J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

Keywords: Accumulator plant. P. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. Hidayati 1). biomas. conjugatum dan M. Kecamatan Nanggung. Paspalum conjugatum. NPK. accumulation capacity Katakunci: Tumbuhan akumulator. Hg. Kecamatan Nanggung. ke sawah ataupun ke kolam ikan. The fertilizer treatments were significantly affected plant growth. vaginalis. Based on characteristic of hyperaccumulator plant. N. Monocharia vaginalis. Kecamatan Nanggung. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. F. nudiflora were selected for fitoremediation of Hg contaminated soil. sativa dan C. molesta. nudiflora. Meanwhile S. Oryza sativa. molesta also showed the highest capasity to accumulate Hg/year followed by C. Hg. M. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. Bogor E-mail : tihaeti@yahoo. Cibinong. Kemungkinan 1 . Cyperus monocephala. Desa Bantar Karet. The treatments were fertilizer: no fertilizer (as a control). Kabupaten Bogor. Desa Bantar Karet. Limnoharis flava. sativa and C. this research suggested that S. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. nudiflora. The S. Centrosema pubescens. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). conjugatum. Syarif 1) & S. Bogor Titi Juhaeti 1). vaginalis.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. The result showed that the growth of each plant was significantly different. Desa Bantar Karet. Kabupaten Bogor. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. O. P. molesta showed the highest biomass followed by M. The aim of this research is to study the potency of Salvinia molesta. biomass. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. manure and compost. O. Cibinong Science Centre. vaginalis.

Monochoria vaginalis. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. di daerah Sunda disebut jukut pendul bodas. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum. Salvinia molesta (kiambang. Centrosema pubescens. mata lele). Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. Hidayati. Kayser etal. Cyperus monocephala. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis. Salvinia molesta. di kebun. Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya.Juhaeti. dikenal dengan nama sentro. Pivetz. di hutan sekunder. di tempat yang agak basah seperti di pinggir sungai juga di sawah. Commelina nudiflora. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . Mikania cordata. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. dan kubis. barley. 2000. Indian mustard. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. 2000. Centrosema pubescens Benth. 2001. di tepi jalan. kacang-kacangan. penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. termasuk pohon. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Cyperus monocephala dikenal sebagai teki badot. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. gandum. oat. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. 2 2001.. 2007. Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. 2004 Dalam Rodriguez et al. Terry and Banuelos. Chen et al. merupakan tumbuhan terna memanjat.. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). rumputrumputan dan tumbuhan air. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung.

Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi. Nanggung. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor. 3 . Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. dan Cd pada tanaman. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn. Desa Bantar Karet. Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. Penelitian dilakukan pada bulan Maret-Oktober 2007.S. Sementara itu. Desa Bantar Karet Kec. Ni. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Dalam prakteknya.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Kecamatan Nanggung. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa. Penelitian in-situ dilakukan di Kampung Leuwibolang. Bogor. Kab. Salvinia molesta D. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman.

(tali korang). HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S. 3. M. Syarif & Hidayat Mitchell(kayambang). petak penelitian tidak tergenang. Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman. Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut. Mikania cordata (Burm. Pada tahap ini jenis tanaman yang diuji dikurangi yakni C. Pengairan menggunakan air yang tidak terkontaminasi merkuri. kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman. vaginalis. 3. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. Monocharia vaginalis (Burm. Sedangkan perlakuan pemupukannya adalah: 1.) B.8 X 2 meter dengan 3 ulangan.f. P. molesta. Limnoharis flava (L. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama. flava. Setelah itu. dan 5. . pubescens dan M. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas). conjugatum. Paspalum conjugatum Berg (jukut pahit). sativa. Commelina nudiflora L. C. Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar. O. 2.5 bulan setelah tanam. NPK 16 g/petak. Pupuk kandang 5 kg/petak dan 4.L.Juhaeti. 3. Centrosema pubescens (sentro). Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. 2. Oryza sativa (padi). Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1. tajuk dan total tanaman. konsentrasi Hg (ppm) di akar dan tajuk. Hidayati. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. Pada saat panen. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen. Kontrol. 4. Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian. 4.) Presl (eceng leutik). L.f. seluruh biomassa tanaman berupa akar dan tajuk diambil. sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat. Untuk tanaman air. petak penelitian dijaga supaya selalu tergenang. cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan.Robins. sedangkan untuk tanaman darat. 2. Perlakuan pemupukan diberikan pada saat tanam.

3 2850.74 619. cordata C.75 95.0 425.9 1523.7 b 2257.1 3.8333 0.04 153. vaginalis L. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam.2 1779.6917 2.0 1337.7273 1464.51 47.34 a 184.667 34. Pengaruh pemupukan terhadap pertumbuhan tanaman. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1.617 102. pubescens dan M .233 Tdk ditanam Tdk ditanam 77.4 624. conjugatum C.2833 1.786 b 5 .21 332. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879.95 66.46 241. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1.841 a 37.6167 2.580 Jenis tanaman S.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257.16 212.133 56.792 bc 70.6 659.65 345.66 a 269.2 b 3 1050.69 427. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman.1833 3.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589. cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3. C.cordata tidak ditanam kembali (Tabel 1). flava P.64 161.0500 3.37 b 3 78.7 2778. Akan tetapi.51 a 2 169.74 106.138 a 87. pubescens M. dan C.0 223.88 35.23 187.93 b 221.69 b 152.33 187. Akan tetapi C. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi. Produksi total biomasa tanaman (gram) tiap periode penanaman. onocephala C.1917 0.6 252.03 a 345. pubescens dan M. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.53 c 751.6 a 2018.9 Tdk ditanam Tdk ditanam 693.22 a 1110.600 c 63.2 1671.6 ab 2329.5 ab 2 1955.3 12092 996.8 a 2028.93 9.3417 0.05 144.71 72. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman. sativa M. molesta O.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala. nudiflora Tabel 2. terlihat dari tingginya produksi biomasa tanaman.5 a 1619.67 a 216.99 a 287. Hal ini dilakukan karena dalam fitoremediasi.867 bc 59.6 b 2620.

cordata. Monocephala. Hidayati.vaginalis. kecuali pada M. konsentrasi Hg (ppm) akar tanaman (b). dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman.flava. molesta. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. 6 konsentrasi Hg (ppm) .Juhaeti. Syarif & Hidayat tersebut ke bagian tanaman yang dipanen. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk.conjugatum. Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman. T5 = P. T9 = C.pubescens. T 6= C. T4 = L. T3 = M. masing-masing jenis tanaman menunjukkan kemampuan yang berbeda. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c). T2 = O. T8 = M. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab).nudiflora. hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a). Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda. T7 = C. Sativa.

pubescens dan M. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. M. monocephala. cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. L. T6 = C. Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk.conjugatum. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. perlu diperhatikan beberapa kriteria. marginal.pubescens. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. Pada penelitian ini. Monocephala. Diharapkan. T7 = C. sedangkan C.vaginalis. dan C. T8 = M. T5 = P. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. C. Sativa.cordata. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg). (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2. Salvinia molesta. flava. T3 = M. conjugatum. sativa. T4 = L.flava. O. vaginalis. T2 = O. P. molesta. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . T9 = C.nudiflora. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman.

Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik.nudiflora. P. M. C. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran. Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. terbukti dengan adanya konsentrasi logam yang tinggi pada akar. S. Syarif & Hidayat yang tinggi (Reeves 1992). Kemudian. molesta. potensi produksi biomasa tananaman yang diuji pun cukup tinggi. yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air). Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal. (2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal. yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. L. monocephala. pubescens. sativa. . Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu.vaginalis. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu.conjugatum. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal.cordata dan C. C. Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik.Juhaeti.flava. M. Hidayati. Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu.

Gambar 3. Sativa. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. C. T4 = L. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman. O. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. molesta. Vaginalis. Tanamantanaman tersebut adalah S. T5 = P. conjugatum. P.vaginalis. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. conjugatum. sativa. T3 = M. molesta. nudiflora. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata.pubescens. nudiflora. sativa. nudiflora. T8 = M. Monocephala. T9 = C. T7 = C. M. M. P. O. nudiflora dan P. sativa dan C.flava. vaginalis. molesta. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . sativa. T2 = O. umur panen. molesta.cordata. C. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. O. conjugatum dan M. T6 = C. M. jarak tanam.conjugatum. O. P.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan. vaginalis. vaginalis. conjugatum. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat.nudiflora. molesta. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S. C. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman.

flava C.55 C.155 C. pubscens M.03 31. moncephala M. monoephala C. cordata C. vaginalis 8.70 6 O. flava P.197 C. sativa M.316 C. sativa P. nudiflora 114.3 10.912 P. cordata C. moncephala C. molesta M. flava 44. flava 4. conjgtum 11.558 19.37 C.049.502 S. conjatum 107. molesta 111.516 16.498 M. pubescens S. Hidayati. flava M. nudiflora 16.8 C. vaginalis L. pubscens M.87 5030.241 Kandang C. sativa 141. molesta M.2 4644. cordata C. conjugatum 5625.435 S.357 P.1 1721.6 3894.04 5 S.758 C.369 C.3 2105.581 24.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O. vaginalis 68. molesta 13303.278 C.conjgtum 40. conjugatum C. conjgam 67. molesta C.9 6936. monephala M. sativa 4755. flava 13. nudiflora 63.33 10513. pubescens S.848 12.263 32.2 M. nudiflora L. vaginalis 33.456 16.3 O.5 1895. conjugatum C. sativa L. nudiflora 6331. cordata C. vaginalis C. flava 18. molesta 40. cordata 859. pubescens 12558.9 8046.34 Jenis tanaman Kontrol NPK O. vaginalis P. flava P. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46.095 19.6 O.625 O.099 9. sativa 85. flava M.conjugtum S.55 4 10 .627 P.13 1164. monoephala L.9 6488.Juhaeti.9 C.765 L. sativa 159. flava O. molesta O.05 M. pubescens 3216 5259. mocephal 32.604 18.568 L.43 4598.13 1 O. Syarif & Hidayat Tabel 3.931 C.946 11. monephal 42.104 31. conjugatum 4542.7 4742.6 5077. molesta O. monoephala M. nudiflora 4504. nudiflora 57.455 O.907 12. nudiflora S.849 41.14 8. molesta 63. sativa 55.869. vaginalis 7682. vaginalis L. sativa M.401 7. molesta 10897.4 P.253 M.9 P. nudiflora 18. sativa 6098. pubescens M.471 33.11 2 C.214 S. pubescens M.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S.062 L.803 L.298 M. cordata C. cordata C. conjgtum 55. pubscens S.31 L. molesta 55. pubescens M. flava P.643 5.conjgtum C. molesta 190. monephla 36. flava 24. conjugatum C. cordata C. pubescens S. monoephala 10. cordata C. sativa M. sativa C. nudiflora 107.183 M. puescens M. monoephala 2476.5 M.712 12. vaginalis 28. vaginalis L.937 9.999 3.171 C.97 C.7 1254. nudiflora O.03 3949. cordata C.5 M.mocephal 35. vaginalis 42. nudiflora P.529 P. vaginalis L.605 Kompos S. cordata C. cordata C.

Rodriguez. The Vegetation of Ultramafic (Serpentine) Soils. & O. 2006. Vergnano. I. Juhaeti. Harapini. Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation. N. FN. L. 2007. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation.Plant. Int. RB.. Asencio.. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator.. Reeves. JS. C. Juhaeti & F. Hampshire: Intercept Ltd. Rodriguez. Moreno. RD. 2007. Syarif. T. T.. RD. & CL. Di dalam: Backer. Hidayati. J. Stewart & BH. 12-20 Oktober 2006.. Proctor. 2004. Mattioni. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution. Reeves (ed). Soil Sci Soc Am J 59:125-133. Hidayati. N. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives.. Baker. S. Gabbrielli. 1995. Practices 6(2): 165-175. J. Nutr 14 : 1067-1080. DAFTAR PUSTAKA Brown. Phytoremediation 9(1): 1-13. 1992. RL. Memasukkan: November 2008 Diterima: Juli 2009 11 . Rincon.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). Chaney. Hlm 253-227. Anderson. F. CWN. Bogor. Environ. Robinson.. Laporan Akhir Penelitian Kompetitif LIPI. Hidayat. The Hyperaccumulation of Nickel by Serpentine Plants. SL. Angle & AJM. 1991. J. Syarif & M. AJM. R. International JSPS Seminar. J.

jenis sotong ini tidak diminati oleh para nelayan.email: rist001@lipi. biserialis dan I. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. Hylleberg & Nateewathana 1991b). Idiosepiidae. Karena ukurannya yang sangat kecil. picteti hingga saat ini hanya dijumpai di Ambon.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. Dalam tulisan ini diuraikan karakter morfologi. Cibinong 16911 – Indonesia. Norman 2000). distribution. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I. picteti. Keywords: Cephalopoda. pygmaeus herbereri. habitat dan distribusi empat jenis sotong mini jenis I. Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. Banda. Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. The arms are short and robust and almost equal in length. pygmaeus khusus dari perairan pantai di Lombok. I. The animals are dorso-ventrally compressed and cigar-shaped. habitat. Sibolga dan Lombok. reproduksi dan siklus hidupnya.go. habitat. Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a. Marwoto 2 University of Vienna. Balikpapan. Jackson 1988. One conspicuous morphological character of this genus is the adhesive 13 . siklus hidup dan distribusi Idiosepius.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. habitat. distribusi. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. ovally elongated with the long axis parallel to the body axis (Figure 1). except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). The females reach maturity at 3 cm length. the fins are small. Fac. pygmaeus. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik. of Life Science. Indo-Pacific Kata kunci: Cephalopoda. Idiosepiidae. 1090 Vienna. Austria 2 Museum Zoology Bogor. Cell Imaging and Ultrastructure Research. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. biserialis dan I. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I. Nabhitabhata 1998. Research Center for Biology – LIPI. Ternate. I.

pygmaeus and the other species mostly in size. Lombok. Unfortunately. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. Hiding there. Examinations by Nesis (1982). Indonesia. Furthermore. In 1927. however. Later. picteti at Ambon Island. Grimpe (1931) compared the collected material with samples of I. contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. pygmaeus has a wide distribution in Indonesia. The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay. 2008. 2008). collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I. In 1898. 1881 in Ternate 14 and Banda-Sea. up to this day. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). in females. they also lie in wait to capture prey swimming by. Cyran et al. pygmaeus Steenstrup. more than 115 years ago. Joubin (1894a) collected one male holotype sample of I. Appellöf discovered I. pygmaeus from several institutions and proposed that his specimens differ from I. The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. It can be assumed that this species has disappeared or even become extinct. Idiosepius pygmaeus hebereri was .Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. This species was thought to occur only in the Philippines. revealed that the morphological characteristics were insufficiently different to justify the subspecies. Collection of Idiosepius in Indonesian waters has long history.

The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections).166´E) (Kalk. Austria) and MZB (Museum Zoologicum Bogoriense). 98° 25.541´E) (von Byern et al. geographical distribution and origin of migration remain. 2005) . 2005) Indonesia: Ekas-Bay. Indonesia. With the present description and geographical data. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00. 35° 22. Apart from I. Lombok (08° 52. less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia). Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong. I. picteti and I. Previously. was recently discovered in Indonesian waters (von Byern et al. pygmaeus below). Phuket Island (8° 02. pygmaeus. Japan. RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss. Cape Town. The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. 32° 54. Ekas-Bay. 26° 02.184´S.281´E) (Voss 1962. picteti. Research Center for Biology – LIPI. Nevertheless. Shigeno (von Byern et al. This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals. In contrast to I.487´ E) (von Byern & Klepal 2009) and Ko Pratong. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. Inhambane Bay (23° 51. 1962 (Figure 2A) Holotype: deposited at South African Museum. von Byern & Klepal 2009) Japan: Takasu. Collector: S.215´S. Adam 1986. Monque (23° 41.331´S.300´S.Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I. biserialis. we report new collection places for Idiosepius in Indonesia and extend the previous type localities. Lombok (08° 15 .020´S.721´E. many questions about their life cycle. it was thought to occur only in African waters (Mozambique) and Thailand. 1959. So far. San Jose Mission Station. 35° 22.156´N.553´E) (von Byern & Klepal 2009). pygmaeus. 2005). 32° 54. Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus. von Byern & Klepal 2009). individuals of I. METHODS Idiosepius specimens were collected along the bay of Lombok in November . a further species. 116° 27. South Africa (SAM A6520) Type locality: Mozambique.December 2007 using a dipnet.

Byern & Marwoto 50.781‘ E) . In the caught male.3 mm (males) and 7.38 ± 1. separated by a deep cleft. The fins are semicircular and about ¼ of the mantle length.35 mm 15. collected November 2007 (unpubl.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I. The specimens from Thailand are larger (ML to 5.2 mm C 7.5 ± 0. data) Morphological characteristics: This species has the smallest specimens of the genus.857‘ E) (08° 50. biserialis (Voss. 357‘S . Animals from Mozambique are small.1 mm females). 1894a) and C) dorsal and ventral view of I. 1962). slender. bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm.84 ± 0. The fins are more rounded kidney-shaped and A B 14. pygmaeus (Nesis. 714‘S . 116° 26. which are nearly constant in size to the end of the club. with a mantle length of 4. picteti (Joubin. The clubs of this species bear two rows of small suckers. The left arm also has two small flaps. at the tip.31 mm (females).7 ± 1. 116° 27.54 mm males and 7. 1982). B) I. 16 . the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. Both ventral arms in the male are hectocotylized.

The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm. Idiosepius picteti has a small tentacle club with four rows of suckers.945´N.89 mm males and 9.39 ± 1. 1886. sometimes also three or four oblique rows of suckers. Klong Bang Rong (8° 02. The left ventral arm is more slender. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48. Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius. Our examinations of this specimen reveal that Joubin (1894a) erred. 1887 Idiosepius pygmaeus Hoyle. 1920 Naefidium picteti Grimpe.1 mm females) with 3 suckers on the left and 5 on the right ventral arm. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe.030´E) (Suwanmala 17 . no additional specimens of this species have ever been found. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available. The right ventral arm in the male is very short and broad. while the two investigated females have a mantle length of 5. 1881 (Figure 2C). Copenhagen. The tentacle clubs have two horizontal rows of suckers. Idiosepius pygmaeus Steenstrup. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle. The animals from Japan are almost twice as long (6. The oral face the arm is transversely plicate.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle. Zamboanga (4° 20´N. Idiosepius picteti Joubin. Amboina – according to Joubin. 98° 24.34 ± 0. Synonymy: Idiosepion pygmaeum Fischer. The body is large and elongate (mantle length 14 mm). Joubin 1894b. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”. Zoologisk Museum. 98° 25. Denmark (ZMUC CEP52) Type locality: Philippines.472´E) (von Byern a & Klepal 2009). 1931 Holotype: deposited at Kobenhavns Universitet. longer and bilobate at the tip.35 mm. Each ventral arm has a single small sucker near the base. Genève. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male.25 ± 0.107´N. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia.

Lewis 1991.28 mm males and 15. Jackson 1993. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898). Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). North Queensland (19° 15´S.Byern & Marwoto et al. short.12 mm females) to I. Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus. collected December 2007 (unpubl. Grimpe (1931) .51 ± 1. Jackson 1992. Germany (ZMB) Type locality: Indonesia. 116° 30. Berlin. The specimens bear 4 rows of suckers at the club of the tentacle. Lombok (08° 52.709‘ E). 1931 Holotype: deposited at the Zoologisches Museum. The fins are small.637‘ S. Pecl & Moltschaniwskyj 1997. Balikpappan (Grimpe 1931). The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm. 119° 42. rounded and slightly constricted at their base. 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville. collected November 2007 (unpubl.020´S. I. Semmens et al.885‘ S. 116° 27. 116° 43. 146° 50´E) (Jackson 1988.012‘ E).937‘ E). data) • Rinca Island (08° 39.730‘ S.52 mm in males and 16. data) • Telong Elong (08° 48. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay. Jackson & Choat 1992. collected December 2007 (unpubl.37 mm in females.244‘ S. More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms. According to the description of Steenstrup (1881). data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11. data) • Gili Lawang (08° 19. both ventral arms have only one sucker at their base. The 18 right ventral arm is stout and thick.5 ± 2. collected December 2007 (unpubl. 1995. bilobated at the tip. one individual has 1/1.53 ± 1.015‘ E). Institut für Systematische Zoologie. Idiosepius pygmaeus from Indonesia is similar in size (11.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19. another 4/4 suckers on the hectocotyli. 116° 42.26 ± 4. Museum für Naturkunde der Humboldt-Universität. Ekas-Bay. while the left arm is thinner and slender.

The females of this subspecies have a mean mantle length of 14. I. Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. The species are mostly distributed in the tropical Indo-Pacific. unpubl. spawning. 2003). the males of 8. but individuals were also found in cooler Russian waters (Nesis et al. 1845). 1962. I. Presently. data). while the right arm is more stocky and broad with 2 suckers at the base. Moreover. DISCUSSION Systematics The relationships among species within this genus remain unknown. I. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. biserialis and I. 1881 and I.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri. paradoxus inhabit sea grass and algae areas. southern Australia including Tasmania. but this value needs verification. I. macrocheir Voss. minimus (D‘Orbigny. Japan. 1888).5 mm. 1894a). Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss. paradoxus (Ortmann. 1921. von Byern et al. I. All observations on this genus concerning behaviour. relatively little is known about the biology and life cycles of Idiosepius. 1962. biserialis has the widest geographical distribution. embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983. ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. For example. 1991. picteti (Joubin. I. and also has two lobes at its tip. The left ventral arm is longer and bigger than the right arm. pygmaeus Steenstrup. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). and African waters. the geographical distributions of all Idiosepius taxa are still only marginally explored. thailandicus Chotiyaputta et al. 2005). I. 2002). At its base the left arm has 3 suckers. I. no data are available about its postembryonic life. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982).5 mm. The fins are small and have a round to almost oval form.g. Jackson 1992). Within the genus. notoides Berry. Others like I. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. pygmaeus). the onset of sexual maturity or postembryonic behaviour.

So far. Gili Lawang. SS. pygmaeus could only be found in mangrove forests and belts. Bull. Naturelles de Belgique 56: 149-154. The Philip. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. . Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. de L´Institut Royal des Sci. biserialis in Africa. indicating that this species is specialised for sea grass areas (von Byern et al. During high tide. Appellöf. Additional genetic. Sci. the animals were also observed to mate within this flotsam and escape under the waste when threatened. Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. Sepiadarium. 47 (1): 39-55. pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). 1898. von Byern & Klepal 2009). In contrast. but are clearly absent in the northern. western and south-western shores of the Island. 1986. and Idiosepius. 2005. 2006. Cephalopods of the genera Sepiolidea. Moreover. A. W. I. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. von Byern & Klepal 2009). 1881 (Mollusca Cephalopoda Decapoda). Cephalopoden von Ternate. We still do not know whether the animals stay there at high tide or move elsewhere. Berry. Our thanks go in particular to Mrs. Moreover. garbage. ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. REFERENCES Adam.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. These observations agree well with other collections of I. 1921. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. such as those along the eastern part of Lombok Island at Gili Sulat. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. Lombok Island. Interestingly. Telong Elong and Ekas-Bay. J. On some days this flotsam covers almost the whole water surface. the garbage in the water apparently does not affect I. Japan and Thailand. Biology Department and furthermore to Mr. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. leaves and other plant material were transported here by the current. individuals of the former I. Lalu Japa & Karnan from Mataram University.

1993. Savy Paris. Mollusques vivants et fossiles. Choat 1992. 1887. Gide et Cie. North Queensland. The Veliger 35 (4): 396-401. 1962. Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss. Idiosepidae. Jackson. von Byern 2008. (Cephalopoda: Idiosepiidae).S. Aquat.An annotated and illustrated catalogue of cephalopod species 21 . Grimpe. Cephalopodes Familie XIII. GD &J H. ACV. & A. P. 350-351. Australia. Anzeiger 51: 208-214. The Jap. 1962 (Mollusca. WE. Grimpe. 1992. 1886. Zoology 16: 1245. pro: Loligo picteti Joubin 1894. Cephalopods of the world . Challenger during the years 187376.. CH. Zool. Cephalopoda). Malacology 50 (3): 165-174. Libraire F. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. Tome Premier. Nateewathana 1991a. 49: 218-228. P. T. A new record for the Andaman Sea. Hoyle.M. GD. Phuket Marine Biol. Redescription of Idiosepius pygmaeus Steenstrup.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. Center Res. internal anatomy. Über die Cephalopoden der SundaExpedition Rensch. J. Okutani & S. G. Jereb. 1845. Can. 87: 265-272. Teuthologische Mitteilungen IV. Roper 2005. Chaitiamvong 1991. G. Report on the Scientific Results of the Voyage of H. GD. Fishery Bulletin 91: 260-270. 1881 (Cephalopoda: Idiosepiidae). Hylleberg. Fish. J. Phuket Marine Biol. 55: 33-42. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n. J. Jackson. Report on the Cephalopoda collected by H. GD. Venus.S. Bull. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles. N. Bull. & CFE. & A. Fish. 56: 1-9. The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus. W.g. Klepal & J. 1931. Bull. Paris. sp.Challenger during the Years 1873-76. 1988. Morphology. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. Fischer. and biometrics of the cephalopod Idiosepius biserialis Voss. Naefidium n. D‘Orbigny. Jackson.M. with mention of additional morphological characters. Teuthologische Mitteilungen XIII. Growth in tropical cephalopods: An analysis based on statolith microstructure. Jackson. Zool.Sci. Anzeiger 95 (5/8): 149-174. Hylleberg.. Center Res. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus. 1920.J. Cyran. Nateewathana 1991b.

Inc. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae). Lewis. Publications. The zoogeographical composition of the intertidal fauna at Inhaca Island. FAO species catalogue for fishery purpose. M. Distinctive Behaviour of Thai pygmy Squid. L. London. S. Annotationes Zool. Idiosepius thailandicus Chotiyaputta. A. Japanische Cephalopoden. 1894a. Moltschaniwskyj 1997.A. Nabhitabhata. Céphalopodes d‘Amboine. L. J. Japonenses 10 (21): 209-213. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. Australia. Vol. 1st. Kalk. G. Pecl. et Ann. Idiosepiidae and Spirulidae). Sepiolidae. Zool. African J.: 178-180. Ltd. Moltschaniwskyj & CG.P.. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus. Behavior 85: 42-57. N A. 1: Chambered nautiluses and sepioids (Nautilidae. Royal Soc. Nesis. Jahrbücher 3: 639670. 242: 751-764. Revue Suisse de Zool. 1983. Moscow. 1921. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. V. Sasaki. 1959. Hamburg. L. Okutani& Chaitiamvong. Joubin. North Queens-land. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. Norman. GT & N A. 1982. 1888. Idiosepius pygmaeus Steenstrup. J. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. 1-82. Copyright Agency of the UdSSR for Light and Food Industry Publishing House. for English Translation. Sepiidae.First record of Idiosepiidae in Russian seas. London.S. Food and Agriculture Organization of the United Nations. AR. Revue Suisse de Zool. Moynihan. Zoo. 1987 TFH.Byern & Marwoto known to date. 266: 1133-1139. Sci. Ratnikov. 3: 459-460. Tintenfischfuehrer. 1991. Levitov. 1888) (Cephalopoda) . Semmens. du Musèe d‘Historie Naturelle de Genéve 2: 23-64.Sci. 1902. M.A.. Rome. Mémoires de la Société Zoologique de France 15: 80-145. 2002. Somatic growth processes: how are they altered in captivity ? Proc. Joubin. Sepiadariidae. Revision des Sepiolidae. 4. & N A. Phuket Marine Biological Center Special Publication 18 (1): 25-40. Jahr Verlag. On an adhering habit of a pygmy cuttlefish. K.. No. M. J. Cephalopods of the World. Pecl. Ruthenica 12 (1): 81-84. 1991. Moltschaniwskyj 1999. 1998. Katugin & AV. a small tropical cephalopod. Ortmann. Joubin. Alexander 1995. 1894b. K. Mocambique. MD. Translated from Russian by B. Nesis. ON. 2000. 22 .

83: 1297-1300.Mar. of S. 2007.UK.Selsk. Mus. Bull. Sepiadarium and Idiosepius two new genera of the family of Sepia. von Byern & J. von Byern. GL.danske Vidensk. Phuket Island. & W. von Byern. Klepal. Voss. Hist. von Byern. 1949. J.. Klepal 2008. Res. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea). GL.Occurrence of Idiosepius (Mollusca: Cephalopoda) J. Yamamoto. South African cephalopods. Rudoll. Transaction of the Royal Soc. Cephalopoda): 38-43. N. & Histochemistry 83 (1): 29-46. 234: 1-180. Shigeno 2005: Distribution pattern of a minimalist . J. Biol. J. Cyran & W. J. J. Memasukkan:Maret 2009 Diterima: Juli 2009 23 . K. 67: 49-51.. S. Biotech. Malacology 15 (5-8): 94-96. Steenstrup. Mar. 2006. 2003. Histochemical characterization of the adhesive organ of three Idiosepius spp. Phuket Mar. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. Nabhitabhata. J.. 1963. Bull. & W. Africa 36 (4): 245-272. J. species. Biol. Idiosepii-dae) in Indonesian waters. Cephalopods of the Philippine Islands. and Spirula Lmk.. Voss.Wien 108 B: 137-144. Ann. Steer & GT. Thailand. Idiosepiidae) at Klong Bangrong.Skrifter Raekke 6 (Bd. With remarks on the two related forms Sepioloidea d´Orb. 1962. Associate. MA. Suwanmala. U. 1881. Tracey.UK. Klepal.New records for Idiosepius biserialis (Idiosepiidae. Pecl.Biol. the Japan. J. Observation of Idiosepius pygmaeus (Cephalopoda. 75: 885897. Mollusca).S. 2009. 1): 211-242. L. Malacologica (in press).Assoc. Nürnberger & S.National Mus. Venus.. SR. Reevaluation of systematic characters of Idiosepius (Cephalopoda. J. von Byern. Nat. T. Occurrence of Idiosepius pygmaeus (Cephalopoda.Cent.

77%).38%) and October (14. females.3. 1.61 ± 0. total mortality rate (Z) of the males. (Anodonta edentula) in mangrove ecosystem were determined. Kata kunci: Kerang lumpur tropis. and 4. and 2.3 years for the males. recruitment pattern and mortality) of this tropical mudflat clam. also males and females combined were 1. while in the females were in April (16.63 mm.58 mm.Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan. (Anodontia edentula) in Mangrove Ecosystem. pertumbuhan. Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al. Subsequently. annual growth coefficient (K) of males.5 respectively. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000. The peaks of males were in June (12. Keywords : Mudflat clam. maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi. 70.88mm and 70.95 ± 0. also males and females combined were 65. and also males and females combined. there were two unequal pulses. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam.43. kematian. Overall. and the size of males was less than females. females. 4. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 .88%) and August (15. The results showed that asymtotic length (L infinity) of males. Recruitment occurred every month in the males. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria). also by the thin and fragile shells of the clams. population parameters of tropical mudflat clam.26%).1 year for males and females combined.67%) and May (20. Over a 12 months period (Januari 2005 – Desember 2005). females. 2001). dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001).31. females. The objectives of this research were to study population parameters (growth. 2001). recruitment. which were 2. mortality. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis. These high rates were caused by the extreme life condition.56 ± 0.65. growth. which indicated a fast growth of the clams in relatively short period. 2 years for the females. also males and females combined were 4.12%).5 and 1. rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska. and in the males and females combined were in March (12. Berbagai organisme mendiami ekosistem ini.

Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara. mortalitas dan rekrutmen dari populasi kerang Anodontia edentula. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3. Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang. 2001. . dilakukan sebulan sekali selama 12 bulan. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000.00 euro/kg. serta ditimbang berat basahnya menurut jenis kelamin.Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1). Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. Aktivitas ekploitasi yang berlebihan. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula. Pengambilan contoh kerang lumpur Anodontia edentula. serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm. Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. Di Indonesia kerang ini belum mendapat perhatian. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim. yaitu musim Barat dan Timur. Di Maluku. Lebata &Primavera 2001) Demikian pula di Thailand.

39220.1. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i.038 log10 K (Pauly 1980).Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03. Lokasi penelitian 27 .9957/K + to. Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: . L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami. Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan. Persamaan von Bertalanffy bila dijabarkan lebih lanjut. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. dan b adalah sudut/ slope yang merupakan nilai Z. yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang. “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i.2752 log10 L” -1.95(L”) dimasukkan ke dalam persamaan diatas. dimana K adalah koefisien pertumbuhan. t adalah umur (atau umur relative. dan jika panjang maksimum (L maks) = 0. Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2. Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0.

Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0.9294.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3). dengan nilai koefisien determinasi (R2) sebesar 0.3134 (L = panjang dan W = berat).0002x 2 R = 0. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0. Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam.Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992). HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.0001 L3. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa.9327.15.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0.00008 L 3.321 dengan nilai koefisien determinasi (R2) sebesar 0.0002 L3.9658. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123. Kondisi pola pertumbuhan yang berlaku pada kerang jantan.13. Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275. 28 . berlaku juga pada betinanya.1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2. Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin. Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0.9657 n = 2692 3.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2).

3.58 mm dengan koefisien pertumbuhan (K) dari jantan.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128. Analisis distribusi sebaran cangkang selama periode penelitian. sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan.9327 n = 1192 Gambar 4. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan. betina dan total masing masing 1.288 R2 = 0. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.38. memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula.5 dan 1.3213 R2 = 0. 29 .9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. dengan menggunakan program FiSAT.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang. 1.63 mm. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3.5 per tahun. 70.88 mm dan 70. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3. (Gambar 4). Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan.

9957/K + 30 to. Rentan hidup (t max) dari jantan. maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan.34 mm dan 67. -0. Dari nilai-nilai K dan L” yang telah diperoleh di atas. Gambar kurva LCCC dari kerang jantan.98. 2 tahun dan 2.41-4. Nilai mortalitas total didapat dari negatif slope.43.6% per tahun.3 tahun.2752 log10 L” 1. betina dan total dari model yang terbentuk. maka didapat umur kerang terpanjang (life span) adalah t maks = 2. 67.00 bulan. betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut.e-1. umur to.0. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan. sedangkan untuk panjang maksimun jantan.096 tahun atau 1. betina.88 [1 .58 [1 .65 dan 4. betina dan total masing-masing 99.0% dan 99. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.15 bulan. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu. betina dan total masing-masing adalah 4.3(t+0. dan total masing-masing 62.97 bulan dan total . dengan demikian Z untuk jantan. Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve.56 X dengan r = -0. 4.63 [1 .e-1.1 tahun.70 mm.61 X dengan r = -0. Dengan memperhatikan umur maksimum. dan kerang total dengan Y = 11.95±0.35 mm. betina dan total masing masing 2.087) ] Dari beberapa parameter yang diperoleh. betina dan total masingmasing diperoleh t0 = -0.95 X dengan r = 0. betina dan total terlihat pada Gambar 7.e-1.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm.19–4. dan jika panjang maksimum (L maks) = 0.7%.096) ] Betina : Lt = 70. dengan memasukkan formula Log10(-to) = -0. maka dapat dibentuk dugaan kurva pertumbuhan. kerang betina dengan Y= 10.99.087 tahun atau 1.56±0.97.038 log10 K. Dari hasil perhitungan t0 terhadap kerang jantan.081) ] Total : Lt = 70.4(t+0. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol. LCCC yang dibuat dari kehilangan individu setiap kelas ukuran. 99.95(L”) dimasukkan ke dalam persamaan di atas. jantan.33– 4. Kalkulasi laju mortalitas untuk jantan.3922-0. K dan L”. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol).61±0. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment .31.081 tahun atau 0.5(t+0. Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65. dimana dapat dilihat pada Gambar 6. adalah Y= 10. Jika ditinjau dari segi biologi.

4 31 .31) a).63 m m dan K =1.Kurva pertumbuhan kerang jantan: L” = 65.0. Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan.5 c) Kurva pertumbuhan kerang total: L” = 71.3 b) Kurva pertumbuhan kerang betina: L” = 70. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.edentula hasil analisis menggunakan program FiSAT (ver.Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam. tetapi ditemukan dalam tubuh induk kerang. Kurva pertumbuhan kerang A.28 mm dan K =1. a) JANTAN b) BETINA c) TOTAL Gambar 5.88 mm dan K =1. Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya.

kecuali bulan Desember. Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 . persaingan dan tekanan lingkungan. selain itu terdapat interaksi biotik seperti predator. Pada kerang jantan. (a).e-1.12%) dan total gabungan pada bulan Maret (12.63 [1 . Hasil olahan pola rekrutmen tergambar pada Gambar 8.5 3 Betina: Lt = 70.096) ] 2 2.77%. yaitu 14. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65.5 1 1.58 [1 .5 Wak tu (tahun) 2 2.3(t+0.26%). Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0. Dugaan kurva pertumbuhan kerang Adonontia edentula.88 [1 .5 1 1.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama. Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik.5(t+0.5 3 Total : Lt = 70.e-1. namun masih memungkinkan keberadaan status populasi kerang ini.081) ] 2 2.88%) dan Agustus (15.e-1. namun hal ini cukup berarti bagi kesinambungan populasi di alam. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0.5 1 1.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1).38%) dan Oktober.5(t+0.67%) dan Mei (20. betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen. pada betina pada bulan April (16.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0.087) ] Gambar 6.

2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. Pendugaan parameter b. koefisien hubungan panjang berat. Kurva konversi hasil tangkapan panjang (LCCC) kerang A.edentula (a) jantan. Pola pertumbuhan (b) (a) (c) Gambar 7. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. (b) betina dan (c) total 33 .Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. begitupun jenis yang berbeda bisa mempunyai pola yang sama. Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya. Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama. Penelitian dari Anodontia woodiana (Afanasjev et al.

12 7.88 11.29 8.94 10.25 6.38 7.47 12.67 10.27 16.95 0.45 12.29 2.39 0.35 6.95 8.83 9.00 Betina 1.47 12. Persentase rekrutmen kerang A.47 14. Persentase rekrutmen bulanan jantan. 34 . betina dan total kerang A.64 20.97 0.92 10.39 15.45 0.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.00 (a) (b) (c) Gambar 8.31 15.19 1.77 8.edentula (a) jantan.16 7.26 18.98 3.52 2.22 9.00 Total 2.12 13. (b) betina dan (c) total.Yuliana Natan Tabel 1.67 8.

34 per tahun menunjukkan pertumbuhan yang lama. memerlukan waktu mencapai panjang asimtotik 10 tahun. Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132. dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang.Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan. menunjukkan kecepatan tumbuh yang cepat.3 tahun mencapai panjang asimtotik 35 .58 mm). Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2. Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity.edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya. 2001). Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000. Jenis lainnya seperti kerang estuari di Philipina. maka panjang infinity adalah 13. 2001). Berbeda jenis berbeda pula panjang infinity (L”). maka L” lebih kecil dari di Philipina. Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh. Panjang infinity A. akan membedakan parameter populasinya. sebesar 13 cm. K betina = 1.95. Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1. dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi.227 mencapai umur 10 tahun (Afanajev et al. bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama. K yang ditemukan perairan hutan mangrove desa Passo.18 mm dan K = 0.5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik.3. Koefisien pertumbuhan. K = 0. dugaan panjang infinity (L”) A. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm.edentula sangat terbatas. Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya. edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0.5 dan K gabungan = 1. Literatur serta informasi tentang kerang A. Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi).67 cm. panjang infinity mencapai 93 mm.

karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. yang sebenarnya ada penambahan individu baru. dan gabungan jenis kelamin yaitu 2 tahun. Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. tetapi bulan Desember pada Tabel 1 tidak kelihatan. Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. Hal ini menunjukkan bahwa pada kondisi alami. Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan. Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F).Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya. namun hal ini cukup berarti bagi kesinambungan populasi di alam. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek. Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. selain itu terdapat interaksi . Jika dilihat dari strategi hidup kerang. Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator. predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). terutama menghindari perubahan lingkungan yang ekstrim. begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin. Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik.3 tahun) dibandingkan dengan betina.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003). Laju mortalitas total yang cukup tinggi.

9(1): 123.. Del Norte-Campos AG. West Central Philippines. betina dan total masing-masing adalah 4. 19(1). Laju mortalitas total yang cukup tinggi. J. Bulan Mei adalah puncak rekrutmen tertinggi. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama. dengan koefisien pertumbuhan (K) dari jantan. 58 hal.95±0. Ambon. Anodontia edentula (Family Lucinidae). 2.5 dan 1.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2.Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. 2001. disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh. Archives of Polish Fisheries. betina dan total masing masing 1. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. B. Pada kerang jantan.Sci.3 tahun. 2003. yaitu Afanasjev SA. betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan. Laju mortalitas total Z. Pelecypoda: Psammobiidae) from the Beate Bay area. sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae). baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan.43. 37 . Asian publ.88%) dan Agustus (15. Marine Pollution Bull. dimana ukuran jantan lebih kecil dari betinanya. 2004. 241-245. 2001.131. tahun dan 2.61±0. 4. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.77%. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14.58 mm.65 dan 4. Fakultas Perikanan Universitas Pattimura. Latale SS. pada betina pada bulan April (16.38%) dan Oktober. 17: 299-312. Unionidae) in the Heated Konin Lakes System. Lebata MJHL. 1.67%) dan Mei (20. 2000. 1133-1138. persaingan dan tekanan lingkungan. betina dan gabungan masing-masing adalah 65.12%) dan total gabungan pada bulan Maret (12. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi). Kraszewski.1 tahun. Shell Shellfish Res.26%).63 mm.31. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang. Zdanowski & A.88 mm dan 70. Lebata MJHL.3. Elemental Sulphur in the Gills of the Mangrove Mud Clam.56±0. 11(42). Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia. 70. Oxygen. untuk jantan. Elsevier Science Ltd.

L. FAO Fisheries Departement. Sekolah Pascasarjana IPB.Ng & N. Shellfish Res. T. 2001. Turkey. 2008.Sivasothi. 2003. Tan. Muhammed SZ. Murphy. & HM. Morgani. 2001 Gill Structure. Computation and interpretation of bological statistics of fish populations. N.Yuliana Natan Lebata MJHL. Venema 1992. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . BC. Primavera. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis. HDH. Tan. &SC. Hugh. Tan.Zool 27:339-343. Ng PKL. Yassien. Bull.K. Res. W. A Guide to mangrove of Singapore 1. 1975. J. (Desertasi). Fish. Seong. T. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam. 19:191-382. J. Sivasothi. Lim KKP. 2003 (Eds). Sparre P. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. Rome. Animal diversity. TK. Board Can. 20(3):1273-1278. Singapore Science Centre. Ricker WE. KS. 407 p. Y. Bogor 162 hal. In P. Introduction to tropical fish assesment. Natan.

Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. Radiotracer 109Cd was applied in the study. Key words : Bioaccumulation. radiotracer Cd. Cd. At the steady state condition green mussel accumulated 72. panas pada bagian dada.21-107. Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya.2354. Pada gilirannya pada rantai makanan. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS). It was found that both salinity and temperature had significant effect ( P< 0. The research aimed at evaluating the effect of salinity.001) on accumulation rate of 109Cd. The highest concentration factor of Cd (31. tertinggi termasuk manusia.80 Bq/gr Cd.09) was appeared in water salinity of 29% and of water temperature 30oC. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer. It revealed that the small Perna viridis (5.2 cm in length) accumulated 109Cd about 107.80 Bq/gr. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit. Blackmore & Wang. Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme. Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik. Dari berbagai penelitian (Morton 1987. Perna viridis Kata kunci : Bioakumulasi. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 .6 cm in length) had an uptake of about 72. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. Perunut radioaktif. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase. whereas the bigger size of Perna viridis (6.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau.21 Bq/gr. A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. penyakit paru-paru akut dan menimbulkan kematian. Pekanbaru. 2002) dinyatakan bahwa kenaikan suhu.

46 Bq/ml) yaitu dengan meneteskan 7.6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia.5 dan 6. Untuk menghilangkan stress. 5. BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra. dan diberi pakan Chlorella sp. Media uji air laut diganti setiap hari. dua kali sehari. sesuai kombinasi taraf perlakuannya. S1T2 (salinitas 29o/oo dengan suhu 30oC). Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut. Organisme dipisahkan menurut kelompok ukuran (5.6 ml ke setiap aquarium. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd. Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial. konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1. bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a). Secara periodik (dua hari sekali). Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium. sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu. hewan uji diaklimitasikan selama seminggu di laboratorium. Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional. Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda.2. Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC). Data yang . dihitung mengikuti Connell & Miller (1995). 210 Pb dan sebagainya). S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC).Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas.

94 30.74 12.46 55.41 25.27 44.00 51. Model tersebut merupakan permodelan saturasi.54 15.21 80.24 30.70 ± 34.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.62 52.51 52. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.2 cm 5.90 79.35 41.61 11.64 19.77 28.80 90.33 13.31 53.84 61.12 47.25 22.78 28.60 32.23-54. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.6 cm 5.5 cm 6.33 53.98 49.5 cm 6.60 59.21-107.37 4.42 70.07 47.83 54.23 40.23 ± 41. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.80 Bq/gr dan 49.08 47.50 51.48 39.44 51.14 21.73 39.33 14.19 36.75 49.93 59.29 17.72 45.20 27.75 70.50 28.62 29.70 70.46-73.0. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).41 54. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.65 36.12.84 (Tabel 1a dan 1b). FKss (faktor konsentrasi steady state) 41 .61 59.45 35.09 ± 41.08 47.91 2.77 28.16 72.02 43.09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.37 ± 20.36 21.23 107. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.2 cm 5.90 34.65 20.01 Keterangan : Css (konsentrasi steady statei).30 ± 4.12 30.27 ± 31.60 3.99 37.89 4.81 73.6 cm 30.87 19. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.89 3.65 23.52 24.

70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.69 24. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.2 cm 31o/oo) di suhu dan ukuran yang sama (5.80 51.2 cm 5.2 cm dan 30oC) pada Tabel 1b.10 49.32 10.91 16 60.00 12 57.35 14.58 30.99 4 35.45 18.7137x + 8.92 7.2 cm 5.03 25.80 51.46 35.26 3.66 24. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.2 cm 5.98 11.74 14 60.5 cm 6.38 20.81 22.06 1.33 16.10 23.9423 B y = 2.21 75.82 45.08 8 41. FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.64 35.72 18 60. ■= 5.5 cm 6.01 15.5 cm 6. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.84 78.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.761 R2 = 0.56 4.43 ± 21.86 13.49 51.9176 5. nilai koefisien determinasi untuk salinitas 29o/oo (0.88 20.54 33. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.51 54.38 49.46 36.85 ± 15.25 13.6044x + 5.71 20.5 cm ▲=6.26 21.0667 R2 = 0.89 37.09 (Gambar 5).01).41 10.46 30.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.Yusni Ikhwan Siregar Tabel 1b.46 6 38.62 Keterangan: Css (konsentrasi steady statei).59 54.5 cm 6.47 25.761 R = 0.8014 R2 = 0.42 17.6044x + 5.76 19.99 ± 19.81 33.9462 y = 1.26 10 44.9462 y = 1.6 cm 5.33 19.55 16.97 16.7137x + 8. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.2673x + 11.21 ± 36.6 cm ♦=5.97 16.10 Css FKss 63.99 1.6 cm 2 25.18 36. 42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.34 92.0667 R = 0.9951) .72 37.44 49.6 cm 5.2673x + 11.67 Mean±S 47.68 24.41 14.61 29.71 19.2 cm 5.84 ± 34.22 21.06 42.37 3.80 17. Pada Gambar 6.8014 R2 = 0.6 cm Gambar 1.09 24.20 ± E 4.

Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0. (Gambar 8). Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5.4495x + 16. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas.6 cm Gambar 2.9734 2 4 6 8 5.9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.2052x + 8.01).7667 2 R = 0.9951.2 cm 10 5. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0.2 cm 5.968).6 cm ♦=5.5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.2 cm dan 29o/oo) pada Tabel 1a dan 1b.9433 y = 1. ■= 5.0943x + 10.6 cm ♦=5. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.6186x + 27.5 cm 6. Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.6 cm Waktu Kontak (hari) 5.9539 B y = 2.5 cm ▲=6.8171x + 23.9 R2 = 0.9764 y = 2.9685 y = 1.5 cm 6.29 R2 = 0.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2.2 cm 5.66x + 7. ■= 5.2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.2 cm 5.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.9668 y = 2.5 cm ▲=6.2494 R2 = 0.773 R2 = 0. terlihat pada Gambar 7.6 cm Gambar 3. 43 .529 2 R = 0.5 cm 6.

5 c m 6 .9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.6 cm 10 15 20 Waktu Kontak (hari) Gambar 4. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).2 c m 5 . 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 .2 cm 5.057 2 R = 0. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC. oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11.968 A B Gambar 6.6 cm 10 0 0 5 5.5 cm 6.6 c m B Gambar 5.7x + 53.Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5. 44 .2 cm 5. Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.43x + 65.523 R 2 = 0.5 cm 6.

51 Bq/gr (Tabel 1b).20-34. Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19. 109 45 . faktor konsentrasi steady state di salinitas 29o/oo 1. konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1.23 10.5 c m 6 .01). Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0.70.2 c m 5 .84-47.6 c m B Gambar 7.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 .30-41.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya. Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15.23 sampai dengan 54.21 dan 20. 2000). Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang.35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9). Sedangkan pada suhu 28oC.09 kali dalam durasi kontak 14 sampai dengan 16 hari. kerang hijau mampu mengakumulasi 109Cd 31.10-75. Pada kondisi tersebut. dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo.43 dimana nilai konsentrasi steady statenya berkisar 30.

pertumbuhan dan metabolisme fisiologi dari organisme laut. pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4. .6 8 5 x + 7 .2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 .24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar. Model tersebut merupakan model saturasi. Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.23 . Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0.9 7 9 1 A B R 2 = 0 .Yusni Ikhwan Siregar Cd 60 y = 1 1 .9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3. Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup.70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.3 1 R 2 = 0 . Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi.09 (Gambar 5).4 3 x + 1 9 .5. umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah. Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31. Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata. Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B).01).

6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a.5 5 R 2 = 0 . Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.01).8 4 R 2 = 0 . Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5. Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis.5 c m 6 .7 6 3 x + 3 3 . Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998). 109 Cd oleh Mengacu pada Gambar 6.2. S1T1 (2). 47 . Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1).4 7 9 x + 6 0 .6 . Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu. 5. nilai koefisien determinasi untuk salinitas 29o/ (0.8 8 6 8 y = .23 + 3. Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0.6 c m Gambar 9.2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = . S2T2 (3) dan S2T1 (4).968).5 3 2 R = 0 .0 8 8 x + 4 8 . Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.4 .9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.5 dan 6.9 9 7 2 109 Faktor Konsentrasi rata-rata 5 .96X). Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.6 .Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.8 1 9 1 y = . Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7).

Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut. Proses bioabsorpsi ini bersifat bolak baik dan cepat. Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). Mg. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda. amino. Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl.Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Kemudian Sivalingam dalam Coeroli et al. Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987). Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt. hydroxy.23 10. dan hydroxy-carboxyl yang berada pada dinding sel. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass. Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). Logam berat dapat juga diendapkan pada proses metabolisme dan . dan Ca pada dinding sel digantikan oleh ion-ion logam berat. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake. phosphate.01). pertama pertukaran ion di mana ion monovalent dan divalent seperti Na.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). 48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. thiol. (1984). Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0. Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam. 1984).

Miller. Perna viridis (L. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. Growth of the green mussel. Landret. B. &WX. DW. D. salinitas dan lain-lain (Nora et al. ZA.) in Edaiyur backwaters. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus. A. KVK. Proceeding of one day seminar Development Radioecology and 49 . Ansari. Simpson. van der Velde. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut. Fakultas Matematika dan IPA IPB. Nair. Ingole. Perna viridis: Influences of Body Size. UI press. den Harog. M. Chatterji. The Hong Kong University of Science and Technology. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. Bogor Suseno. 1758) (Bivalvia: Mytilacea). Amer. Reproduction. Morton. dibandingkan dengan kerang hijau yang berukuran besar. P2PLR BATAN. 1987. in: in YukShan & Tam (eds. “ Kimia dan Ekotoksikologi Pencema- ran. Recent innovations in cultivation of molluscs in French Polynesia. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Aquaculture 40:47-55. 1998. 2002. Water Treatment with Algae Springer-Verlag and Landes Bioscience. HA. Malac. G. 1995.. 1998). Se. MS. 17 Rajagopal. Removal of Copper by Free and Immobilized Microalgae.). 1984. growth rate and culture potential of the green mussel. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut. 5(2):159-164. & GJ. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities. S. Chlorella vulgaris. Jakarta. Aquaculture 162:187-202. H. Coeroli. 2004a. Terjemahan Yanti Koestoer. —— 2004b. & C.. Bull. suhu. p. 1997. Perna viridis L. Connel. VP.1998. steady state. Venugopalan. Aquaculture 39:45-67. Cr. V. Hong Kong. in a sea water circulating system. Biokinetics of Cadmium in Indonesia’s Green Mussel. Nora FY. Serpong September 2004. DAFTAR PUSTAKA Blackmore. Gaillande..Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. 518 hal. Parulekar. Orasi Ilmiah. Jenner. Wang. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. & AH. Guru Besar Tetap Ilmu Kimia Lingkungan. east coast of India. 1984. InterPopulation Differences in Cd. BS. JP. YST Wong & CG. Seminar Nasional Teknologi Limbah. 13pp. Saeni.

Ecol. Ecol. Wang. Wang. Dei . Prog. Ser.Yusni Ikhwan Siregar Marine Environment in Indonesia. 1999. & RCH. WX. Mar. 186:161-172. Mar. 2000. Prog. Memasukkan: Maret 2009 Diterima: Juli 2009 50 . Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus.137:567-575. WX. Ser. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. Hotel Sahid Jaya Jakarta.

Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia. E-mail: tjwinanto@yahoo.35 C g wet weight-1 hour-1 (28.85). fisiology. The result showed that optimal temperature and salinity on P. Fak. than would be decreased when temperature and salinity increased.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson).95 C g wet weight-1 hour-1 (24. The quickest time of plantigrade stages have found by treatment BF (day 19. response.72 – 77. The highest survival rate of larvae was by treatment BF.26 %.43 μm (AP x DV). Kata kunci: Pinctada maxima.75 – 87. in different levels of temperature and salinity. Di pasaran internasional.58 J g wet weight-1 hour-1). Stages II: 5.33 μm and stage III: 80.Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗.05) with BE (day 20.88 x 69. physiology.18 – 30.62 μm. The highest of energy budged for routine metabolism at treatment BF. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006). Stage I: energy budged between 6. larvae. Keywords: Pinctada maxima. Fak. Dedi Soedharma2. Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995). larvae.93 μm – 30. metabolism. but has not higher significant (P e” 0. 2 Departemen Ilmu dan Teknologi Kelautan.80 C g wet weight-1 hour-1 (15.73 μm – 58.13 x 47. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF).91 – 82. Stage II: 81.29 μm – 80. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”. Perikanan dan Ilmu Kelautan IPB.32 x 69. Sain dan Teknik UNSOED.73 – 7.85 – 5. Stages III: 4.92 %.74 J g wet weight-1 hour-1).05) with BE.57 x 18. Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal.39 % and stage III: 76.78 x 17.90 J g wet weight-1 hour-1). 51 . Sanusi2 1 Jur.05) with BE. at stage I: 29. respon. The aim of this study is to obtained information on energy budget on routine metabolism.50) and hasn’t significant (P > 0. Perikanan dan Ilmu Kelautan. Ridwan Affandi3. 1997). stage II: 57. PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al. metabolisme. with three replications. & Harpasis S. and to know the levels of optimum temperature and salinity.48 – 24. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan. The research was used randomized block design.73 – 4. stage I: survival rate between 87. The best of relative growth length of larvae by treatment BF and not significant (P e” 0.07– 19.62 x 46. and also prerequisite for individual growth and survival.

representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al. keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan.000 per cm. Inokulum yang digunakan berasal dari biakan murni skala lab. sangat diperlukan informasi tentang pengaruh suhu. serta dapat diketahui tingkat suhu dan salinitas optimum.Winanto. kemudian diperbanyak hingga mencapai kepadatan .143. sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. Soedharma. Rose data tidak dipublikasikan. Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. harga spat dari hatchery kira-kira $US 0. karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. Selama pemeliharaan larva di dalam lab. Jika hasilnya positif. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4. salinitas. yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994). Dame 1996).1 – 0. jika semata-mata hanya menggantungkan pengumpulan spat dari alam. Affandi & Sanusi Saat ini. dan konsumsi energi oleh metabolisme internal (Crisp 1984. 2007). diperlukan kondisi lingkungan yang optimum dan terkendali. Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas.A.14 per mm panjang engsel (R. dengan harga sekitar Rp 2. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai. Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim. 1997). Martinez-Fernandez et al. Di Australia. 2004). sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi.000 ekor. Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. Suplai spat merupakan bagian yang krusial dari industri ini. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda. Asha & Muthiah 2005. seperti untuk pertumbuhan. perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif. konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005. Menurut Gricourth et al. Selama proses produksi spat skala besar di hatchery. dalam Taylor et al.

Untuk mengetahui laju metabolisme rutine larva 53 . (B) 28 oC. yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. Larva diperoleh dari hasil pemijahan Induk P. 2001. maka percobaan dikelompokkan menjadi tiga. Berdasarkan pada stadia perkembangan larva. Winanto 2004). 10 dan 5 mikron). Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al. Perlakuan yang digunakan terdiri dari 2 faktor. dipelihara di dalam wadah percobaan ember plastik volume 20 liter. 2001. sampel disaring dan ditampung menggunakan planktonet. botol C untuk mengukur laju konsumsi oksigen. kapas sintetik dan ultra violet. dan (C) 30 oC. Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. maxima stadia bentuk-D (D1). galbana dan P. (E) 32 ‰. sedangkan salinitas diukur dengan refraktometer (Atago.0001 gr). Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. (II) salinitas. Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). yaitu (I) suhu. karena salinitas air di lokasi penelitian e” 34 ‰. catrage (15. Oksigen terlarut diukur dengan alat DO meter (YSI 550A. untuk meningkatkan suhu air digunakan alat pemana s. tipe 03J0820 AJ). 2002). Untuk mengetahui berat larva. Winanto 2004). Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. Botol A untuk stok air yang dijenuhkan. kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0. (F) 34 ‰. Larva diberi pakan I. Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3). Jepang). Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan. yaitu berupa satu unit peralatan yang terdiri dari empat botol. botol B sebagai wadah hewan uji. Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva. Hewan uji berupa larva P. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. Pengukuran suhu dila kukan dengan menggunakan termometer Hg. Disain percobaan untuk mengetahui laju konsumsi oksigen.

1997) dilakukan dengan menggunakan mikrometer okuler. Waktu pertama kali teridentifikasi stadia plantigrade. Soedharma. Pengamatan dimulai dari hari ke 18. maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut. Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993).9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. 1 mgO2 = 0. Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004). Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali. 1990). maxima. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC. Pengambilan sampel dilakukan setiap jam sebanyak 10 ml. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel. 54 . Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade. Data-data dengan dua variable seperti laju metabolisme dan berat larva.Winanto. Gambar 1. Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml.7 mlO2 (Jeong & Cho 2007). 1 mlO2 = 19.

Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0. tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰).804x – 625. Stadia III: Y = -1.83 %. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen. salinitas 30 ‰ (AD). Pada stadia I.64 (R2 = 0. Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C. (Gambar 2).8283). Seda ngkan pa da stadia I dan III korelasinya kurang kuat.37 % dan pada stadia III kembali menurun (49.8227.5137). 7963 dan stadia III: 0.8227). Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2. pada stadia II menurun sampai 79. Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1.7001x2 + 96. pengaruh suhu terhadap laju metabolisme mencapai 82.09 mgO2/g berat basah/jam (AD). Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1). Stadia II : Y = -0.27 %. Stadia II : Y = -1. pengaruh salinitas terhadap laju metabolisme sekitar 48.8283.10 (R2 = 0. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C.03x – 1431. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC. Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0. menunjukkan adanya korelasi yang kuat.7946x2 + 102.55 %.5821x2 + 38. salinitas 30 ‰ (AD) (Tabel 2).18 (R2 = 0.16 mgO 2 /g berat basah/jam (BF) dan terendah 1. pada stadia II meningkat menjadi 51. stadia II: 0.483x – 411.70 (R2 = 0.05).9387x2 + 110. dan pada stadia III efek suhu meningkat menjadi 82.3706x2 + 25. Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu. Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0.80 (R2 = 0.02x – 1532. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0.5137).63 %. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0. dengan koefisien determinasi (R2) pada stadia I sekitar 0.4855). Pada stadia I.05) dengan salinitas 34 ‰ (F).187x – 1337. 55 .05) antar perlakuan suhu dan salinitas.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P.7963). maxima tertinggi terjadi pada perlakuan suhu 28 oC.42 %). Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata.

7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.04f 1.8 R2 = 0. III Tabel 1.03b 1.03b 2.03d 1.03c 1.72 ± 0.03d 1.31 ± 0.08d 1.32 ± 0. maxima stadia I.03e 0.03b 1.03c 1.1337.34 ± 0.14 ± 0.10 ± 0.29 ± 0.03a 1.73 ± 0.7 R2 = 0.15 ± 0.79 ± 0.16 ± 0.Winanto.04f 0.03b 1. II.03b 1.1 R2 = 0.75 ± 0. Soedharma.05e 0.04a 1.187x .65 ± 0.8227 y = -1. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.08 ± 0.03a 1.41 ± 0.03c 0.02f (F) 34 1.16 ± 0.7946x 2 + 102.03f 0.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.29 ± 0.1431.03d 1.03f 1.7001x 2 + 96.03x . Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.12 ± 0.30 ± 0.9387x 2 + 110.77 ± 0.75 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.02x . 56 .09 ± 0.8283 Suhu (oC) Gambar 2.03d 1.39 ± 0.04e Salinitas (‰) (E) 32 1.34 ± 0.74 ± 0.98 ± 0.03d 1.1532.03b 1.76 ± 0.

7394x2 + 49.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0. Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P. maxima. maxima dipengaruhi oleh suhu dan 57 .243 (R2 = 0.483x .023x – 795. baik untuk aktivitas maupun perkembangan larva P. Persamaan yang diperoleh adalah Y = -295.795.625. jadi berat (85.17 R2 = 0.023x .804x . Stadia III : Y = -0.4942). stadia II dan stadia III Gambar 4.5821x + 38.3706x 2 + 25. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III). maxima.856).7394x 2 + 49.4855 y = -0.17 (R2 = 0.18 2 R = 0. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P.64 R2 = 0.856. Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4).4942 31 32 Salinitas (‰) 33 34 35 Gambar 3. Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan.25x + 29.411.5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0. maxima stadia I.

70 ± 0.08 2. salinitas.32 ± 0.43d 16.04 ± 0.68e 2. J (D) 30 3.25 ± 0.47 %).83 ± 0.07 ± 0.40d 15.57e Salinitas (‰) (E) 32 4.09 15.05) antar perlakuan suhu.14 4. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 .12 4. C (A) 26.55 ± 0.41 ± 0.01±0.10 4. salinitas dan tahap stadia.32 ± 0.48 ± 0.07 ± 0.45a 23.14 3.69±0.10 10. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0.10 3.07 10.50 ± 0. C (C) 30.09 5. C (B) 28. C (A) 26. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26.16 15.26±0. Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0. Soedharma.45b 30.12 5.46e 1. sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3). C (B) 28. sintasan tertinggi terjadi pada perlakuan suhu 28 o C. Pada stadia I. J (Joule). J (C) 30.36 ± 0. J Stadia II (A) 26. J Stadia III (A) 26.51f 2.31 ± 0.07 ± 0.37b 24.43d 18. C (Calorie).45 ± 0.90a 18.15 ± 0.39f 2. C (A) 26.50c 18.53±1.05) dengan 32 ‰ (E). C (C) 30.39 ± 0.42b 19.83 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas. salinitas 34 ‰ (87.20 ± 0.03 ± 0.12 15.10 4.69 4.09 ± 2.11 5.12 7.12d 24.39f 3.43b 27.74 ± 0.62 ± 0. baik pada analisis varian maupun uji Tukey (Gambar 5). salinitas 30 ‰ (32. J (B) 28.37c 16.88 ± 0.73 ± 0.11 10.60a 15. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P.45 ± 0.27 5.09 5.37d 24. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.36b 19.90 ± 0.40±0.62 ± 0.67 ± 0. J (B) 28.10 6.60 ± 0.45b 24.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.52 ± 0.64 ± 0. J (C) 30.09 4.10 4.80 ± 0.09 3. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0. Pada stadia II dan III.14 18.68 ± 0. C (C) 30.14 ± 0.12 ± 0.02 ± 0.13±0. Affandi & Sanusi Tabel 2. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan.05) antar perlakuan suhu. J (C) 30.30 ± 0.58 ± 0.Winanto. sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.58 ± 0.29f (F) 34 4.59f 3.05). J (B) 28.44d 18.09 18.10 3.86 ±0.75 ± 0. C (B) 28.92 %) dan terendah pada suhu 26 oC.41 ± 0.02 ± 0.38 ± 0.84 ± 0.37c 11.60 ± 0.05) dari E dan F.

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3.72 ± 0.71 ±1. 28o dan 30o C. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18.04c 54. B & C =suhu 26o .92 ±1.17 ± 1.98 ±0. Sintasan (%) larva P.04f 22.27b 81.86d 60.17 ± 0.41 ± 0.77f (F) 34 43.80 ± 1. D.79 ± 1. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.39 ± 0.20 ± 1. E.80b 77.75 ± 1.23 ± 0.71d 70.26 ± 0.75d 61.64d 69. Pertumbuhan panjang relatif larva stadia I (D1–D6). stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.17a 61.83e Salinitas (‰) (E) 32 43.67 ± 1.34 ± 0.28d 72.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus.46 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.29b 87.73b 82.09d 71. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 .19c 48. & F= salinitas 30. pertumbuhan.17 ± 1.67 ± 0.09 ± 0.60 ± 0. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas.81e 21.91f 32.03b 87.88b 76.93 hari) (Gambar 6).60f 22. PEMBAHASAN Konsumsi oksigen larva P.33 ± 0.75f 32.02 ± 1. Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan.39 ± 0.76e 10.61 ± 0.91 ± 0.91a 64.95 ±0.82a 59.62c 48. laju konsumsi oksigen dan laju metabolisme.

maka . tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi. bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda. 1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis. Affandi & Sanusi 2. Diduga. 32 ‰. Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling.856). disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0. 2004). kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat. variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan. Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. gamet dan larva yang berada pada satu seri penelitian. semakin berkembang tahapan stadia larva baik panjang maupun berat.0. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif. maka laju konsumsi oksigen semakin menurun. Laju konsumsi oksigen pada larva Mytilus edulis antara 0.00. hingga mencapai batas optimum (28 oC. Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat.5 – 5 mlO2/jam/g berat kering. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983). Jika dihitung per unit berat badan. Hasil korelasi menunjukkan kecenderungan linear positif.80. 34 ‰). Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0. berat badan dan tingkat aktivitas. Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air. 1983).75–3 ml O2/jam/g berat kering (Zeuthen. Lebih lanjut Bayne (1983) menyampaikan. Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. Soedharma.70 sampai > 1.7 dan > 1. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0.5 sampai 10 mlO2/jam/g berat kering. Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan. Dari hasil analisis dapat diinterpretasikan. 1949 dalam Bayne.Winanto.

merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi. Diduga pada kondisi laju konsumsi oksigen tinggi. Seba gai salah satu indika tor. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan. Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose. Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Lama waktu (hari) pencapaian stadia plantigrade larva P.1997). Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). 61 . Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al. fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983). Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. Pada P. maxima pada berbagai tingkat suhu dan salinitas. 2005).

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

74 – 5. (2000) di dalam laguna Great Barrier Reef. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa. beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994). dalam O’Connor and Lawler (2004) jumlah larva P. tetapi pada suhu kurang pengaruhnya.Winanto. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. 1983). maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE.02 – 24. margaritifera antara 23–28 oC. Soedharma. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963. Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). imbricata (Roding) dipengaruhi oleh suhu dan salinitas. Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P. 1983). Disamping adanya variable lain. Menurut O’Connor.83 C/g berat basah/jam (24.53 – 30. KESIMPULAN Suhu dan salinitas optimum untuk larva P. dalam Ala garswa mi et al. Pada stadia I pembelanjaan energi mencapai 6. sehingga larva berkembang dengan baik. Penelitian Yukihira et al.58 – 7. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC.67 C/g . salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC. Pada suhu optimum aktivitas metabolisme berjalan maksimum.13 J/g berat basah/jam). imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia. salinitas 32 ‰ (BE). Bayne 1965. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas. apalagi jika salinitas turun sampai kurang dari 29 ‰. maxima dan P. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil. tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas. Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. Stadia II antara 5. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar.20 C/g berat basah/jam (27. Quensland Utara. Pada kisaran salinitas 29–35 ‰.62 – 4. Australia mencatat bahwa kisaran suhu optimum pa da P. Berkaitan 66 dengan kompetensi larva untuk menempel. per sonal observasi.39 J/g berat basah/jam) dan pada stadia III antara 4. BF).

88 x 69. Salinity and pH on Larval Growth. Bogor Alagarswami K. salinitas 34 ‰ (BF. DAFTAR PUSTAKA Affandi R. Petunjuk Teknis (6): 61 hal. Ditjen. Fisiologi Ikan. DS..93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰. _____ 2002. Aquaculture 3.28 x 21. atas bantuan yang diberikan selama penelitian. Balai Budidaya Laut Lampung. Stadia II antara 57.32– 19. Aquaculture 122: 161-169. Pembenihan Tiram Mutiara (Pinctada maxima). serta C. Velayudhan. Petunjuk Teknis (VII): 106 hal. V. Ed. Mengenal Mutiara.58 J/g berat basah/jam). Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. No. P. Kultur Pakan Hidup. Effects of Temperature. 1994.75 – 87. Crassostrea virginica. Competency to Settle in Oyster Larva e. (BE.26 %.13x7. IPB. Anna . Pencernaan dan Penyerapan Makanan.80 µm–34. 287-301.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49. 2006. Wild versus hatcheryreared larvae. 1983. Sjafei. Balai Budidaya Laut. ACC Victor & AD. Asha. J. Chellam. Managemen Sumberdaya Perairan. 2001. 29: 4-6. Aquaculture 250: 823-829. J. Pengolahan dan Pemasaran Hasil Perikanan.43 µm. Survival and Development of Sea cucumber Holothuria spinifera Theel. A. Sulistiono 2005. Stadia II antara 81. Balai Budidaya Laut Lampung.62 x 46.55 hari). Pada stadia I pertumbuhan relatif mencapai 33. Perna canaliculus.32x 69.29 µm – 80.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. B.V. 2005. Alfaro. Amsterdam. UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut.92 %. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould). Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC. J. MF. Warta Pasar Ikan. Rahardjo &.. Mina Mitra Usaha. Perhiasan Para Bangsawan.73 µm – 58.91 – 82. 18.62 µm. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE. Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel. Aquaculture 246: 285-294.39 % dan stadia III antara 76. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata. FPIK. Elsivier Science Publisher. Gandhi. 19.78 %).90 x 20.72 – 77. Pebruari. S.33 µm dan stadia III antara 80. TS. 67 . Muthiah. Pada stadia I sintasan antara 87. Baker. 2005. Dharmaraj.DKP. AC. Dep. Pengaruh suhu (81. PS & P.

1995. E. 10: 103-120.S. JM. Rangel-Davalos. 2004. An Ecosystem Approch. Newell. Feeding.. Martinez-Fernandez. Development 3(8): 299-336. Oxford. & CH. Coastal Aquaculture 2: 627-632. 1851) Larvae. C. E. Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics. A. Affandi & Sanusi Bayne. MT. 1974. NH. J. Mildford. H. R. DJ. Loosanof. Shellfish Rese. Boca Raton. M. & W. Bivalve Molluscs. 1996. Kutsner 1990. Bayne. Physiological Energetics of Marine Molluscs. C. Gosling. V & H. Mechanism of Osmoregulation in Animals. Biology. O.M. R. A. 13: 581-604. In: Feed Mana gement in Intensive Aquaculture. Verdonk... 254 pp. 4: 51-73. 2004. Farming Jewels. Ecology and Culture. Maintenance of Cell Volume. Chacon. 2006. Energy Relation of Marine Invertebra te Larvae. Oecologia 19: 195-201. (Eds). Saleuddin and K. In: Tompa. John Wiley & Sons. N. Mcintyre. In: Holme. Fassler.M. Great Britain. Ecology of Marine Bivalves. New York. S. Methods for the Study of Marine Benthos. RF. Wesseran. Connecticut. US. L. DJ. Proc. Vazques & Z. Farias. The Mollusca IV. Blackwell Sc. Soedharma. In: Gilles. & MH. AcostaSalmon. Davis. Beureu of Commercial Fisheries Biological Laboratory. Thallasia Jugosl. Dharmaraj. Biggeleer.D. New York. Wilbur (Editors). 1983. Crisp. Dame. Symp.A. Mathieu & K. Crisp.. Rearing of Bivalve Mollusks. 130p. An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. 1975.. Physiological ecology of marine molluscan larvae. Neter. AS. Fishing News Book. 1979. Gilles. Davidson. 284372. BL. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. Energy flow measurements. Garcia-Esquivel. JAMV. 1963.Winanto. 1983. 22(1): 415-421. Applied Linear Statistikcal 68 . Part I. Aquaculture 230: 417-423. Aquaculture 251: 85-98. World Aquaculture 29 (3): 5-10. Academic Press. The Mollusca. Physiology. 1996. BL & RC. S. Temperature and Water Quality. Osmoregulation and Ecology in Media of Fluctuating Salinity. Publ. New Developments in Pearl Farming. Gricourt. Goddard. 1984. CRC Press.. J. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). In: A. Elliot. W. CR. Jeuniaux. J. 1983.. Energy Equivalent of Oxygen Consumption in Animal Energetics. Kellner. 2003. Viana.

Widdows. respon in different ways to culture in similar environments. Southgate & CE. Klumpp. WB. Resgalla. 1997. J. Aquaculture 270: 451-463. Regression. WB & SU. Soria.. (Ed). Prog. 2004.J. Jakarta. 44: 1-28. 1979. 5th. Mar. Wirahadikusumah. Taylor. 138 hal.. Gramedia Pustaka Utama. pp. 748 hal. ES. Biokimia: Metabolisme Energi. Biomonitoring of coastal waters and estuaries. 195: 179-17 ____ 2006. G. Pechenik. RGD & JH. Pinctada maxima and P. M. R (ed). H. 2007. In: Kramer. Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster. Proceeding European Marine Biology Symposium. Taylor. 1970. 2004. Torrie. Karbohidrat dan Lipid. Exp. Ecol. 247-267. 2007. Pinctada imbricata Roding. Aquaculture 270: 464474. JJ. Tokyo. pp: 189196.M. Bandung. AC & J. Aquaculture 229: 493506.. Margaritifera. 11:537-554. Analisis REGRESI Menggunakan SPSS. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . ITB. Mechanism of Osmoregulation in Animals. Aquaculture 153: 31-40. 1993. 2000. Vernberg. O’Connor. Smaal. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture. Sulaiman. Contoh Kasus dan Pemecahannya. Von Brand. Reis F ilho. Lawler. 1980. Toppan Copany. K. J. Analysis of Variance and Experiental Designs. Ser. J. Merino & E. Temperature and Osmoregulation in Aquatic Species. Japan. Brasil. Yukihira. Aquaculture. Rose. Andi Offset.. Marine Ecology. New York. Maintenance of Cell Volume. CRC Press. Growth and energy balance during the larva lives of three prosobranch gastropods. Suatu Pendekatan Biometrik. 1972..Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models.. JS. Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil. J. 1994. J. 252: 208-224. Vernberg. KS. Gilles. 1173 p. Steel. W. 3 rd Edition. J. Margaritifera. WA & NF. 1985. John Wiley & Sons. LTD. Laitano & RW. Yogyakarta.. RA. G. JA. PC. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. Biol. In. The scope for growth of bivalves as an integrated response parameter in biological monitoring. Prinsip dan Prosedur Statistika. Silverthorn. The pearl oyster.Jr. C. Metabolicenvironmental interaction in the marine plankton. Boca Raton.. Lucas & DW. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures.

70 mm). was 300 m2 wide and 1 m deep. The result of implantation was followed that 30. woodiana. in the freshwater pond. 2.0 %. 12.2 %. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk. Jur. sized ranging from 12 – 15 cm were studied. Anodonta. The research was conducted for 9 months. kedalaman laut 1. 71 .30 mm) but hasn’t biggest significant (P>0.9 %. 12. The result showed that best thickness of pearl deposition by 90 cm deep (1. 2006. 79 % and 78.10 mm) and biggest significant (P< 0.2 %. Sain dan Teknik. Hyriopsis schlegeli (Simpson). Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s. effect. level of deep Kata kunci: Kerang air tawar. maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925). Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930. Kovitvadhi et al. Fak. 2008).co.id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana). Unsoed. (B) 60 cm and (C) 90 cm. Tjahjo Winanto2. Maskur1. &Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. Keywords: Freshwater mussel. to get fast nacre deposition and high quality of pearl. whereas survival rate was followed 79. khususnya di Danau Biwa. Perikanan dan Ilmu Kelautan.05) to the deep of 60 cm (1. warna dan kilau (shine) Sonkar (2007). One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre). Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al. Berdasarkan kualitasnya yang tinggi.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1. Anodonta woodiana. berat. Di Jepang. PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. Completely randomized design was used with levels of deep treatment (A) 30 cm. Purwokerto E-Email: bufish68@yahoo.05) to the deep of 30 cm (0. 60 and 90 cm deep were 11. Freshwater pearl Anodonta woodiana. The objective of this study was to obtain information on best level of depth to culture of pearl. Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China.7 %.

sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi. kalsium. masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. Skinner et al.Rachman. kerang berukuran panjang antero-posterior (AP) 10-15 cm. konduktivitas. seperti suhu. kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. karena luwes untuk perhiasan. khususnya pada produksi mutiara bulat air tawar. daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. sehingga kajian mengenai hal tersebut perlu dilakukan. sehingga mempunyai nilai tambah sebagai perhiasan. namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah. Anonymous 2007. Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). dengan perlakuan kedalaman pemeliharaan 30. Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 . 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. Oliver 2000. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. hijau dan biru muda. Faktor teknis. Sonkar 2007). Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre). kecerahan dan kesuburan perairan (Dan & Ruobo 2000. Jumlah sampel 250 ekor. sehingga membuat harganya paling mahal (Anonymous 2005). Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik. Berdasarkan kualitasnya. internal dan teknis. pH. 2003). penanganan dan pemeliharaan pasca implantasi. Faktor internal meliputi jenis kerang yang digunakan. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. kualitas lapisan mutiara (nacre). Menurut Pagcatipunan (1986). sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. alkalinitas. Semakin tinggi karatnya maka harganyapun makin mahal. BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1). Faktor eksternal antara lain kualtas air. nitrat. misalnya keterampilan teknisi dalam proses implantasi. sehingga dapat diperoleh mutiara berkualitas tinggi. Warna sebenarnya sangat tergantung pada selera konsumen. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. oksigen terlarut.

al. sehingga organ dalam terlihat jelas. Pengolahan data dilakukan dengan SPSS ver 15. Jumlah sampel pada setiap perlakuan adalah 75 ekor. Dengan menggunakan spatula insang disibakkan. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan. Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. agar luka tidak menjadi infeksi (Rachman et al. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991). Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. Pasca implantasi. Operasi dilakukan dengan menempatkan kerang pada penjepit. Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. Selanjutnya. bagian ventral kerang menghadap operator. Usahakan agar posisi mantel menempel dengan inti (Winanto et al. Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor. sehingga dapat ditemukan 73 . Secara matematis.1992). Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian.1992). Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. yaitu dengan menggunakan metode ekspose (Winanto et al. Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. posisi demikian dilakukan selama 2 jam. Sebelum operasi. keduanya dimasukkan ke dalam satu saluran. Pengamatan dilakukan selama 9 bulan (April– Desember). dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan.1992). pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral). 2007). maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih.

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

90 0.04–5.093 6.70–99.50–7.62 0. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan. Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik.80–25. 5Skinner et al (2003). tidak menempel pada inti.70 Subur Lumpur berpasir 90 cm 2. yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan.36–0.00 68. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp).69 6.083 6–15 64.12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000). Kecerahan air di kolam penelitian antara 20 – 60 cm. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk.10 0.40 0. 2Hochheimer (2007).03–0.60–90.00 0.01–4.82 0. 4Summerfelt (2007).03–0. Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5.60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.80–14.03 <0.35–0.67 24.54 15 – 251 <1. yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian.20–6. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.90–25.09 7–13 68.36–0. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau.40–25. Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2.00–7.76–99. seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan.04–0.90 6. Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%. Parameter air lainnya yang perlu diperhatikan adalah kecerahan.90 22. 3Oliver (2000).32 7. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 . Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan.17 23.5–8.15–3.

G 2000. 8. Winanto. R. Kovitvadhi. 2006. INS/81/008. Rojali. Dan. Memasukkan: Maret 2009 Diterima: Juli 2009 78 . Hongkong. Peterborough. Metode Perancangan Percobaan. Machado. Thongpan. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1.1–11–2008. M. AK. Juhaman. No.in. Imperial Leaflet. Chinese Academy of Fisheries Sciences. T. Cahn. DKP. 1986. H & G. & K RungruangsakTorrisen. Yuniarti. Pontjoprawiro & M. Invertebr. Part 1: Biology of the species and its present situation in Ireland. Anonymous 2007. Budidaya Mutiara. A.35. 2008. FAO. S. Dev. Bandung. 1991. 49: 255-262. Gasperz V. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera.T.Rachman. Reprod..357. Jakarta. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh.2 %). Irish Wildlife Manuals. P. S. Imperial Real Question Real Answer. Kovitvadhi. 1992. Diamon Graphics. Ruobo. Kovitvadhi.2 %). United Kingdom. 1856). A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea. info@pearl. Pagcatipunan. Pearl Culture in Japan. B. Sintasan terbaik pada kedalaman air 30 cm (79. Rome. Oliver. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12. S. Hyriopsis (Hyriopsis) bialatus Simpson. 1900. 2007. Pearl Aquaculture Research Foundation. &D. 1999. Moorken. 1–11–2008. Armico. Areekijseree. Murdjani. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp. DAFTAR PUSTAKA Anonymous 2005. U. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel.com . P. Engkagul. Kovitvadhi. 1949. sales@ thepearl. A. Laporan Tahunan. U. berarus dan mengandung cukup kalsium. Aquaculture 275: 169-177.3 mm). Freshwater Pearl Culture and Production in China. Fishing leaflet. EA. 2007. Rachman. india. The Pearl Source.source. Jiangsu Province China. AR. Sawangwong &J. 2000. dkk pada perairan yang bening. Balai Budidaya Laut Lampung & FAO/UNDP. Washington DC.. Sonkar.

Raja Ampat. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas. and identify their species.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. Ficus-Antocephalus. Pangium edule. and determined their positions. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. hutan dataran rendah. Pulau Salawati. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. Papua. dan Pulau Batanta. However floristic compositions varied among plot sites. Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. According to ordination analysis there were five community types. Aporusa–Pometia. Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat. Anthocephalus macrophyllus. Raja Ampat. Pulau Misool. Papua Kata kunci: Vegetasi. Keywords: Vegetation. lowland forest. which might be a characteristic of vegetation of Papua and the nearby small islands. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). Raja ampat. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . e”10 cm) within all of 17 plots were measured. Yensawai (7 plots) and Wailebet (5 plots). and Duabanga-Pterocymbium communities. Pulau Waigeo. Raja Ampat. All trees (dbh. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. Balgooy 1976). Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. Antocephalus-Toxotrophis. and Koordersiodendron pinnatum. Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. Almost all of common species such as Pometia pinnata. Toxotrophis illicifolius. Sterculia-Grewia.

Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan. di samping pantaipantai berpasir putih yang indah. dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. beraneka burung kakatua dan nuri. yang terbentang antara 130º31’7.9" LS. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta. Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap. (Anonim 2006). karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air. Namun demikian secara umum kondisi vegetasi masih cukup baik.4" BT dan 0º47’ 27. 80 .2"–130º53’28. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS. struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. rentan terhadap kerusakan dan peka akan gangguan. dengan ketinggian mulai dari 12 sampai dengan 147 m dpl. dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah. Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas. Yensawai dan Wailebet (Gambar 1). Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora.Edi Mirmanto beragam pada saat ini. dengan kondisi vegetasi yang bervariasi pula. yang meliputi daerah datar sampai berbukit.3"–0º54’19. cendrawasih Wilson. Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut. Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi. yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. kuskus waigeo. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi. maleo waigeo. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006).

berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua.cityseahorse. 8=Kalituris). Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris. Gambar 1. (Peta diperoleh dari httw://www. Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit. lokasi berdasarkan pengukuran dengan GPS) Gambar 2.com) 81 . Rata-rata curah hujan dan temperatur udara di daerah penelitian. Yensawai (3=Waringkabum. 6=Warai) dan Wailebet (7=Kaliyakut. Korpak. dan Warai. Waringkabum. 5=Korpak. 4= Wartandib. Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam. Vegetasi di daerah ini pada umumnya belum terganggu. bergelombang sampai berbukit. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib.html. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat. dengan kondisi medan secara umum datar. 2=Kafnain).com/irian-jaya. dengan kondisi vegetasi yang relatif tidak terganggu.Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar.

dominansi. Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak). dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi. Dari 40 suku yang tercatat. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. Flacourtiaceae. 82 dominansi relatif. yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). Yensawai (7 petak) dan Wailebet (5 petak). diidentifikasi jenisnya.com). Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu . dengan menggunakan perangkat lunak MVSP 3. diukur diameter batang setinggi 1. diikuti oleh Sterculiaceae.3 m dari atas tanah.1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. Verbenaceae. Beberapa suku diantaranya Lauraceae. Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting. kerapatan. dan nilai penting. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm. Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. Sapotaceae. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak. Euphorbiaceae. Alangiaceae. Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). frekuensi relatif kerapatan relatif. (1965). Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA. sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al. dan Rubiaceae.Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar. yang tersebar pada medan maupun kondisi vegetasi yang bervariasi. Di salah satu DAS telah dibuat bak penampungan air. yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2). Anacardiaceae. Sapindaceae.

5 12.0 100.2 11.0 100.3 8. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58.1 1.8 12.6 17.8 5.0 100. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.3 100.4 10.0 1.3 16.4 30.4 4.5 5.1 13. berukuran besar dengan jumlah individu relatif banyak.2 4.7 23. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %.0 7.7 6.3 25.4 1.0 2.6 3.0 100.0 Rata-2 20. Jenis-jenis tersebut umumnya tersebar cukup luas.3 2.3 17.3 13.2 2.4 4.0 2.1 6. tetapi dengan pohon-pohon berukuran relatif kecil.2 19.7 L N O P Q R 14.2 12.6 21.1 9.9 26.0 100.5 1.9 2.9 1.0 100. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3.1 31.7 32.0 100.9 10.0 4.1 5.8 2.6 1.3 2. Struktur hutan Tabel 1.3 2.0 2.0 100.9 21.9 7.4 1.1 3.0 18.8 14. Toxotrophis illicifolius.0 Petak pencuplikan data B C D E F G H I J K 1.1 15.1 17.1 25.6 100.9 4.4 9.1 13.0 2.8 3.7 4.0 22.6 25.1 35.9 3.7 39.8 9.7 13. Pometia pinnata bersama Anthocephalus macrophyllus.9 17.7 41.3 14.4 6.6 1.0 14. Pada Tabel 2.5 44.0 1.4 19.1 5.4 14. Pangium edule.1 1.4 17.2 3.0 8. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.2 24.1 2. tetapi memeiliki kerapatan dan frekuensi yang rendah.6 24. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.0 1.7 6.9 0. Berdasarkan nilai penting (NP) tertinggi.6 16.3 37.1 6.7 11.8 4. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.0 31.1 21.0 100.8 %.6 2. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi.0 100.4 8.0 6.9 19.8 13.6 34. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi.6 2.3 1.8 7.8 17.2 3.0 83 .6 4.7 7.4 5.3 17.0 1.7 3.3 7.1 100. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.0 100.8 21.7 1.7 8.0 33.8 41.7 11.6 5.5 11.1 8.1 0.2 36. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.0 100.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi.9 16.6 4.5 1.2 3.1 31.4 3.1 3.8 1.0 100. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).0 100.2 2.0 100.4 25.1 2.3 4.5 1.6 30.6 3.3 9.1 4.4 3.5 50.1 21.2 19.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).

Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5). Disamping itu diperkirakan bahwa setelah mengalami gangguan. yang menunjukkan adanya rumpang atau daerah terbuka. Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon.5 dan 28 m. yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm).Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal. Sebanyak 2% pepohonan menempati lapisan I. Gambar 3. sedang pepohonan dengan tinggi di bawah 9. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 . ditandai dengan adanya individu pada semua kelas diameter. Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al. dan lapisan-III antara 9. Gambar 4.5 m. Akan tetapi proporsi jumlah individu nampak tidak seimbang. Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m. Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus. Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm.5 dan 18. lapisan-II antara 18. dan 39% pohon menempati lapisan III. pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi. 6% pohon menempati lapisanII. 1965). sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol.5 m merupakan jenis-jenis ternaungi. menunjukkan pola persebaran diameter pohon yang cukup menerus.

87 0.80 1.73 2.02 1.66 1. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.03 1.87 0.44 1.00 NP 18.25 4.63 37.03 50.99 85 .87 0.69 2.33 5.49 7.02 2.42 2.34 100.01 4.22 3.98 2.30 0.66 4.17 3.27 2. Nilai frekuensi relatif (FR). Penyebaran spasial beberapa jenis disajikan pada Gambar 6.04 10.45 2. yaitu dengan nilai Indeks Morishita berkisar angka satu. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.59 5.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon.43 62.73 7.18 2.58 2.73 0.03 3.87 1.84 2.77 1.88 9.87 100. baik antar jenis maupun antar lokasi.43 0. Secara keseluruhan persebaran pohon cukup merata.63 2.73 1.86 1.68 3.43 3.35 2.30 2.74 4.69 5.60 3.63 3.98 4.30 5.00 DR 7.58 1.05 9. Tabel 2.16 1.03 13. yang menunjukkan adanya perbedaan pola persebaran.31 299.43 2.44 2.37 2.10 100.03 2.31 6. Pometia pinnata dan Anthocephalus macrophyllus.01 2. Intsia bijuga.23 1.02 3.24 1.73 1.78 1.77 2.83 1.16 3.04 1.03 2. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.12 5.33 3.33 3.54 6.43 0.35 3.30 1.80 6.02 7.00 KR 6.75 1.40 5.09 150.50 2.

Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. 86 . R) di daerah Wailebet.D) yang terdapat di Yenanas. Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4. Permudaan alami jenis Instia bijuga berjalan kurang baik.I. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6).J). kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H.G. ditandai dengan rendahnya individu pada tingkat semai dan belta. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak. sehingga kemungkinan sudah banyak ditebang. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar. kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C.E) dan Yensawai (F.P).B. kelompok B terdiri atas 3 petak (A.L) dan Wailebet (O. Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data.Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule.K. sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7). Kelompok A terdiri atas 2 petak (Q. Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat. Anthocephalus cadamba. Antiaris toxocaria.

(M=pohon menonjol. L-I=pohon pada lapisan I.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5. Stratifikasi hutan secara umum di daerah penelitian. Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 . Gambar 6. L-II=pohon pada lapisan II. L-III=pohon pada lapisan III. N= pohonpohon ternaungi).

dengan proporsi dominansinya mencapai 61.4 -0.4%. Artocarpus altilis. komunitas Antocephalus-Toxotrophis. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar. Alangium javanicum dan Pimeleodendron ambinicum. Grewia paniculata. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia. Jenis-jenis Sterculia cordata. Pometia pinnata. 0. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . yaitu 1. Berdasarkan jenis-jenis dominan pada setiap kelompok. 3. Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus.4 Toxotrophis illicfolius. Ke 4 jenis tersebut mencakup 48. yang lebih rendah dari pada dua komunitas sebelumnya. Pometia pinnata.4 % total basal area dalam komunitas ini.4 Gambar 6. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. komunitas Duabanga-Pterocymbium. komunitas Ficus-Antocephalus. komunitas Aporusa–Pometia. komunitas Sterculia-Grewia.4 0. Ke lima jenis dominan tersebut meliputi sebanyak 34. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan.7 % dari total basal area. 4.0 SUMBU-X 0. dapat ditentukan menjadi lima tipe komunitas. 2. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon. dan 5.

Artocarpus altilis. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. Krakatau (Tagawa 1992).Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. Simbolon. Pterocymbium tinctorium . Kari-munawa (Yusuf dkk. dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. Pometia pinnata. dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. 1998). tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. maupun luas daerah penelitian. Ficus variegata. Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada. 2003). Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. tidak terdapat dalam komunitas lain. 1995. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Hampir semua jenis dominan tersebut. 2001. seperti Geser (Mirmanto & Ruskandi 1986). serta dengan komposisi jenis yang berbeda pula. misalnya Waigeo (Mirmanto. Canarium maluensis. Koordersiodendron pinnatum dan Cryptocarya multinervis. Dari jenis-jenis yang tercatat. yaitu sebanyak 56 jenis pohon. data belum dipublikasikan). atau terdapat dalam proporsi yang rendah. PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Ficus tinctoria. 2006). Artocarpus communis. Anthocephalus macrophyllus. kecuali Koordersiodendron pinnatum. Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA. Nusakam-bangan (Partomihardjo dkk. Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan.

Inocarpus fagiferus dan Instia bijuga. Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. juga mempengaruhi kesamaan komposisi jenis. Ficus spp. Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat.. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu. Mallotus mollisimus. Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. hanya terdapat dalam jumlah yang relatif sedikit. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata. meskipun secara struktural sudah mendekati kondisi hutan alami. dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. yang rata-rata berukuran cukup besar. Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. Pimeleodendron ambinicum dan Endospermum moluccanum.Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. . Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk). Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp. dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula.

Pangium edule. E. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. 1995. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. Ruskandi. New York. I. MMJ. In: K. 4: 13-48. Maluku. van. Phytogeography.E. Ratnawongse & C. Kabupa91 . Ogawa. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. Irian Jaya. Simbolon (ed. Laporan Perjalanan. HB. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak. E. 2: 215-235. Measuring the dispersion of individuals and analysis of distributional patterns. H. Dalam: H. Mirmanto. Fac. Partomihardjo. M. Prawiroatmodjo. Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. Mueller-Dombois. Report and Proc. Kyusu Univ. Cilacap-Indonesia. Puslitbang Biologi-LIPI. 2001: 39-48.). Structure and floristic composition.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata. Shidei. T. Ellenberg. Purwaningsih. K. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. Biological diversity of small islands: Case study on landscape. Prawiroatmodjo.& Life. Yoda.. D. 1-22. Simbolon. Sambas & S. Aims and methods of vegetation ecology. 1995. Partomihardjo. Comperative ecological study on three main types in S. Doc. 1976. New Guinea Vegetation. Ogino. 1986. 2006. 2003. Morishita. T.). vegetation and floristic notes of Nusakambangan Island. & H. T. Tipe-tipe vegetasi cagar alam pulau Supiori. hal 34-45. DAFTAR PUSTAKA Anonim. K. 2001. Putrajaya. EN. Ser.. Global Taxonomy Initiative in Asia.. 1972. John Wiley & Sons. Propinsi Irian Jaya Barat.. Nat. Malaysia: 106-111. Apasutaya. Asia of forest vegetation in Thailand. H. Paijmans (ed. (Biol. Analisa vegetasi hutan dataran rendah di pulau Geser.). Toxotrophis illicifolius. 1965. & A. Berkaitan dengan kekhasan vegetasi hutan. Roemantyo & S. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. Mem. of first GTI Regional Workshop in Asia. Laporan Teknik 1995. Anthocephalus macrophyllus. Sci. D. 1959.

2 (3): 1-11. Ruskandi.Edi Mirmanto ten Biak Numfor. IV.). 28 (2): 175-183. 1992. Laporan Teknik 1995. Yusuf. 1998. Verhandelingen.. van. Steenis. R. H. Pusat Penelitian Biologi LIPI. Kementrian Perhubungan. Karimunjawa.N. & JHA. Puslitbang BiologiLIPI. Flora Malesiana. Geo J. Noordhof-Kolff NV. hal 54-72. 1948. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea.42. vol. Jakarta. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah. Dalam: H. H. 92 . Primary succession and the effect of first arrival on subsequent development of forest types. Irian Jaya. 2006. Dalam: AJ Arief. 1951. Djawatan Meteorologi dan Geofisika. di kawasan T. Irian Jaya. CGGJ. Ekol. Julistiono (ed. Simbolon. Ferguson. Series I. Laporan Teknik 2006. Schmidt. A. EB Walujo.). hal. Simbolon (ed. Karimunjawa dan bebrapa pulau kecil lainnya. 17-31. FH. Indonesia. Studi vegetasi P. Wardi & Dirman. No. Mulyadi & H. Jakarta. Tagawa.

Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1.) A.) Kosterms.) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. Suregeda glomerulata (Bl. DILLENIACEAE Dillenia ovalifolia Hoogl. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta. Mallotus philippinensis (Lam. Lepiniopsis ternatensis Val. Polyalthia diversifolia Miq.Br. Bridelia insulana Claoxylon longifolium (Bl. Polyalthia laterifolia King Polyalthia subcordata Bl. Teysmaniodendron hollrungii (Warb.) Endi Croton argyratus Bl.S. Raja Ampat.) Baill. Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl. Macaranga tanarius (L. Endospermum moluccanum Glochidion zeylanicum A.) MA Mallotus rufidulud (Miq. Drypetes glabridiscus JJS Drypetes longifolia (Bl. CLUSIACEAE Garcinia dulcis (Roxb. Muller.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr. Cynometra ramiflora L. Inocarpus fagiferus Fosb.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq. Alstonia scholaris R. Instia bijuga Kurtz.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K. FABACEAE Archidendron jiringa (Jack. Jass Macaranga aleuritoides F.) MA Pimeleodendron ambinicum Hassk. Intsia palembanica 93 . ARALIACEAE Gastonia papuana Miq. Mitrephora diversifolia Miq. Tabernaemontana sphaerocarpa Bl. CELASTRACEAE Siphonodon celastrinus Griff.Hofm. ANNONACEAE Spondias cytherea Sonnerat. APOCYNACEAE Popowia beccarii Scheff. Semecarpus australiensis Engl.) Pax & K.) MA Mallotus mollisimus (Geisebr. Polyalthia glauca Boerl. EUPHORBIACEAE Aporusa cf dendroidea Schot.) Nielson Crudia reticulata Merr. Mangifera indica Parishia insignis Hook. Osmoxyon sessiliflorum (L.

)Kosterm. 94 . Horsfieldia hellwigii (Warb.) Merr.)Miq. Horsfieldia irja (Gaertn) Warb. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm. Ficus botrycarpa Miq.Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq.)Sleum Gonocarium littorale (Bl. Toxotrophis illicfolius Vid. Ficus variegata Bl. LECYTHIDACEAE Planchonia sp.)var. Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. Dysoxylum densiflorum (Bl.B. Aglaia goebeliana Warb Aglaia korthalsii Miq.) Hk. Lansium domesticum Correa Sandoricum koetjape (Brom.) Boerl. Cryptocarya multinervis Teschn. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc.f. Trophis philippinensis (Bur. wieringae Kosterm.)C.) Forsb Artocarpus communis Artocarpus varieseanus Miq. Cryptocarya caloneura (Scheff. Ficus glaberrima Bl.)Schouten Gymnacranthera panniculata Val.f. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl.)Sincl. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall.) KN Parker Chisocheton ceramicus Miq. Horsfieldia bivalvis (Hk.Rob. Litsea firma (Bl. Schum.f. Litsea glutinosa (Lour. Litsea timoriana Span.) Merr. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl. Chisocheton lasiocarpus (Miq.)Valeton Dysoxylum arborescens Miq. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf. Litsea forstenii (Bl. Litsea ladermnniii Tschn. Purverulenta (Warb. Litsea calophylantha K. Et Binn.) Benth.)Kost.

v Muell Sterculia cordata Bl. Don Madhuka leucodermis H.)Merr. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L. Br. Psychotria diplococea Landeri Valeton Tarenna barbellata Val.)Merr. OPILLIACEAE Chaemperia manillana (Bl. Palaquium sp.L Palaquium lobbianum Burck Palaquium obovatum Burck. Sterculia cymosa Wall.petiolans Pometia pinnata Forst. Harpulia petiolans Radlk sub. ROSACEAE Prunus javanica Miq. Myristica curcullata Mgf. Neonauclea clemensii M. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L. Myristica lanceifolia Bl.)Tirveng Anthocephalus cadamba Miq. Et B. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L. Pavetta platiclada K. RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Et K. NYCTAGINACEAE Pisonia longirostris T.P. Scott. 95 . RUBIACEAE Adina racemosa (Caw. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R. Pterocymbium tinctorium (Blanco) Merr.J.)Risdl. TILIACEAE Grewia paniculata Ridl. Br. Myristica inutilis R. Schum Pertusandian multiflora (Hw. Anthocephalus macrophyllus (Roxb. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb.) Havil. Morinda citrifolia L.f.) Chew Pipturus argenteus Widd.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC.) Merr & Perry Syzygium pteropoda Lauterb. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl. Schum. Chrysophyllum roxburgii G. sp.J.

Vitex quinata (Lour.Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R. Vitex glabrata R. Br.) F. Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Br. Memasukkan: April 2009 Diterima: Juli 2009 96 . v Will.

timbulnya hama resisten. cry1A. These isolates were Jtg 2151. maize stemborer. Cib 551. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7. diperlukan cara lain selain hanya dengan pestisida. Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . Oleh karena itu. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. the expected size of Lep1A-Lep1B primers. Agustina K. thuringiensis. Lam 762 and C 522. cara tersebut antara lain dengan mempergunakan biopestisida. Ostrinia furnacalis Guenee 1 Bahagiawati1. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984).net. Habib Rizjaani1.7 milyar dolar Amerika (Bent & Yu 1999).Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. first was 490 bp. and second was 986 bp. di antaranya dengan menggunakan insektisida kimia. PCR. Key words: B. Kerusakan yang diakibatkan hama tersebut sangat bervariasi. Kata kunci: B. Ostrinia furnacalis. Email: bahagiawati@indo. 2 Balai Besar Karantina Ikan Soekarno-Hatta. Lam 752. PCR. 243. Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). yaitu matinya organisme non-target. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam. two DNA bands. Ostrinia furnacalis. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997). All of tested isolates showed potentially high toxicity against maize stemborer. From 59 tested isolates. Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. cry1A.id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. the expected size of Lep2A-Lep2B primers. 6 of them gave PCR products. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. thuringiensis.

thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). 1991. relatif cepat. Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. dan mudah digunakan dalam kegiatan rutin (Carozzi et al. thuringiensis subsp. 2000). Bogor digunakan sebagai bahan dalam penelitian ini. Sebagai kontrol negatif dipakai akuades. bubuk biji-bijian. permukaan daun. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan. seperti dari tanah. 1991). Bakteri ini dapat diisolasi dari berbagai bahan. 1991. Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. cukup sensitif. karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel. kependekan dari kata crystal. 1991). dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al. Smith et al. Selain itu. dan berbagai bangkai serangga (Carozzi et al. 1992) yang dimodifikasi seperti . thuringiensis masih terus dilakukan. 2001). penggunaan antibodi monoklonal. Santoso et al. selanjutnya disebut dengan Bt. & Sibuea wati 2002). Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. 1991). antara lain analisis Southern blot. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. dan telah diidentifikasi berbagai jenis protein Cry. Rizjaani. Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989).Bahagiawati.

permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut. thuringinesis terhadap larva O. thuringiensis lokal yang disaring. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri. Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). masing-masing bagian makanan diinokulasi 2 ekor larva. furnacalis yang diperbanyak pada makanan buatan. (2003). Uji toksisitas. Selain itu. diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. Pembuatan makanan buatan. lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan. Rerata persentase kematian. Setiap cawan mewakili satu ulangan. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril. 99 . hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. dan masing-masing perlakuan diulang sebanyak 3 kali. Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm. masingmasing 500 μl. Setelah makanan buatan tersebut membeku. dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. furnacalis mengikuti Bahagiawati et al. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1).Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. (2002). dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. (2003). Uji toksisitas isolat B. berat.0 for windows. Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. Jika terdapat perbedaan antara rerata perlakuan yang diuji. Pengujian toksisitas dilaksanakan dengan memakai serangga O. Sebanyak 1 ml suspensi B. sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. Ada tidaknya perbedaan antara data persentase kematian. analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. (2003) dengan modifikasi sebagai berikut.

furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan.77a (5) 2. Analisis data persentase kematian.67b 96.05. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 .23 (2) 1. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1.20 (1) 0.49b (30) 0.00a 83.33b 96.94a (1) a 0.78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0.67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5. furnacalis Data uji toksisitas terhadap larva O.77a (1) 0. Kontrol positip.003 (1) 1. Tabel 1.03 (1) 0.33b 96. Lam762(5) dan C522(6).30b 96.Bahagiawati. Cib551(3). Cib243(2). Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O.67b 86.613a (5) a 0. & Sibuea Uji toksisitas isolat terhadap O. Lam752(4).133a (5) 2.91a (5) a 0.90b (30) 13. dipel (+). kontrol negatif akuades (-).67b 83.04 (4) 0. Produk PCR dari beberapa isolat Bt lokal Jtg2151(1). Rizjaani.07a (2) a 0.03a (1) a 0. furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1.

Pada kontrol positif (Dipel). Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif.9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0.9 mg dan panjang tubuh 13. berat tubuh dan panjang tubuh larva 101 .409 R2 = 0.7 mm-2. kematian serangga mencapai 83. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt.7726 R = 0.0133 R2 = 0. Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0. persentase kematian dan panjang tubuh. Regresi linier antara: A. B. C.9753 Gambar 3. Kedua analisis di atas menunjukkan hubungan yang terbalik. demikian juga dengan panjang tubuh larva (R2 = 0. dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi.04-0. yaitu makanan buatan yang tidak mengandung suspensi Bt.0609x + 5. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0. namun berbeda nyata dengan kontrol negatif akuades. Berat tubuh larva-larva tersebut mencapai ratarata 5.98). Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan.3%.1311x + 13. Larva-larva yang masih hidup ini terlihat lemah.6 mm untuk panjang tubuh.5 mm. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0.9 mm. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan. persentase kematian dan berat tubuh.13 mg dan panjang tubuh hanya 2.1137x + 1.97). dengan berat tubuh yang relatif kecil yaitu 0.7 mg untuk berat tubuh dan 0.9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel.

Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda.97) berbanding lurus. Hasil penelitian kami memperlihatkan hasil yang lebih akurat . Rizjaani. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung. 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O. Pada waktu Santoso et al. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0. Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989. 1992).7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008). 2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al.Bahagiawati. Santoso et al. adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama. PEMBAHASAN Seperti yang telah dikemukakan. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running. masing-masing Lep1A-Lep1B dan Lep2A. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt. yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup. furnacalis. Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. belum pada tahap bioasai toksisitasnya terhadap hama target. dimana pada tahun 1999 mencapai $300 juta. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. mereka memakai 2 pasang primer. namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B.Lep2B.

furnacalis. furnacalis. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. 1994). thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. yaitu bioinsektisida Bt yang telah dikomersilkan. dan aktifitas makan menurun. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989. thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. Empat isolat yaitu Jtg2151. Larva yang memakan toksin Bt. 1991). Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. 103 . Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. KESIMPULAN Dari 59 isolat yang diuji. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. setelah beberapa hari tampak kecil. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva. Cib 243.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. Pada hasil penelitian Santoso et al. Berdasarkan hasil uji toksisitas isolat B. 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb. gerakannya lambat. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. 1998). Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel. Ceron et al.

Appl. N. Biotek. Santoso. IN. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). J.Bahagiawati.. J. J. cry1A(b). 39. Mikro. & N. PT Ichtiar Baru-Van Hove. 1992.. Oka. S. A. ISAAA Briefs. Indo. 1997. Wereng coklat dan pengendaliannya dalam prespektif. Insecticidal crystal protein of Bacillus thuringiensis. ISAAA. 57(11): 3057-3061. 1925. Envi. Buletin Agrobio: 4 (1): 1-8.. 2002. DD. Rijzaani. GW. NB.7(2): 35-38. Struhl. oleh Van der Laan.. Penggunaan Bacillus thuringiensis sebagai bio. J. Feitelson. Ortiz. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. Mikro Indo. Kramer. Seidman. JS. cry 1A(c) dengan PCR.Y. JG. Masalah dan . Kim. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. Bio/Technology 10: 271275 Höfte.. WS. 1999. RE. A F. Payne. & L. Quintero. J. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. & IC. Micro. Perta. B. Carozzi. LGE. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. 2003. Global Review of Commercial Transgenic Crops: 2008. J. Appl. P. Ceron. Sem. E. 8(1): 2730. & Sibuea DAFTAR PUSTAKA Abbot. Indone. James.G. D. Pest of crops in Indonesia. 1992. A method of computing the effectiveness of an insecticide. Brotonegoro. Whiteley. Setyawan & Sutrisno. Soegiarto & MS. Bravo. Moore.A. Ausubel. Evola & M.. Yu. H. 53(2): 242-255.A. L. Applications of Molecular Biology to Plant Disease and Insect Resistance. 1983. Bahagiawati. Second Ed. Microbiol. 2001. Envi. Agrobio 5(1): 21-28 Bahagiawati. Listanto. Ortiz. Ithaca. Brent. S. 1989. L. Smith & K. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. Sutrisno. Pros.. & Bahagiawati AH. 18: 265-267. Bent. 1981. Kingston. FM. Perhim. Riani Simanjuntak. E. H.insektisida. New York. M. 2008. John Willey. C. Jakarta. Kalshoven. Warren. VC. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. Bahagiawati & Amirhusin. 2002. Advances in Agronomy 66:251298. B. 60: 353-356. 1994. Covarrubias. Bahagiawati. Econ Ento. Rizjaani. & HR. No. Bul. Sarjono. Rev. R. R. 1991. Bacillus thuringiensis: insects and Beyond. Koziei. Surabaya 12-14 Maret 1997. Lina & A. Aranda. Microbiol.

Listanto. & GA. Perhimpunan Entomologi Indonesia Cabang Bogor.R. Cibogo. D. 2000.H. Damayanti & Sutrisno. Lereclus. Tantangan entomologi pada abad XXI. Padi-Buku III: 653-680. Couche. D. J. E. E. Smith. Biol. Zeigler & D. J.. 1998. 1984. van Rie. IN. Baum. Bacillus thuringiensis and its insecticidal crystal proteins. 22-24 Maret 1983. 1991. Oka. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR. & Soehardjan. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Oka IN. D. The phylloplane as a source of Bacillus thuringiensis variants. N. Memasukkan: April 2009 Diterima : September 2009 105 . Appl. Mol. Santoso. Rev. Microbiol. Pengendalian terpadu hama padi. 57: 311-315. TJ.. 1997. 63(3):775-806. Rodiyah. & Bahagiawati AH. Feitelson. Schnepf. Crickmore. Bogor. Risalah lokakarya penelitian padi. RA. Jurnal Bioteknologi Pertanian 5(2): 53-60. J. Dean. Environ.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi.

Kata kunci: Jatropha curcas L. Bacillus. Nitrosomonas. Chromobacterium. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. Cibinong Science Center. Jl. Chromobacterium. Spaerotillus natans. Citrobacter. Rhizobium. inoculants. Nitrosomonas.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L). Genera of Azotobacter. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition. Azotobacter. Raya Jakarta-Bogor km 46. Rhizobium . and Spaerotillus natans were soil bacterial isolates. inoculants. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter. Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. Those isolates were used as inoculants. and formulated to single and mixed bacterial inoculants. Spaerotillus natans. Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. Nitrosomonas. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). and Nitrosomonas spp. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Rhizobium . In the presence of inoculants. Kandungan minyak mencapai 40% 107 . Chromobacterium. Citrobacter.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. plant height was accelerated quickly while other inoculants affected to stalk diameter development. Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Keywords: Jatropha curcas L. Bacillus. The soil was collected from numerous places around Pontianak.. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran. Bacillus. and neither to bare soil dresses with compost. respectively. Bacillus. Azotobacter. That selective inoculant has opportunity to be used for jatropha farming. West Kalimantan. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI.. E-mail: widadomon@yahoo. Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. Citrobacter.

Kalimantan Barat. yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al. Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008). BAHAN DAN CARA KERJA 1. Azospirillum liboferum. 2006). serapan hara. Perlakuan bakteri Azotobacter chroococcum.Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak. Bakteri yang berhasil diisolasi adalah Azotobacter. dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. Kandeel et al. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. 2007). Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar. atau setara dengan 1. Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan . dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot).9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978). Badran & Safwat 2004. 2006). Pusat Penelitian Biologi LIPI. Bacillus. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. Citrobacter.6 metriks ton minyak jarak hasil produksi tanaman per hektar. Rhizobium spp. Chromobacterium. Lewis et al. 1991. 2002. Nitrosomonas. ElGhadban et al. dan Spaerotillus natans. Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. 1995.

Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6). yang diisolasi dari tanah asal Rasau Jaya. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji. 0. yang masing-masing diambilkan 10 ml dari BI.05 g (NH4)2SO4. dan kemudian diformulasikan seperti pada Tabel 1.2x107 Rhizobium. sebagai inokulan P-3. Bacillus. 0. Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp.6H 2 O. Singkawang. Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera). Citrobacter. Citrobacter. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran.5x107 Citrobacter. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya.5 ml sediaan dari inokulan Azotobacter.8x107 Nitrosomonas. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding. perlakuan kompos tanpa mikroba (P-8). 0. Satu dari tiga kecambah yang terbaik pada setiap pot 109 . kemudian ditempatkan di dalam rumah kaca. 0.02 g KCl. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). 1. diinkubasi selama 7 hari. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count. Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos.5 g Ca3PO4. 0. masing-masing sebanyak seperempatnya atau 7. Karoho. kemudian dikondisikan pada pH 7. yang diisolasi dari tanah asal Rasau Jaya. dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2.01 g MgSO4 7H20. Mandor. dan 2. 2. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit. dan P-17. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. 3x10 7 Chromobacterium. atau sebagai inokulancampuran beberapa-genus (multi-genera). 1. dan Bacillus spp.001 g MnSO4 H2O. 0. P16. digoyang pada kecepatan 150 rotasi per menit. Media tadi mengandung: 1 g glukosa.05 g yeast ekstrak dan 0.001 g FeCl 3 . perlakuan kompos sekam ayam (P-7). Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan. Pontianak. 1.3x107 Spaerotillus natans sebagai BahanInokulan (B-I). Sambas. dan Nitrosomonas spp. Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I.

beserta kontrolnya. Chromobacterium. Citrobacter. kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. (isolat tanah Sambas) Azotobacter. dan Nitrosomonas spp. Rhizobium sp (isolat tanah Ketapang) Azotobacter. Citrobacter. Azotobacter sp. (isolat tanah Singkawang) Citrobacter sp. Citrobacter. (isolat tanah Karoho) Azotobacter. Bacillus. (isolat tanah Mandor) Azotobacter. Bacillus. Nitrosomonas spp. Nitrosomonas. Bacillus. dan Rhizobium spp. Bacillus. Citrobacter. dan Nitrosomonas spp.Widawati & Rahmansyah Tabel 1. dan Nitrosomonas spp. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. (isolat tanah Rasau Jaya) Nitrosomonas sp. Bacillus sp. (isolat tanah Pantai Singkawang) Azotobacter. dan Nitrosomonas spp. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. Bacillus.. Citrobacter. dan Nitrosomonas spp. Citrobacter. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. Bacillus. dan Nitrosomonas spp. Bacillus. Bacillus.

P-6. P-15. Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. dan P-17 untuk perlakuan inokulan satu jenis. Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh. P-4. sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst).377 Center = 17. P-12. P-2. 11. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst. yang umumnya berukuran di atas nilai tengah (center).Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5.0. 1. P3. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). P-10. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 . P-7.627 Tinggi tanaman (cm) LCL = 51. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5. P-13.804 UCL = 79. P-12. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. dan 14 mst (Gambar 1). Tanaman yang tidak diberi inokulan pada no.305 1 5 13 17 9 UCL = 22. dan P-17. dan P-17. 2.1. P-14. P16. P-16. P-13.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. P-14. P16. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2. P-15. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp.231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1. sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. P13. 8. sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil. dan P-15.

. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis.Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10.95). Sekalipun pada hasil yang lain. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. atau bahan organik lainnya. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). dan Bacillus spp. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. P-B. P-H. dan P-F sebagai kontrolnya. dan PC bila dibandingkan terhadap P-E. Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp. P-A. sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. dan P-C (Tabel 2). Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman . dan P-I (Gambar 3). Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal. yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan. atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. memperbaiki struktur akar. kompos. namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4). Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. dan memperlancar serapan hara oleh tanaman (Ogunwole et al. sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G. 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya. Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan. memperkecil erosi. akibatnya dapat memperbaiki serapan air. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis.

11.377 (mm) tanam an Center = 44. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65.774 UCL = 22. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 .314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33.231 Center = 17.126 70 20 18 16 60 Center = 59.93 UCL = 19.103 32 10 UCL = 9.52 Center = 15.295 24 8 Center = 7. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.627 60 50 40 30 LCL = 51.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2. dan 14 mst.615 9 28 Center = 26.637 LCL = 8.931 50 LCL = 46.486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56.344 Center = 11.66 LCL = 19. Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata.804 LCL = 13.745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat. 8.647 LCL = 11.305 UCL = 79.637 7 6 20 LCL = 5.

kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 . Bacillus. Bacillus. Nitrosomonas. Citrobacter. Bacillus. Bacillus. Nitrosomonas spp.kontrol 1 (tanpa inokulan) . dan Rhizobium spp Azotobacter. Bacillus. dan Nitrosomonas spp. dan Nitrosomonas spp Azotobacter. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter.kontrol 3 (tanpa inokulan) . Bacillus. Azotobacter.kontrol 2 (tanpa inokulan) . Citrobacter. dan Nitrosomonas spp Azotobacter.Widawati & Rahmansyah Tabel 2. dan Nitrosomonas spp Azotobacter. Bacillus. Citrobacter. dan Spaerotillus natans Azotobacter. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F . Citrobacter. Citrobacter. dan Nitrosomonas spp. Chromobacterium. Bacillus. Azotobacter. Citrobacter.

namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus). Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al. 11. atau tanpa kompos (P-F).80 0. R^2 = .20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1. Kecepatan tumbuh batang hasil pengamatan 5. dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC).40 0.60 0. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E).7 x + 23.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1.40 0.649 + 1.20 0.60 0. 115 . Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4.722 * X.904 Y = 23.00 0.904 Gambar 3.7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0. dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F).00 1. serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya.20 0. fraksi atau serpih tanah. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman.80 A C G H 0. 8.20 1.00 0.

Agric. dan klorofil daun bila dibandingkan terhadap kontrolnya. Rao & B. Ch. dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. Res. yang diisolasi dari tanah asal. 2004. Rep. Narayanaiah. Gnanamanickam. FS. & MS.. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. DAFTAR PUSTAKA Badran. Kalimantan Barat. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. dan Nitrosomonas spp.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization. Plant Biotech. Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan. Johnson. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. & TS. Egyptian J. bobot akar. Deore. biomassa. 82(2): 247256. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan. M. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. Bakteri Bacillus spp yang diujikan oleh Desai et al.. Seed inoculation with Bacillus spp. 2007. S. 2008. Venkateswarlu. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. 2:7–11 Desai. Bacillus. GR. Isolat bakteri yang diperoleh dari tanah asal Pontianak. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. Reddy. improves seedling .: an important biodiesel plant. S. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. luas daun. yang mana keberhasilannya terjadi seperti pada pengujian ini. AC. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). Safwat. Ch Kumari.

plant. 1978. Sci. Agric. Mahfouz. OM. Effect of mineral vs. Naglaa & AA. AL. Soc. Sreedevi. JS. 3(1):7378. Indian Perfume. 2007. S. African J. Res. Effect of biofertilizers on the growth. El-Ghadban. SP. 1995. yield. Influence of biofertilizers on growth. Int. Chikara. Richaume. Int. 152: 707–716. M. volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. Gangrade & KC. 5(2): 75-80. Trivedi. L. CK. 2001. and essential oil content of fennel (Foeniculum vulgare Mill. Asian Biotechnology and Development Review.. LO. 44 (1): 229-234. 2002.. Cairo. Agrophysics. Banerjee. Wani.. Sci. Sadek.Biol. 2006. Res. Improve livelihoods and environmental protection through biodiesel plantation in Asia. & A. 21: 361-366. Am. EAE. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media. E. Saber. Kabesh & MS. World Appl. A. Maheshwari. Ain Shams Univ. 84(3): 977-992. 2008. 35(2): 308-311.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. 39: 27-32.Inte. 2006.). Abdel-Latif. Chaudhary. 308-312. Daudu. SK. Scien. biofertilizer on growth. Fert. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol. Soils..J. Sharaf-Eldin. Ghosh. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. Egyptian J. SA. & Surahmaida. Vietnamita. Shrivastava. Tropical Hort. Yousry. 2008. 8(2):11-29. AM. Memasukkan: April 2009 Diterima: September 2009 117 .). M. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards. Biol. Kandeel. MN. Elefan. Plant Soil Sci. ES. Microbiol. 47(1): 351–371. J. Ogunwole.): influence of additives. Agric.. 1991. 58(3): 245 – 251. 4(4): 519-522.) cv. J. Ranjard. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin. Quantitative and qualitative microscale distribution of bacteria in soil. In vitro clonal propagation of physic nut (Jatropha curcas L. Shalan & TAT... Mangkoedihardjo. Osman. Patolia. for phytoremediation of lead and cadmium polluted soil. SK. 2008. Munoz. Environmental Technology & Management. JO. & MA. 2008. SAT. volatile oil yield and chemical composition of Ocimum basilicum L. DR. Lewis. International Conference on Environmental Research and Technology (ICERT).. & M. D’Silva & TK. Jatropha curcas L.. Dominguez & OS. S. Annals Agric. Int.

tubulosus. identifikasi. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. and perferesence. urban area Kata kunci: Kelelawar buah. while the female of C. corola types. Kelelawar kelompok Megachiroptera mengkonsumsi buah. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi.id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. Serat polen mengandung protein lebih dari 60%. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah. Bats have important role on seed dispersal and or plant pollinator. oblate type for the male of C.Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. Urceolatus type has important for female of C. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen. titthaheileus. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. polen dan nektar (Suyanto 2001).co. while the female in disk type. sphinx. titthaheileus and C. West Jawa. Email: srisoegiharto@gmail. sphinx. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar.com 2 Staf Pengajar Mayor KVT IPB Bogor. brachyotis and R. oblate spheroidal for the female of Rousettus amplexicaudatus and male of C. brachyotis and C. Email: apkartono@yahoo. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. The male of C. The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. minutus. C. 119 . Where as the female has interest in campanulatus type. Key words: Fruit bats. C. pollen identification. sphinx. amplexicaudatus like permagnae type (100-200 ì m). titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m). Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda. brachyotis. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. Furthermore the male of Macroglossus sobrinus has interested in rotatus. prolate pollen type has importance for the male of Eonycteris spelaea. pollen.

Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku. Macroglossus sobrinus. mulai Maret 2008 hingga Juni 2009. Pengambilan sampel polen didapat dari isi pencernaan kelelawar. Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan. C. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling.00 – 08. Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga. dan sering terdapat karbohidrat lengkap sporo-pollenin.Soegiharto & Kartono hidrokarbon. langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. . Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina. Nayar (1999) dan Paldat (2005). Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan. C. yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). sphinx.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan.00-18. Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan. BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. titthaheileus. Rousettus amplexicaudatus dan Eonycteris spelaea. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. terpenoid. Jaring kabut yang dipasang pada waktu senja hari pada pukul 17. Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan. pigmen carotenoid.00 WIB dan pagi hari pada pukul 06. pengulangan dilakukan sebanyak tiga kali. C. brachyotis.

dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. kupu.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. C. Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok.5 (Leps & Smilauer 1999).466 dengan eigenvalue = 0. Bentuk mahkota bunga terbagi kedalam 8 tipe. Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0. Untuk bentuk mahkota lebih kuat mempengaruhi C. yaitu tabung. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a. axis 3 = 0. Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). dan raksasa/giganteae (>200 ì m). tabung dan bulat. brachyotis betina. bintang. disk. 121 . Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang.187. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar. tipe polen dan ukuran polen. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. suboblate. Analisis pengaruh karakteristik bentuk bunga. Pada penelitian ini data yang dihasilkan dalam bentuk persentase. sedang/mediae (25–50ì m).241 dengan eigenvalue = 0. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. dan bulir. mangkuk. Penyajian data dilakukan dalam 3 bentuk. kedok. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. kecil/minute (10– 25ì m).116 dengan eigenvalue = 0. (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. prolate dan perprolate. prolate spheroidal.753. oblate. yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. Tipe polen terbagi ke dalam 7 tipe yaitu peroblate. titthaheileus betina dan jantan. sangat besar/ permagnae (100–200ì m).390. Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan. jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). oblate spheroidal. axis 2 = 0. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009). besar/ magnae (50–100ì m). lonceng. Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies. sphinx betina. sedangkan betinanya dipengaruhi kuat oleh bentuk disk. serta C.

047 dengan eigenvalue = 0.47 30. sphinx.462. axis 3 = 0.54 7. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae.99 Keterangan : CM = Cynopterus minutus .1 14. DI_S= Disk. R = Rousettus amplexicaudatus.97 11. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal. titthaheileus.66 25.06 18.84 41.95 44. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate.48 12.24 12. Spesies C. menjelaskan bahwa Rousettus amplexicaudatus betina dan C. M = Macroglossus sobrinus.4 11.09 7.15 4.588. sphinx betina.61 19.03 9. axis 2 = 0.194. Untuk jenis C.. KU_P= Kupu-kupu. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal.77 68.08 11. Pada Gambar 2b.427. MA_K= Mangkuk.74 57. dengan eigenvalue = 0.28 14.356. minutus jantan.86 4. C.55 9. E = Eonycteris spelaea. brachyotis. C. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a.11 68.44 50. Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3.40 21.23 43.18 33.26 9.08 29.39 48. dengan eigenvalue = 0.091 dengan eigenvalue = 0.95 18. LO_C= Lonceng. axis 2 = 0.886.74 61. sedangkan spesies C. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate. CB = C.05 2.598.58 42.53 9.7 27. Tabel 1. dengan eigenvalue = 0.39 42. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1. BU_L= Bulir.88 52.97 100 100 85. p = jumlah persentase. CS = C. menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0. KE_D= Kedok.26 7. 122 . Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0. BI_T= Bintang.03 7. Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C. brachyotis betina dan R. CT = C.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2.285. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b. TA_B= Tabung.

47 18.13 11.72 14.66 56. CT = C.67 29.8 14.95 42.58 53.93 64.69 39. R = Rousettus amplexicaudatus.72 14. Tabel 3.77 46.29 52. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40.5 41.65 7.48 7.2 64.61 4.87 7. R = Rousettus amplexicaudatus. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar. brachyotis.71 44. CB = C.83 61.24 35.23 15. sphinx.86 6.97 Keterangan : CM = Cynopterus minutus.94 11.56 100 100 100 92. CS = C.21 100 5.13 Magnae p 15. M = Macroglossus sobrinus.04 25.42 6. CT = C.16 35. brachyotis.65 3.52 86.13 12.69 10. titthaheileus.28 74.95 39.92 44.4 Keterangan : CM = Cynopterus minutus.17 23. p = jumlah persentase 123 .23 43. p = jumlah persentase. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36.45 35. E = Eonycteris spelaea.2 85.31 14. titthaheileus.74 61. M = Macroglossus sobrinus. CS = C.85 5. CB = C.52 7.03 100 1.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14.59 42.01 57.9 85. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar.48 13. E = Eonycteris spelaea.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2.04 Permagnae p 43.92 37. sphinx.78 20.08 41.26 76.97 34.01 14.34 42.

6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. 2 = C.4 Axis 1 1.0 Gambar 1. Keterangan : 1. sphinx betina. DI_S -0. = Cynopterus minutus jantan. TA_B= Tabung. 10= Macroglossus sobrinus betina. sphinx jantan. 13= Eonycteris spelaea betina. KU_P= Kupu-kupu.. -0. 12= Eonycteris spelaea jantan. brachyotis jantan. 124 . 4= C. 9= Macroglossus sobrinus jantan. 3= C. 11= Rousettus amplexicaudatus betina. brachyotis betina.4 b. MA_K= Mangkuk. 6= C. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2. BU_L=Bulat. BI_T= Bintang.0 0. titthaheileus jantan. LO_C= Lonceng. minutus betina. KE_D= Kedok.Soegiharto & Kartono 0.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0.4 Axis 1 1. 5= C. b) hubungan axis 1 dan axis 3. 8=C. 7= C. DI_S= Disk. titthaheileus betina.4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a.

6 1. bracyotis betina. = Cynopterus minutus jantan. brachyotis jantan. titthaheileus betina.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0. 12= Eonycteris spelaea jantan.4= C. 11 -0. OB -0. 6= C. PE_PR= Perprolate. Gambar 2.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0. 7= C. titthaheileus jantan. 3= C. 125 . minutus betina.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0.0 0. 2 = C. sphinx jantan. 11= Rousettus amplexicaudatus betina. b) hubungan axis 1 dan axis 3.. OB_SP= Oblate spheroidal. 10= Macroglossus sobrinus betina.8 a. sphinx betina. a) hubungan axis 1 dan axis 2. PE_OB= Peroblate. 13= Eonycteris spelaea betina. PR= Prolate.8 b. OB= Oblate. 8=C. 9= Macroglossus sobrinus jantan. PR_SP= Prolate Speroidal. Keterangan : 1.6 Axis 1 PR_SP 1. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen.0 Axis 1 . 5= C. SB_OB= Sub Oblate.

10= Macroglossus sobrinus betina. titthaheileus jantan. 7= C.. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen. 8=C.0 Axis 1 Gambar 3. 2 = C. bau. = Cynopterus minutus jantan. MA = Magnae. 13= Eonycteris spelaea betina. (2003) karakteristik kelelawar dalam mencari makan pada malam hari. 9= Macroglossus sobrinus jantan. mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. tingkat 1. brachyotis jantan. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator).Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae. minutus betina. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan. menghasilkan nektar yang berlimpah. Keberagaman tersebut dijelaskan oleh Graham et al. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. 4= C. bracyotis betina. Keterangan : 1. GI = Giganteae. (2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar. sphinx jantan. 5= C. PA = Permagnae 126 . 12= Eonycteris spelaea jantan. 11= Rousettus amplexicaudatus betina. 6= C. Bentuk keberagaman yang ditunjukkan berupa warna.4 8 PA 9 12 3 5 7 2 GI 4 11 13 1. Menurut Graham et al. bentuk.2 kebutuhan pakan yang tinggi. titthaheileus betina.0 -1. dan ukuran. 3= C. bentuk mahkota bunga mangkuk. sphinx betina. ukuran polen besar dan dalam jumlah banyak. mengeluarkan bau menyengat (asam butyric).

Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah. sedangkan tipe polen. Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar.2. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen. sphinx. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar.3. spesies Rousettus amplexicaudatus betina dan C. Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus. permagnae dan giganteae. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar. Peneliti lain (Graham et al. Pendapat Graham et al.2 dan Ceiba sp. [Euphorbiaceae] sp. berpendar atau warna kusam. 1. serta bunga terletak pada cabang pohon. menghasilkan nektar yang banyak dan polen yang berlebihan. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan. C. ukuran polen tersebut mulai dari magnae. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari. Ceiba sp. brachyotis. Ceiba sp. Bauhinia sp. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. mengeluarkan bau yang tajam dan menyerupai bau kelelawar.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. Syzygium sp.. permagnae dan giganteae. tipe polen. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar. Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar.. C. bunga terbuka dan mudah diakses. sphinx jantan lebih memilih oblate spheroidal. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp.. titthaheileus.1.. Ceiba pentandra. Stroo (2000) mencoba menganalisis pengaruh ukuran polen. namun berbeda kesimpulan tentang sistem aperture. C.. ukuran polen tersebut mulai dari magnae. Baringtonia sp. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 . Durio sp. [Orchidaceae] sp.

titthaheileus. Voigt (2004) dan Bumrungsri et al. Bumrungsri et al. (3) kelelawar lidah pendek/ pemakan buah. Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. C. Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar.. sphinx. bunga dan daun. sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. Rousettus amplexicaudatus dan Eonycteris spelaea. yang menjadi pakannya. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. Toelch & Winter (2007). kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering). kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar.Soegiharto & Kartono kelelawar tersebut. Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. (2009) akan lebih dijelaskan pada hasil penelitian kami. Perbedaan pendapat Warren & Diaz (2001). brachyotis. seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan. Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. C. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. C. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. kedok pada spesies Eonycteris spelaea jantan. . (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. (2) tipe bunga yang mudah diakses polennya. Durio spp. yaitu: (1) tipe bunga yang mudah diakses nektarnya. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea.

2004. Illustrated Handbook on Pollen Terminology.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. 2001. Graham & LW. 1998. Pollen Flora of Maharashtra State India. Understanding Flowers and Flowering:An Inte- grated Approach. Sripaoraya. J & P. A. Graham. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers. E. Smilauer. G. New Delhi: Today & Tomorrow’s. Paldat. Racey. Pusat Penelitian dan Pengembangan Biologi – LIPI. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae.& Y. Sridith & PA. [20 Juni 2009] ter Braak. New York: Chronica Botanica. 2003. K. Canoco Reference Manual and User ’s Guide to Canoco for Windows. Component Phy. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar.blogspot. LE. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. 2009. Pollen morphological evolution in bat pollinated plants. Winter. http: //abdulsyahid-forum. Dept. Trop. Bogor. Bombacaceae) in southern Thailand. Wilcox. Erdtman. 1999. Faculty of Biological Sciences. Plant Biology. T. 2005. 193:265–269 Voigt. Transformasi Data. JM. A. Glover. Pearson and Prentice Hall. 129 . Plant Sys. Syahid. 1943. Kelelawar di Indonesia. Copenhagen: Munksgard. CC. A. & P. 2007.. Nayar. Multivariate Analysis of Ecological Data.com / 2009/04/transformasi-data. TS. International Bioscence Series Volume XIV. 1952. Erdtman. The pollination ecology of durian (Durio zibethinus. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan. 222: 225–242. Psychometric function for nectar volume perception of a flower-visiting bat.html. 2009. of Palynology Stroo. permagnae dan giganteae. Leps. 1999. U. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores. Oxford: Oxford Univ. Chongsiri. G. 2000. 2007. CJF. An Introduction to Pollen Analysis. Ithaca: Microcomputer Power Toelch. University of South Bohemia. Pr. Ceske Budejovice. BJ. Smilauer. Ecol 25:85–92. J.Evol. Suyanto. DAFTAR PUSTAKA Bumrungsri S.

HM. 1992. Arthropod-Plant Inter. 2001. Warren. Evolutionary Ecology 15:157–166. Diaz. 2007. Memasukkan: Juli 2009 Diterima: September 2009 130 . Preparasi dan dasar determinasi palinologi. Morphology and development of floral features recognized by pollinators. J. Glover. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. Whitney. Bandung. & BJ. & A. A twopollinator model for the evolution of floral complexity. Yulianto E.Soegiharto & Kartono Component Physiology 174:541– 548. 1:147–158.

Character differences between both of Papasan only revealed physiology adaptation.) Voigt) in Three Population in Yogyakarta. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1. The chromosome number of both Papasan is 2n=24. berbentuk lonceng. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L. This plant is commonly used as vegetable.30 a. Buahnya berbentuk oval dengan panjang 4-6 cm. Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran. while Papasan II at about 08. Fakultas Biologi. They differ in phenotype.9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006). found in three population (Ngebel. The difference R value between Papasan I and II was smaller than 0.30 a. Kata kunci: Coccinia grandis L.30 p.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1. Keywords: Coccinia grandis L.m. Cromosom. batang memanjat. 131 . 11 a. Papasan. In Daerah Istimewa Yogyakarta.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L. Chromosome. indica. Papasan memiliki beberapa nama ilmiah seperti C.. Berbah and Gajah Wong Riverbank). there were two varians of Papasan (Papasan I and II). Based on the statistic test. dan aksiler. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11. anti bacterial. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). contains of 22 autosomes and 2 sex chromosomes.1]non-3-ena-2. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika. The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m). It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L. Papasan.. grandis dan C.rindyastuti@yahoo. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983.. Papasan memiliki sulur.30 p. bunga berwarna putih kehijauan. Universitas Gadjah Mada E-mail : ridesti.m and 2-2.25.m.3. C. and anti diarrhea. berwarna hijau pada saat muda dan berwarna merah pada saat tua.5-dimetilbisiklo[3. anti diabetic. Selain itu. Kariotype.m. Niedzielski 2002).m-00. Karyotype. Dalam “Flora of Java”. UPT BKT Kebun Raya Purwodadi-LIPI 2. cordiflora. especially in shape and taste of fruit.30-09. Papasan is a dioecious plant belongs to the family Cucurbitaceae.

Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). Fakultas Biologi Universitas Gadjah Mada.Rindyastuti &Daryono Papasan memiliki satu nama yaitu C.Juni 2008. Yogyakarta selama delapan bulan. Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. grandis var. dua macam Papasan yang ditemukan di populasi Ngebel. Di Daerah Istimewa Yogyakarta. jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek). Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003). ukuran. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. bentuk. yang digunakan adalah metode Squash (Jahier et al. yaitu dari bulan Oktober 2007. wightiana (Roumer) Grab. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel. Metode preparasi kromosom. grandis (L. grandis dan varian buah pahit C. Varian buah manis yang umumnya dibudidayakan merupa-kan C. grandis) yaitu tipe buah manis dan buah pahit. variasi bentuk dan rasa buahnya. Keduanya berbeda dalam hal rasa.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. Cogn sebagai nama sinonim. Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel. 1996). Dengan demikian. Di India ditemukan dua varian Papasan (C. Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. 132 grandis var. varietas atau forma. cordifolia Auct non. Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. Kedua populasi tersebut berbeda karena perbedaan morfologi.

Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1.00 3.49 0-12. Satu persatu.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades. Pada setiap pemotretan.0. diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda.67 1.Identifikasi Papasan (Coccinia grandis (L.49 RLK 1. Ukuran tiap ulangan dirata-rata. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37.0 untuk konversi skala ukuran kromosom. Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i. Bentuk kromosom berdasarkan Indeks Sentromer (IS). Lengan pendek diukur dari telomer lengan pendek sampai sentromer.00-1.5 12. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog.5-25. Tabel 1. Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering.01-7. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom. Kromosom difoto dengan mikrofotografi. Hasil pemotongan dicopy dalam format Adobe Photoshop 7. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7.00 133 .00 >7.5-50 25-37.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. Untuk menyusun karyogram. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya.0 dan CorelDRAW X3. Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16. Lengan panjang diukur dari telomer lengan panjang sampai sentromer. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto. Ujung akar diambil.68-3.

1 .2.0.0.9.0. Bentuk biji 2.2 6. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan.64 0. Bentuk 5. terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II. Ukuran biji (cm) a) panjang b) lebar 3. Warna 2.5.4 7. Rasa 3.6 .5 . Buah Papasan I memiliki garisgaris putih. Tepi daun 3.2. Karakter Dari karakter buah.3 8.9 .6 0. membulat-oval. Perbedaan baru terlihat pada ukuran daun. banyak variasi Membundar berlekuk licin.2 oval-bulat variasi sedikit 1.7 . Bunga 1.4 8 . Karakter morfologi Papasan I dan II.6 . Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4. Tabel 2.11. variasi bentuk dan rasa buahnya.3 . bentuk daun.7. Tanaman Papasan I Papasan II membundar berlekuk licin. Viabilitas 4. tidak berambut 6. Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4.5.7 manis membulat 0. berasa manis dengan sedikit variasi bentuk buah.6 2.6 2 . tidak berambut 7. Papasan II memiliki ukuran daun lebih besar daripada Papasan I. Bentuk buah 2. memiliki rasa buah pahit dan variasi bentuk buah yang banyak.0. Ukuran daun (cm) a) panjang daun b) lebar daun 2. Seperti tampak pada tabel. Permukaan daun 4.3 . sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar.6 . Warna buah a) muda b) tua 3. sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua.33 tinggi putih Melengkung keluar (recurved) satu 134 . Bentuk daun 2.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4. Buah 1.25 pahit oval 0.3 .5 . Daun 1.4 memanjang.7.3 . Biji 1.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2.9.

Agarwal & Roy 1984.10-12.50-09.30 WIB sedangkan sel Papasan II aktif membelah antara jam 08. Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 .15 WIB.00-11. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin. 3. biji Papasan berbentuk oval dan mampat. 11. Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2.00-11.15 WIB. sedangkan daun mahkota Papasan II menggulung keluar (recurved).Identifikasi Papasan (Coccinia grandis (L. Guha et al. Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955.30 WIB. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2). 7. Papasan I lurus. Perbedaan karakter terlihat pada daun mahkota. chepalandra. indica yaitu 2n=24.15. diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek.30 WIB. sedangkan yang berbentuk metasentris ada pada autosom nomor 1. Disamping itu. dari 24 kromosom Papasan. 4. biji Papasan I memiliki bentuk membulat. dengan frekuensi terbanyak pada jam 11. memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil. Berdasarkan nilai IS (Tabel 3).20. 8.50-10. sedangkan prometafase Papasan II banyak ditemukan pada jam 09.30-09. Sel Papasan I aktif membelah antara jam 08. sedangkan biji Papasan II sangat mudah berkecambah. sedangkan kromosom kelamin berbentuk metasentris. 11. Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C. hirtella dan C. 5. C. Secara umum. Sedangkan.30 dan 14. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. sedangkan biji tanaman Papasan II berbentuk oval. Pada Papasan I prometafase banyak ditemukan antara jam 09. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2.00-14.00-12.00-14.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2). 9. biji Papasan I tidak dapat berkecambah.20 dan 14. 12. Namun. Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II. dan 11. 2004) sehingga. 10. 6.30 WIB. Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris.00-11.

panjang lengan panjang (q) dan panjang absolut kromosom (p+q). 8. 7. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. 10. sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. 6. Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II. 4.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). 9. Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram. Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p). sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. 2. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). 3. Karyogram kromosom Papasan II. dan 11. Karyogram kromosom Papasan I. 136 .

155 0.64±0.79±0.34739 44.105 1.135 0.76±0.102 0. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.53865 45.33331 47.71775 47.133 0.84±0.252 1.249 1.5394 45.267 0.7189 46.06673 46.062 0.62±0.130 0.108 1.50±0.17±0.58±0.86±0.090 0.077 0.139 0.255 1.86±0.097 0.70±0.230 1.51±0.77649 47.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.44±0.83784 45.075 0.87±0.069 0.77±0.70±0.069 0.081 0.218 1.116 1.26413 46.121 0.071 0.80±0.22 1.89±0.06±0.91±0.69±0.66±0.62±0.33±0.28729 47.242 1.86±0.82±0.083 0.26497 46.94±0.42±0.268 2.129 1.162 1.182 0.58±0.29±0.122 1.77302 43.079 0.128 0.061 0.083 0.085 0.55±0.075 0.75±0.129 1.61615 44. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman. Tanaman No.96±0.107 0.82±0.48±0.13±0. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.73±0.Identifikasi Papasan (Coccinia grandis (L.53±0.76±0. 137 .37865 47.63128 46.074 1.099 0.073 0.78±0.189 2.42±0.02±0.54±0.72±0.067 0.091 0.15998 45.73±0.48±0.109 0.34532 43. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.073 0.16±0.66±0.230 1.072 0.106 1.13±0.095 0.102 0.089 1.86±0.70±0.00024 47.94±0.74±0.063 0.29±0.03±0.092 1.99±0.112 0.25±0.46603 46.103 0.70±0.67±0.083 0.109 0.56±0.078 2.69±0.146 1.89±0.23 1.60±0.) Voigt) di Tiga Populasi Tabel 3.72844 46.254 1.73±0.59±0.78±0.120 1.67±0.73±0. baik autosom maupun kromosom kelamin.80±0.74±0.112 0.96±0.085 0.86±0.148 Indeks Sentromer (IS) 35.22531 45.114 0.211 1.27804 36.113 1.

Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman.87 0.16-2.13 36.77649 2. Semakin besar nilai R.44 1. Nilai R menunjukkan variasi ukuran kromosom.00 Papasan I Papasan II Gambar 3.34739 2.50-0. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata. 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.59-1. Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer.01 Papasan II 2n=24=20m+2sm+XX(m) 0.86 0. Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- . Berdasarkan hasil uji statistik pada aras 5% (Tabel 5).5394-47.33 1.51-0.25 35. Perbandingan karakter kromosom Papasan I dan II. diduga Papasan I dan II masih tergolong dalam satu spesies.345-47. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0. Perbandingan idiogram kromosom Papasan I dan II. variasi ukuran kromosom juga semakin tinggi.56-1.06-2.Rindyastuti &Daryono Tabel 4.

nilai R kedua Papasan tergolong kecil.) Voigt) di Tiga Populasi batannya. Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0. X = Pasangan kromosom kelamin betina 139 . PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda. Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar.Identifikasi Papasan (Coccinia grandis (L. Berdasarkan Tabel 5. cuaca atau kesuburan tanah. Untuk membandingkan nilai R Papasan I dan II.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0. Tabel 5. selisih nilai R antara Papasan I dan II lebih kecil dari 0. Namun. Nilai R antara Papasan I dan II berbeda. NS = Non-signifikan. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II. artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah. Berdasarkan Gambar 4. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4). Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan.25.25. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim. karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda. Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R.

4 = American muskmelon Gambar 4.5 2 1.01 0. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II. antara organ yang satu dengan yang lain dalam satu spesies. perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan. Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya. 3 = Melon PI 371795. Tabel 5.115 0. No.125 0. Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. 2 = Papasan II.5 Nilai R Nilai R 1 0. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain. Oleh sebab itu. Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman.575 Papasan II 0.565 Melon PI 371795 0.Rindyastuti &Daryono Perbandingan Nilai R 2.5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling . bahkan antara tipe sel satu dengan tipe sel yang lain. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas. Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.45 American muskmelon - Menurut Tamarin (1999). 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0.

71 memiliki kedudukan taksonomi yang sama dengan A.) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain. atas bantuan konsultasinya. ukuran. S. yunnanensis dengan rasio 2. maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L. S. dan Drs. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel.Identifikasi Papasan (Coccinia grandis (L. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II.25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. Tuty Arisuryanti. AAG. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. gracillis berdasarkan selisih nilai R lebih dari 0. mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. Purnomo. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4).25. PK. M. DAFTAR PUSTAKA Agarwal. dalam Ferruci (2000) memisahkan Serjania communis dengan S. Qi-Xing et al. Raka Swastika. Si.. Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0.Gen. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. bunga dan biji. & RP. mengindikasikan bahwa berdasarkan karakter kromosom. buah.25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C. Indian J. Karyotype of Coccinia indica. khususnya atas konsultasi di bidang taksonomi tumbuhan. S. Senada dengan hal tersebut. Namun melon tidak tergolong dalam genus Coccinia. Roy. atas bantuannya secara teknis.25.59. Qi-Xing et al. Herlianti Anissa. Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas. Disamping itu. & Plant Breeding 44(1): 117-120. tetapi Cucumis. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0.Si. bentuk. Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan.. grandis L. 2000). serta karakter genotip yang meliputi waktu mitosis. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2. Dr. M. Nogueira et al. 141 . perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. Meastika Dianeta. 1984. jumlah. Sc. Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. KESIMPULAN Berdasarkan perbandingan karakter fenotip. yaitu karakter morfologi daun.) Voigt.

A. K. Morfologi Tumbuhan. Delourne & AM.Rindyastuti &Daryono Backer. Winarsih. Russel. Inc. & AE.jst. K & B. 1996. 1. F. Smith. Chromosome Atlas of Flowering Plants. H. MW. Wylie. 2003.co. MS. 1998. serta Isolasi dan Identifikasi Senyawanya”. Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit. Tjitrosoepomo.ac. 1998. McGraw HillBook Company. Subramaniam. Econ. Gadjah Mada University Press. USA. California. Genetics. 37 (4) : 380-383. & D. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. USA. JM. CD. G.html. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana. 2002. Plant Systematics. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia. Act Phytotaxo.http:// www. 2000. Guha. Flora of Java Vol.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. Cheure. 51-57. Ferruci. Inc. The Benjamin/Cummings Publishing Company. Tangui. Coccinia grandis. London. 1979. Scarlet Gourd. Sixth edition. Jahier. Cytological. www. Tamarin. Y. 2006. Plant Systematics. 305.V Groningen.) PI 371795. Science Publisher. Comp. CA. Sinha. Karakterisasi Kromosom Melon (Cucumis melo L. Science Publisher. 98-101. McGraw Hill-Book.go. Jstage. G.html?id=4138. h a r t w i c k . Memasukkan Agustus 2009 Diterima: September 2009 142 . ZhongShu. Fifth edition. Luchsinger. stage. 1999. 2004. New York. Eber. SB. Sundari. & RC. 217-222. Jones.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id. 1999.jst. hartwick. 1983. & AP. Techniques of Plant Cytogenetics. Bot. Bakhuizen van den Brink. RK. Inc.unud. w w.. Oxford University Press. PJ.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. Coccinia indica. 2000. 3-5. Walter Noordh off N.jp/ article/cytologia/70/1/70_53/article. Inc.id/ind/ detailPenelitian.. George Allens and UNWIN LTD. 2007. 176182.pdf/10Pemanfaatan TumbuhanObatDiare109. Ciawi. Principles of Genetics. Z. 1996. Little-knownTropical Drug Plant.lemlit. Singh. Karyomorphology and Relationships of Amentotaxus Pilg. Ramachandran. Fakultas Biologi UGM. Zhi-Jiang & Y. Sin. Sinha & S. Winarno. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae. RH.go. The Netherlands. Darlington. 1955. e d u / P re b u i l t / BiolJBR3_www. R. Evolutionary Genetics. Yogyakarta. 1965. http://www. New York.kalbe. Yogyakarta.jp/article/ cytologia/70/1/70_53/article. Qi-Xing. www. JM. Diakses tanggal 5 November 2007. 1-77. 38 (6) : 525532. Niedzielski. 234-325.

Jl.. Keywords: Phenanthrene. pH 7. yang 143 . perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu. but the synthesis was inversely correlated with the cell growth. Salah satunya adalah phenanthrene. 1984) yang sangat berbahaya bagi kesehatan manusia. and able to degrade phenantrene after 5 hours. biostimulasi dan bioaugmentasi. Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. This isolate grew optimum at 300C.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI.. metilpropil). maka. About 75 % of phenantrene was degraded after 12 hours. Alcanivorax Borkumensis M5 was isolated from sea water. maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. distribusi. 1992. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. Pseudomonas spp. Menurut Brodkorb et al. Polyhydroxybutirate (PHB) was produced during culture growth.bacteria Kata kunci: Phenantren. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya. Phenantrene is one of the most persistent organic substances in environment.5 hours and specific growth rate of 0.8 with a doubling time of 14. degradasi. Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil. yang tersusun dari gabungan tiga cincin benzena. Cycloclasticus pugetti. produksi. dietil. antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan. yang merupakan salah satu senyawa karsenogenik (Cerniglia. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH.Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) . The relation between PHB synthesis and phenantrene degradation is due required further investigation.0476/hour. degradation . Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta.

larutan kedua mengandung MgCl2. CaCl2. PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh. dan SrCl2 (divalent cation salts). 24 mg SrCl2·6H2O.60 BT dan 5. NaBr. 0. Uyttebroek et al. 83 mg NaBr. termasuk pestisida. 3. KCl.6 dengan NaOH). dan larutan ketiga mengandung FeCl2. Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan.0 mg FeCl2·4H2O. NaHCO 4 . Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22.46 gr CaCl2·2H2O. H 3BO 3 .0 gr/L) ditambahkan pada larutan pertama.850 LS. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC).18 gr MgCl2·6H2O. Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. 89 mg Na2HPO4·7H2O.98 gr Na2SO 4. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al. 144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi.79 gr NaCl. Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH.6 mg NaF.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. karena memiliki metabolisma yang berbeda dengan mikroba teresterial. Letak astronomisnya adalah 106. NH 4 Cl. 0.27 gr NH4Cl. NaF. Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit. Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%). BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta.72 gr KCl. Larutan pertama mengandung NaCl. Noble Agar (Difco) (15. . dan 2. 11. 27 mg H 3 BO 3 . 31 mg NaHCO 3 .3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}. Untuk memadatkan media. Lo´pez et al. oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya. Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. salinitas temperatur dan status nutrisi. Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. Na2SO 4. Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7. 1. 2006 ). 1. 2001. 2. 2002).

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

5 0.17 Gambar 2.8 0.4 OD 600 nm 1 0.0266 1.9 0.0437 pH 5.6 1.9977 2 0.3% Salinitas 5% 0 Td (jam) 15.25 18.79 48.018 x +0.302 Y=0.0476 x + 0.2 1 0.501 R2 = 0.4 0.7 38.8 Y= 0.6 0.018 0.0143x + 0.9685 R2 = 0.17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7.33 14. Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.0437 x + 0.9459 R 2 = 0.8869 R2 = 0.0369 x +0.4 0.3 0.3958 Y=0. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 .3% Salin 5% 1.9704 0.4 OD 600 nm 1.2273 R2 = 0.0143 0.3344 Y= 0.0266x + 0.2 0.8 0.Dyah Supriyati Tabel 2.94 Y= 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.5 25.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.7 0.8 dan pH 5.4 0.2 1 0.0476 0.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.6 0.6 1.8 pH 5.17 30 C 40 0C Salinitas 3.8 0.0369 0.3887 Y= 0.6 0.9701 R = 0.

bakteri mempunyai waktu generasi 18.17 Media Media Gambar 3.5 Berat sel (gr/l) 1.7 jam .1 0. dan produksi sel).8 bakteri M5 mempunyai td 15.7 jam.05 0 Salin3.3% Salin 5% pH 5.17). bakteri ini bisa dikategorikan sebagai bakteri laut tropis. Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini. Di salinitas 5%. Dengan td 18. dengan td 14. Artinya setiap 14.25 0.3 %.3 % lebih baik dibandingkan dengan 5. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas. pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3.2 0.3 0. Sedangkan.5 1 0. Dilihat dari 3 parameter di atas (waktu generasi.35 0.4 0. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25. bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%.17 PHB mg/g sel 2 0.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC.5 jam.15 0. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur. Hal ini menunjukkan bahwa.5 jam di salinitas 3.3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5.3% Salin 5% pH 5.79 jam Nilai waktu generasi M5 ini lebih cepat. seperti misalnya di perairan laut Indonesia.5 0 Salin3. pertumbuhan bakteri M5 mulai lemah.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5. Nilai waktu generasi M5 ini lebih cepat. 2. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38. Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3. Pada media dengan pH 7. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .3%..17 (45.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3. Pada media dengan salinitas 3. salinitas maupun pH yang serupa dengan asalnya. laju pertumbuhan.3 %.5 jam berarti bakteri mempunyai waktu generasi 14.

KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. 1990. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L. & E A. metabolism. dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0. TS. Microbiol.Pada media dimana pertumbuhan bakteri M5 terlihat terhambat. perlu diteliti lebih lanjut. A. tumbuh optimum pada salinitas 3. CE. yang berperan pada proses degradasi phenantrene.Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene. Appl. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium. Microbial degradation of polycyclic aromatic hydrocarbons. Dawes. Cerniglia. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%.. Legge. 58:3117–3121. bakteri M5 justru sel membentuk PHB paling sedikit.8) Kemungkinan isolat M5 mampu membentuk PHB.1%). Pada media yang relatif optimum untuk pertumbuhannya. Microbiol. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. Media seawater ini dipilih karena menurut Springael. 54:450–472. sel jusru membentuk PHB lebih banyak. 1990) pada proses anaerobik-aerobik. &R L. Made Sudiana. DAFTAR PUSTAKA Anderson. pada media air laut mengandung phenantrene. 150 . metabolic role. Brodkorb. Rev. Microbiol. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene.J. Dengan tumbuhnya bakteri M5 tersebut. suhu 30oC dan pH mendekati netral (7. Appl. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. Occurrence.3 % . 30:31–71. and industrial uses of bacterial polyhydroxyalkanoates.atas bantuan yang diberikan hingga selesainya tulisan ini. 1992.Adv. 1984. Environ.

2006. Biotechnol. Microbiol. & U. D. H. AR.&U. Mulder. Ortega-Calvo. Petroleum biodegradation in marine environments. Kishira... Microbiol. AM. M. Shutsubo. Lo´pez. Janssen. M. Karlson. 8:836–847. C. J. Wattiau. 2004. 63:452–459. Minguillo´n & M. L. Springael. Memasukkan: Agustus 2009 Diterima: September 2009 151 . Grifoll. Breugelmans. A. Z. Metabolism of fluoranthene by Mycobacterium sp. Karlson. Kasai & K. Environ. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). Karlson. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama. Biotechnol. Appl. Biotechnol. 2001. P. Bastiaens. Microbiol. JJ. 68:2683–2689. 1:63–70 Johnsen. H. MP. Breure & WH. Ryngaert. ARK. strain AP1. 2002. 1999. U. B. Uyttebroek. Hausner. Johnsen. S. Rulkens. Mol. Y. Bendixen. Vila. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. Appl. Joffe. Appl. Microbiol. Environ. Chemosphere 43:1085– 1094. J. Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models. 2006. 70:747–756. Microbiol.

JR.. Cambridge. 1990.species. Bucke. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar. Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim. Informasi dari Internet : Schulze. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA.G. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris). Jakarta. ASM.R. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris. & SW. MF. 1983. Dalam : Gerhart.html. ABSTRAK (bahasa Inggris. 151-158. 15 –18 Oktober 1982. Pola Pertanian. Indon. Washington. β. Ueda.. S. Abstrak : Suryajaya. T. Bogor : Institut Pertanian Bogor. 1982. Setiap halaman diberi nomor halaman secara berurutan. P.). Zhang. Jakarta . Methods for General and Molecular Bacteriology. Tesis. Liquid culture. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah. J. 2000. 248-277. Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). & MT. tanpa mengubah jenis huruf. Skripsi. W. Suwanto. Penulisan simbol α. Gen. NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). R. dan tabel disertai CD. 15-16 Februari 2000. foto. Information for surveys/Estimated of population density. Microbiol. H.J. atas.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. KATA KUNCI (maksimal 6 kata). 1999. Perkembangan tanaman polong-polongan utama di Indonesia.1. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. Suhartono. dan bawah masingmasing 2. Murray. Abstrak Pertemuan Ilmiah Mikrobiologi. 29: 345-354. Drew. Cambridge University Press. Prosiding : Mubarik. P. Detection and Identification of Lories and Pottos in The Wild.. Wood. HASIL. . Buku : Chaplin.E. 1994.A. PEMBAHASAN. D. Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali. http//www.net/primates/loris/ lorCp. Vol 6. Disertasi : Kemala. dan lain-lain dimasukkan melalui fasilitas insert. NR. PENDAHULUAN. BAHAN DAN CARA KERJA. maksimal 250 kata). Kata dalam bahasa asing dicetak miring. Identification of plasmids linked with polyglutamate production in B. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). Batas dari tepi kiri 3 cm. χ. Bab dalam Buku : Gerhart. subtilis. 42. Enzyme Technology. Krieg (eds.. & N. 1987. Apll. Biol. A. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. & C. No. kanan. & S.[Disertasi].

No. Desember 2009: Dr. Puslit Biologi-LIPI Ir. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Puslit Biologi-LIPI Ir. Niken Tunjung Murti Pratiwi.J. No 1.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6. Heryanto MSc. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 . Hari Sutrisno. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Majariana Krisanti MSi. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Biol. Rugayah. Vol 6. Indon.

) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 . Agustina K. Habib Rizjaani.J.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Ostrinia furnacalis Guenee Bahagiawati. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Vol 6. Biol. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. No. Kartono Identifikasi Papasan (Coccinia grandis (L. Indon.

Sign up to vote on this title
UsefulNot useful