serta temperatur
penempelan primer dapat dianggap sama. Pasangan primer ini terdiri atas
20 nukleotida, dan dengan analisis yang sama, sepadan dengan pasangan
primer 10. Produk yang dihasilkan memiliki panjang 306 bp, sama dengan
panjang produk pasangan primer 10 sehingga kualitas produk yang
dihasilkan sama. %GC untuk setiap primer berada dalam rentang ideal
sehingga kemungkinan terjadinya breath, lepasnya primer dari template,

dan penurunan efisiensi reaksi setiap siklus akibat kuatnya ikatan primer
dengan template dapat dihindari. Meskipun memiliki kemungkinan
terbentuknya hairpin lebih tinggi dari pasangan primer 10, pasangan
primer 9 masih memiliki kemungkinan terbentuknya hairpin relatif lebih
rendah dari pasangan primer lain. Kemungkinan pembentukan primerdimer pasangan primer ini sama dengan pasangan primer 10. Ditambah
lagi, pasangan primer 9 memiliki poli-G, poli-T, dan poli-purin yang lebih
sedikit dari pasangan primer 10 sehingga kemungkinan terjadinya
penempelan acak, breath, dan bentuk dobel heliks yang ganjil lebih
rendah dari pasangan primer 10. Artinya, secara umum, kualitas primer 9
lebih baik dari kualitas primer 10.
Berdasarkan analisis tersebut, dapat disimpulkan bahwa pasangan
primer 9 merupakan pasangan primer terbaik yang dapat digunakan
untuk mengamplifikasi sekuens 2 menggunakan PCR.
Sebenarnya, dalam analisis pemilihan primer, data-data seperti G,
%stabilitas, analisis sticky end, dll. diperlukan untuk menunjang
keakuratan pemilihan primer. Data-data tersebut disediakan oleh program
analisis primer berbayar seperti OligoTM (Judelson, 2006). Dengan
menggunakan program seperti OligoTM, energi yang dibutuhkan untuk
keberlangsungan suatu reaksi, stabilitas primer, analisis struktur sekunder
primer, dan prediksi bentuk akhir serta panjang produk dapat diketahui
dengan jelas. Akibatnya, primer yang dipilih memiliki kualitas lebih baik
dibanding primer yang dipilih dengan analisis manual nonkuantitatif
(Judelson, 2006).

Daftar Pustaka
Judelson, H. 2006. Primer Guidelines. [Online]
http://oomyceteworld.net/protocols/primer%20designing2.pdf, diakses
tanggal 26 September 2015.
NEB. 2015. Guidelines for PCR Optimization with OneTaq and OneTaq Hot
Start DNA Polymerases. [Online] https://www.neb.com/tools-andresources/usage-guidelines/guidelines-for-pcr-optimization-with-onetaq-andonetaq-hot-start-dna-polymerases, diakses tanggal 25 September 2015.
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T.L.
2012. Primer-BLAST: A tool to design target-specific primers for polymerase
chain reaction. BMC Bioinformatics, 13, 134.