Anda di halaman 1dari 27

LAPORAN PRAKTIKUM BIOTEKNOLOGI FARMASI

PERANCANGAN PRIMER
GEN HSF

Oleh :
ALFIATUR ROHMAH
142210101049

BAGIAN BIOLOGI FARMASI


FAKULTAS FARMASI
UNIVERSITAS JEMBER
2016

DAFTAR ISI
COVER.............................................................................................................................1
DAFTAR ISI......................................................................................................................2
BAB I PENDAHULUAN.................................................................................................3
1.1

Latar Belakang....................................................................................................3

1.2

Rumusan Masalah...............................................................................................4

1.3

Tujuan Praktikum................................................................................................4

BAB II TINJAUAN PUSTAKA.......................................................................................5


BAB III METODE KERJA...............................................................................................8
3.1

Alat yang digunakan...........................................................................................8

3.2

Cara kerja............................................................................................................8

BAB IV HASIL DAN PEMBAHASAN.........................................................................10


4.1

Pengertian Primer.............................................................................................10

4.2

Gen HSF............................................................................................................11

4.3

Persyaratan Primer yang Baik...........................................................................12

4.4 Primer dari gen HSF terhadap haemophilus influence.......................................13


BAB V KESIMPULAN DAN SARAN........................................................................17
5.1

Kesimpulan.......................................................................................................17

5.2

Saran.................................................................................................................17

DAFTAR PUSTAKA......................................................................................................18
LAMPIRAN...............................................................................................................
..............19

BAB I
PENDAHULUAN
1.1 LATAR BELAKANG
Polymerase Chain Reaction (PCR) merupakan teknik biologi molekuler yang
memiliki tingkat sensitivitas dan spesifisitas yang tinggi. Dengan penggunaan teknik PCR
maka keberadaan penyakit pada organisme dapat diketahui sedini mungkin, sehingga
dapat dilakukan langkah pengendalian penyakit atau tindakan oleh para pengambil
kebijakan, terutama dalam budidaya perikanan (Radji 2010). Pada proses PCR terdapat
beberapa siklus yaitu denaturasi, annealing, dan ekstensi. Denaturasi merupakan proses
pemanasan dengan menggunakan suhu 90-95C dengan tujuan untuk memisahkan untai
ganda pada DNA sehingga menjadi dua untai tunggal yang akan menjadi tempat
menempelnya primer. Selanjutnya tahap annealing yaitu proses penurunan suhu sampai
mencapai 45-50C, penurunan suhu ini dilakukan agar primer berpasangan dengan
sekuen komplementernya atau terjadinya penempelan antara oligonukleotida dengan utas
tunggal DNA. Lalu tahap selanjutnya ekstensi pada tahap ini dilakukan kenaikkan suhu
sampai 72C, dengan suhu tersebut enzim Taq DNA (Thermus Aquaticus) dapat bekerja
dengan optimum, pada tahap ini terjadi pemanjangan primer menjadi suatu utas DNA
baru oleh enzim DNA polimerase.
Penggunaan PCR sebagai metode deteksi yang cepat dan akurat pun telah
berkembang pesat, sehingga memungkinkan pengembangan metode yang lebih spesifik.
Erwanto et al. (2012) menggunakan RFLP-PCR untuk melakukan deteksi kehalalan pada
bakso, sedangkan Almira Primasari (2011) memanfaatkan multiplex-PCR untuk
mendeteksi kontamian tikus dalam produk daging.
Salah satu kunci keberhasilan deteksi dengan PCR adalah pemilihan primer yang akan
digunakan. Primer spesifik akan menempel pada region spesifik pada DNA template yang
merupakan target, untuk selanjutnya akan diamplifikasi menjadi untai DNA baru. Desain
primer yang tepat sangat diperlukan untuk menghasilkan primer spesifik yang sesuai
dengan target amplifikasi. Untuk deteksi DNA babi, salah satu gen yang dapat digunakan
sebagai marka (penanda) spesifik adalah gen sitokrom b (cyt b). Gen ini dipilih untuk
identifikasi species vertebrata karena menunjukkan variasi yang sangat terbatas dalam
satu species tetapi variasinya sangat besar antara satu species dengan species lainnya.
Sitokrom b merupakan satu dari 37 gen dalam genom sirkuler mitokondria. Sekuen gen

cyt b memiliki keunikan, yaitu adanya bagian yang conserved di tingkat species, sehingga
dapat digunakan untuk deteksi spesifik pada species tertentu.
1.2 RUMUSAN MASALAH
1.2.1 Bagaimana cara melakukan perancangan primer secara online?
1.2.2 Bagaimana cara menentukan primer yang baik?
1.2.3 Bagaimana cara menentukan spesifitas primer?
1.3 TUJUAN
1.3.1 Mengetahui cara perancangan primer secara online
1.3.2 Mengetahui cara menentukan primer yang baik
1.3.3 Mengetahui cara menentukan spesifitas primer yang baik

BAB II
TINJAUAN PUSTAKA
PCR (polimerase chain reaction) salah satu teknik untuk mempelajari
biologi molekuler, merupakan metode enzimatis yang digunakan untuk
melipatgandakan secara eksponensial suatu sekuen nukleotida tertentu dengan
cara in vitro. Metode ini sangat sensitif, sehingga dapat digunakan untuk
melipatgandakan satu molekul DNA.
Konsep asli teknologi PCR mensyaratkan bahwa bagian tertentu sekuen
DNA yang akan dilipatgandakan harus diketahui terlebih dahulu sebelum proses
pelipatgandaan tersebut dapat dilakukan. Sekuen yang diketahui tersebut penting
untuk menyediakan primer, yaitu sekuen oligonukleotida pendek yang berfungsi
mengawali

sintesis

rantai

DNA

dalam

reaksi

berantai

polimerase.

Pengembangan lebih lanjut metode PCR memungkinkan dilakukannya


pelipatgandaan suatu fragmen DNA yang belum diketahui sekuennya, misalnya
dengan metode Alu- PCR (Rosenthal, 1992). Alu adalah suatu sekuen DNA
(panjangnya kurang lebih 300 bp) yang banyak terdapat sepanjang genom
manusia (repetitive DNA sequence). Alu-PCR adalah metode PCR yang
memanfaatkan sekuen-sekuen Alu sebagai dasar untuk membuat primer untuk
melipatgandakan suatu fragmen DNA yang belum diketahui sekuen yang
terdepat di antara dua sekuen Alu.
Target PCR yaitu asam nukleat (DNA) untai ganda yang diekstraksi dari
sel dan terdenaturasi menjadi asam nukleat beruntai tunggal. Komponen reaksi
PCR terdiri atas pasangan primer berupa oligonukleotida spesifik untuk target
gen yang dipilih, enzim (umumnya Taq polymerase, enzim thermostable dan
thermoactive yang

berasal dari

Thermus

aquaticus) dan

triphosphat

deoxynucleoside (dNTP) digunakan untuk amplifikasi target gen secara


eksponensial dengan hasil replikasi ganda dari target awal. Reaksi ini dilakukan
dalam

suatu

mesin

pemanas

yangdiprogram

secara

otomatis

disebut

thermocycler. Mesin tersebut menyediakan kondisi termal yang diperlukan


untuk proses amplifikasi (Nollet & Toldr 2011).

Proses yang terjadi dalam mesin PCR meliputi tiga tahap utama yaitu
denaturasi (pemisahan untai ganda DNA), annealing (penempelan primer) dan
ekstensi (pemanjangan primer). Proses yang dimulai dari denaturasi,
penempelan dan ekstensi disebut sebagai satu siklus. Produk PCR dapat
langsung divisualisasikan melalui proses elektroforesis dan digunakan untuk
analisis lebih lanjut (Weissensteiner et al., 2004). Produk PCR dipisahkan
dengan elektroforesis gel yang diwarnai dengan bromida dan divisualisasikan
dengan sinar ultraviolet (Nollet & Toldr, 2011).
Proses PCR melibatkan 4 komponen utama, yaitu (1) DNA template,
yaitu fragmen DNA yang akan digandakan, (2) oligonukleotida primer, yaitu
suatu sekuen oligonukleotida pendek (15-25 basa nukleotida) yang mengawali
sintesis rantai DNA, (3) deoksiribonukleotida trifosfat (dNTP)m terdiri dari
dATP, dCTP, dGTP, dTTP, dan (4) enzim DNA polimerase, yang merupakan
katalis reaksi sintesis rantai DNA.
Keberhasilan PCR ditentukan oleh beberapa faktor, antara lain:
1. deoksiribonukleotida trifosfat (dNTP). Larutan stok dNTP yang akan
digunakan dalam PCR sebaiknya dinetralkan menjadi pH 7,0. Untuk
menentukan konsentrasinya, dapat digunakan spektrofotometer. Larutan
stock tersebut perlu dituang dalam volume kecil (aliquot) dengsn konsentrasi
1Mm dan disimpan pada suhu -20oC. Konsentrasi masing-masing dNTP
yang diperlukan dalam PCR berkisar antara 20-200M dan keempat dNTP
2.
3.
4.
5.
6.
7.

yang digunakan sebaiknya


oligonukleotida primer
DNA template
komposisi larutan buffer
jumlah siklus reaksi
enzim yang digunakan, dan
faktor teknis dan faktor non teknis lainnya, misalnya kontaminasi.
Tahapan PCR yang paling menentukan adalah penempelan primer.

Sepasang primer oligonukleotida (primer maju dan primer mundur) yang akan
dipolimerisasi masing-masing harus menempel pada sekuens target, tepatnya
pada kedua ujung fragmen yang akan diamplifikasi. Untuk itu urutan basanya

harus komplementer atau setidak-tidaknya memiliki homologi cukup tinggi


dengan urutan basa kedua daerah ujung fragmen yang akan diamplifikasi itu.
Padahal, kita belum mengetahui dengan pasti urutan basa sekuens target. Oleh
karena itu, diperlukan cara tertentu untuk merancang urutan basa kedua primer
yang akan digunakan.
Dasar yang digunakan adalah urutan basa yang diduga mempunyai
kemiripan dengan urutan basa sekuens target. Urutan ini adalah urutan serupa
dari

sejumlah

spesies/strain

organisme

lainnya

yang

telah

diketahui/dipublikasikan. Sebagai contoh, untuk merancang sepasang primer


yang diharapkan dapat mengamplifikasi sebagian gen lipase pada isolat Bacillus
termofilik tertentu dapat digunakan informasi urutan basa gen lipase dari strainstrain Pseudomonas fluorescens, P. mendocina , dan sebagainya, yang
sebelumnya telah diketahui.
Urutan basa pasangan primer yang telah disusun kemudian dianalisis
menggunakan program komputer untuk mengetahui kemungkinan terjadinya
primer-dimer akibat homologi sendiri (self-homology) atau homologi silang
(cross-homology). Selain itu, juga perlu dilihat kemungkinan terjadinya salah
tempel (mispriming), yaitu penempelan primer di luar sekuens target.

BAB III
METODE KERJA
3.1 Waktu dan Tempat Pelaksanaan Praktikum
Hari, tanggal
: Rabu, 2 Maret 2016
Waktu
: Pukul 10.40 13.20 WIB (shift A)
Tempat
: Ruang SCL Fakultas Farmasi Universitas Jember
3.2 Alat dan Bahan
Alat
: Komputer dan Koneksi Internet
Bahan
: CDS gen dari organisme tertentu sebagai molekul DNA target
3.3 Cara Kerja
3.3.1 Mencari CDS gen target
Membuka situs http://www.ncbi.nlm.nih.gov
Ketikkan gen yang mau dicari sekuensnya pada kolom search

Pilih nucleotide pada pilihan all database

Tekan tombol search

Pilih complete genome

Klik FASTA

3.3.2 mencari primer


Membuka situs http://www.ncbi.nlm.nih.gov

Klik DNA dan RNA

Klik Primer-BLAST

Salin semua CDS gen yang dimaksud pada kolom enter accession gi or
FASTA sequence

Pilih genome (all organism) sebagai pilihan database

Klik Get Primer

Tunggu hingga hasilnya keluar

3.3.3 Menentukan spesifitas primer


Membuka situs http://www.ncbi.nlm.nih.gov

Pilih BLAST

Pilih nucleotide BLAST

Masukkan primer yang ingin dicek pada kolom enter accession number(s),
gi(s), or FASTA sequence

Pilih nucletide pada pilihan database

Klik BLAST

Tunggu smpai hasilnya keluar

BAB IV
HASIL DAN PEMBAHASAN
4.1 Pengertian primer
Primer adalah molekul oligonukleotida untai tunggal yang terdiri atas sekitar 30
basa. Polimerisasi primer dapat berlangsung karena adanya penambahan basa demi basa
dari dNTP yang dikatalisasi oleh enzim DNA polimerase. Namun, pada PCR enzim
DNA polimerase yang digunakan harus termostabil karena salah satu tahap reaksinya
adalah denaturasi untai ganda DNA yang membutuhkan suhu sangat tinggi (sekitar
95C). Salah satu enzim DNA polimerase yang umum digunakan adalah Taq DNA
polimerase, yang berasal dari bakteri termofilik Thermus aquaticus.
Tiap

putaran

reaksi

PCR

terdiri

atas

tiga

tahap,

yaitu denaturasi

templat, penempelan primer, dan polimerisasi primer, yang masing-masing berlangsung


pada suhu lebih kurang 95C, 50C, dan 70C. Pada tahap denaturasi, pasangan untai
DNA templat dipisahkan satu sama lain sehingga menjadi untai tunggal. Pada tahap
selanjutnya, masing-masing untai tunggal akan ditempeli oleh primer. Jadi, ada dua
buah primer yang masing-masing menempel pada untai tunggal DNA templat.
Biasanya, kedua primer tersebut dinamakan primer maju (forward primer) dan primer
mundur (reverse primer). Setelah menempel pada untai DNA templat, primer
mengalami polimerisasi mulai dari tempat penempelannya hingga ujung 5 DNA
templat (ingat polimerisasi DNA selalu berjalan dari ujung 5 ke 3 atau berarti dari
ujung 3 ke 5 untai templatnya). Dengan demikian, pada akhir putaran reaksi pertama
akan diperoleh dua pasang untai DNA jika DNA templat awalnya berupa sepasang untai
DNA.
Pasangan-pasangan untai DNA yang diperoleh pada suatu akhir putaran reaksi
akan menjadi templat pada putaran reaksi berikutnya. Begitu seterusnya hingga pada
putaran yang ke n diharapkan akan diperoleh fragmen DNA pendek sebanyak 2n 2n.
Fragmen DNA pendek yang dimaksudkan adalah fragmen yang ukurannya sama dengan
jarak antara kedua tempat penempelan primer. Fragmen pendek inilah yang merupakan
urutan target yang memang dikehendaki untuk digandakan (diamplifikasi).

10

4.2 Gen HSF


Heat shock factor (HSF) adalah aktivator transkripsi gen heat shock. Aktivator
ini mengikat secara khusus untuk Heat Shock urut Elements (HSE) di seluruh genom
yang konsensus urutannya bermotif. Dalam kondisi non-stres, Drosophila HSF adalah
monomer terikat nuklir lokal, sedangkan hasil aktivasi heat shock di trimerization dan
mengikat ke HSE. The Heat Shock urutan Element sangat kekal dari ragi ke manusia.
Faktor Heat shock 1 (HSF-1) adalah regulator utama heat shock transkripsi
protein pada eukariota. Dengan tidak adanya stres selular, HSF-1 dihambat oleh asosiasi
dengan protein heat shock dan dan menyebabkan tidak aktif. Tekanan seluler, seperti
peningkatan suhu, dapat menyebabkan protein dalam sel untuk misfold. protein Heat
shock mengikat protein yang gagal melipat dan memisahkan dari HSF-1. Hal ini
memungkinkan HSF1 untuk membentuk trimer dan mentranslokasi ke inti sel dan
mengaktifkan transkripsi.

Fungsinya tidak hanya penting untuk mengatasi efek

proteotoxic stres termal, tetapi juga diperlukan untuk pengembangan hewan yang tepat
dan kelangsungan hidup secara keseluruhan sel-sel kanker.
Beberapa faktor yang dapat mengaktivasi HSFI diantaranya: kesalahan dalam
pelipatan protein, gangguan homeostasis protein, dan perubahan kondisi redoks
intraselular yang diakibatkan karena perubahan temperatur atau stress. HSF 1 dapat
dihambat oleh mekanisme umpan balik negatif melalui interaksinya dengan Hsp7O dan
Hsp90. Ekspresi Hsp90 dan Hsp70 tertinggi pada suatu sel akan mengakibatkan
terminasi ekspresi gen heat shock (proses autoregulasi)" Selain itu HSF1 juga dapat
dihambat oleh mekanisme umpan balik melalui fosforilasi. HSF1 difosforilasi pada
residu serin di daerah regulator yang memodulasi daerah aktivasi pada suhu normal.
Residu serin terlibat dalam mempertahankan jumlah HSFI pada keadaan buruk dalam
kondisi basal. Fosforilasi residu ini akan meningkat melalui stimulasi jalur Raf/ERK,
jalur protein kinase yang diaktivasi mitogen yang responsif pada faktor pertumbuhan,
dan berakibat pada inhibisi aktivitas HSF1.

11

4.3 Persyaratan primer yang baik


1. Panjang primer
Panjang primer harus 18-24 nukleotida, jika kurang dari 15 nukleotida akan
menurunkan spesifitas hibridisasi dengan DNA target, jika lebih dari 40 akan
menurunkan aktivitas DNA polymerase.
2. Suhu Leleh (Tm)
Primer Melting Temperature (Tm) merupakan temperatur yang diperlukan oleh
separoh primer dupleks yang mengalamai disosiasi/lepas ikatan. Primer dengan
Tm berkisar antara 50-60C sangat ideal, sedangkan Tm diatas 65C akan
mengurangi efektifitas anelaing sehingga proses amplifikasi DNA kurang
berjalan baik. Tm ini sangat ditentukan oleh jumlah basa GC (GC contains).
Tm primer dapat dihitung dengan formula:
A. Tm (C) = ((G+C) x4) + ((A+T) x2)).secara kasar (kurang akurat)
B. Tm(C) = {H/ S + R ln(C)} - 273.15..secara akurat
3. Primer annealing temperature
The primer annealing temperature (Ta) merupakan suhu yang diperkirakan
primer dapat berikatan dengan template (DNA) dengan stabil (DNA-DNA
hybrid stability). Jika suhu anealing tinggi akan menyulitkan terjadinaya iktan
primer dengan DNA template sehingga akan menghasilkan produk PCR yang
rendah (kurang efisien). Namun jika Ta terlalu rendah akan menyebabkan
terjadinya penempelan primer pada DNA tempalat yang tidak spesifik. Ta dapat
dihitung dengan menggunakanformula di bawah ini:
Ta = 0.3 x Tm(primer) + 0.7 Tm (product) 14.9
Tm(primer) = Tm primer
Tm(product) = Tm produk PCR
4. GC Content
Jumlah Basa G dan C (GC content) di dalam primer yang ideal sekitar 40-60%.
5. GC Clamp
Jumlah basa G dan C yang terdapat pada 5 basa terakhir (3) disebut dengan GC
clamp. GC clamp yang baik sekitar 3 basa G/C dan tidak melebihi 5 basa G/C.
keberadaan G/C di ujung 3 primer sangat membantu terjadinya stabilitas ikatan
12

antara primer dengan DNA templat yang diperlukan untuk inisiasi DNA
polymerase (proses PCR).
6. Primer sebaiknya tidak memiliki urutan pengulangan dari 2 basa dan
maksimum pengulangan 2 basa sebanyak 4 kali masih dapat di toleransi.
Misalnya ATATATAT.
7. Primers sebaiknya tidak memiliki urutan basa yang di ulang terus menerus.
Pengulangan basa berurutan sampai 4 kali masih dapat di toleransi. Misalnya
AGCGGGGGATGGGG memiliki urutan basa G diulang 5 kali berturut-turut.
8. Avoid Cross homology : untuk meghindari cross homologi dapat dilakukan
dengan cara menganalisis homologi primer dengan DNA genome melalui
BLAST-NCBI.
9. Amplicon Length : Panjang PCR produk yang ideal berkisar antara 100-500
basang basa.
10. Optimum Annealing temperature (Ta Opt): Suhu annealing optimum sangat
mempengaruhi hasil PCR. Ta Opt ini dapat dihitung dengan cara
Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) 25
11. Primer Pair Tm Mismatch: Perbedaan Tm sepasang primer sebaiknya tidak
lebih dari 5C.
Keberhasilan reaksi PCR bergantung pada primer yang terbentuk dari gen tersebut,
semakin baik primer yang dihasilkan maka reaksi PCR akan berlangsung dengan
baik. Dan sebaliknya jika primer yang dihasilkan jelek maka reaksi PCR juga akan
terganggu.
4.4 Primer dari gen HSF terhadap haemophilus influence
Dari gen HSF didapat sequence DNA yang kemudian dimasukkan kedalam
sebuah kolom untuk mengetahui primer dari gen tersebut. Hasil penelusuran
menunjukkan bahwa gen HSf terhadap Haemophilus Influenza memiliki 10 primer yang
berbeda. Dari kesepuluh primer tersebut dipilih primer yang paling baik dan yang
memenuhi persyaratan primer yang baik. Pada praktikum kali ini primer yang dipilih
adalah primer 1, primer 2, dan primer 3.

13

1. Primer 1
Forward primer GACAAAACCACAGGCGAACC
Reverse primer GCCTGATTTCGCAATCGCAT
Forward primer dimulai pada panjang basa 5926 bp dengan panjang
primer forward 20 bp. Suhu annealing untuk primer ini adalah 59.97C dengan
konsentrasi GC 55%. Primer ini memiliki struktur Self complementarity.
Query

GACAAAACCACAGGCGAACC

20

||||||||||||||||||||
Sbjct

5926

GACAAAACCACAGGCGAACC

5945

Reverse primer dimulai pada panjang basa 6336 bp dengan panjang primer
reverse 20 bp. Suhu annealing untuk primer ini adalah 59.97C dengan
konsentrasi GC 50%. Primer ini memiliki struktur Self complementarity dan
Self 3' complementarity.
Query 1

GCCTGATTTCGCAATCGCAT 20
| | || | | || | | | || | || | || |

Sbjct 6336 GCCTGATTTCGCAATCGCAT 6317


Primer 1 ini memilki panjang produk 411 nukleotida.
2. Primer 2
Forward primer CGGCTTGAAGATTGGCGATG
Reverse primer ACGGATGCACCTTTTGTTGC

14

Forward primer dimulai pada panjanag basa 3150 bp dengan panjang primer
forward 20 bp. Suhu annealing dari primer ini adalah 59.97C dengan
konsentrasi GC 55%. Primer ini memiliki struktur Self complementarity dan
Self 3' complementarity.
Query

CGGCTTGAAGATTGGCGATG

20

||||||||||||||||||||
Sbjct

3150

CGGCTTGAAGATTGGCGATG

3169

Reverse primer dimulai pada panjang basa 4130 bp dengan panjang primer
reverse 20 bp. Suhu annealing dari primer ini adalah 59.97C dengan konsentrasi GC
50%. Primer ini memiliki struktur Self complementarity dan Self 3' complementarity.
Query

ACGGATGCACCTTTTGTTGC

20

||||||||||||||||||||
Sbjct

4130

ACGGATGCACCTTTTGTTGC

4111

Primer 2 ini memiliki panjang produk 981 nukleotida.

3. Primer 3
Forward primer GCAACCTACGACACAGTGGA
Reverse primer GCCGTTTGCGTCTTTGAAC
Forward primer dimulai pada panjang basa 4804 bp dengan panjang primer
forward 20 bp. Suhu annealing dari primer ini adalah 59.97C dengan konsentrasi

GC 55%. Primer ini memiliki sturktur Self complementarity dan Self 3'
complementarity.
Query

GCAACCTACGACACAGTGGA

20

||||||||||||||||||||
Sbjct

4804

GCAACCTACGACACAGTGGA

4823

15

Reverse primer dimulai pada panjang basa 5577 bp dengan panjang primer
reverse 20 bp. Suhu annealing dari primer ini adalah 59.97C dengan konsentrsi
GC 50%. Primer ini memiliki struktur self complementarity dan self 3
complementarity.
Query

GCCGTTTGCGTCTTTGAACT

20

||||||||||||||||||||
Sbjct

5577

GCCGTTTGCGTCTTTGAACT

5558

Primer 3 ini memiliki panjang produk 774 nukleotida.


Berdasarkan hasil praktikum yang telah saya lakukan dapat diketahui jika ketiga
primer diatas memenuhi persyaratan sebagai primer yang baik. Ketiga primer diatas
memiliki panjang primer 20 nukleotida (syaratnya harus dalam rentang 18-24
nukleotida), suhu leleh primernya 59.97C (syaratnya 50-60C) dan selisih Tm antar
primer kurang dari 5.
Setelah ditentukan primer yang baik maka selanjutnya perlu dilakukan pengujian
dari keiga primer tersebut. Pengujiannya adalah apakah primer tersebut memiliki
spesifitas yang abaik atau tidak. Spesifitas adalah kemampuan alat tes untuk mendeteksi
mereka yang memiliki kesamaan nukleotida dengan DNA target. Primer yang telah kita
desain tersebut harus diuji spesifisitasnya agar kita yakin bahwa:

Primer tersebut hanya akan mengamplifikasi daerah yang kita mau

Tidak menempel pada daerah lain di genom organisme target (dalam contoh ini
TMV memiliki materi genetik berupa RNA)

Tidak menempel pada DNA organisme lain yang mungkin tercampur bersama
DNA TMV ketika isolasi DNA. Misalnya DNA host-nya TMV yaitu tembakau.
Dari hasil pngujian spesifitas menggunakan aplikasi BLAST didapat data

bahwa spesifitas primer adalah 100%. Artinya, primer yang kita pilih memiliki
kesamaan dengan DNA target sebesar 100%.

16

BAB V
PENUTUP
5.1 Kesimpulan

Primer yang dipilih memenuhi persyaratan sebagai primer yang baik


Dari ketiga primer diatas dapat dikatakan ketiganya memiliki spesifitas
yang baik, hal ini dapat dilihat dari hasil BLAST yang menunjukkan nilai
100% untuk spesifitasnya

5.2 Saran
Praktikum selanjutnya diharapkan dapat memesan langsung primer sesuai
dengan keiinginan sekuens basa nitrogen untuk ekspresi gen tertentu.

17

DAFTAR PUSTAKA
Aris T W. 2000. Inverse Polymerase Chain Reaction. Jurnal Hayati. Vol 7 (4) :
121-123.
Madej R. 1991. Polymerase Chain Reaction : Application to the Clinical
Laboratory, Laboratory Roche Diagnostic Research, p. 23-32, 45-49.
Iserte J A, Stephan B I, Goni S E, Borio C S, Ghiringhelli P D, Lozano M E.
2013. Family-specific degenerate primer design: a tool to design consensus degenerated
oligonucleotides. Biotechnol Res Int 2013:38364.
Vinay K. Singh, R Govindarajan, Sita Naik and Anil Kumar. 2000. The Effect of
Hairpin Structure on PCR Amplification Efficiency. Molecular Biology Today (2000)
1(3): 67-69.

18

LAMPIRAN
1. Membuka situs www:http//ncbi.nlm.nih.gov dan memasukkan
nama gen yang akan dicari sekuensnya

2. Pilih Haemophilus influenzae Hsf (hsf) gene, complete cds

3. Memilih complete genome, tampilan sebagai berikut

19

4. Klik FASTA, tampilan sebagai berikut

5. Membuka situs www.ncbi. nlm.nih.gov lalu pilih DNA & RNA

20

6. Klik primer BLAST dan masukkan CDS ge ke kolom enter accesion( gi) or FASTA,

7. Pilih genome (all organism) lalu klik get primer

8. Tampilan hasil primer

21

9. Membuka situs www.ncbi.nlm.nih.gov kemudian gilih BLAST

10.Pilih nucleotide BLAST, masukkan primer yang ingin dicek

22

11.Primer 1 (forward)

12.Primer 1 (reverse)

23

13.Primer 2 (forward)

24

14.Primer 2 (reverse)

15.Primer 3 (forward)

25

16.Primer 3 (reverse)

26

27