Anda di halaman 1dari 18

BAB V.

EKSPRESI GEN

Salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik
adalah fungsi fenotipik. Artinya, DNA harus mampu mengatur pertumbuhan dan
diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu.
Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam
sel. Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu, dan setiap
asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam
molekul DNA. Rangkaian proses ini, mulai dari DNA hingga terbentuknya asam amino,
dikenal sebagai dogma sentral biologi molekuler.

Gambar 1. Diagram dogma sentral biologi molekuler

Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA
dinamakan transkripsi, sedangkan penerjemahan urutan basa RNA menjadi urutan asam
amino suatu protein dinamakan translasi. Jadi, proses tanskripsi dan translasi dapat
dilihat sebagai tahap-tahap ekspresi urutan basa DNA. Namun, tidak semua urutan basa
DNA akan diekspresikan menjadi urutan asam amino. Urutan basa DNA yang pada
akhirnya menyandi urutan asam amino disebut sebagai gen. Dengan demikian, secara
kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat
dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino
tertentu.
2

Tahap-tahap transkripsi
Transkripsi berlangsung dalam empat tahap, yaitu pengenalan promoter, inisiasi,
elongasi, dan teminasi. Masing-masing akan dijelaskan sebagai berikut.
1. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang
mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. Daerah ini dinamakan
promoter. Baik pada prokariot maupun eukariot, promoter selalu membawa suatu
urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai
urutan konsensus. Pada prokariot urutan konsensusnya adalah TATAAT dan disebut
kotak Pribnow, sedangkan pada eukariot urutan konsensusnya adalah TATAAAT
dan disebut kotak TATA. Urutan konsensus akan menunjukkan kepada RNA
polimerase tempat dimulainya sintesis. Kekuatan pengikatan RNA polimerase oleh
promoter yang berbeda sangat bervariasi. Hal ini mengakibatkan perbedaan kekuatan
ekspresi gen.
2. Setelah mengalami pengikatan oleh promoter, RNA polimerase akan terikat pada
suatu tempat di dekat daerah promoter, yang dinamakan tempat awal polimerisasi.
Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun
segera dimulai.
3. Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul
DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA
yang sedang diperpanjang.
4. Molekul RNA yang baru saja selesai disintesis, dan juga enzim RNA polimerase,
segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa
pengakhir (terminasi). Terminasi dapat terjadi oleh dua macam sebab, yaitu terminasi
yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan
terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Di antara
keduanya terminasi diri lebih umum dijumpai. Terminasi diri terjadi pada urutan basa
palindrom yang diikuti oleh beberapa adenin (A). Urutan palindrom adalah urutan
yang sama jika dibaca dari dua arah yang berlawanan. Oleh karena urutan palindom
ini biasanya diselingi oleh beberapa basa tertentu, maka molekul RNA yang
dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti
pada Gambar 2.
3

urutan penyela

5’ 3’
ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT DNA
T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA
3’ 5’

transkripsi

U U
U U
C G
C G
U A
C G
G C RNA
G C
A U
A U
5’ A U 3’

Gambar 2 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala

Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Hal ini
karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida,
promoter dapat mengikat RNA polimerase yang lain. Pada gen-gen yang ditranskripsi
dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut
akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang
berbeda-beda.
Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama.
Hanya saja, pada prokariot produk langsung transkripsi atau transkrip primernya adalah
mRNA (akan dijelaskan di bawah), sedangkan pada eukariot transkrip primernya harus
mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. Prosesing RNA ini
mencakup dua peristiwa, yaitu modifikasi kedua ujung transkrip primer dan pembuangan
4

urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron). Ujung 5’
dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga
terbentuk suatu gugus terminal yang dinamakan cap, sedangkan ujung 3’ dimodifikasi
dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. Sementara itu,
panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang
transkrip primer, tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah
dibuang. Setelah intron dibuang, segmen-segmen sisanya (disebut ekson) segera
digabungkan menjadi mRNA. Pembuangan intron dan penggabungan ekson menjadi
molekul mRNA dinamakan penyatuan RNA atau RNA splicing.

Macam-macam RNA
Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami
diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam
RNA, yaitu
1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali
bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul
mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi
urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding
sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi
pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon.
Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 1.
Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi
(disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer
sequences atau noncoding sequences). Sementara itu, pada eukariot di samping
kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi.
Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA
pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa
polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA
polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang
masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya
dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA
polisistronik.
5

2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi
hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi
mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom
yang diselingi oleh beberapa basa (Gambar 3). Pada salah satu kalanya, tRNA
membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA.
Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat
tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul
aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase.
Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan
gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan
oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai
dengan antikodon dan macam asam amino yang dibawanya.

Gambar 3. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian
struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan
separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan
6

sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan
tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang
translasi di bawah ini).

Translasi
Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit
karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara
makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi
menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus
berperan dalam proses translasi tersebut meliputi
1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom
2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan
mengaktifkan asam amino
3. Empat puluh hingga 60 molekul tRNA yang berbeda
4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi
polipeptida.
Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom,
suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas
dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah
ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju
pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S).
Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot
biasanya sekitar 80S.
Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing
dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul
aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan
molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di
tapak P.
Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan
arah tertentu sebagai berikut.
1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga
ujung 3’.
7

2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan


asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein
yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan
metionin dan diakhiri dengan serin.
Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4.
Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya
telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa
tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau
urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan
oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi
satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam
amino yang dibawanya. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA.
Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai
polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus
amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam
amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan
tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada
prokariot, akan diberikan di bawah ini.
arah gerakan ribosom

P A ribosom

5’ AUC ACC CUG GGG 3’ mRNA


UAG UGG

GAC
tRNA aminoasil-tRNA
aa aa aa COOH
aa aa
NH2 NH2 COOH

ikatan peptida
Gambar 4. Skema garis besar sintesis protein
Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang
membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa
sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan
8

terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-


tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut
dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang
sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. Pada
eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin, tetapi molekul ini
akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi
(IF-1, IF-2, dan IF-3). Selain itu, baik pada prokariot maupun eukariot, terdapat pula
metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan
sebagai metionil-tRNAMet).
Kompleks inisiasi pada prokariot terbentuk antara mRNA, metionil-tRNAfMet, dan
subunit kecil ribosom (30S) dengan bantuan protein IF-1, IF-2, dan IF-3, serta sebuah
molekul GTP. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan
basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan
pengarah (leader sequence) pada mRNA. Selanjutnya, kompleks inisiasi bergabung
dengan subunit besar ribosom (50S), dan metionil-tRNAfMet terikat pada tapak P.
Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-
tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya
yang akan masuk ke tapak A. Pengikatan aminoasil-tRNAfMet berikutnya, misalnya alanil-
tRNAala, ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu.
Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P
dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil
transferase, suatu enzim yang terikat pada subunit ribosom 50S. Reaksi ini
menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala
di tapak A.
Langkah berikutnya adalah translokasi, yang melibatkan (1) perpindahan f-met-ala-
tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom
sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke
tapak P. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah
triplet kodon untuk alanin. Triplet kodon berikutnya, misalnya penyandi serin, akan
masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali.
9

Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan
dengan EF-G.
Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu
tripet kodon yang menyandi terminasi memasuki tapak A. Sebelum suatu rantai
polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin
menjadi metionin. Terminasi ditandai oleh terlepasnya mRNA, tRNA di tapak P, dan
rantai polipeptida dari ribosom. Selain itu, kedua subunit ribosom pun memisah. Pada
terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau
releasing factors, yaitu RF-1 dan RF-2.
Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Pada
umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang
satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Kompleks translasi
yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau
polisom. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida
yang akan disintesis. Sebagai contoh, rantai hemoglobin yang tersusun dari sekitar 150
asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom).
Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Hal ini
dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara
transkripsi dan translasi. Dengan berlangsungnya kedua proses tersebut secara
bersamaan, ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn
off) ekspresi gen, seperti yang akan dijelaskan nanti, juga menjadi sangat efisien.
Namun, tidak demikian halnya pada eukariot. Transkripsi terjadi di dalam nukleus,
sedangkan translasi terjadi di sitoplasma (ribosom). Pertanyaan yang muncul adalah
bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma, faktor-faktor
apa yang menentukan saat dan tempat translasi? Sayangnya, hingga kini kita belum dapat
menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Kita baru mengetahui
bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada
pada prokariot. Salah satu di antaranya seperti telah kita bicarakan di atas, yaitu bahwa
mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih
dahulu sebelum dapat ditranslasi.
10

Kode genetik
Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode
genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari
pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino.
Basa nitrogen pada mRNA hanya ada empat macam, sedangkan asam amino ada 20
macam. Oleh karena itu, jelas tidak mungkin tiap asam amino disandi oleh satu basa.
Begitu juga, kombinasi dua basa hanya akan menghasilkan 4 2 atau 16 macam duplet,
masih lebih sedikit daripada macam amino yang ada. Kombinasi tiga basa akan
menghasilkan 4 3 atau 64 triplet, melebihi jumlah macam asam amino. Dalam hal ini, satu
macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon.

Sifat-sifat kode genetik


Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut.
1. Kode genetik bersifat universal. Artinya, kode genetik berlaku sama hampir di setiap
spesies organisme.
2. Kode genetik bersifat degenerate atau redundant, yaitu bahwa satu macam asam
amino dapat disandi oleh lebih dari satu triplet kodon. Sebagai contoh, treonin dapat
disandi oleh ACU, ACC, ACA, dan ACG. Sifat ini erat kaitannya dengan sifat
wobble basa ketiga, yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu
disertai perubahan macam asam amino yang disandinya. Diketahuinya sifat wobble
bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala
ragi, yang ternyata dapat berpasangan dengan basa A, U, atau pun C. Dengan
demikian, satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon
pada mRNA.
3. Oleh karena tiap kodon terdiri atas tiga buah basa, maka tiap urutan basa mRNA, atau
berarti juga DNA, mempunyai tiga rangka baca yang berbeda (open reading
frame). Di samping itu, di dalam suatu segmen tertentu pada DNA dapat terjadi
transkripsi dan translasi urutan basa dengan panjang yang berbeda. Dengan perkataan
lain, suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang
tindih (overlapping). Sebagai contoh, bakteriofag фX174 mempunyai sebuah untai
tunggal DNA yang panjangnya lebih kurang hanya 5000 basa. Seandainya dari urutan
11

basa ini hanya digunakan sebuah rangka baca, maka akan terdapat sekitar 1700 asam
amino yang dapat disintesis. Kemudian, jika sebuah molekul protein rata-rata
tersusun dari 400 asam amino, maka dari sekitar 1700 asam amino tersebut hanya
akan terbentuk 4 hingga 5 buah molekul protein. Padahal kenyataannya, bakteriofag
фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino.
Dengan demikian, jelaslah bahwa dari urutan basa DNA yang ada tidak hanya
digunakan sebuah rangka baca, dan urutan basa yang diekspresikan (gen) dapat
tumpang tindih satu sama lain.
Tabel 1. Kode genetik

Basa I Basa II Basa III


(5’) (3’)
U C A G
U
Phe Ser Tyr Cys
U Phe Ser Tyr Cys C
Leu Ser Stop Stop A
Leu Ser Stop Trp G
Leu Pro His Arg U
C Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
ILe Thr Asn Ser U
A Ile Thr Asn Ser C
ILe Thr Lys Arg A
Met Thr Lys Arg G
Val Ala Asp Gly U
G Val Ala Asp Gly C
Val Ala Glu Gly A
Val Ala Glu Gly G
Keterangan :
phe = fenilalanin ser = serin his = histidin glu = asam glutamat
leu = leusin pro = prolin gln = glutamin cys = sistein
ile = isoleusin thr = treonin asn = asparagin trp = triptofan
met = metionin ala = alanin lys = lisin arg = arginin
val = valin tyr = tirosin asp = asam aspartat gly = glisin
AUG (kodon metionin) dapat menjadi kodon awal (start codon)
stop = kodon stop (stop codon)
12

Pengaturan Ekspresi Gen


Produk-produk gen tertentu seperti protein ribosomal, rRNA, tRNA, RNA
polimerase, dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang
berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel.
Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-
menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada
kondisi lingkungan di sekitarnya. Sementara itu, banyak pula gen lainnya yang
ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan
diekspresikan pada waktu dan di dalam jenis sel tertentu. Untuk gen-gen semacam ini
harus ada mekanisme pengaturan ekspresinya.
Pengaturan ekspresi gen dapat terjadi pada berbagai tahap, misalnya transkripsi,
prosesing mRNA, atau translasi. Namun, sejumlah data hasil penelitian menunjukkan
bahwa pengaturan ekspresi gen, khususnya pada prokariot, paling banyak terjadi pada
tahap transkripsi.
Mekanisme pengaturan transkripsi, baik pada prokariot maupun pada eukariot,
secara garis besar dapat dibedakan menjadi dua kategori utama, yaitu (1) mekanisme
yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon
terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram
(preprogramed circuits). Mekanisme penyalapadaman sangat penting bagi
mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali
terjadi secara tiba-tiba. Sebaliknya, bagi eukariot mekanisme ini nampaknya tidak terlalu
penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang
datang dari dalam tubuh, dan di sisi lain, sistem sirkulasi akan menjadi penyangga bagi
sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. Pada mekanisme
sirkit, produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu
transkripsi gen kedua, produk gen kedua akan menekan transkripsi gen kedua dan
memacu transkripsi gen ketiga, demikian seterusnya. Ekspresi gen yang berurutan ini
telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan
di luar urutan. Oleh karena urutan ekspresinya berupa sirkit, maka mekanisme tersebut
dinamakan sirkit ekspresi gen.
13

Induksi dan represi pada prokariot


Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari
berbagai mekanisme genetika molekuler. Bakteri ini secara alami hidup di dalam usus
besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa.
Apabila suatu ketika E. coli ditumbuhkan pada medium yang sumber karbonnya bukan
glukosa melainkan laktosa, maka enzim pemecah laktosa akan disintesis, sesuatu yang
tidak biasa dilakukannya. Untuk itu, gen-gen penyandi berbagai enzim yang terlibat
dalam pemanfaatan laktosa akan diekspresikan (turned on). Sebaliknya, dalam keadaan
normal, yaitu ketika tersedia glukosa sebagai sumber karbon, maka gen-gen tersebut
tidak diekspresikan (turned off). Proses yang terjadi ketika ekspresi gen merupakan
respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi,
sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai
induser. Jadi, dalam contoh ini laktosa merupakan induser.
Induksi secara molekuler terjadi pada tingkat transkripsi. Peristiwa ini berkenaan
dengan laju sintesis enzim, bukan dengan aktivitas enzim. Pada pengaktifan enzim suatu
molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim
tersebut, bukan peningkatan laju sintesisnya.
Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme),
bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan
bagi pertumbuhannya. Sebagai contoh, Salmonella typhimurium mempunyai sejumlah
gen yang menyandi enzim-enzim untuk biosintesis triptofan. Dalam medium
pertumbuhan yang tidak mengandung triptofan, S. typhimurium akan mengekspresikan
(turned on) gen-gen tersebut. Akan tetapi, jika suatu saat ke dalam medium
pertumbuhannya ditambahkan triptofan, maka gen-gen tersebut tidak perlu diekspresikan
(turned off). Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap
keberadaan suatu zat di lingkungannya dinamakan represi, sedangkan zat yang
menyebabkan terjadinya represi disebut sebagai korepresor. Jadi, dalam contoh ini
triptofan merupakan korepresor.
Seperti halnya induksi, represi juga terjadi pada tahap transkripsi. Represi sering
dikacaukan dengan inhibisi umpan balik (feedback inhibition), yaitu penghambatan
14

aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu
sendiri. Represi tidak menghambat aktivitas enzim, tetapi menekan laju sintesisnya.

Model operon
Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model
yang diajukan oleh F. Jacob dan J. Monod pada tahun 1961. Menurut model yang dikenal
sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi
enzim, yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan
dengan gen-gen struktural yang diaturnya. Gen regulator menyandi pembentukan suatu
protein yang dinamakan represor. Pada kondisi tertentu represor akan berikatan dengan
operator, menyebabkan terhalangnya transkripsi gen-gen struktural. Hal ini terjadi karena
enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan, atau
bahkan tumpang tindih, dengan operator.
Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi
gen-gen struktural (PO), operator (O), dan gen-gen struktural (GS). Di luar operon
terdapat gen regulator (R) beserta promoternya (PR), molekul protein represor yang
dihasilkan oleh gen regulator, dan molekul efektor. Molekul efektor pada induksi adalah
induser, sedangkan pada represi adalah korepresor.
Pada Gambar 5 terlihat bahwa terikatnya represor pada operator terjadi dalam
keadaan yang berkebalikan antara induksi dan represi. Pada induksi represor secara
normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki
promoter operon. Akibatnya, transkripsi gen-gen struktural tidak dapat berlangsung.
Namun, dengan terikatnya represor oleh induser, promoter operon menjadi terbuka bagi
RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya
ditranslasi. Dengan demikian, gen-gen struktural akan diekspresikan apabila terdapat
molekul induser yang mengikat represor.
Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon
induksi. Salah satu contohnya adalah operon lac, yang terdiri atas gen-gen penyandi
enzim pemecah laktosa seperti telah disebutkan di atas.
Sebaliknya, pada represi secara normal represor tidak berikatan dengan operator
sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen
struktural dapat terjadi. Akan tetapi, dengan adanya korepresor, akan terbentuk kompleks
15

represor-korepresor yang kemudian berikatan dengan operator. Dengan pengikatan ini,


RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen
struktural menjadi terhalang. Jadi, ekspresi gen-gen struktural akan terepresi apabila
terdapat molekul korepresor yang berikatan dengan represor.

operon
PR R PO O GS1 GS2 GS3

represor efektor (induser atau korepresor)


a)

RNA polimerase

induser

RNA polimerase berjalan

transkripsi
kompleks represor-induser
translasi
b)
RNA polimerase berjalan

transkripsi
korepresor
translasi

kompleks represor-korepresor
c)
Gambar 5. Model operon untuk pengaturan ekspresi gen
a) komponen operon b) induksi c) represi
16

Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang


dinamakan operon represi. Operon trp, yang terdiri atas gen-gen penyandi enzim untuk
biosintesis triptofan merupakan contoh operon represi.

Pengaturan ekspresi gen pada eukariot


Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan
ekspresi gen pada eukariot. Namun, kita telah mengetahui bahwa pada eukariot tingkat
tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Hal ini
menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi, dan juga prosesing
mRNA, memegang peran yang sangat penting dalam proses diferensiasi sel.
Operon, kalau pun ada, nampaknya tidak begitu penting pada eukariot. Hanya pada
eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip
operon. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik, yaitu hanya
membawa urutan sebuah gen struktural. Transkrip primer yang adakalanya menyerupai
polisistronik pun akan diproses menjadi mRNA yang monosistronik.
Selain itu, terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan
ekspresi seperangkat gen yang telah terprogram (preprogramed). Berbagai macam sinyal
seperti molekul-molekul sitoplasmik, hormon, dan rangsangan dari lingkungan memicu
dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat
yang tepat selama perkembangan individu. Bukti paling nyata mengenai adanya
keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada
kasus mutasi yang terjadi pada lalat Drosophila, misalnya munculnya sayap di kepala di
tempat yang seharusnya untuk mata. Dengan mempelajari mutasi-mutasi semacam ini
diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen
selama perkembangan normal individu.
Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam
seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang
telah mengalami prosesing. Sebagai contoh, hanya ada dua hingga lima persen urutan
DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya.
Demikian pula, mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan
delapan persen urutan DNAnya. Jadi, sebagian besar urutan basa DNA di dalam genom
eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di
17

dalam sel atau jaringan tertentu. Dengan perkataan lain, molekul mRNA yang dihasilkan
dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda
pula.

Pengaturan pada tahap prosesing mRNA


Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah
yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang
sama. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang
berbeda, yang akan ditranslasi dengan efisiensi berbeda pula.
Pada tikus, misalnya, ditemukan bahwa perbedaan sintesis enzim α-amilase oleh
berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan
pola pembuangan intron. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada
yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. Jadi, dalam hal
ini transkrip primernya sebenarnya sama, tetapi kemudian ada perbedaan mekanisme
prosesing, khususnya pada penyatuan (splicing) mRNA.

Pengaturan translasi
Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang
lebih kurang sama, pada eukariot ada mekanisme pengaturan translasi. Macam-macam
pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali
sebelum datangnya suatu sinyal, (2) pengaturan umur (lifetime) molekul mRNA, dan (3)
pengaturan laju seluruh sintesis protein.
Telur yang tidak dibuahi secara biologi bersifat statis. Akan tetapi, begitu fertilisasi
terjadi, sejumlah protein akan disintesis. Hal ini menunjukkan bahwa di dalam sel telur
yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal
untuk translasi. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon, sedangkan
molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked
mRNA).
Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi. Sel telur ini
akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan.
Dengan demikian, laju sintesis protein menjadi sangat rendah. Namun, hal ini bukan
akibat kurangnya pasokan mRNA, melainkan karena terbatasnya ketersediaan suatu
18

unsur yang dinamakan faktor rekrutmen. Hingga kini belum diketahui hakekat unsur
tersebut, tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA.
Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap
mRNA. Sebagai contoh, konsentrasi suatu jenis molekul antibodi dipertahankan konstan
oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. Jadi, molekul
antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya
sehingga inisiasi translasi akan terhambat.

Sintesis beberapa protein dari satu segmen DNA


Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen.
Sebaliknya, pada eukariot tidak pernah dijumpai mRNA polisistronik, tetapi ada kondisi
yang dapat disetarakan dengannya, yakni sintesis poliprotein. Poliprotein adalah
polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong
untuk menghasilkan sejumlah molekul protein yang utuh. Tiap protein ini dapat dilihat
sebagai produk satu gen tunggal.
Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling
dipisahkan oleh kodon stop dan kodon awal, tetapi dipisahkan oleh urutan asam amino
tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease
tertentu. Tempat-tempat pemotongan ini tidak akan berfungsi serempak, tetapi bergantian
mengikuti suatu urutan.

Referensi:

Susanto, A.H (2002) Bahan Ajar Genetika Dasar, Fakultas Biologi UNSOED,
Purwokerto