Anda di halaman 1dari 95

UNIVERSITAS INDONESIA

KLONING GEN HUMAN INTERFERON ALPHA 2a PADA


VEKTOR pET-32b(+) DAN EKSPRESI PADA Escherichia coli

TESIS

ARIZAH KUSUMAWATI
1006787092

FAKULTAS FARMASI
PROGRAM S2 ILMU KEFARMASIAN
DEPOK
JANUARI 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

UNIVERSITAS INDONESIA

KLONING GEN HUMAN INTERFERON ALPHA 2a PADA


VEKTOR pET-32b(+) DAN EKSPRESI PADA Escherichia coli

TESIS

Diajukan sebagai salah satu syarat untuk memperoleh gelar Magister Farmasi

ARIZAH KUSUMAWATI
1006787092

FAKULTAS FARMASI
PROGRAM STUDI S2 ILMU KEFARMASIAN
DEPOK
JANUARI 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

KATA PENGANTAR

Puji syukur saya panjatkan kepada Allah SWT, karena atas berkat dan
rahmatNya, saya dapat menyelesaikan tesis ini. Penulisan tesis ini dilakukan
dalam rangka memenuhi salah satu syarat untuk mencapai gelar Magister Farmasi
pada Fakultas Farmasi Universitas Indonesia. Saya menyadari banyaknya bantuan
dan bimbingan dari berbagai pihak dari masa perkuliahan sampai pada
penyusunan tesis ini, sehingga tesis ini dapat terselesaikan. Oleh karena itu,
perkenankanlah saya dengan setulus hati mengucapkan rasa terima kasih yang
sebesar-besarnya kepada:
(1)

Prof. Dr. Maksum Radji, M.Biomed., Apt. dan Dr. Adi Santoso, M.Sc.,
selaku dosen pembimbing yang telah menyediakan waktu, tenaga, dan
pikiran untuk mengarahkan saya dalam penelitian dan penyusunan tesis ini;

(2)

Prof. Dr. Yahdiana Harahap, MS., Apt., selaku Dekan Fakultas Farmasi
Universitas Indonesia;

(3)

Prof. Dr. Effionora Anwar, MS., Apt., selaku Ketua Program Studi S2 Ilmu
Kefarmasian

Fakultas

Farmasi

Universitas

Indonesia

yang

telah

memberikan dorongan untuk menyelesaikan program S2 Ilmu Kefarmasian;


(4)

Dr. Amarila Malik, M.Si., Apt., Dr. Herman Suryadi, MS., Apt., dan Dr.
Mahdi Jufri, M.Si., Apt. selaku Dewan penguji yang telah banyak

memberikan

penilaian

maupun

saran-saran

untuk

perbaikan

dan

penyempurnaan tesis ini;


(5)

Pusat Penelitian Bioteknologi Lembaga Ilmu Pengetahuan Indonesia yang


telah memberikan kesempatan kepada saya untuk menjadi peserta tugas
belajar program pasca sarjana dan memfasilitasi saya demi kelancaran
penelitian tesis ini;

(6)

Kementerian Riset dan Teknologi yang telah memberikan bantuan dana


pendidikan kepada saya untuk dapat mengikuti program tugas belajar S2
Ilmu Kefarmasian di Universitas Indonesia;

(7)

Ayah, Ibu, Kakak, Mertua dan Suami yang senantiasa memberikan doa,
semangat dan kasih sayang kepada saya;

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

(8)

Teman-teman di Laboratorium Terapetik Protein dan Vaksin atas bantuan


yang telah diberikan selama melaksanakan penelitian di Pusat Penelitian
Bioteknologi LIPI;

(9)

Semua pihak yang telah memberikan bantuan hingga tesis ini dapat
diselesaikan.
Akhir kata, saya berharap Allah SWT berkenan membalas segala kebaikan

semua pihak yang telah membantu. Semoga tesis ini membawa manfaat bagi
pengembangan ilmu.
Depok, 2 Januari 2013
Penulis

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

ABSTRAK

Nama
Program Studi
Judul

: Arizah Kusumawati
: S2 Ilmu Kefarmasian
: Kloning Gen Human Interferon Alpha 2a pada Vektor
pET-32b(+) dan Ekspresi pada Escherichia coli

Interferon (IFN) merupakan sitokin yang diproduksi oleh berbagai tipe sel sebagai
respon rangsangan terhadap stimulasi virus, bakteri, parasit, sel tumor, atau
antigen lain. Interferon termasuk kelompok IFN tipe I yang mempunyai
berbagai efek biologis yang meliputi antiviral, antitumor dan juga sebagai
immunoterapetik. Penelitian ini bertujuan untuk mensintesis protein rekombinan
human IFN 2a melalui sistem ekspresi pada bakteria E. coli BL21(DE3). Pada
gen human ifn 2a dilakukan penambahan situs pemotongan enzim restriksi Nco I
dan Xho I menggunakan metode PCR, kemudian dilanjutkan dengan proses ligasi
ke vektor pET-32b(+) dan selanjutnya ditransformasikan pada E. coli DH5.
Hasil sekuensing menunjukkan bahwa vektor rekombinan (pET-32b(+)-IFN 2a)
memiliki urutan nukleotida yang benar. Vektor rekombinan ini selanjutnya
ditransformasikan ke dalam E.coli BL21(DE3). Klon transforman yang diperoleh
dikultur dan diinduksi dengan penambahan IPTG 1 mM sehingga
mengekspresikan protein rekombinan human IFN 2a. Dari hasil isolasi,
diperoleh protein rekombinan human IFN 2a dalam bentuk protein terfusi
sehingga mempermudah proses deteksi dan purifikasi. Protein dikarakterisasi
melalui metode SDS PAGE dilanjutkan dengan Western blot dan pewarnaan
CBB. Pita protein rekombinan human IFN2a yang diperoleh berukuran 36 kDa.
Hasil maksimal ditunjukkan ekspresi pada suhu 37C dengan waktu inkubasi 5
jam setelah induksi.
Kata Kunci
xiv+74 halaman
Daftar Pustaka

: Interferon, vektor pET-32b(+), E. coli DH5, E. coli


BL21(DE3).
: 34 gambar; 1 tabel; 5 lampiran
: 48 (1990-2011)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

ABSTRACT

Name
: Arizah Kusumawati
Study Program : Magister of Pharmacy
Title
: Cloning Human Interferon Alpha 2a Gene at pET-32b(+)
Vector and Expression in Escherichia coli
Interferon (IFN) is a cytokine produced by various cell types as a response of
stimulation to viruses, bacteria, parasites, tumor cells, or other antigens. Interferon
type I IFN groups have various biological effects, including antiviral, antitumor
and immunotherapeutic. The aim of this research is to synthesize recombinant
human IFN 2a proteins through bacterial expression systems in E. coli BL21
(DE3). Addition genes of human IFN 2a, which are restriction enzyme cutting
sites for Nco I and Xho I, are added through PCR method. This step is followed by
ligation process to the pET-32b(+) vector and then transformed into E. coli DH5.
The recombinant vector (pET-32b(+)-IFN 2a) has a nucleotide right sequence
after it was being sequenced, after was transformed into E. coli BL21 (DE3).
Obtained transformant clones were cultured and induced by addition of IPTG 1
mM to produce the expression of recombinant human IFN 2a proteins. As result
of isolation process, recombinant protein of human IFN 2a are collected in fused
protein thus can simplify the detection and purification method. The proteins are
characterized by the SDS PAGE method followed by Western blot and CBB
staining. The results show that the recombinant human IFN 2a protein bands are
exactly 36 kDa. The maximum expression results were obtained at 37C with 5
hours incubation after induction process.

Key Words
xiv+74 pages
Bibliography

: Interferon, pET-32b(+) vector, E. coli DH5, E. coli


BL21(DE3)
: 34 pictures; 1 tables; 5 appendices
: 48 (1990-2011)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

DAFTAR ISI

HALAMAN JUDUL ..........................................................................


i
HALAMAN PERNYATAAN BEBAS PLAGIARISME ...............................
ii
HALAMAN PERNYATAAN ORISINALITAS ...........................................
iii
HALAMAN PENGESAHAN ........................................................................
iv
KATA PENGANTAR .....................................................................................
v
LEMBAR PERSETUJUAN PUBLIKASI ...................................................... vii
ABSTRAK ....................................................................................................... viii
ABSTRACT ..................................................................................................... ix
DAFTAR ISI ...................
x
DAFTAR GAMBAR ........................... xii
DAFTAR TABEL ............................... xiv
DAFTAR LAMPIRAN ...................
xv
BAB 1 PENDAHULUAN ........................
1.1 Latar Belakang ............................
1.2 Rumusan Masalah ..................
1.3 Hipotesis .....................................................................................
1.4 Tujuan Penelitian ........................................................................
1.5 Manfaat Penelitian ......................................................................

1
1
2
2
3
3

BAB 2 TINJAUAN PUSTAKA .......................


2.1 Interferon .....................................................................
2.2 Kloning dan Isolasi DNA ............................................................
2.3 Vektor pET-32b(+) ......................................................................
2.4 Manipulasi Enzimatis DNA .........................................................
2.4.1 Enzim Endonuklease Restriksi ..........................................
2.4.2 Enzim DNA Ligase ...........................................................
2.4.3 Enzim DNA Polimerase ...................................................
2.5 Amplifikasi DNA .......................................................................
2.6 Analisis DNA .............................................................................
2.6.1 Pemisahan Menggunakan Gel ...........................................
2.6.2 Sekuensing DNA ...............................................................
2.7 Ekspresi Protein pada Escherichia coli ......................................
2.8 Analisis Protein ..........................................................................
2.8.1 Western Blot ......................................................................
2.8.2 Analisis Densitometri ........................................................

4
4
8
11
13
13
14
15
15
17
17
18
20
23
23
23

BAB 3 METODE PENELITIAN ...............................................................


3.1 Tempat dan Waktu .....................................................................
3.2 Bahan dan Alat ..........................................................................
3.2.1 Bahan ................................................................................
3.2.2 Alat ....................................................................................
3.3 Tahap Kerja .................................................................................
3.3.1 Penyiapan DNA Insert ......................................................
3.3.2 Penyiapan Vektor pET-32b(+) ..........................................

25
25
25
25
26
26
26
29

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

3.3.3 Pembuatan Sel Kompeten E. coli ......................................


3.3.4 Kloning Gen human ifn 2a ...........................................
3.3.5 Skrining dan Verifikasi Klon Transforman di E. coli
DH5 .................................................................................
3.3.6 Kultivasi dan Isolasi Vektor Rekombinan ........................
3.3.7 Transformasi Vektor Rekombinan ke E. coli
BL21(DE3) ........................................................................
3.3.8 Skrining dan Verifikasi Klon Transforman di E. coli
BL21(DE3) ........................................................................
3.3.9 Ekspresi, Isolasi dan Karakterisasi Protein Rekombinan
Human IFN 2a .................................................................

29
30
31
31
34
34
35

BAB 4 HASIL DAN PEMBAHASAN ........................................................


4.1 Penyiapan DNA Insert ................................................................
4.2 Penyiapan Vektor pET-32b(+) ..................................................
4.3 Kloning Gen human ifn 2a ....................................................
4.4 Skrining dan Verifikasi Klon Transforman di E. coli
DH5 ..........................................................................................
4.5 Kultivasi dan Isolasi Vektor Rekombinan ..................................
4.6 Transformasi Vektor Rekombinan ke E. coli BL21
BL21(DE3) .................................................................................
4.7 Skrining dan Verifikasi Klon Transforman di E. coli
BL21(DE3) .................................................................................
4.8 Ekspresi, Isolasi dan Karakterisasi Protein Rekombinan
Human IFN 2a ..........................................................................

39
39
42
44

BAB 5 KESIMPULAN DAN SARAN .........................................................


5.1 Kesimpulan .................................................................................
5.2 Saran ...........................................................................................

68
68
68

DAFTAR PUSTAKA ....................................................................................

69

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

46
48
53
54
56

DAFTAR GAMBAR

Gambar 2.1
Gambar 2.2
Gambar 2.3
Gambar 2.4
Gambar 4.1
Gambar 4.2
Gambar 4.3
Gambar 4.4
Gambar 4.5
Gambar 4.6
Gambar 4.7
Gambar 4.8
Gambar 4.9
Gambar 4.10

Gambar 4.11
Gambar 4.12
Gambar 4.13
Gambar 4.14
Gambar 4.15
Gambar 4.16

Gambar 4.17

Gambar 4.18
Gambar 4.19
Gambar 4.20
Gambar 4.21
Gambar 4.22

Mekanisme Aksi Interferon .............................................................


Jalur Jak-Stat ....
Gen human interferon 2a ...
Vektor pET-32b(+) ......................................................
Elektroforesis Hasil PCR untuk Penyiapan DNA Insert ...........
Elektroforesis Hasil Purifikasi Produk PCR dan Hasil
Pemotongan Ganda dengan Enzim Nco I dan Xho I .................
Elektroforesis Hasil Purifikasi Metode Fenol Kloroform
Setelah Pemotongan Ganda .......................................................
Elektroforesis Hasil Pemotongan Vektor pET-32b(+)
Elektroforesis Hasil Purifikasi Vektor pET-32b(+) Setelah
Pemotongan Ganda dengan Enzim Xho I dan Nco I ..................
Hasil Transformasi pada E. coli DH5 ......................................
Elektroforesis Hasil PCR dengan Primer IFN_NcoI_F dan
IFN_XhoI_R pada Klon Transforman 1-11 E. coli DH5 .......
Elektroforesis Hasil PCR dengan Primer pET_Screen_F dan
pET_Screen_R pada Klon Transforman 1-11 E. coli DH5 . ...
Elektroforesis Hasil Miniprep Klon Transforman di E. coli
DH5 . ...
Elektroforesis Skrining Metode PCR Menggunakan Primer
(IFN_NcoI_F dengan pET_Screen_R) dan (Primer
pET_Screen_F dengan IFN_XhoI_R) pada Hasil Miniprep
Klon 1, 2, 3, 4, dan Klon 11 E. coli DH5 .........
Elektroforesi Hasil Pemotongan Vektor Rekombinan Klon 2 ..
Elektroforesis Hasil Qiagen Plasmid Maxi Kit ...
Hasil Alignment Sekuen Klon 2 dengan Stag-18mer-primer ....
Hasil Alignment Sekuen Klon 2 dengan T7terminatorprimer .....................
Hasil Transformasi Vektor Rekombinan pada E. coli
BL21(DE3) .. ..
Elektroforesis Hasil PCR Skrining dengan Primer
pET_Screen_F dan pET_Screen_R pada Klon Transforman
E. coli BL21(DE3) .....................................................................
Elektroforesis Hasil PCR Skrining dengan Primer
IFN_NcoI_F dan IFN_XhoI_R pada Klon Transforman E.
coli BL21(DE3) ..
Western Blot Klon 1 Inkubasi 37C IPTG 1 mM ...
Pewarnaan CBB Klon 2, 3, 6, dan 7 Inkubasi 37C IPTG
1 mM .......................................................................................
Pewarnaan CBB Klon 4 dan Klon 5 Inkubasi 37C IPTG
1 mM .......
Pewarnaan CBB Pelet Klon 3 Inkubasi 37C IPTG 1 mM ....
Pewarnaan CBB Supernatan Klon 3 Inkubasi 37C IPTG
1 mM ..

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

5
6
8
12
39
40
41
42
43
45
47
47
48

49
50
51
52
52
54

55

55
57
58
58
60
60

Gambar 4.23
Gambar 4.24
Gambar 4.25
Gambar 4.26
Gambar 4.27
Gambar 4.28
Gambar 4.29
Gambar 4.30

Western Blot Klon 3 Inkubasi 30C IPTG 1 mM.....................


Pewarnaan CBB Klon 3 Inkubasi 30C IPTG 1 mM................
Pewarnaan CBB Pelet Klon 3 Inkubasi 28C IPTG 1 mM.......
Pewarnaan CBB Supernatan Klon 3 Inkubasi 28C IPTG
1 mM .......................
Pewarnaan CBB Pelet Klon 3 Suhu 28C, 30C, 37C IPTG
1 mM ............................................................
Western Blot Pelet Klon 3 Suhu 28C, 30C, 37C IPTG
1 mM .........................................................
Western Blot Supernatan Klon 3 Suhu 28C, 30C, 37C
IPTG 1 mM ...............................................................
Pewarnaan CBB Hasil Isolasi Protein dari Pelet ..

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

61
61
62
62
63
63
64
66

DAFTAR TABEL

Tabel 4.1

Hasil Kuantifikasi Tingkat Ekspresi pada Pelet dan


Supernatan ..............................................

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

65

DAFTAR LAMPIRAN

Lampiran 1
Lampiran 2
Lampiran 3
Lampiran 4
Lampiran 5

Skema Kerja Penelitian ...........................................................


Vektor pcDNA3.1+:IFN-Gene ...............................................
Hasil Sekuen Klon 2 E. coli DH5 dengan Stag-18merprimer ......................................................................................
Hasil Sekuen Klon 2 E. coli DH5 dengan T7terminatorprimer ......................................................................................
Nukleotida Human Interferon Alpha 2a (GenBank:
DI084466.1)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

73
74
75
77
79

BAB 1
PENDAHULUAN

1.1 Latar Belakang


Interferon (IFN) adalah obat yang pada awalnya dikembangkan untuk
terapi penyakit kanker, tetapi pada saat ini interferon juga digunakan untuk
pengobatan berbagai penyakit. Terapi interferon telah digunakan secara luas untuk
pengobatan hepatitis kronis (hepatitis B dan C), kaposis sarkoma, dan karsinoma
lainnya (Tae-Ok Bae et al., 1995). Interferon termasuk interferon tipe I dan
merupakan obat yang potensial untuk dikembangkan karena tingginya kebutuhan
interferon dalam pengobatan. Interferon memiliki berbagai efek biologis
meliputi antiviral, antitumor dan juga sebagai immunoterapetik (Brassard, 2002).
Interferon 2a merupakan bagian dari fokus produksi protein teraputik
interferon dengan teknologi DNA rekombinan. Beberapa penelitian sebelumnya
tentang interferon 2a diantaranya adalah purifikasi dan karakterisasi rekombinan
human interferon 2a yang diproduksi dari Saccharomyces cerevisiae (Tae-Ok
Bae et al., 1995), dan efek heat shock produksi rekombinan human interferon 2a
pada Escherichia coli galur MSD462 dengan vektor ekspresi pZe0148 (Roy et al.,
2005). Pada penelitian ini akan dilakukan kloning gen human interferon 2a pada
vektor pET-32b(+) dan ekspresinya menggunakan inang Escherichia coli galur
BL21(DE3).
Sistem pET merupakan sistem yang didesain untuk kloning dan ekspresi
tingkat tinggi pada E. coli. Vektor pET-32b(+) dilengkapi dengan multipel situs
restriksi, fusi sekuen thioredoxin (Trx.Tag), histidin (HisTag), STag, serta situs
pemotongan thrombin dan enterokinase (pET Sistem Manual, 2006). Protein yang
dihasilkan dalam bentuk protein terfusi sehingga dapat memudahkan proses
deteksi dan purifikasi protein rekombinan. Tag thioredoxin pada vektor pET32b(+) berfungsi untuk mendukung pembentukan ikatan disulfida, meningkatkan
kelarutan protein, serta melindungi protein rekombinan terhadap agregasi yang
tidak diinginkan selama ekspresi. Tag histidin kedepannya akan digunakan untuk
purifikasi protein rekombinan. Situs pemotongan enterokinase yang terdapat di

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

vektor pET-32b(+) kedepannya akan digunakan untuk pemisahan antara fusi tag
dengan protein target setelah proses purifikasi.
Sebagian besar produk farmasi yang telah dipasarkan pada kelompok
rekombinan interferon diproduksi dan dipurifikasi dari E. coli (Rabhi-Essafi,
2007). Inang E. coli galur BL21(DE3) dipilih sebagai sistem ekspresi karena
mempunyai berbagai keuntungan. Escherichia coli BL21(DE3) merupakan
bakteri yang umum untuk ekspresi protein yang menggunakan promotor T7. DE3
menunjukkan bahwa inang merupakan lisogen dari prophage (DE3), oleh
karena itu membawa salinan kromosom gen T7 RNA polimerase di bawah kontrol
promotor lacUV5 yang diinduksi dengan penambahan isopropyl-1-thio--Dgalactopyranoside (IPTG). T7 RNA polimerase diekspresikan pada saat
penambahan IPTG yang mana akan menginduksi level ekspresi tinggi protein
pada vektor ekspresi dengan promotor T7 (Studier, 1991). Escherichia coli
BL21(DE3) merupakan inang umum yang digunakan untuk ekspresi protein
karena defisiensi protease Lon dan OmpT, yang mana kedua protease tersebut
dapat menginduksi proteolisis dari protein yang dioverekspresi (Srensen dan
Mortensen, 2005).

1.2 Rumusan Masalah


Interferon 2a adalah salah satu agen terapetik berbasis bioteknologi yang
dibutuhkan dan mempunyai nilai ekonomi yang tinggi. Rekombinan interferon
2a yang beredar dan digunakan di indonesia merupakan produk impor. Oleh
karena itu, sangat perlu adanya pengembangan sistem produksi rekombinan
interferon 2a di dalam negeri untuk meningkatkan kemampuan produksi bahan
obat berbasis bioteknologi serta mengurangi ketergantungan dari luar negeri. Pada
penelitian ini dilakukan kloning gen human interferon 2a pada vektor pET32b(+) dan ekspresi pada inang sel E. coli BL21(DE3) untuk menghasilkan
protein rekombinan human interferon 2a.
1.3 Hipotesis
Sintesis protein rekombinan human interferon 2a dapat dilakukan dengan
menggunakan gen sintetik human interferon 2a yang dikloning pada vektor pET-

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

32b(+) dan diekspresikan menggunakan sistem ekspresi prokariotik pada sel


bakteria E. coli BL21(DE3).

1.4 Tujuan penelitian


Tujuan umum pada penelitian ini adalah untuk mensintesis protein
rekombinan human interferon 2a melalui sistem ekspresi pada bakteria E. coli
BL21(DE3). Adapun tujuan khusus pada penelitian ini yaitu untuk mendesain
vektor rekombinan pET-32b(+)-IFN 2a dan melakukan analisis ekspresi protein
rekombinan human interferon 2a pada inang ekspresi E. coli BL21(DE3).
1.5 Manfaat Penelitian
Manfaat dari penelitian ini yaitu dihasilkannya protein rekombinan human
interferon 2a sehingga dapat diuji lebih lanjut untuk dapat digunakan dalam
pengobatan.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

BAB 2
TINJAUAN PUSTAKA

2.1 Interferon
Interferon (IFN) termasuk kelompok glikoprotein yang diproduksi oleh
berbagai tipe sel sebagai respon terhadap rangsangan yang diterima oleh sel.
Rangsangan tersebut bisa disebabkan oleh virus, bakteri, parasit, sel tumor, atau
antigen lain. Interferon mempunyai berat molekul sekitar 20-30 kDa. Interferon
juga termasuk dalam golongan sitokin seperti interleukin (ILS), colonystimulating factors dan growth factors. Sitokin bekerja pada reseptor spesifik di
permukaan sel dan berfungsi sebagai pengatur kelangsungan hidup sel, proliferasi
sel, diferensiasi dan aktivasi fungsional sel (Obeid dan Bouvois, 2006).
Interferon berdasarkan tipe reseptornya dikelompokkan menjadi 2 tipe.
Interferon tipe I berikatan pada reseptor tipe 1, yaitu IFN alpha (), IFN beta (),
IFN omega (), dan IFN tao (). Interferon tipe 2 berikatan pada reseptor tipe 2,
yaitu IFN gamma (). Hampir semua tipe sel memproduksi IFN tipe I. Interferon
tipe II hanya diproduksi oleh sel limfosit T dan NK-cells (Natural Killer Cells)
(Jonasch dan Haluska, 2001).
Interferon memiliki aktivitas spektrum luas dan mekanisme kerjanya
melalui interaksi yang komplek. Interferon mempunyai aktivitas antivirus,
antitumor, berpengaruh pada metabolisme dan diferensiasi sel serta memodulasi
sistem imun (Jonasch dan Haluska, 2001). Interferon dapat mencegah replikasi
virus pada sel, serta dapat mengaktifkan fungsi khusus dari sel meliputi
deferensiasi,

pertumbuhan,

pengekspresian

antigen

permukaan

dan

immunoregulasi sel (Meager, 2006). Aktivitas antivirus IFN melalui mekanisme


pencegahan replikasi pada sel-sel sekitar yang terinfeksi. Pencegahan replikasi
dilakukan melalui pengikatan IFN pada reseptor permukaan membran sel yang
mengaktifkan gen-gen pengkode protein yang menghalangi replikasi virus.
Ekspresi gen pengkode IFN terjadi melalui jalur transduksi sinyal dan aktivasi
transkripsi yang dikenal dengan jalur Jak-Stat. Interferon dan berikatan pada
tipe reseptor yang sama, sedangkan IFN berikatan pada tipe reseptor yang
berbeda (Samuel, 2001).
4

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Mekanisme aksi dari IFN dimulai dengan zat penginduksi IFN akan
memicu sel untuk mengaktifkan gen ifn sehingga dihasilkan mRNA yang
kemudian ditranslasikan menjadi protein IFN. Protein IFN selanjutnya
disekresikan keluar sel. Interferon ekstraseluler akan terikat ke reseptor pada
membran sel sekitarnya. Proses pengikatan IFN pada reseptor ini akan
menginisiasi sinyal kaskade JAK/STAT yang selanjutnya akan menstimulasi
ekspresi gen penghasil protein efektor. Protein efektor akan memediasi efek IFN
sebagai antivirus, anti tumor, dan imunomodulator (Pang et al., 2005). Sel yang
teraktivasi juga dapat menghasilkan protein aktivator bagi sel lain sehingga
menghasilkan protein efektor (Samuel, 2001).

Gambar 2.1 Mekanisme Aksi Interferon (Pang et al., 2005).

Jalur transduksi sinyal untuk aktivasi transkripsi dan pengekspresian gen


pengkode ifn yaitu melalui jalur Jak-Stat. Protein Signal Transducer and Activator
of Transcription (STAT) merupakan faktor transkripsi yang dapat difosforilasi
pada residu asam amino tirosin oleh enzim tirosin kinase Janus Family of
Tyrosine Kinase (JAK). Protein STAT terdiri atas tujuh macam yaitu Stat-1, Stat2, Stat-3, Stat-4, Stat-5a, Stat-5b dan Stat-6. Protein JAK terdiri 4 macam yaitu
Jak-1, Jak-2, Jak-3 dan Tyk-2 (Samuel, 2001).
Proses transduksi sinyal diinisiasi oleh pengikatan IFN pada subunit
reseptor tirosin kinase. Pengikatan IFN akan mengaktivasi faktor transkripsi Jak
dan Stat melalui fosforilasi tirosin. Kinase Jak-1 dan Tyk-2 yang teraktivasi oleh

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

IFN dan IFN akan menghasilkan fosforilasi dan dimerisasi protein Stat-1
(p91) dan Stat-2 (p113) yang selanjutnya ditranslokasi bersama IRF-9 (p48) ke
inti sel. Komplek ketiga protein ini disebut dengan IFN-Stimulated Gene Factor 3
(ISGF 3) yang dapat mengaktifkan gen-gen pengkode ifn dan melalui IFNStimulted Response Element (ISRE). Pada IFN kinase Jak-1 dan Jak-2 yang
teraktivasi akan memfosforilasi dan menyebabkan homodimerisasi protein Stat-1
yang kemudian ditranslokasi ke inti sel. Komplek dimer ini disebut dengan Jak-1
dan Gamma Activation Factor (GAF) yang mengaktifkan gen-gen pengkode ifn .
Komplek GAF akan mengaktivasi gen-gen IFN melalui elemen GammaActivated Sequence (GAS) (Samuel, 2001).

Gambar 2.2 Jalur Jak-Stat (Samuel, 2001).


Interferon dan dibentuk oleh berbagai sel sebagai reaksi terhadap
infeksi viral, bakteri, mikoplasma dan protozoa. Interferon diproduksi oleh
leukosit dan IFN dipoduksi oleh fibroblas. Kedua IFN tersebut sama-sama
dikodekan oleh gen yang terletak pada kromosom 9 manusia. Interferon dan
berfungsi sebagai virustatis yaitu mencegah infeksi lebih lanjut dengan cara
menduduki reseptor-reseptor khas pada membran sel normal sehingga tidak dapat

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

dipenetrasi oleh virus. Kedua IFN tersebut juga bersifat sitostatis yaitu
menghambat pertumbuhan sel-sel tumor dan menstimulasi makrofag serta NKcells (Natural Killer Cells) yang mana dapat mendeteksi sel-sel tumor dan sel-sel
yang diinvasi virus dan kemudian menghancurkannya. Interferon digunakan
untuk pengobatan pada hepatitis dan jenis leukimia tertentu. Interferon
digunakan pengobatan pada penyakit multiple sclerosis (Tan Hoan Tjay, 2007).
Interferon gamma (IFN ) diproduksi oleh limfosit T dan NK-cells dengan
gen pengkode ifn terletak pada kromosom 12 manusia. Gen ifn memiliki 3
intron dan terdiri dari 146 asam amino dengan kandungan karbohidrat 30%
(Arbabi, 2003). Interferon berfungsi sebagai immunostimulator (Tan Hoan Tjay,
2007). Interferon memiliki daya antiviral lebih lemah dibandingkan IFN dan
IFN . Aktivitas biologis dari IFN juga dapat mencegah pertumbuhan sel
neoplastik (Arbabi, 2003).
Interferon merupakan glikoprotein yang terdiri atas 165 asam amino
dalam bentuk 2a dan 2b dengan masing-masing asam amino lisin dan arginin pada
posisi 23. Interferon memiliki dua ikatan disulfida yaitu antara Cys1 ke Cys98
dan Cys29 ke Cys138 (Tae-ok Bae et al., 1995). Interferon adalah glikoprotein
yang terdiri atas 165 asam amino dalam bentuk 1a dan 1b dengan masing-masing
asam amino sistein dan serin pada posisi 17. Interferon adalah glikoprotein yang
terdiri atas 140 asam amino dengan bentuk 1a dan 1b yang memiliki masingmasing asam amino glutamin atau arginin diposisi 137 (Tan Hoan Tjay, 2007).
Interferon 2a merupakan subtipe dari IFN yang terdiri atas 165 asam
amino sistein dengan 4 sistein dan 2 ikatan disulfida. Interferon 2a adalah
glikoprotein dengan berat molekul sekitar 19.000 dalton (Tae-Ok Bae et al.,
1995). Struktur 3 dimensi protein IFN 2a yang ditentukan menggunakan
spektroskopi nuclear magnetic resonance (NMR) pada pH 3,5 menunjukkan
bahwa IFN 2a sebagian besar mengandung alpha heliks (6 alpha heliks, 65%
alpha heliks) dalam struktur sekunder dan sisanya adalah kumparan koil dan loop
(Klaus et al., 1997).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Gambar 2.3 Gen human interferon 2a.


(http://www.roche-australia.com/fmfiles/re7229005/downloads/anti-virals/roferon-pi.pdf)

Penggunaan IFN 2a telah disetujui oleh FDA (Food and Drug


Administration) untuk pengobatan non-hodgkins lymphoma (NHL), hairy cell
leukemia, chronic myelogenous leukemia (CML), AIDS-related kaposis sarcoma,
dan hepatitis C kronis (Jonasch dan Haluska, 2001). Banyak upaya yang telah
dilakukan untuk kloning dan ekspresi rekombinan human IFN 2a pada berbagai
mikroorganisme. Beberapa studi mengenai IFN2a diantaranya dilakukan oleh
Tae-Ok Bae et al. (1995) purifikasi dan karakterisasi rekombinan human IFN 2a
yang diproduksi dari Saccharomyces cerevisiae, dan Roy et al. (2005) efek heat
shock produksi rekombinan IFN 2a pada Escherichia coli galur MSD462 dengan
vektor ekspresi pZe0148. Pada penelitian ini akan dilakukan kloning gen human
ifn 2a pada vektor pET-32b(+) dan ekspresinya menggunakan inang E. coli galur
BL21(DE3).

2.2 Kloning dan Isolasi DNA


Kloning DNA (deoxyribonucleic acid) merupakan proses penggandaan
jumlah DNA rekombinan yang dapat melalui proses perkembangbiakan sel
bakteri, sel ragi, sel mamalia (Muladno, 2010). Kloning DNA merupakan teknik

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

DNA rekombinan yang memungkinkan untuk dibuatnya satu DNA tertentu dalam
jumlah besar dan murni. Metode kloning DNA melibatkan ligasi sekuen tertentu
misalnya gen manusia ke dalam vektor. Vektor merupakan urutan DNA yang
terdapat di dalam satu sel, tetapi bukan merupakan bagian dari genom sel.
Pembawa kloning dengan DNA yang diklon di dalamnya akan diperbanyak dalam
sel inang untuk menghasilkan sejumlah besar DNA dengan urutan spesifik yang
kemudian dilakukan isolasi untuk studi selanjutnya (Grompe et al., 1998).
Vektor adalah DNA untai ganda sirkuler yang ukurannya kecil (2000-5000
pb) yang dapat bereplikasi di dalam sel inang. Vektor berdasarkan jumlah
salinannya dibedakan menjadi dua yaitu vektor dengan jumlah salinan tinggi dan
salinan rendah. DNA vektor murni dapat dipisahkan dari DNA genom sel inang,
karena DNA vektor memiliki ukuran jauh lebih kecil. Ukuran DNA genom sel
inang memiliki ukuran yang besar misalnya pada genom E. coli 1x106 pb. Vektor
memiliki origin of replication (ORI) sendiri sehingga mampu memperbanyak diri
dengan bantuan mesin-mesin seluler endogen. Vektor kloning juga memiliki
marka untuk seleksi yang umumnya berupa gen yang membawa resistensi
terhadap antibiotika tertentu. Hanya klon rekombinan yang mengandung vektor
maka yang akan mampu tumbuh dalam media yang mengandung antimikroba
tertentu (Grompe et al., 1998).
Vektor modern saat ini telah direkayasa sehingga memiliki beberapa situs
restriksi (polylinker sites). Vektor pada saat sekarang ini telah dibuat mempunyai
jumlah salinan tinggi dan memiliki ukuran 3 kb sehingga dapat menerima DNA
sisipan sampai 15 kb. Kebanyakan DNA yang diklon ke dalam vektor berukuran
relatif kecil kurang dari 10 kb, karena ukuran DNA yang jauh lebih besar biasanya
tidak stabil. Oleh karena itu, juga dikembangkan vektor kloning yang dapat
membawa DNA dengan ukuran besar diantaranya vektor kloning faga (phage),
kosmid, Bacterial Artificial Chromosomes (BAC) dan

Yeast Artificial

Chromosomes (YAC) (Grompe et al., 1998).


Prosedur kloning suatu gen tertentu didahului dengan pemotongan DNA
vektor dengan menggunakan enzim restriksi, sehingga DNA vektor sirkuler
terbuka dan menjadi linier. DNA untai ganda linier lain yang diinginkan dibuat
dengan ujung-ujungnya sesuai untuk diligasikan ke dalam celah sehingga

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

terbentuk kembali vektor sirkuler yang mengandung insert. Vektor rekombinan


yang diperoleh kemudian akan dimasukkan ke dalam sel inang melalui proses
transformasi (Grompe et al., 1998).
Proses pemasukan molekul DNA ke dalam sel disebut transformasi karena
masuknya molekul DNA ke dalam sel dapat mengubah fenotip sel tersebut
(Muladno, 2010). Proses transformasi pada bakteri dapat dilakukan dengan cara
memanaskan campuran DNA dan sel bakteri yang kompeten pada suhu 42C
selama 1 menit (heat shock) atau dengan memberikan aliran listrik
(electroporation), sehingga DNA vektor rekombinan dapat melalui dinding
bakteri kemudian masuk ke dalam sel bakteri. Setelah proses transformasi selesai,
bakteri ditumbuhkan pada media agar yang mengandung marka antibiotik. Pada
kondisi ini, hanya sel yang mengandung vektor rekombinan yang dapat tumbuh
dan membentuk koloni. Tiap koloni bakteri ini disebut klon, tiap klon
diperbanyak dalam media cair untuk dilakukan isolasi DNA dalam jumlah besar.
Klon yang mengandung vektor rekombinan merupakan sumber DNA yang
permanen, karena sel bakteri tidak mati dan dapat terus menerus membelah tanpa
batas (Grompe et al., 1998).
Isolasi DNA terdiri dari beberapa tahap yaitu (1) kultivasi sel dalam media
yang sesuai; (2) pemecahan dinding sel; (3) ekstraksi DNA; (4) purifikasi DNA.
Proses pemecahan dinding sel bakteri dapat dilakukan secara fisik dengan cara
sonikasi maupun secara kimia dengan menggunakan enzim lisozim, etilendiamin
tetra asetat (EDTA), dan sodium diodesil sulfat (SDS). Seteleh dinding sel lisis,
dilanjutkan pemisahan debris sel menggunakan metode disentrifus. Metode
disentrifus digunakan untuk memisahkan antara komponen sel yang tidak larut
akan mengendap dan ekstrak sel dalam supernatan yang jernih. Ekstrak sel dalam
supernatan selain mengandung DNA juga masih mengandung protein dan RNA,
sehingga perlu untuk dimurnikan (Radji, 2011).
Proses pemurnian DNA yang umumnya dilakukan yaitu dengan
penambahan larutan fenol ataupun dengan campuran fenol kloroform dengan
perbandingan 1:1, untuk mengendapkan protein dengan cara disentrifus dan
dihancurkan secara enzimatis dengan proteinase. Pemurnian DNA selanjutnya
dengan penambahan RNAse untuk membersihkan DNA dari RNA. Molekul DNA

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

yang diperoleh kemudian dilakukan presipitasi menggunakan etanol absolut


disimpan pada suhu -20C, kemudian disentrifus untuk mengendapkan DNA dan
mempermudah pemisahan (Radji, 2011).

2.3 Vektor pET-32b(+)


Sistem pET adalah sistem unggul yang dikembangkan untuk kloning dan
ekspresi protein rekombinan pada E. coli. Studier et al. (1990) pertama kali
menjelaskan tentang sistem ekspresi pET, yang mana telah dikembangkan untuk
berbagai aplikasi ekspresi. Lebih dari 40 jenis vektor pET yang berbeda tersedia
secara komersial (pET Sistem Manual, 2006). Sistem pET mencakup promotor
hibrid, multipel situs kloning yang tergabung dengan fusi yang berbeda, situs
pemotongan protease, dan modifikasi latar belakang genetik dari vektor pBR322
untuk berbagai tujuan ekspresi (Srensen dan Mortensen, 2005).
Vektor pET-32b(+) merupakan sistem yang dilengkapi dengan multipel
situs restriksi dan terdapat fusi sekuen thioredoxin (Trx.Tag), histidin (HisTag),
STag, serta situs pemotongan thrombin dan enterokinase (pET Sistem Manual,
2006). Protein yang dihasilkan dalam bentuk protein terfusi sehingga
memudahkan untuk proses deteksi dan purifikasi protein rekombinan. Tag
thioredoxin berfungsi untuk mendukung pembentukan ikatan disulfida dan
meningkatkan kelarutan protein. Tag histidin 6x pada terminal N dan terminal C
berfungsi untuk deteksi protein target menggunakan metode Western blot. Tag
histidin juga dapat digunakan untuk purifikasi protein target menggunakan
Immobilized metal-affinity chromatography (IMAC) dengan matriks Ni2+-NTA,
Co2+-CMA (Talon) dan dielusi menggunakan imidazol (Terpe, 2002). Fusi
peptida STag dapat digunakan untuk uji kuantitatif, deteksi menggunakan metode
Western blot serta purifikasi protein rekombinan berdasarkan metode pemisahan
afinitas. Situs pemotongan enterokinase digunakan untuk pemisahan antara fusi
tag dan protein target setelah proses purifikasi.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

pET-32b(+)
(5899 pb)

Gambar 2.4 Vektor pET-32b(+).


(https://wasatch.biochem.utah.edu/chris/links/pET32.pdf)

Sistem pET dapat mengekspresikan protein tingkat tinggi karena


mekanisme ekspresinya dikontrol dengan menggunakan promotor T7lac, inang

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

dengan pylsS, serta penambahan glukosa ke media berdasarkan karakteristik


protein target. PlysS pada inang ekspresi berfungsi untuk meningkatkan toleransi
DE3 lisogen untuk vektor dengan insert yang toksik, serta vektor menjadi lebih
stabil. Vektor pET-32b(+) memiliki promotor T7lac dengan sekuen lac operator
downstream dari promotor T7. Vektor juga membawa sekuen pengkode untuk
represor lac (lacI) dengan orientasi dari promotor T7lac dan lacI berbeda. Vektor
apabila digunakan dalam DE3 lisogen, maka represor lac beraksi di promotor
lacUV5 dalam kromosom inang untuk menekan transkripsi gen T7 RNA
polimerase dan juga pada promotor T7lac dalam vektor untuk memblokir
transkripsi gen target (pET Sistem Manual, 2006).
Vektor rekombinan ditransformasikan ke dalam galur sel E. coli yang
kromosomnya mempunyai salinan gen untuk T7 RNA polimerase (T7 gen 1)
untuk memproduksi protein. Inang dengan galur DE3 lisogen dipilih karena
defisiensi protease, auksotrof asam amino, dapat meningkatan kelarutan, dan
suplementasi kodon yang jarang (rare codon) (pET Sistem Manual, 2006).
Escherichia coli galur BL21(DE3) adalah inang yang umum untuk ekspresi
protein yang menggunakan promotor T7. DE3 menunjukkan bahwa inang
merupakan lisogen dari prophage (DE3), oleh karena itu membawa salinan
kromosom dari gen T7 RNA polimerase di bawah kontrol promotor lacUV5 yang
diinduksi dengan penambahan isopropyl-1-thio--D-galactopyranoside (IPTG).
Escherichia coli BL21(DE3) adalah inang yang paling banyak digunakan untuk
ekspresi protein karena defisiensi protease Lon dan OmpT (Srensen dan
Mortensen, 2005).

2.4 Manipulasi Enzimatis DNA


Manipulasi DNA dapat dilakukan secara enzimatis dengan menggunakan
berbagai macan enzim diantaranya yaitu :
2.4.1

Enzim Endonuklease Restriksi


Enzim endonuklease restriksi umumnya diperoleh dari bakteri, yang mana

dapat mengenal DNA untai ganda dengan urutan basa spesifik serta memotong
pada tempat yang tertentu. Enzim endonuklease restriksi berfungsi untuk
membatasi masuknya DNA asing dengan cara memotong DNA pada situs

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

restriksi yang tidak terdapat pada bakteri. Setiap enzim endonuklease restriksi
dapat mengenal, mengikat dan memotong urutan basa tertentu. Urutan basa yang
dipotong biasanya terdiri dari 4-8 pasang basa (pb), dan enzim endonuklease
restriksi hanya memotong DNA yang mempunyai urutan basa yang benar-benar
persis dengan kode tersebut. Sebagai contohnya yaitu urutan basa yang dikenal
oleh enzim EcoRI adalah GAATTC. Semua situs yang memiliki urutan basa
GAATTC akan dipotong oleh enzim EcoR1, namun jika ada satu basa yang
berbeda misalnya CAATTC maka mampu mencegah terjadinya pemotongan.
Proses

pemotongan

DNA

dengan

enzim

endonuklease

restriksi

dapat

menghasilkan potongan asimetris 5' atau 3' terbuka sehingga ujungnya kohesif
(sticky end), ataupun potongan simetris sehingga ujungnya tumpul (blunt end)
(Grompe et al., 1998).
Enzim endonuklease restriksi diberi nama sesuai dengan bakteri
penghasilnya, misalnya EcoRI berasal dari Escherichia coli. Penggunaan enzim
restriksi adalah dengan menginkubasi enzim bersama-sama dengan DNA dalam
larutan bufer yang sesuai, sehingga akan dihasilkan potongan-potongan DNA
dengan ukuran tertentu. Pemotongan enzim restriksi bersifat spesifik untuk urutan
basa tertentu, sehingga DNA yang berbeda akan menghasilkan pola pemotongan
yang khas. Pola yang khas ini dapat diketahui setelah dilakukan elektroforesis gel
dan pewarnaan sehingga fragmen DNA yang berbeda-beda ukurannya dapat
terlihat (Grompe et al., 1998). Enzim endonuklease restriksi sangat bermanfaat
diaplikasian pada teknologi DNA rekombinan karena sangat selektif dalam
memotong untai DNA (Radji, 2011).
2.4.2

Enzim DNA Ligase


Enzim DNA ligase adalah enzim yang berfungsi mengikatkan dua potong

DNA secara kovalen (Grompe et al., 1998). Enzim DNA ligase merupakan enzim
yang terdapat pada sistem biologis yang dapat mengkatalis pembentukan ikatan
kovalen yang merekatkan kembali potongan fragmen-fragmen DNA. Enzim DNA
ligase adalah salah satu enzim yang sangat penting dalam perkembangan
teknologi DNA rekombinan (Radji, 2011). Enzim DNA ligase ini terutama
digunakan untuk menyisipkan sepotong DNA ke dalam vektor kloning. Enzim
DNA ligase yang paling banyak digunakan adalah T4 DNA ligase. Reaksi ligasi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

terjadi antara gugus 3'OH dari salah satu untai DNA dengan gugus fosfat dari
untai DNA pasangannya. Reaksi ligasi menggunakan ATP sebagai sumber energi
(Grompe et al., 1998).
Proses ligasi menggunakan T4 DNA ligase memerlukan kofaktor ATP
yang kemudian membentuk kompleks enzim-AMP. Kompleks ini menempel dan
menyambung gugus 5'-fosfat dan 3'-hidroksi dengan ikatan kovalen sehingga
terbentuk rantai fosfodiester (Sudjadi, 2008). Ligasi DNA hanya dapat terjadi
antara dua ujung fragmen DNA yang kompatibel. Kompatibilitas inilah yang
digunakan untuk mengatur ligasi beberapa fragmen DNA yang berbeda secara
sekaligus dalam satu campuran reaksi (Grompe et al., 1998). Proses
penyambungan fragmen DNA dengan ujung kohesif dengan enzim DNA ligase
cukup efisien dan telah banyak digunakan dalam pembuatan vektor rekombinan.
Pada fragmen DNA dengan ujung tumpul memerlukan kondisi ligasi yang spesial,
yaitu kadar fragmen DNA harus tinggi dan larutan reaksi agak kental sehingga
gerakan molekul lebih lambat (Sudjadi, 2008).
2.4.3

Enzim DNA Polimerase


Enzim DNA polimerase adalah enzim yang menggunakan satu DNA untai

tunggal sebagai cetakan (template) untuk mensintesis untai kedua yang


komplemen dengan cetakannya. Enzim DNA polimerase membutuhkan primer
dalam mensintesis DNA baru dari arah 5' ke 3'. Primer adalah sepotong kecil
DNA yang komplemen terhadap untai DNA yang akan disalin, polimerase
melekat pada primer dan kemudian akan memperpanjang primer dengan cara
menambahkan blok-blok deoksinukleotida dari arah 5' ke 3' (Grompe et al., 1998).
Primer merupakan oligonukleotida rantai pendek yang dibuat secara sintetik dan
umumnya memiliki panjang 15-32 pasang basa. Enzim DNA polimerase memiliki
aktivitas optimal pada suhu 92-95C dan digunakan dalam polymerase chain
reaction (PCR) (Radji, 2011).

2.5 Amplifikasi DNA


Amplifikasi atau perbanyakan DNA untai ganda selain dengan
menggunakan vektor kloning dalam sel inang hidup juga dapat dilakukan dengan
metode polymerase chain reaction (PCR). Dengan menggunakan metode PCR

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

mampu diperoleh DNA dalam jumlah besar dan murni secara kimia. Metode PCR
memungkinkan untuk dibuat sejumlah besar DNA dengan urutan basa tertentu
dalam waktu yang singkat dan tanpa kloning. Sejumlah kecil DNA untai tunggal
dapat disintesis dari nukleotida tunggal dengan bantuan oligonukleotida (Grompe
et al., 1998). Metode PCR merupakan suatu proses sintesis enzimatik untuk
mengamplifikasi fragmen DNA secara in vitro. Teknik PCR dapat meningkatkan
jumlah fragmen DNA hingga mencapai 106-107 kali dalam waktu singkat (Radji,
2011).
Prosedur PCR menggunakan DNA polimerase yang tahan terhadap panas
(thermostable) dan dua primer oligonukleotida sintetik. Urutan DNA gen yang
akan diamplifikasi harus diketahui sebagian sehingga dapat dibuat primer yang
membatasi ujung DNA target. Prosedur PCR terdiri dari 3 tahap yaitu: (1)
denaturasi DNA untai ganda, (2) penempelan primer ke DNA (annealing), dan (3)
memperpanjang primer (extension) (Grompe et al., 1998). Ketiga tahapan siklus
tersebut diatas diulang sesuai dengan jumlah siklus amplifikasi yang akan
dilakukan (Radji, 2011).
Pada tahap denaturasi terjadi pemanasan pada suhu 94-98C, yang mana
bertujuan untuk memisahkan untai ganda DNA target menjadi untai tunggal.
Untai tunggal lalu siap dihibridisasikan dengan oligonukleotida yang sesuai pada
proses annealing. Pada proses annealing temperatur diturunkan sampai di bawah
titik leleh hibrid DNA-oligonukleotida yaitu pada suhu sekitar 50-68C. Tahapan
selanjutnya yaitu setelah primer menempel maka enzim DNA polimerase dapat
menyalin urutan DNA untai tunggal pada temperatur 72C (extension), dengan
deoksinukleotida trifosfat (dNTP) yang tersedia. Setiap untai DNA target yang
ada sejak awal akan disalin dan jumlah DNA akan menjadi dua kali lipat pada
akhir tiap siklus. Jadi, setelah 25-30 siklus maka urutan DNA yang diinginkan
diperbanyak sampai jutaan kali lipat. DNA hasil PCR dapat divisualisasikan
sebagai pita (band) pada gel agarosa dengan pengecatan menggunakan etidium
bromida (EtBr), dan selanjutnya dapat digunakan untuk kloning ataupun
sekuensing DNA. Perubahan temperatur berturut-turut pada PCR dilakukan pada
mesin thermocycler. Satu kali proses PCR biasanya selesai dalam jangka waktu 3

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

jam. Oleh karena itu, metode PCR merupakan metode tercepat untuk membuat
DNA tertentu untuk dilakukan studi lebih lanjut (Grompe et al., 1998).
Keterbatasan dari metode PCR diantaranya

yaitu adanya

salah

menambahkan nukleotida oleh enzim Taq polimerase (Taq error) dan


ketidakmampuan untuk mengamplifikasi fragmen DNA yang besar. Modifikasi
Taq generasi baru yang mampu mengamplifikasi sampai 20 kb dengan tingkat
fidelitas tinggi dapat mengurangi kesalahan PCR dan meningkatkan kemampuan
amplifikasi. Kegunaan PCR diantaranya yaitu: (1) untuk mengamplifikasi DNA
pada daerah tertentu sebagai strategi rekayasa genetik; (2) memperbanyak DNA
genom untuk keperluan diagnostik; (3) memperbanyak DNA untuk sekuensing;
(4) untuk memnyisipkan atau membuat mutasi (site directed mutagenesis); (5)
dikombinasikan dengan reverse transcription untuk mengkuantifikasi jumlah
mRNA awal (RT-PCR) (Grompe et al., 1998).

2.6 Analisis DNA


Analisis DNA dapat dilakukan dengan menggunakan berbagai metode
diantaranya yaitu :
2.6.1

Pemisahan Menggunakan Gel


Teknik dasar pemisahan DNA dan RNA menggunakan elektroforesis pada

sistem gel berdasarkan prinsip perbedaaan ukuran. DNA dan RNA pada pH netral
bermuatan negatif dan akan bermigrasi ke arah anoda. Pada saat migrasi pada
matriks polimer gel, maka fragmen kecil akan bergerak lebih cepat daripada
fragmen yang besar. Migrasi elektroforetik melalui gel akan dapat memisahkan
campuran fragmen DNA sehingga tampak sebagai pita-pita yang berbeda
ukurannya. Matriks gel yang dapat dipakai untuk pemisahan asam nukleat
diantaranya yaitu gel agarosa dan gel poliakrilamid. Gel agarosa dapat digunakan
untuk pemisahan fragmen DNA berukuran 0.1-20 kb, sedangkan poliakrilamid
untuk fragmen DNA berukuran 0.025-2 kb (Grompe et al., 1998). Gel agarosa
mempunyai daya pemisahan lebih rendah dibandingkan dengan gel poliakrilamid,
tetapi mempunyai rentang pemisahan yang lebih besar. Gel agarosa biasanya
dilakukan dalam konfigurasi horisontal dalam kekuatan medan listrik dan arah
tetap (Sudjadi, 2008).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Gel agarosa dibuat dengan melarutkan serbuk agarosa dalam bufer


kemudian dipanaskan dan lalu dituang pada cetakan dan didiamkan sampai
dingin. Setelah dingin dan mengeras, agarosa membentuk matriks dengan
kerapatan yang ditentukan oleh konsentrasi agarosa. Jika medan magnet diberikan
antara kedua ujung gel, maka DNA yang bermuatan negatif pada pH netral dan
bergerak ke anoda. Kecepatan migrasi dari DNA tergantung dari ukuran (panjang)
DNA, konformasi DNA, konsentrasi agarosa, dan besaran tegangan yang
digunakan

(Sudjadi, 2008). Fragmen DNA yang telah dipisahkan dengan

elektroforesis gel dapat divisualisasikan dengan cara pewarnaan gel setelah


elektroforesis selesai sehingga fragmen DNA dapat terlihat. Pewarna yang
biasanya digunakan adalah etidium bromida yang mana dapat mengikat DNA dan
akan berfluoresensi merah dibawah sinar UV (Grompe et al., 1998).
Akrilamid merupakan suatu monomer yang digunakan dalam pembuatan
gel akrilamid, yang ditambahkan amonium persulfat dan distabilkan oleh
TEMED, maka terjadi reaksi berantai sehingga monomer terpolimerisasi menjadi
rantai panjang. Jika dalam reaksi terdapat bisakrilamid, maka reaksi menjadi
bersambung melintang menjadi gel yang pori-porinya ditentukan oleh panjang
rantai dan jumlah sambungan silang. Gel poliakrilamid dibuat dengan cara
menuangkan antara dua lempeng kaca yang dipisahkan dengan pembatas dengan
ketebalan tertentu. Elektroforesis gel poliakrilamid yang digunakan untuk
memisahkan protein dengan sistem vertikal (Sudjadi, 2008).
2.6.2

Sekuensing DNA
Sekuensing adalah analisis DNA yang paling detil karena menggunakan

penentuan urutan basa-basa nukleotida. Teknik sekuensing DNA merupakan salah


satu teknik yang penting dalam teknologi DNA rekombinan karena sangat
bermanfaat untuk menentukan urutan basa nukleotida suatu gen ataupun sekuen
genom total suatu sel atau organisme. Teknik sekuensing DNA untuk pengurutan
basa DNA terdiri 2 macam cara yaitu (1) cara degradasi kimiawi oleh A. Maxam
dan W. Gilbert di Amerika, dan (2) cara determinasi rantai oleh F. Sanger dan
A.R. Coulson di Inggris (Radji, 2011).
Metode penghentian rantai dengan dideoksi (dideoxy chain termination)
yang dikembangkan oleh Sanger merupakan metode yang paling banyak

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

digunakan. Pada mulanya DNA didenaturasi dan dipisahkan menjadi untai


tunggal dengan cara pemanasan. Satu primer oligonukleotida yang telah dilabel
radioaktif ditambahkan ke dalam reaksi dan akan menempel pada sekuen
pasangannya pada DNA target. DNA polimerase digunakan untuk menyalin DNA
untai tunggal. Penambahan dNTP dalam jumlah banyak dan sampai jenuh akan
menghasilkan produk ekstensi dengan ujung terlabel radioaktif, tetapi tidak
menghasilkan informasi urutan basa. Penambahan sedikit ddNTP ke dalam
campuran dNTP akan dapat memberikan informasi urutan basa DNA.
Dideoksinukleotida akan terinkorporasi pada ujung 3' untai DNA yang baru
disintesis. DNA polimerase tidak dapat menambahkan basa baru pada ddNTP,
sehingga inkorporasi ddNTP akan mengakibatkan penghentian sintesis rantai
DNA. Penambahan dNTP dan ddNTP dengan rasio yang tepat memungkinkan
untuk menghentikan sintesis rantai DNA pada tiap posisi nukleotida (Grompe et
al., 1998).
Sebagai contohnya, jika ektensi primer dilakukan menggunakan dATP,
dTTP, dGTP dan ddCTP, maka polimerase akan mensintesis untai DNA baru
sampai harus menggunakan ddCTP. Inkorporasi ddCTP pada titik ini
menyebabkan DNA polimerase tidak dapat melanjutkan ekstensi. Dengan
demikian, panjang produk hasil ekstensi yang terlabel radioaktif menentukan
posisi G pertama yang disalin. Untuk menentukan posisi G yang lainnya, maka
reaksi sekuensing yang sebenarnya dilakukan dengan menggunakan campuran
dCTP dan ddCTP dengan perbandingan ~200:1. Pada kondisi ini kemungkinan
terjadi penghentian rantai DNA adalah ~1:200 yang terjadi ketika terdapat G pada
DNA yang disekuensing. Hasilnya akan diperoleh produk ekstensi dengan
berbagai panjang, yang kemudian divisualisasi dengan elektroforesis pada gel
poliakrilamid. Berdasarkan pada panjang produk, maka tiap fragmen akan
menentukan posisi satu G. Untuk menentukan posisi keempat basa, empat reaksi
sekuensing dilakukan untuk tiap sampel. Pada tiap reaksi dicampurkan dNTP dan
ddNTP yang sesuai dikombinasi dengan 3 dNTP lainnya dalam konsentrasi jenuh.
Keempat reaksi sekuensing kemudian dielektroforesis bersebelahan pada gel
(poliakrilamid denaturasi), sehingga hasil sekuens DNA dapat langsung dibaca
(Grompe et al., 1998). Berdasarkan perbedaan migrasi masing-masing fragmen

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

DNA, maka akan dapat ditentukan urutan basa-basa DNAnya. Hasil sekuensing
DNA merupakan urutan basa yang komplementer terhadap urutan basa-basa yang
terbaca pada hasil elektroforesis (Radji, 2011).
Perkembangan teknologi modern dewasa ini telah memungkinkan
dilakukannya automatisasi sekuensing DNA. Perkembangan peralatan yang ada
pada saat ini telah memungkinkan dapat membaca hasil sekuensing secara
langsung dan sekaligus menyimpan data ke dalam database komputer. Adanya
automasisasi dapat mengurangi faktor kesalahan yang sering terjadi dalam
pembacaan dan pemulisan urutan DNA secara manual. Mesin sekuensing
sekarang telah menggunakan fluoresen sebagai pengganti radioaktif. Senyawa
fluoresen dapat diinkorporasikan ke dalam primer sekuensing atau ke dalam
nukleotida. Pada sekuensing manual menggunakan elektroforesis gel atau
elektroforesis kapiler untuk memisahkan fragmen DNA berdasarkan ukurannya.
Pada sekuensing otomatis deteksi fragmen DNA yang berfluoresensi dilakukan
dengan bantuan sinar laser dan sinyal diproses oleh komputer (Grompe et al.,
1998).

2.7 Ekspresi Protein pada Escherichia coli


Pemilihan sistem ekspresi untuk produksi protein rekombinan tergantung
pada banyak faktor. Faktor-faktor tersebut diantaranya karakteristik pertumbuhan
sel, tingkat ekspresi, modifikasi pascatranslasi, aktivitas biologis protein, dan
regulasi produksi protein terapetik (Hodgson, 1993). Dalam pemilihan sistem
ekspresi juga perlu mempertimbangkan rincian biaya dalam proses, desain, dan
pertimbangan ekonomi lainnya (Makrides, 1996). Inang E. coli. merupakan inang
pertama yang digunakan untuk kloning dan ekspresi protein rekombinan. Inang E.
coli baik digunakan untuk ekspresi protein intraseluler yang relatif kecil dan tidak
memerlukan modifikasi pascatranslasi yang terlalu banyak untuk membuat protein
tersebut fungsional. Keuntungan sistem ekspresi pada E. coli diantaranya yaitu
mudah untuk dilakukan manipulasi DNA rekombinan serta proses seleksi dan
ekspresi yang cepat (Grompe et al., 1998).
Tidak setiap gen dapat diekspresikan secara efisien pada organisme E.
coli. Hal ini bisa disebabkan oleh sekuen gen yang unik, stabilitas dan efisiensi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

translasi mRNA, kemudahan dalam folding protein, degradasi protein oleh


protease sel inang, perbedaan besar dalam penggunaan kodon antara gen asing
dan di E. coli, serta potensi toksisitas protein ke inang. Kelemahan E. coli sebagai
sistem ekspresi mencakup ketidakmampuannya untuk melakukan banyak
modifikasi pascatranslasi pada protein eukariotik, kurangnya mekanisme sekresi
untuk efisiensi pelepasan protein ke dalam medium kultur, serta keterbatasan
kemampuan untuk memfasilitasi pembentukan ikatan disulfida yang luas. Di sisi
lain, banyak protein eukariot yang masih memiliki aktivitas biologis dalam bentuk
nonglikosilasi dan oleh karena itu dapat diproduksi dalam E. coli (Fuh et al.,
1990).
Sistem ekspresi protein rekombinan E. coli merupakan sistem pilihan
untuk produksi IFN mengingat gen ifn tidak memiliki intron, dan IFN non
glikosilasi telah diketahui bioaktif. Escherichia coli dapat ditumbuhkan mencapai
kepadatan sel yang tinggi, dan galur yang digunakan untuk produksi protein
rekombinan umumnya adalah aman. Escherichia coli juga dapat menjadi pilihan
untuk fermentasi skala besar. Sebagian besar produk farmasi yang telah
dipasarkan pada kelompok rekombinan IFN diproduksi dan dipurifikasi dari E.
coli (Rabhi-Essafi, 2007).
Sistem ekspresi untuk produksi protein rekombinan dalam E. coli melalui
kombinasi antara vektor dan galur E. coli sebagai inang ekspresi (Srensen dan
Mortensen, 2005). Protein dapat diekspresikan dengan bantuan vektor melalui
induksi ekspresi menggunakan pemberian reagen seperti isopropyl-1-thio--Dgalactopyranoside (IPTG). Reagen IPTG berfungsi melepas represi promotor
sehingga mengasilkan ekspresi protein rekombinan dalam jumlah yang tinggi.
Dilekatkannya protein tertentu pada molekul protein misalnya galaktosidase
dapat lebih menstabilkan protein, yang mana jika tidak dilekatkan mungkin akan
terdegradasi dalam E. coli. Penambahan tag pada protein yang diekspresikan
berfungsi untuk memudahkan menemukan dan mengisolasi protein setelah
diekspresikan. Tag yang banyak digunakan diantaranya Glutation-S-transferase
(GST) yang dapat diisolasi menggunakan kolom glutation atau tag histidin yang
diisolasi menggunakan kolom nikel (Grompe et al., 1998).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Ekspresi protein rekombinan pada dasarnya dapat diarahkan ke tiga lokasi


yaitu sitoplasma, periplasma atau media kultivasi (Srensen dan Mortensen,
2005). Protein IFN yang diekspresikan pada E.coli seringnya dalam bentuk
presipitasi agregat tidak larut dalam sitoplasma yang disebut dengan badan inklusi
(Swaminathan dan Khanna, 1999; Bedarrain et al., 2001; Srivasta et al., 2005),
yang umumnya merupakan protein misfolding dan secara biologis inaktif
(Villaverde dan Carrio, 2003). Proses refolding dari badan inklusi kurang
diinginkan karena hasil perolehan kembalinya rendah dan memerlukan optimasi
kondisi refolding yang berbeda untuk setiap protein target (Middelberg, 2002).
Selain itu, proses resolubilisasi tidak dapat secara penuh mengembalikan pelipatan
protein dan fungsi yang optimal protein (Fathallah et al., 2009).
Beberapa bagian dari protein yang diekspresikan seperti ikatan disulfida
(Lilie et al., 1998; Makrides, 1996), modifikasi pascatranslasi (Zhang et al.,
1998), hidrofobisitas, muatan (net charge) dan struktur sekunder merupakan
faktor-faktor yang menentukan dalam pembentukan badan inklusi (Chiti et al.,
2003). Faktor-faktor lain yang juga menentukan pembentukan badan inklusi yaitu
terkait dengan lingkungan tempat protein diekspresikan diantaranya pH dan
temperatur (Yon, 2002). Reaksi agregasi terjadi pada suhu yang tinggi karena
temperatur yang kuat dapat meningkatkan kekuatan interaksi hidrofobik sehingga
membuat pelipatan protein salah (Kiefhaber et al., 1991).
Tujuan utama ekspresi protein rekombinan pada sistem bakteria adalah
mendapatkan akumulasi tingkat tinggi produk terlarut protein rekombinan
(Villaverde dan Carrio, 2003). Kelarutan protein target dapat dipengaruhi oleh
temperatur induksi dan waktu induksi. Temperatur yang lebih rendah menjadikan
level ekspresi lebih lambat sehingga terjadi peningkatkan pelipatan protein target,
meskipun dapat menurunkan hasil protein target. Waktu induksi yang lama juga
dapat meningkatkan ekspresi, akan tetapi dapat menginduksi proteolisis protein
target, terjadinya heterogenitas sampel dan menurunkan hasil yang diperoleh
(Fathallah et al., 2009).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

2.8 Analisis Protein


Analisis protein dapat dilakukan dengan menggunakan berbagai metode
diantaranya yaitu :
2.8.1

Western Blot
Protein spesifik dalam campuran protein dapat diidentifikasi dengan teknik

Western blotting. Pada metode Western blotting, protein dipisahkan berdasarkan


ukuran massanya dengan cara elektroforesis gel poliakrilamida SDS-PAGE
(sodium dodecyl sulfate polyacrilamide gel electrophoresis) dengan sistem
vertikal (Kuby, 1994). Protein yang akan dielektroforesis sebelumnya ditambah
dengan SDS dan kemudian dipanaskan. Sodium dedosil sulfat merupakan suatu
detergen

anionik

yang

berguna

untuk

menyelubungi

molekul

protein.

Penyelubungan protein menyebabkan terganggunya interaksi non-kovalen


sehingga molekul protein dalam struktur primer. Merkaptoetanol juga
ditambahkan untuk mereduksi ikatan disulfida. Kompleks SDS dengan protein
yang terdenaturasi memiliki jumlah muatan negatif yang sebanding dengan
ukuran protein (Sudjadi, 2008)
Kompleks protein-SDS kemudian dielektroforesis sehingga molekul
protein bergerak menuju kutub positif dan terpisah berdasarkan ukuran massanya.
Protein yang telah terpisahkan menjadi pita-pita pada gel poliakriamid kemudian
ditransfer ke membran nitroselulosa. Proses transfer makromolekul dari gel ke
membaran nitriselulosa disebut dengan proses blotting (Radji, 2011). Identifikasi
protein dilakukan dengan merendam membran nitroselulosa dalam larutan yang
mengandung antibodi primer, kemudian dicuci untuk menghilangkan antibodi
primer yang tidak berikatan dengan protein target. Langkah selanjutnya adalah
penambahan antibodi sekunder yang hanya melekat pada antibodi sekunder dan
tidak melekat pada protein target. Antibodi sekunder telah terkonjugasi dengan
suatu enzim yang dapat divisualisasikan dengan penambahan substrat karena
dapat mengoksidasi substrat yang tidak berwarna menjadi berwarna (Sudjadi,
2008).
2.8.2

Analisis Densitometri
Densitas merupakan kemampuan sebuah material untuk menyerap atau

memantulkan sinar. Densitas dapat dibedakan menjadi dua bagian yaitu densitas

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

transmisi yaitu kemampuan lapisan material untuk menyerap sinar yang datang
dan densitas refleksi yaitu kemampuan lapisan material untuk memantulkan sinar
yang datang. Pengukuran densitas dapat menggunakan sebuat alat ukur yang
disebut densitometer. Densitometer merupakan alat yang berfungsi untuk
mengukur besarnya densitas atau dengan kata lain merupakan alat yang digunakan
untuk mengukur derajat kehitaman atau kepekatan (densitas optis) suatu model
atau bahan semi-transparan (Siregar, 2009).
Analisis densitometri merupakan salah satu cara untuk konfirmasi hasil
elektroforesis. Hasil analisis densitometri terhadap pita-pita pada gel hasil
elektroforesis dapat digunakan untuk konfirmasi keberadaan pita, dan untuk
kuantifikasi proporsi penyusun protein yang dielektroforesis (Aulanniam, 2004).
Suatu pita menandakan adanya akumulasi protein pada gel hasil elektroforesis
diidentifikasi sebagai oleh suatu puncak (peak). Masing-masing puncak memiliki
karakteristik ketinggian (height) sebagai intensitas densitograf dan luas daerah di
bawah kurva (area) sebagai gambaran kuantitas protein pada pita tersebut.
Ketebalan pita pada gel hasil SDS-PAGE dikuantifikasi dalam bentuk luas daerah
di bawah kurva pada kurva densitograf (Mustofa et al., 2006).
Kuantifikasi intensitas pita Western blot dapat dilakukan dengan sistem
digitalisasi automatik menggunakan UN-SCAN-IT. Program UN-SCAN-IT dapat
mengkuantifikasi data Western blot dengan menggunakan dua metode. Metode
analisis segmental memberikan informasi piksel total dan analisis pita pada setiap
segmen, sedangkan analisis lane yang memberikan informasi profil densitas
ekstraksi dan analisis pita untuk seluruh jalur (lane). Pada pengukuran pita
dilakukan pemindaian sebagai JPEG dalam format 8 bit grayscale pada 600 dpi
dan intensitas piksel. Pada pengukuran intensitas piksel dilakukan pengkoreksian
terhadap latar (background). Derajat kehitaman atau kepekatan digunakan
program UN-SCAN-IT untuk menganalisa pita dan diukur dalam bentuk piksel.
Piksel adalah unsur gambar atau representasi sebuah titik terkecil dalam sebuah
gambar grafis yang dihitung per inci. Data digital piksel total yang diperoleh dapat
digunakan untuk menghitung kepadatan optik relatif pada setiap pita untuk
analisis yang lebih lanjut (Rezvani et al., 2009).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

BAB 3
METODE PENELITIAN

3.1 Tempat dan Waktu


Penelitian ini dilakukan di laboratorium Terapetik Protein dan Vaksin,
Bidang Biologi Molekuler, Pusat Penelitian Bioteknologi, Lembaga Ilmu
Pengetahuan Indonesia. Waktu pelaksaan penelitian adalah dari bulan Juli 2011
sampai Juli 2012.

3.2 Bahan dan Alat


3.2.1 Bahan
Aquades, aquabides (ddH2O), nuclease free water, GoTaq Green Master
Mix (Promega), enzim restriksi Nco I, Xho I, dan Mlu I (Roche), primer
IFN_NcoI_F 5' CATGCCATGGCCTGTGATCTGCCTCAAACC 3' (1st BASE),
primer IFN_XhoI_R 5' CCGCTCGAGTCATTCCTTACTTCTTAAAC 3' (1st
BASE), primer pET_Screen_F 5' TAATACGACTCACTATAGGGGAAT 3' (1st
BASE), primer pET_Screen_R 5' TTATTGCTCAGCGGTGGCAGCAGC 3' (1st
BASE), STag-18mer-primer 5' GAACGCCAGCACATGGAC 3' (Macrogen),
T7terminator-primer 5' GCTAGTTATTGCTCAGCGG 3' (Macrogen), agarosa
(Fermentas), marker DNA 1 kilo basa (Fermentas), loading buffer, etidium
bromida (EtBr), enzim T4 DNA ligase (NEB), DNA ligation buffer (NEB),
Agarose Gel DNA Extrction Kit (Roche), metanol, etanol, kalsium klorida
(CaCl2), ampisilin (Sigma), ekstrak ragi (Difco), tripton (Difco), agar bakto
(Difco), isopropyl-1-thio--D-galactopyranoside /IPTG (Roche), natriun klorida
(NaCl), sodium deodesil sulfat (SDS), akrilamid, ammonium persulfat (APS),
separating gel buffer, stacking gel buffer, tetrametil metilen diamin (TEMED),
bufer elektroforesis, nitro blue tetrazolium/NBT (Promega), 5-bromo-4chloro-3indolyl-phosphate/BCIP (Promega), Anti--Interferon Mouse mAb (MMHA-2)
(Calbiochem), Anti-mouse IgG (H+L) AP conjugate (Promega), etanol, metanol,
gen sintetik human ifn 2a dalam vektor pcDNA3.1+:IFN-Gene (DNA 2.0 Inc.,
Menlo Park), vektor pET-32b(+) (Novagen), E. coli galur DH5 (Invitrogen), E.
coli galur BL21(DE3) (Novagen).
25

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

3.2.2 Alat
Alat PCR (Biometra), alat elektroforeis DNA (Advance), alat elektroforeis
protein (Bio-rad), Ultraviolet (UV) Transiluminator, autoklaf, inkubator shaker,
penangas air, laminar, lemari pendingin -20C, lemari pendingin 4C, oven,
mikropipet, vortex, sentrifus, cawan petri, labu erlenmeyer, tabung reaksi, tip,
tabung PCR, tabung sentrifus.
3.3 Tahap Kerja
Metode yang digunakan dalam penelitian ini secara garis besar
berdasarkan metode pada buku panduan pET Sistem Manual (2006).
3.3.1

Penyiapan DNA insert


Penyiapan DNA insert dilakukan dengan metode PCR menggunakan

cetakan gen human ifn 2a dalam vektor pcDNA3.1+IFN-Gene. Proses PCR


dilakukan dengan menggunakan sepasang primer yaitu IFN_Nco_I F 5'
CATGCCATGGCCTGTGATCTGCCTCAAACC 3' dan IFN_Xho_I R 5'
CCGCTCGAGTCATTCCTTACTTCTTAAAC 3' yang telah ditambahkan situs
pemotongan Nco I dan Xho I yang dicetak miring dan digaris bawahi. Proses PCR
dimulai dengan dicampurkannya semua komponen yang dibutuhkan dalam reaksi
ke dalam tabung PCR, yaitu ddH2O (6,5 l), DNA (2 l), primer IFN_NcoI_F (2
l), primer IFN_XhoI_R (2 l), dan GoTaq Green Master Mix (12,5 l) sehingga
volume totalnya 25l. Reaksi PCR dilakukan dengan siklus sebagai berikut:
denaturasi awal pada suhu 94C selama 5 menit, denaturasi 94C selama 1 menit,
penempelan 55C selama 1 menit, dan polimerisasi 72C selama 2 menit (tiga
tahap ini dilakukan sebanyak 30 siklus) serta polimerisasi akhir pada suhu 72C
selama 6 menit (pET Sistem Manual, 2006).
Produk hasil PCR selanjutnya dilakukan pengecekan dengan metode
elektroforesis pada medium agarosa 1% dengan sampel hasil PCR (5 l), ddH2O
(5 l), loading buffer (2 l) dengan tegangan 100 volt selama kurang lebih 30
menit. Elektroforesis dilakukan sampai loading buffer mencapai dua pertiga dari
panjang gel. Gel agarosa kemudian diwarnai dengan larutan EtBr dan diamati
diatas sinar UV. Hasil PCR yang benar kemudian dilakukan purifikasi dengan
menggunakan 2 metode yang berbeda yaitu gel (Agarose Gel DNA Extraction Kit)
dan metode fenol kloroform.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Tahapan purifikasi hasil PCR menggunakan Agarose Gel DNA Extraction


Kit dilakukan berdasarkan manual (Roche) adalah:
1. Hasil PCR 60 l dielektroforesis pada gel agarosa 1%, kemudian
divisualisasikan dengan etidium bromida (EtBr).
2. Gel agarosa dilihat pada UV transiluminator, selanjutnya pita fragmen hasil
PCR diambil dengan dipotong menggunakan scalpel kemudian dimasukkan ke
tabung 2 ml.
3. Berat agarosa lalu ditimbang dan ditambahkan 300 l agarose solubilisation
buffer (vial 2) per 100 mg gel agarosa.
4. Sebanyak 10 l suspensi silika (vial 1) ditambahkan ke campuran untuk
mengikat DNA.
5. Campuran diinkubasi selama 10 menit pada suhu 57C dan divortex setiap 2
menit.
6. Campuran selanjutnya disentrifus 12.000 rpm selama 1 menit dan
supernatannya dibuang dengan pemipetan.
7. Pelet ditambahkan 500 l nucleic acid binding buffer (vial 3) dan divortex.
8. Campuran lalu disentrifus 12.000 rpm selama 1 menit dan supernatannya
dibuang dengan pemipetan.
9. Pelet dicuci dengan 500 l washing buffer (vial 4).
10. Campuran disentrifus 12.000 rpm selama 1 menit dan supernatannya dibuang
dengan pemipetan.
11. Pelet dicuci lagi dengan 500 l washing buffer (vial 4).
12. Campuran disentrifus 12.000 rpm selama 1 menit dan supernatannya dibuang
dengan pemipetan.
13. Proses pengeringan dilakukan pada suhu kamar selama 10-15 menit.
14. Pelet dilarutkan dengan 20 l nuclease free water dan diinkubasi 10 menit
pada suhu 15-25C untuk DNA insert, sedangkan untuk vektor diinkubasi 10
menit pada suhu 56-60C dengan divortex setiap 2-3 menit.
15. Campuran disentrifus 12.000 rpm selama 1 menit dan supernatan diambil dan
dipindahkan ke tabung baru.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Tahapan proses purifikasi hasil PCR dengan metode fenol kloroform


yaitu:
1. Hasil PCR 60 l ditambahkan ddH2O 90 l kemudian ditambahkan 150 l
fenol kloroform dan divortex.
2. Campuran disentrifus 12.000 rpm selama 5 menit pada suhu 4C.
3. Bagian atasnya diambil dan dipindahkan ke tabung baru kemudian
ditambahkan etanol absolut (2,5 kali volume) dan disimpan semalam.
4. Campuran disentrifus 12.000 rpm selama 30 menit pada suhu 4C dan
supernatan dibuang dengan pemipetan.
5. Pelet dicuci dengan 1 ml etanol 70%, disentrifus 12.000 rpm selama 5 menit
pada suhu 40C kemudian supernatan dibuang dengan pemipetan.
7. Pelet dikeringkan pada suhu kamar kurang lebih 30 menit selanjutnya
dilarutkan dengan 20 l nuclease free water.
Hasil PCR yang telah dipurifikasi kemudian dipotong menggunakan enzim
restriksi Nco I dan Xho I dan dilanjutkan purifikasi dengan fenol kloroform.
Proses pemotongan dimulai dengan dicampurkannya semua komponen ke dalam
tabung, yaitu ddH2O (10,5 l), bufer H (2,5 l), hasil PCR yang telah dipurifikasi
(10 l), enzim Nco I (1 l), enzim Xho I (1 l) dengan volume total 25 l dan
diinkubasi pada suhu 37C dalam penangas air (waterbath) selama 1 jam. Hasil
dari proses pemotongan kemudian dilakukan pengecekan dengan metode
elektroforesis pada medium agarosa 1% dengan sampel (2 l), ddH2O (8 l),
loading buffer (2 l) dan diamati diatas sinar UV. Tahapan proses purifikasi DNA
insert yang telah dipotong dengan metode fenol kloroform yaitu:
1. DNA insert hasil pemotongan 23 l ditambahkan ddH2O 100 l kemudian
ditambahkan 130 l fenol kloroform dan divortex.
2. Campuran disentrifus 12.000 rpm selama 5 menit pada suhu 4C.
3. Bagian atasnya diambil dan dipindahkan ke tabung baru kemudian
ditambahkan etanol absolut (2,5 kali volume) dan disimpan semalam.
4. Campuran disentrifus 12.000 rpm selama 30 menit pada suhu 4C, kemudian
supernatan dibuang dengan pemipetan.
5. Pelet dicuci dengan 1 ml etanol 70% dan disentrifus 12.000 rpm selama 5
menit pada suhu 4C kemudian supernatan dibuang dengan pemipetan.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

7. Pelet dikeringkan pada suhu kamar kurang lebih 30 menit selanjutnya


dilarutkan dengan 20 l nuclease free water.

3.3.2

Penyiapan Vektor pET-32b(+)


Vektor pET-32b(+) dengan konsentrasi 300 ng/l dilakukan pemotongan

dengan enzim restriksi Nco I dan Xho I pada suhu 37C selama 1 jam. Proses
pemotongan vektor pET-32b(+) dimulai dengan dicampurkannya semua
komponen ke dalam tabung, yaitu ddH2O (16,5 l), bufer H (2,5 l), vektor pET32b(+) (4 l), enzim Nco I (1 l), enzim Xho I (1 l) dengan volume total 25 l
dan selanjutnya diinkubasi pada suhu 37C dalam penangas air selama 1 jam.
Hasil proses pemotongan kemudian dilakukan pengecekan dengan metode
elektroforesis pada medium agarosa 1% dengan sampel (3 l), ddH2O (7 l),
loading buffer (2 l) dan dilakukan pengamatan diatas sinar UV. Vektor pET32b(+) yang telah dipotong kemudian dipurifikasi menggunakan fenol kloroform
yang mana metodenya serupa dengan purifikasi fenol kloroform pada penyiapan
DNA insert.
Vektor pET-32b(+) yang telah linear selanjutnya dilakukan tahapan ligasi
dengan DNA insert (gen human ifn 2a) yang telah dipersiapkan. Reaksi ligasi
terdiri dari nuclease free water (12 l), bufer T4 DNA ligase (2 l), vektor pET32b(+) (2 l), DNA insert (3 l), enzim T4 DNA ligase (1 l) dengan volume
total 20 l dan diinkubasi pada suhu 4C semalam. Hasil dari proses ligasi
diharapakan dapat diperoleh vektor rekombinan pET-32b(+)-IFN 2a yang
sirkuler.

3.3.3

Pembuatan Sel Kompeten E. coli


Proses pembuatan sel kompeten E. coli adalah sebagai berikut :

1. Stok beku 20 l dari koloni tunggal E. coli diinokulasikan pada 4 ml LB cair


dan ditumbuhkan pada suhu 37C dikocok 200 rpm semalam.
2. Sebanyak 800 l kultur semalam diinokulasikan pada 100 ml LB cair dan
ditumbuhkan pada suhu 37C dikocok 250 rpm selama 3 jam.
3. Kultur didinginkan di es selama 5-10 menit kemudian dituang ke 3 tabung
sentrifus masing-masing 35 ml.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

4. Kultur disentrifus 6000 rpm pada suhu 4C selama 5 menit dan supernatan
dibuang.
5. Pelet diresuspen dalam 4 ml CaCl2 60 mM dingin untuk masing-masing
tabung, dikocok-kocok supaya homogen.
6. Campuran didiamkan di es 30 menit lalu disentrifus 6000 rpm pada suhu 4C
selama 5 menit dan supernatannya dibuang.
7. Pelet diresuspen dalam 4 ml CaCl2 60 mM dingin untuk masing-masing
tabung, dikocok-kocok supaya homogenkan.
8. Campuran didiamkan di es selama 30 menit lalu disentrifus 6000 rpm pada
suhu 4C selama 5 menit dan supernatannya dibuang.
9. Pelet diresuspen dengan 1 ml CaCl2 60 mM dingin untuk masing-masing
tabung, kemudian digabung menjadi satu dan ditambah 1 ml CaCl2 60 mM
sehingga volume akhir 4 ml. Sel kompeten dapat langsung digunakan atau
disimpan semalam dalam lemari es 4C untuk meningkatkan kompetensi.

3.3.4

Kloning Gen human ifn 2a


Hasil ligasi kemudian ditransformasikan pada sel kompeten E. coli galur

DH5 sebagai inang kloning. Proses transformasi dilakukan dengan menggunakan


metode heat shock pada suhu 42C selama 90 detik (Radji, 2011). Adapun proses
dari transformasi adalah sebagai berikut:
1. Sel kompeten 100 l ditambahkan hasil ligasi 5-10 l.
2. Campuran diinkubasi di es selama 30 menit.
3. Campuran dilakukan heat shock pada penangas air suhu 42C selama 90 detik.
4. Campuran didinginkan di es selama 1 menit.
5. Campuran ditambahkan 400 l LB cair steril.
6. Campuran diinkubasi pada suhu 37C dengan dikocok selama 45 menit.
7. Campuran diinokulasi ke media LB agar yang telah ditambah ampisilin
dengan metode sebar 20 l, 50 l, 80 l, dan 350 l (suspensi sel 350 l
disentrifus dulu dan buang supernantan sisakan 80 l).
8. Tahap inkubasi dilakukan pada inkubator 37C semalan dan selanjutnya
diisolasi koloni tunggal yang tumbuh.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Hasil transformasi ditumbuhkan pada media LB padat yang ditambah


ampisilin (pET Sistem Manual, 2006). Sebagai kontrol negatif digunakan suspensi
sel kompeten yang ditumbuhkan pada media LB padat yang ditambah ampisilin.
Klon transforman E. coli diseleksi dengan menggunakan marker antibiotik
ampisilin. Hanya klon E. coli yang mengandung vektor rekombinan pET-32b(+)IFN 2a yang dapat tumbuh pada media LB padat yang ditambah ampisilin.
3.3.5

Skrining dan Verifikasi Klon Transforman di E. coli DH5


Verifikasi masuknya gen DNA insert pada vektor rekombinan dilakukan

dengan beberapa metode yaitu PCR colony screening, isolasi vektor rekombinan
pET-32b(+)-IFN 2a, analisis restriksi dan juga sekuensing (pET Sistem Manual,
2006). Proses PCR colony screening dilakukan dengan menggunakan primer
pET_Screen_F 5' TAATACGACTCACTATAGGGGAAT 3' dan pET_Screen_R
5' TTATTGCTCAGCGGTGGCAGCAGC 3'. Metode PCR colony screening
dilakukan dengan tahapan sebagai berikut:
1. Koloni yang tumbuh berdiameter lebih dari 1 mm diambil dengan pipet tip.
2. Pipet tip dicelupkan ke tabung 0,5 ml yang telah diisi 50 l aquades.
3. Tabung dipanaskan di heat block pada suhu 99C selama 5 menit untuk
melisiskan sel dan merusak DNAse.
4. Campuran disentrifus pada 12.000 rpm selama 1 menit untuk mengendapkan
debris sel.
5. Campuran diambil 10 l supernatan dan dilakukan prosesPCR.
6. Reaksi PCR terdiri atas supernatan (10l), primer pET_Screen_F (2 l),
primer pET_Screen_R (2 l), GoTag Green Master Mix (12,5 l) dengan
volume total 26,5 l.
7. Setelah proses PCR selesai dilakukan pengecekan dengan elektrofosesis gel
agarosa dan divisualisasikan menggunakan EtBr.

3.3.6 Kultivasi dan Isolasi Vektor Rekombinan


Metode isolasi vektor rekombinan pET-32b(+)-IFN 2a dilakukan dengan
tahapan sebagai berikut:
1. Media LB cair dibuat dan disterilisasi dengan autoklaf.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Contoh pembuatan media LB cair 10 ml yaitu: bakto tripton 1% = 0,2 gram,


ekstrak ragi 0,5% = 0,1 gram, NaCl 1% = 0,2 gram (pET Sistem Manual,
2006). Setelah steril dan sebelum digunakan perlu ditambahakan 10 l
ampisilin 5%.
2. Koloni tunggal diinokulasikan ke dalam tabung yang berisi media 3 ml yang
telah ditambah ampisilin dan diinkubasi semalam pada suhu 37C dengan
dikocok 200 rpm.
3. Kultur diambil dan dimasukkan ke tabung steril 1,5 ml kemudian disentrifus
12.000 rpm selama 1 menit. Selain itu juga dilakukan pembuatan kultur stok
yang disimpan pada suhu -20C dengan ditambah gliserol.
4. Supernatan dibuang dengan pemipetan kemudian pelet divortex.
5. Pelet ditambahkan 150 l larutan 1 diaduk sampai larut dan divortex
kemudian diinkubasi di es selama 10 menit. Larutan 1 terdiri dari 50 mM
glukosa, 25 mM tris pH 8, 10 mM EDTA dan ddH2O.
6. Campuran ditambahkan 180 l larutan 2 diaduk perlahan-lahan sampai ada
lendir kemudian ditaruh dies selama 10 menit. Larutan 2 terdiri dari 0,2 M
NaOH, SDS 1% dan ddH2O.
7. Campuran ditambahkan 135 l larutan 3 dingin (sodium asetat 3 M pH 5,7)
diaduk perlahan-lahan dan dibolak-balik.
8. Campuran disentrifus 12.000 rpm pada suhu 4C selama 5 menit. Pada pelet
berisi DNA genom, sedangkan pada supernatan berisi DNA vektor.
9. Supernatan diambil dan dipindahkan ke tabung baru, ditambahkan 400 ml
fenol kloroform (1:1) kemudian divortex.
10. Campuran disentrifus 12.000 rpm selama 5 menit pada suhu 4C.
11. Bagian atas diambil dan pindahkan ke tabung baru kemudian ditambahkan
etanol absolut (2,5 kali volume) dan disimpan semalam.
12. Campuran disentrifus 12.000 rpm selama 30 menit pada suhu 4C kemudian
supernatan dibuang dengan dipipet.
13. Pelet dicuci dengan ditambahkan 1 ml etanol 70%.
14. Campuran disentrifus 12.000 rpm selama 5 menit pada suhu 4C kemudian
supernatan dibuang dengan aspirasi.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

15. Pelet dikeringkan pada suhu kamar kurang lebih 30 menit dan dilarutkan
dengan 20 ml ddH2O yang ditambah 1 l RNAse 1:5.
16. Campuran diinkubasi selama 20-60 menit pada 37C, lalu disimpan di -20C.
Vektor rekombinan pET-32b(+)-IFN 2a yang telah diisolasi selanjutnya
dilakukan analisis restriksi dan disekuen untuk konfirmasi adanya DNA insert dan
peletakan kodon yang tepat. Vektor rekombinan pET-32b(+)-IFN 2a dilakukan
pemotongan kembali menggunakan enzim restriksi Nco I dan Xho I. Komponen
analisis restriksi terdiri dari ddH2O (12,5 l), bufer H (2,5 l), vektor rekombinan
(8 l), enzim Nco I (1 l), enzim Xho I (1 l) dengan total volume 25 l dan
diinkubasi 37C pada penangas air selama 1 jam. Hasil pemotongan kemudian
dielektroforesis pada gel agarosa 1%.
Vektor rekombinan pET-32b(+)-IFN2a yang telah benar selanjutnya
dilakukan perbanyakan dengan dikultivasi. Isolasi dan purifikasi purifikasi vektor
rekombinan dilakukan dengan Qiagen Plasmid Maxi Kit serta diukur
konsentrasinya menggunakan alat Nanophotometer. Prosedur Qiagen Plasmid
Maxi Kit adalah sebagai berikut:
1. Kultur stok gliserol 35 l ditumbuhkan ke dalam LB cair 5 ml yang telah
ditambah ampisilin dan diinkubasi pada 37C dikocok 200 rpm semalam.
2. Kultur diambil 4 ml dan diinokulasikan ke LB cair 200 ml yang telah
ditambah ampisilin.
3. Kultur diinkubasi pada 37C dikocok 200 rpm selama 6 jam.
4. Kloramfenikol 30 mg ditambahkan dan diinkubasi pada 37C dikocok 200
rpm semalam.
5. Pemanenan sel dilakukan dengan disentrifus pada 4000 rpm 4C selama 15
menit dan supernatannya dibuang.
6. Pelet diresuspensi dengan 10 ml bufer P1 yang mana sudah mengandung
RNase.
7. Bufer P2 10 ml ditambahkan dengan dibolak-balik 5 kali dan campuran
selanjutnya diinkubasi selama 5 menit pada suhu kamar.
8. Bufer P3 10 ml dingin ditambahkan dan dihomogenkan dengan dibolak-balik
5 kali dan campuran selanjutnya diinkubasi selama 20 menit pada suhu kamar.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

9. Campuran disentrifus pada 13.000 rpm 4C selama 30 menit dan


supernatannya diambil.
10. Qiagen tip 500 diekuilibrasi dengan ditambahkan 10 ml bufer QBT dan bufer
dibiarkan keluar menetes karena gaya gravitasi sampai kolom menjadi kosong.
11. Supernatan dimasukkan ke Qiagen tip 500.
12. Qiagen tip 500 dilakukan pencucian 2 kali dengan 30 ml bufer QC.
13. DNA plasmid dielusi dengan ditambahkan 15 ml buffer QF.
14. Hasil elusi dipresipitasi dengan ditambahkan 10,5 ml isopropanol.
15. Campuran disentrifus pada 13.000 rpm 4C selama 30 menit dan
supernatannya dibuang.
16. Pelet dicuci dengan ditambahkan 5 ml etanol 70% dan disentrifus pada 13.000
rpm 4C selama 10 menit dan supernatannya dibuang.
17. Pelet dikeringkan pada suhu ruang selama 10 menit kemudian pelet dilarutkan
2 ml nuclease free water.
Karakterisasi selanjutnya yaitu dengan analisis urutan nukleotida
menggunakan metode sekuensing. Pembacaan dilakukan dua arah yaitu
menggunakan STag-18mer-primer dan T7terminator-primer. Penentuan urutan
nukleotida dilakukan di Korea (Macrogen).

3.3.7

Transformasi Vektor Rekombinan ke E.coli BL21(DE3)


Vektor

rekombinan

pET-32b(+)-IFN2a

yang

benar

selanjutnya

ditransformasikan ke sel kompeten E. coli BL21(DE3) untuk mengekspresikan


protein rekombinan human IFN 2a. Metode transformasi yang digunakan yaitu
heat shock pada suhu 42C selama 90 detik. Tahapan transformasi vektor
rekombinan pET-32b(+)-IFN2a ke sel kompeten E. coli BL21(DE3) dilakukan
seperti metode transformasi hasil ligasi ke sel kompeten E. coli DH5. Hasil
transformasi kemudian ditumbuhkan pada media LB padat yang ditambah
ampisilin (pET Sistem Manual, 2006).

3.3.8

Skrining dan Verifikasi Klon Transforman di E. coli BL21(DE3)


Klon transforman E. coli BL21(DE3) yang diperoleh diseleksi dengan

media selektif LB padat yang mengandung antibiotik ampisilin. Verifikasi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

masuknya vektor rekombinan pET-32b(+)-IFN 2a pada inang ekspresi E. coli


BL21(DE3) dilakukan menggunakan PCR colony screening dan indentifikasi
protein terfusi. Proses PCR colony screening klon transforman E. coli BL21(DE3)
dilakukan seperti PCR colony screening pada klon transforman E. coli DH5.
Hasil proses PCR colony screening kemudian dilakukan pengecekan dengan
metode elektroforesis pada medium agarosa 1% dengan sampel (5 l), ddH2O (5
l), loading buffer (2 l) dilakukan pewarnaan dengan EtBr dan diamati diatas
sinar UV.

3.3.9

Ekspresi, Isolasi dan Karakterisasi Protein Rekombinan Human IFN


2a
Klon transforman E. coli BL21(DE3) yang terpilih selanjutnya dilakukan

uji ekspresi protein rekombinan pada skala kecil menggunakan medium produksi
yaitu media LB cair 10 ml yang ditambah 50 g/ml ampisilin. Inkubasi dilakukan
dengan variasi suhu pada 28C, 30C dan 37C. Kultur sel bakteri pada OD600
sekitar 0,5 diinduksi menggunakan IPTG konsentrasi akhir 1 mM. Adapun
protokol induksi yang digunakan adalah sebagai berikut:
1. Kultur stok gliserol 20 l ditumbuhkan pada media LB cair 3 ml yang telah
ditambah ampisilin dan diinkubasi pada 37C dikocok 200 rpm semalam.
2. Kultur semalam diambil 0,5 ml dan dimasukkan ke LB cair 10 ml yang telah
ditambah ampisilin.
3. Kultur ditumbuhkan dengan dikocok 250 rpm pada suhu 37C mencapai
OD600: 0,5 sekitar 2 jam.
4. Kultur diambil 0,5 ml dimasukkan ke tabung 1,5 ml dan disentrifus pada 8000
rpm 4C selama 10 menit, selanjutnya dipisahkan antara supernatan dan pelet
sebagai sampel 0 jam sebelum induksi lalu disimpan pada -20C.
5. Kultur diinduksi dengan penambahan IPTG konsentrasi akhir 1 mM dan
dilanjutkan inkubasi pada variasi suhu 28C, 30C, dan 37C dengan dikocok
250 rpm.
6. Pengambilan sampel 0,5 ml dilakukan pada waktu 1, 2, 3, 4, 5, 6, 7 jam dan
semalam, selanjutnya disentrifus dan dipisahkan antara supernatan dan pelet

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

lalu

disimpan

pada

-20C.

Pelet

selanjutnya

diresuspensi

dengan

menggunakan 100 l buffer PBS 1x.


Isolasi protein rekombinan human IFN 2a dari pelet dilakukan dengan
metode sebagai berikut:
1. Kultur stok gliserol 20 l ditumbuhkan pada media LB cair 3 ml yang telah
ditambah ampisilin dan diinkubasi pada 37C dikocok 200 rpm semalam.
2. Kultur semalam diambil 1,25 ml dan dimasukkan ke LB cair 25 ml yang telah
ditambah ampisilin.
3. Kultur ditumbuhkan dengan dikocok 250 rpm pada suhu 37C mencapai
OD600: 0,5 sekitar 2 jam.
4. Kultur diinduksi dengan penambahan IPTG konsentrasi akhir 1 mM dan
dilanjutkan inkubasi pada suhu 37C dengan dikocok 250 rpm.
5. Pemanenan sel dilakukan setelah 5 jam inkubasi dengan disentrifugasi 12.000
rpm pada suhu 4C selama 10 menit untuk memisahkan pelet dan supernatan.
6. Pelet diresuspensi dengan 2,5 ml bufer 50 mM tris HCl pH 8 yang ditambah 1
mM EDTA dan 1 mM PMSF.
7. Campuran disonikasi sebanyak 10 kali selama 30 detik di es dengan selang
waktu 30 detik di es.
8. Campuran disentrifugasi pada 12.000 rpm suhu 4C selama 10 menit untuk
memisahkan antara supernatan (protein terlarut di sitoplasma) dan pelet.
9. Pelet dicuci dengan bufer 50 mM tris HCl yang ditambah 1% triton X-100
(750 l bufer untuk 0,1 gram pelet).
10. Campuran diikubasi 5 menit pada suhu kamar dan selanjutnya disentrifus
12.000 rpm pada suhu 4C selama 5 menit.
11. Tahap pencucian dilakukan sebanyak 2 kali.
12. Pelet disolubilisasi dengan bufer 50 mM tris HCl yang ditambah 6 M guanidin
HCl dan 800 mM merkaptoetanol (750 l bufer untuk 0,1 gram pelet).
13. Campurn diinkubasi selama 30 menit pada suhu kamar dan selanjutnya
disentrifus pada 12.000 rpm pada suhu 4C selama 15 menit.
14. Supernatan dipisahkan dari pelet selanjutnya di cek menggunakan SDS PAGE
dengan pewarnaan CBB atau Western blot dan penyimpanan dilakukan pada

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

suhu -20C. Supernatan merupakan protein yang tidak terlarut yaitu sebagai
badan inklusi di dalam sitoplasma.
Karakterisasi protein rekombinan human IFN 2a yang diperoleh
dilakukan dengan metode elektroforesis SDS-PAGE yang dilanjutkan dengan
pewarnaan CBB atau Western blot. Tahapan metode elektroforesis SDS-PAGE
adalah sebagai berikut:
1. Pembuatan gel poliakrilamid yang terdiri atas separating gel dan stacking gel.
Larutan separating gel 12%: 1,5 M tris HCl pH 8,8 (2,5 ml); 10% SDS (100
l); 40% akrilamid (3 ml); aquades (4,4 ml); APS 10% (100 l); TEMED (6
l). Larutan separating gel dimasukkan dalam cetakan dan dibiarkan selama
30 menit supaya berpolimerisasi sehingga terbentuk gel.
Larutan stacking gel: 0,5 M tris HCl pH 6,8 (1,25 ml); 10% SDS (100 l);
40% akrilamid (900 l); aquades (7 ml); APS 10% (100 l); TEMED (15 l).
Larutan stacking gel dimasukkan ke dalam cetakan pada posisi diatas
separating gel kemudian sisir dimasukkan pada cetakan dan gel akan
terbentuk setelah 30 menit.
2. Penyiapan sampel untuk dielektroforesis.
Pada supernatan dan pelet masing-masing diambil 10 l dimasukkan ke dalam
tabung dan ditambahkan 10 l loading buffer RSB 2x (1:1) lalu dipanaskan
pada 95C selama 4 menit. Marker 5 l ditambah 5 l loading bufer RSB 2x.
3. Sampel dimasukkan kedalam sumuran dan dielektroforesis dalam bufer
elektroforesis pada tegangan 90 volt selama 90 menit.
Bufer elektroforesis untuk 1 liter pH 8,3: tris 15,5 g, glisin 72 g, SDS 5 g, lalu
ditambah aquades sampai 1 liter.
Gel poliakrilamid yang telah selesai dielektroforesis SDS PAGE kemudian
dikarakterisasi dengan pewarnaan commasie brilliant blue (CBB) atau
menggunakan Western blot. Proses pewarnaan CBB adalah sebagai berikut:
1. Gel SDS-PAGE diinkubasi dengan stain (40% metanol: 20 ml; 7% asam
asetat glasial: 3,5 ml; ddH2O: 26,5 ml; CBB stain: 6 ml) dan dikocok 3 jam.
2. Gel dicuci dengan destain I (40% metanol: 20 ml; 7% asam asetat glasial: 3,5
ml; ddH2O: 26,5 ml) dan dikocok semalam.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

3. Gel dicuci dengan destain II (5% methanol: 2,5 ml; 7% asam asetat glasial:
3,5 ml; ddH2O 44 ml) dikocok 1 jam.
Tahapan metode Western blot adalah sebagai berikut:
1. Protein sebelumnya telah dipisahkan dengan metode SDS PAGE.
2. Protein selanjutnya ditransfer ke membran nitriselulosa dengan cara
dielektroforesis dalam bufer transfer pada tegangan 90 volt selama 90 menit.
Bufer transfer untuk 1 liter: tris 25 mM 3,03 g, glisin 192 mM 14,4 g, 20%
metanol 200 ml, ditambah aquades sampai 1 liter.
3. Membran diambil kemudian diinkubasi dengan 10% susu bebas lemak dalam
bufer TBS 1x dengan dikocok selama 1 jam.
Bufer TBS (Tris Buffer Saline) untuk 1 liter dengan pH 7,6: tris 2,42 g, NaCl
8g, HCl 1N 3,8 g, ditambah aquades sampai 1 liter.
4. Pencucian dilakukan 3 kali menggunakan 0,1% Tween 20 dalam TBS 1x
selama 15 menit, 5 menit dan 5 menit dengan dikocok.
5. Larutan antibodi primer ditambahkan dan diinkubasi 1 jam dengan dikocok.
Larutan antibodi primer: 10 l anti--Interferon Mouse mAb dilarutkan pada
10 ml 10% susu bebas lemak dalam bufer TBS 1x.
6. Pencucian dilakukan 3 kali menggunakan 0,1% Tween 20 dalam TBS 1x
selama 15 menit, 5 menit dan 5 menit dengan dikocok.
7. Larutan antibodi sekunder ditambahkan dan diinkubasi 1 jam dengan dikocok.
Larutan antibodi sekunder: 3 l anti-mouse IgG (H+L) AP conjugate
dilarutkan pada 10 ml 10% susu bebas lemak dalam bufer TBS 1x.
8. Pencucian dilakukan 3 kali menggunakan 0,1% Tween 20 dalam TBS 1x
selama 15 menit, 5 menit dan 5 menit dengan dikocok.
9. Hasil analisis diketahui dengan munculnya pita pada membran nitriselulosa
setelah pemberian substrat NBT-BCIP (bufer alkaline phosphatase 5 ml; NBT
33 l; dan BCIP 16,5 l).
Hasil SDS PAGE yang dilanjutkan Western blot difoto yang selanjutnya
dilakukan

analisis

densitometri

dengan

sistem

digitalisasi

menggunakan UN-SCAN-IT Gel versi 6.1.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

automatik

BAB 4
HASIL DAN PEMBAHASAN

4.1 Penyiapan DNA insert


Penyiapan DNA insert dilakukan dengan metode PCR menggunakan
cetakan gen sintetik human ifn 2a dalam vektor pcDNA3.1:IFN-Gene. Metode
PCR dipilih karena mampu diperoleh sejumlah besar DNA dengan urutan basa
tertentu dalam waktu yang singkat (Grompe et al., 1998). Primer spesifik dibuat
berdasarkan sekuen gen human ifn 2a pada GenBank DI084466.1. Sepasang
primer digunakan untuk tahap amplifikasi gen human ifn 2a yaitu IFN_NcoI_F
dan IFN_XhoI_R yang telah ditambahkan situs restriksi Nco I dan Xho I.
Penambahan situs restriksi bertujuan untuk menempelkan situs restriksi pada gen
human ifn 2a yang selanjutnya digunakan untuk proses ligasi ke vektor pET32b(+). Dua jenis enzim endonuklease restriksi digunakan untuk menghindari
keterbalikan arah transkripsi atau translasi gen yang disisipkan ke dalam plasmid
(Radji, 2011). Hasil amplifikasi gen human ifn 2a selanjutnya dilakukan
pengecekan dengan dielektroforesis pada gel agarosa 1%.

750 pb
500 pb

510 pb

Gambar 4.1 Elektroforesis Hasil PCR untuk Penyiapan DNA Insert.


Keterangan: (1) Marker; (2-7) Produk PCR.

Metode PCR yang digunakan pada penelitian ini dapat mengamplifikasi


gen human ifn 2a dengan baik. Amplifikasi dengan primer IFN_NcoI_F dan
IFN_XhoI_R menghasilkan produk yang berukuran 510 pb (Gambar 4.1).
Berdasarkan pita DNA pada hasil elektroforesis dapat diketahui bahwa primer
IFN_NcoI_F dan IFN_XhoI_R secara spesifik mengamplifikasi gen target yang
39

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

diindikasikan dengan terdapatnya pita tunggal. Adanya perbedaan ketebalan pita


yang tampak pada hasil elektroforesis kemungkinan dikarenakan oleh proses
pemipetan dalam pengambilan sampel pada tabung kurang diaduk homogen,
meskipun volume yang diambil sama akan tetapi konsentrasinya dapat berbeda.
Hasil amplifikasi dengan metode PCR selanjutanya dilakukan purifikasi
sebelum digunakan untuk tahapan kloning. Purifikasi bertujuan untuk
menghilangkan sisa-sisa primer, garam, enzim, dan pengotor-pengotor lain yang
dapat mengganggu proses kloning. Purifikasi produk PCR untuk penyiapan DNA
insert pada penelitian ini dilakukan dengan menggunakan dua metode yang
berbeda yaitu metode Agarose Gel DNA Extraction Kit (Roche) dan metode
purifikasi fenol kloroform. Hasil purifikasi produk PCR selanjutnya dilakukan
pengecekan dengan dielektroforesis pada gel agarosa 1%.

510 pb

750 pb
500 pb

510 pb

Gambar 4.2 Elektroforesis Hasil Purifikasi Produk PCR dan Hasil Pemotongan
Ganda dengan Enzim Nco I dan Xho I.
Keterangan: (1) Produk PCR; (2) Produk PCR dipurifikasi Agarose gel DNA
extraction kit; (3) Produk PCR dipurifikasi Fenol kloroform; (4 dan 6) Kosong;
(5) Marker (7) Hasil purifikasi Agarose gel DNA extraction kit dipotong enzim
Nco I dan Xho I.
Pita hasil purifikasi menggunakan metode Agarose Gel DNA Extraction
Kit dan metode fenol kloroform sama-sama mempunyai ukuran 510 pb (Gambar
4.2 nomor 2 dan 3). Akan tetapi hasil elektroforesis purifikasi dengan metode
Agarose Gel DNA Extraction Kit menunjukkan pita yang lebih bersih daripada
purifikasi dengan metode fenol kloroform. Pita hasil purifikasi dengan metode
fenol kloroform terlihat smear, hal ini menunjukkan masih terdapatnya pengotor

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

meskipun telah dilakukan proses purifikasi. Purifikasi metode Agarose gel DNA
extraction kit adalah dengan menggunakan silika. Silika digunakan karena dapat
mengabsorbsi DNA, tidak mengadsorbsi protein, RNA, dan oligonukleotida yang
panjangnya kurang dari 50 pb sehingga dapat diperoleh DNA yang cukup murni.
Purifikasi metode fenol kloroform merupakan campuran pelarut organik yang
dapat mendenaturasi protein dan melarutkan komponen lipid, sehingga antara
protein dan DNA dapat dipisahkan. Fenol dapat mengikat protein dan sebagian
kecil RNA, sedangkan kloroform dapat membersihkan protein dan polisakarida
dari larutan (Muladno, 2010). Purifikasi dengan metode Agarose Gel DNA
Extraction Kit menunjukkan hasil yang lebih baik sehingga hasilnya digunakan
untuk tahapan penelitian selanjutnya.
Proses pemotongan ganda dengan enzim restriksi Nco I dan Xho I
dilakukan produk PCR yang telah dipurifikasi. Hasil elektroforesis yang diperoleh
menunjukkan pita yang berukuran 510 pb (Gambar 4.2 nomor 7), hal ini
menunjukkan proses pemotongan ganda telah berhasil dilakukan. Beberapa faktor
yang perlu diperhatikan dalam pemotongan menggunakan enzim restriksi
diantaranya yaitu jumlah DNA, enzim, dan bufer dalam volume reaksi total yang
sesuai. Hasil dari proses pemotongan ganda selanjutnya dilakukan purifikasi
menggunakan metode fenol kloroform. Hasil purifikasi dengan metode fenol
kloroform dilakukan pengecekan dengan dielektroforesis pada gel agarosa 1%.

750 pb
500 pb

510 pb

Gambar 4.3 Elektroforesis Hasil Purifikasi Metode Fenol Kloroform Setelah


Pemotongan Ganda.
Keterangan: (1) Marker; (2) Kosong; (3) Hasil purifikasi.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Hasil elektroforesis menunjukkan terdapat hanya satu pita tanpa smear


yang berukuran 510 pb (Gambar 4.3). Hal ini menunjukkan bahwa tahap akhir
purifikasi dengan menggunakan metode fenol kloroform untuk penyiapan DNA
insert telah berhasil dilakukan dengan baik. DNA insert (gen human ifn 2a) hasil
purifikasi tahap akhir diatas telah siap digunakan pada tahapan selanjutnya untuk
diligasikan ke vektor pET-32b(+) .

4.2 Penyiapan Vektor pET-32b(+)


Vektor pET-32b(+) yang mempunyai konsentrasi 300 ng/l terlebih
dahulu dilakukan pemotongan dengan menggunakan enzim restriksi. Untuk
mengetahui kemampuan pemotongan enzim restriksi Nco I pada vektor, maka
dilakukan pemotongan ganda dengan menggunakan enzim restriksi lainnya yaitu
Mlu I. Hasil pemotongan menggunakan enzim restriksi Nco I dan Mlu I akan
terlihat dua pita yang ukurannya berbeda. Vektor pET-32b(+) selanjutnya
dilakukan pemotongan ganda menggunakan enzim restriksi Nco I dan Xho I. Hasil
dari pemotongan kemudian dielektroforesis pada agel agarosa 1%, dilanjutkan
pewarnaan dengan larutan EtBr dan diamati diatas sinar UV.

5845 pb

5899 pb

4590 pb
1309 pb

1500 pb
1000 pb

Gambar 4.4 Elektroforesis Hasil Pemotongan Vektor pET-32b(+).


Keterangan: (1) Vektor pET-32b(+) dipotong Xho I dan Nco I; (2) Vektor
pET-32b(+) dipotong Nco I dan Mlu I; (3) Kosong; (4) Marker;
(5) Vektor pET-32b(+).
Hasil elektroforesis menunjukkan bahwa enzim Xho I dan Nco I
kondisinya masih bagus dan mampu untuk memotong vektor pET-32b(+)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

(Gambar 4.4). Hal ini terbukti dari hasil pemotongan ganda menggunakan enzim
Mlu I menghasilkan dua pita yang ukurannya benar. Vektor pET-32b(+) yang
dipotong dengan enzim Nco I dan enzim Mlu I diperoleh dua pita yang berukuran
4590 pb dan 1309 pb. Hasil pemotongan ganda vektor pET-32b(+) dengan enzim
Xho I dan Nco I terlihat pita yang mempunyai ukuran 5845 pb. Pita kecil yang
berukuran 54 pb tidak dapat terlihat dikarenakan konsentrasinya yang kecil dan
sewaktu proses elektroforesis pita tersebut bermigrasi dengan cepat pada gel
agarosa 1% sehingga keluar dari gel. Terdapatnya pita yang berukuran 5845 pb
menunjukkan bahwa pemotongan ganda pada vektor pET-32b(+) dengan enzim
Xho I dan Nco I telah berhasil dilakukan.
Vektor pET-32b(+) yang telah dipotong ganda menggunakan enzim Xho I
dan Nco I selanjutnya dilakukan purifikasi menggunakan metode fenol kloroform.
Purifikasi dilakukan pada vektor pET-32b(+) yang telah terpotong bertujuan
untuk menghilangkan sisa-sisa enzim, dan pengotor-pengotor lainnya. Pemurnian
DNA yang umum dilakukan yaitu melalui penambahan larutan fenol dan
kloroform dengan perbandingan 1:1. Pengendapan DNA dilakukan menggunakan
cara presipitasi etanol absolut dan dipisahkan dengan cara disentrifus (Radji,
2011). Hasil purifikasi vektor pET-32b(+) dengan metode fenol kloroform
dilakukan pengecekan dengan dielektroforesis pada gel agarosa 1%.

5899 pb
5845 pb

Gambar 4.5 Elektroforesis Hasil Purifikasi Vektor pET-32b(+) Setelah


Pemotongan Ganda dengan Enzim Xho I dan Nco I.
Keterangan: (1) Marker; (2) Vektor pET-32b(+) dicek 2 l; (3) Vektor pET32b(+) dipotong Xho I dan Nco I lalu dipurifikasi dicek 2 l; (5) Vektor pET32b(+) dipotong Xho I dan Nco I dicek 3 l.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Elektroforesis hasil purifikasi metode fenol kloroform pada vektor pET32b(+) yang telah dilakukan pemotongan ganda dengan enzim Xho I dan Nco I
menunjukkan hanya satu pita dan tidak ada smear (Gambar 4.5). Hal ini
menunjukkan bahwa proses purifikasi vektor pET-32b(+) telah berhasil
dilakukan. Vektor pET-32b(+) telah bersih dan siap digunakan untuk diligasikan
ke DNA insert (gen human ifn 2a) yang telah dipersiapkan. Tahapan ligasi harus
menggunakan DNA insert dan vektor yang bersih supaya proses ligasinya benar
dan tidak mengalami gangguan.
4.3 Kloning Gen human ifn 2a
Kloning diawali dengan memasukkan DNA insert ke dalam vektor. Ligasi
dilakukan antara vektor pET-32b(+) yang dilinearkan dengan gen human ifn 2a
(insert) yang telah dipersiapkan sebelumnya. Proses ligasi menggunakan enzim
ligase yang berfungsi untuk mengkatalis pembentukan ikatan kovalen DNA untuk
menyisipkan sepotong DNA ke dalam vektor (Radji, 2011). Pada penelitian ini
reaksi ligasi dilakukan dengan menggunakan enzim T4 DNA ligase yang
diinkubasi pada suhu 4C semalam. Komposisi vektor dan insert yang digunakan
untuk proses ligasi adalah sekitar 1:3. Hasil dari proses ligasi diharapakan
diperolehnya vektor rekombinan pET-32b(+)-IFN 2a yang sirkuler. Reaksi ligasi
dikerjakan sedemikian rupa sehingga akan meghasilkan rekombinan yang banyak
(Sudjadi, 2008)
Hasil ligasi kemudian ditransformasikan pada sel kompeten E. coli DH5
sebagai inang kloning. Sel E. coli DH5 mempunyai laju rekombinasi yang
rendah sehingga memungkinkan digunakan untuk pemeliharaan yang stabil
plasmid DNA (Tolia dan Joshua-Tor, 2006). Faktor penting yang mempengaruhi
efisiensi transformasi adalah kualitas dari sel kompeten (Xiaowei Li et al., 2010).
Sel E. coli dibuat kompeten supaya permeabilitas dinding sel meningkat sehingga
vektor rekombinan lebih mudah masuk ke dalam sel. Sel E. coli dibuat kompeten
dengan penambahan larutan CaCl2 dingin. Laruan CaCl2 dalam keadaan dingin
efektif menyebabkan perubahan permeabilitas dinding sel bakteri menjadi lebih
permiabel (Radji, 2011). Perlakuan heat shock yang diikuti dengan pendinginan
akan menjadikan dinding sel kembali seperti semula.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Proses transformasi dilakukan dengan metode heat shock pada suhu 42C
selama 90 detik (Radji, 2011). Metode heatshock dipilih karena metodenya
sederhana, pori-pori membran sel E. coli dapat terbuka dalam waktu yang singkat
dan siap untuk menerima vektor rekombinan yang akan masuk. Hasil dari
transformasi dicek keberhasilannya dengan cara ditumbuhkan pada media LB
padat yang ditambahkan ampisilin. Sebagai kontrol negatif digunakan suspensi sel
kompeten yang ditumbuhkan pada media LB padat yang ditambahkan ampisilin.
Klon transforman E. coli diseleksi dengan menggunakan marker antibiotik
ampisilin. Hanya klon E. coli yang mengandung vektor rekombinan pET-32b(+)IFN 2a yang dapat tumbuh pada media padat LB yang ditambah dengan
ampisilin.

Gambar 4.6 Hasil Transformasi pada E. coli DH5.


Keterangan: (A) Inokulasi 80 l; (B) Inokulasi 350 l; (C) Kontrol negatif.
Hasil transformasi ke inang kloning E. coli DH5 diperoleh 13 klon
transforman (Gambar 4.6). Tiga klon transforman tumbuh pada inokulasi 80 l

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

dan sepuluh klon transforman tumbuh pada inokulasi 350 l. Proses transformasi
ke sel kompeten E. coli DH5 telah berhasil dilakukan yang mana ditunjukkan
dengan terdapatnya klon transforman yang tumbuh pada media LB padat yang
ditambah ampisilin meskipun efisiensinya rendah. Efisiensi transformasi yang
rendah kemungkinan disebabkan oleh kurang optimalnya proses ligasi yang
dilakukan. Suhu optimum untuk ligasi merupakan kompromi antara kecepatan
aksi enzim dan penyambungan kedua ujung yang berdasarkan percobaan sekitar
4-15C (Sudjadi, 2008). Tingkat efisiensi transformasi juga dipengaruhi oleh
konsentrasi DNA dan kondisi sel inang. Klon transforman yang diperoleh masih
perlu dilakukan skrining dan verifikasi untuk mengetahui masuknya vektor
rekombinan ke dalam sel E. coli DH5. Pada kontrol negatif terlihat tidak ada
yang tumbuh pada media LB padat yang telah ditambah ampisilin, hal ini
menunjukkan sel kompeten E. coli DH5 yang digunakan untuk transformasi
kondisinya baik.
4.4 Skrining dan Verifikasi Klon Transforman di E. coli DH5
Skrining dan verifikasi klon transforman pada penelitian ini dilakukan
dengan beberapa metode yaitu PCR colony screening, isolasi vektor rekombinan
pET-32b(+)-IFN 2a, analisis restriksi dan juga dilakukan sekuensing (pET
Sistem Manual, 2006). Beberapa metode skrining dan verifikasi dilakukan
bertujuan untuk memastikan keberhasilan ligasi gen human ifn 2a pada vektor
pET-32b(+) membentuk vektor rekombinan (pET-32b(+)-IFN 2a) dan juga
keberhasilan proses transformasi ke inang kloning E. coli DH5. Proses seleksi
klon bakteri ini tergolong sulit karena dari ribuan sel bakteri, hanya beberapa sel
bakteri saja yang kemunginan menerima plasmid DNA rekombinan yang masuk
ke dalam sel bakteri (Radji, 2011).
Skrining koloni rekombinan E. coli untuk mengetahui terdapatnya gen
target dapat dilakukan dengan metode PCR koloni. Metode PCR koloni
merupakan metode yang mudah dan sederhana untuk skrining klon bakteri
(Azhahianambi et al., 2008). Metode PCR colony screening dilakukan dengan
menggunakan sepasang primer upstream dan downstream dari DNA insert.
Sepasang primer dibuat yaitu primer pET_Screen_F dan pET_Screen_R yang

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

digunakan untuk mengetahui terdapatnya insert pada vektor pET-32b(+)


sehingga membentuk vektor rekombinan (pET-32b(+)-IFN 2a) dan juga untuk
mengetahui masuknya vektor rekombinan tersebut ke dalam sel E. coli DH5.
Skrining koloni dengan metode PCR juga dilakukan dengan menggunakan primer
IFN_NcoI_F dan IFN_XhoI_R. Hasil skrining menggunakan metode PCR dan
pada klon transforman 1-11 dicek dengan dielektroforesis pada agarosa 1%.

9 10 11 12

1500 pb
1000 pb

1100 pb

Gambar 4.7 Elektroforesis Hasil PCR dengan Primer pET_Screen_F dan


pET_Screen_R pada Klon Transforman 1-11 E. coli DH5.
Keterangan: (1) Marker; (2) Klon 1; (3) Klon 2; (4) Klon 3; (5) Klon 4 (6) Klon 5;
(7) Klon 6; (8) Klon 7; (9) Klon 8; (10) Klon 9; (11) Klon 10; (12) Klon 11.
1

9 10 11 12

750 pb
500 pb

510 pb

Gambar 4.8 Elektroforesis Hasil PCR dengan Primer IFN_NcoI_F dan


IFN_XhoI_R pada Klon Transforman 1-11 E. coli DH5.
Keterangan: (1) Marker; (2) Klon 1; (3) Klon 2; (4) Klon 3; (5) Klon 4 (6) Klon 5;
(7) Klon 6; (8) Klon 7; (9) Klon 8; (10) Klon 9; (11) Klon 10; (12) Klon 11.
Elektroforesis hasil PCR colony screening dengan primer pET_Screen_F
dan pET_Screen_R pada klon transforman 1-11 adalah positif semuanya dengan
terdapatnya pita yang berukuran sekitar 1100 pb (Gambar 4.7). Hal ini

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

menunjukkan bahwa insert telah masuk pada vektor pET-32b(+) membentuk


vektor rekombinan dan vektor rekombinan (pET-32b(+)-IFN 2a) telah masuk ke
sel E. coli DH5. Elektroforesis hasil PCR dengan primer IFN_NcoI_F dan
IFN_XhoI_R pada klon transforman 1-11 menunjukkan positif semuanya dengan
terdapatnya pita yang berukuran 510 pb (Gambar 4.8). Hasil keseluruhan
menunjukkan bahwa pada 11 klon transforman terdapat insert gen human ifn 2a
pada vektor rekombinan (pET-32b(+)-IFN 2a) yang telah masuk ke inang
kloning E. coli DH5.
4.5 Kultivasi dan Isolasi Vektor Rekombinan
Klon transforman 1-11 hasil transformasi pada inang kloning E. coli DH5
selanjutnya dikultivasi pada media LB cair yang ditambah ampisilin untuk proses
miniprep. Isolasi vektor rekombinan (miniprep) pada 11 klon transforman
dilakukan dengan metode lisis alkali. Tahap pelisisan dilakukan pada suasana
alkali (pH 12) karena molekul DNA kromosom terfragmentasi dan terdenaturasi,
sedangkan DNA plasmid terdenaturasi tetapi masih saling terpaut antara masingmasing untai dan tidak terpotong karena ukurannya kecil (Sudjadi, 2008). Tujuan
kultivasi dan isolasi plasmid adalah untuk memperoleh vektor rekombinan yang
selanjutnya dilakukan analisis restriksi dan disekuensing.

10

11

12
6355 pb

Gambar 4.9 Elektroforesis Hasil Miniprep Klon Transforman di E. coli DH5.


Keterangan: (1) Marker; (2) Klon 1; (3) Klon 2; (4) Klon 3; (5) Klon 4; (6) Klon
5; (7) Klon 6; (8) Klon 7; (9) Klon 8; (10) Klon 9; (11) Klon 10; (12) Klon 11.
Elektroforesis hasil miniprep pada klon transforman 1-11 menunjukkan
positif semua dengan terdapatnya pita yang berukuran 6355 pb pada sumuran 2

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

sampai 12 (Gambar 4.9). Hal ini menunjukkan bahwa proses miniprep pada klon
transforman 1-11 telah berhasil dilakukan dengan baik. Dalam melakukan isolasi
DNA plasmid harus memperhatikan keberadaan DNA genom yang berasal dari
sel bakteri. Adanya kontaminasi dari DNA genom bakteri dapat mempengaruhi
keberhasilan kloning DNA (Radji, 2011). Hasil isolasi vektor rekombinan (pET32b(+)-IFN 2a) pada klon transforman 1, 2, 3, 4, 11 dipilih untuk dilakukan
pengecekan lebih lanjut menggunakan metode PCR. Proses PCR menggunakan
primer gabungan antara primer IFN_NcoI_F dengan pET_Screen_R dan
pET_Screen_F dengan IFN_XhoI_R. Hasil PCR yang diperoleh selanjutnya
dilakukan cek dengan dielektroforesis pada gel agarosa 1,5%.

10

11

1000 pb

1000 pb

600 pb
500 pb

Gambar 4.10 Elektroforesis Skrining Metode PCR Menggunakan Primer


(IFN_NcoI_F dengan pET_Screen_R) dan (Primer pET_Screen_F dengan
IFN_XhoI_R) pada Hasil Miniprep Klon 1, 2, 3, 4, dan Klon 11 E. coli DH5.
Keterangan: (1) Klon 1; (2) Klon 2; (3) Klon 3; (4) Klon 4; (5) Klon 11;
(6) Marker; (7) Klon 1; (8) Klon 2 ; (9) Klon 3; (10) Klon 4; (11) Klon 11.
Elektroforesis hasil PCR dengan primer IFN_NcoI_F dan pET_Screen_R
pada hasil miniprep klon transforman 1, 2, 3, 4, dan klon 11 menunjukkan positif
semuanya dengan terdapatnya pita yang berukuran benar disekitar 600 pb
(Gambar 4.10 nomor 1-5). Elektroforesis hasil PCR dengan primer pET_Screen_F
dengan IFN_XhoI_R pada hasil miniprep klon transforman 1, 2, 3, 4, dan klon 11
juga menunjukkan hasil positif semuanya dengan terdapatnya pita yang berukuran

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

benar disekitar 1000 pb. Hal ini menunjukkan bahwa pada klon transforman 1, 2,
3, 4, dan klon 11 terdapat vektor rekombinan (pET-32b(+)-IFN 2a) yang telah
masuk ke dalam inang E. coli DH5.
Hasil minirep vektor rekombinan pada klon transforman 2 selanjutnya
dipilih dan dipurifikasi dengan menggunakan metode fenol kloroform. Proses
purifikasi bertujuan untuk menghilangkan RNAse pada proses isolasi DNA
rekombinan. RNAse digunakan pada proses miniprep berfungsi untuk
membersihkan DNA dari RNA (Radji, 2011). Metode analisis restriksi dilakukan
pada hasil miniprep klon transforman 2 yang sudah dilakukan purifikasi. Hasil
miniprep pada klon transforman 2 dilakukan pemotongan ganda dengan
menggunakan enzim restriksi Xho I dan Nco I. Vektor rekombinan (pET-32b(+)IFN 2a) yang telah dipotong selanjutnya dilakukan pengecekan dengan
dielektroforesis pada gel agarosa 1%.

5899 pb
5845 pb

750 pb
500 pb

510 pb

Gambar 4.11 Elektroforesi Hasil Pemotongan Vektor Rekombinan Klon 2.


Keterangan: (1) Marker; (2) Vektor pET-32b(+); (3) Vektor rekombinan klon 2
dipotong enzim Xho I dan Nco I.
Pemotongan hasil miniprep vektor rekombinan klon transforman 2 yang
sudah dipurifikasi dengan metode menghasilkan dua buah pita yang berukuran
5845 pb dan 510 pb (Gambar 4.11). Pita yang berukuran 5845 pb menunjukkan
vektor pET-32b(+), sedangkan pita yang berukuran 510 pb menunjukkan
terdapatnya insert. Hasil yang diperoleh menunjukkan bahwa vektor rekombinan
pada klon transforman 2 telah berhasil dipotong oleh enzim Xho I dan Nco I dan
mempunyai insert (gen human ifn 2a). Klon transforman 2 selanjutnya dipilih

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

untuk dikultivasi pada media LB cair 200 mL yang telah ditambah ampisilin
untuk perbanyakan vektor rekombinan (pET-32b(+)-IFN 2a). Isolasi dan
purifikasi vektor rekombinan dilakukan dengan menggunakan Qiagen Plasmid
Maxi Kit.
Hasil Qiagen Plasmid Maxi Kit selanjutnya diukur konsentrasinya dengan
menggunakan alat Nanophotometer. Hasil pengukuran menunjukkan A260/A280:
1,851 dan diperoleh konsentrasi 405 ng/l. Kemurnian larutan DNA dihitung
dengan membandingkan absorbansi pada panjang gelombang 260 nm dan
absorbansi pada panjang gelombang 280 nm. Nilai kemurnian DNA hasil isolasi
dan purifikasi menggunakan Qiagen Plasmid Maxi Kit adalah 1,851 sehingga
telah murni dan dapat digunakan untuk tahapan selanjutnya. Rasio A 260/A280
antara 1,8-2,0 mencerminkan DNA yang relatif murni dan terbebas dari
kontaminan protein (Muladno, 2010).

6355 pb

Gambar 4.12 Elektroforesis Hasil Qiagen Plasmid Maxi Kit.


Keterangan: (1) Marker; (2) Hasil Qiagen Plasmid Maxi Kit Klon 2.

Elektroforesis hasil Qiagen Plasmid Maxi Kit pada gel agarosa 1%


menunjukkan terdapatnya pita yang berukuran 6355 pb (Gambar 4.12). Hal ini
menunjukkan bahwa proses isolasi dan purifikasi menggunakan Qiagen Plasmid
Maxi Kit telah berhasil dilakukan dan diperoleh vektor rekombinan dengan
konsentrasi 405 ng/ l. Hasil elektroforesis vektor rekombinan terdapat dua pita
menunjukkan vektor yang dicek mempunyai 2 bentuk yaitu supercoil dan relaxed
circular. Urutan migrasi bentuk-bentuk vektor pada elektroforesis gel dari yang
paling cepat adalah supercoil, supercoiled denaturated, relaxed circular, linear,

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

dan nicked open circular. Vektor rekombinan (pET-32b(+)-IFN 2a) dari klon 2
hasil Qiagen Plasmid Maxi Kit selanjutnya dilakukan analisis sekuensing untuk
mengetahui urutan nukleotidanya. Sekuensing DNA merupakan teknik yang dapat
dimanfaatkan untuk menentukan urutan basa nukleotida suatu gen ataupun sekuen
genom total suatu sel atau organisme (Radji, 2011). Analisis urutan nukleotida
dengan metode sekuensing dilakukan di perusahaan Macrogen Korea dengan
menggunakan dua primer yaitu Stag-18mer-primer dan T7terminator-primer.

Gambar 4.13 Hasil Alignment Sekuen Klon 2 dengan Stag-18mer-primer.

Gambar 4.14 Hasil Alignment Sekuen Klon 2 dengan T7terminator-primer.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Urutan nukleotida hasil sekuensing vektor rekombinan klon transforman 2


selanjutnya disejajarkan dengan urutan nukleotida human IFN 2a pada GenBank
menggunakan program MultAlin (Multiple sequence alignment). Berdasarkan
analisis urutan nukleotida menggunakan primer Stag-18mer-primer dan
T7terminator-primer menunjukkan bahwa urutan nukleotida DNA insert (gen
human ifn 2a) klon transforman 2 memiliki urutan yang sama dengan urutan
nukleotida human IFN 2a pada GenBank DI084466.1 dan tidak terdapat mutasi
(Gambar 4.13 dan 4.14). Berdasarkan data yang diperoleh, maka dapat
disimpulkan bahwa pada klon transforman 2 telah membawa gen human ifn 2a
yang benar dalam vektor rekombinan sehingga vektor rekombinan (pET-32b(+)IFN 2a) dapat digunakan untuk tahapan penelitian selanjutnya.
4.6 Transformasi Vektor Rekombinan ke E. coli BL21(DE3)
Vektor rekombinan (pET-32b(+)-IFN2a) dari klon transforman 2 dengan
insert yang benar selanjutnya ditransformasikan ke sel E. coli galur BL21(DE3)
sebagai inang ekspresi. Sistem ekspresi untuk produksi protein rekombinan dalam
E. coli melalui kombinasi antara vektor dan galur E. coli sebagai inang ekspresi
(Srensen dan Mortensen, 2005). Proses transformasi dilakukan dengan perlakuan
kejut panas (heat shock) pada suhu 42C selama 90 detik (Radji, 2011). Hasil dari
transformasi selanjutnya ditumbuhkan pada media padat LB yang telah
ditambahkan ampisilin.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Gambar 4.15. Hasil Transformasi Vektor Rekombinan pada E. coli BL21(DE3).


Keterangan: (A) Inokulasi 20 l; (B) Inokulasi 50 l; (C) Inokulasi 80 l;
(D) Inokulasi 350 l; (E) Kontrol negatif.

Hasil transformasi vektor rekombinan ke inang ekspresi sel kompeten E.


coli BL21(DE3) diinokulasikan pada media LB padat yang mengandung ampisilin
dengan metode sebar. Hasil transformasi vektor rekombinan (pET-32b(+)IFN2a) dari klon transforman 2 ke sel kompeten E. coli BL21(DE3)
menunjukkan diperolehnya banyak klon transforman (Gambar 4.15). Banyaknya
klon transforman yang tumbuh menunjukkan bahwa proses transformasi yang
dilakukan berhasil dengan baik. Escherichia coli merupakan inang umum yang
digunakan untuk produksi protein rekombinan, meskipun terdapat gen yang
kurang efisien apabila diekspresikan pada organisme ini (Srivastva et al., 2005).

4.7 Skrining dan Verifikasi Klon Transforman di E coli BL21 (DE3)


Klon transforman E. coli BL21(DE3)

yang diperoleh diseleksi

menggunakan media padat LB selektif yang mengandung ampisilin. Verifikasi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

masuknya vektor rekombinan pET-32b(+)-IFN 2a pada inang ekspresi E. coli


BL21(DE3) dilakukan dengan menggunakan metode PCR colony screening. Klon
transforman dipilih 7 secara acak dan dilakukan PCR skrining menggunakan
primer pET_Screen_F dengan pET_Screen_R dan IFN_NcoI_F dengan
IFN_XhoI_R. Hasil dari PCR colony screening kemudian dilakukan pengecekan
dengan metode elektroforesis pada medium agarosa 1%.

1500 pb
1000 pb

1100 pb

Gambar 4.16 Elektroforesis Hasil PCR Skrining dengan Primer pET_Screen_F


dan pET_Screen_R pada Klon Transforman E. coli BL21(DE3).
Keterangan: (1) Marker; (2) Klon 1; (3) Klon 2; (4) Klon 3; (5) Klon 4;
(6) Klon 5; (7) Klon 6; (8) Klon 7.

750 pb
500 pb

510 pb

Gambar 4.17 Elektroforesis Hasil PCR Skrining dengan Primer IFN_NcoI_F dan
IFN_XhoI_R pada Klon Transforman E. coli BL21(DE3).
Keterangan: (1) Marker; (2) Klon 1; (3) Klon 2; (4) Klon 3; (5) Klon 4;
(6) Klon 5; (7) Klon 6; (8) Klon 7.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Metode PCR colony screening pada ketujuh klon transforman di E. coli


BL21(DE3) dilakukan menggunakan metode yang serupa dengan PCR colony
screening pada klon transforman di E. coli DH5. Elektroforesis hasil PCR
skrining dengan primer pET_Screen_F dan pET_Screen_R pada ketujuh klon
transforman diperoleh pita yang berukuran sekitar 1100 pb (Gambar 4.16). Hal ini
menunjukkan bahwa vektor rekombinan (pET-32b(+)-IFN2a) telah masuk ke
inang ekspresi E. coli BL21(DE3). Ketujuh klon transforman juga dilakukan PCR
skrining dengan menggunakan primer IFN_NcoI_F dan IFN_XhoI_R diperoleh
pita berukuran 510 pb yang mana merupakan ukuran gen human ifn 2a (Gambar
4.17). Keselruhan hasil yang diperoleh menunjukkan bahwa vektor rekombinan
(pET-32b(+)-IFN2a) telah berhasil ditranformasikan pada inang ekspresi E. coli
BL21(DE3) dengan baik.
4.8 Ekspresi, Isolasi dan Karakterisasi Protein Rekombinan Human IFN 2a
Klon transforman E. coli BL21(DE3) yang telah dipastikan mempunyai
vektor rekombinan (pET-32b(+)-IFN2a) selanjutnya dilakukan uji ekspresi
protein. Ketujuh klon transforman dilakukan uji ekspresi protein pada skala kecil
dengan menggunakan medium produksi yaitu media LB cair 10 ml yang ditambah
ampisilin dan diinkubasi pada suhu 37C. Induksi dilakukan dengan penambahan
IPTG pada kultur sel yang telah mencapai OD600 sekitar 0,5 dengan konsentrasi
akhir IPTG 1 mM. Reagen IPTG berfungsi melepas represi promotor sehingga
diperoleh ekspresi protein rekombinan dalam jumlah yang tinggi (Grompe et al.,
1998). Pemanenan kultur dilakukan pada waktu 1, 2, dan 3 jam setelah inkubasi.
Isolasi protein rekombinan human IFN 2a dilakukan pada protein yang terlarut
pada medium kultivasi (supernatan) dan protein tidak terlarut (pelet). Pelet
selanjutnya diresuspensi menggunakan bufer PBS 1x. Hasil isolasi protein pada
supernatan dan pelet kemudian dianalisis menggunakan SDS-PAGE yang
dilanjutkan dengan Western blot atau pewarnaan CBB.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

120 kDa
80 kDa
60 kDa
36 kDa

35 kDa
30 kDa
20 kDa

Gambar 4.18 Western Blot Klon 1 Inkubasi 37C IPTG 1 mM.


Keterangan: (1) Pelet 0 jam; (2) Supernatan 0 jam; (3) Marker; (4) Pelet 1 jam;
(5) Supernatan 1 jam; (6) Pelet 2 jam; (7) Supernatan 2 jam; (8) Pelet 3 jam;
(9) Supernatan 3 jam.
Hasil SDS PAGE yang dilanjutkan Western blot pada klon 1 yang
diinkubasi pada suhu 37C dengan induksi IPTG 1 mM menunjukkan terdapatnya
pita tebal pada pelet dan pita tipis pada supernatan yang mempunyai berat
molekul sekitar 36 kDa (Gambar 4.18). Pita tersebut merupakan berat molekul
dari protein rekombinan IFN 2a yang terfusi dengan thioredoxin dan 6x histidin.
Pendeteksian terdapatnya protein rekombinan IFN 2a pada Western blot
menggunakan antibodi monoklonal anti interferon yang spesifik. Waktu 0 jam
merupakan level basal ekspresi protein sebelum dilakukan induksi. Hasil yang
diperoleh juga menunjukkan bahwa inkubasi pada suhu 37C dengan induksi
IPTG 1 mM maka protein rekombinan human IFN 2a lebih dominan
diekspresikan dalam bentuk tidak terlarut.
Ekspresi protein rekombinan sebagai protein terfusi mempunyai manfaat
dapat dibuat konstruksi gen yang lebih menguntungkan, memungkinkan ekspresi
level tinggi protein terlarut (Kapust dan Waugh, 1999) dengan menurunkan
kecenderungan pembentukan badan inklusi (Lilie et al., 1998). Formasi pelipatan
dan pembentukan ikatan disulfida pada protein target dapat ditingkatkan dengan
fusi thioredoxin pada E. coli galur defisiensi thioredoxin reductase (trxB)
(Fathallah et al., 2009). Banyak protein yang normalnya diproduksi dalam bentuk
tidak terlarut pada E. coli menjadi lebih terlarut jika difusikan dengan sekuen Nterminal thioredoxin (LaValline et al., 1993; Novy et al., 1995).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

10

36 kDa

Gambar 4.19 Pewarnaan CBB Klon 2, 3, 6, dan 7 Inkubasi 37C IPTG 1 mM.
Keterangan: (1) Pelet 3 jam klon 7; (2) Supernatan 3 jam klon7; (3) Supernatan 3
jam klon 6; (4) Pelet 3 jam klon 6; (5) Supernatan 3 jam klon 2; (6) Pelet 3 jam
klon 2; (7) Supernatan 3 jam klon 3; (8) Pelet 3 jam klon 3; (9) Pelet 0 jam klon 3;
(10) Marker.
1

10

36 kDa

Gambar 4.20 Pewarnaan CBB Klon 4 dan Klon 5 Inkubasi 37C IPTG 1 mM.
Keterangan: (1) Supernatan 4 jam klon 5; (2) Supernatan 3 jam klon 5;
(3) Supernatan 4 jam klon 4; (4) Supernatan 3 jam klon 4; (5) Marker;
(6) Pelet 4 jam klon 5; (7) Pelet 3 jam klon 5; (8) Pelet 4 jam klon 4;
(9) Pelet 3 jam klon 4; (10) Pelet 0 jam klon 4.
Hasil elektroforesis SDS-PAGE dengan pewarnaan CBB pada klon 2, 3, 6,
dan klon 7 dengan membandingkan waktu inkubasi 3 jam setelah induksi IPTG
juga menunjukkan adanya pita tebal yang mempunyai berat molekul sekitar 36
kDa pada pelet (Gambar 4.19). Hasil elektroforesis SDS-PAGE dengan
pewarnaan CBB pada klon 4 dan klon 5 dengan membandingkan waktu inkubasi
3 jam dan 4 jam setelah induksi IPTG juga menunjukkan terdapatnya pita tebal
yang mempunyai berat molekul sekitar 36 kDa pada pelet (Gambar 4.20). Hasil
yang diperoleh menunjukkan bahwa inkubasi pada suhu 37C dengan induksi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

IPTG 1 mM klon 2, 3, 4, 5, 6, dan klon 7 maka protein rekombinan human IFN


2a yang lebih dominan diekspresikan dalam bentuk tidak terlarut sama seperti
hasil ekspresi pada klon 1.
Hasil uji ekspresi skala kecil pada klon 1, 2, 3, 4, 5, 6, dan klon 7
menunjukkan bahwa protein rekombinan human IFN 2a telah berhasil
diekspresikan pada sel E. coli BL21(DE3). Pita tebal protein terdapat pada E. coli
setelah dilakukan induksi dengan IPTG. Hal ini menunjukkan bahwa
overproduksi protein rekombinan human IFN 2a telah berhasil dilakukan.
Protein rekombinan yang diperoleh dalam bentuk protein terfusi sehingga
mengalami penambahan berat molekul. Protein rekombinan human IFN 2a
mempunyai berat molekul 19 kDa dengan fusi tagnya mempunyai berat molekul
17 kDa sehingga berat molekul total adalah 36 kDa. Penelitian Yu-Ling Sun et al.
(2011) tentang ekspresi rabbit neutrophil peptide-1 dalam vektor pET-32b(+)
pada inang E. coli Rosetta-gami(DE3)pLysS menyatakan bahwa fusi Trx-(His)6tag mempunyai ukuran sekitar 17 kDa setelah dilakukan pemotongan
menggunakan enterokinase. Ekspresi rabbit neutrophil peptide-1 dengan induksi
IPTG 1 mM pada suhu 37C dihasilkan protein terlarut setelah dilakukan
ekstraksi dengan disonikasi.
Klon 3 selanjutnya dipilih dan dilakukan uji ekspresi lebih lanjut
menggunakan variasi suhu 28C, 30C, dan 37C dengan induksi IPTG 1 mM.
Pemanenan kultur setelah induksi dilakukan pada waktu 1, 2, 3, 4, 5, 6, 7 jam, dan
kultur semalam. Variasi suhu dilakukan pada penelitian ini bertujuan untuk
mencari optimasi suhu pada ekspresi protein rekombinan human IFN 2a terfusi
sehingga diperoleh hasil ekspresi protein rekombinan human IFN 2a yang
maksimal. Pemanenan kultur dilakukan pada berbagai waktu inkubasi bertujuan
untuk mencari waktu yang tepat untuk pemanenan sehingga diperoleh hasil
ekspresi maksimal protein rekombinan human IFN 2a.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

36 kDa

Gambar 4.21 Pewarnaan CBB Pelet Klon 3 Inkubasi 37C IPTG 1 mM.
Keterangan: (1) Pelet 10 jam; (2) Pelet 9 jam; (3) Pelet 8 jam; (4) Pelet 7 jam;
(5) Pelet 6 jam; (6) Pelet 5 jam; (7) Pelet 4 jam; (8) Pelet 3 jam; (9) Marker.
1

10

36 kDa

Gambar 4.22 Pewarnaan CBB Supernatan Klon 3 Inkubasi 37C IPTG 1 mM.
Keterangan: (1) Marker; (2) Supernatan 0 jam; (3) Supernatan 3 jam;
(4) Supernatan 4 jam; (5) Supernatan 5 jam; (6) Supernatan 6 jam; (7) Supernatan
7 jam; (8) Supernatan 8 jam; (9) Supernatan 9 jam; (10) Supernatan 10 jam.
Hasil SDS PAGE dengan pewarnaan CBB pada klon 3 yang diinkubasi
pada suhu 37C dengan induksi IPTG 1 mM menunjukkan terdapatnya pita yang
mempunyai berat molekul sekitar 36 kDa (Gambar 4.21 dan Gambar 4.22).
Perbandingan hasil ekspresi protein pada supernatan dan pelet menunjukkan
bahwa ekspresi protein rekombinan human IFN 2a dengan waktu pemanenan 3,
4, 5, 6, 7, 8, 9, dan 10 jam setelah induksi lebih dominan diekspresikan dalam
bentuk tidak terlarut yaitu terdapat pada pelet sel.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

10

36 kDa

Gambar 4.23 Western Blot Klon 3 Inkubasi 30C IPTG 1 mM.


Keterangan: (1) Marker; (2) Pelet 0 jam; (3) Pelet 5 jam; (4) Supernatan 5 jam; (5)
Pelet 6 jam; (6) Supernatan 6 jam; (7) Pelet 7 jam; (8) Supernatan 7 jam;
(9) Pelet semalam; (9) Supernatan semalam.
1

10

36 kDa

Gambar 4.24 Pewarnaan CBB Klon 3 Inkubasi 30C IPTG 1 mM.


Keterangan: (1) Pelet 4 jam; (2) Pelet 3 jam; (3) Pelet 2 jam; (4) Pelet 1 jam;
(5) Marker; (6) Supernatan 4 jam; (7) Supernatan 3 jam; (8) Supernatan 2 jam;
(9) Supernatan 1 jam; (10) Supernatan 0 jam.
Hasil SDS PAGE dengan pewarnaan CBB pada klon 3 yang diinkubasi
pada suhu 30C dengan induksi IPTG 1 mM menunjukkan terdapatnya pita yang
mempunyai berat molekul sekitar 36 kDa (Gambar 4.23 dan Gambar 4.24).
Perbandingan hasil ekspresi protein pada supernatan dan pelet menunjukkan
bahwa ekspresi protein rekombinan human IFN 2a dengan waktu pemanenan 1,
2, 3, 4, 5, 6, 7 jam dan semalam setelah induksi lebih dominan diekspresikan
dalam bentuk tidak terlarut pada pelet sel.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

10

36 kDa

Gambar 4.25 Pewarnaan CBB Pelet Klon 3 Inkubasi 28C IPTG 1 mM.
Keterangan: (1) Pelet semalam; (2) Pelet 8 jam; (3) Pelet 7 jam; (4) Pelet 6 jam;
(5) Pelet 5 jam; (6) Pelet 4 jam; (7) Pelet 3 jam; (8) Pelet 2 jam;
(9) Marker; (10) Pelet 0 jam.
1

10

36 kDa

Gambar 4.26 Pewarnaan CBB Supernatan Klon 3 Inkubasi 28C IPTG 1 mM.
Keterangan: (1) Pelet 1 jam; (2) Marker; (3) Supernatan 2 jam; (4) Supernatan 3
jam (5) Supernatan 4 jam; (6) Supernatan 5 jam; (7) Supernatan 6 jam
(8) Supernatan 7 jam; (9) Supernatan 8 jam; (10) Supernatan semalam.
Hasil SDS PAGE dengan pewarnaan CBB pada klon 3 yang diinkubasi
pada suhu 28C dengan induksi IPTG 1 mM menunjukkan terdapatnya pita yang
mempunyai berat molekul sekitar 36 kDa (Gambar 4.25 dan Gambar 4.26).
Perbandingan hasil ekspresi protein pada supernatan dan pelet menunjukkan
bahwa ekspresi protein rekombinan human IFN 2a dengan waktu pemanenan 1,
2, 3, 4, 5, 6, 7, 8 jam dan semalam setelah induksi lebih dominan diekspresikan
dalam bentuk tidak terlarut yaitu terdapat pada pelet sel.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Keberhasilan ekspresi protein rekombinan dipengaruhi oleh banyak faktor


diantaranya plasmid dengan fusi tag yang digunakan, galur E. coli untuk inang
ekspresi dan sifat protein yang diekspresikan. Beberapa strategi yang berbeda
dapat digunakan tergantung pada kebutuhan protein untuk diekspresikan. Ekspresi
protein yang toksik pada sel inang dapat menyebabkan lisisnya sel sehingga hasil
yang diperoleh kurang optimal (Tolia dan Joshua-Tor, 2006). Pada penelitian ini
telah berhasil dilakukan ekspresi protein rekombinan human IFN 2a pada E. coli
galur BL21(DE3).

10

36 kDa

Gambar 4.27 Pewarnaan CBB Pelet Klon 3 Suhu 28C, 30C, 37C IPTG 1 mM.
Keterangan: (1) Marker; (2) Pelet 3 jam (28C); (3) Pelet 4 jam (28C); (4) Pelet
5 jam (28C); (5) Pelet 3 jam (30C); (6) Pelet 4 jam (30C); (7) Pelet 5 jam
(30C); (8) Pelet 3 jam (37C); (9) Pelet 4 jam (37C); (10) Pelet 5 jam (37C).
1

10

36 kDa

Gambar 4.28 Western Blot Pelet Klon 3 Suhu 28C, 30C, 37C IPTG 1 mM.
Keterangan: (1) Marker; (2) Pelet 3 jam (28C); (3) Pelet 4 jam (28C); (4) Pelet
5 jam (28C); (5) Pelet 3 jam (30C); (6) Pelet 4 jam (30C); (7) Pelet 5 jam
(30C); (8) Pelet 3 jam (37C); (9) Pelet 4 jam (37C); (10) Pelet 5 jam (37C).

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

10

36 kDa

Gambar 4.29 Western Blot Supernatan Klon 3 Suhu 28C, 30C, 37C
IPTG 1 mM.
Keterangan: (1) Marker; (2) Supernatan 3 jam (28C); (3) Supernatan 4 jam
(28C); (4) Supernatan 5 jam (28C); (5) Supernatan 3 jam (30C);
(6) Supernatan 4 jam (30C); (7) Supernatan 5 jam (30C); (8) Supernatan 3 jam
(37C); (9) Supernatan 4 jam (37C); (10) Supernatan 5 jam (37C).
Hasil SDS PAGE klon 3 dengan pewarnaan CBB (Gambar 4.27) dan
Western blot (Gambar 4.28) yang membandingkan hasil ekspresi protein
rekombinan human IFN 2a pada pelet sel yang diinduksi IPTG 1 mM dengan
variasi suhu 28C, 30C, dan 37C menunjukkan bahwa ekspresi optimal
diperoleh pada suhu inkubasi 37C dengan rentang waktu pemanenan antara 3
sampai 5 jam setelah induksi. Hasil SDS PAGE klon 3 dengan Western blot
(Gambar 4.29) yang membandingkan hasil ekspresi protein rekombinan human
IFN 2a pada supernatan yang diinduksi IPTG 1 mM dengan variasi suhu 28C,
30C, dan 37C menunjukkan bahwa ekspresi maksimal diperoleh pada suhu
inkubasi 30C dengan waktu pemanenan 3 jam setelah induksi.
Kuantifikasi data tingkat ekspresi pada penelitian ini dilakukan dengan
cara analisis densitometri pita hasil Western blot pada pelet (Gambar 4.28) dan
supernatan (Gambar 4.29) menggunakan sistem digitalisasi automatik program
UN-SCAN-IT Gel versi 6.1. Kuantifikasi yang dilakukan yaitu dengan
membandingkan hasil piksel total pada masing-masing sampel yang terdeteksi
sehingga dapat dibandingkan tingkat ekspresi pada masing-masing perlakuan dan
diketahui hasil yang maksimal. Piksel total merupakan jumlah total keseluruhan
piksel dalam area pita.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Tabel 4.1
Hasil Kuantifikasi Tingkat Ekspresi pada Pelet dan Supernatan.
Perlakuan
3 jam (28C)
4 jam (28C)
5 jam (28C)
3 jam (30C)
4 jam (30C)
5 jam (30C)
3 jam (37C)
4 jam (37C)
5 jam (37C)

Piksel Total
Pelet Supernatan
143960
71505
154760
77770
149549
82115
142012
129810
135055
87573
150057
65391
148327
39584
173122
24274
181773
18872

Hasil kuantifikasi menggunakan program UN-SCAN-IT menunjukkan


bahwa piksel total tertinggi pada pelet diperoleh pada suhu inkubasi 37C dengan
waktu pemanenan 5 jam, sedangkan piksel total tertinggi pada supernatan
diperoleh pada suhu inkubasi 30C dengan waktu pemanenan 3 jam (Tabel 4.1).
Oleh karena itu, dapat diambil kesimpulan bahwa ekspresi protein rekombinan
human IFN 2a yang diinduksi IPTG 1 mM dengan variasi suhu 28C, 30C, dan
37C menunjukkan hasil ekspresi maksimal pada pelet sel diperoleh pada suhu
inkubasi 37C dengan waktu pemanenan 5 jam setelah induksi. Hasil ekspresi
maksimal pada supernatan diperoleh pada suhu inkubasi 30C dengan waktu
pemanenan 3 jam setelah induksi. Berdasarkan keseluruhan hasil penelitian, maka
hasil terbaik ditunjukkan pada ekspresi protein rekombinan human IFN 2a yang
diinduksi IPTG 1 mM pada suhu inkubasi 37C dengan waktu pemanenan 5 jam
setelah induksi.
Isolasi protein human IFN 2a pada pelet sel pada penelitian ini dilakukan
dengan pemecahan dinding sel bakteri menggunakan metode sonikasi. Sonikasi
merupakan aplikasi gelombang ultrasonik untuk mengaduk partikel dalam suatu
sampel yang dapat digunakan untuk mempercepat pelarutan suatu materi dengan
memecah reaksi intermolekuler. Isolasi pada pelet sel bertujuan untuk mengetahui
protein human IFN 2a diekspresikan dalam bentuk terlarut atau bentuk agregrat
yang tidak terlarut (badan inklusi) pada sitoplasma. Isolasi badan inklusi

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

dilakukan dengan metode sentrifugasi dan solubilisasi menggunakan bufer yang


mengandung guanidine hydrochloride dan merkaptoetanol.

36 kDa

Gambar 4.30 Pewarnaan CBB Hasil Isolasi Protein dari Pelet.


Keterangan: (1) Badan inklusi; (2) Pencucian ke 2; (3) Pencucian ke 1;
(4) Protein terlarut; (5) Marker.
Hasil SDS PAGE dengan pewarnaan CBB menunjukkan bahwa pita
protein rekombinan human IFN 2a yang mempunyai berat molekul sekitar 36
kDa lebih banyak diekspresikan dalam bentuk terlarut dibandingkan bentuk badan
inklusi (Gambar 4.30). Pada proses pencucian yang pertama juga masih
menunjukkan terdapatnya protein rekombinan human IFN 2a (Gambar 4.30 no
3). Hal ini bisa disebabkan pada proses pengambilan supernatan masih
terdapatnya sisa-sisa pada tabung. Hasil penelitian yang telah diperoleh
menunjukkan bahwa protein rekombinan human IFN 2a lebih dominan
diekspresikan dalam bentuk terlarut di sitoplasma. Ekspresi protein rekombinan
dalam bentuk terlarut mempunyai keuntungan diantaranya yaitu proses
purifikasinya lebih menghemat biaya dan tidak memakan waktu daripada
refolding dan purifikasi pada badan inklusi (Fathallah et al., 2009). Data
peneletian yang sebelumnya menyatakan bahwa protein IFN yang diekspresikan
pada E.coli

seringnya

dalam

bentuk

badan inklusi dalam

sitoplasma

(Swaminathan dan Khanna, 1999; Bedarrain et al., 2001; Srivasta et al., 2005).
Berbagai strategi untuk meningkatkan kelarutan protein rekombinan yang
diproduksi pada E. coli dapat dilakukan dengan cara pembatasan agregrasi invivo
protein yang diantaranya melaui kultivasi pada temperatur yang lebih rendah,

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

penurunan konsentrasi penginduksi, dan sistem ekspresi dengan promotor yang


indusibel. Level induksi yang rendah juga dilaporkan dapat meningkatkan
kelarutan protein yang diekspresikan (Baneyx dan Mujacic, 2004). Oleh karena
itu, perlu dilakukan optimasi faktor-faktor lingkungan seperti temperatur, media,
dan konsentrasi penginduksi dalam mengekspresikan suatu gen. Pada penelitian
ini telah berhasil diperoleh protein terfusi rekombinan human IFN 2a dalam
bentuk terlarut di sitoplasma yang diekspresikan pada inang E. coli BL21(DE3)
menggunakan media LB dengan suhu inkubasi 37C dan waktu pemanenan 5 jam
setelah induksi IPTG 1 mM.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

BAB 5
KESIMPULAN DAN SARAN

5.1 Kesimpulan
Berdasarkan hasil penelitian secara keseluruhan menunjukkan bahwa gen
human ifn 2a telah berhasil dimasukkan ke dalam vektor pET-32b(+)
membentuk vektor rekombinan pET-32b(+)-IFN 2a. Vektor rekombinan juga
telah berhasil ditransformasikan pada inang kloning E. coli DH5 dan selanjutnya
ditansformasikan pada inang ekspresi E. coli BL21(DE3). Ekspresi protein
rekombinan human IFN 2a dengan induksi IPTG 1 mM pada variasi suhu 28C,
30C, dan 37C menunjukkan bahwa hasil optimal diperoleh pada suhu inkubasi
37C dengan waktu pemanenan 5 jam setelah induksi. Protein rekombinan human
IFN 2a yang diperoleh lebih dominan diekspresikan dalam bentuk terlarut di
sitoplasma sebagai protein terfusi dengan berat molekul sekitar 36 kd.

5.2 Saran
Protein rekombinan human IFN 2a pada penelitian masih perlu dilakukan
pemisahan fusi tag dan purifikasi sehingga didapatkan protein rekombinan yang
murni. Protein rekombinan human IFN 2a yang telah murni perlu diuji
aktivitasnya secara in vitro mengunakan sel mamalia dan uji in vivo menggunakan
hewan uji dengan dibandingkan IFN 2a komersial. Hasil penelitian ini juga perlu
dilakukan scale up untuk mendapatkan protein rekombinan human IFN 2a dalam
jumlah yang lebih banyak.

68

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

DAFTAR PUSTAKA

Arbabi M., Alasti F., Sanati M.H., Hosseini S., Deldar A., and Maghsoudi N.
(2003). Kloning and expression of human gamma-interferon cDNA in E.
Coli. Iraian Journal of Biotechnology, 1 (2), 87-94.
Aulanniam. (2004). Prinsip dan Teknik Analisis Biomolekul. Fakultas Pertanian
Universitas Brawijaya Press.
Azhahianambi P., Ghosh S., Kumar A., and Suryanaraya V.V.S. (2008). Cost
effectiveness of colony lysis and colony PCR methods for screening of
recombinant Escherichia coli colonies--a comparative study. Indian J Exp
Biol. 46 (10), 731-735.
Baneyx F., and Mujacic M. (2004). Recombinant protein folding and misfolding
in Escherichia coli. Nat. Biotechnol., 22, 1399-1408.
Bedarrain A., Cruz Y., Cruz O., Navarro M., and Gil M. (2001). Purification and
conformational properties of a human interferon alpha2b produced in
Escherichia coli. Biotechnol. Appl. Biochem., 33, 173-182.
Brassard D.L., Grace M.J., and Bordens R.W. (2002). Interferon- as an
immunotherapeutic protein. Journal of Leukocyte Biology, 71, 565-581.
Chiti F., Stefani M., Taddei N., Ramponi G., and Dobson C.M. (2003).
Rationalization of the effects of mutations on peptide and protein
aggregation rates. Nature, 424, 805-808.
Fathallah M.D., Carthage T., Rabhi-Essafi I., and Coteaux M. (2009). Method for
the production of high-level soluble human recombinant interferon alpha in
E. coli and vectors useful for such a production. US Patent Application
Publication. US 2009/0258394 A1.
Fuh G., Mulkerrin M. G., Bass S., McFarland N., Brochier M., Bourell J. H.,
Light D. R., and Wells J. A. (1990). The human growth hormone receptor.
Secretion from Escherichia coli and disulfide bonding pattern of the
extracellular binding domain. J. Biol. Chem., 265, 3111-31153.
Grompe M., Johnson W., and Jameson L. (1998). Recombinant DNA and genetic
techniques. In Principles of molecular medicine. Edited by J. Larry
Jameson. Humana Press Inc. Totowa, New Jersey.
Hodgson J. (1993). Expression sistems: a users guide. Bio/Technology, 11, 887893.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Jeong W., and Shin H.C. (1998). Supply of the argU gene product allows highlevel expression of recombinant human interferon-2a in Escherichia coli.
Biotechnology Letters, 20 (1), 19-22.
Jonasch E., and Haluska F.G. (2001). Interferon in oncological practice : review
of interferon biology, clinical application, and toxicities. The Oncologist, 6,
34-55.
Kapust R.B., and Waugh D.S. (1999). Escherichia coli maltose-binding protein is
uncommonly effective at promoting the solubility of polypeptides to which
it is fused. Protein Sci., 8, 1668-1674.
Klaus W., Gsella B., Labhardta A.M., Wipfa B., Senn H. (1997). The threedimensional high relarutan structure of human interferon -2a determined by
heteronuclear NMR spectroscopy in larutan. Journal of Molecular Biology,
274 (4), 661-675.
Kiefhaber T., Rudolph R., Kohler H.H., and Buchner J. (1991). Protein
aggregation in vitro and in vivo: a quantitative model of the kinetic
competition between folding and aggregation. Biotechnology (NY), 9, 825829.
LaVallie E.R., DiBlasio E.A., Kovacic S., Grant K.L., Schendel P.F., and McCoy
J.M. (1993). A thioredoxin gene fusion expression system that circumvents
inclusion body formation in the E. coli cytoplasm. Bio/Technology, 11, 18793.
Lilie H., Schwarz E., and Rudolph,R. (1998). Advances in refolding of proteins
produced in E. coli. Curr. Opin. Biotechnol., 9, 497-501.
Makrides S.C. (1996). Strategies for achieving high-level expression of genes in
Escherichia coli. Microbiol Rev., 60 (3), 512-538.
Meager A. (2006). The Interferons: characterization and application. WILEYVCH Verlag GmbH & Co. KGaA, Weinheim.
Middelberg A. (2002). Preparative protein refolding. Trend Biotechnol., 20, 437.
Muladno. (2010). Teknologi rekayasa genetika, Edisi Kedua. Penerbit IPB Press.
Bogor.
Mustofa I., Mahaputra L., Dachlan Y.P., Rantam F.A., dan Hinting A. (2006).
Analisis densitometrik protein reseptor fertilisasi (ZP3) pada zona pelusida
kambing sebagai kandidat bahan imunokontrasepsi. Media Kedokteran
Hewan., 22 (2).
Novagen. https://wasatch.biochem.utah.edu/chris/links/pET32.pdf.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Novy R., Berg J., Yaeger K., and Mierendorf,R. (1995). inNovations, 3, 7-9.
Obeid D., and Bauvois B. (2006). Interferons: mechanisms, biological activities
and survey of their use in human diseases. Current Bioactive Compounds, 2
(4), 431-444.
Pang K.R., Wu J.J., Huang D.B., Tyring S.K., and Baron S. (2005). Biological
and clinical basis for molecular studies of interferons. In Interferon methods
and protocols. Edited by Daniel J.J. Carr. Humana Press Inc., Totowa, New
Jersey.
pET Sistem Manual (11th ed). (2006). Novagen. EMD Biosciences Inc., an
affiliate of Merck KGaA, Darmstadt, Germany.
Rabhi-Essafi I., Sadok A., Khalaf S.A., and Fathallah D.M. (2007). A strategy for
high-level expression of soluble and functional interferon f as a GST fusion
protein in E. coli. Protein Engineering, Design & Selection, 20 (5), 201-209.
Radji M. (2011). Rekayasa genetika pengantar untuk profesi kesehatan. Penerbit
Sagung Seto. Jakarta.
Rezvani K., Teng Y., Pan Y., Dani J.A., Lindstrom J., Gras E.A.G., McIntosh
J.M., and Biasi M.D. (2009). UBXD4, a UBX-containing protein, regulates
the cell surface number and stability of 3-containing nicotinic acetylcholine
receptors. The Journal of Neuroscience, 29 (21), 6883-6896.
Roche. 2010. Roferon-A (Interferon alpha-2a). Australia. http://www.rocheaustralia.com/fmfiles/re7229005/downloads/anti-virals/roferon-pi.pdf.

Roy R.K., Sapatnekar S.M., and Deshmukh R.A. (2005). The Effect of heat shock
on production of recombinant human interferon alpha 2a by Escherichia
coli. Iranian Biomedical Journal, 9 (4), 155-162.
Samuel C.E. (2001). Antiviral actions of interferons. Clin Microbiol Rev., 14 (4),
778-809.
Siregar M.L. (2009). Peningkatan mutu standar kualitas hasil cetakan
mengunakan kombinasi pengaturan. Tesis. Fakultas Teknik Universitas
Indonesia Press-Jakarta.
Srensen H.P., and Mortensen K.K. (2005). Advanced genetic strategies for
recombinant expression in Escherichia coli. J Biotechnol, 115,113-128.
Srivasta P., Bhattacharaya P., Pandey G., and Mukherjee K.J. (2005).
Overexpression and purification of recombinant human interferon alpha2b in
Escherichia coli. Protein Expr. Purif., 41, 313-322.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Studier F.W., Rosenberg A.H., Dunn J.J., Dubendorff J.W. (1990). Use of T7
RNA polymerase to direct expression of cloned genes. Methods Enzymol.,
185, 60-89.
Sudjadi. (2008). Bioteknologi kesehatan. Penerbit Kanisius. Yogyakarta,
Swaminathan,S. and Khanna,N. (1999). Affinity purification of recombinant
interferon-alpha on a mimetic ligand adsorbent. Protein Expr. Purif., 15,
236-242.
Tae-Ok Bae, Ho-Jin Chang, Jung Ho Kim, and Soon Jae Park. (1995).
Purification and Characteization of Recombinant Human Interferon Alpha
2a Produced from Saccharomyces cerevisiae. J. Biochem. Mol. Biol., 28 (6),
477-483.
Tan Hoan Tjay, dan Rahardja K. (2007). Obat-Obat Penting Khasiat,
Penggunaan, dan Efek-Efek Sampingya. Jakata: PT Elex Media
Komputindo.
Tolia N. H., and Joshua-Tor L. (2006). Strategies for protein coexpression in
Escherichia coli. Nature Methods, 3 (1), 55-64.
Villaverde A., and Carrio M.M. (2003). Protein aggregation in recombinant
bacteria: biological role of inclusion bodies. Biotechnol Lett., 25, 13851395.
Xiaowei Li, Xin sui, Yan Zhang, Yepen Sun, Yan Zhao, Ying Zhai and Qingyu
Wang. (2010). An improved calcium chloride method preparation and
transformation of competent cells. African Journal of Biotechnology, 9 (50),
8549-8554.
Yon J.M. (2002). Protein folding in the post-genomic era. J Cell Mol Med., 6,
307-327.
Yu-Ling Sun, Yi-Juain Lin, and Chih-Sheng Lin. (2011). Soluble expression and
production of rabbit neutrophil peptide-1 in Escherichia coli. Romanian
Biotechnological Letters, 16 (5), 6618-6629.
Zhang Y., Olsen D.R., Nguyen K.B., Olson P.S., Rhodes E.T. and Mascarenhas
D. (1998). Expression of eukaryotic proteins in soluble form in E. coli.
Protein Exp Purif., 12, 159-165.

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lampiran 1. Skema Kerja Penelitian

Penyiapan
DNA insert

Penyiapan
vektor pET-32b(+)

Amplifikasi dengan PCR


Purifikasi
Pemotongan
Purifikasi fenol kloroform

Pemotongan
Purifikasi fenol kloroform

Ligasi DNA insert dan


vektor pET-32b(+)

Transformasi ke E. coli DH5


(inang kloning)
Skrining dan verifikasi klon transforman
(PCR colony screening, isolasi vektor rekombinan, analisis restriksi, sekuensing)
Kultivasi dan isolasi vektor rekombinan pET-32b(+)-IFN 2a

Transformasi ke E. coli BL21(DE3)


(inang ekspresi)
Skrining dan verifikasi klon transforman
(PCR colony screening)
Kultivasi dan ekspresi sel transforman
(induksi dengan IPTG)
Isolasi protein rekombinan human IFN 2a
Analisis elektroforesis SDS-PAGE
(Western blot dan Pewarnaan CBB)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lampiran 2. Vektor pcDNA3.1+:IFN-Gene

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lampiran 3. Hasil Sekuen Klon 2 E. coli DH5 dengan Stag-18mer-primer

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lanjutan

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lampiran 4. Hasil Sekuen Klon 2 E. coli DH5 dengan T7terminator primer

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lanjutan

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013

Lampiran 5. Nukleotida Human Interferon Alpha 2a (GenBank: DI084466.1)

Kloning gen..., Arizah Kusumawati, F Farmasi, 2013