Anda di halaman 1dari 14

MAKALAH BIOTEKNOLOGI FARMASI

HUMAN PAPILLOMA VIRUS (HPV) VACCINES

Oleh:
1.
2.
3.
4.

R. Ayu Rifqa Zainatul H


Kirana Rifrianasari
Fitri Wulan
Via Lachtheany

132210101089
132210101091
132210101093
132210101097

FALKUTAS FARMASI
UNIVERSITAS JEMBER
2015
KATA PENGANTAR

Puji syukur kami panjatkan kepada Tuhan, karena atas berkat dan rahmat-Nya makalah ini
dapat terselesaikan sesuai dengan waktu yang telah ditentukan. Makalah ini adalah sebagai
salah satu tugas mata kuliah Bioteknologi dengan judul makalahnya yaitu Human
PapillomaVirus (HPV) Vaccines
Dalam kesempatan ini tidak lupa kami ucapkan terima kasih kepada :
1. Tuhan Yang Maha Esa.
2. Ibu Evi Umayah Ulfa S.farm., M.Si., Apt. selaku dosen mata kuliah Bioteknologi
yang telah memberi materi perkuliahan dengan sangat baik.
3. Teman-teman yang telah banyak membantu dalam penyusunan makalah ini.
Kami menyadari sepenuhnya bahwa makalah ini masih banyak kekurangannya baik dari
segi isi, penampilan maupun teknik pengetikannya. Oleh karena itu kami mengharapkan kritik
dan saran-saran yang sifatnya membangun demi perbaikan dan penyempurnaan makalah ini
selanjutnya.
Akhirnya kami mengharap agar makalah ini dapat menjadi sumbangan ilmu
pengetahuan bagi rekan-rekan yang lain dan juga dapat menambah pengetahuan kita.

Jember, Mei 2015

Penyusun

BAB I
PENDAHULUAN

1.1 Latar Belakang


Bioteknologi mengacu pada penerapan sistem biologi, organisme hidup atau
turunannya dalam membuat atau memodifikasi produk atau proses untuk penggunaan khusus.
Bioteknologi digunakan di berbagai bidang termasuk pertanian, ilmu makanan dan
Pharmaceutical. Perusahaan farmasi menggunakan bioteknologi untuk obat manufaktur,
pharmacogenomics, terapi gen dan pengujian genetik. Bioteknologi perusahaan membuat
produk bioteknologi (lebih spesifik kata produk farmasi biotek) dengan memanipulasi dan
memodifikasi organisme, biasanya pada tingkat molekul. Bioteknologi farmasi perusahaan
menggunakan teknologi DNA rekombinan, yang memerlukan manipulasi genetik sel atau
antibodi monoklonal untuk membuat produk bioteknologi mereka. Produk-produk farmasi
biotek yang dibuat oleh perusahaan-perusahaan biotek yang banyak digunakan dalam
pencegahan, diagnosis atau pengobatan berbagai jenis penyakit tentunya agar kita selalu
menerapkan healthy lifestyle kita agar menjadi lebih baik lagi.
Formulasi farmasi konvensional adalah molekul relatif sederhana diproduksi
terutama melalui teknik trial and error untuk mengobati gejala-gejala penyakit atau penyakit.
Di sisi lain, biopharmaceuticals adalah molekul biologis yang kompleks, yang umum dikenal
sebagai protein, yang biasanya bertujuan menghilangkan mekanisme yang mendasari untuk
mengobati penyakit. Namun, hal ini tidak benar dalam semua kasus seperti dalam kasus
diabetes mellitus tipe 1 di mana insulin hanya digunakan untuk mengobati gejala-gejala
penyakitnya dan bukan penyebab utama. Bioteknologi farmasi pada dasarnya, adalah
digunakan untuk membuat molekul yang lebih besar yang kompleks dengan bantuan sel-sel
hidup (seperti yang ditemukan dalam tubuh manusia seperti sel-sel bakteri, ragi sel, hewan
atau tumbuhan sel). Tidak seperti molekul kecil yang diberikan kepada pasien melalui tablet,
molekul besar yang biasanya disuntikkan ke dalam tubuh pasien.
Ketika dua disiplin-farmasi dan bioteknologi-datang bersama-sama, mereka
menghasilkan banyak keuntungan bagi manusia dalam hal kesehatan. Hal ini dimungkinkan
melalui Pharmacogenomics (berasal dari 'farmakologi' dan 'genomics') yang merujuk kepada
studi tentang bagaimana warisan genetik mempengaruhi respon tubuh manusia individu untuk
obat. biofarmasi obat bertujuan untuk merancang dan memproduksi obat-obatan yang
disesuaikan dengan genetik masing-masing orang. Dengan demikian perusahaan bioteknologi
farmasi dapat mengembangkan obat-obatan khusus dibuat untuk efek terapi yang maksimal.
Selain itu, obat-obatan bioteknologi dapat diberikan kepada pasien dalam dosis yang tepat
sebagai dokter akan tahu genetika pasien dan bagaimana proses dan tubuh memetabolisme

obat. Salah satu manfaat lebih dari bioteknologi farmasi adalah dalam bentuk vaksin yang
lebih baik. Biotek perusahaan desain dan memproduksi vaksin yang lebih aman oleh
organisme yang ditransformasi melalui rekayasa genetik. Vaksin-vaksin biotek meminimalkan
risiko infeksi.
Sementara, Produk bioteknologi farmasi lain yang dibuat oleh perusahaan farmasi
biotek mencakup, Antibodi, Protein dan DNA rekombinan Produk.
Human Papillomavirus (HPV) Vaccines merupakan salah satu vaksin yang sedang
banyak digunakan di Amerika Serikat. Terdapat dua jenis vaksin HPV yang sedang
dikembangkan dan disetujui di Amerika Serikat bahkan juga negara lainnya. Kedua vaksin
tersebut berdasarkan rekombinan virus seperti partikel dari protei HPV L1 (VLP), komponen
L1 dari membran kapsid terluar virus yang secara alami merakit sendiri untuk membentuk
partikel mirip dengan struktur kapsid terluar dari HPV.
Human Papilloma Virus (HPV) termasuk golongan pavovavirus yang merupakan virus
DNA yang dapat bersifat memicu terjadinya perubahan genetik. HPV berbentuk ikosahedral
dengan ukuran 50-55 nm, 72 kapsomer, dan 2 protein kapsid. HPV merupakan suatu virus
yang bersifat non enveloped yang mengandung double stranded DNA. Virus ini juga
bersifat epiteliotropik yang dominan menginfeksi kulit dan selaput lendir dengan karakteristik
proliferasi epitel pada tempat infeksi. Infeksi virus HPV telah dibuktikan menjadi penyebab
lesi prekanker, kondiloma akuminata, dan kanker. Meskipun HPV menyerang wanita, virus ini
juga mempunyai peran dalam timbulnya kanker anus, vulva, vagina, penis dan beberapa
kanker orofaring.
Virus ini menginfeksi membran basalis pada daerah metaplasia dan zona transformasi
serviks. Setelah menginfeksi sel epitel serviks sebagai upaya untuk berkembang biak, virus ini
akan meninggalkan sekuensi genomnya pada sel inang. Genom HPV berupa episomal (bentuk
lingkaran dan tidak terintegrasi dengan DNA inang) dijumpai pada Carcinoma Insitu (CIN)
dan berintegrasi dengan DNA inang pada kanker invasif. Pada percobaan invitro HPV terbukti
mampu mengubah sel menjadi immortal.
Cervarix dari Glaxo Smith Kine merupakan vaksin dwivalen (dua antigen) yang
mengandung rekombinan sel serangga (sistem vektor baculovirus). Protein kapsid HPV L1
berasal dari HPV tipe 11 dan HPV tipe 16, sehinggatersedia agen proteksi bagi untai HPV
yang berasosiasi dengan kanker servik.
Gardasil dari Merck merupakan vaksin quadravalen (empat antigen) yang tersusun dari
protein kapsid rekombinan HPV L1 berdasarkan VLPs dari empat untai berbeda dari HPV
(HPV-6, HPV-11, HPV-16, dan HPV-18) diekspresikan oleh Saccharomyces cereviciae

(yeast), sehingga dapat menyediakan agen proteksi pada untai HPV yang berasosiasi dengan
dua kanker yaitu kanker servik dan kelamin.
Banyak sekali beberapa perusahaan dari beberapa negara yang mengembangkan vaksin
dari HPV ini, terlebih pada industri farmasi di Amerika Serikat terlihat dari luasnya
pemasaran dengan dukungan R&D yang profesional.
1.2 Rumusan Masalah
1. Bagaimana gen pengkode vaksin Human Papillomavirus (HPV)?
2. Bagaimana kondisi kloning vaksin Human Papillomavirus (HPV)?
3. Bagaimana mekanisme kerja vaksin Human Papillomavirus (HPV) ?
4. Bagaimana proses produksi vaksin Human Papillomavirus (HPV)?
5. Bagaimana proses purifikasi dan pengemasan produk vaksin Human Papillomavirus
(HPV) ?
1.3 Manfaat
1. Untuk mengetahui gen pengkode vaksin Human Papillomavirus (HPV).
2. Untuk mengetahui kondisi kloning vaksin Human Papillomavirus (HPV).
3. Untuk mengetahui mekanisme kerja vaksin Human Papillomavirus (HPV).
4. Untuk mengetahui proses produksi vaksin Human Papillomavirus (HPV).
5. Untuk mengetahui proses purifikasi dan pengemasan produk vaksin Human
Papillomavirus (HPV).

BAB II
PEMBAHASAN
2.1 Gen Pengkode Vaksin HPV
Pada vaksin HPV Cervarix gen yang disisipkan adalah gen pengkode protein
L1. Protein L1 merupakan protein yang berfungsi dalam pembentukan kapsid bagi
Human Papiloma Virus atau sering disebut mayor viral coat protein. Gen pengkode
protein

L1

memiliki

sekuen

DNA

yang

5CCACATGTCTCTTTGGCTGCCTAGCG-3

mengkode
dan

protein

L1

adalah

5-GCGGCCGCTCGA

GTTACAGCTTAC GTTTTTTGC-3. (San Milln, Sebastin, Nuez, Veramendi, &


Escribano, 2009).
Vektor kloning yang digunakan sebagai media agar target DNA dapat
diperbanyak untuk selanjutnya diekspresikan menjadi protein yang diinginkan adalah
pGEM-T. Kemudian enzim restriksi yang digunakan adalah AfI1 dan NotI. Setelah
itu, plasmid kloning dimasukan ke dalam E. Coli.(Deschuyteneer et al., 2010; San
Milln et al., 2009).
Sementara vektor ekspresi yang digunakan adalah Autographa californica
nucleopolyhedrovirus (AcMNPV) yang merupakan jenis Baculovirus Expressing
sistem. Baculovirus Exspresssing Vector System merupakan virus yang menginfeksi
serangga, salah satu protein penting yang disandi oleh genom virus ini adalah
polihedrin, yang akan terakumulasi dalam jumlah sangat besar didalam nuclei sel-sel
serangga yang diinfeksi karena gen tersebut mempunyai promoter yang sangat aktif.
Promoter ini dapat digunakan untuk memacu overekspresi gen-gen asing yang diklon
ke dalam genom baculovirus sehingga akan diperoleh produk protein yang sangat
banyak jumlahnya di dalam kultur sel-sel serangga yang terinfeksi. Nantinya protein
yang diekspresikan dalam sel serangga akan dimurnikan dan berubah menjadi VLP
(Virus Like Partikel).(Deschuyteneer et al., 2010).
Baculovirus tersebut akan diekspresikan didalam sel serangga (Eukaryota)
yaitu Trichoplusia nii. Lebih tepatnya diinfeksikan ke sel Trichoplusia nii Hi-5
Rix4446. Penggunaan organisme eukaryota pada pengekspresian protein tersebut
karena dengan diproduksi pada sel insecta maka akan menghasilkan vaksin dengan
imun respon humoral yang lebih baik dan lebih tinggi serta jumlah yang lebih banyak.
(Deschuyteneer et al., 2010).
Human Papilloma Virus (HPV) (Rekombinan) merupakan rangkaian yang
dimodifikasi dengan 3-monophosphoryl lipid A (MPL) yang telah dihilangkan kadar
keasamannya ditambah adjuvant (zat yang dapat meningkatkan respon kekebalan
tubuh terhadap antigen) aluminum [AS(04)].
Pembuatan vaksin ini menggunakan prinsip pengekspresian gen L1 menjadi
Kapsid yang kosong (Virus Like Partikel). Di mana telah kita ketahui L1 berfungsi
dalam membentuk kapsid dari HPV16.
HPV-16 L1 cDNA diisolasi terlebih dahulu dari virus HPV. Gen L1 ini
diamplifikasi dengan PCR dengan primer 5CCACATGTCTCTTTGGCTGCCTAG
CG-3 dan 5-GCGGCCGCTCGAGTTACAGCTTACG TTTTT TGC-3. Gen L1
kemudian disisipkan pada vektor klonning pGEM-T yang dimasukkan ke bakteri
E.coli untuk memastikan protein yang diisolasi sudah benar. Kemudian gen disisipkan

pada vektor ekspresi Autographa californica nucleopolyhedrovirus (AcMNPV) (salah


satu jenis dari vektor baculovirus) dengan enzim restriksi AfI1 dan NotI. Kemudian
setelah vektor tersisipi oleh gen L1, vector baculovirus dimasukkan ke dalam sel
insekta yaitu Trichoplusia ni yakni pada sel Hi-5 Rix4446. Setelah menginfeksi sel
serangga, salah satu protein penting yang disandi oleh genom virus ini adalah
polihedrin, yang akan terakumulasi dalam jumlah sangat besar didalam nuclei sel-sel
serangga yang diinfeksi karena gen tersebut mempunyai promoter yang sangat aktif.
Promoter ini dapat digunakan untuk memacu overekspresi gen-gen asing yaitu
gen L1 yang diklon ke dalam genom baculovirus sehingga akan diperoleh produk
protein L1 yang sangat banyak jumlahnya di dalam kultur sel-sel serangga yang
terinfeksi. Selanjutnya dilakukan ekstraksi untuk mengeluarkan protein L1 yang sudah
diekspresikan. Protein ini akan menjadi VLP (Virus Like Partikel) yang berupa kapsid
virus kosong dimana didalamnya tidak terdapat materi genetik virus.
2.2 Kondisi Kloning Vaksin HPV
Vaksin yang digunakan untuk mencegah kanker serviks adalah vaksin HPV, yang
pertamakali di temukan dan dikenalkan oleh Profesor lan frazer dari Australia tahun
2006. Setelah melewati riset yang cukup panjang, akhirnya pada 29 Juni 2006, U.S
Food and Drug Administration (FDA) mengesahkan vaksin pertama dalam mencegah
kanker servik dan penyakit lain yang terkait dengan HPV. Vaksin ini dikenal dengan
sebutan quadrivalent vaccine, efektif melawan 4 tipe HPV(6,11,16, 18), tipe yang
menyebabkan 70 % kanker servik dan 90% genital wart. Vaksin HPV merupakan vaksin
dengan teknologi rekombinan. Vaksin berisi VLP ( Virus Like Protein ) yang merupakan
kloning dari LI ( Viral Capsid gene) yang mempunyai sifat imunogenik kuat. Vaksin
HPV merupakan vaksin profilaksis bukan vaksin terapetik. Di Dunia Proporsi remaja
putri yang mendapatkan satu atau lebih dosis vaksin HPV hanya 49 %, dan proporsi
mendapatkan semua tiga dosis 32 % ( WHO, 2010 ).
Kanker serviks disebabkan oleh infeksi kronik human papillomavirus (HPV)
dengan genotipe HPV-16 sebagai HPV tersering yang menginfeksi epitel serviks.
Protein penyelubung virus yang disebut kapsid mayor (L1) mempunyai peranan penting
dalam menginfeksi epitel serviks. Gen diamplifikasi dengan polymerase chain reaction
menggunakan primer spesifik. Infeksi HPV-16 pada jaringan kanker dikonfirmasi
dengan menggunakan kit komersial untuk tes genotipe HPV. Fragmen L1 kemudian
diklon dan diinsersikan ke dalam pJET1.2/L1-16, kemudian dipotong dengan enzim
BamHI dan BgIII untuk kemudian divalidasi dan disekuensing. Hasil sekuensing

menunjukkan amplikon gen L1 HPV-16 sebesar 1.595 pasang basa. Analisis dari dua
amplikon gen L1 HPV-16 menggunakan software BIOEDIT dan Basic Local Alignment
Search Tool menunjukkan kesamaan ho mologi 99% dan 97% dengan sekuens L1 HPV16 asal Thailand yang terregistrasi pada GenBank.
2.3 Mekanisme Kerja Vaksin HPV
Vaksin HPV bekerja seperti imunisasi lain. Para peneliti berhipotesis bahwa
komponen permukaan yang unik dari HPV dapat membuat respon antibodi yang mampu
melindungi tubuh terhadap infeksi, dan komponen ini dapat digunakan untuk
membentuk dasar vaksin.
Komponen permukaan HPV dapat berinteraksi satu sama lain untuk membentuk
Virus-Like Partikel (VLP) yang tidak menular, karena mereka tidak memiliki DNA.
Namun, VLP ini dapat menempel pada sel-sel dan merangsang sistem kekebalan tubuh
untuk memproduksi antibodi yang dapat mencegah papillomavirus menginfeksi sel
dimasa mendatang.
Meskipun vaksin HPV dapat membantu mencegah infeksi HPV masa depan,
mereka tidak bisa membantu menghilangkan infeksi HPV yang ada. Artinya mereka
hanya berfungsi untuk mecegah terjadinya kanker serviks bukan untuk mengobati.
Vaksin bekerja dengan mengajari sistem kekebalan tubuh untuk mengenali dan
menyerang bakteri atau virus yang dapat menyebabkan penyakit dalam badan manusia.
Semua perempuan mulai usia 9 tahun. Ada juga ahli yang bilang, semua perempuan
dibawah 27 tahun. Untuk yang usianya lebih dari 27 tahun berkonsultasilah dulu ke
dokter Spesialis Kebidanan dan penyakit Kandungan,untuk pemeriksaan pre-vaksinasi.
Vaksinasi HPV diberikan melalui suntikan sebanyak 3 kali dengan jarak antara
suntikan pertama dengan ke dua 1 bulan dan jarak antara suntikan ke dua dengan
suntikan ke tiga adalah enam bulan sesudahnya.
Vaksin HPV didesain untuk mencegah infeksi oleh HPV tipe 6, 11, 16, dan 18.
Sayangnya, terdapat banyak tipe lain yang dapat menyebabkan kanker serviks dan juga
kutil didaerah kelamin serta perubahan pra kanker yang lain dari leher rahim, vagina,
atau pukas, dengan alasan itu, tes Pap masih direkomendasikan sebagai metode
pemeriksaan dini untuk penyakit.
2.4 Proses Produksi Vaksin HPV
Vaksin HPV sebagai vaksin kanker serviks adalah vaksin kedua di dunia yang dapat
mencegah terjadinya kanker. Sebelumnya terdapat vaksin hepatitis B untuk mencegah
kanker hati. Teknologi untuk memproduksi vaksin HPV adalah rekombinan DNA.

Proses produksinya adalah diawali dengan proses fermentasi yang melibatkan


pertumbuhan independen dari S.cerevisiae, bergabung dengan masing-masing HPV
strain Protein L1 pada media kimia yang meliputi vitamin, asam amino, garam mineral,
dan karbohidrat.
VLP dilepaskan dari sel-sel ragi dengan menghancurkan

sel dan kemudian

dimurnikan dengan serangkaian metode kimia dan fisik. VLP yang telah dimurnikan,
diserap pada alumunium preformed yang mengandung ajuvan (aluminium amorf
hydroxyphosphate sulfat; tawas). Quadrivalent vaksin HPV VLP adalah suspensi cair
steril disiapkan dengan menggabungkan VLP yang terserap dari setiap jenis HPV dan
jumlah tambahan dari alumunium yang mengandung ajuvan dan kemudian diakhiri
dengan pemurnian buffer.

2.5 Proses Purifikasi dan Pengemasan Produk Vaksin HPV


2.5.1 Proses Purifikasi Vaksin HPV
Untuk mendapatkan vaksin HPV (pemurnian / purifikasi) dilakukan dengan
beberapa cara, sesuai dengan sumber atau vektor penghasil vaksinnya anntara lain
(Perez-Filgueira et al., 2006) :
Sel Serangga
Proses pemurnian vaksin HPV yang diperoleh dari sel serangga
dilakukan dengan cara:Sel serangga yang masih dalam tahap berkembang
diberikan 50 mg / mL gentamisin, 50 unit / MLE penisilin dan 50 mg / mL
streptomisin. masukkan dalam labu ukur 75ml Kemudian pellet yang
dihasilkan disentrifugasi dalam 1000g selama 5 menit. 500 mg pellet yang
telah terinfeksi sel serangga diresuspensi dalam 8 mL PBS-HS dan disonikasi
selama 2 menit.

Sel-sel yang sudah resisten atau terekombinan terhadap

antibiotik tersebut, pelletnya disentrifugasi pada 1000 g selama 5 menit.


Sedangkan untuk ekstrak dilakukan dengan penambahan sukrosa 40% dan
disentrifugasi dalam

rotor ayun (Kontron TST4114) selama 2 jam pada

140000 g pada 40 C. Pelet yang dihasilkan diresuspensi dalam CsCl pada


larutan PBS-HS dan disentrifugasi selama 20 jam pada 260.000 g dalam ember
berayun rotor pada 100 C. Fraksi yang dihasilkan diukur dengan refraktometer.
Larva

Untuk mengekstraksi vaksin HPV dari larva, dilakukan dengan cara:


500mg larva ditambahkan dengan 8mL PBS-HS kemudian dihomogenisasi
dengan blender dan disonikasi selama 2 menit. Selanjutnya disentrifugasi
dalam 20000gr selama 5 menit pada suhu 4 derajat celcius. Supernatan yang
dihasilkan ditambahkan dengan sukrosa 40%. Proses selanjutnya dilakukan
sama seperti pemurnian vaksin HPV pada sel serangga.

Mikroskop elektron dan pelabelan immunoglobulin


Sampel fraksi dinyatakan positif apabila dalam gradient CsCl yang
didialisis dengan PBS-HS mengambang pada filter (ukuran pori 0.2 um,
Millipore). Sehingga sampel harus ditempatkan ke grid tembaga yang berlapis
karbon (ukuran 400 jala), ditutupi dengan membran Formvar dan diwarnai
dengan uranil asetat 1% selama 1 menit. Sampel diperiksa di bawah Zeiss EM
910 Transmisi Mikroskop Elektron (TEM) yang beroperasi pada 60 dan 80
kV.

Analisis perakitan L1 dengan pengendapan sukrosa


Untuk mengidentifikasi bentuk perakitan dari L1, ekstrak yang larut
dari sel serangga dan larva disiapkan untuk keperluan Blotting Barat. Sampel
dimasukkan ke dalam gradient yang berupa sukrosa. Setelah 2 jam sampel
disentrifugasi pada 150.000 g dalam ember rotor berayun, ditentukan
densitasnya dengan refraktometri dan dianalisis dengan ELISA Vir-1 Antibodi
Cam (Abcam). Hasil sedimentasi L1 dikalibrasi dengan katalase hati sapi
sebagai penandanya. Sapi tersebut diimunisasi secara injeksi intraperitoneal
dengan CsCl dari larva yang telah dimurnikan (menggunakan Adjuvant
Freund lengkap). Serum yang dihasilkan selanjutnya dititrasi dengan VLPs
yang telah dimurnikan (Gardasil, Merck) dengan ELISA di piring microtitre
pada 40 C dan diencerkan dengan PBS (pH 7,4). Tahapan yang terakhir
dilakukan adalah piring diinkubasi selama 1 jam pada 37 0 C dengan anti-IgG
dari kambing (antibodi horseradish peroksidase yang terkonjugasi). Tahap
pencucian dalam analisis perakitan L1 ini harus dilakukan setiap langkah
ketika menggunakan PBS-T. Sehingga bisa didapatkan absorbansi pada
panjang gelombang 405 nm yang diukur dengan pembacaan plat pada
mikrotiter. Titer antibodi dinyatakan sebagai pengenceran serum tertinggi

yang dapat menghasilkan dua kali absorbansi yang merata untuk serum praimun.
2.5.2 Pengemasan Produk Vaksin HPV
GARDASIL

Pabrik

Merck Sharp & Dohme

Komposisi

Quadrivalent human papillomavirus (types 6, 11, 16, 18) recombinant vaccine.

Indikasi

Pencegahan displasia serviks derajat tinggi (CIN 2/3), karsinoma serviks, lesi
displastik vulva derajat tinggi (VIN 2/3) & kondiloma akuminata yang
berhubungan dengan HPV tipe 6, 11, 16 & 18.

Dosis

3 dosis terpisah, masing-masing 0.5 mL secara IM, diberikan pd bulan ke 0, 2


& 6.

Kontra Indikasi

Penyakit febris akut berat. Hipersensitivitas.

Perhatian Khusus Penyakit menular seksual. Tidak untuk pengobatan kanker serviks, lesi serviks,
vulva & displastik vagina derajat tinggi atau kondiloma akuminata & untuk
pencegahan timbulnya lesi lain yang berhubungan dengan HPV.
Trombositopenia atau ggn koagulasi darah. Individu dg ggn respon imun.
Vaksinasi hrs ditunda selama hamil.
Reaksi Simpang
Obat

Sakit kepala, demam, mual, pusing; reaksi lokal pd tempat inj.


Lihat Formulir Pemantauan Reaksi Simpang Obat

Interaksi Obat

Vaksin & imunosupresan lain.

Kategori
Kehamilan (US
FDA)

Hati-hati untuk
Penggunaan

Kategori B: Studi terhadap reproduksi pada binatang percobaan tidak


memperlihatkan adanya risiko terhadap janin tetapi tidak ada studi terkontrol
yang dilakukan terhadap wanita hamil, atau studi terhadap reproduksi binatang
percobaan memperlihatkan adanya efek samping (selain penurunan fertilitas)
yang tidak dikonfirmasikan dalam studi terkontrol pada wanita pada kehamilan
trimester 1 (dan tidak ada bukti risio pada trimester selanjutnya).
For caution against possible variation of physical aspect of medicine.

Penyimpanan

Lihat informasi mengenai penyimpanan Gardasil secara rinci untuk


memastikan waktu simpan yang optimal.

Kelas MIMS

Vaksin, Antiserum, & Imunologikal

Klasifikasi Obat

Sediaan/Kemasan
Form

Packing/Price

Gardasil vaccine 0.5 mL

(pre-filled syringe) 0.5 mL x 1's (Rp928,125/pre-filled syringe)

Pabrik:

Merck Sharp & Dohme

CERVARIX

Cervarix merupakan jenis vaksin bivalen HPV 16/18 L1 VLP vaksin yang diproduksi
oleh Glaxo Smith Kline Biological, Rixensart, Belgium. Pada preparat ini, Protein L1 dari
HPV diekspresikan oleh vektor rekombinan baculovirus dan VLP dari kedua tipe ini
diproduksi yang kemudian dikombinasikan sehingga menghasilkan suatu vaksin yang sangat
merangsang sistem imun . Preparat ini diberikan secara intramuskuler dalam tiga kali
pemberian yaitu pada bulan ke 0, kemudian diteruskan bulan ke 1 dan ke 6 masing-masing
0,5 ml.
Vaksin ini diberikan dengan cara intramuskuler 0,5 cc diulang tiga kali, produk
Cervarix diberikan bulan ke 0,1 dan 6 sedangkan Gardasil bulan ke 0, 2 dan 6 (Dianjurkan
pemberian tidak melebihi waktu 1 tahun). Pemberian booster (vaksin ulangan), respon
antibodi pada pemberian vaksin sampai 42 bulan, untuk menilai efektifitas vaksin diperlukan

deteksi respon antibodi. Bila respon antibodi rendah dan tidak mempunyai efek penangkalan
maka diperlukan pemberian Booster.

BAB III
PENUTUP

3.1 Kesimpulan
Dari hal-hal yang sudah disampaikan diatas dapat disimpulkan bahwa :
1. Human Papilloma Virus (HPV) Vaccines merupakan salah satu vaksin yang
termasuk golongan pavovavirus yang merupakan virus DNA yang dapat bersifat
memicu terjadinya perubahan genetik.
2. Vaksin HPV berisi VLP ( Virus Like Protein ) yang merupakan kloning dari LI
( Viral Capsid gene) yang mempunyai sifat imunogenik kuat.
3. Vaksin ini dikenal dengan sebutan quadrivalent vaccine, efektif melawan 4 tipe
HPV(6,11,16, 18), tipe yang menyebabkan 70 % kanker servik dan 90% genital
wart.
4. Untuk mendapatkan vaksin HPV (pemurnian / purifikasi) dilakukan dengan
beberapa cara, sesuai dengan vektor penghasil vaksinnya anntara lain sel
serangga, larva, Analisis perakitan L1 dengan pengendapan sukrosa dan
Mikroskop elektron dan pelabelan immunoglobulin.
5. Gardasil dan Cervarix sangat efektif dalam mencegah infeksi dengan jenis HPV
yang targetkan.

DAFTAR PUSTAKA

Deschuyteneer, M., Elouahabi, A., Plainchamp, D., Plisnier, M., Soete, D., Corazza, Y.,
Lockman, L., Giannini, S., & Deschamps, M. 2010. Molecular and structural
characterization of the L1 virus-like particles that are used as vaccine antigens in
CervarixTM, the AS04-adjuvanted HPV-16 and -18 cervical cancer vaccine. Landes
Bioscience, 6(5): 407419.
Ernndez San Milln, A., Gmez Sebastin, S., Nez, M. C., Veramendi, J., & Escribano, J.
M. 2010. Human papillomavirus-like particles vaccine efficiently produced in a nonfermentative system based on insect larva.
Gondo, Harry Kurniawan. Vaksin dan Human Papiloma Virus (HPV) untuk Pencegahan
Kanker Serviks Uteri. Surabaya : Fakultas Kedokteran wijaya Kususma.
Purnadanti, Sinta. 2012. Ekspresi Protein Fusi E6/GFP dan E7/GFPpada Sel HeLa. Skripsi.
Tidak Diterbitkan. Depok : Fakultas Matematika dan Ilmu Pengetahuan Alam Program
Studi Biologi Universitas Indonesia