Anda di halaman 1dari 9

Tugas Bioinfo

Nama : Tyas Arum Widayati


NIM

: 10612031

1. Hasil dari pencarian complete genome dari Hepatitis B Virus pada NCBI adalah sebagai
berikut:

2. Pada sekuens genom Hepatitis B Virus tersebut, terdapat gen pengkode L-HBsAG; LHB; large
surface protein HbsAg. Gen pengkode tersebut adalah gen S. Letak gen tersebut berada
pada basa 2848 3215 serta 1 835 (DNA berbentuk sirkular).

3. Primer yang dianggap paling baik untuk mengamplifikasi Gen S adalah:


Primer forward: tgtgggtcaccatattcttgg (start: 2811 2832)
Primer reverse: gccccaacgtttggttttat (start: 862 842)
Langkah Kerja

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Sesuai dengan poin 2, gen yang akan diamplifikasi adalah gen S. Gen S tersebut terletak pada
basa 2848 3215 dan 1 835. Oleh karena itu, dalam pembuatan primer, pertama-tama
dilakukan pencarian coding sequence dari gen tersebut. Coding sequence dari gen S adalah
sebagai berikut:

Pembuatan primer dilakukan dengan aplikasi Primer3Plus dari


http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi. Pada query sekuens gen
yang akan dibuat primernya, diisi dengan coding sequence gen S (dimulai dari basa 2848
3215 lalu 1 835) kemudian ditambahkan dengan 37 bp sekuens yang berada sebelum dan
sesudah sekuens gen tersebut. Penambahan 37 bp sekuens ini bertujuan agar posisi primer
terletak sebelum sekuens gen pengkode. Dengan posisi primer tersebut, diharapkan primer
dapat menginisiasi polimerisasi DNA pengkode gen tersebut secara utuh. Apabila posisi

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

primer berada di tengah sekuens gen yang akan diamplifikasi, gen tersebut memiliki
kemungkinan akan teramplifikasi sebagian.
Sekuens yang dimasukkan: (bagian yang kuning adalah non-cds gen S

1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251

cgcctcattt tgtgggtcac catattcttg ggaacaagag ctacagcatg


ggaggttggt cttccaaacc tcgacaaggc atggggacga atctttctgt
tcccaatcct ctgggattct ttcccgatca ccagttggac cctgcgttcg
gagccaactc aaacaatcca gattgggact tcaaccccaa caaggatcac
tggccagagg caaatcaggt aggagcggga gcatttggtc cagggttcac
cccaccacac ggaggccttt tggggtggag ccctcaggct cagggcatat
tgacaacact gccagcagca cctcctcctg cctccaccaa tcggcagtca
ggaagacagc ctactcccat ctctccacct ctaagagaca gtcatcctca
ggccatgcag tggaactcca caacattcca ccaagctctg ctagatccca
gagtgagggg cctatatttt cctgctggtg gctccagttc cggaacagta
aaccctgttc cgactactgc ctcacccata tcgtcaatct tctcgaggac
tggggaccct gcaccgaaca tggagagcac aacatcagga ttcctaggac
ccctgctcgt gttacaggcg gggtttttct tgttgacaag aatcctcaca
ataccacaga gtctagactc gtggtggact tctctcaatt ttctaggggg
agcacccacg tgtcctggcc aaaattcgca gtccccaacc tccaatcact
caccaacctc ttgtcctcca acttgtcctg gctatcgctg gatgtgtctg
cggcgtttta tcatattcct cttcatcctg ctgctatgcc tcatcttctt
gttggttctt ctggactacc aaggtatgtt gcccgtttgt cctctacttc
caggaacatc aactaccagc acgggaccat gcagaacctg cacgattcct
gctcaaggaa cctctatgtt tccctcttgt tgctgtacaa aaccttcgga
cggaaactgc acttgtattc ccatcccatc atcctgggct ttcgcaagat
tcctatggga gtgggcctca gtccgtttct cctggctcag tttactagtg
ccatttgttc agtggttcgt agggctttcc cccactgttt ggctttcagc
tatatggatg atgtggtatt gggggccaag tctgtacaac atcttgagtc
cctttttacc tctattacca attttctttt gtctttgggt atacatttga
accctaataa aaccaaacgt tggggctact cccttaactt catggga

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Pemilihan 37 bp sebelum dan sesudah sekuens gen S diperoleh berdasarkan hasil uji coba.
Dengan penambahan 37 basa ini, diperoleh GC content yang paling mendekati 50%. Hasilnya
adalah sebagai berikut:

Primer ini dipilih berdasarkan ketercapaiannya parameter yang dimasukkan, walaupun tidak
ada yang mencapai optimal. Selain itu, dilakukan juga evaluasi menggunakan OligoEvaluator
(http://www.oligoevaluator.com/OligoCalcServlet) yang menunjukkan bahwa primer
forward memiliki GC content sebanyak 47.6%, GC Clamp 2, Run length 3 bp, Tm berdasarkan
primer3plus adalah 60.6C namun dari hasil evaluasi OligoEvaluator, Tm yang diperoleh
adalah 64.5C. Pada primer ini, struktur sekunder yang dapat muncul memiliki kekuatan
yang lemah dan tidak memiliki primer dimer.

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Reverse primer juga dianalisis menggunakan OligoEvaluator. Hasil yang diperoleh adalah GC
Clamp = 0, GC content 45%, panjang primer 20 bp, run length 4 bp, Tm berdasarkan
Primer3Plus adalah 60.9C dan berdasar OligoEvaluator yaitu 64.5C. Struktur sekunder yang
dapat terbentuk kekuatannya sedang dan tidak ada primer dimer.

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Berdasarkan PremierBiosoft (2015), kriteria primer yang baik adalah:


1. Memiliki GC Content sebesar 40%-60% dengan GC Content optimal 50%. Primer yang
diperoleh, baik forward maupun reverse, memiliki GC Content yang berada pada
rentang tersebut (forward: 47.6% dan reverse 45%, mendekati 50%).
2. Selain itu, GC Clamp yang diperoleh tidak boleh lebih dari 3, karena apabila melebihi 3,
maka basa G atau C pada 5 basa terakhir ujung 3 akan melipat sehingga ujung 3 tidak
berikatan dengan template.
3. Tm yang diperoleh berdasarkan Primer3Plus berada di sekitar 60C. Berdasarkan
PremierBiosoft (2015), Tm yang baik berada di range 52-58C. Berdasarkan Mullis et al.
(2012), Tm yang baik berada dalam range 52-60C. Tm dari primer yang diperoleh
berada di sekitar 60C sehingga masih mendekati suhu optimum. Walaupun terdapat
perbedaan dengan Tm pada OligoEvaluator, Tm yang diperoleh masih berada di bawah
65C. Apabila Tm berada di atas 65C, dapat terjadi secondary annealing.
4. Nilai run menurut PremierBiosoft (2015) maksimum yang dapat diterima adalah 4bp.
Nilai run length dari primer yang diperoleh adalah 3bp dan 4bp, sehingga masih berada
di dalam range yang dapat diterima. Apabila primer memiliki run length dari basa
tunggal yang panjang, dapat memungkinkan terjadinya misprime.
5. Panjang basa yang diperoleh sesuai dengan panjang basa optimal menurut
PremierBiosoft (2015) adalah 18-22bp. Panjang basa primer yang diperoleh masih
berada pada range, sehingga primer tersebut dapat dikatakan memiliki panjang basa
optimal untuk amplifikasi gen.
6. Struktur sekunder yang terdapat pada primer ini memiliki kekuatan lemah dan sedang.
Berdasarkan PremierBiosoft (2015), struktur sekunder sebaiknya dihidari karena
menunjukkan bahwa primer tidak stabil. Namun, karena kekuatan struktur primer ini
tidak kuat, maka primer ini masih dapat menjadi pilihan.
7. Uji spesifisitas: dari hasil uji spesifisitas, diperoleh hasil sebagai berikut:

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Tugas Bioinfo
Nama : Tyas Arum Widayati
NIM

: 10612031

Uji spesifisitas tersebut menunjukkan walaupun sekuens yang keluar dari hasil uji
spesifisitas ini tidak sama persis dengan Hepatitis B Virus Complete Genome yang
digunakan untuk membuat primer, namun beberapa hasil menunjukkan bahwa primer
ini dapat berikatan dengan S gene pada Hepatitis B Virus walaupun isolatnya berbeda.
Referensi
Mullis, B. K., F. Ferre, R. A. Gibbs. 2012. The Polymerase Chain Reaction. New York City:
Springer Science & Business Media
PremierBiosoft. 2015. PCR Primer Design Guidelines.
http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html (Diakses pada 28
September 2015 pukul 11.35)