P. 1
6(1)2009

6(1)2009

|Views: 693|Likes:
Dipublikasikan oleh Putri Indah Ayuningrum

More info:

Published by: Putri Indah Ayuningrum on Oct 01, 2011
Hak Cipta:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

02/18/2013

pdf

text

original

J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. NPK. Based on characteristic of hyperaccumulator plant.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. N. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. Desa Bantar Karet. Paspalum conjugatum. The result showed that the growth of each plant was significantly different. Hidayati 1). Meanwhile S. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. conjugatum. nudiflora. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). this research suggested that S. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya. manure and compost. Bogor Titi Juhaeti 1). vaginalis. Limnoharis flava.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. nudiflora were selected for fitoremediation of Hg contaminated soil. molesta. accumulation capacity Katakunci: Tumbuhan akumulator. O. Kabupaten Bogor. Cyperus monocephala. molesta showed the highest biomass followed by M. Hg. F. Desa Bantar Karet. Kecamatan Nanggung. sativa dan C. Cibinong Science Centre. Kabupaten Bogor. Desa Bantar Karet. conjugatum dan M. nudiflora. Kemungkinan 1 . Hg. The fertilizer treatments were significantly affected plant growth. The aim of this research is to study the potency of Salvinia molesta. vaginalis. biomas. sativa and C. The S. biomass. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. P. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. M. Centrosema pubescens. Syarif 1) & S. molesta also showed the highest capasity to accumulate Hg/year followed by C. Kecamatan Nanggung. P. Bogor E-mail : tihaeti@yahoo. Kecamatan Nanggung. ke sawah ataupun ke kolam ikan. The treatments were fertilizer: no fertilizer (as a control). Keywords: Accumulator plant. vaginalis. Monocharia vaginalis. O. Oryza sativa. Cibinong.

Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. di tempat yang agak basah seperti di pinggir sungai juga di sawah. termasuk pohon. barley. Centrosema pubescens Benth. di hutan sekunder. gandum. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. Indian mustard. dan kubis. merupakan tumbuhan terna memanjat. mata lele). 2000. Mikania cordata.Juhaeti. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. Hidayati. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum. Salvinia molesta (kiambang. 2001. Salvinia molesta.. Terry and Banuelos. Centrosema pubescens. kacang-kacangan. di daerah Sunda disebut jukut pendul bodas. 2 2001. di kebun. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). rumputrumputan dan tumbuhan air. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya. dikenal dengan nama sentro. Chen et al. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. 2004 Dalam Rodriguez et al. 2000. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. oat. Kayser etal. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. Monochoria vaginalis. Cyperus monocephala dikenal sebagai teki badot. Cyperus monocephala. Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. 2007.. di tepi jalan. Commelina nudiflora. Pivetz. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis.

Salvinia molesta D. Penelitian in-situ dilakukan di Kampung Leuwibolang. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Nanggung. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan. Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. Sementara itu. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. dan Cd pada tanaman. Bogor.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Kab. Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman.S. BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Ni. Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. Kecamatan Nanggung. Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa. Penelitian dilakukan pada bulan Maret-Oktober 2007. Dalam prakteknya. Desa Bantar Karet Kec. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri. Desa Bantar Karet. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. 3 .

conjugatum. cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan. flava. Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama. O. Pada saat panen. Paspalum conjugatum Berg (jukut pahit). Pengairan menggunakan air yang tidak terkontaminasi merkuri. 4. Pada tahap ini jenis tanaman yang diuji dikurangi yakni C. vaginalis.f. NPK 16 g/petak. 2. Untuk tanaman air. kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman. molesta.Juhaeti. 2.f. Sedangkan perlakuan pemupukannya adalah: 1.L. Mikania cordata (Burm. Kontrol. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0. tajuk dan total tanaman. sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat. P.8 X 2 meter dengan 3 ulangan. . seluruh biomassa tanaman berupa akar dan tajuk diambil. Centrosema pubescens (sentro). HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S. Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. petak penelitian tidak tergenang.5 bulan setelah tanam. Perlakuan pemupukan diberikan pada saat tanam. Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar. sativa. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1. C. 3. petak penelitian dijaga supaya selalu tergenang. 3. M. dan 5.) Presl (eceng leutik).(tali korang). Monocharia vaginalis (Burm. Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. sedangkan untuk tanaman darat. 2. Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1. Pupuk kandang 5 kg/petak dan 4. Limnoharis flava (L. L. konsentrasi Hg (ppm) di akar dan tajuk. Hidayati. Setelah itu. pubescens dan M. 4. Oryza sativa (padi). 3. Commelina nudiflora L. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas). Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman.Robins.) B. Syarif & Hidayat Mitchell(kayambang).

2 1671. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.88 35.23 187.7 b 2257.21 332.617 102. flava P.8 a 2028.2 1779.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257.51 a 2 169.0 1337.6 252.05 144.cordata tidak ditanam kembali (Tabel 1).03 a 345.600 c 63. dan C. cordata C.1917 0.667 34.22 a 1110. vaginalis L.786 b 5 .74 619.99 a 287.1833 3.34 a 184.233 Tdk ditanam Tdk ditanam 77.71 72. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921.133 56. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam.3417 0.93 9.6917 2.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879. C.74 106.3 2850.2833 1.6 a 2018.7 2778.6 659.3 12092 996. sativa M. Akan tetapi C. molesta O. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman.04 153.867 bc 59. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1.4 624.65 345.46 241. pubescens dan M.5 ab 2 1955.792 bc 70.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589.2 b 3 1050.69 427.75 95. Akan tetapi.93 b 221.33 187.6 ab 2329. nudiflora Tabel 2. pubescens M.9 1523.8333 0. terlihat dari tingginya produksi biomasa tanaman.6167 2.64 161.138 a 87.0 425.0500 3.7273 1464.51 47.0 223.69 b 152. Produksi total biomasa tanaman (gram) tiap periode penanaman.37 b 3 78. pubescens dan M . cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi.53 c 751.9 Tdk ditanam Tdk ditanam 693.6 b 2620. conjugatum C.66 a 269.580 Jenis tanaman S.16 212. Hal ini dilakukan karena dalam fitoremediasi.5 a 1619. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman.841 a 37.95 66. onocephala C.1 3. Pengaruh pemupukan terhadap pertumbuhan tanaman.67 a 216.

T7 = C.cordata.pubescens.nudiflora. T2 = O. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c). Hidayati. kecuali pada M.conjugatum. Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda. T8 = M. T 6= C. konsentrasi Hg (ppm) akar tanaman (b). Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman. T5 = P. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk. molesta. T4 = L.Juhaeti. Monocephala. T9 = C. T3 = M.flava. hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a). Syarif & Hidayat tersebut ke bagian tanaman yang dipanen. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman. masing-masing jenis tanaman menunjukkan kemampuan yang berbeda. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab).vaginalis. 6 konsentrasi Hg (ppm) . dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. Sativa.

flava. T4 = L. (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain. T2 = O. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . L. Monocephala. cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg). sedangkan C.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2. M. pubescens dan M. conjugatum. T8 = M. Salvinia molesta. T6 = C. T5 = P. monocephala.nudiflora. vaginalis. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. C.flava. Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. perlu diperhatikan beberapa kriteria.conjugatum. T3 = M. T7 = C.cordata. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk. marginal. Diharapkan. molesta. Pada penelitian ini. Sativa. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. O. P.pubescens.vaginalis. T9 = C. sativa. dan C.

Juhaeti. Kemudian.cordata dan C. C. P. yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air). M.nudiflora.flava. hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu.vaginalis. sativa. Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman. Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. monocephala. Hidayati. C. Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik. Syarif & Hidayat yang tinggi (Reeves 1992). (2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal. Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk. Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran. molesta. yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. potensi produksi biomasa tananaman yang diuji pun cukup tinggi. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik.conjugatum. L. S. Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal. Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. terbukti dengan adanya konsentrasi logam yang tinggi pada akar. pubescens. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu. M. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. .

T9 = C. nudiflora dan P. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. T8 = M. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata. M. conjugatum dan M. molesta. M. T4 = L. O.pubescens. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman. sativa dan C. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. vaginalis. vaginalis. nudiflora. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S. Gambar 3. C. O. Vaginalis. T3 = M. O. P. Tanamantanaman tersebut adalah S. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . molesta. nudiflora. C. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S. umur panen. nudiflora.conjugatum. T2 = O.cordata. Monocephala. Sativa. conjugatum. jarak tanam.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan. sativa. molesta. molesta. T5 = P. T7 = C. M.nudiflora. vaginalis.vaginalis. P. C. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat. O. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman.flava. sativa. molesta. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. conjugatum. sativa. P. conjugatum. T6 = C.

nudiflora 57.435 S. vaginalis C. pubscens M.87 5030.062 L.849 41.6 3894. monoephala L. nudiflora 114.298 M.05 M.931 C.70 6 O. nudiflora 6331. flava 4.55 C. pubscens M.97 C.049.7 1254. vaginalis 42.3 10.55 4 10 . conjgtum 55. conjugatum 5625. puescens M. flava 18.214 S. nudiflora O. moncephala M.099 9.278 C. cordata C.Juhaeti.253 M.455 O. Syarif & Hidayat Tabel 3.mocephal 35.155 C. sativa 4755. molesta 63.6 5077. flava C.2 M. nudiflora 16. conjugatum C. nudiflora 107.4 P.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O. vaginalis 8.3 2105. sativa M. pubescens 12558. cordata C. vaginalis 7682. vaginalis 28. vaginalis L.625 O. molesta 190.999 3.765 L. monephala M.03 3949. sativa 6098.758 C.13 1164. nudiflora 18.946 11. molesta C. vaginalis L.912 P.498 M. monoephala 2476. moncephala C. molesta 13303. conjgam 67. flava P. conjugatum 4542. sativa 141. sativa 55.907 12. monoephala M.643 5.869.5 M. mocephal 32.43 4598. monoephala C. conjugatum C.848 12. conjatum 107.605 Kompos S. nudiflora P. sativa 159.104 31. nudiflora L.2 4644.558 19. sativa M.9 C.conjugtum S.471 33. cordata 859. cordata C.357 P.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S.803 L.8 C.568 L.5 M. flava P.937 9. flava 44.1 1721.37 C. cordata C. sativa 85. pubescens M.6 O. flava P.095 19. cordata C. Hidayati.31 L. pubescens M.5 1895.04 5 S. sativa L. cordata C. molesta M.401 7.9 6488. molesta O. vaginalis L.9 6936.33 10513. pubescens S.581 24. molesta 40. sativa P.456 16.529 P. molesta 55. cordata C.712 12. cordata C. sativa C. conjugatum C.7 4742. vaginalis L. cordata C. flava M.241 Kandang C. flava O. monoephala 10. molesta 10897. cordata C. pubescens S.316 C. nudiflora 63.9 8046.conjgtum 40.34 Jenis tanaman Kontrol NPK O. conjgtum 11.263 32. vaginalis P. flava 13.03 31. pubscens S.13 1 O. cordata C.171 C.14 8.3 O. nudiflora S. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46. nudiflora 4504. pubescens 3216 5259. sativa M. monephal 42. flava M. molesta M.516 16.627 P.369 C.conjgtum C. flava 24. vaginalis 33.9 P.11 2 C. monephla 36. pubescens M.183 M. pubescens S.502 S.604 18. molesta O. vaginalis 68.197 C. molesta 111.

L. Nutr 14 : 1067-1080. Int. Chaney.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). J. F.. Memasukkan: November 2008 Diterima: Juli 2009 11 . Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation.. Gabbrielli. Harapini. Mattioni. DAFTAR PUSTAKA Brown. Hampshire: Intercept Ltd. 1992. 2007. Syarif & M.. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator. R. RL. 1995. FN. Practices 6(2): 165-175. C. Hidayati.. Rodriguez. Bogor. Syarif. Soil Sci Soc Am J 59:125-133. Rincon. Proctor. Environ. Reeves. Angle & AJM. & O. N. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution.. Laporan Akhir Penelitian Kompetitif LIPI. Di dalam: Backer. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation. Hidayat. I. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives. N.Plant. & CL. International JSPS Seminar. J. T. CWN. 2007. T. J. Hidayati. Anderson. 1991. Baker. 12-20 Oktober 2006. 2004. Stewart & BH. Vergnano. Moreno. RD. SL. The Hyperaccumulation of Nickel by Serpentine Plants. JS. Asencio. J. Robinson. Juhaeti & F.. Hlm 253-227. RB. Reeves (ed). The Vegetation of Ultramafic (Serpentine) Soils. S. RD. Rodriguez. 2006. Phytoremediation 9(1): 1-13. Juhaeti. AJM..

Karena ukurannya yang sangat kecil. Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. habitat. Keywords: Cephalopoda. Nabhitabhata 1998. reproduksi dan siklus hidupnya. Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I. Norman 2000). biserialis dan I. Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a.email: rist001@lipi. Research Center for Biology – LIPI. Hylleberg & Nateewathana 1991b). Dalam tulisan ini diuraikan karakter morfologi. pygmaeus. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. pygmaeus herbereri. Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. distribusi. Cell Imaging and Ultrastructure Research. distribution. except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). Indo-Pacific Kata kunci: Cephalopoda. Austria 2 Museum Zoology Bogor. 1090 Vienna. Banda. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. siklus hidup dan distribusi Idiosepius. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Idiosepiidae. biserialis dan I. The animals are dorso-ventrally compressed and cigar-shaped. The females reach maturity at 3 cm length. Marwoto 2 University of Vienna. habitat. the fins are small. jenis sotong ini tidak diminati oleh para nelayan. The arms are short and robust and almost equal in length. One conspicuous morphological character of this genus is the adhesive 13 . Idiosepiidae. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. ovally elongated with the long axis parallel to the body axis (Figure 1). Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. I. habitat dan distribusi empat jenis sotong mini jenis I. I. Cibinong 16911 – Indonesia. Balikpapan. pygmaeus khusus dari perairan pantai di Lombok.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. picteti. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I. Fac. Ternate. of Life Science. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. Sibolga dan Lombok. Jackson 1988. picteti hingga saat ini hanya dijumpai di Ambon.go. habitat.

This species was thought to occur only in the Philippines. Unfortunately. Joubin (1894a) collected one male holotype sample of I. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). pygmaeus has a wide distribution in Indonesia. Examinations by Nesis (1982). It can be assumed that this species has disappeared or even become extinct. Furthermore. 1881 in Ternate 14 and Banda-Sea. they also lie in wait to capture prey swimming by. more than 115 years ago. in females.Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. up to this day. The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. Idiosepius pygmaeus hebereri was . pygmaeus from several institutions and proposed that his specimens differ from I. collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I. pygmaeus and the other species mostly in size. Indonesia. 2008. He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. picteti at Ambon Island. Appellöf discovered I. 2008). The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). however. organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. Grimpe (1931) compared the collected material with samples of I. Hiding there. Later. contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). pygmaeus Steenstrup. Collection of Idiosepius in Indonesian waters has long history. Lombok. In 1898. Cyran et al. revealed that the morphological characteristics were insufficiently different to justify the subspecies. In 1927. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay.

Previously. picteti and I. Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. Monque (23° 41. 2005). less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia). Nevertheless.020´S.553´E) (von Byern & Klepal 2009). Indonesia. METHODS Idiosepius specimens were collected along the bay of Lombok in November .721´E. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00. geographical distribution and origin of migration remain. individuals of I. 2005) . pygmaeus.156´N. I. 1962 (Figure 2A) Holotype: deposited at South African Museum. Lombok (08° 52.487´ E) (von Byern & Klepal 2009) and Ko Pratong. 1959.December 2007 using a dipnet. we report new collection places for Idiosepius in Indonesia and extend the previous type localities. Austria) and MZB (Museum Zoologicum Bogoriense).541´E) (von Byern et al. In contrast to I.Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I. 116° 27. Japan. Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong. Cape Town. biserialis. von Byern & Klepal 2009). The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. 2005) Indonesia: Ekas-Bay. San Jose Mission Station. 35° 22. Research Center for Biology – LIPI. pygmaeus below). Collector: S. 32° 54. 26° 02. 35° 22.331´S. von Byern & Klepal 2009) Japan: Takasu. Lombok (08° 15 . a further species. pygmaeus.166´E) (Kalk. 32° 54. it was thought to occur only in African waters (Mozambique) and Thailand. many questions about their life cycle. Ekas-Bay. Shigeno (von Byern et al. This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals. Phuket Island (8° 02. was recently discovered in Indonesian waters (von Byern et al. With the present description and geographical data. RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss. South Africa (SAM A6520) Type locality: Mozambique. Inhambane Bay (23° 51. picteti.215´S. Adam 1986.300´S. 98° 25. The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections). So far.184´S. Apart from I.281´E) (Voss 1962.

picteti (Joubin.38 ± 1. with a mantle length of 4. 1962). The specimens from Thailand are larger (ML to 5.54 mm males and 7. The left arm also has two small flaps. data) Morphological characteristics: This species has the smallest specimens of the genus. collected November 2007 (unpubl. separated by a deep cleft. 1982).857‘ E) (08° 50.2 mm C 7. In the caught male. Both ventral arms in the male are hectocotylized.84 ± 0. 16 .Byern & Marwoto 50. biserialis (Voss.35 mm 15. 116° 27.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I. 357‘S .1 mm females). 714‘S . pygmaeus (Nesis. The fins are more rounded kidney-shaped and A B 14. bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm. the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. 1894a) and C) dorsal and ventral view of I.5 ± 0. 116° 26. at the tip. Animals from Mozambique are small. slender.7 ± 1. The clubs of this species bear two rows of small suckers. B) I.31 mm (females).781‘ E) . The fins are semicircular and about ¼ of the mantle length. which are nearly constant in size to the end of the club.3 mm (males) and 7.

35 mm. The animals from Japan are almost twice as long (6. The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48.39 ± 1. Amboina – according to Joubin.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle. The body is large and elongate (mantle length 14 mm).89 mm males and 9. Denmark (ZMUC CEP52) Type locality: Philippines. longer and bilobate at the tip. 1881 (Figure 2C). The right ventral arm in the male is very short and broad. 1931 Holotype: deposited at Kobenhavns Universitet. 1887 Idiosepius pygmaeus Hoyle. while the two investigated females have a mantle length of 5. Copenhagen. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle.030´E) (Suwanmala 17 . 98° 25. Zamboanga (4° 20´N. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia. 98° 24. The oral face the arm is transversely plicate. no additional specimens of this species have ever been found.25 ± 0. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe.1 mm females) with 3 suckers on the left and 5 on the right ventral arm.107´N. Synonymy: Idiosepion pygmaeum Fischer. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”. Idiosepius pygmaeus Steenstrup.34 ± 0. Klong Bang Rong (8° 02. Idiosepius picteti Joubin. Genève. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male.472´E) (von Byern a & Klepal 2009). 1886. Each ventral arm has a single small sucker near the base.945´N. Our examinations of this specimen reveal that Joubin (1894a) erred. The tentacle clubs have two horizontal rows of suckers. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe. Zoologisk Museum. Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius. 1920 Naefidium picteti Grimpe. The left ventral arm is more slender. Joubin 1894b. sometimes also three or four oblique rows of suckers. Idiosepius picteti has a small tentacle club with four rows of suckers.

The fins are small. 116° 27.730‘ S. data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11. collected December 2007 (unpubl. Jackson & Choat 1992. The specimens bear 4 rows of suckers at the club of the tentacle. data) • Telong Elong (08° 48.244‘ S.885‘ S. Grimpe (1931) . Ekas-Bay.51 ± 1. Germany (ZMB) Type locality: Indonesia. 146° 50´E) (Jackson 1988. another 4/4 suckers on the hectocotyli. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898).012‘ E). The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). Lombok (08° 52.Byern & Marwoto et al.015‘ E). I. rounded and slightly constricted at their base. Museum für Naturkunde der Humboldt-Universität.5 ± 2. bilobated at the tip. 116° 43. short.52 mm in males and 16. The 18 right ventral arm is stout and thick. Jackson 1993. According to the description of Steenstrup (1881). collected November 2007 (unpubl. Jackson 1992. both ventral arms have only one sucker at their base.937‘ E). Idiosepius pygmaeus from Indonesia is similar in size (11.37 mm in females. North Queensland (19° 15´S. collected December 2007 (unpubl. 119° 42. Balikpappan (Grimpe 1931).020´S. pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe. 116° 42. while the left arm is thinner and slender. Pecl & Moltschaniwskyj 1997. 1995. Berlin.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19. collected December 2007 (unpubl.53 ± 1. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay.28 mm males and 15.12 mm females) to I. data) • Gili Lawang (08° 19. 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville.709‘ E). Semmens et al.26 ± 4.637‘ S. Lewis 1991. Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus. Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms. Institut für Systematische Zoologie. data) • Rinca Island (08° 39. one individual has 1/1. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm. 1931 Holotype: deposited at the Zoologisches Museum. 116° 30.

but this value needs verification. no data are available about its postembryonic life. data). I. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). southern Australia including Tasmania. relatively little is known about the biology and life cycles of Idiosepius. von Byern et al. 2005). I. DISCUSSION Systematics The relationships among species within this genus remain unknown. picteti (Joubin. Within the genus.5 mm. thailandicus Chotiyaputta et al. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. spawning. The fins are small and have a round to almost oval form. Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . and African waters. while the right arm is more stocky and broad with 2 suckers at the base. I. 2002). the males of 8. 1888). 1991. 1962. 1921. I. pygmaeus Steenstrup. Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss. 1845). pygmaeus). the onset of sexual maturity or postembryonic behaviour. Jackson 1992). I. 1962. notoides Berry.g. embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al. macrocheir Voss. and also has two lobes at its tip. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. I. Japan. Others like I. I. I. minimus (D‘Orbigny. the geographical distributions of all Idiosepius taxa are still only marginally explored. ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. All observations on this genus concerning behaviour. The females of this subspecies have a mean mantle length of 14.5 mm. biserialis and I.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri. 2003). paradoxus (Ortmann. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982). The left ventral arm is longer and bigger than the right arm. Presently. 1881 and I. paradoxus inhabit sea grass and algae areas. but individuals were also found in cooler Russian waters (Nesis et al. At its base the left arm has 3 suckers. biserialis has the widest geographical distribution. The species are mostly distributed in the tropical Indo-Pacific. For example. Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. unpubl. Moreover. 1894a).

the garbage in the water apparently does not affect I. biserialis in Africa. de L´Institut Royal des Sci. Sci. western and south-western shores of the Island. Our thanks go in particular to Mrs. Telong Elong and Ekas-Bay. REFERENCES Adam. 1921. The Philip. Additional genetic. pygmaeus could only be found in mangrove forests and belts. In contrast. I. On some days this flotsam covers almost the whole water surface. A. 2006. Gili Lawang. but are clearly absent in the northern. 1986. Naturelles de Belgique 56: 149-154. W. 2005. SS. Moreover. Cephalopoden von Ternate. 1898. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. So far. leaves and other plant material were transported here by the current. J. garbage. the animals were also observed to mate within this flotsam and escape under the waste when threatened. 47 (1): 39-55. ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. These observations agree well with other collections of I. indicating that this species is specialised for sea grass areas (von Byern et al. During high tide.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. Biology Department and furthermore to Mr. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. Lalu Japa & Karnan from Mataram University. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. Interestingly. individuals of the former I. Japan and Thailand. Lombok Island. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. Bull. Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. 1881 (Mollusca Cephalopoda Decapoda). Moreover. Cephalopods of the genera Sepiolidea. and Idiosepius. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. Sepiadarium. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. We still do not know whether the animals stay there at high tide or move elsewhere. . von Byern & Klepal 2009). Berry. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. Appellöf. pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). such as those along the eastern part of Lombok Island at Gili Sulat. von Byern & Klepal 2009).

J. Über die Cephalopoden der SundaExpedition Rensch. J. Center Res. Phuket Marine Biol. Bull. Tome Premier. & CFE. Jackson. Hylleberg. Mollusques vivants et fossiles. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles. W. P. 87: 265-272. von Byern 2008. 1931. Report on the Cephalopoda collected by H. G. Grimpe. Libraire F. 56: 1-9. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus. (Cephalopoda: Idiosepiidae). Fischer.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. 1992. with mention of additional morphological characters. 1993. 1881 (Cephalopoda: Idiosepiidae). and biometrics of the cephalopod Idiosepius biserialis Voss. Teuthologische Mitteilungen XIII. Zool. GD. N. Nateewathana 1991a. 55: 33-42.An annotated and illustrated catalogue of cephalopod species 21 . Idiosepidae. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. Morphology. 1988. Center Res. The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus.S.. GD. Naefidium n. 1887. 1962. Fish. Roper 2005. sp. Phuket Marine Biol. Klepal & J. Anzeiger 51: 208-214. Redescription of Idiosepius pygmaeus Steenstrup. Jackson. GD &J H. 1845. Teuthologische Mitteilungen IV. Bull. Hoyle. Jereb. Cephalopodes Familie XIII. Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss. 1962 (Mollusca. Jackson. Australia. Chaitiamvong 1991. Cyran. & A.. 1920. Fish. Nateewathana 1991b. Bull. G. Fishery Bulletin 91: 260-270. T.M. Choat 1992. Venus. & A. D‘Orbigny. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n.g. The Veliger 35 (4): 396-401. Challenger during the years 187376.J.Sci. 49: 218-228. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. Paris. WE. Cephalopoda). GD. Zoology 16: 1245. internal anatomy. Okutani & S. ACV. Can. 350-351. Grimpe. CH. The Jap. pro: Loligo picteti Joubin 1894.Challenger during the Years 1873-76. North Queensland. P.S. J. Malacology 50 (3): 165-174. Gide et Cie. Hylleberg. Report on the Scientific Results of the Voyage of H.M. 1886. Jackson. Zool. Savy Paris. A new record for the Andaman Sea. Cephalopods of the world . Growth in tropical cephalopods: An analysis based on statolith microstructure. Aquat. Anzeiger 95 (5/8): 149-174.

1894b. Food and Agriculture Organization of the United Nations. African J. MD. M. Mocambique. Okutani& Chaitiamvong. Behavior 85: 42-57. Moltschaniwskyj 1997. On an adhering habit of a pygmy cuttlefish. Nesis. for English Translation. 1991. London.S. Royal Soc. J.First record of Idiosepiidae in Russian seas. Revue Suisse de Zool. Alexander 1995. Idiosepius pygmaeus Steenstrup. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus. du Musèe d‘Historie Naturelle de Genéve 2: 23-64. 3: 459-460. 1888) (Cephalopoda) . J. Sci. Moynihan. Distinctive Behaviour of Thai pygmy Squid. ON. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae).: 178-180. Nesis. G. V. Ltd. 1959. 1888. Translated from Russian by B. 1921. Levitov.Byern & Marwoto known to date. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. Vol. 1: Chambered nautiluses and sepioids (Nautilidae. London.. K. Pecl. Ruthenica 12 (1): 81-84. Sasaki. A. Joubin. Zool. Publications. S. Australia. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. Hamburg. Jahr Verlag.A. et Ann. Sepiadariidae. Idiosepiidae and Spirulidae). M. a small tropical cephalopod. Zoo. 1st. 22 . Somatic growth processes: how are they altered in captivity ? Proc. Lewis. Revue Suisse de Zool. 1983. 4. Pecl. J.P. Idiosepius thailandicus Chotiyaputta. FAO species catalogue for fishery purpose. Cephalopods of the World. Joubin. Annotationes Zool. Ortmann. 1982. The zoogeographical composition of the intertidal fauna at Inhaca Island. 242: 751-764. L. 1998. Sepiidae. M. Moltschaniwskyj 1999. 1991. 266: 1133-1139. Ratnikov. Mémoires de la Société Zoologique de France 15: 80-145. Katugin & AV. 2002. Semmens. 1894a. AR.. 1-82. Phuket Marine Biological Center Special Publication 18 (1): 25-40. Céphalopodes d‘Amboine. Rome. N A. 1987 TFH. No. Copyright Agency of the UdSSR for Light and Food Industry Publishing House. Japanische Cephalopoden. 1902.Sci. Moscow. K. 2000. North Queens-land. L. Tintenfischfuehrer. Revision des Sepiolidae. & N A. L.. Inc. Joubin. Moltschaniwskyj & CG. Nabhitabhata. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. Japonenses 10 (21): 209-213. Sepiolidae. Jahrbücher 3: 639670. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. Norman. GT & N A.A. Kalk.

N. Africa 36 (4): 245-272. Occurrence of Idiosepius pygmaeus (Cephalopoda.Selsk. the Japan. S.. 75: 885897. Associate. MA. Thailand. J. K. Hist.S. Histochemical characterization of the adhesive organ of three Idiosepius spp. Observation of Idiosepius pygmaeus (Cephalopoda. Malacology 15 (5-8): 94-96. Biol. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea). Idiosepiidae) at Klong Bangrong. Nürnberger & S. Cyran & W. & W. Malacologica (in press). Biotech. 2007.Wien 108 B: 137-144. Steenstrup.Skrifter Raekke 6 (Bd.Mar. J. 2003. Yamamoto. U.New records for Idiosepius biserialis (Idiosepiidae. With remarks on the two related forms Sepioloidea d´Orb. South African cephalopods.UK. Shigeno 2005: Distribution pattern of a minimalist . 67: 49-51. 234: 1-180. 2009. J. von Byern. Cephalopoda): 38-43. SR. GL.. von Byern.. 1949. J. Mollusca). Nat. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. 1962.UK. Voss. Cephalopods of the Philippine Islands. species. Tracey. J. Ann.Cent. 83: 1297-1300. von Byern & J. Bull. and Spirula Lmk. Reevaluation of systematic characters of Idiosepius (Cephalopoda. Res. Bull. Memasukkan:Maret 2009 Diterima: Juli 2009 23 . L. Idiosepii-dae) in Indonesian waters. J.National Mus. Pecl. J. T. Klepal. Mar. Transaction of the Royal Soc. Klepal. 1881.Biol. Phuket Island. Voss.Assoc. Klepal 2008. Suwanmala. Sepiadarium and Idiosepius two new genera of the family of Sepia.. 2006. Nabhitabhata. 1): 211-242. Phuket Mar. & Histochemistry 83 (1): 29-46.Occurrence of Idiosepius (Mollusca: Cephalopoda) J.danske Vidensk. Mus. von Byern. Biol. von Byern. Rudoll. Steer & GT.. J. Venus. GL. 1963. J. of S. & W.

61 ± 0. mortality.38%) and October (14. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000.1 year for males and females combined.12%).67%) and May (20. and 2. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam. females. and 4.95 ± 0. 2001). rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska. recruitment.3.88mm and 70. Kata kunci: Kerang lumpur tropis. females. maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 . 1.26%). growth.56 ± 0. Keywords : Mudflat clam.31. (Anodonta edentula) in mangrove ecosystem were determined.Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan.77%). annual growth coefficient (K) of males. Subsequently. which indicated a fast growth of the clams in relatively short period. The peaks of males were in June (12. 2 years for the females. The objectives of this research were to study population parameters (growth.5 and 1.65. also males and females combined were 65. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis. (Anodontia edentula) in Mangrove Ecosystem.88%) and August (15. Overall. total mortality rate (Z) of the males. females. These high rates were caused by the extreme life condition. 4. also by the thin and fragile shells of the clams.43. Over a 12 months period (Januari 2005 – Desember 2005).63 mm. recruitment pattern and mortality) of this tropical mudflat clam.5 respectively. also males and females combined were 4. 2001).3 years for the males. females. kematian. there were two unequal pulses. and in the males and females combined were in March (12. also males and females combined were 1. 70. which were 2. while in the females were in April (16. and the size of males was less than females. pertumbuhan. Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al. Berbagai organisme mendiami ekosistem ini. dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001). The results showed that asymtotic length (L infinity) of males.58 mm. and also males and females combined. Recruitment occurred every month in the males. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria). population parameters of tropical mudflat clam.

yaitu musim Barat dan Timur. 2001. Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. . serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. Pengambilan contoh kerang lumpur Anodontia edentula. serta ditimbang berat basahnya menurut jenis kelamin. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1). mortalitas dan rekrutmen dari populasi kerang Anodontia edentula. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. Di Indonesia kerang ini belum mendapat perhatian.Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. dilakukan sebulan sekali selama 12 bulan. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. Lebata &Primavera 2001) Demikian pula di Thailand. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3.00 euro/kg. Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. Di Maluku. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula. Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm. Aktivitas ekploitasi yang berlebihan. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim. Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang.

Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur. dan jika panjang maksimum (L maks) = 0. dan b adalah sudut/ slope yang merupakan nilai Z. Lokasi penelitian 27 . Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: . Persamaan von Bertalanffy bila dijabarkan lebih lanjut. L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami. dimana K adalah koefisien pertumbuhan. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i.9957/K + to.39220. Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0. t adalah umur (atau umur relative.1.038 log10 K (Pauly 1980). yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang. “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i.2752 log10 L” -1.95(L”) dimasukkan ke dalam persamaan diatas.Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i. Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan.

28 .Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992). Kondisi pola pertumbuhan yang berlaku pada kerang jantan. Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0. Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0.0002x 2 R = 0.321 dengan nilai koefisien determinasi (R2) sebesar 0. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.9294. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa.00008 L 3. Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin. Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275.0001 L3. berlaku juga pada betinanya.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123.3134 (L = panjang dan W = berat).15.9327.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3). HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2).1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2.9658. Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0.9657 n = 2692 3.13. dengan nilai koefisien determinasi (R2) sebesar 0.0002 L3.

70. sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan.38.88 mm dan 70. dengan menggunakan program FiSAT.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128. 29 . Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0. Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam.288 R2 = 0.63 mm. Analisis distribusi sebaran cangkang selama periode penelitian. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3.3.9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65.3213 R2 = 0. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan.5 per tahun. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3.9327 n = 1192 Gambar 4. betina dan total masing masing 1.58 mm dengan koefisien pertumbuhan (K) dari jantan. (Gambar 4). memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula.5 dan 1.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang. 1.

56±0. Dari hasil perhitungan t0 terhadap kerang jantan. maka dapat dibentuk dugaan kurva pertumbuhan. K dan L”.19–4. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.34 mm dan 67.00 bulan. Gambar kurva LCCC dari kerang jantan. Dari nilai-nilai K dan L” yang telah diperoleh di atas.61±0.70 mm. Rentan hidup (t max) dari jantan. betina dan total terlihat pada Gambar 7.0. dimana dapat dilihat pada Gambar 6.e-1. Kalkulasi laju mortalitas untuk jantan. dan total masing-masing 62. Jika ditinjau dari segi biologi.98.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam.4(t+0.3(t+0. betina dan total masing masing 2.3 tahun.5(t+0. betina dan total dari model yang terbentuk.096) ] Betina : Lt = 70. dengan memasukkan formula Log10(-to) = -0.e-1. jantan. betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut.31.95±0.0% dan 99. maka didapat umur kerang terpanjang (life span) adalah t maks = 2. betina dan total masing-masing 99.9957/K + 30 to. betina dan total masingmasing diperoleh t0 = -0.61 X dengan r = -0. Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve.1 tahun. sedangkan untuk panjang maksimun jantan. 2 tahun dan 2. dan jika panjang maksimum (L maks) = 0. betina dan total masing-masing adalah 4. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan. Nilai mortalitas total didapat dari negatif slope. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol. 4. betina.081 tahun atau 0.087 tahun atau 1.081) ] Total : Lt = 70. LCCC yang dibuat dari kehilangan individu setiap kelas ukuran.2752 log10 L” 1.038 log10 K. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol).95 X dengan r = 0. umur to.88 [1 .6% per tahun. kerang betina dengan Y= 10. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment .58 [1 . Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65. 99.65 dan 4.41-4.97 bulan dan total . dengan demikian Z untuk jantan.99.95(L”) dimasukkan ke dalam persamaan di atas.35 mm.56 X dengan r = -0.3922-0.096 tahun atau 1.087) ] Dari beberapa parameter yang diperoleh. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm.e-1. maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan. 67.97. -0. dan kerang total dengan Y = 11. adalah Y= 10.15 bulan. Dengan memperhatikan umur maksimum. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu.63 [1 .43.33– 4.7%.

4 31 . Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan. tetapi ditemukan dalam tubuh induk kerang.88 mm dan K =1.5 c) Kurva pertumbuhan kerang total: L” = 71. Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya.Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam.Kurva pertumbuhan kerang jantan: L” = 65.0. Kurva pertumbuhan kerang A.28 mm dan K =1. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.3 b) Kurva pertumbuhan kerang betina: L” = 70.edentula hasil analisis menggunakan program FiSAT (ver.31) a). a) JANTAN b) BETINA c) TOTAL Gambar 5.63 m m dan K =1.

58 [1 . (a).e-1. Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0.12%) dan total gabungan pada bulan Maret (12.5 Wak tu (tahun) 2 2.081) ] 2 2.38%) dan Oktober. kecuali bulan Desember.5(t+0. Hasil olahan pola rekrutmen tergambar pada Gambar 8.88 [1 . selain itu terdapat interaksi biotik seperti predator. Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik.096) ] 2 2.5 1 1.5(t+0.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). Dugaan kurva pertumbuhan kerang Adonontia edentula. Pada kerang jantan. namun hal ini cukup berarti bagi kesinambungan populasi di alam. namun masih memungkinkan keberadaan status populasi kerang ini. persaingan dan tekanan lingkungan.67%) dan Mei (20.88%) dan Agustus (15.5 3 Betina: Lt = 70.63 [1 .5 3 Total : Lt = 70. pada betina pada bulan April (16.e-1.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0. Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 . betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen. yaitu 14.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama.087) ] Gambar 6.77%.3(t+0.26%).5 1 1. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65.e-1.5 1 1.5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0.

Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. (b) betina dan (c) total 33 . Pendugaan parameter b.Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. 2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif. Kurva konversi hasil tangkapan panjang (LCCC) kerang A. Pola pertumbuhan (b) (a) (c) Gambar 7. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama.edentula (a) jantan. koefisien hubungan panjang berat. begitupun jenis yang berbeda bisa mempunyai pola yang sama. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu. Penelitian dari Anodontia woodiana (Afanasjev et al. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya.

00 (a) (b) (c) Gambar 8.67 8.31 15.12 7.47 12.25 6.edentula (a) jantan.39 0. Persentase rekrutmen bulanan jantan.94 10.47 12.Yuliana Natan Tabel 1.88 11.27 16.77 8.19 1.26 18. (b) betina dan (c) total. betina dan total kerang A.45 12.35 6.67 10.39 15.52 2. Persentase rekrutmen kerang A.95 0.83 9.98 3. 34 .29 8.97 0.00 Total 2.16 7.45 0.38 7.95 8.47 14.00 Betina 1.22 9.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.64 20.92 10.29 2.12 13.

Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132. panjang infinity mencapai 93 mm. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70.3. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. Berbeda jenis berbeda pula panjang infinity (L”). dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. maka panjang infinity adalah 13. Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya. K = 0.67 cm. Koefisien pertumbuhan.58 mm). Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity.227 mencapai umur 10 tahun (Afanajev et al. K yang ditemukan perairan hutan mangrove desa Passo. Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh.18 mm dan K = 0. Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang. akan membedakan parameter populasinya. edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0. menunjukkan kecepatan tumbuh yang cepat.edentula sangat terbatas. Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Literatur serta informasi tentang kerang A.95.5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya. Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity. 2001).Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm. maka L” lebih kecil dari di Philipina. 2001). Jenis lainnya seperti kerang estuari di Philipina. K betina = 1.edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama. memerlukan waktu mencapai panjang asimtotik 10 tahun. Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi). Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1. Panjang infinity A.3 tahun mencapai panjang asimtotik 35 . sebesar 13 cm.34 per tahun menunjukkan pertumbuhan yang lama. dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi.5 dan K gabungan = 1. dugaan panjang infinity (L”) A.

tetapi bulan Desember pada Tabel 1 tidak kelihatan.3 tahun) dibandingkan dengan betina. Hal ini menunjukkan bahwa pada kondisi alami. Jika dilihat dari strategi hidup kerang. namun hal ini cukup berarti bagi kesinambungan populasi di alam. Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan. Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. Laju mortalitas total yang cukup tinggi. Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F).Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya. predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. dan gabungan jenis kelamin yaitu 2 tahun. terutama menghindari perubahan lingkungan yang ekstrim. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator. Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. yang sebenarnya ada penambahan individu baru. begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin. Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. selain itu terdapat interaksi . Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003).

11(42). 17: 299-312. dengan koefisien pertumbuhan (K) dari jantan.56±0. sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae).5 dan 1.88%) dan Agustus (15. pada betina pada bulan April (16.26%). B.1 tahun. dimana ukuran jantan lebih kecil dari betinanya. yaitu Afanasjev SA.43. 58 hal.67%) dan Mei (20. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang. 2001. persaingan dan tekanan lingkungan.63 mm. Oxygen. 1133-1138. Laju mortalitas total yang cukup tinggi. Kraszewski. Archives of Polish Fisheries. Anodontia edentula (Family Lucinidae).61±0.Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. 70. disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh.12%) dan total gabungan pada bulan Maret (12. 1. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14. 2001. Asian publ. 19(1).88 mm dan 70. Zdanowski & A.58 mm.131. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. 37 . Ambon. betina dan gabungan masing-masing adalah 65. Elemental Sulphur in the Gills of the Mangrove Mud Clam. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi). Latale SS. baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan. Fakultas Perikanan Universitas Pattimura. Pelecypoda: Psammobiidae) from the Beate Bay area. West Central Philippines.3. Pada kerang jantan.38%) dan Oktober.Sci. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama. Lebata MJHL. betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan.95±0. Shell Shellfish Res. 2004. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. J. Elsevier Science Ltd. Marine Pollution Bull.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2. Unionidae) in the Heated Konin Lakes System.65 dan 4. Del Norte-Campos AG.77%.. betina dan total masing-masing adalah 4. Bulan Mei adalah puncak rekrutmen tertinggi. 2003. Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia. 9(1): 123. 2000.31. Laju mortalitas total Z. tahun dan 2. untuk jantan. betina dan total masing masing 1. 4.3 tahun. Lebata MJHL. 241-245. 2.

Bull. Seong. KS.K.Yuliana Natan Lebata MJHL.Sivasothi. HDH. Turkey. Res. Ng PKL. T. 2001. 407 p. Ricker WE. Hugh. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam. Primavera. Board Can. TK. J. & HM. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . BC.Zool 27:339-343. 19:191-382.Ng & N.L. Animal diversity. Tan. T. Computation and interpretation of bological statistics of fish populations. Y. A Guide to mangrove of Singapore 1. (Desertasi). J. Shellfish Res. In P. Murphy. Sivasothi. Yassien. Introduction to tropical fish assesment. 2008. 1975. Tan. 2001 Gill Structure. N. Tan. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. FAO Fisheries Departement. Bogor 162 hal. 2003. Singapore Science Centre. Lim KKP. Sparre P. Fish. Muhammed SZ. Natan. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis. &SC. Sekolah Pascasarjana IPB. Rome. W. Morgani. Venema 1992. 2003 (Eds). 20(3):1273-1278.

Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. Dari berbagai penelitian (Morton 1987. The research aimed at evaluating the effect of salinity. Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit. The highest concentration factor of Cd (31.80 Bq/gr Cd. Cd.2354. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS). radiotracer Cd. At the steady state condition green mussel accumulated 72. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 . Blackmore & Wang.80 Bq/gr. whereas the bigger size of Perna viridis (6. Perna viridis Kata kunci : Bioakumulasi. Pekanbaru. Perunut radioaktif. Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya. panas pada bagian dada. penyakit paru-paru akut dan menimbulkan kematian.09) was appeared in water salinity of 29% and of water temperature 30oC. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase. 2002) dinyatakan bahwa kenaikan suhu.6 cm in length) had an uptake of about 72. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau.001) on accumulation rate of 109Cd. Radiotracer 109Cd was applied in the study. tertinggi termasuk manusia.21 Bq/gr.21-107.2 cm in length) accumulated 109Cd about 107. Pada gilirannya pada rantai makanan. Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer. It was found that both salinity and temperature had significant effect ( P< 0. Key words : Bioaccumulation. It revealed that the small Perna viridis (5.

dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. 210 Pb dan sebagainya).5 dan 6. sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu. Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda. sesuai kombinasi taraf perlakuannya.2. dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial. Organisme dipisahkan menurut kelompok ukuran (5. Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a). Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia. Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium. Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra. Untuk menghilangkan stress. Secara periodik (dua hari sekali). 5.46 Bq/ml) yaitu dengan meneteskan 7. dihitung mengikuti Connell & Miller (1995). Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut. dua kali sehari. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd.6 ml ke setiap aquarium. Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1. konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). S1T2 (salinitas 29o/oo dengan suhu 30oC). Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut. hewan uji diaklimitasikan selama seminggu di laboratorium. Media uji air laut diganti setiap hari. BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. dan diberi pakan Chlorella sp. Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional.Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas. Data yang .6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC). Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC).

74 12.08 47.23-54.19 36.73 39.60 3.0.09 ± 41.62 52.5 cm 6.89 3.16 72.09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.93 59. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.45 35.60 59.29 17.94 30.37 ± 20.21 80.91 2.20 27. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).84 (Tabel 1a dan 1b).81 73.84 61. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.5 cm 6. Model tersebut merupakan permodelan saturasi.65 36.90 34.61 59.33 14.35 41.54 15.27 44.80 90.50 28.87 19.27 ± 31.52 24.30 ± 4. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.99 37.77 28.44 51. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.90 79.23 ± 41.6 cm 30.12.42 70.46 55.25 22.23 40.37 4.62 29.24 30.46-73.61 11.83 54.00 51.80 Bq/gr dan 49. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.70 ± 34.07 47.70 70. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.75 49.12 30.48 39. FKss (faktor konsentrasi steady state) 41 .65 23.23 107.21-107.2 cm 5.01 Keterangan : Css (konsentrasi steady statei).36 21.02 43.65 20.75 70.2 cm 5.60 32.31 53.33 53.50 51. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.89 4.64 19.33 13.78 28.41 25.98 49.14 21.72 45.51 52.77 28.41 54.12 47.08 47.6 cm 5.

6 cm 2 25.82 45.2 cm 5.42 17.54 33.55 16.06 1. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.80 17. 42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.72 37.61 29. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.6 cm Gambar 1.74 14 60.71 19.46 35.45 18.46 36.7137x + 8.6044x + 5.26 10 44.38 49.08 8 41.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.2 cm 5.0667 R = 0.46 30.25 13. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.59 54.00 12 57.41 14.41 10. FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.01).10 Css FKss 63.6 cm 5.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.6044x + 5.43 ± 21.2 cm 5.32 10.81 33.2 cm 5.66 24.7137x + 8.6 cm ♦=5.46 6 38.97 16.35 14.99 4 35.99 ± 19.33 16.88 20.2673x + 11. Pada Gambar 6.5 cm ▲=6.18 36.21 ± 36.26 3.97 16.9951) .86 13.0667 R2 = 0.89 37.85 ± 15.20 ± E 4.01 15.5 cm 6.2 cm 31o/oo) di suhu dan ukuran yang sama (5.9462 y = 1.09 (Gambar 5).03 25.58 30.76 19.6 cm 5.81 22.2 cm dan 30oC) pada Tabel 1b.8014 R2 = 0.38 20.99 1.9423 B y = 2.10 23.72 18 60.761 R = 0.8014 R2 = 0.26 21.06 42.70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.9176 5.68 24.62 Keterangan: Css (konsentrasi steady statei).2673x + 11.34 92.44 49.84 78.09 24.71 20.80 51.80 51.21 75. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata.49 51.69 24.67 Mean±S 47.98 11.5 cm 6. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.64 35.91 16 60.9462 y = 1.10 49.5 cm 6.Yusni Ikhwan Siregar Tabel 1b.37 3.47 25.51 54. nilai koefisien determinasi untuk salinitas 29o/oo (0.84 ± 34.92 7.33 19. ■= 5.56 4.761 R2 = 0.5 cm 6.22 21.

6 cm ♦=5.2 cm 5.5 cm 6.5 cm ▲=6. Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5. ■= 5.9685 y = 1. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas.9433 y = 1. (Gambar 8).9 R2 = 0.9734 2 4 6 8 5.4495x + 16.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0. Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.9951.6 cm Gambar 2.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2.9668 y = 2.2052x + 8. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0. 43 .9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.6 cm Waktu Kontak (hari) 5.8171x + 23.2 cm 10 5.968).5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.6 cm ♦=5.0943x + 10.773 R2 = 0.2494 R2 = 0.01). Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.2 cm 5.2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.66x + 7.9539 B y = 2. terlihat pada Gambar 7. ■= 5.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.529 2 R = 0.5 cm 6. Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0.29 R2 = 0.2 cm 5. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.6186x + 27.6 cm Gambar 3.5 cm ▲=6.7667 2 R = 0.5 cm 6.9764 y = 2.2 cm dan 29o/oo) pada Tabel 1a dan 1b.

9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.5 cm 6.2 c m 5 .968 A B Gambar 6. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).5 c m 6 .2 cm 5. oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11. 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 . Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.057 2 R = 0.2 cm 5.5 cm 6.6 c m B Gambar 5.7x + 53.43x + 65.523 R 2 = 0. 44 .6 cm 10 0 0 5 5.Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC.6 cm 10 15 20 Waktu Kontak (hari) Gambar 4.

konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.20-34. Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15.09 kali dalam durasi kontak 14 sampai dengan 16 hari.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 .2 c m 5 . Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19. Sedangkan pada suhu 28oC.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo.30-41.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo.5 c m 6 .23 sampai dengan 54.51 Bq/gr (Tabel 1b).43 dimana nilai konsentrasi steady statenya berkisar 30. 2000). Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo. Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang. 109 45 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.10-75.21 dan 20. kerang hijau mampu mengakumulasi 109Cd 31. faktor konsentrasi steady state di salinitas 29o/oo 1.84-47. Pada kondisi tersebut.01).23 10.35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9).6 c m B Gambar 7. Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0.70.

pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4. Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut. Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup.9 7 9 1 A B R 2 = 0 .4 3 x + 1 9 .23 .01).2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0. Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.5.70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54. Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5. Model tersebut merupakan model saturasi.24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar.3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 .9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8.Yusni Ikhwan Siregar Cd 60 y = 1 1 . .3 1 R 2 = 0 . umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3.6 8 5 x + 7 . Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B). Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata.09 (Gambar 5). Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi. pertumbuhan dan metabolisme fisiologi dari organisme laut.

2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = .4 7 9 x + 6 0 .5 dan 6.0 8 8 x + 4 8 .8 1 9 1 y = . Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1). 5. S1T1 (2).5 5 R 2 = 0 .8 8 6 8 y = .9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.7 6 3 x + 3 3 . Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis.4 . 47 .6 c m Gambar 9. dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998). Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.2. Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.01).23 + 3. 109 Cd oleh Mengacu pada Gambar 6. nilai koefisien determinasi untuk salinitas 29o/ (0. S2T2 (3) dan S2T1 (4).5 3 2 R = 0 .Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 .9 9 7 2 109 Faktor Konsentrasi rata-rata 5 .8 4 R 2 = 0 .96X). Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.6 . Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0. Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7).968). Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu.5 c m 6 .6 . Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5.6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a.

pertama pertukaran ion di mana ion monovalent dan divalent seperti Na. Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. Proses bioabsorpsi ini bersifat bolak baik dan cepat. Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. 1984). Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass. thiol. dan hydroxy-carboxyl yang berada pada dinding sel. bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt. Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam. hydroxy. Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut. (1984).Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl. 48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut. Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987). Mg. Logam berat dapat juga diendapkan pada proses metabolisme dan . amino.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya.01). Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). Kemudian Sivalingam dalam Coeroli et al.23 10. phosphate. dan Ca pada dinding sel digantikan oleh ion-ion logam berat.

S. Simpson. dibandingkan dengan kerang hijau yang berukuran besar. BS. D. Water Treatment with Algae Springer-Verlag and Landes Bioscience. 1998). Aquaculture 162:187-202. “ Kimia dan Ekotoksikologi Pencema- ran. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut.. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. ZA. Aquaculture 39:45-67. Guru Besar Tetap Ilmu Kimia Lingkungan. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut.) in Edaiyur backwaters. Aquaculture 40:47-55. Jenner. & AH. Connel. 13pp. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities. YST Wong & CG. Miller. Fakultas Matematika dan IPA IPB. 518 hal. Removal of Copper by Free and Immobilized Microalgae. Amer. Serpong September 2004. V. Jakarta. Landret. Bogor Suseno. JP. HA. VP. InterPopulation Differences in Cd. 17 Rajagopal. suhu. M. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. in a sea water circulating system. Reproduction. Recent innovations in cultivation of molluscs in French Polynesia. van der Velde. Terjemahan Yanti Koestoer. Biokinetics of Cadmium in Indonesia’s Green Mussel. A. P2PLR BATAN. Venugopalan. 1987. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus.). 1995. MS. 1998. Morton. Gaillande. Se. salinitas dan lain-lain (Nora et al. Parulekar. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Coeroli. steady state. KVK. Seminar Nasional Teknologi Limbah. Perna viridis L. 1984. DAFTAR PUSTAKA Blackmore. in: in YukShan & Tam (eds. The Hong Kong University of Science and Technology. Hong Kong. Proceeding of one day seminar Development Radioecology and 49 . Wang. Cr.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. 2002. Malac. DW. Perna viridis (L. Ansari. 5(2):159-164. den Harog. Nair. Saeni. 2004a. Bull. 1984. 1997. Orasi Ilmiah.. H. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. Nora FY. —— 2004b. & GJ. Growth of the green mussel. growth rate and culture potential of the green mussel. Perna viridis: Influences of Body Size. G. Chatterji. & C. 1758) (Bivalvia: Mytilacea). UI press.. Ingole. Chlorella vulgaris.1998. east coast of India. B. &WX. p.

137:567-575. & RCH. Wang. Prog. Prog. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. Dei . Memasukkan: Maret 2009 Diterima: Juli 2009 50 . Hotel Sahid Jaya Jakarta. WX. Wang. 186:161-172. Ser. WX. Ecol. Ser. Mar.Yusni Ikhwan Siregar Marine Environment in Indonesia. 2000. Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus. 1999. Ecol. Mar.

62 μm. larvae. The result showed that optimal temperature and salinity on P.88 x 69. respon. than would be decreased when temperature and salinity increased.57 x 18.95 C g wet weight-1 hour-1 (24. The highest of energy budged for routine metabolism at treatment BF. and also prerequisite for individual growth and survival. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”. Sanusi2 1 Jur. Stages III: 4.75 – 87.07– 19. Dedi Soedharma2.85). Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995). Perikanan dan Ilmu Kelautan IPB.78 x 17. Sain dan Teknik UNSOED.58 J g wet weight-1 hour-1). sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006).72 – 77. metabolism. E-mail: tjwinanto@yahoo. The quickest time of plantigrade stages have found by treatment BF (day 19.05) with BE.73 – 7. Fak. larvae. physiology. in different levels of temperature and salinity. The best of relative growth length of larvae by treatment BF and not significant (P e” 0.26 %.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson).50) and hasn’t significant (P > 0. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF). PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al.39 % and stage III: 76.90 J g wet weight-1 hour-1). fisiology. Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia. Kata kunci: Pinctada maxima. Stage I: energy budged between 6.05) with BE.74 J g wet weight-1 hour-1). The research was used randomized block design.18 – 30. 1997). stage I: survival rate between 87. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. 51 . Fak. and to know the levels of optimum temperature and salinity. 2 Departemen Ilmu dan Teknologi Kelautan. Stage II: 81.93 μm – 30. response. at stage I: 29. but has not higher significant (P e” 0.91 – 82. Keywords: Pinctada maxima. The highest survival rate of larvae was by treatment BF.80 C g wet weight-1 hour-1 (15. metabolisme.Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗.32 x 69.05) with BE (day 20. Stages II: 5. stage II: 57. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan. Perikanan dan Ilmu Kelautan.92 %. Di pasaran internasional.73 – 4.43 μm (AP x DV).85 – 5. with three replications.48 – 24. Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal.35 C g wet weight-1 hour-1 (28.62 x 46. & Harpasis S. Ridwan Affandi3.13 x 47.29 μm – 80.33 μm and stage III: 80. The aim of this study is to obtained information on energy budget on routine metabolism.73 μm – 58.

harga spat dari hatchery kira-kira $US 0. Menurut Gricourth et al. Selama pemeliharaan larva di dalam lab. Inokulum yang digunakan berasal dari biakan murni skala lab. Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas. keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan. perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol. sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. Di Australia. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4. Suplai spat merupakan bagian yang krusial dari industri ini. Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. dengan harga sekitar Rp 2.1 – 0. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif. diperlukan kondisi lingkungan yang optimum dan terkendali. kemudian diperbanyak hingga mencapai kepadatan . salinitas. Soedharma. Asha & Muthiah 2005. Selama proses produksi spat skala besar di hatchery.A. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal. 2007). representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al. Martinez-Fernandez et al. Rose data tidak dipublikasikan. Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. Affandi & Sanusi Saat ini.14 per mm panjang engsel (R. 2004). dalam Taylor et al. serta dapat diketahui tingkat suhu dan salinitas optimum. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. jika semata-mata hanya menggantungkan pengumpulan spat dari alam. dan konsumsi energi oleh metabolisme internal (Crisp 1984. seperti untuk pertumbuhan. sangat diperlukan informasi tentang pengaruh suhu. karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim.Winanto. 1997).000 ekor. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda.000 per cm. Jika hasilnya positif.143. Dame 1996). yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994). sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi. konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005.

Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al. Pengukuran suhu dila kukan dengan menggunakan termometer Hg. kapas sintetik dan ultra violet. Berdasarkan pada stadia perkembangan larva. Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva. (E) 32 ‰. yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. (B) 28 oC. Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. Untuk mengetahui laju metabolisme rutine larva 53 . yaitu berupa satu unit peralatan yang terdiri dari empat botol. untuk meningkatkan suhu air digunakan alat pemana s. Oksigen terlarut diukur dengan alat DO meter (YSI 550A. maxima stadia bentuk-D (D1). dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001). sampel disaring dan ditampung menggunakan planktonet. Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. yaitu (I) suhu. maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. dipelihara di dalam wadah percobaan ember plastik volume 20 liter. Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. 10 dan 5 mikron). sedangkan salinitas diukur dengan refraktometer (Atago. (F) 34 ‰. 2001. Hewan uji berupa larva P. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). Larva diperoleh dari hasil pemijahan Induk P. Larva diberi pakan I. tipe 03J0820 AJ). Disain percobaan untuk mengetahui laju konsumsi oksigen. Winanto 2004). karena salinitas air di lokasi penelitian e” 34 ‰. 2002). galbana dan P. maka percobaan dikelompokkan menjadi tiga. (II) salinitas. Jepang). 2001. botol C untuk mengukur laju konsumsi oksigen. Perlakuan yang digunakan terdiri dari 2 faktor. Untuk mengetahui berat larva. Winanto 2004). dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3). Botol A untuk stok air yang dijenuhkan. Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. catrage (15. kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. botol B sebagai wadah hewan uji. Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan.0001 gr). dan (C) 30 oC.

maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml. Waktu pertama kali teridentifikasi stadia plantigrade. Gambar 1. 1997) dilakukan dengan menggunakan mikrometer okuler. 1 mlO2 = 19. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel. Data-data dengan dua variable seperti laju metabolisme dan berat larva. Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade.Winanto. 1990). Pengambilan sampel dilakukan setiap jam sebanyak 10 ml.7 mlO2 (Jeong & Cho 2007). Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004). Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P. Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al. Soedharma. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. Pengamatan dimulai dari hari ke 18. 54 . maxima. Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan. Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993). selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali.9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. 1 mgO2 = 0. Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC.

pada stadia II meningkat menjadi 51. 55 . Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0.05) dengan salinitas 34 ‰ (F).804x – 625. Stadia II : Y = -0. salinitas 30 ‰ (AD).02x – 1532. tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰). Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1. Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu.10 (R2 = 0.18 (R2 = 0.5821x2 + 38. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen. maxima tertinggi terjadi pada perlakuan suhu 28 oC.27 %.03x – 1431. Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C. Seda ngkan pa da stadia I dan III korelasinya kurang kuat. dan pada stadia III efek suhu meningkat menjadi 82. pengaruh salinitas terhadap laju metabolisme sekitar 48.8227).7946x2 + 102. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0.4855). pengaruh suhu terhadap laju metabolisme mencapai 82. Stadia III: Y = -1.83 %.80 (R2 = 0.8283).9387x2 + 110.5137). Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2. Pada stadia I.16 mgO 2 /g berat basah/jam (BF) dan terendah 1.05). salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC.8227. Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1).05) antar perlakuan suhu dan salinitas. dengan koefisien determinasi (R2) pada stadia I sekitar 0.64 (R2 = 0. stadia II: 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P. pada stadia II menurun sampai 79. Stadia II : Y = -1. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0.09 mgO2/g berat basah/jam (AD). salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C.5137).187x – 1337. salinitas 30 ‰ (AD) (Tabel 2). Pada stadia I.42 %). 7963 dan stadia III: 0.483x – 411.7001x2 + 96. Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata.70 (R2 = 0.37 % dan pada stadia III kembali menurun (49. Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0. (Gambar 2).7963).8283. menunjukkan adanya korelasi yang kuat.63 %.3706x2 + 25. Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0.55 %.

Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.03d 1.03f 0.1337.04a 1.03c 1.Winanto.04e Salinitas (‰) (E) 32 1.02x . II.74 ± 0.03x .03a 1.12 ± 0.8227 y = -1.187x . Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.03b 1.1532. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.03d 1.10 ± 0.02f (F) 34 1.7001x 2 + 96. maxima stadia I.05e 0. III Tabel 1.8 R2 = 0.34 ± 0.03b 1. 56 .75 ± 0.41 ± 0.04f 0.9387x 2 + 110.73 ± 0.8283 Suhu (oC) Gambar 2.03f 1.03c 1.15 ± 0. Soedharma.32 ± 0.03d 1.29 ± 0.14 ± 0.03b 1.03d 1.03e 0.03b 2.1431.03b 1.31 ± 0.7 R2 = 0.03d 1.03c 0.72 ± 0.09 ± 0.79 ± 0.16 ± 0.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.7946x 2 + 102.98 ± 0.08 ± 0.75 ± 0.16 ± 0.29 ± 0.04f 1. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.03b 1.76 ± 0.34 ± 0.39 ± 0.65 ± 0.03a 1.1 R2 = 0.30 ± 0.7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1.08d 1.77 ± 0.

856.5821x + 38. maxima. Stadia III : Y = -0.25x + 29.3706x 2 + 25.5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0. Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P.4942).17 R2 = 0. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P. maxima.483x .4855 y = -0.023x . baik untuk aktivitas maupun perkembangan larva P. maxima stadia I.023x – 795.7394x2 + 49.243 (R2 = 0. maxima dipengaruhi oleh suhu dan 57 .856).4942 31 32 Salinitas (‰) 33 34 35 Gambar 3.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4). Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan. stadia II dan stadia III Gambar 4.7394x 2 + 49.804x .64 R2 = 0.411. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III).18 2 R = 0. Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0. jadi berat (85.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0. Persamaan yang diperoleh adalah Y = -295.795.625.17 (R2 = 0.

40d 15.05) dari E dan F.41 ± 0. J (D) 30 3.51f 2.16 15.12 ± 0. C (B) 28.86 ±0. C (C) 30.14 4.37d 24.12 5. C (B) 28.11 10. C (C) 30.60 ± 0. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P.68 ± 0. baik pada analisis varian maupun uji Tukey (Gambar 5). J (C) 30.80 ± 0.15 ± 0.12 7.45b 24.50c 18.52 ± 0. J (C) 30.09 ± 2. salinitas 34 ‰ (87.14 3.32 ± 0.60 ± 0.42b 19.08 2. J (C) 30.07 ± 0.62 ± 0. Pada stadia II dan III.60a 15.45 ± 0. Soedharma.92 %) dan terendah pada suhu 26 oC.04 ± 0.37c 11.84 ± 0. salinitas 30 ‰ (32. salinitas dan tahap stadia.02 ± 0.43d 18.50 ± 0. C (Calorie).07 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26.09 4.75 ± 0.12d 24.30 ± 0.64 ± 0. C (A) 26.55 ± 0.83 ± 0.45a 23.27 5.09 5.44d 18. J Stadia II (A) 26. C (B) 28. sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.09 18.05) antar perlakuan suhu.32 ± 0. sintasan tertinggi terjadi pada perlakuan suhu 28 o C.14 18. J (B) 28. C (A) 26.05) dengan 32 ‰ (E). J (B) 28.07 10.07 ± 0.88 ± 0.25 ± 0. Affandi & Sanusi Tabel 2.37c 16.74 ± 0.10 10.39 ± 0.58 ± 0.11 5.12 4. salinitas.03 ± 0.10 3.45 ± 0.36 ± 0.12 15.09 15.10 4.02 ± 0. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 .68e 2.47 %).10 4.90 ± 0.57e Salinitas (‰) (E) 32 4.62 ± 0.10 6.01±0. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.37b 24.39f 2. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0. C (A) 26. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas. Pada stadia I.09 3.13±0.53±1. Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0.83 ± 0.70 ± 0.26±0.69 4.29f (F) 34 4.39f 3. J (Joule).41 ± 0.05) antar perlakuan suhu.45b 30.69±0.14 ± 0.38 ± 0.43b 27.09 5.36b 19. C (C) 30. J Stadia III (A) 26.Winanto.67 ± 0.43d 16. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan.73 ± 0.10 3.59f 3.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.05).40±0.90a 18.48 ± 0.46e 1. sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3).10 4. J (B) 28.31 ± 0. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0.58 ± 0.20 ± 0.

17 ± 0.04f 22.67 ± 1.46 ± 0.98 ±0. Pertumbuhan panjang relatif larva stadia I (D1–D6).64d 69.61 ± 0. Sintasan (%) larva P.73b 82.09d 71. & F= salinitas 30. E.17 ± 1. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18.04c 54.60 ± 0.79 ± 1. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.20 ± 1.23 ± 0.29b 87. Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.77f (F) 34 43.71 ±1.71d 70.75d 61. B & C =suhu 26o .28d 72.75 ± 1.86d 60. 28o dan 30o C.80b 77.82a 59. PEMBAHASAN Konsumsi oksigen larva P.17a 61.62c 48.26 ± 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3. laju konsumsi oksigen dan laju metabolisme. pertumbuhan.09 ± 0. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 .88b 76.95 ±0.91f 32.27b 81.19c 48. D.33 ± 0.67 ± 0.75f 32.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.34 ± 0. stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.91 ± 0.02 ± 1.03b 87.76e 10.39 ± 0.91a 64.72 ± 0.80 ± 1.60f 22.39 ± 0. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas.83e Salinitas (‰) (E) 32 43.17 ± 1.93 hari) (Gambar 6).41 ± 0.92 ±1.81e 21.

bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda. 1983). Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan.5 – 5 mlO2/jam/g berat kering. Lebih lanjut Bayne (1983) menyampaikan. Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif. tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi.0. Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. berat badan dan tingkat aktivitas. Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0. Diduga.80. Jika dihitung per unit berat badan. kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat. Affandi & Sanusi 2.Winanto. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. semakin berkembang tahapan stadia larva baik panjang maupun berat.856). hingga mencapai batas optimum (28 oC. Hasil korelasi menunjukkan kecenderungan linear positif. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling.5 sampai 10 mlO2/jam/g berat kering. 34 ‰). Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2. 1949 dalam Bayne.75–3 ml O2/jam/g berat kering (Zeuthen.7 dan > 1. Dari hasil analisis dapat diinterpretasikan. variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda.70 sampai > 1. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat.00. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983). maka laju konsumsi oksigen semakin menurun. Laju konsumsi oksigen pada larva Mytilus edulis antara 0. gamet dan larva yang berada pada satu seri penelitian. maka . Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air. disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0. 1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis. 2004). 32 ‰. Soedharma. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan. Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian.

1997). merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi. Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Seba gai salah satu indika tor. Lama waktu (hari) pencapaian stadia plantigrade larva P. 61 . Diduga pada kondisi laju konsumsi oksigen tinggi. peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan. maxima pada berbagai tingkat suhu dan salinitas. fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983). Pada P. Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7. Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. 2005).

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas.74 – 5.Winanto. maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE.53 – 30. salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC.83 C/g berat basah/jam (24.39 J/g berat basah/jam) dan pada stadia III antara 4. beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994). dalam O’Connor and Lawler (2004) jumlah larva P. Bayne 1965. Penelitian Yukihira et al. BF).62 – 4. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC. imbricata (Roding) dipengaruhi oleh suhu dan salinitas. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil. dalam Ala garswa mi et al. Pada suhu optimum aktivitas metabolisme berjalan maksimum. Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. margaritifera antara 23–28 oC. Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P. Australia mencatat bahwa kisaran suhu optimum pa da P. Menurut O’Connor. 1983). salinitas 32 ‰ (BE). Pada stadia I pembelanjaan energi mencapai 6. sehingga larva berkembang dengan baik. KESIMPULAN Suhu dan salinitas optimum untuk larva P. tetapi pada suhu kurang pengaruhnya. Soedharma. per sonal observasi.02 – 24. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. apalagi jika salinitas turun sampai kurang dari 29 ‰. Stadia II antara 5.13 J/g berat basah/jam).20 C/g berat basah/jam (27. Pada kisaran salinitas 29–35 ‰. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. Disamping adanya variable lain. maxima dan P. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas. Quensland Utara. Berkaitan 66 dengan kompetensi larva untuk menempel. imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. 1983).67 C/g . (2000) di dalam laguna Great Barrier Reef. diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar.58 – 7. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa.

Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel. B.91 – 82. 287-301. salinitas 34 ‰ (BF. (BE.88 x 69. 67 . _____ 2002. IPB. Elsivier Science Publisher.62 µm. 29: 4-6. Asha. UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut. Velayudhan. Pengolahan dan Pemasaran Hasil Perikanan. Anna . 2006. Petunjuk Teknis (VII): 106 hal.13x7.75 – 87. Rahardjo &. Amsterdam. Aquaculture 250: 823-829. Pembenihan Tiram Mutiara (Pinctada maxima). Sjafei.72 – 77.32– 19. 2001. Wild versus hatcheryreared larvae.58 J/g berat basah/jam).43 µm. Mengenal Mutiara. 2005.33 µm dan stadia III antara 80.73 µm – 58. Dharmaraj. Perhiasan Para Bangsawan. Aquaculture 3. DAFTAR PUSTAKA Affandi R. 19. Effects of Temperature. serta C. Balai Budidaya Laut Lampung. Baker. AC. J. Ditjen.29 µm – 80. Mina Mitra Usaha. Petunjuk Teknis (6): 61 hal. P.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. Pada stadia I sintasan antara 87. PS & P.55 hari). J. Muthiah.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49. Alfaro. Crassostrea virginica. Gandhi.62 x 46. Chellam. atas bantuan yang diberikan selama penelitian. 1994. Salinity and pH on Larval Growth. Competency to Settle in Oyster Larva e. Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC. S.80 µm–34. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould). Ed. Perna canaliculus. Bogor Alagarswami K. Pengaruh suhu (81. Survival and Development of Sea cucumber Holothuria spinifera Theel. J. DS. Warta Pasar Ikan.28 x 21. Stadia II antara 81. ACC Victor & AD.26 %.39 % dan stadia III antara 76. 2005. Pebruari. Aquaculture 246: 285-294. 1983. Sulistiono 2005.V. MF. Kultur Pakan Hidup. Balai Budidaya Laut.92 %. 18. Managemen Sumberdaya Perairan. Dep. Balai Budidaya Laut Lampung. A. Pada stadia I pertumbuhan relatif mencapai 33.32x 69. Aquaculture 122: 161-169. V.. No. FPIK..DKP.93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰. TS. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata. Fisiologi Ikan.90 x 20.78 %). Stadia II antara 57. Pencernaan dan Penyerapan Makanan. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE.

Garcia-Esquivel. Blackwell Sc. Farming Jewels. In: Feed Mana gement in Intensive Aquaculture. 1974. Boca Raton. Thallasia Jugosl.. Coastal Aquaculture 2: 627-632. Bayne. Temperature and Water Quality. In: Holme. Connecticut. BL.S. Crisp.. Methods for the Study of Marine Benthos. An Ecosystem Approch. Verdonk. Gosling. Gricourt.. Saleuddin and K. RF. Feeding. 1983. Neter. Biggeleer. Gilles. Fishing News Book. Part I. Physiological ecology of marine molluscan larvae. US. Energy Equivalent of Oxygen Consumption in Animal Energetics. An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. Loosanof. Wesseran. Mildford. W. CRC Press. Chacon. 284372. R. 254 pp. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). Physiology. Aquaculture 251: 85-98. New Developments in Pearl Farming. 13: 581-604. 1975. In: Tompa. M. A. Goddard. JAMV. 2003. J. & W.Winanto. 1851) Larvae. DJ. Energy Relation of Marine Invertebra te Larvae. 1995. 1963.. New York. Beureu of Commercial Fisheries Biological Laboratory. E.D.. 4: 51-73. 130p. C. Farias. DJ. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. 2004. 10: 103-120. R. Oxford.M. Maintenance of Cell Volume. NH. Mcintyre. Davidson. L. Ecology and Culture. John Wiley & Sons. Biology. The Mollusca. Martinez-Fernandez. Aquaculture 230: 417-423. World Aquaculture 29 (3): 5-10. Symp.. 1983. V & H. JM. Proc. In: Gilles. Applied Linear Statistikcal 68 . (Eds). Mathieu & K. Jeuniaux. & CH. AS. Publ. CR. 1979. Dame. Crisp. Elliot. Wilbur (Editors). Energy flow measurements. E. H. N. 1983. Osmoregulation and Ecology in Media of Fluctuating Salinity.. 1984. Affandi & Sanusi Bayne. Vazques & Z. 2006. Davis. Soedharma.M. S. Great Britain. MT. Viana. Mechanism of Osmoregulation in Animals. Ecology of Marine Bivalves. J. 2004. Kellner. 1996. Dharmaraj. Academic Press. Development 3(8): 299-336.A. O. Kutsner 1990. AcostaSalmon. Bivalve Molluscs. Rearing of Bivalve Mollusks. 1996. C. BL & RC. The Mollusca IV. & MH. In: A. Physiological Energetics of Marine Molluscs. 22(1): 415-421. Fassler. Newell. Shellfish Rese. A. S. J. New York. Rangel-Davalos. Oecologia 19: 195-201. Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics.

Prinsip dan Prosedur Statistika. J. Marine Ecology.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models. Bandung. Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster. Reis F ilho. G. J. In.. Andi Offset. J.J. Biokimia: Metabolisme Energi. Mechanism of Osmoregulation in Animals. Ecol. 138 hal. Contoh Kasus dan Pemecahannya. 3 rd Edition. 1980. Aquaculture 270: 464474. Klumpp. 748 hal. Taylor. M. Regression. Lucas & DW. J. Biol. Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil. (Ed). Vernberg. Brasil. R (ed). Metabolicenvironmental interaction in the marine plankton. Ser. J. Karbohidrat dan Lipid. Vernberg. KS. Exp. W. 2004. WB. Japan. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture. 1994. JJ. Growth and energy balance during the larva lives of three prosobranch gastropods. WB & SU. Sulaiman. Aquaculture 153: 31-40. Taylor.M. 1993.. Toppan Copany. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. K.. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . Yogyakarta. Laitano & RW. Wirahadikusumah. 44: 1-28. 2000. 2004. Suatu Pendekatan Biometrik. 11:537-554. CRC Press. ES. 1997. RGD & JH. New York. Merino & E. 2007.. LTD. Maintenance of Cell Volume. AC & J. WA & NF. 1972. pp: 189196. 252: 208-224. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures. Aquaculture. 1970. JS. 5th. Margaritifera. Analisis REGRESI Menggunakan SPSS. Biomonitoring of coastal waters and estuaries. respon in different ways to culture in similar environments. H. J. Silverthorn. Southgate & CE. Von Brand.. Pechenik. Pinctada maxima and P. Jakarta.. Prog. Aquaculture 270: 451-463. Analysis of Variance and Experiental Designs. The pearl oyster. Boca Raton. Gramedia Pustaka Utama. Rose. JA. Margaritifera. Temperature and Osmoregulation in Aquatic Species. pp. The scope for growth of bivalves as an integrated response parameter in biological monitoring. Gilles. In: Kramer. C. Resgalla. G. O’Connor. 1173 p. 247-267.. 1979. 1985. Widdows. Tokyo. Smaal. 2007.. Torrie. RA.Jr. Mar. ITB. John Wiley & Sons. Aquaculture 229: 493506. 195: 179-17 ____ 2006. Lawler. Yukihira. Steel. Pinctada imbricata Roding. Proceeding European Marine Biology Symposium. Soria. PC.

Sain dan Teknik.30 mm) but hasn’t biggest significant (P>0. to get fast nacre deposition and high quality of pearl. 2008). Purwokerto E-Email: bufish68@yahoo. whereas survival rate was followed 79.id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana). Tjahjo Winanto2. effect. Kovitvadhi et al. Freshwater pearl Anodonta woodiana. (B) 60 cm and (C) 90 cm. Fak. 71 .05) to the deep of 60 cm (1. in the freshwater pond. Unsoed. 60 and 90 cm deep were 11. khususnya di Danau Biwa. was 300 m2 wide and 1 m deep.2 %. 12. budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925).0 %.7 %. &Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. Anodonta woodiana. Perikanan dan Ilmu Kelautan. Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930.10 mm) and biggest significant (P< 0. Completely randomized design was used with levels of deep treatment (A) 30 cm. sized ranging from 12 – 15 cm were studied. The result showed that best thickness of pearl deposition by 90 cm deep (1. One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre). maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). Keywords: Freshwater mussel. level of deep Kata kunci: Kerang air tawar. Berdasarkan kualitasnya yang tinggi. 2.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1. Di Jepang. Hyriopsis schlegeli (Simpson).70 mm). Maskur1. 12. woodiana. The research was conducted for 9 months. Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s. Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al.co.9 %. kedalaman laut 1.05) to the deep of 30 cm (0. PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. warna dan kilau (shine) Sonkar (2007).2 %. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk. 79 % and 78. Jur. Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China. Anodonta. The result of implantation was followed that 30. 2006. berat. The objective of this study was to obtain information on best level of depth to culture of pearl.

pH. BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1). alkalinitas. Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. internal dan teknis. Faktor eksternal antara lain kualtas air. Berdasarkan kualitasnya. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. penanganan dan pemeliharaan pasca implantasi. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. sehingga dapat diperoleh mutiara berkualitas tinggi. Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 . seperti suhu. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. Sonkar 2007). masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. Warna sebenarnya sangat tergantung pada selera konsumen. Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). sehingga membuat harganya paling mahal (Anonymous 2005). Oliver 2000. Faktor teknis. Anonymous 2007. kerang berukuran panjang antero-posterior (AP) 10-15 cm. Menurut Pagcatipunan (1986). kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre). Faktor internal meliputi jenis kerang yang digunakan. 2003). Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. misalnya keterampilan teknisi dalam proses implantasi. Skinner et al. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. hijau dan biru muda. Jumlah sampel 250 ekor. kualitas lapisan mutiara (nacre). kalsium. sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi. konduktivitas. sehingga mempunyai nilai tambah sebagai perhiasan. nitrat. kecerahan dan kesuburan perairan (Dan & Ruobo 2000. 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. sehingga kajian mengenai hal tersebut perlu dilakukan. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. oksigen terlarut. namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah.Rachman. dengan perlakuan kedalaman pemeliharaan 30. Semakin tinggi karatnya maka harganyapun makin mahal. khususnya pada produksi mutiara bulat air tawar. daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. karena luwes untuk perhiasan. Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik.

Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991). bagian ventral kerang menghadap operator. Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. Pengolahan data dilakukan dengan SPSS ver 15. Pasca implantasi. Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. Jumlah sampel pada setiap perlakuan adalah 75 ekor.1992). Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. Operasi dilakukan dengan menempatkan kerang pada penjepit. agar luka tidak menjadi infeksi (Rachman et al. posisi demikian dilakukan selama 2 jam. Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. keduanya dimasukkan ke dalam satu saluran. Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian.1992). Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad. Usahakan agar posisi mantel menempel dengan inti (Winanto et al. kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. Pengamatan dilakukan selama 9 bulan (April– Desember). Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. Secara matematis. al. Sebelum operasi. Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. sehingga dapat ditemukan 73 . maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih. Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral).Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. sehingga organ dalam terlihat jelas. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan. Selanjutnya. 2007).1992). Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan. Dengan menggunakan spatula insang disibakkan. yaitu dengan menggunakan metode ekspose (Winanto et al. terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor.

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

tidak menempel pada inti.80–14. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 .10 0.90 0. Kecerahan air di kolam penelitian antara 20 – 60 cm.00–7.62 0. 5Skinner et al (2003).80–25.40 0.32 7.15–3. seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan.82 0.093 6.90–25.04–0. 4Summerfelt (2007). Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana.12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000).03 <0. yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian. yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan.36–0. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk.90 6.36–0.50–7. Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik.60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6.09 7–13 68.70–99.35–0.60–90. 3Oliver (2000). Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%.17 23.76–99.20–6. Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.083 6–15 64. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp).40–25.90 22.00 68. Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan.04–5.70 Subur Lumpur berpasir 90 cm 2. Parameter air lainnya yang perlu diperhatikan adalah kecerahan.54 15 – 251 <1. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau.69 6.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2.00 0.5–8. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan. 2Hochheimer (2007).03–0.03–0.67 24. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.01–4.

1–11–2008. 2007. FAO. No.1–11–2008. Irish Wildlife Manuals. B. Hyriopsis (Hyriopsis) bialatus Simpson. M. Metode Perancangan Percobaan. 2008. &D. Invertebr. Imperial Real Question Real Answer.in. Chinese Academy of Fisheries Sciences. AR. 2007. Sawangwong &J. 1949. 1992. EA. Moorken. A. Cahn. Juhaman. 1900. dkk pada perairan yang bening. Oliver. Kovitvadhi. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. Pagcatipunan. Reprod. 2000. Yuniarti. P. 49: 255-262.. Armico.source.com . india. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh. United Kingdom. Kovitvadhi. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel. T.35. 1856). 8. H & G. berarus dan mengandung cukup kalsium. Part 1: Biology of the species and its present situation in Ireland. Engkagul. Sonkar. Pearl Culture in Japan. Freshwater Pearl Culture and Production in China. Imperial Leaflet. Thongpan. R. P. A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea. Dev. 1986. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera. 1999. Budidaya Mutiara. The Pearl Source. DAFTAR PUSTAKA Anonymous 2005. Winanto. Peterborough. DKP.3 mm). Rome. Diamon Graphics. Gasperz V. AK. Bandung. Ruobo. Pontjoprawiro & M. Laporan Tahunan. Balai Budidaya Laut Lampung & FAO/UNDP. Pearl Aquaculture Research Foundation.2 %).T. Fishing leaflet. Rachman.. Rojali. G 2000. Hongkong. info@pearl. Murdjani. Sintasan terbaik pada kedalaman air 30 cm (79. Washington DC. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12. Memasukkan: Maret 2009 Diterima: Juli 2009 78 . Machado. Aquaculture 275: 169-177. Kovitvadhi. Jiangsu Province China. INS/81/008. S. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp. Areekijseree. Dan. & K RungruangsakTorrisen.357. 2006. S. U. Jakarta. Kovitvadhi. Anonymous 2007. U.2 %). S. sales@ thepearl. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature.Rachman. A. 1991. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1.

and Duabanga-Pterocymbium communities. Sterculia-Grewia. However floristic compositions varied among plot sites. Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . Anthocephalus macrophyllus. and determined their positions. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. dan Pulau Batanta. Pulau Waigeo. Toxotrophis illicifolius. Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. Pulau Salawati. and Koordersiodendron pinnatum. Yensawai (7 plots) and Wailebet (5 plots). In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. Papua Kata kunci: Vegetasi. Raja ampat. Raja Ampat. lowland forest. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. Pulau Misool. Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. According to ordination analysis there were five community types. Pangium edule. Raja Ampat.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. hutan dataran rendah. Keywords: Vegetation. Aporusa–Pometia. Raja Ampat. Ficus-Antocephalus. Balgooy 1976). which might be a characteristic of vegetation of Papua and the nearby small islands. e”10 cm) within all of 17 plots were measured. Papua. All trees (dbh. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas. and identify their species. Antocephalus-Toxotrophis. Almost all of common species such as Pometia pinnata.

Yensawai dan Wailebet (Gambar 1). Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut. yang meliputi daerah datar sampai berbukit. karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah. kuskus waigeo.9" LS.2"–130º53’28. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS. dengan kondisi vegetasi yang bervariasi pula. di samping pantaipantai berpasir putih yang indah. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air. dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. maleo waigeo. rentan terhadap kerusakan dan peka akan gangguan. Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. cendrawasih Wilson. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan.3"–0º54’19. Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap. Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil. beraneka burung kakatua dan nuri. dengan ketinggian mulai dari 12 sampai dengan 147 m dpl. dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. Namun demikian secara umum kondisi vegetasi masih cukup baik. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi. beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006). 80 . Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. yang terbentang antara 130º31’7. (Anonim 2006).Edi Mirmanto beragam pada saat ini.4" BT dan 0º47’ 27.

Rata-rata curah hujan dan temperatur udara di daerah penelitian. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib. 5=Korpak.cityseahorse. berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua. Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam. dengan kondisi vegetasi yang relatif tidak terganggu. Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit.html. 4= Wartandib. 2=Kafnain).Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar. Waringkabum. Yensawai (3=Waringkabum. Vegetasi di daerah ini pada umumnya belum terganggu. lokasi berdasarkan pengukuran dengan GPS) Gambar 2. Gambar 1. Korpak. Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris.com) 81 . bergelombang sampai berbukit. dan Warai. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat. 6=Warai) dan Wailebet (7=Kaliyakut. dengan kondisi medan secara umum datar. (Peta diperoleh dari httw://www.com/irian-jaya. 8=Kalituris).

3 m dari atas tanah. Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak). Dari 40 suku yang tercatat. kerapatan. sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al. dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. Flacourtiaceae. frekuensi relatif kerapatan relatif. dengan menggunakan perangkat lunak MVSP 3. diidentifikasi jenisnya. ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm. beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi.1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. 82 dominansi relatif. Sapotaceae. (1965). yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2). diikuti oleh Sterculiaceae. Anacardiaceae.com). Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. Verbenaceae. Yensawai (7 petak) dan Wailebet (5 petak). dan Rubiaceae. Sapindaceae. Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). Alangiaceae. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. dan nilai penting. Euphorbiaceae.Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar. diukur diameter batang setinggi 1. yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). dominansi. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. Beberapa suku diantaranya Lauraceae. Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu . yang tersebar pada medan maupun kondisi vegetasi yang bervariasi. Di salah satu DAS telah dibuat bak penampungan air. Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting.

8 2.7 7.7 41.6 4.0 Petak pencuplikan data B C D E F G H I J K 1.9 4.0 2.2 12.0 31.8 14. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.1 31.0 100.8 13.4 6.3 1. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %.6 2.1 13.0 2.6 17.9 16.1 6.2 2.0 100.6 16.3 16.6 21.0 22.3 25.1 8.4 10.3 17.9 3.4 19.2 4.5 5.4 4.5 11.0 6.7 11.4 25.7 6.7 32.3 2.3 2.3 9.0 2.7 4. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.6 24.6 100.8 21. Pometia pinnata bersama Anthocephalus macrophyllus.5 50.2 19.0 1.5 12. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).1 1.7 1.9 10.0 100.4 3.0 100.6 30.1 2.0 83 .4 1.6 4.0 100.1 21.0 100.0 7.7 L N O P Q R 14.6 1.3 2.1 0.3 8.8 1. berukuran besar dengan jumlah individu relatif banyak. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58.9 17.0 8.2 2.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi.4 8.8 %.9 7.5 1.7 11.1 25.1 5.9 2.4 4.8 17.0 100.8 41.0 100.2 36.1 3. tetapi dengan pohon-pohon berukuran relatif kecil. Jenis-jenis tersebut umumnya tersebar cukup luas.1 3.4 17.6 34.0 100.1 17.0 14.8 4.1 21. Pangium edule.0 100. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi.6 1.9 21.7 23.1 15.4 9.7 39.1 6.8 3. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.7 8.0 100.8 7.8 9.5 1.3 14.0 4.3 37.1 35.2 3.0 100.0 2. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.9 0.1 2.2 24.0 100.8 5. Toxotrophis illicifolius.6 25.9 1.8 12.2 3.4 3.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).0 18.3 7.5 44.1 9.7 3.3 4. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.0 33.5 1.0 Rata-2 20. Struktur hutan Tabel 1.4 5.1 1.3 17.6 3.3 100.1 100.4 1.0 1.2 19.2 11.1 31.0 1. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi. tetapi memeiliki kerapatan dan frekuensi yang rendah.2 3.7 13. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.1 13.0 1. Pada Tabel 2.6 5.6 3.1 4. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya.1 5. Berdasarkan nilai penting (NP) tertinggi.7 6.9 26.0 100.4 14.0 100.6 2.9 19.3 13.4 30.

Sebanyak 2% pepohonan menempati lapisan I.5 dan 28 m. ditandai dengan adanya individu pada semua kelas diameter. 1965). Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon. Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 . dan 39% pohon menempati lapisan III. Disamping itu diperkirakan bahwa setelah mengalami gangguan. lapisan-II antara 18. Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm.5 m. Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5). Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m. Gambar 3. Akan tetapi proporsi jumlah individu nampak tidak seimbang. sedang pepohonan dengan tinggi di bawah 9. sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan.5 dan 18. Gambar 4. yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm). Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol. yang menunjukkan adanya rumpang atau daerah terbuka. menunjukkan pola persebaran diameter pohon yang cukup menerus.5 m merupakan jenis-jenis ternaungi. dan lapisan-III antara 9.Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal. 6% pohon menempati lapisanII. pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi.

16 1.58 1.03 2.02 3.54 6.83 1.73 2.66 1.69 5. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.31 299.30 1.98 4.03 1.37 2.98 2.43 62.87 1.87 100.77 2.75 1.43 0.60 3.00 NP 18. yang menunjukkan adanya perbedaan pola persebaran. Penyebaran spasial beberapa jenis disajikan pada Gambar 6.25 4.84 2.40 5.43 2.35 2.77 1. Intsia bijuga.04 1.59 5. yaitu dengan nilai Indeks Morishita berkisar angka satu.42 2. baik antar jenis maupun antar lokasi.16 3.78 1.30 2.03 13.45 2.03 3.01 2.99 85 .44 1. Tabel 2.35 3.87 0.87 0. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.63 2.22 3.30 0.05 9.80 6.18 2.43 3.87 0.33 3.66 4.44 2.09 150. Pometia pinnata dan Anthocephalus macrophyllus.04 10.31 6.74 4.73 1.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon. Secara keseluruhan persebaran pohon cukup merata. Nilai frekuensi relatif (FR).27 2.50 2.73 1.12 5.33 5.63 3.88 9.00 KR 6.63 37.03 50.49 7.68 3.10 100.24 1.02 2.02 7.43 0.80 1.17 3.00 DR 7.58 2.01 4.69 2.73 7.23 1.30 5.73 0.02 1.34 100.86 1. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.03 2.33 3.

Permudaan alami jenis Instia bijuga berjalan kurang baik.D) yang terdapat di Yenanas. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar. Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat. 86 . Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4. kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H.K. sehingga kemungkinan sudah banyak ditebang.J). Antiaris toxocaria. kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C. Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6).P).G. Kelompok A terdiri atas 2 petak (Q. Anthocephalus cadamba. kelompok B terdiri atas 3 petak (A. Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. ditandai dengan rendahnya individu pada tingkat semai dan belta. sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi.E) dan Yensawai (F.B. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak. R) di daerah Wailebet.I.L) dan Wailebet (O. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7).Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule.

L-I=pohon pada lapisan I. L-III=pohon pada lapisan III. L-II=pohon pada lapisan II. N= pohonpohon ternaungi). Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 . Gambar 6. Stratifikasi hutan secara umum di daerah penelitian. (M=pohon menonjol.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5.

3. komunitas Sterculia-Grewia. Pometia pinnata. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0. dengan proporsi dominansinya mencapai 61.4 0. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . yaitu 1. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia. 0.4 -0. Berdasarkan jenis-jenis dominan pada setiap kelompok. komunitas Ficus-Antocephalus.4 % total basal area dalam komunitas ini. Ke lima jenis dominan tersebut meliputi sebanyak 34. Ke 4 jenis tersebut mencakup 48. Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus. komunitas Aporusa–Pometia. komunitas Antocephalus-Toxotrophis. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar.0 SUMBU-X 0.4 Gambar 6. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan. dan 5. yang lebih rendah dari pada dua komunitas sebelumnya. Jenis-jenis Sterculia cordata. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea. komunitas Duabanga-Pterocymbium. 2.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. dapat ditentukan menjadi lima tipe komunitas. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon.4 Toxotrophis illicfolius.7 % dari total basal area.4%. Grewia paniculata. 4. Alangium javanicum dan Pimeleodendron ambinicum. Pometia pinnata. Artocarpus altilis.

seperti Geser (Mirmanto & Ruskandi 1986). Kari-munawa (Yusuf dkk. PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. Pometia pinnata. serta dengan komposisi jenis yang berbeda pula. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. misalnya Waigeo (Mirmanto. data belum dipublikasikan). Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA. Artocarpus altilis. 2006). yaitu sebanyak 56 jenis pohon. Anthocephalus macrophyllus. maupun luas daerah penelitian. atau terdapat dalam proporsi yang rendah. Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. Artocarpus communis. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. kecuali Koordersiodendron pinnatum. dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan. tidak terdapat dalam komunitas lain. Canarium maluensis. Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada. Dari jenis-jenis yang tercatat. Krakatau (Tagawa 1992). Koordersiodendron pinnatum dan Cryptocarya multinervis.Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. Ficus variegata. Nusakam-bangan (Partomihardjo dkk. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. Ficus tinctoria. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. 2001. 1998). 2003). Simbolon. 1995. Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. Hampir semua jenis dominan tersebut. Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. Pterocymbium tinctorium .

Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. Pimeleodendron ambinicum dan Endospermum moluccanum. dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp.Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk). Inocarpus fagiferus dan Instia bijuga. . meskipun secara struktural sudah mendekati kondisi hutan alami. hanya terdapat dalam jumlah yang relatif sedikit. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama. Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata.. dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula. Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. juga mempengaruhi kesamaan komposisi jenis. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides. Mallotus mollisimus. Ficus spp. yang rata-rata berukuran cukup besar. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu.

HB. Paijmans (ed. EN. Ratnawongse & C. Maluku. Aims and methods of vegetation ecology. Toxotrophis illicifolius. Prawiroatmodjo. New Guinea Vegetation. Ser. Report and Proc. Ogino.. Yoda. Morishita. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. Doc. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. Partomihardjo. T. Tipe-tipe vegetasi cagar alam pulau Supiori. E.. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. T. Global Taxonomy Initiative in Asia. of first GTI Regional Workshop in Asia. Ogawa. Cilacap-Indonesia.E. Kabupa91 . Irian Jaya. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. D. vegetation and floristic notes of Nusakambangan Island. Mueller-Dombois. Mem. Structure and floristic composition. 4: 13-48. 1959. & A. 1976. Nat. hal 34-45. Propinsi Irian Jaya Barat. Simbolon. 1965. Roemantyo & S. Malaysia: 106-111. Anthocephalus macrophyllus. John Wiley & Sons. Sci. H. Sambas & S. 1986. 2003.. H. 1995. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. Puslitbang Biologi-LIPI. Laporan Teknik 1995. Prawiroatmodjo. Ellenberg. Analisa vegetasi hutan dataran rendah di pulau Geser. M. I. Comperative ecological study on three main types in S. Simbolon (ed. MMJ. In: K. Dalam: H. 2001. Berkaitan dengan kekhasan vegetasi hutan. K. T.).). Phytogeography. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. K. & H. van. D. 1995. Fac. Putrajaya. Purwaningsih. 1972. Kyusu Univ.). Partomihardjo. Shidei. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. Laporan Perjalanan. Biological diversity of small islands: Case study on landscape. 2006. E.& Life. 1-22. 2: 215-235. New York. Ruskandi.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata. Asia of forest vegetation in Thailand. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. 2001: 39-48. (Biol. Apasutaya. Pangium edule. DAFTAR PUSTAKA Anonim.. Mirmanto. Measuring the dispersion of individuals and analysis of distributional patterns.

Mulyadi & H. Irian Jaya. Primary succession and the effect of first arrival on subsequent development of forest types. Studi vegetasi P. 2006. Yusuf. Ruskandi. & JHA. H. vol. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea. van. Karimunjawa dan bebrapa pulau kecil lainnya. Jakarta. Simbolon. Pusat Penelitian Biologi LIPI. Series I. 92 . Wardi & Dirman. Puslitbang BiologiLIPI. Laporan Teknik 1995. Dalam: AJ Arief. Dalam: H. Flora Malesiana. 1948. CGGJ. IV. 17-31. 1998.42. Verhandelingen. Julistiono (ed. FH. Geo J. Tagawa. Irian Jaya. Ekol.).N. Laporan Teknik 2006. hal 54-72..). 28 (2): 175-183. hal. No. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah. Jakarta.Edi Mirmanto ten Biak Numfor. di kawasan T. Djawatan Meteorologi dan Geofisika. EB Walujo. Indonesia. Noordhof-Kolff NV. H. A. Schmidt. Ferguson. 1951. 2 (3): 1-11. Simbolon (ed. 1992. Karimunjawa. R. Kementrian Perhubungan. Steenis.

Lepiniopsis ternatensis Val.) MA Mallotus mollisimus (Geisebr. Bridelia insulana Claoxylon longifolium (Bl.S. EUPHORBIACEAE Aporusa cf dendroidea Schot. Mangifera indica Parishia insignis Hook. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta.) Pax & K. APOCYNACEAE Popowia beccarii Scheff.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq. Macaranga tanarius (L. DILLENIACEAE Dillenia ovalifolia Hoogl.Br.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K. Drypetes glabridiscus JJS Drypetes longifolia (Bl.Hofm. Osmoxyon sessiliflorum (L. Mitrephora diversifolia Miq. Suregeda glomerulata (Bl.) MA Pimeleodendron ambinicum Hassk. Cynometra ramiflora L. Semecarpus australiensis Engl. Muller. Alstonia scholaris R. Inocarpus fagiferus Fosb.) Baill. Polyalthia laterifolia King Polyalthia subcordata Bl. FABACEAE Archidendron jiringa (Jack. Intsia palembanica 93 . Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl.) Nielson Crudia reticulata Merr. Polyalthia diversifolia Miq. Raja Ampat. CLUSIACEAE Garcinia dulcis (Roxb. Instia bijuga Kurtz.) A. CELASTRACEAE Siphonodon celastrinus Griff. ARALIACEAE Gastonia papuana Miq. Endospermum moluccanum Glochidion zeylanicum A.) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. Teysmaniodendron hollrungii (Warb. Tabernaemontana sphaerocarpa Bl.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1. ANNONACEAE Spondias cytherea Sonnerat.) Endi Croton argyratus Bl. Polyalthia glauca Boerl.) MA Mallotus rufidulud (Miq. Jass Macaranga aleuritoides F.) Kosterms. Mallotus philippinensis (Lam.

Et Binn.f. Cryptocarya caloneura (Scheff. Cryptocarya multinervis Teschn.Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall. Ficus glaberrima Bl. Litsea glutinosa (Lour.)Sleum Gonocarium littorale (Bl.) Merr. Trophis philippinensis (Bur. Horsfieldia irja (Gaertn) Warb.Rob.)Sincl.)Valeton Dysoxylum arborescens Miq.f.)C.) Benth. Purverulenta (Warb. Dysoxylum densiflorum (Bl. 94 .)Kost. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm.f.) Hk.) Boerl. Ficus variegata Bl. Litsea ladermnniii Tschn.) Forsb Artocarpus communis Artocarpus varieseanus Miq. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud. Chisocheton lasiocarpus (Miq.B. Lansium domesticum Correa Sandoricum koetjape (Brom. Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. Toxotrophis illicfolius Vid. Litsea firma (Bl.)Schouten Gymnacranthera panniculata Val. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc. Litsea timoriana Span.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf.)var.) Merr. LECYTHIDACEAE Planchonia sp.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq. Litsea forstenii (Bl.)Miq. Horsfieldia hellwigii (Warb.) KN Parker Chisocheton ceramicus Miq.)Kosterm. Ficus botrycarpa Miq. wieringae Kosterm. Horsfieldia bivalvis (Hk. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl. Aglaia goebeliana Warb Aglaia korthalsii Miq. Litsea calophylantha K. Schum.

sp. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L. Anthocephalus macrophyllus (Roxb. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L. Pterocymbium tinctorium (Blanco) Merr. Palaquium sp. ROSACEAE Prunus javanica Miq. RUBIACEAE Adina racemosa (Caw.J.) Havil. Et K. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC.J. TILIACEAE Grewia paniculata Ridl.L Palaquium lobbianum Burck Palaquium obovatum Burck. Neonauclea clemensii M. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F. Br.)Tirveng Anthocephalus cadamba Miq. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour.) Merr & Perry Syzygium pteropoda Lauterb. Sterculia cymosa Wall. Morinda citrifolia L.petiolans Pometia pinnata Forst.)Merr.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp. Myristica lanceifolia Bl.f.) Chew Pipturus argenteus Widd. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb. RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Scott. OPILLIACEAE Chaemperia manillana (Bl.P. Schum Pertusandian multiflora (Hw. Schum.v Muell Sterculia cordata Bl. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L.)Merr. NYCTAGINACEAE Pisonia longirostris T. Harpulia petiolans Radlk sub. Psychotria diplococea Landeri Valeton Tarenna barbellata Val. Chrysophyllum roxburgii G. Myristica inutilis R. Pavetta platiclada K. Et B. Br. 95 . Don Madhuka leucodermis H. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl.)Risdl. Myristica curcullata Mgf. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R.

v Will. Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Memasukkan: April 2009 Diterima: Juli 2009 96 . Br. Br.) F. Vitex quinata (Lour. Vitex glabrata R.Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R.

maize stemborer. timbulnya hama resisten. di antaranya dengan menggunakan insektisida kimia. Ostrinia furnacalis. 2 Balai Besar Karantina Ikan Soekarno-Hatta. 6 of them gave PCR products.Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. Lam 762 and C 522. Lam 752. Cib 551. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7. Email: bahagiawati@indo. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam. PCR. cry1A. Kata kunci: B. thuringiensis. cara tersebut antara lain dengan mempergunakan biopestisida. Habib Rizjaani1. Ostrinia furnacalis Guenee 1 Bahagiawati1. Agustina K.7 milyar dolar Amerika (Bent & Yu 1999). Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . cry1A. From 59 tested isolates. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997).net. and second was 986 bp. Kerusakan yang diakibatkan hama tersebut sangat bervariasi. 243. yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984). the expected size of Lep2A-Lep2B primers. thuringiensis. PCR. Oleh karena itu. These isolates were Jtg 2151. two DNA bands. the expected size of Lep1A-Lep1B primers. yaitu matinya organisme non-target.id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. diperlukan cara lain selain hanya dengan pestisida. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). All of tested isolates showed potentially high toxicity against maize stemborer. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. first was 490 bp. Ostrinia furnacalis. Key words: B.

Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. 1991). 1991).Bahagiawati. Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. dan telah diidentifikasi berbagai jenis protein Cry. antara lain analisis Southern blot. Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989). karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. 1991. Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. dan mudah digunakan dalam kegiatan rutin (Carozzi et al. penggunaan antibodi monoklonal. Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. Santoso et al. permukaan daun. bubuk biji-bijian. Bakteri ini dapat diisolasi dari berbagai bahan. Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al. Smith et al. thuringiensis subsp. Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. seperti dari tanah. dan berbagai bangkai serangga (Carozzi et al. kependekan dari kata crystal. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. relatif cepat. 1991). thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. 1992) yang dimodifikasi seperti . Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. 1991. & Sibuea wati 2002). Rizjaani. 2001). Bogor digunakan sebagai bahan dalam penelitian ini. Sebagai kontrol negatif dipakai akuades. cukup sensitif. selanjutnya disebut dengan Bt. thuringiensis masih terus dilakukan. Selain itu. 2000). Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan.

Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. berat. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. Uji toksisitas. permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut. Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. masingmasing 500 μl. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril. lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan. Setelah makanan buatan tersebut membeku. 99 . sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. thuringinesis terhadap larva O. dan masing-masing perlakuan diulang sebanyak 3 kali. Pengujian toksisitas dilaksanakan dengan memakai serangga O. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1). dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. Uji toksisitas isolat B. masing-masing bagian makanan diinokulasi 2 ekor larva. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. Rerata persentase kematian.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. Selain itu. Ada tidaknya perbedaan antara data persentase kematian. thuringiensis lokal yang disaring. Pembuatan makanan buatan. furnacalis mengikuti Bahagiawati et al. Sebanyak 1 ml suspensi B. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri. berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. (2002). Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). (2003). Jika terdapat perbedaan antara rerata perlakuan yang diuji. Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10. (2003). Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm.0 for windows. (2003) dengan modifikasi sebagai berikut. Setiap cawan mewakili satu ulangan. furnacalis yang diperbanyak pada makanan buatan.

03 (1) 0.78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0.07a (2) a 0.94a (1) a 0. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan. dipel (+).67b 96. furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 . Produk PCR dari beberapa isolat Bt lokal Jtg2151(1).77a (5) 2. Lam752(4).03a (1) a 0. kontrol negatif akuades (-).20 (1) 0. Cib243(2).00a 83.67b 83.33b 96.003 (1) 1. furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1.67b 86.49b (30) 0. Cib551(3).90b (30) 13. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1.33b 96.613a (5) a 0.04 (4) 0. Analisis data persentase kematian.30b 96.77a (1) 0. Lam762(5) dan C522(6). Rizjaani.05.23 (2) 1. Tabel 1. Kontrol positip.91a (5) a 0. & Sibuea Uji toksisitas isolat terhadap O.67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5.133a (5) 2. furnacalis Data uji toksisitas terhadap larva O.Bahagiawati. Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O.

9 mm. Berat tubuh larva-larva tersebut mencapai ratarata 5.9 mg dan panjang tubuh 13. kematian serangga mencapai 83. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0.6 mm untuk panjang tubuh. Kedua analisis di atas menunjukkan hubungan yang terbalik. Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0.97). Regresi linier antara: A. Pada kontrol positif (Dipel). dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0. yaitu makanan buatan yang tidak mengandung suspensi Bt.9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0. Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan. B.9753 Gambar 3. persentase kematian dan berat tubuh. persentase kematian dan panjang tubuh.1137x + 1. demikian juga dengan panjang tubuh larva (R2 = 0. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan.5 mm.7 mg untuk berat tubuh dan 0.3%. C.9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2. Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif.7 mm-2. berat tubuh dan panjang tubuh larva 101 . dengan berat tubuh yang relatif kecil yaitu 0.7726 R = 0.04-0.98).409 R2 = 0.13 mg dan panjang tubuh hanya 2. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt.0609x + 5. Larva-larva yang masih hidup ini terlihat lemah.1311x + 13.0133 R2 = 0.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel. namun berbeda nyata dengan kontrol negatif akuades.

Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al. dimana pada tahun 1999 mencapai $300 juta.Bahagiawati. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt. 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O. PEMBAHASAN Seperti yang telah dikemukakan.7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008). adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama. Santoso et al. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. Hasil penelitian kami memperlihatkan hasil yang lebih akurat . belum pada tahap bioasai toksisitasnya terhadap hama target. furnacalis. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989. masing-masing Lep1A-Lep1B dan Lep2A. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. 1992). yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0. Rizjaani. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda.Lep2B.97) berbanding lurus. 2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup. mereka memakai 2 pasang primer. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B. Pada waktu Santoso et al. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running.

Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989. dan aktifitas makan menurun. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. 1998). Empat isolat yaitu Jtg2151. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. Larva yang memakan toksin Bt. Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. 103 . Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. yaitu bioinsektisida Bt yang telah dikomersilkan. Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. furnacalis. setelah beberapa hari tampak kecil. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. furnacalis. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel. KESIMPULAN Dari 59 isolat yang diuji. 1994). gerakannya lambat. Ceron et al. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. Cib 243. 1991). Berdasarkan hasil uji toksisitas isolat B. Pada hasil penelitian Santoso et al.

Setyawan & Sutrisno. A F. Bahagiawati & Amirhusin. Agrobio 5(1): 21-28 Bahagiawati. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. cry1A(b). 1981. Covarrubias. Payne. Mikro. Wereng coklat dan pengendaliannya dalam prespektif. J. E. Penggunaan Bacillus thuringiensis sebagai bio. Yu. 18: 265-267. Brotonegoro. J. H. Masalah dan . Feitelson. 60: 353-356. 2008. Aranda. J. S. Bahagiawati. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. 2001. WS. R.. Whiteley. cry 1A(c) dengan PCR. Microbiol. 1991. Mikro Indo. 1992. Indo. Santoso. Envi. Bio/Technology 10: 271275 Höfte. Bacillus thuringiensis: insects and Beyond. Soegiarto & MS. Advances in Agronomy 66:251298. 1997. 1983. LGE. Listanto. Kim. 2002. Warren. Ausubel. Jakarta. Bul. Biotek. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. Moore. IN. E. Applications of Molecular Biology to Plant Disease and Insect Resistance. & Sibuea DAFTAR PUSTAKA Abbot. Appl.A. 1999. Surabaya 12-14 Maret 1997. Brent. 1989. Global Review of Commercial Transgenic Crops: 2008. Ceron. Pest of crops in Indonesia. Perhim. Bahagiawati. Sem. J. New York. Buletin Agrobio: 4 (1): 1-8. Quintero. Ortiz. Appl. ISAAA. P. B. Struhl. Insecticidal crystal protein of Bacillus thuringiensis. RE. & HR. Riani Simanjuntak. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. L. Rev. VC. Kalshoven. Rizjaani. Carozzi.. M. R. 57(11): 3057-3061. 1994. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). ISAAA Briefs. Lina & A. & L. 1992. Rijzaani. oleh Van der Laan.. John Willey.. Second Ed. & IC. PT Ichtiar Baru-Van Hove. & N. Pros.. Micro. NB. J. 2002. N. C.. Kramer. JG. B. Evola & M. JS. Bent. James.A. S. 53(2): 242-255. FM. Seidman. & Bahagiawati AH. GW. Indone. 1925.Y. 39. Koziei. Econ Ento. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. Envi. Ithaca. 2003.Bahagiawati. D. Kingston. Bravo. A method of computing the effectiveness of an insecticide. J.G. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. Microbiol. Perta. 8(1): 2730. Smith & K.insektisida. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. Oka.. No. DD. Sarjono. Sutrisno. A.7(2): 35-38. L. Ortiz. H.

2000. D. Bogor. Bacillus thuringiensis and its insecticidal crystal proteins. Dean. 22-24 Maret 1983. Environ. Santoso. Pengendalian terpadu hama padi. 1991. Rev. Zeigler & D. Risalah lokakarya penelitian padi. D. D. N. 1984.R. Lereclus. 1998. Jurnal Bioteknologi Pertanian 5(2): 53-60. Appl. Padi-Buku III: 653-680. Tantangan entomologi pada abad XXI. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR. 63(3):775-806. Rodiyah. Perhimpunan Entomologi Indonesia Cabang Bogor. van Rie. 1997. Listanto. J.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi. Crickmore. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Oka IN. J.. J. Memasukkan: April 2009 Diterima : September 2009 105 . Damayanti & Sutrisno. Oka. Schnepf. & Bahagiawati AH.. 57: 311-315. RA. & GA. IN. Baum. Feitelson. E. The phylloplane as a source of Bacillus thuringiensis variants. E. Microbiol. Mol. & Soehardjan. TJ. Biol. Cibogo. Smith. Couche.H.

inoculants. Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. Chromobacterium. Spaerotillus natans. Bacillus. Raya Jakarta-Bogor km 46.. Bacillus. Rhizobium. The soil was collected from numerous places around Pontianak. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). and neither to bare soil dresses with compost. Citrobacter. plant height was accelerated quickly while other inoculants affected to stalk diameter development. Chromobacterium. Keywords: Jatropha curcas L. Jl. inoculants. and Nitrosomonas spp. Azotobacter. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant. Nitrosomonas. Citrobacter. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition. and formulated to single and mixed bacterial inoculants. Nitrosomonas. Kata kunci: Jatropha curcas L. and Spaerotillus natans were soil bacterial isolates. West Kalimantan. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L). Rhizobium . That selective inoculant has opportunity to be used for jatropha farming. E-mail: widadomon@yahoo. Nitrosomonas.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI. respectively. Chromobacterium. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. Bacillus.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Rhizobium .. Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. In the presence of inoculants. Kandungan minyak mencapai 40% 107 . Genera of Azotobacter. Azotobacter. Cibinong Science Center. Spaerotillus natans. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. Those isolates were used as inoculants. Bacillus. Citrobacter.

BAHAN DAN CARA KERJA 1. Pusat Penelitian Biologi LIPI. Bakteri yang berhasil diisolasi adalah Azotobacter. Kandeel et al.6 metriks ton minyak jarak hasil produksi tanaman per hektar. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar.9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978). Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan . Azospirillum liboferum. yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al. ElGhadban et al. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. Perlakuan bakteri Azotobacter chroococcum. 2006). sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. Kalimantan Barat.Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. Rhizobium spp. Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. 2007). 1991. Nitrosomonas. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. Chromobacterium. 1995. dan Spaerotillus natans. Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. 2006). Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. 2002. serapan hara. Citrobacter. Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot). atau setara dengan 1. Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Lewis et al. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak. Bacillus. Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. Badran & Safwat 2004. Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008).

0. Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp. dan Nitrosomonas spp. yang masing-masing diambilkan 10 ml dari BI. 1. dan Bacillus spp. Pontianak. yang diisolasi dari tanah asal Rasau Jaya. Singkawang. 0. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count. sebagai inokulan P-3. perlakuan kompos sekam ayam (P-7). Media tadi mengandung: 1 g glukosa.001 g FeCl 3 . 3x10 7 Chromobacterium. 0.5 g Ca3PO4. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). dan P-17. Karoho.5x107 Citrobacter. atau sebagai inokulancampuran beberapa-genus (multi-genera). Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera).001 g MnSO4 H2O. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran. 2. Bacillus.3x107 Spaerotillus natans sebagai BahanInokulan (B-I). Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I. yang diisolasi dari tanah asal Rasau Jaya. Mandor. Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus.5 ml sediaan dari inokulan Azotobacter.05 g (NH4)2SO4. masing-masing sebanyak seperempatnya atau 7.6H 2 O. 0. 0. diinkubasi selama 7 hari. Satu dari tiga kecambah yang terbaik pada setiap pot 109 . Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan. Citrobacter. digoyang pada kecepatan 150 rotasi per menit. 0. dan kemudian diformulasikan seperti pada Tabel 1.8x107 Nitrosomonas. kemudian ditempatkan di dalam rumah kaca. dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2. Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6).02 g KCl. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. P16. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya.05 g yeast ekstrak dan 0. dan 2. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding.2x107 Rhizobium. 1.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit. Sambas. 1. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji. Citrobacter. perlakuan kompos tanpa mikroba (P-8). kemudian dikondisikan pada pH 7.01 g MgSO4 7H20.

Citrobacter. (isolat tanah Mandor) Azotobacter. (isolat tanah Singkawang) Citrobacter sp. Bacillus.Widawati & Rahmansyah Tabel 1. Bacillus.. (isolat tanah Sambas) Azotobacter. Bacillus. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. dan Nitrosomonas spp. Bacillus. Citrobacter. dan Nitrosomonas spp. Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. beserta kontrolnya. dan Nitrosomonas spp. Rhizobium sp (isolat tanah Ketapang) Azotobacter. Citrobacter. Bacillus. dan Rhizobium spp. (isolat tanah Karoho) Azotobacter. Citrobacter. Bacillus. kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. Bacillus. Nitrosomonas. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. Azotobacter sp. Citrobacter. (isolat tanah Rasau Jaya) Nitrosomonas sp. Nitrosomonas spp. dan Nitrosomonas spp. Bacillus sp. Chromobacterium. dan Nitrosomonas spp. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . Citrobacter. (isolat tanah Pantai Singkawang) Azotobacter. dan Nitrosomonas spp. Bacillus.

305 1 5 13 17 9 UCL = 22. Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. 1.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. dan P-17. P-14. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst).0. Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. dan P-15. yang umumnya berukuran di atas nilai tengah (center). P-13. Tanaman yang tidak diberi inokulan pada no. P3. dan P-17 untuk perlakuan inokulan satu jenis.1. sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil. 8. P-15. P-7. P-4. P16. P13. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp. P-10.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. P-15. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13. P-14. sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. P-2. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 . P-16. dan 14 mst (Gambar 1).231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1. 2. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst. P16. P-12. 11.627 Tinggi tanaman (cm) LCL = 51. dan P-17. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5. P-12. P-6.804 UCL = 79. P-13.377 Center = 17.

PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). memperbaiki struktur akar. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. akibatnya dapat memperbaiki serapan air. yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman . Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan.Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. kompos. inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. dan Bacillus spp. atau bahan organik lainnya. dan PC bila dibandingkan terhadap P-E. 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya. sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. P-A. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis. dan P-F sebagai kontrolnya. dan P-C (Tabel 2). Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp. Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis. P-B. memperkecil erosi. Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal. yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan.. atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. Sekalipun pada hasil yang lain. P-H. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos. Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. dan P-I (Gambar 3). Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G.95). namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4). dan memperlancar serapan hara oleh tanaman (Ogunwole et al.

615 9 28 Center = 26.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33. 8.486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56.627 60 50 40 30 LCL = 51.647 LCL = 11.804 LCL = 13.295 24 8 Center = 7.52 Center = 15. 11.314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14.93 UCL = 19. dan 14 mst.231 Center = 17.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2.637 LCL = 8.931 50 LCL = 46.774 UCL = 22.637 7 6 20 LCL = 5.745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.377 (mm) tanam an Center = 44. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.344 Center = 11.126 70 20 18 16 60 Center = 59. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 . Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat.305 UCL = 79.103 32 10 UCL = 9.66 LCL = 19.

Bacillus. Bacillus. Nitrosomonas spp.kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 . Bacillus. Bacillus. dan Nitrosomonas spp Azotobacter. Azotobacter. Bacillus. dan Nitrosomonas spp Azotobacter. Bacillus.Widawati & Rahmansyah Tabel 2. Azotobacter. Bacillus. Nitrosomonas. dan Nitrosomonas spp. Citrobacter. Citrobacter. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter. Chromobacterium.kontrol 2 (tanpa inokulan) . dan Nitrosomonas spp. dan Spaerotillus natans Azotobacter. Citrobacter.kontrol 3 (tanpa inokulan) .kontrol 1 (tanpa inokulan) . Citrobacter. Bacillus. dan Rhizobium spp Azotobacter. Citrobacter. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F . dan Nitrosomonas spp Azotobacter. Citrobacter.

20 0.904 Y = 23.80 A C G H 0.40 0.80 0. fraksi atau serpih tanah.20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1. 8. namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus). R^2 = .722 * X.00 1.7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0. atau tanpa kompos (P-F).60 0.40 0.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4.60 0. Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F).00 0. Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis.00 0. 115 . dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1.20 1.20 0. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman. 11. dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC). serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E). Kecepatan tumbuh batang hasil pengamatan 5.7 x + 23.649 + 1.904 Gambar 3.

Ch Kumari. FS. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. Agric. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. GR. Safwat. 82(2): 247256.. Bacillus.: an important biodiesel plant. M. Res. dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. Plant Biotech. & MS. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization. Kalimantan Barat. Egyptian J. & TS. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. Rao & B. Rep. AC. S. Narayanaiah. 2007. Venkateswarlu. 2008. Bakteri Bacillus spp yang diujikan oleh Desai et al. Ch. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. dan Nitrosomonas spp. Seed inoculation with Bacillus spp. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). Gnanamanickam. Reddy. yang diisolasi dari tanah asal. 2:7–11 Desai. S. Deore. improves seedling . 2004. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. bobot akar. Isolat bakteri yang diperoleh dari tanah asal Pontianak. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. yang mana keberhasilannya terjadi seperti pada pengujian ini. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri.. biomassa. Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. Johnson. DAFTAR PUSTAKA Badran. luas daun. dan klorofil daun bila dibandingkan terhadap kontrolnya.

Asian Biotechnology and Development Review. El-Ghadban.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. AL. 58(3): 245 – 251. Agric. volatile oil yield and chemical composition of Ocimum basilicum L. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol. Environmental Technology & Management. Sharaf-Eldin. Ghosh. Agrophysics. Naglaa & AA. plant. African J. JS. Trivedi. Kandeel. Quantitative and qualitative microscale distribution of bacteria in soil. 44 (1): 229-234. 3(1):7378. Saber. M. DR. D’Silva & TK. Shalan & TAT. M.): influence of additives. A. SP. and essential oil content of fennel (Foeniculum vulgare Mill. for phytoremediation of lead and cadmium polluted soil. Fert. ES. JO. Sci. World Appl. Jatropha curcas L. Shrivastava. 39: 27-32. Mangkoedihardjo. 308-312. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. Sci. SA. 2007. Richaume. Munoz. Maheshwari.. 2008.. 152: 707–716. volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. AM. 8(2):11-29. Res. Mahfouz. Chikara..Biol. Microbiol. Dominguez & OS. Sreedevi. 2001. CK. 5(2): 75-80. biofertilizer on growth. Int. Lewis. S. S. yield.). Memasukkan: April 2009 Diterima: September 2009 117 . Abdel-Latif. 2008. Sadek. Daudu. Osman. Scien. Soc. SAT. 21: 361-366. 2002. SK. Soils. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards. Ain Shams Univ. 1995. Influence of biofertilizers on growth. Res. Int. Ranjard. J. Cairo. Wani..) cv. 2006. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media. 2008. Gangrade & KC.. Annals Agric. SK.J. Vietnamita. Egyptian J. & M. Tropical Hort. In vitro clonal propagation of physic nut (Jatropha curcas L. Effect of biofertilizers on the growth. & MA. MN.).. 47(1): 351–371. Kabesh & MS. Plant Soil Sci. Am.. OM. & A.. 2006. 2008. Int. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin.. L. Indian Perfume. 1991. Effect of mineral vs. Ogunwole. E. Yousry. 1978.Inte. Banerjee. LO. Improve livelihoods and environmental protection through biodiesel plantation in Asia. J. Chaudhary. & Surahmaida. 4(4): 519-522. Agric. 84(3): 977-992. Patolia. International Conference on Environmental Research and Technology (ICERT). EAE. Elefan. 35(2): 308-311. Biol.

urban area Kata kunci: Kelelawar buah. C. The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. pollen identification. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. prolate pollen type has importance for the male of Eonycteris spelaea. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. Serat polen mengandung protein lebih dari 60%. polen dan nektar (Suyanto 2001). The male of C. Bats have important role on seed dispersal and or plant pollinator. titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m). oblate spheroidal for the female of Rousettus amplexicaudatus and male of C. sphinx. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen.co. oblate type for the male of C. and perferesence. Email: srisoegiharto@gmail. identifikasi. sphinx. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar. C. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah. West Jawa. minutus. brachyotis and C. brachyotis and R. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi. amplexicaudatus like permagnae type (100-200 ì m). 119 . Kelelawar kelompok Megachiroptera mengkonsumsi buah. while the female of C.Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. while the female in disk type. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. corola types. Key words: Fruit bats. Urceolatus type has important for female of C. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. brachyotis. pollen.id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. titthaheileus.com 2 Staf Pengajar Mayor KVT IPB Bogor. titthaheileus and C. Where as the female has interest in campanulatus type. Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda. sphinx. Furthermore the male of Macroglossus sobrinus has interested in rotatus. Email: apkartono@yahoo. tubulosus.

Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. Rousettus amplexicaudatus dan Eonycteris spelaea. Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku. Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan. Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan. Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). sphinx. Macroglossus sobrinus. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. C.00-18.00 – 08. terpenoid.Soegiharto & Kartono hidrokarbon. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic. Nayar (1999) dan Paldat (2005). mulai Maret 2008 hingga Juni 2009. . Jaring kabut yang dipasang pada waktu senja hari pada pukul 17. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling. Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan. 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. C. brachyotis. 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan. pigmen carotenoid. C. Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. dan sering terdapat karbohidrat lengkap sporo-pollenin. BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. pengulangan dilakukan sebanyak tiga kali. Pengambilan sampel polen didapat dari isi pencernaan kelelawar. Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan. titthaheileus.00 WIB dan pagi hari pada pukul 06.

oblate spheroidal. Pada penelitian ini data yang dihasilkan dalam bentuk persentase. (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. oblate. mangkuk. Untuk bentuk mahkota lebih kuat mempengaruhi C. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a.390. sphinx betina.753. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang. tipe polen dan ukuran polen.116 dengan eigenvalue = 0. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009). brachyotis betina. sedangkan betinanya dipengaruhi kuat oleh bentuk disk. prolate dan perprolate. Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan. Penyajian data dilakukan dalam 3 bentuk. dan bulir. dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. prolate spheroidal. Tipe polen terbagi ke dalam 7 tipe yaitu peroblate. besar/ magnae (50–100ì m). sangat besar/ permagnae (100–200ì m). Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. dan raksasa/giganteae (>200 ì m). kecil/minute (10– 25ì m). Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0. sedang/mediae (25–50ì m). tabung dan bulat. HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar. Bentuk mahkota bunga terbagi kedalam 8 tipe. suboblate. C. 121 . axis 2 = 0.5 (Leps & Smilauer 1999). yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. kedok. axis 3 = 0.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. serta C. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. yaitu tabung. disk.241 dengan eigenvalue = 0. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. titthaheileus betina dan jantan.187. Analisis pengaruh karakteristik bentuk bunga. kupu.466 dengan eigenvalue = 0. Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. lonceng. bintang. Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies.

M = Macroglossus sobrinus.88 52. Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3.886.1 14.24 12.06 18. CB = C.05 2.08 29.39 48.588. KE_D= Kedok.99 Keterangan : CM = Cynopterus minutus . Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C. CT = C.53 9.03 7.55 9. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1.77 68.598. axis 2 = 0. dengan eigenvalue = 0.4 11. C. Pada Gambar 2b.26 9.427. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate.48 12.28 14.95 44. menjelaskan bahwa Rousettus amplexicaudatus betina dan C.462.11 68. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate. 122 .194.74 57.285.47 30. C.356. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae.66 25..39 42.95 18. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b.18 33.61 19. dengan eigenvalue = 0. KU_P= Kupu-kupu.23 43. menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0. sedangkan spesies C. R = Rousettus amplexicaudatus.08 11. minutus jantan.15 4. TA_B= Tabung. axis 2 = 0.58 42. p = jumlah persentase.7 27.09 7. sphinx.54 7.047 dengan eigenvalue = 0. axis 3 = 0.84 41. DI_S= Disk. brachyotis betina dan R.26 7.74 61. Untuk jenis C.97 11.44 50.03 9. LO_C= Lonceng. E = Eonycteris spelaea. BU_L= Bulir. brachyotis. CS = C. MA_K= Mangkuk. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal. BI_T= Bintang. dengan eigenvalue = 0. titthaheileus.091 dengan eigenvalue = 0. Tabel 1. Spesies C.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2. Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0.97 100 100 85. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a. sphinx betina.86 4.40 21.

77 46. M = Macroglossus sobrinus.13 12.24 35.72 14. M = Macroglossus sobrinus.01 14. p = jumlah persentase.61 4. sphinx.83 61. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40.9 85. E = Eonycteris spelaea.31 14. CS = C.85 5.71 44. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar.2 64. p = jumlah persentase 123 .52 7.97 34.65 3.93 64. CB = C.56 100 100 100 92.04 25.52 86. E = Eonycteris spelaea.5 41.69 10.34 42.86 6.26 76.48 7. brachyotis.74 61.29 52.95 42. brachyotis.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2. titthaheileus.17 23.97 Keterangan : CM = Cynopterus minutus.78 20.59 42.87 7. CT = C.48 13.03 100 1.01 57.13 11.69 39.23 43.72 14.95 39.66 56.8 14.42 6. R = Rousettus amplexicaudatus. titthaheileus.16 35.4 Keterangan : CM = Cynopterus minutus. CS = C.28 74.08 41. CT = C.58 53.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14.45 35. R = Rousettus amplexicaudatus.67 29.47 18. sphinx. CB = C. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36.23 15.94 11.04 Permagnae p 43.2 85.13 Magnae p 15. Tabel 3.21 100 5.92 44.92 37.65 7.

4 Axis 1 1. 9= Macroglossus sobrinus jantan. 10= Macroglossus sobrinus betina. brachyotis jantan. titthaheileus betina.4 Axis 1 1. 5= C. BU_L=Bulat. TA_B= Tabung. 13= Eonycteris spelaea betina. 11= Rousettus amplexicaudatus betina.0 0. 4= C. 3= C. BI_T= Bintang. sphinx jantan. 124 . 8=C. KU_P= Kupu-kupu. b) hubungan axis 1 dan axis 3. 6= C. -0.4 b. MA_K= Mangkuk. minutus betina. 12= Eonycteris spelaea jantan.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0.4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a. Keterangan : 1. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2. 2 = C.0 Gambar 1.6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. KE_D= Kedok.. brachyotis betina. DI_S= Disk. titthaheileus jantan. = Cynopterus minutus jantan. 7= C. sphinx betina. DI_S -0. LO_C= Lonceng.Soegiharto & Kartono 0.

Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0.8 a. titthaheileus jantan. 3= C.. 9= Macroglossus sobrinus jantan. 2 = C. 6= C. titthaheileus betina. PE_OB= Peroblate. sphinx betina. 5= C.4= C. a) hubungan axis 1 dan axis 2. 125 . SB_OB= Sub Oblate. Keterangan : 1. PR_SP= Prolate Speroidal. OB= Oblate. minutus betina. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen. 10= Macroglossus sobrinus betina.8 b. bracyotis betina. PE_PR= Perprolate. Gambar 2.6 Axis 1 PR_SP 1. 7= C. 8=C. PR= Prolate. sphinx jantan.0 Axis 1 . b) hubungan axis 1 dan axis 3. brachyotis jantan. 11= Rousettus amplexicaudatus betina. OB -0. 12= Eonycteris spelaea jantan. = Cynopterus minutus jantan.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0. OB_SP= Oblate spheroidal. 11 -0.0 0.6 1.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0. 13= Eonycteris spelaea betina.

menghasilkan nektar yang berlimpah.. tingkat 1. 11= Rousettus amplexicaudatus betina. minutus betina. 7= C. Keterangan : 1. dan ukuran. bau. 13= Eonycteris spelaea betina. 4= C. bentuk. 2 = C. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. GI = Giganteae.4 8 PA 9 12 3 5 7 2 GI 4 11 13 1. 12= Eonycteris spelaea jantan.2 kebutuhan pakan yang tinggi. titthaheileus betina. Keberagaman tersebut dijelaskan oleh Graham et al. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator). 10= Macroglossus sobrinus betina. brachyotis jantan. (2003) karakteristik kelelawar dalam mencari makan pada malam hari.0 Axis 1 Gambar 3. mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan. mengeluarkan bau menyengat (asam butyric). bentuk mahkota bunga mangkuk. 3= C. titthaheileus jantan. PA = Permagnae 126 . MA = Magnae. 5= C. 9= Macroglossus sobrinus jantan. sphinx betina.Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae.0 -1. 8=C. (2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar. Menurut Graham et al. ukuran polen besar dan dalam jumlah banyak. Bentuk keberagaman yang ditunjukkan berupa warna. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. = Cynopterus minutus jantan. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen. bracyotis betina. 6= C. sphinx jantan.

Syzygium sp.2. ukuran polen tersebut mulai dari magnae. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar.. Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. sphinx jantan lebih memilih oblate spheroidal. bunga terbuka dan mudah diakses. C. permagnae dan giganteae. [Euphorbiaceae] sp.. Baringtonia sp. permagnae dan giganteae. C.. mengeluarkan bau yang tajam dan menyerupai bau kelelawar. titthaheileus. Bauhinia sp.. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari. 1. Ceiba sp. berpendar atau warna kusam. serta bunga terletak pada cabang pohon. menghasilkan nektar yang banyak dan polen yang berlebihan. spesies Rousettus amplexicaudatus betina dan C. namun berbeda kesimpulan tentang sistem aperture. tipe polen. Pendapat Graham et al.2 dan Ceiba sp.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus. C. [Orchidaceae] sp. Ceiba pentandra. Durio sp. Peneliti lain (Graham et al. ukuran polen tersebut mulai dari magnae. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen. Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen.. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 .1.3. sedangkan tipe polen. sphinx. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan. Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. Ceiba sp. tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar. Stroo (2000) mencoba menganalisis pengaruh ukuran polen. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp. brachyotis. Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar.

. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. yang menjadi pakannya. Voigt (2004) dan Bumrungsri et al. seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan. Rousettus amplexicaudatus dan Eonycteris spelaea. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. yaitu: (1) tipe bunga yang mudah diakses nektarnya. kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering).Soegiharto & Kartono kelelawar tersebut. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. C. Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar.. kedok pada spesies Eonycteris spelaea jantan. Toelch & Winter (2007). misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram. (3) kelelawar lidah pendek/ pemakan buah. (2) tipe bunga yang mudah diakses polennya. (2009) akan lebih dijelaskan pada hasil penelitian kami. Durio spp. Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. C. sphinx. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. Bumrungsri et al. kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar. brachyotis. bunga dan daun. (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. Perbedaan pendapat Warren & Diaz (2001). Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. titthaheileus. C.

Plant Sys. Kelelawar di Indonesia. Leps. Plant Biology. Canoco Reference Manual and User ’s Guide to Canoco for Windows.& Y. Graham. Smilauer. Understanding Flowers and Flowering:An Inte- grated Approach. Ithaca: Microcomputer Power Toelch. Chongsiri. New York: Chronica Botanica. 2004. University of South Bohemia. 1999. TS. 2009. A. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. Glover.html. The pollination ecology of durian (Durio zibethinus. CJF. Illustrated Handbook on Pollen Terminology. LE.com / 2009/04/transformasi-data. 222: 225–242. Psychometric function for nectar volume perception of a flower-visiting bat. Pollen Flora of Maharashtra State India. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae. 2003. 1999. 193:265–269 Voigt. Dept. 1998. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar. BJ.blogspot.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. J. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores.. Sridith & PA. Paldat. Winter. E. Erdtman. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan. 2007. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers. Ecol 25:85–92. Pearson and Prentice Hall. 2001. New Delhi: Today & Tomorrow’s. Faculty of Biological Sciences. 1952. 129 . 2007. Copenhagen: Munksgard. 2005. Pusat Penelitian dan Pengembangan Biologi – LIPI. Smilauer. Graham & LW. Oxford: Oxford Univ. Multivariate Analysis of Ecological Data. A. Component Phy. Racey. Pollen morphological evolution in bat pollinated plants. & P. An Introduction to Pollen Analysis. Suyanto. Bombacaceae) in southern Thailand. 1943. http: //abdulsyahid-forum. International Bioscence Series Volume XIV. CC. Ceske Budejovice. [20 Juni 2009] ter Braak. Pr.Evol. A. J & P. Sripaoraya. T. 2000. Nayar. G. Bogor. DAFTAR PUSTAKA Bumrungsri S. permagnae dan giganteae. G. JM. 2009. Trop. Syahid. Transformasi Data. U. Erdtman. K. Wilcox. of Palynology Stroo.

Yulianto E.Soegiharto & Kartono Component Physiology 174:541– 548. Memasukkan: Juli 2009 Diterima: September 2009 130 . J. 2007. HM. 2001. Diaz. & BJ. Whitney. Morphology and development of floral features recognized by pollinators. 1992. Preparasi dan dasar determinasi palinologi. Bandung. Arthropod-Plant Inter. A twopollinator model for the evolution of floral complexity. Warren. 1:147–158. Glover. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. & A. Evolutionary Ecology 15:157–166.

Berbah and Gajah Wong Riverbank).25. Character differences between both of Papasan only revealed physiology adaptation. 131 . The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m). Niedzielski 2002). 11 a. In Daerah Istimewa Yogyakarta. C.1]non-3-ena-2.) Voigt) in Three Population in Yogyakarta. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L.m.. Chromosome. They differ in phenotype. anti diabetic. grandis dan C. Buahnya berbentuk oval dengan panjang 4-6 cm. dan aksiler.m. Selain itu. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983. Karyotype. batang memanjat. cordiflora. found in three population (Ngebel.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L. especially in shape and taste of fruit.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L. This plant is commonly used as vegetable.30 p. UPT BKT Kebun Raya Purwodadi-LIPI 2. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5. Kata kunci: Coccinia grandis L.. contains of 22 autosomes and 2 sex chromosomes. Fakultas Biologi. while Papasan II at about 08. Based on the statistic test. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika.30-09. indica. Papasan is a dioecious plant belongs to the family Cucurbitaceae. Papasan. there were two varians of Papasan (Papasan I and II). and anti diarrhea. Keywords: Coccinia grandis L. Dalam “Flora of Java”.30 a. Papasan memiliki sulur. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11.30 a.m..30 p.3. Papasan memiliki beberapa nama ilmiah seperti C. Cromosom.9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006). berwarna hijau pada saat muda dan berwarna merah pada saat tua.m and 2-2. Universitas Gadjah Mada E-mail : ridesti. The difference R value between Papasan I and II was smaller than 0. berbentuk lonceng. Papasan. The chromosome number of both Papasan is 2n=24. Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran.rindyastuti@yahoo.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1.5-dimetilbisiklo[3. bunga berwarna putih kehijauan. anti bacterial. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1.m-00. Kariotype.

grandis dan varian buah pahit C. bentuk. Varian buah manis yang umumnya dibudidayakan merupa-kan C. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. varietas atau forma. Kedua populasi tersebut berbeda karena perbedaan morfologi. Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. grandis var. 132 grandis var. Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. grandis (L. variasi bentuk dan rasa buahnya. perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). Fakultas Biologi Universitas Gadjah Mada. Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003). yang digunakan adalah metode Squash (Jahier et al. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . Yogyakarta selama delapan bulan. Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel.Juni 2008. wightiana (Roumer) Grab. 1996). grandis) yaitu tipe buah manis dan buah pahit. Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype. Di Daerah Istimewa Yogyakarta. Cogn sebagai nama sinonim. jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek).Rindyastuti &Daryono Papasan memiliki satu nama yaitu C. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. yaitu dari bulan Oktober 2007. cordifolia Auct non. ukuran. Dengan demikian. Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. Metode preparasi kromosom. Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. dua macam Papasan yang ditemukan di populasi Ngebel. Keduanya berbeda dalam hal rasa.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. Di India ditemukan dua varian Papasan (C.

Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG.00 3.5 12. Hasil pemotongan dicopy dalam format Adobe Photoshop 7.5-25. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades. Untuk menyusun karyogram. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar. Pada setiap pemotretan. Satu persatu. Tabel 1.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering. Lengan panjang diukur dari telomer lengan panjang sampai sentromer.Identifikasi Papasan (Coccinia grandis (L.5-50 25-37. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7.49 RLK 1. Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7. Bentuk kromosom berdasarkan Indeks Sentromer (IS). diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda.01-7. Kromosom difoto dengan mikrofotografi. Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1.00-1.00 >7. Lengan pendek diukur dari telomer lengan pendek sampai sentromer. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3.49 0-12. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37.0 untuk konversi skala ukuran kromosom. Ujung akar diambil.00 133 .67 1. Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16.0. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom. Ukuran tiap ulangan dirata-rata. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog.68-3.0 dan CorelDRAW X3.

4 8 .5. variasi bentuk dan rasa buahnya. Ukuran biji (cm) a) panjang b) lebar 3. Karakter Dari karakter buah.7 . Warna buah a) muda b) tua 3.2 6.7. Tepi daun 3.6 2 .3 . Perbedaan baru terlihat pada ukuran daun.9.1 . Biji 1.6 .7.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2. Ukuran daun (cm) a) panjang daun b) lebar daun 2.0.0. Daun 1.6 0.5. membulat-oval. Bentuk buah 2. Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4.3 8.9 . Bentuk biji 2.6 .3 . Warna 2. tidak berambut 7. Permukaan daun 4.0.7 manis membulat 0.33 tinggi putih Melengkung keluar (recurved) satu 134 . Karakter morfologi Papasan I dan II. Bentuk 5. memiliki rasa buah pahit dan variasi bentuk buah yang banyak.6 2. berasa manis dengan sedikit variasi bentuk buah. sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar. tidak berambut 6. bentuk daun.5 . Bentuk daun 2. Tanaman Papasan I Papasan II membundar berlekuk licin. Viabilitas 4.25 pahit oval 0. banyak variasi Membundar berlekuk licin.9.3 .2.2.64 0.2 oval-bulat variasi sedikit 1.0. Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4.5 . Tabel 2.3 . Buah 1. Papasan II memiliki ukuran daun lebih besar daripada Papasan I.4 7. sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua. Bunga 1. Seperti tampak pada tabel. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan. Rasa 3.6 . terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II.11.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4.4 memanjang. Buah Papasan I memiliki garisgaris putih.

Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II.50-09. Perbedaan karakter terlihat pada daun mahkota. Secara umum. Sedangkan. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris.00-14. memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil. biji Papasan berbentuk oval dan mampat. dari 24 kromosom Papasan. Disamping itu.Identifikasi Papasan (Coccinia grandis (L. biji Papasan I memiliki bentuk membulat. Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2.30 WIB sedangkan sel Papasan II aktif membelah antara jam 08. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2. hirtella dan C. dengan frekuensi terbanyak pada jam 11.00-12. 11. 11.00-14.00-11.15. Agarwal & Roy 1984. 12. Guha et al. Papasan I lurus.20.15 WIB. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3. Pada Papasan I prometafase banyak ditemukan antara jam 09. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2). diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek. Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 . chepalandra. 8.15 WIB. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom.30 WIB. 3.30-09. 4.50-10. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. 6.30 dan 14. Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C. sedangkan daun mahkota Papasan II menggulung keluar (recurved). Sel Papasan I aktif membelah antara jam 08.20 dan 14. Berdasarkan nilai IS (Tabel 3). biji Papasan I tidak dapat berkecambah. sedangkan biji Papasan II sangat mudah berkecambah. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin. Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II. 2004) sehingga. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. sedangkan biji tanaman Papasan II berbentuk oval.30 WIB.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2).00-11.10-12. Namun. indica yaitu 2n=24.00-11. 7. Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24. sedangkan yang berbentuk metasentris ada pada autosom nomor 1.30 WIB. dan 11. 10. C. sedangkan kromosom kelamin berbentuk metasentris. 9. sedangkan prometafase Papasan II banyak ditemukan pada jam 09. 5.

3. 136 . autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. Karyogram kromosom Papasan II. Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram. 7. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. dan 11. Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). 4.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). 9. sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. panjang lengan panjang (q) dan panjang absolut kromosom (p+q). 8. 2. 6. 10. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p). Karyogram kromosom Papasan I. Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II.

89±0.129 1.26413 46. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.182 0.37865 47.74±0.34739 44.86±0.27804 36.58±0.254 1.075 0.120 1.83784 45.33331 47. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.268 2.128 0.51±0.86±0. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.071 0.108 1.29±0.122 1.218 1.162 1.70±0.06±0.66±0.069 0.76±0.82±0.116 1. Tanaman No. 137 .090 0.069 0.078 2.96±0.99±0.53865 45.96±0.56±0.102 0.13±0.063 0.44±0.16±0.22 1.146 1. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman.155 0.42±0.63128 46.077 0.61615 44.71775 47.255 1.69±0.22531 45.130 0.26497 46.59±0.073 0.86±0.46603 46.48±0.062 0.66±0.097 0.00024 47.82±0.7189 46.84±0.79±0.252 1.55±0.78±0.075 0.067 0.107 0.121 0.50±0.29±0.230 1.62±0.54±0.13±0.083 0.072 0.67±0.135 0.139 0.089 1.03±0.58±0.073 0.211 1.083 0.78±0.148 Indeks Sentromer (IS) 35.085 0.48±0.112 0.25±0.103 0.87±0.102 0.70±0.081 0.079 0.Identifikasi Papasan (Coccinia grandis (L.94±0.80±0.230 1.074 1.77649 47.133 0.15998 45.33±0.06673 46.085 0.72844 46.129 1.70±0.64±0.34532 43.74±0.73±0.099 0.94±0.70±0.17±0.113 1.091 0.5394 45.80±0.77302 43.67±0.267 0.76±0.42±0.73±0.23 1.109 0.60±0.73±0.28729 47.53±0.) Voigt) di Tiga Populasi Tabel 3.249 1.77±0.72±0.112 0.105 1.73±0.242 1.061 0. baik autosom maupun kromosom kelamin.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.89±0.092 1.109 0.86±0.75±0.69±0.106 1.095 0.62±0.91±0.083 0.189 2.02±0.114 0.86±0.

Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- .59-1.345-47.33 1. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata.16-2.06-2. Semakin besar nilai R.87 0. Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman. Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer. Perbandingan idiogram kromosom Papasan I dan II.Rindyastuti &Daryono Tabel 4. Berdasarkan hasil uji statistik pada aras 5% (Tabel 5).13 36.25 35.01 Papasan II 2n=24=20m+2sm+XX(m) 0.44 1. diduga Papasan I dan II masih tergolong dalam satu spesies.5394-47. variasi ukuran kromosom juga semakin tinggi.51-0.50-0. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0. Nilai R menunjukkan variasi ukuran kromosom.00 Papasan I Papasan II Gambar 3. 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.77649 2.56-1. Perbandingan karakter kromosom Papasan I dan II.86 0.34739 2.

25. Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0.25. Tabel 5. Berdasarkan Tabel 5. nilai R kedua Papasan tergolong kecil. Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan.Identifikasi Papasan (Coccinia grandis (L.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0. Untuk membandingkan nilai R Papasan I dan II.) Voigt) di Tiga Populasi batannya. cuaca atau kesuburan tanah. Namun. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim. PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda. Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar. Berdasarkan Gambar 4. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II. X = Pasangan kromosom kelamin betina 139 . karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda. Nilai R antara Papasan I dan II berbeda. NS = Non-signifikan. Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R. selisih nilai R antara Papasan I dan II lebih kecil dari 0. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4). artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah.

5 Nilai R Nilai R 1 0. 3 = Melon PI 371795. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II.5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1. No. Tabel 5.115 0. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas.575 Papasan II 0. Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. bahkan antara tipe sel satu dengan tipe sel yang lain. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain.5 2 1.565 Melon PI 371795 0. Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya.Rindyastuti &Daryono Perbandingan Nilai R 2. 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0. Oleh sebab itu. Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.125 0. antara organ yang satu dengan yang lain dalam satu spesies. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling . Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman.01 0. 4 = American muskmelon Gambar 4.45 American muskmelon - Menurut Tamarin (1999). perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan. 2 = Papasan II.

59. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2. Sc. DAFTAR PUSTAKA Agarwal. dalam Ferruci (2000) memisahkan Serjania communis dengan S.25. 141 . yunnanensis dengan rasio 2. khususnya atas konsultasi di bidang taksonomi tumbuhan. mengindikasikan bahwa berdasarkan karakter kromosom.Gen. tetapi Cucumis. Dr. Raka Swastika. ukuran. serta karakter genotip yang meliputi waktu mitosis. bentuk. PK. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II. S. grandis L. 1984. 2000).) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain. S. mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. Meastika Dianeta. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0.. M. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. Roy. Nogueira et al. Namun melon tidak tergolong dalam genus Coccinia. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. Herlianti Anissa. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4). Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0.71 memiliki kedudukan taksonomi yang sama dengan A. Karyotype of Coccinia indica. Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi. Disamping itu. yaitu karakter morfologi daun. Si. Tuty Arisuryanti. maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L. Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas. Indian J. buah.) Voigt. M. gracillis berdasarkan selisih nilai R lebih dari 0.25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. bunga dan biji. perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. Senada dengan hal tersebut. Qi-Xing et al.Si. atas bantuannya secara teknis.. Qi-Xing et al. AAG. dan Drs. jumlah. Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan. S.25. atas bantuan konsultasinya. & Plant Breeding 44(1): 117-120. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel.25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C.Identifikasi Papasan (Coccinia grandis (L. Purnomo. KESIMPULAN Berdasarkan perbandingan karakter fenotip. & RP.

Gadjah Mada University Press. K. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana. Niedzielski. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae.jp/ article/cytologia/70/1/70_53/article. Scarlet Gourd. Luchsinger. 1996.jp/article/ cytologia/70/1/70_53/article. JM.ac. JM. 1983. Z. Winarsih.. Jahier.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. Comp.html?id=4138. Fifth edition. 1999. Sinha. w w. Wylie. 1979.co. MS. McGraw HillBook Company. Yogyakarta. Oxford University Press. 1. Darlington. Sinha & S.lemlit. Plant Systematics. SB. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia.go. MW. Act Phytotaxo. Tamarin. 1998. ZhongShu. PJ. 1955. www. Ramachandran. Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit. CA. Plant Systematics. K & B. 305. stage. RK.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. USA. Memasukkan Agustus 2009 Diterima: September 2009 142 . 1965. Science Publisher. http://www. Karakterisasi Kromosom Melon (Cucumis melo L. Bakhuizen van den Brink. Eber. Singh. Inc. Little-knownTropical Drug Plant. Sixth edition. A. Fakultas Biologi UGM. California. 217-222. Diakses tanggal 5 November 2007.jst. Inc. Jstage. Karyomorphology and Relationships of Amentotaxus Pilg. Y.html. Jones. 2004. 176182. Walter Noordh off N. F. Tangui.http:// www. Russel. 51-57. 2000. 38 (6) : 525532. George Allens and UNWIN LTD. 1999. Ciawi. Tjitrosoepomo. G.) PI 371795. McGraw Hill-Book.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id. Cytological. Evolutionary Genetics. Inc. Delourne & AM. The Netherlands. Bot.unud. hartwick. Coccinia indica. Morfologi Tumbuhan. Smith. CD. RH. Inc. Coccinia grandis. 98-101. 1996. e d u / P re b u i l t / BiolJBR3_www. New York.jst. & AE. Techniques of Plant Cytogenetics. Ferruci. USA. 2000. 1-77. 37 (4) : 380-383. Sundari. 2006.Rindyastuti &Daryono Backer. 2007. Guha. Yogyakarta. 2003.go. & D. Principles of Genetics. & AP.V Groningen.pdf/10Pemanfaatan TumbuhanObatDiare109. Zhi-Jiang & Y. serta Isolasi dan Identifikasi Senyawanya”. 1998.kalbe. New York.. Sin. H. London. 3-5. www. Chromosome Atlas of Flowering Plants. G. Genetics. The Benjamin/Cummings Publishing Company. & RC. Flora of Java Vol. Winarno. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. Qi-Xing. Science Publisher. Econ. Cheure. R. 2002. h a r t w i c k .id/ind/ detailPenelitian. Subramaniam. 234-325.

antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan. yang 143 . This isolate grew optimum at 300C. degradasi. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH. 1984) yang sangat berbahaya bagi kesehatan manusia. Cycloclasticus pugetti. yang tersusun dari gabungan tiga cincin benzena.. Pseudomonas spp. Phenantrene is one of the most persistent organic substances in environment.. Keywords: Phenanthrene. pH 7. yang merupakan salah satu senyawa karsenogenik (Cerniglia.5 hours and specific growth rate of 0. distribusi. About 75 % of phenantrene was degraded after 12 hours. Alcanivorax Borkumensis M5 was isolated from sea water. maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan.Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) . biostimulasi dan bioaugmentasi.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya. Polyhydroxybutirate (PHB) was produced during culture growth. perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu. Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta. Menurut Brodkorb et al. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi. but the synthesis was inversely correlated with the cell growth. and able to degrade phenantrene after 5 hours. 1992. Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. metilpropil). maka. Salah satunya adalah phenanthrene.8 with a doubling time of 14. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. Jl. degradation .bacteria Kata kunci: Phenantren. produksi. Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil. The relation between PHB synthesis and phenantrene degradation is due required further investigation.0476/hour. dietil.

850 LS. 0. BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta.72 gr KCl. Untuk memadatkan media.0 mg FeCl2·4H2O. larutan kedua mengandung MgCl2. Letak astronomisnya adalah 106. 2002). Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit.60 BT dan 5. 27 mg H 3 BO 3 . 31 mg NaHCO 3 . 0. oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya. 24 mg SrCl2·6H2O. NaHCO 4 . salinitas temperatur dan status nutrisi.6 dengan NaOH). Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan. Na2SO 4.3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}.98 gr Na2SO 4.18 gr MgCl2·6H2O. Lo´pez et al. 1. NaF. Uyttebroek et al. PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh. Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. 3. 1.6 mg NaF. Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%). Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. 144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi.0 gr/L) ditambahkan pada larutan pertama. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al. Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22. 89 mg Na2HPO4·7H2O. NH 4 Cl.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. KCl. NaBr. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC). Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. H 3BO 3 . 2001. . dan 2. Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH. dan larutan ketiga mengandung FeCl2. termasuk pestisida. dan SrCl2 (divalent cation salts).27 gr NH4Cl. 11. 2006 ).79 gr NaCl. 2. CaCl2. 83 mg NaBr. Noble Agar (Difco) (15.46 gr CaCl2·2H2O. karena memiliki metabolisma yang berbeda dengan mikroba teresterial. Larutan pertama mengandung NaCl. Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7.

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

8 0.2 1 0.501 R2 = 0.0266 1.0437 pH 5.2273 R2 = 0.0476 0.8 Y= 0.0476 x + 0.0143x + 0.3 0.17 30 C 40 0C Salinitas 3.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.4 0.7 0.9685 R2 = 0.302 Y=0. Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.6 0.2 0.3% Salin 5% 1.6 0.9 0.0369 0.4 OD 600 nm 1.0369 x +0.79 48.8 dan pH 5.4 0.8 0. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 .9704 0.3% Salinitas 5% 0 Td (jam) 15.4 OD 600 nm 1 0.018 x +0.9977 2 0.0143 0.4 0.25 18.018 0.7 38.5 0.5 25.8 pH 5.2 1 0.0437 x + 0.3958 Y=0.8869 R2 = 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.0266x + 0.6 0.3887 Y= 0.Dyah Supriyati Tabel 2.6 1.94 Y= 0.33 14.6 1.9459 R 2 = 0.8 0.3344 Y= 0.17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7.17 Gambar 2.9701 R = 0.

Hal ini menunjukkan bahwa.5 jam berarti bakteri mempunyai waktu generasi 14.5 0 Salin3.3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5. salinitas maupun pH yang serupa dengan asalnya.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC. dan produksi sel). Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini.3 0.05 0 Salin3. Sedangkan. 2. laju pertumbuhan.7 jam .5 jam.17).25 0.5 jam di salinitas 3.4 0. Pada media dengan pH 7. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%. pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3. pertumbuhan bakteri M5 mulai lemah. Dilihat dari 3 parameter di atas (waktu generasi. Di salinitas 5%. Nilai waktu generasi M5 ini lebih cepat.17 (45. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25. Dengan td 18.2 0. bakteri ini bisa dikategorikan sebagai bakteri laut tropis.3% Salin 5% pH 5. bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis.1 0.. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38.bakteri mempunyai waktu generasi 18.5 1 0.3% Salin 5% pH 5.15 0.17 Media Media Gambar 3. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .35 0. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5.7 jam. seperti misalnya di perairan laut Indonesia. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas. Artinya setiap 14. dengan td 14. Pada media dengan salinitas 3.3%. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur.3 %.3 % lebih baik dibandingkan dengan 5.3 %.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5.8 bakteri M5 mempunyai td 15.5 Berat sel (gr/l) 1. Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3.17 PHB mg/g sel 2 0.79 jam Nilai waktu generasi M5 ini lebih cepat.

Appl. bakteri M5 justru sel membentuk PHB paling sedikit. Appl. suhu 30oC dan pH mendekati netral (7. sel jusru membentuk PHB lebih banyak. Media seawater ini dipilih karena menurut Springael.3 % . &R L. Dawes.atas bantuan yang diberikan hingga selesainya tulisan ini. 54:450–472. A. Made Sudiana. Dengan tumbuhnya bakteri M5 tersebut. Occurrence. & E A. metabolism. Microbiol.Pada media dimana pertumbuhan bakteri M5 terlihat terhambat.J.. DAFTAR PUSTAKA Anderson. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%.8) Kemungkinan isolat M5 mampu membentuk PHB. Microbiol. Brodkorb.1%). 1992. Microbiol. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. 150 . 1990. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene. 1984.Adv. Rev. Environ. Microbial degradation of polycyclic aromatic hydrocarbons. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. metabolic role. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. CE. 1990) pada proses anaerobik-aerobik. yang berperan pada proses degradasi phenantrene.Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini. Pada media yang relatif optimum untuk pertumbuhannya. pada media air laut mengandung phenantrene. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene. Legge. TS. 30:31–71. tumbuh optimum pada salinitas 3. 58:3117–3121. and industrial uses of bacterial polyhydroxyalkanoates. dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0. Cerniglia. perlu diteliti lebih lanjut.

Minguillo´n & M. Z. MP. 2006. Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models. P. & U. Bendixen. AR. H. L. Environ. 8:836–847. Springael. 70:747–756. Karlson. J. Microbiol. 68:2683–2689. Biotechnol. Environ. Metabolism of fluoranthene by Mycobacterium sp. Ortega-Calvo. Karlson. 1999. Appl. Mulder. M. 2001. strain AP1. Microbiol. Hausner. 2002. Breure & WH. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil. H. Microbiol. JJ. AM. Appl. C.&U. Vila. Ryngaert. Bastiaens. Rulkens.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama. Wattiau. Uyttebroek. Karlson. S. D. Kasai & K. 1:63–70 Johnsen. U. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). Breugelmans. Lo´pez. Memasukkan: Agustus 2009 Diterima: September 2009 151 . Janssen. Johnsen.. Biotechnol. A. Joffe. B. Kishira. Appl. Microbiol. Y. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. Mol. 63:452–459. Biotechnol. 2006. 2004.. Grifoll. J. Chemosphere 43:1085– 1094. M. Shutsubo. Petroleum biodegradation in marine environments. ARK. Microbiol.

Abstrak : Suryajaya. Jakarta . KATA KUNCI (maksimal 6 kata). 151-158. No. 2000. Vol 6. Indon. Pola Pertanian. Washington. ABSTRAK (bahasa Inggris. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). D. P. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris). Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). 15 –18 Oktober 1982. Liquid culture. Tesis. tanpa mengubah jenis huruf. Abstrak Pertemuan Ilmiah Mikrobiologi.E. 1990. Drew. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. Cambridge. A. BAHAN DAN CARA KERJA. R. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point. & SW. HASIL. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. Identification of plasmids linked with polyglutamate production in B. Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim.net/primates/loris/ lorCp. Enzyme Technology. Krieg (eds. 29: 345-354. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). & N. ASM. dan lain-lain dimasukkan melalui fasilitas insert.. 1999. Disertasi : Kemala... Gen. & MT. 1983. W. Batas dari tepi kiri 3 cm. Biol. Skripsi. . Perkembangan tanaman polong-polongan utama di Indonesia. 248-277.R. Detection and Identification of Lories and Pottos in The Wild. 1982. maksimal 250 kata). Jakarta. Cambridge University Press. PEMBAHASAN. Dalam : Gerhart. Prosiding : Mubarik. Methods for General and Molecular Bacteriology. Buku : Chaplin. & C. Bucke. PENDAHULUAN. MF. 15-16 Februari 2000.[Disertasi]. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. Apll. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris. Penulisan simbol α. & S. J. Suhartono. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA. 42. Suwanto. NR. Bogor : Institut Pertanian Bogor.A. P. Setiap halaman diberi nomor halaman secara berurutan. http//www. β. H. Zhang. Wood.1. χ. Kata dalam bahasa asing dicetak miring.G. Microbiol.). atas. S. Ueda. foto. dan tabel disertai CD. Murray. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah. 1994. 1987. Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali.html. JR.species.. subtilis. T. Bab dalam Buku : Gerhart. Informasi dari Internet : Schulze. Information for surveys/Estimated of population density.J. dan bawah masingmasing 2. kanan.

Heryanto MSc. Indon. Vol 6. No. Puslit Biologi-LIPI Ir. Desember 2009: Dr. Majariana Krisanti MSi. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Biol. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr.J.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6. Niken Tunjung Murti Pratiwi. Hari Sutrisno. No 1. Rugayah. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 . Puslit Biologi-LIPI Ir.

Vol 6. No. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. Indon.J. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Habib Rizjaani.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 . Agustina K. Ostrinia furnacalis Guenee Bahagiawati. Kartono Identifikasi Papasan (Coccinia grandis (L. Biol.

You're Reading a Free Preview

Mengunduh
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->