Anda di halaman 1dari 11

LAPORAN PRAKTIKUM

REKAYASA GENETIKA

ISOLASI RNA GEN mmPMa PADA TANAMAN TEMBAKAU TRANSGENIK

Oleh:
HANNI TSAAQIFAH
P051150071

PROGRAM STUDI BIOTEKNOLOGI


SEKOLAH PASCASARJANA
INSTITUT PERTANIAN BOGOR
BOGOR
2016

PENDAHULUAN
Latar Belakang
RNA, terutama mRNA merupakan materi genetik yang mengkode suatu protein
(Moeljopawiro dkk, 1992). RNA total dapat di isolasi dari sel dengan menambahkan
enzim DNase yang berfungsi untuk mendegradasi DNA. Isolat RNA yang baik
merupakan syarat untuk penelitian yang berkaitan dengan ekspresi gen. Haris et al.
(2005) dalam penelitiannya menyebutkan bahwa analisis ekspresi dari suatu tanaman
baik identifikasi maupun pengujian pola ekspresinya merupakan tahapan penting untuk
mendapatkan informasi tentang fungsi gen.
Dalam Central dogma dikatakan bahwa informasi biologi bermula dari DNA ke
RNA kemudian ke protein. Pemakaian cDNA dalam beberapa kegiatan molekular
cenderung lebih aman dibandingkan RNA (mRNA) secara langsung. Hal ini dikarena
kestabilan dari RNA itu sendiri yang mudah sekali terdegradasi oleh RNase. Sehingga
untuk berkerja dengan RNA secara langsung menjadi kurang efisien karena
membutuhkan tingkat kehati-hatian yang cukup tinggi. Oleh karena itu, cara yang
dianggap paling efektif dan efisien ketika ingin berkerja dengan RNA, yaitu dengan
menggunakan sekuens komplemen dari mRNA tersebut yang selanjutnya dalam
prosesnya menghasilkan cDNA. Pustaka cDNA hanya mengandung sekuen yang
terekspresi dalam bentuk mRNA dalam suatu kondisi tertentu menjadikan suatu
kelebihan tersendiri. Aplikasi analisis cDNA telah dilaporkan pada penelitian Chen
(2012) dalam mengetahui ekspresi gen dari virus TMV pada tanaman tembakau.
Lebih lanjut, pada konstruksi pustaka cDNA memerlukan RNA dependent DNA
polymerase berupa RT PCR atau Reverse Transcriptase PCR, dimana merupakan teknik
yang digunakan untuk membuat cDNA (complementary DNA) dengan RNA sebagai
template-nya. Proses ini adalah kebalikan dari transkripsi DNA menjadi RNA yang
umum terjadi pada makhluk hidup, sehingga dinamakan reverse transcription
(transkripsi terbalik) (Zhang, et al., 2010). Di alam proses ini hanya terjadi pada virusvirus tertentu ketika menyisipkan materi genetiknya yang berupa RNA ke dalam genom
inangnya. Mengingat pentingnya teknik analisis ekspresi gen tersebut maka praktikum
kali ini dilakukan isolasi RNA, serta analisis ekspresi gen pada daun tembakau
transgenik yang mengandung gen Mmpma.

Tanaman tembakau merupakan tanaman dikotil dan inang alami untuk A.


tumifaciens (Mayo et al., 2006). Tanaman tembakau transgenik yang dipakai pada
praktikum ini mengandung gen Mmpma, merupakan gen SOD yang awalnya disandi
oleh Melastoma malabathricum L. yang terlibat dalam cekaman asam dan kadar Al
yang tinggi, menyandi H+-ATPase membrane plasma (Muzuni, 2011). Keberadaan
protein ini banyak terlibat pada proses cekaman, yang bekerja dengan mengaktivasi
serangkaian transporter sekunder. Untuk itu penting mempelajari isolasi RNA serta
analisis ekspresi dari gen mMpma.
Tujuan Praktikum
Praktikum ini bertujuan untuk mengetahui dan memahami prinsip bagaimana
mengisolasi suatu gen dari hasil ekspresinya (pada jaringan tanaman).
METODOLOGI
Tempat dan Waktu
Praktikum ini dilakukan di Laboratorium Biorin, PPSHB, Institut Pertanian
Bogor (IPB) pada tanggal 23 Maret 2016.
Alat dan Bahan
Alat yang digunakan pada praktikum ini adalah mortar, microtube sentrifuge,
mikropipet, mikrotip, inkubator, sentrifuge, spektrofotometer, dan microwave.
Sedangkan alat yang digunakan untuk deteksi RNA dan cDNA adalah mesin
thermocycler dan elektroforesis gel agarose.
Bahan yang digunakan adalah daun tembakau, ntirogen cair, Trizol, , kloroform,
isopropanol, ethanol DEPC 75%, ddH2O DEPC 0,1%, 20 MOPS ,formamid,
formaldehid, buffer DNAse, DNAse, enzim reverse transcriptase, primer actin, ddH2O,
gel agarose, TAE 1 EtBr, alkohol, dan es.
Cara Kerja
Isolasi RNA dengan Reagen Trizol
Lembaran daun tembakau digerus menggunakan mortar dengan ditambahkan
nitrogen cair. Serbuk daun tembakau yang diperoleh kemudian dimasukkan kedalam

microtube yang berisi 800 l Trizol, kemudian dihomogenisasi menggunakan votrtex


dan diinkubasi selama 5 menit pada suhu ruang. Larutan ditambahhkan dengan 200 l
kloroform, diinvert (dibolak-balik) dan diinkubasi kembali selama 3 menit pada suhu
ruang. Kemudian disentrifugasi dengan kecepatan 10000 rpm dengan suhu 4C selama
15 menit. Bagian supernatan diambil dan dipindahkan dalam microtube baru kemudian
ditambahkan 500 l isopropanol. Microtube dibolak-balik kembali dan diinkubasi pada
suhu ruang selama 10 menit, kemudian disentrifuge pada suhu 4C, 10 menit.
Supernatan dibuang dan pelet ditambahkan 500 l ethanol DEPC 75%. Dilakukan
sentrifugasi dengan kecepatan 5700 rpm, pada suhu 4C selama 5 menit. Pellet
kemudian dikeringkan dengan vacum dry dan ditambahkan dengan RNAse dalam
DEPC water 0,1 % sebanyak 30l.
Pengukuran Kuantifikasi dan Visualisasi RNA
Pengukuran kuantitas RNA dilakukan dengan menggunakan spektrofotometer
pada panjang gelombang A260/A280 dengan campuran 5l sampel ditambah dengan
695 l DEPC, dimasukkan dalam kuvet, dan diukur absorbansinya.
Rumus = OD 260 x pengenceran x konstanta
Konstanta RNA = 40
Setelah diukur menggunakan spektrofotometer, sebanyak 10 g RNA
ditambahkan dengan premix kemudian diinkubasi dengan suhu 65C selama 10 menit
dan selanjutnya diinkubasi kembali didalam es selama 5 menit. Komposisi premix yang
digunakan adalah sebagai berikut:
20 MOPS

: 1,25 l

Formamid

: 12,5 l

Formaldehid

: 4,375 l

ddH2O DEPC 0,1%

: 6,875 l

Visualisasi RNA dilakukan dengan memindahkan RNA pada gel agarosa 1%


(w/v) selama 30 menit dengan tegangan 100 Volt. Gel agarosa 1% dibuat dengan
menimbang 0,35 gram agarose kemudian ditambahkan 1,75 ml 20 MOPS dan ddH 2O
DEPC 31,36 ml. Selanjutnya dipanaskan dalam microwave, didinginkan, dan
ditambahkan 1,89 ml formaldehyde. Sebanyak 10 l sampel ditambahkan dengan 2 l
loading dye kemudian dimigrasikan ke dalam gel agarose.

Penghilangan DNA dari sampel RNA


Sejumlah dH2O DEPC dan 5 g total RNA dicampurkan hingga mencapai volume
10 l, kemudian ditambahkan dengan 1,1 l buffer DNAse dan 0,2 l DNAse. Lalu
campuran larutan tersebut diinkubasi dalam PCR selama 5-10 menit untuk aktivasi
enzim pada suhu 25C. Setelah itu ditambahkan EDTA 1 l dan diinkubasi kembali
pada PCR dengan suhu 65C selama 10 menit. Larutan kemudian disimpan dalam es
selama 5 menit.
Sintesis cDNA
Sintesis cDNA dilakukan dengan mencampurkan 5 i Script reaction mix
sebanyak 2l, 0,5 l i Script reverse transcriptase, 1 l RNA template (100 fg menjadi 1
g total RNA), dan 6,5 l nuclease-free water. Campuran diinkubasi pada mesin
thermocycler dengan suhu 25C selama 5 menit, 42C selama 30 menit, dan 85C
selama 5 menit. cDNA yang diperoleh kemudian disimpan dalam suhu 4C sebelum
digunakan untuk analisis.
Dalam konstruksi pustaka cDNA, DNA polimerase yang memerlukan RNA
(RNA dependent DNA polymerase) yakni reverse transcriptase (RT) digunakan
untuk mengcopy messenger RNA (mRNA) menjadi molekul cDNA utas ganda.
Berbeda dengan mRNA yang dengan mudah terdegradasi dan menggambarkan
proses transkripsi dari gengen yang aktif pada suatu jaringan atau sel tertentu,
cDNA merupakan molekul yang lebih stabil sehingga sesuai untuk disisipkan ke
dalam vektor kloning, baik berupa plasmid, cosmid, atau bakteriofage. Populasi
mRNA yang telah di copy menjadi cDNA apabila diklon akan menghasilkan
pustaka cDNA yang bersifat permanen. Keuntungan pustaka cDNA adalah hanya
mengandung sekuen yang terekspresi dalam bentuk mRNA dalam suatu kondisi
atau waktu tertetu (Kleinsmith & Kish, 1995).
PCR aktin
Setelah tahapan transkripsi balik, maka untuk memeriksa apakah transkripsi balik
berhasil, maka dilakukan PCR dengan menggunakan gen aktin. Total volume campuran
PCR aktin adalah 10 l yang terdiridari cDNA template 1 l, mastermix 5 l, primer
aktin actF (ATGGCAGATGCCGAGGATAT) sebagai primer forward dan actR
(CAGTTGTGCGACCACTTGCA) sebagai primer reverse yang spesifik untuk ekson1-

ekson2 aktin dari tembakau masing-masing primer yang digunakan sebanyak 0.25 l
dan ddH2O sebanyak 3.5 l. Kondisi PCR terdiridari17 siklus.
Real Time PCR
Sampel yang telah diukur dengan menggunakan nanodrop untuk mengetahui
konsentrasi cDNA sampel yang didapat kemudian di sesuaikan sehingga menjadi 50
ng/l. Campuran berisi 1l sampeldan 9l mix Real Time PCR, yang kemudian di PCR
hingga 17 siklus.
HASIL DAN PEMBAHASAN
Prosedur isolasi RNA harus dilakukan dalam kondisi RNase-free. Sampel daun
tembakau yang diisolasi RNAnya harus bebas dari kontaminasi dengan ribonucleases
(RNase). Ada beberapa hal yang dapat dilakukan untuk meminimalkan risiko
mengekspos sampel dari Dnases eksternal dan Rnases. Peralatan yang dipergunakan
harus terlebih dahulu diautoklaf atau ditreatment (disemprot ethanol 70%) untuk
mencegah kontaminasi RNase. Perlakuan dengan larutan 0,1% diethyl pyrocarbonate
(DEPC) yang berfungsi menginaktivasi nuklease juga dapat dilakukan.
Isolasi RNA dengan Reagen Trizol
Pada praktikum ini digunakan daun tembakau yang dihaluskan menggunakan
mortar. Secara garis besar, isolasi RNA melalui 5 tahapan yaitu: 1). Homogenisasi, 2).
Separasi, 3) Presipitasi RNA, 4). Pencucian RNA, 5). Redissolving RNA. Tahap
homogenisasi, sampel serbuk daun tembakau ditambah reagen Trizol. Proses separasi
dilakukan dengan penambahan chloroform ke dalam sampel yang telah dihomogenisasi.
Setelah disentrifuge, sampel akan terpisah menjadi 2 bagian: bagian atas adalah fase air
(bening) & bagian bawah adalah sel yang rusak (coklat tua), diantara kedua fase
tersebut terdapat padatan berwarna putih susu. Fase air mempunyai volume sebesar 70%
dari volume reagen Trizol yang digunakan. RNA berada dalam fase air tersebut.
Memasuki tahap presipitasi, fase air diambil kemudian ditambah dengan isopropanol.
Fungsi isopropanol adalah untuk membantu presipitasi RNA. Pellet RNA baru akan
terlihat, setelah dilakukan sentrifuge. Pellet RNA berwarna putih susu. Setelah itu pellet
RNA dicuci dengan menggunakan DEPC.

Pengukuran Kuantifikasi dan Visualisasi RNA


Pellet

RNA

kemudian

dianalisis

konsentrasinya

dengan

menggunakan

spektrofotometer. Analisis dilakukan dengan panjang gelombang 260 nm. Pembacaan


260 nm memungkinkan untuk menghitung konsentrasi asam nukleat. OD yang
diperoleh dari panjang gelombang tersebut kemudian dimasukkan dalam rumus untuk
menghitung konsentrasi RNAnya.
Rumus = OD 260 x pengenceran x konstanta = ...g/ml
Konstanta RNA = 40
Rasio OD260/OD280 dari RNA total pada penelitian ini adalah berkisar antara 1.1
dan 1.5 yang menunjukkan bahwa RNA total yang diisolasi mempunyai kemurnian
yang masih rendah diaman masih terdapat kontaminan protein.
Tabel 1. Hasil pengukuran absorbansi RNA total daun tembakau
Kel

A 260

A 280

Kemurnian

1
2
3
4
5
6
7
8
9
10

0,390
0,897
0,281
0,463
0,432
0,362
0,104
0,357
0,668
0,295

0,212
0,320
0,284
0,254
0,088
0,303
0,473
0,227

1,32
1,44
1,52
1,42
1,18
1,17
1,41
1,30

Konsentrasi
(g/ml)
2184
4984
1573,6
2592,8
2419,2
2027,2
582,4
1999,2
3740,8
1652

Hasil elektroforesis RNA total menunjukkan adanya pita RNA yang semir putih
tipis pada 9 kelompok. Hasil yang semir menunjukkan bahwa RNA total yang diisolasi
mempunyai kemurnian yang masih rendah (mengacu pada tabel 1), kondisi tersebut
masih kurang bagus digunakan sebagai cetakan untuk sintesis cDNA total. Pita RNA
total pada daun tembakau kemungkinan adalah rRNA yang terdapat pada mitokondria
dan kloroplas yang berukuran 23S, 16S, dan 5S. untuk kelompok 7 migrasi RNA tidak
terlihat, kemungkinan disebabkan karena proses isolasi RNA kurang berhasil sehingga
jumlah RNA sangat rendah. Hal ini mengacu mengacu pada tabel 1, dimana kelompok 7
kuantitas RNAnya hanya 582,4 g/ml. Tentu berbeda jauh dengan kelompok lain yang
mencapai angka ribuan.

Gambar 1. Hasil visualisasi RNA total daun tembakau menggunakan elektroforesis gel
agarosa 1% (1-10: sampel kelompok 1-10)
Sintesis cDNA
Pada tahap ini hasil isolat RNA selanjutnya akan dipakai untuk pembentukan
cDNA. Dalam Central dogma dikatakan bahwa informasi biologi bermula dari DNA ke
RNA kemudian ke protein.Pada praktikum ini cDNA total telah berhasil disintesis
melalui transkripsi balik dengan menggunakan RNA total sebagai cetakan (tabel 2).
Dengan primer oligo-dT, hanya mRNA yang dapat disintesis menjadi cDNA karena
mempunyai poliA pada ujung 3 sedangkan rRNA dan tRNA tidak mempunyai
Teramplifikasinya cDNA dengan primer ActF dan ActR menunjukkan bahwa sintesis
cDNA total melalui proses transkripsi balik telah berlangsung dengan baik. Hasil dari
sintesis cDNA dapat dilihat pada tabel 2.
Tabel 2. Hasil uji cDNA menggunakan nanodrop.

Konsentrasi
cDNA
836.9

785.8

829.7

1006.8

834

778.7

796.7

815.5

818.9

10

824.2

Kelompok

PCR aktin dan Real Time PCR


Setelah terbentuk cDNA, maka dilakukan PCR untuk mendapatkan gen
SOD. Untuk mendapatkan gen tersebut diperlukan primer spesifik yang dapat
menempel dan mengamplifikasi gen tersebut secara spesifik sehingga cDNA
tersebut dapat diketahui mengandung gen SOD dan dapat dijadikan sebagai
pustaka cDNA. RNA yang telah diisolasi kemudian digunakan sebagai template untuk
mensintesis DNA dalam proses PCR. Oleh karena PCR tidak dapat dilakukan dengan
menggunakan RNA sebagai cetakan maka terlebih dahulu dilakukan proses transkripsi
balik (reverse transcription) terhadap molekul mRNA sehingga diperoleh molekul
cDNA (complementary DNA). Molekul cDNA tersebut kemudian digunakan sebagai
cetakan dalam proses PCR. Teknik RT-PCR memerlukan enzim transkriptase balik
(reverse transcriptase). Enzim transkriptase balik adalah enzim DNA polimerase yang
menggunakan molekul RNA sebagai cetakan untuk menyintesis molekul DNA (cDNA)
yang komplementer dengan molekul RNA tersebut (Yuwono, 2006).
RT-PCR dipakai untuk reaksi transkripsi balik untuk mengkonversi RNA menjadi
cDNA dan reaksi PCR untuk mengamplifikasi gen tertentu yang ingin kita ketahui
ekspresinya dilakukan dalam satu rangkaian reaksi dan dalam satu tabung reaksi yang
sama. Sedangkan pada two step RT-PCR, reaksi transkripsi balik dan reaksi PCR
dilakukan secara terpisah dan melibatkan beberapa tabung reaksi.

Gambar 2. Grafik Real Time/Q PCR, A. grafik aktin tanaman tembakau, b. grafik
sampel cDNA Tembakau transgenik.

Tabel 3. Data hasil Real Time PCR sampel daun tembakau.

1
2

Sampl
e
Name
1
2

4
5
6

4
5
6

8
9

8
9

10

10

Channe
l

Ct
Fitting Ekspres
Ct Fitting
sampe sampe
i
actin actin
l
l
sampel
0
0
0
0
0
0
33.2
0
2
137
0
0
0
0
0
0
0
0
0
0
30.6
0
0
108
0
0
0
0
0
0
0
35.8
0
3
60
0

Berdasarkan data pada tabel 3, Untuk mengetahui apakah gen SOD terekspresi
atau tidak, maka dilakukan penghitungan ct dengan merasiokan antara ct sampel / ct
aktin, dimana hasil akhir menujukkan angka 0. Artinya pada praktikum ini ekspresi dari
gen SOD pada tanaman tembakau transggenik tidak berhasil. Hasil tersebut mengacu
pada grafik maupun data dimana cDNA pada semua sampel tidak muncul. Hasil ini
berkaitan dengan hasil isolat RNA pada tahap awal yang masih kurang murni sehingga
bis ajadi berdampak pada tahap berikutnya.
KESIMPULAN
Pada saat melakukan isolasi RNA perlu kehati-hatian karena sifat dari RNA yang
single strand sangat rentan dan mudah terdegradasi. Secara umum isolasi RNA
dilakukan dengan tahapan 1). Homogenisasi, 2). Separasi, 3) Presipitasi RNA, 4).
Pencucian RNA, 5). Redissolving RNA. Pada praktikum isolasi RNA ini digunakan
reagen trizol.
Pada praktikum ini berhasil melakukan isolasi RNA meskipun hasil yang
diperoleh semir, namun hal tersebur menunjukkan bahwa terdapat RNA dengan
kemurnian yang rendah. Hasil ini sebenarnya belum begitu baik sebagai template
sintesis cDNA. Pustaka cDNA dapat diperoleh dari mengisolasi mRNA dari suatu
jaringan tanaman sebagai hasil ekspresi dari sebuah gen target.

Untuk analisis ekspresi dari tanaman tembakau transgenik, tidahk berhasil.


Kesimpulan ini mengacu pada data kyang menunjukkan rasio antara ct sampel/ct aktin
yang nilainya 0.
DAFTAR PUSTAKA
Chen Rong-Ping, Liu Lie, Wan Xiu-Qing, Qiu En-Jian, Wang Chun-Jun, Song BaoGang, Yan Pei-Qiang, and Yang Tie-Zhao. 2012. cDNA-AFLP Analysis of
Differentially Expressed Genes in Tobacco Infected by Tobacco Mosaic Virus.
ACTA AGRONOMICA SINICA, 38(1): 62-70.
Haris, N., Aswidinnoor, H., Suwanto A., Suhartono, M., Mathius, N. T., Purwantara, A.
2005. Konstruksi pustaka cDNA dari daun klon karet AVROS 20137 yang
diinfeksi patogen Corynespora cassiicola. Menara Perkebunan, 73(2): 44-62.
Mayo, K. J., B. J. Gonzales dan H. S. Mason. 2006. Genetic transformation of tobacco
NT1 cell with Agrobacterium tumefaciens, Nat. Prot., 1: 1105-1111.
Moeljopawiro, S., Sudjadi, Ismadi, S. Sodoadisewoyo, H. Hartiko, W. Asmara,
T.Yuwono dan Sisimindari. 1992. Genetika Molekuler. Reviewer: Joedoro
Soedarsono. Pusat Antar Universitas-Bioteknologi, Universitas Gadjah Mada,
Yogyakarta.
Muzuni. 2011. Iolasi, Pengklonan, danKonstruksi RNAi Gen Penyandi H+-ATPase
Membaran
Plasma
dariMelastomamalabathricumL.
DisertasiBiologi,
IntitutPertanian Bogor. Bogor.
Yuwono T.2006. BioteknologiPertanian. GadjahMada University Press. Yogyakarta.
Zhang G, Dong Y L, Xia N, Zhang Y, Wang X J, Qu Z P, Li Y M, Huang L L, Kang Z S.
2010. cDNA-AFLP analysis reveals differential gene expression in wheat adultplant resistance to stripe rust. Acta Agron Sin, 36: 401409