Anda di halaman 1dari 13

1

BAB I
PENDAHULUAN
1.1 Latar belakang
Kanker merupakan salah satu penyakit yang termasuk dalam kelompok penyakit
tidak menular (Non-communicable diseases atau NCD). NCD merupakan
penyebab kematian tertinggi di sebagian besar negara-negara di Amerika,
Mediterania Timur, Eropa, Asia Tenggara dan Pasifik Barat. Kematian akibat
NCD diproyeksikan meningkat 15% secara global antara tahun 2010 dan 2020,
hingga mencapai 44 juta kematian. Peningkatan tertinggi (diperkirakan sebesar
20%) akan terjadi di negara-negara Afrika, Asia Tenggara dan Mediterania Timur.
Akan tetapi negara-negara yang diperkirakan mempunyai jumlah angka kematian
tertinggi pada tahun 2020 adalah Asia Tenggara (10,4 juta kematian) dan Pasifik
Barat (12,3 juta kematian) (WHO, 2010).
Kanker adalah penyakit yang ditandai dengan kelainan siklus sel khas yang
menimbulkan kemampuan sel untuk tumbuh tidak terkendali (pembelahan sel
melebihi batas normal), menyerang jaringan biologis di dekatnya, bermigrasi ke
jaringan tubuh yang lain melalui sirkulasi darah atau sistem limfatik.
Kami akan meneliti kandungan yang tedapat dari tempe dalam menyembuhkan
kanker. Kedelai memiliki kandungan yang bersifat sebagai antioksidan. Menurut
(Winarsi,2007), antioksidan adalah substansi nutrisi maupun non-nutrisi yang
terkandung dalam bahan pangan, yang mampu mencegah atau memperlambat
terjadinya kerusakan oksidatif dalam tubuh. Antioksidan bekerja sebagai free
radical scavengers, mencegah dan memperbaiki kerusakan yang disebabkan oleh
radikal bebas. Sementara itu, menurut jurnal (Ofir, 2012) dikatakan bahwa pada
ragi yang berasal dari jamur Saccharomyces cerevisiae memiliki kandungan Whi5
yang dapat membunuh sel kanker melalui proses penghambatan proliferasi.
Sementara itu, fase yang dapat dihambat pada proses proliferasi adalah fase
sintesis yaitu fase pembentukan antara G1-S. Whi5 merupakan protein yang
terdapat di jamur Saccharomyces cerevisiae (ragi pada tempe) untuk menghambat
transkripsi G1-S.
Berdasarkan pengetahuan yang kami peroleh mengenai kandungan yang terdapat
pada kedelai sebagai antioksidan dan pada Saccharomyces cerevisiae (ragi tempe)
sebagai penghambat proliferasi yang dapat membunuh sel kanker, kami ingin

mengkombinasikan antar kedua komponen bahan tersebut, apakah dengan


penggabungan antara kedua bahan ini akan memberikan hasil yang maksimal
dalam penyembuhan kanker, mengingat fungsi ragi tempe ini mampu
menyembuhkan kanker sementara fungsi kedelai mampu melindungi sel normal
dari paparan radikal bebas.
1.2 Rumusan Masalah
1.2.1 Bagaimana potensi kombinasi isoflavon Glycine maxdan Whi5 pada ragi
1.2.2

tempesebagai agen antikanker via penurunan CDK2 pada sel HeLa?


Bagaimana mekanisme kerjakombinasi isoflavon Glycine maxdan Whi5
pada ragi tempe sebagai agen antikanker via penurunan CDK2 pada sel

1.2.3

HeLa?
Berapakah dosiskombinasi isoflavon Glycine maxdan Whi5 pada ragi

tempe sebagai agen antikanker via penurunan CDK2 pada sel HeLa?
1.3 Tujuan
1.3.1 Untuk membuktikan potensi kombinasi isoflavon Glycine maxdan Whi5
pada ragi tempe sebagai agen antikanker via penurunan CDK2 pada sel
1.3.2

HeLa.
Untuk mengetahui mekanisme antikankerkombinasi isoflavon Glycine

1.3.3

maxdan Whi5 pada ragi tempe via penurunan CDK2 pada sel HeLa.
Untuk mengetahui dosis kombinasi isoflavon Glycine maxdan Whi5 pada

ragi tempe sebagai agen antikanker via penurunan CDK2 pada sel HeLa.
1.4 Luaran yang diharapkan
Luaran yang diharapkan peneliti dikembangkannya tempe sebagai obat
antikanker, membuat formulasi dengan bahan aktif tempe dan mendapatkan paten,
sertapublikasi hasil penelitian dalam jurnal nasional.
1.5 Manfaat
Manfaat keilmuan dapat dijadikan sebagai dasar teori untuk meningkatkan
khasanah ilmu pengetahuan dalam bidang kesehatan. Manfaat bagi masyarakat
sebagai sumber informasi bahwa tempe memiliki potensi untuk menjadi obat
antikanker. Manfaat bagi pemerintah memberikan alternatif penyembuhan kanker
dengan menggunakan tempe.

BAB II
TINJAUAN PUSTAKA
2.1 Kanker
2.1.1 Definisi

Kanker dalam pengertian sederhana adalah sel yang tumbuh terus menerus secara
tidak terkendali, tidak terbatas, dan tidak normal (abnormal). Dalam kondisi
normal, sel hanya akan berkembang biak dengan cara membelah diri jika ada yang
mati atau rusak. Sementara sel kanker akan terus berkembang biak meskipun tidak
dibutuhkan oleh tubuh. Sel kanker merusak jaringan sel lain yang normal dan
menyebar ke organ tubuh lain melalui jaringan ikat, darah, saraf dan jaringan
penunjang organ tubuh (Mardiana, 2011).
2.1.2 Terapi
Sel-sel kanker dapat dikendalikan oleh aktivitas proliferasi, apoptosis, invasi,
migrasi, dan adhesi. Inaktivasi p53 adalah salah satu mutasi yang paling
umumdan menyediakan mekanisme resistensi kunci yang membantu sel-sel
kanker untuk menghindari induksi apoptosis sehingga meningkatnya proliferasi
menjadi tidak terkendali.Terapi kanker dapat dilakukan dengan berbagai jalur
diantaranya meningkatkan aktivitas apoptosis, menghambat proliferasi, dan
menghindari terjadinya mutasi (Mardiana, 2011).
2.1.3 Patofisiologi
Beberapa kanker diawali dengan perubahan sel yang tidak normal. Sel-sel ini
dapat mengalami hiperplastik atau displastik. Hiperplasia adalah bertambahnya
jumlah sel pada suatu jaringan atau organ yang menyebabkan meningkatnya
ukuran organ tersebut. Hal tersebut berbeda dengan hipertropi yang disebabkan
pembesaran ukuran sel. Sedangkan displasia adalah perubahan tidak normal dari
ukuran, bentuk, dan organisasi sel. Hiperplasia dan displasia dapat mengawali
munculnya kanker dalam beberapa bulan maupun tahun (Dipiro, et al., 2011).
Proses invasi dan metastase melalui beberapa langkah penting. Setelah
pembentukan neoplastik, sel ganas dan jaringan disekitarnya mensekresikan zat
yang menstimulasi terbentuknya pembuluh darah baru yang menyediakan oksigen
dan nutrisi. Proses ini disebut angiogenesis atau neovascularization. Sel tumor
kemudian harus melepaskan diri dari tumor utama dan menginvasi sel lain melalui
pembuluh darah dan pembuluh limfatik. Sel tumor atau kumpulan sel tumor yang
melepaskan diri dari tumor utama melalui pembuluh ini kebanyakan tidak dapat
bertahan dalam sirkulasi. Sel-sel yang telah disebarkan tersebut kemudian harus
menempel pada endotel vaskuler. Sel tersebut dapat berproliferasi pada lumen
pembuluh darah, namun kebanyakan berekstravasasi ke jaringan disekitarnya.
Lingkungan yang baru ini memungkinkan penyediaan growth factor dan nutrisi

untuk melakukan proliferasi dari metastase. Pada setiap proses sel metastase harus
melawan system imun host. Lalu sel metastase harus menginisiasi terjadinya
angiogenesis untuk memastikan terjadinya pertumbuhan dan proliferasi. Banyak
penelitian telah dilakukan untuk mencegah proses dari angiogenesis ini, karena
angiogenesis ini adalah tahap vital yang harus dilalui sel untuk dapat tumbuh dan
melakukan proliferasi (Dipiro, et al., 2011).
2.2 Tempe
Tempe salah satu produk fermentasi kedelai tradisional yang cukup terkenal,
dengan menggunakan jamur R. oligosporus.Dengan proses fermentasi menjadi
tempe, nilai gizi hasil olahan ini bertambah baik, karena pada proses fermentasi
dapat mengurangi kandungan antitripsin dan asam fitat yang dapat memperlambat
penyerapan protein (Setyowati et al., 2008).Inokulum tempe merupakan
kumpulan spora kapang yang memegang peranan penting dalam pembuatan tempe
karena dapat mempengaruhi mutu yang dihasilkan (Babu, 2009).
2.3Isoflavon
Pada kedelai ditemukan suatu zat antioksidan dalam bentuk isoflavon. Isoflavon
merupakan antioksidan yang sangat dibutuhkan tubuh untuk menghentikan reaksi
pembentukan radikal bebas (Hsu, 2010). Dalam kedelai terdapat tiga jenis
isoflavon, yaitu daidzein, glisitein, dan genistein. Jumlah isoflavon dalam kedelai
bervariasi, bergantung pada jenis kedelai, daerah geografis budidaya, dan cara
pengolahannya (Winarsi, 2007).

2.4 Whi5

Whi5 merupakan represor transkripsi G1-S yang secara negatif memulai dengan
cara mengikat dan menonaktifkan SBF. Whi5 diidentifikasi sebagai protein yang
mengontrol ukuran sel. Inaktivasi Whi5 menyebabkan aktivasi awal G1 spesifik
dan mengarah ke inisiasi siklus sel yang premature, sedengkan overekspresi dari
Whi5 menyebabkan keterlambatan G1 dan peningkatan ukuran sel. Pada siklus sel
kinase Cdk1/Cdc28, dalam hubungannya dengan Cyclin Cln3, memfosforilasi
Whi5, akibatnya terjadi ekspor Whi5 dari inti sel dan pelepasan SBF. Jalur ini
homolog dengan regulasi faktor traksripsi E2F pada siklus G1/S oleh Rb pada sel
mamalia. Whi5 yang terdapat dalam Saccaromyces cereviseae mempengaruhi
trankripsi melalui interaksi dengan SBF dan faktor trakskripsi MBF. Pada
Saccharomyces cereviseae, faktor-faktor transkripsi SBF dan MBF masingmasing adalah protein Swi4/Swi6 dab Mbp1/Swi6 (Ofir, 2012).
BAB III
METODE PENELITIAN
3.1 DesainPenelitian
Penelitian ini dilakukan dengan studi
Empiris dengan pendekatan kuantitatif secara eksperimental murni menggunakan
desain true experimental in vitro, pre post only control group design untuk
mengetahui pengaruh kombinasi isoflavon Glycine max dan Whi5 pada ragi
terhadap penurunan CDK2 pemicu sel kanker dengan objek sel HeLa.
3.2 SampelPenelitian
Sampel yang digunakan adalah sel HeLa (cell line kanker leher rahim yang
dikultur). Jumlah perlakuan pada penelitian ini ialah 10 perlakuan sehingga sel
HeLa akan dibagi menjadi 10 kelompok. Berikut merupakan pembagian
kelompok pemberian Isoflavon dan injeksi Whi5 dari ekstrak tempe :
Kelompok

Perlakuan yang diberikan

Kontrol Negatif

Tanpadiberiperlakuanapapun

KontrolPositif

Antioksidan BHT + Methotrexate

Kelompok A

Ekstrak tempe konsentrasi I 2% v/v

Kelompok B

Ekstrak tempe konsentrasi II 4% v/v

Kelompok C

Ekstrak tempe konsentrasi III6% v/v

Kelompok D

Ekstrak tempe konsentrasi IV8% v/v

Kelompok E

Ekstrak tempe konsentrasi V10% v/v

Kelompok F

Ekstrak tempe konsentrasi VI + BHT + Methotrexate)2 % v/v

Kelompok G

Ekstrak tempe konsentrasi VII + BHT + Methotrexate)4 % v/v

Kelompok H

Ekstrak tempe konsentrasi VIII + BHT + Methotrexate)6 % v/v

Kelompok I

Ekstrak tempe konsentrasi IX + BHT + Methotrexate)8 % v/v

Kelompok J

Ekstrak tempe konsentrasi X + BHT + Methotrexate)10 % v/v


Tabel 1. Rincian Perlakuan

Perhitungan besarnya pengulangan pada sampel adalah sebagai berikut (Anshori


M., 2008):
(t-1) (r-1) 15
t : jumlah perlakuan, r : jumlah ulangan
Pada penelitian ini t = 5 sehingga jumlah pengulangan adalah:
(10-1) (r-1) 15
r-1 15:9
r = 1,667 + 1 = 2,667 Dibulatkan menjadi 3 pengulangan.
Dari rumus diperoleh jumlah sel HeLa untuk masing-masing perlakuan adalah
lebih besar sama dengan 3. Sebagai cadangan, 10 L sel HeLaditambahkan pada
setiap kelompok perlakuan untuk mengantisipasi kemungkinan yang tidak
diinginkan seperti kematian, kegagalan pengambilan sampel, dll. Sehingga besar
sampel yang dibutuhkan :
Besar sampel Sel HeLa= (50x10) + (10x10) = 500 + 100 = 600L(Yenny, 2006).

3.3 Tempat Penelitian


Penelitian dilakukan di Laboratorium Biokimia Fakultas Kedokteran Universitas
Brawijaya Malang dan Laboratorium Penelitian dan Pengujian Terpadu (LPPT)
UGM Yogyakarta.
3.4VariabelPenelitian
3.4.1 Variabel Bebas Penelitian
Antioksidan BHT dan Methotrexate
Isoflavon dan Whi5 dari ekstrak tempe

3.4.2 Variabel Tergantung Penelitian


Gambaran morfologi sel dan proliferasi sel
Ekspresi CDK2
3.5Prosedur Penelitian

Skema 1. Prosedur Penelitian


3.5.1 Pembuatan Tempe
Kedelai direbus dan dikuliti kemudian direndam selama 24 jam dengan
temperatur kamar menggunakan air kran. Setelah itu, disiapkan ragi tempe dan
dicampur dengan rata kemudian dibungkus dengan menggunakan daun pisang dan
diperam selama 24, 48, 72, 96 jam dalam suhu kamar (27 oC) dan terbentuklah
tempe (Fitria, 2013).
3.5.2 Pembuatan Ekstrak Tempe

Sebanyak 100gr sampel diblender hingga terbentuk bubur, kemudian dimaserasi


dalam 250 ml etanol 70% selama 24 jam, kemudian disaring dan filtratnya
ditampung. Residu ditambah dengan 100 ml etanol 70%, kemudian dimaserasi
selama 24 jam, kemudian disaring dan filtratnya ditampung. Residu kedua
ditambah dengan100ml etanol 70 %. Filtrat hasil maserasi kemudian dipekatkan
dengan rotary evaporator hingga diperoleh ekstrak kental. Ekstrak kental di oven
selama 30 menit dengan suhu 50oC sehingga diperoleh isolate (Fitria, 2013).
3.5.3 Pengidentifikasian Isoflavon dan Perhitungan Kadar Isoflavon
Larutan sampel dibuat dengan mengambil 1 mg isolat isoflavon hasil ekstraksi
lalu masing-masing dilarutkan dalam etanol 10 mL. Larutan kemudian
disentrifugasi lalu diambil 20 L dengan alat injeksi. Selanjutnya sampel
diinjeksikan ke dalam HPLC.
Aktivitas antiradikal dihitung dengan metode DPPH dimana sampel direaksikan
dengan larutan DPPH. Aktivitas antiradikal diperlihatkan pada sistem yang
warnanya berubah dari ungu menjadi kekuningan (Fitria, 2013).

aktivitas antioksidan= 1

absorbansi sampel
x 100
absorbansi kontrol

Nilai 0% berarti tidak mempunyai aktivitas antiradikal bebas atau antioksidan,


sedangkan nilai 100% berarti peredaman total dan pengujian perlu dilanjutkan
dengan pengenceran larutan uji untuk melihat batas konsentrasi aktivitasnya.
3.5.4 Pengidentifikasian Whi5
Whi5 diidentifikasi dengan menggunakan primer sekuens DNA dengan panjang
295 a.a dan berat molekul 32,901 Da. Posisi Whi5 Sc dalam plot CH diperoleh
dengan menggunakan urutan asam amino sebagai query dan menjalankan prediksi
dari Predictor server Daerah Tentu Disorder (PONDR). Kami memperkirakan
gangguan struktural Whi5 dan Rb dengan jaringan saraf yang berbeda. PONDRFIT adalah meta-prediktor yang mengintegrasikan output dari enam prediktor
yang berbeda gangguan (Xue et al., 2010). Sekuens DNA Whi5/YOR083W :
ATGAGTTTGAGAACGCCGAAGAGAAGCAGGACTAGCGATGAACAAGA
ACAAGAACAAGAACAAGAGCAGGTACAGAACCCAGATACACATGTAA
ACAACGAGCATCAGCAGCGACCTGGGCCAACCACTCTATTGAGCACGC
CAGTACGTCTCAAAAATGGCTTTGGAACACCATCGCCGCCGTCACCAC

CAGGCATAACGAAAAGCATCACTAAATCGAGAAGAAGGCCGTCGACAA
CGAGTCTTCAGGGTATATTCATGTCGCCCGTCAATAAGCGTCGTGTCGG
CATAACCGCACATGGACGTGTATATGACCATAACGACGACGGACACGAA
AGTGAGAGTGAGGACGACGAAAATGAAGAAGAAAATGAAAATCAAAA
GAAGTACGACGGACACGTTAGTATGCCTTTGTTGCCACCGACAACGCC
CAAGTCAAGACGGTCGGAGGTGTTTCTGTCGCCGTCGCCGCGTTTGAG
GTCACCTCCGACGGCTGCGCGTCGGTCTACGGGCGAGCGGCCCATCCG
CGAAATATCACATACTTTGCGCACCAGGCTCAATTACGCGTTAGTCAAG
CTGCAAAATGGATGGACGGACAAGACACTTCCCGAGCTGGAGACGGA
GCTTGCTCCAGCAGTGCAGACGCCGCCACGTCGCTATCACAACAGATTT
CCAGATAGTGCAGACGCGGGTACTTCCGCGCATACAGCGTTTCTTCAGG
CGCTCGGAGGCCACCCACCACGGGAGGAGGCCACGGCTGTCGAAACA
CTGATGCTATTGTCGTCGCCTACCAAGAAGCAACAACACCGACCCGTGC
CGGCGACATCTGCTGGAGAACCCACGGACGAAACGGAGCCCGAGTCG
GATACCGAAGTGGAGACGTCTTAA (Makarevic, 2014).
3.5.5 PembuatanPreparatSel HeLa
Sel HeLa ditumbuhkan dalam media RPMI 1640-serum. Di dalamnya terkandung
nutrisi yang cukup untuk pertumbuhan yaitu, asam amino, vitamin, garam-garam
anorganik, dan glukosa. Serum yang ditambahkan mengandung hormon-hormon
yang mampu memacu pertumbuhan sel. Albumin berfungsi sebagai protein
transport, lipid diperlukan untuk pertumbuhan sel, dan mineral sebagai kofaktor
enzim.
3.5.6 Uji Sitotoksik
Kultur sel HeLa pada 96-well plate diuji menggunakan uji MTT. MTT (10 l
TACS MTT Cell Proliferation Assays) ditambahkan dengan PBS pada
microculture well yang mengandung sel dan media. Inkubasi dilakukan selama 4
jam pada suhu 37.5oC dengan 5% CO2, ditambahkan 100 l reagen solubilisasi
MTT II pada semua well, termasuk kontrol, dan diinkubasi pada suhu 37 oC
dengan 5% CO2 selama semalam. Setelah plates direaksikan, diukur absorbansi
pada 570 nm menggunakan 96-well plate reader(Fitria, 2013).
3.5.7 Pengukuran Proliferasi dengan Metode MTT Assay dan ELISA

10

Pertumbuhan sel dinilai dengan menggunakan 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazoliumbromide (MTT) dye reduction assay. Sel tumor (100 l,
1104 cells/ml) ditaburkan dalam 96 plate kultur jaringan. Setelah 24,48 dan 72
jam, MTT (0.5 mg/ml) ditambahkan setelah 4 jam. Setelah itu, sel dilisiskan
dengan menggunakan buffer yang terkandung 10% SDS di 0.01 M HCl. Plate
diinkubasi semalaman dengan kondisi 37oC, 5% CO2. Setiap plate diukur
menggunakan microplateELISA reader dengan absorbansi 570 nm. Setiap
eksperimen diukur 3 kali pengulangan. Proliferasi sel diukur dengan
menggunakan enzyme-linked immunosorbent assay (ELISA) kit. Sel tumor
ditumbuhkan pada microtite plate 96-well yang diinkubasi dengan 20 l BrdU tiap
well selama 8 jam. Deteksi dilakukan dengan menggunakan antiBrdU. Absorbansi
diukur pada panjang gelombang 450 nm (Rode, 2008).
3.5.7 Pengamatan Ekspresi CDK2 dengan Metode PCR
PCR (Polymerase Chain Reaction) dilakukan dalam beberapa tahap. Tahap awal
adalah denaturasi yang bertujuan untuk membuka untai ganda DNA menjadi 2
untai tunggal. Selanjutnya adalah penempelan primer (annealing) sehingga ikatan
hidrogen akan terbentuk antara primer dengan urutan komplemen pada template.
Kemudian reaksi polimerisasi (extension) dimana primer yang telah menempel
tadi akan mengalami perpanjangan pada sisi 3 dengan penambahan dNTP yang
komplemen dengan template oleh DNA polimerase. Pendeteksian hasil dari
produk PCR dilakukan dengan meteode deteksi elektroforesis gen agarosa. CDK2
dianalisa dengan menggunakan marker NAMALWA (Barnum, 2012).
3.6ProsedurPengumpulandanAnalisis Data
AnalisisstatistikadenganOne Way ANOVA danregresi linier denganmenggunakan
SPSS 16.One Way ANOVA digunakan untuk menguji apakah rata-rata
lebihdariduasampel berbeda secara signifikan atau tidak yaitu induksi normal,
kanker dengan pemberian kombinasi isoflavon Glycine max dan Whi5 pada ragi
tempe dengan dosis I, II, III, IV, V, VI, VII, VIII, IX, X. Uji yang dilakukan
pertama kali adalah melihat homogenitas data dengan uji homogenitas
varians.Setelah didapatkan data yang homogeny dilanjutkan dengan analisis PostHoc test. Variabel bebas yaitu pemberian kombinasi isoflavon Glycine max dan
Whi5 pada ragi tempe secara sonde dan variable tergantung yaitu kadar CDK2

11

kemudian dicari median dan standart deviasi. Analisis dilakukan pada 95% ( =
0,05). Apabila diperoleh p>0,05 artinya tidak ada perbedaan yang nyata,
sebaliknya bila p<0,05 menunjukkan ada perbedaan yang bermakna.
BAB IV
BIAYA DAN JADWAL KEGIATAN
4.1 Anggaran Biaya
No Jenis Pengeluaran
1
Peralatan penunjang
2
Bahan habis pakai
3
Perjalanan
Lain lain
4
Jumlah

Biaya (Rp)
Rp 1.118.500,00
Rp 7.431.500,00
Rp. 2.450.000,00
Rp 1.500.000,00
Rp 12.500.000,00

Tabel 2. Rincian biaya


4.2 Jadwal Kegiatan
No

JenisKegiatan

1
2
3
4
5
6
7
8
9
10
11
12
13
14

Penyusunan jadwal dan anggota penanggung jawab


Penyediaan peralatan dan bahan penelitian
Perizinan dan permohonan kerjasama
Pembuatan form pencatatandanpelaporan
Menyiapkan tempe
Perakitan alat dan bahan
Pengadaptasian objek coba
Pengecekan jumlah sel HeLa
Pemberian antioksidan BHT dan Methotrexate
Pemberian isoflavon dan Whi5
Pengamatan proliferasi sel HeLa
Pengamatan CDK2 dengan MTT Assay
Pengumpulan dan analisis data
Pelaporan
Tabel 3. Jadwal penelitian

Bulan
1 2

DAFTAR PUSTAKA
Babu, P. D, R. Bhakyaraj dan R. Vidhyalakshmi. 2009. A Low Cost Nutritious
Food Tempeh- A Review. World Journal of Dairy & Food Sciences 4
(1): 22-27.
Barnum, Susan R. 2012. Biotechnology an Introduction, 2nd edition.
USA:Thomson Brooks/Cole.

12

Chen,

Roita

dkk.

2012.

Solusi

Cerdas

Mencegah

dan

Mengobati

Kanker.Jakarta:PT Agro Media Pustaka.


Dipiro, J. T Talbert R.L, Yee. G.C, Matzke, G.R, Wells, B.G, Posey, L.M. 2011.
Pharmacotherapy Pathophysiologic Approach 8th Edition.United States of
America:Mc Graw-Hill.
Fitria, Nur Aini, Nurila Ciptaning Sidi, Rina Kartika Safitri, Annisa Nur Hasanah,
Titis Risni, 2013. Tempe Daun Pepaya sebagai Alternatif Terapi untuk
Penderita Kanker. Jurusan Teknologi Hasil Pertanian. Universitas Sebelas
Maret.
Hsu,

A.,

T.M.

Bray.,

W.G.

Helferich.,

Differential EffectsofWhole

Soy

onApoptosis

Cancer

in

Prostate

D.R.Doerge.,

Extract

and

E.
Soy

Ho.

2010.

Isoflavones

Cells.Experimental Biology and

Medicine. 235: 90-97.


Makarevic, Jasmina., Jochen Rutz., Eva Juengel., Silke Kaulfuss., Michael Reiter.,
Igor Tsaur., Georg Bartsch., Axel Haferkamp., Roman A. Blaheta. 2014.
Amygdalin Blocks Bladder Cancer Cell Growth In Vitro by Diminishing
Cyclin A and cdk2.
Mardiana, L., 2011. Kanker Pada Wanita Pencegahan dan Pengobatan dengan
Tanaman Obat. Jakarta: Penebar Swadaya.
Nursalam, 2011. Manajemen Keperawatan Aplikasi dalam Praktik Keperawatan
Profesional.Jakarta:Salemba Medika.
Ofir, Ayala.,Kay Hofmann., Esther Weindling., Tsvia Gildor., Katherine S.
Barker., Katherine S. Barker., P. David Rogers., Daniel Kornitzer. 2012.
Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene
expression and DNA replication stress response.
Rode, Hans-Jurgen. 2008. Apoptosis, Cytotoxicity and Cell Proliferation. Roche
Diagnostic.
Setyowati R, Dwi S, & Sri R. 2008. Pengaruh Penambahan Bekatul terhadap
Kadar s Kasar, Sifat Organoleptik dan Daya Terima Pada Pembuatan
Tempe Kedelai (Glycine max (L) Merill). Jurnal Penelitian Sains &
Teknologi 9 (1): 52 61.

13

Suprapti, M. L. 2003. Teknologi Pengolahan Pangan : Pembuatan Tempe.


Yogyakarta:Cetakan Kanisius.
Winarsi, H. 2007.Antioksidan Alami dan Radikal Bebas. Yogyakarta: Penerbit
Kanisius.
World Health Organization (WHO). 2010. Monitoring the Building Blocks of
Health Systems. A Handbook of Indicators and their Measurement
Strategies. Geneva: World Health Organization.