J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

Hidayati 1). M. Centrosema pubescens. O. vaginalis. Cyperus monocephala. NPK. Bogor Titi Juhaeti 1). P. molesta also showed the highest capasity to accumulate Hg/year followed by C. Syarif 1) & S. Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. conjugatum. Hg. Cibinong Science Centre. Kabupaten Bogor. vaginalis. biomass. Hg. nudiflora were selected for fitoremediation of Hg contaminated soil. Desa Bantar Karet. Limnoharis flava. molesta showed the highest biomass followed by M. sativa dan C. Monocharia vaginalis. Based on characteristic of hyperaccumulator plant. The result showed that the growth of each plant was significantly different. molesta. The fertilizer treatments were significantly affected plant growth. sativa and C. ke sawah ataupun ke kolam ikan. vaginalis. this research suggested that S. Kemungkinan 1 . F.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. Paspalum conjugatum. Kabupaten Bogor. N. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya. conjugatum dan M. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. nudiflora. P. Cibinong. Kecamatan Nanggung. Desa Bantar Karet. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). Desa Bantar Karet.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. accumulation capacity Katakunci: Tumbuhan akumulator. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. The aim of this research is to study the potency of Salvinia molesta. Bogor E-mail : tihaeti@yahoo. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. Keywords: Accumulator plant. Meanwhile S. O. The S. biomas. manure and compost. The treatments were fertilizer: no fertilizer (as a control). Kecamatan Nanggung. Kecamatan Nanggung. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. Oryza sativa. nudiflora.

dan kubis. 2004 Dalam Rodriguez et al. Centrosema pubescens. 2007. dikenal dengan nama sentro. 2000. Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). barley.Juhaeti. di kebun. Chen et al. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. kacang-kacangan. di tempat yang agak basah seperti di pinggir sungai juga di sawah. merupakan tumbuhan terna memanjat. di hutan sekunder. Salvinia molesta. Cyperus monocephala. Mikania cordata. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan.. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. 2001. Pivetz. rumputrumputan dan tumbuhan air. Indian mustard. 2 2001. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. oat. penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis. Cyperus monocephala dikenal sebagai teki badot. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum. mata lele). Centrosema pubescens Benth. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung. Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Kayser etal. termasuk pohon. di tepi jalan. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. gandum. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. Commelina nudiflora. Salvinia molesta (kiambang. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. Monochoria vaginalis. Hidayati. di daerah Sunda disebut jukut pendul bodas. 2000.. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. Terry and Banuelos.

Kab. Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi. BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. dan Cd pada tanaman. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn.S. Salvinia molesta D. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Kecamatan Nanggung. Ni. Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Desa Bantar Karet. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. Penelitian dilakukan pada bulan Maret-Oktober 2007. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Penelitian in-situ dilakukan di Kampung Leuwibolang. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. Sementara itu. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Nanggung. Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. 3 . Desa Bantar Karet Kec. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman. Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa. Bogor. Dalam prakteknya. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor.

vaginalis. Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut. conjugatum. Pupuk kandang 5 kg/petak dan 4.L. 2. M. P. Mikania cordata (Burm. dan 5. 3. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen. Limnoharis flava (L.5 bulan setelah tanam. petak penelitian dijaga supaya selalu tergenang. O. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. Paspalum conjugatum Berg (jukut pahit). 3. sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat. 4. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1. Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman. sativa. L. pubescens dan M. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas). Sedangkan perlakuan pemupukannya adalah: 1. Hidayati.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1. konsentrasi Hg (ppm) di akar dan tajuk. flava.f. Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar. Untuk tanaman air. 4.f. sedangkan untuk tanaman darat. Oryza sativa (padi). 3. Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. Pada saat panen.Robins. Syarif & Hidayat Mitchell(kayambang).8 X 2 meter dengan 3 ulangan. Centrosema pubescens (sentro). Perlakuan pemupukan diberikan pada saat tanam.) Presl (eceng leutik). 2. tajuk dan total tanaman. Pada tahap ini jenis tanaman yang diuji dikurangi yakni C. Kontrol. seluruh biomassa tanaman berupa akar dan tajuk diambil. petak penelitian tidak tergenang. Commelina nudiflora L.Juhaeti. Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. 2. C. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama. Pengairan menggunakan air yang tidak terkontaminasi merkuri. . cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan. Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian. Monocharia vaginalis (Burm.(tali korang). HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S. molesta. Setelah itu. NPK 16 g/petak.) B. kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0.

1917 0. conjugatum C.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi.6 b 2620. Akan tetapi C.67 a 216.69 427.0 223.7273 1464.841 a 37.6 a 2018. vaginalis L.0500 3. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman.37 b 3 78.5 ab 2 1955.05 144. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman.600 c 63.5 a 1619.6917 2. C.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257.6 ab 2329.1 3.22 a 1110.46 241.51 47.8 a 2028.7 2778.75 95.74 619.667 34.233 Tdk ditanam Tdk ditanam 77.4 624.34 a 184.9 1523. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam.792 bc 70.9 Tdk ditanam Tdk ditanam 693.cordata tidak ditanam kembali (Tabel 1).7 b 2257. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879.65 345.133 56.8333 0. Hal ini dilakukan karena dalam fitoremediasi.580 Jenis tanaman S.3417 0.16 212. Produksi total biomasa tanaman (gram) tiap periode penanaman.95 66.3 12092 996.2 1671. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1.88 35. terlihat dari tingginya produksi biomasa tanaman. sativa M. pubescens M.6167 2.0 425.71 72.51 a 2 169.1833 3. cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3.786 b 5 .23 187. cordata C. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1.867 bc 59. nudiflora Tabel 2.04 153.66 a 269. Akan tetapi.53 c 751.99 a 287. pubescens dan M . onocephala C.138 a 87.2 1779.64 161.03 a 345.2 b 3 1050.617 102.69 b 152. molesta O. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921. dan C.0 1337. Pengaruh pemupukan terhadap pertumbuhan tanaman.2833 1.74 106.6 659.93 b 221.33 187.6 252.21 332.93 9. flava P. pubescens dan M.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala.3 2850. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.

T2 = O. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk. Monocephala.cordata.vaginalis. Syarif & Hidayat tersebut ke bagian tanaman yang dipanen.flava. T 6= C. Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman.conjugatum. konsentrasi Hg (ppm) akar tanaman (b). kecuali pada M. T4 = L. Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman. Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda. T3 = M. T7 = C. 6 konsentrasi Hg (ppm) .nudiflora. T9 = C. Sativa. Hidayati. molesta. T5 = P. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c).pubescens. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. masing-masing jenis tanaman menunjukkan kemampuan yang berbeda. dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab). hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a). T8 = M.Juhaeti.

T8 = M. Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. vaginalis. sativa. dan C. conjugatum. Sativa. Monocephala.cordata.vaginalis. T4 = L. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al.pubescens. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg). T7 = C.conjugatum. T3 = M. T5 = P. pubescens dan M. T2 = O. C. flava. T6 = C. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . L. T9 = C.nudiflora. P. Salvinia molesta. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. monocephala. sedangkan C.flava. marginal. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. M. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman. cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. molesta. perlu diperhatikan beberapa kriteria. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. Pada penelitian ini. O. Diharapkan. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2.

Hidayati. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. L. molesta. Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik. pubescens. yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air).nudiflora. C. hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. M. Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik. Kemudian. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O. . Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk. S. sativa.conjugatum. Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. monocephala. terbukti dengan adanya konsentrasi logam yang tinggi pada akar. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman.cordata dan C.flava. M. yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. Syarif & Hidayat yang tinggi (Reeves 1992). Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. P. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu.Juhaeti. Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu. potensi produksi biomasa tananaman yang diuji pun cukup tinggi. C. (2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal.vaginalis.

T7 = C. vaginalis. M. conjugatum dan M. molesta. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. P. C.pubescens. T4 = L. nudiflora. M. Tanamantanaman tersebut adalah S. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . vaginalis. O.nudiflora. T2 = O. sativa. conjugatum. Monocephala. molesta.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan.flava. molesta. M. O. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata. sativa. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman. sativa. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. O. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. nudiflora. umur panen. conjugatum. P. P. vaginalis. conjugatum. T8 = M. C. T6 = C. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat.vaginalis. jarak tanam. O. T5 = P. nudiflora. Gambar 3. Sativa. nudiflora dan P. sativa dan C. Vaginalis. T9 = C. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S.cordata. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. molesta. C. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman. T3 = M. molesta.conjugatum. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S.

278 C.456 16. vaginalis P.3 O.31 L.171 C. sativa M.13 1 O. pubscens M.9 6488. sativa M. sativa C. pubescens M. molesta O. mocephal 32. molesta C.849 41.3 10.11 2 C. flava M.03 31.183 M. vaginalis C. Hidayati.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S. nudiflora 6331.87 5030. nudiflora 18. vaginalis 33. cordata C.03 3949.758 C. conjgtum 55.2 4644. sativa M.529 P. vaginalis L. cordata C. flava M. flava 4. cordata C. molesta 111. molesta O.6 5077.2 M.8 C.401 7. molesta 190.9 C. conjgam 67.9 6936. flava 13.7 1254. flava O. nudiflora O.33 10513. nudiflora S.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O. sativa L. nudiflora P.214 S. conjugatum 4542.316 C.70 6 O.502 S.241 Kandang C. sativa 6098.5 M. monoephala 10. conjugatum C.5 1895. nudiflora 107. monephal 42.7 4742. vaginalis L.099 9.14 8. cordata C. conjugatum C.558 19. pubescens S. cordata C. cordata C.conjgtum 40.907 12. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46.095 19. vaginalis 7682.643 5. pubescens M.298 M.conjgtum C. puescens M.604 18. cordata 859.9 P. monoephala C. sativa 85.6 3894.357 P. monoephala M.455 O.803 L.937 9.Juhaeti. molesta 10897.197 C. flava P.471 33. pubescens S. nudiflora 114.627 P.581 24. molesta M.435 S. nudiflora 63. flava P. monoephala L. nudiflora 4504.5 M.049. nudiflora L. pubscens M. vaginalis 8. sativa 55. cordata C. pubescens 12558.43 4598.625 O.97 C. flava 24.55 C.931 C. vaginalis 28.55 4 10 . flava 44. molesta 13303. cordata C. flava C.9 8046. monephla 36. conjugatum 5625.999 3. vaginalis L.712 12. flava 18. vaginalis 42.104 31. molesta 55.253 M. Syarif & Hidayat Tabel 3. vaginalis 68.516 16.062 L. sativa P. sativa 159. sativa 4755.34 Jenis tanaman Kontrol NPK O.1 1721. monephala M.4 P. cordata C. sativa 141. nudiflora 57. conjgtum 11. vaginalis L. nudiflora 16. cordata C.912 P.605 Kompos S.13 1164. conjatum 107.498 M. moncephala C. moncephala M. pubescens 3216 5259.155 C. molesta M.848 12.mocephal 35. cordata C. molesta 63.conjugtum S. flava P.765 L. pubescens S.04 5 S.369 C. pubescens M. monoephala 2476.946 11.869.568 L.05 M. molesta 40.6 O.263 32.37 C. conjugatum C.3 2105. pubscens S.

Bogor. C. Practices 6(2): 165-175. 2004. N.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). 12-20 Oktober 2006. Syarif. RB. T.. & CL. CWN. Juhaeti. Hidayat.. 2006. Harapini. R.. Asencio. Baker. Memasukkan: November 2008 Diterima: Juli 2009 11 . Moreno. RD. 2007. J. Rincon. T. Hlm 253-227. Rodriguez.Plant. Anderson.. Di dalam: Backer. Mattioni. Hidayati. Nutr 14 : 1067-1080. N. Environ. Phytoremediation 9(1): 1-13. 1992. Reeves. Rodriguez. The Vegetation of Ultramafic (Serpentine) Soils. 1995. S. DAFTAR PUSTAKA Brown. Laporan Akhir Penelitian Kompetitif LIPI. AJM.. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution. Stewart & BH. SL. Proctor. The Hyperaccumulation of Nickel by Serpentine Plants. L. Int. Robinson. FN. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator.. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives. J. Soil Sci Soc Am J 59:125-133. Vergnano. Hidayati.. Hampshire: Intercept Ltd. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation. RL. Chaney. & O. JS. RD. Syarif & M. 2007. J. I. Juhaeti & F. F. Gabbrielli. 1991. Reeves (ed). International JSPS Seminar. J. Angle & AJM. Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation.

I. Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. One conspicuous morphological character of this genus is the adhesive 13 . distribution. I. Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a. Keywords: Cephalopoda. Indo-Pacific Kata kunci: Cephalopoda. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik. Idiosepiidae. Cell Imaging and Ultrastructure Research.go. The females reach maturity at 3 cm length. biserialis dan I. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. biserialis dan I. 1090 Vienna. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Dalam tulisan ini diuraikan karakter morfologi. of Life Science. Marwoto 2 University of Vienna. except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). ovally elongated with the long axis parallel to the body axis (Figure 1). Cibinong 16911 – Indonesia. distribusi. jenis sotong ini tidak diminati oleh para nelayan.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. Jackson 1988. Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. picteti hingga saat ini hanya dijumpai di Ambon. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I. habitat.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. the fins are small. habitat. Hylleberg & Nateewathana 1991b). Norman 2000). Sibolga dan Lombok. Research Center for Biology – LIPI. reproduksi dan siklus hidupnya. Banda.email: rist001@lipi. Idiosepiidae. pygmaeus. picteti. Fac. habitat. pygmaeus khusus dari perairan pantai di Lombok. pygmaeus herbereri. Ternate. siklus hidup dan distribusi Idiosepius. Austria 2 Museum Zoology Bogor. Nabhitabhata 1998. habitat dan distribusi empat jenis sotong mini jenis I. The animals are dorso-ventrally compressed and cigar-shaped. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. Karena ukurannya yang sangat kecil. The arms are short and robust and almost equal in length. Balikpapan. Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I.

in females. Unfortunately. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). up to this day. He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. pygmaeus has a wide distribution in Indonesia. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay. This species was thought to occur only in the Philippines. 2008). however. contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). Examinations by Nesis (1982). collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I. pygmaeus and the other species mostly in size. 2008. In 1927. they also lie in wait to capture prey swimming by. It can be assumed that this species has disappeared or even become extinct. pygmaeus from several institutions and proposed that his specimens differ from I. In 1898. organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. picteti at Ambon Island. Lombok. more than 115 years ago. The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. Idiosepius pygmaeus hebereri was .Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. Furthermore. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. Cyran et al. Appellöf discovered I. revealed that the morphological characteristics were insufficiently different to justify the subspecies. Grimpe (1931) compared the collected material with samples of I. Joubin (1894a) collected one male holotype sample of I. 1881 in Ternate 14 and Banda-Sea. Indonesia. Later. Hiding there. pygmaeus Steenstrup. The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). Collection of Idiosepius in Indonesian waters has long history.

Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus. individuals of I. pygmaeus below).300´S. METHODS Idiosepius specimens were collected along the bay of Lombok in November .166´E) (Kalk. von Byern & Klepal 2009). picteti and I.487´ E) (von Byern & Klepal 2009) and Ko Pratong. pygmaeus. RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss. many questions about their life cycle.Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I.184´S. Austria) and MZB (Museum Zoologicum Bogoriense). we report new collection places for Idiosepius in Indonesia and extend the previous type localities. 2005) Indonesia: Ekas-Bay.156´N.553´E) (von Byern & Klepal 2009). 35° 22.721´E. Inhambane Bay (23° 51.December 2007 using a dipnet. Japan. Apart from I. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. Lombok (08° 52. Research Center for Biology – LIPI. Indonesia.541´E) (von Byern et al. a further species. So far. biserialis. geographical distribution and origin of migration remain. it was thought to occur only in African waters (Mozambique) and Thailand. 26° 02.281´E) (Voss 1962. The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. 32° 54. 35° 22. Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong. von Byern & Klepal 2009) Japan: Takasu. Cape Town. pygmaeus. 1962 (Figure 2A) Holotype: deposited at South African Museum. I. less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia). 1959. 32° 54.020´S. This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals. 2005) . 98° 25. Shigeno (von Byern et al.331´S. Adam 1986. Previously. picteti.215´S. 116° 27. was recently discovered in Indonesian waters (von Byern et al. Phuket Island (8° 02. Ekas-Bay. San Jose Mission Station. Collector: S. South Africa (SAM A6520) Type locality: Mozambique. Monque (23° 41. Lombok (08° 15 . 2005). The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections). With the present description and geographical data. Nevertheless. In contrast to I.

pygmaeus (Nesis.Byern & Marwoto 50.1 mm females). 1962). 1982). The fins are more rounded kidney-shaped and A B 14. Animals from Mozambique are small.7 ± 1.54 mm males and 7.781‘ E) . Both ventral arms in the male are hectocotylized. collected November 2007 (unpubl. The left arm also has two small flaps. 357‘S . In the caught male. separated by a deep cleft. 16 . which are nearly constant in size to the end of the club. with a mantle length of 4.38 ± 1.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I. bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm. B) I. 116° 26. The fins are semicircular and about ¼ of the mantle length.35 mm 15. data) Morphological characteristics: This species has the smallest specimens of the genus. 714‘S . picteti (Joubin. 116° 27. the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. at the tip. slender. 1894a) and C) dorsal and ventral view of I.2 mm C 7.5 ± 0.3 mm (males) and 7.84 ± 0. The specimens from Thailand are larger (ML to 5. biserialis (Voss. The clubs of this species bear two rows of small suckers.31 mm (females).857‘ E) (08° 50.

The right ventral arm in the male is very short and broad. The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm. Denmark (ZMUC CEP52) Type locality: Philippines. 1887 Idiosepius pygmaeus Hoyle. 1881 (Figure 2C). Copenhagen. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia. 98° 24. The oral face the arm is transversely plicate. while the two investigated females have a mantle length of 5. The left ventral arm is more slender. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe. The tentacle clubs have two horizontal rows of suckers. Idiosepius pygmaeus Steenstrup. Idiosepius picteti Joubin.030´E) (Suwanmala 17 . 1886. Klong Bang Rong (8° 02.35 mm.472´E) (von Byern a & Klepal 2009). 98° 25. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”.39 ± 1. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available. Synonymy: Idiosepion pygmaeum Fischer. The animals from Japan are almost twice as long (6. Joubin 1894b. The body is large and elongate (mantle length 14 mm). Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle.107´N.1 mm females) with 3 suckers on the left and 5 on the right ventral arm.34 ± 0. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male. Zoologisk Museum. Idiosepius picteti has a small tentacle club with four rows of suckers. sometimes also three or four oblique rows of suckers.945´N. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle.25 ± 0. 1920 Naefidium picteti Grimpe. Zamboanga (4° 20´N. Our examinations of this specimen reveal that Joubin (1894a) erred. no additional specimens of this species have ever been found.89 mm males and 9. 1931 Holotype: deposited at Kobenhavns Universitet. Genève. Amboina – according to Joubin. longer and bilobate at the tip. Each ventral arm has a single small sucker near the base.

collected December 2007 (unpubl.52 mm in males and 16. 1931 Holotype: deposited at the Zoologisches Museum. pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe.26 ± 4.12 mm females) to I. data) • Gili Lawang (08° 19. rounded and slightly constricted at their base.28 mm males and 15.51 ± 1. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm. one individual has 1/1. Grimpe (1931) . bilobated at the tip. Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). Museum für Naturkunde der Humboldt-Universität.012‘ E).730‘ S. Institut für Systematische Zoologie. The 18 right ventral arm is stout and thick.885‘ S.637‘ S. Semmens et al. I. 119° 42. Lewis 1991.244‘ S.015‘ E). Jackson & Choat 1992. 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville. 116° 27. Balikpappan (Grimpe 1931). 116° 42. 146° 50´E) (Jackson 1988. Idiosepius pygmaeus from Indonesia is similar in size (11. The specimens bear 4 rows of suckers at the club of the tentacle.Byern & Marwoto et al. collected December 2007 (unpubl.020´S. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay. The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). collected December 2007 (unpubl. More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms. data) • Telong Elong (08° 48. while the left arm is thinner and slender. North Queensland (19° 15´S. Germany (ZMB) Type locality: Indonesia.5 ± 2.937‘ E). Berlin. another 4/4 suckers on the hectocotyli. Ekas-Bay.53 ± 1. The fins are small. Jackson 1993.709‘ E). Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus. According to the description of Steenstrup (1881). 116° 30. collected November 2007 (unpubl.37 mm in females. data) • Rinca Island (08° 39. 1995. Pecl & Moltschaniwskyj 1997. data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11. Jackson 1992.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19. 116° 43. Lombok (08° 52. short. both ventral arms have only one sucker at their base. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898).

ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. spawning. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982). 1962.5 mm. The left ventral arm is longer and bigger than the right arm. the onset of sexual maturity or postembryonic behaviour. I. 1921. relatively little is known about the biology and life cycles of Idiosepius. biserialis and I.5 mm. At its base the left arm has 3 suckers. I. Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss. 1845). For example. thailandicus Chotiyaputta et al. paradoxus (Ortmann. Japan. data). Within the genus. I. The species are mostly distributed in the tropical Indo-Pacific. I. 2003). The females of this subspecies have a mean mantle length of 14. the geographical distributions of all Idiosepius taxa are still only marginally explored. 2005). Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. the males of 8. notoides Berry. Moreover.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri. 1991. and also has two lobes at its tip. DISCUSSION Systematics The relationships among species within this genus remain unknown. 2002). The fins are small and have a round to almost oval form. embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983. but this value needs verification. southern Australia including Tasmania. I. Presently. 1962. 1888). All observations on this genus concerning behaviour. picteti (Joubin. but individuals were also found in cooler Russian waters (Nesis et al. I. Jackson 1992). pygmaeus Steenstrup. I. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. biserialis has the widest geographical distribution. and African waters. pygmaeus). no data are available about its postembryonic life. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . unpubl. 1894a). I. macrocheir Voss. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al. paradoxus inhabit sea grass and algae areas. minimus (D‘Orbigny.g. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). von Byern et al. while the right arm is more stocky and broad with 2 suckers at the base. Others like I. 1881 and I.

2006. Japan and Thailand. W. such as those along the eastern part of Lombok Island at Gili Sulat. During high tide. indicating that this species is specialised for sea grass areas (von Byern et al. garbage. SS. Berry. Naturelles de Belgique 56: 149-154. Moreover. REFERENCES Adam. Telong Elong and Ekas-Bay. So far. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. the garbage in the water apparently does not affect I. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. 47 (1): 39-55.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. J. von Byern & Klepal 2009). Lalu Japa & Karnan from Mataram University. 1921. Bull. Gili Lawang. Moreover. Sci. Additional genetic. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. individuals of the former I. Lombok Island. In contrast. ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. Cephalopoden von Ternate. The Philip. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. de L´Institut Royal des Sci. Interestingly. and Idiosepius. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. 2005. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. These observations agree well with other collections of I. western and south-western shores of the Island. 1898. pygmaeus could only be found in mangrove forests and belts. . the animals were also observed to mate within this flotsam and escape under the waste when threatened. I. A. Appellöf. Our thanks go in particular to Mrs. We still do not know whether the animals stay there at high tide or move elsewhere. Biology Department and furthermore to Mr. but are clearly absent in the northern. 1986. biserialis in Africa. leaves and other plant material were transported here by the current. 1881 (Mollusca Cephalopoda Decapoda). pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. On some days this flotsam covers almost the whole water surface. Sepiadarium. von Byern & Klepal 2009). Cephalopods of the genera Sepiolidea.

G. Gide et Cie.M. Chaitiamvong 1991. G. Redescription of Idiosepius pygmaeus Steenstrup. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus. 1992. Jackson. Teuthologische Mitteilungen IV. internal anatomy. 1988. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles. Grimpe. Idiosepidae. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. ACV. Cephalopodes Familie XIII. 1962. Mollusques vivants et fossiles.S. GD &J H. A new record for the Andaman Sea. Malacology 50 (3): 165-174. von Byern 2008. Cyran. pro: Loligo picteti Joubin 1894.. Okutani & S.S. 1887. Paris. 350-351. Tome Premier. Zool. GD. sp. & A. CH. Nateewathana 1991b.Sci. Libraire F. Choat 1992.g. Australia.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. Bull. 1881 (Cephalopoda: Idiosepiidae). GD. 1931. Phuket Marine Biol. (Cephalopoda: Idiosepiidae). Jackson.M. Cephalopoda). Nateewathana 1991a. Naefidium n. Über die Cephalopoden der SundaExpedition Rensch. Savy Paris. 1920. P. 1845. Cephalopods of the world . The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus. J. W. 1962 (Mollusca. Jackson. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n. 55: 33-42. Report on the Cephalopoda collected by H. Fish. Zoology 16: 1245. Center Res. Fishery Bulletin 91: 260-270. Grimpe. Bull. Venus. Challenger during the years 187376.An annotated and illustrated catalogue of cephalopod species 21 . Fischer.. Jackson. P. Anzeiger 51: 208-214. North Queensland. with mention of additional morphological characters. Fish. GD. J. 56: 1-9. Bull. Klepal & J. Teuthologische Mitteilungen XIII. T. Morphology. & CFE.J. J. Anzeiger 95 (5/8): 149-174. WE. 1886. Can. 49: 218-228. Hoyle. & A. The Veliger 35 (4): 396-401. 1993. Hylleberg. 87: 265-272.Challenger during the Years 1873-76. N. Jereb. Report on the Scientific Results of the Voyage of H. Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss. Phuket Marine Biol. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. Aquat. Growth in tropical cephalopods: An analysis based on statolith microstructure. D‘Orbigny. Center Res. Zool. Roper 2005. Hylleberg. The Jap. and biometrics of the cephalopod Idiosepius biserialis Voss.

Pecl. Kalk. S. K. Cephalopods of the World. Lewis. Zool. Norman. Levitov. Joubin. Céphalopodes d‘Amboine. Nabhitabhata.Sci. V. The zoogeographical composition of the intertidal fauna at Inhaca Island. AR. Royal Soc.S. Sepiidae.First record of Idiosepiidae in Russian seas. Zoo.. London. L. MD. London. M. 1983. 1991.: 178-180. Jahrbücher 3: 639670. Hamburg. GT & N A. Sci. Mémoires de la Société Zoologique de France 15: 80-145. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. Annotationes Zool. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae). Nesis. & N A. N A. J. Sasaki. for English Translation. Alexander 1995. Moscow. 1902. 1982. 1987 TFH. African J. a small tropical cephalopod. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. 242: 751-764.A. Phuket Marine Biological Center Special Publication 18 (1): 25-40. 266: 1133-1139. Behavior 85: 42-57. J. Joubin. Revue Suisse de Zool. G. Idiosepiidae and Spirulidae). Rome. Ltd. du Musèe d‘Historie Naturelle de Genéve 2: 23-64. 1st. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. 2002. Idiosepius pygmaeus Steenstrup. Revision des Sepiolidae. K.Byern & Marwoto known to date. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus. 1998. 1888) (Cephalopoda) . 4. Copyright Agency of the UdSSR for Light and Food Industry Publishing House. Moltschaniwskyj & CG. Inc. Japanische Cephalopoden. et Ann. North Queens-land. Ratnikov. J. Ortmann. 3: 459-460. 1921. Vol.. Sepiadariidae. Okutani& Chaitiamvong. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. Moltschaniwskyj 1997. Food and Agriculture Organization of the United Nations. Joubin.P.A. Idiosepius thailandicus Chotiyaputta. M. Australia. 1-82. 22 . FAO species catalogue for fishery purpose. 1: Chambered nautiluses and sepioids (Nautilidae. Revue Suisse de Zool. 2000.. Distinctive Behaviour of Thai pygmy Squid. A. Moynihan. 1888. ON. Moltschaniwskyj 1999. L. Mocambique. Tintenfischfuehrer. 1894a. Katugin & AV. 1991. 1959. Publications. Translated from Russian by B. Nesis. Semmens. Sepiolidae. Pecl. Japonenses 10 (21): 209-213. 1894b. Ruthenica 12 (1): 81-84. Somatic growth processes: how are they altered in captivity ? Proc. No. Jahr Verlag. M. L. On an adhering habit of a pygmy cuttlefish.

Selsk. & W. species. 1881. Biol. of S. 1): 211-242.. Voss. Cyran & W. L. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea).. 2006. J. 1949. 2007. GL. Mus. 234: 1-180. J. Nabhitabhata. J. von Byern. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. and Spirula Lmk. Phuket Island. Nat. MA. Phuket Mar.Skrifter Raekke 6 (Bd. Idiosepiidae) at Klong Bangrong. K. Shigeno 2005: Distribution pattern of a minimalist . J.UK. J. von Byern. 75: 885897. N. SR. Biol. Venus. Rudoll. Memasukkan:Maret 2009 Diterima: Juli 2009 23 . von Byern & J.Mar. J. 1963.UK. Klepal 2008. Occurrence of Idiosepius pygmaeus (Cephalopoda. the Japan. 2003. Voss. Cephalopoda): 38-43. Histochemical characterization of the adhesive organ of three Idiosepius spp. Thailand.Biol. Klepal. Observation of Idiosepius pygmaeus (Cephalopoda.National Mus. U. 83: 1297-1300. Res. Mollusca).. Yamamoto. von Byern. Transaction of the Royal Soc. 67: 49-51. & Histochemistry 83 (1): 29-46. With remarks on the two related forms Sepioloidea d´Orb. Mar. J. J. 1962.New records for Idiosepius biserialis (Idiosepiidae. J. Idiosepii-dae) in Indonesian waters. South African cephalopods. Steer & GT. Suwanmala. Malacology 15 (5-8): 94-96. Associate.Cent.Wien 108 B: 137-144. T. Reevaluation of systematic characters of Idiosepius (Cephalopoda. Cephalopods of the Philippine Islands. Steenstrup.Occurrence of Idiosepius (Mollusca: Cephalopoda) J. Bull. GL. Bull.S. S. Pecl.Assoc. von Byern. Klepal. Nürnberger & S. Biotech. & W. Tracey. Hist.. Sepiadarium and Idiosepius two new genera of the family of Sepia. 2009. Ann. Africa 36 (4): 245-272. Malacologica (in press).danske Vidensk..

maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi. females.3. Recruitment occurred every month in the males. also by the thin and fragile shells of the clams. females. 2001). and the size of males was less than females.43. Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al. The peaks of males were in June (12. 1. pertumbuhan. kematian. and also males and females combined. Over a 12 months period (Januari 2005 – Desember 2005).63 mm. females.58 mm. annual growth coefficient (K) of males. rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska. (Anodonta edentula) in mangrove ecosystem were determined.38%) and October (14.65. The results showed that asymtotic length (L infinity) of males. population parameters of tropical mudflat clam. there were two unequal pulses.5 and 1.67%) and May (20.3 years for the males.88mm and 70. 2001).1 year for males and females combined. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria). total mortality rate (Z) of the males. which indicated a fast growth of the clams in relatively short period. 2 years for the females. 4.88%) and August (15. Keywords : Mudflat clam. growth. dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001). recruitment. and 2. Overall.Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000.12%). These high rates were caused by the extreme life condition. also males and females combined were 4. females.5 respectively. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis. The objectives of this research were to study population parameters (growth.56 ± 0.95 ± 0. also males and females combined were 65. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam.26%). also males and females combined were 1. while in the females were in April (16. (Anodontia edentula) in Mangrove Ecosystem. and 4.77%). which were 2. and in the males and females combined were in March (12.31. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 . mortality.61 ± 0. Kata kunci: Kerang lumpur tropis. 70. Subsequently. Berbagai organisme mendiami ekosistem ini. recruitment pattern and mortality) of this tropical mudflat clam.

2001. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1). Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula.00 euro/kg. serta ditimbang berat basahnya menurut jenis kelamin. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. dilakukan sebulan sekali selama 12 bulan. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3. mortalitas dan rekrutmen dari populasi kerang Anodontia edentula. Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000. Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm. Lebata &Primavera 2001) Demikian pula di Thailand. serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. Di Indonesia kerang ini belum mendapat perhatian. Pengambilan contoh kerang lumpur Anodontia edentula.Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. yaitu musim Barat dan Timur. Di Maluku. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. Aktivitas ekploitasi yang berlebihan. . Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim.

t adalah umur (atau umur relative. Lokasi penelitian 27 . Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: . maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.39220. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i. L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami. “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i. Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan.95(L”) dimasukkan ke dalam persamaan diatas.Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03.2752 log10 L” -1. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2. Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur.1. dimana K adalah koefisien pertumbuhan.038 log10 K (Pauly 1980). Persamaan von Bertalanffy bila dijabarkan lebih lanjut.9957/K + to. dan jika panjang maksimum (L maks) = 0. Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0. yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang. dan b adalah sudut/ slope yang merupakan nilai Z. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i.

9658.9657 n = 2692 3. Kondisi pola pertumbuhan yang berlaku pada kerang jantan.13.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2). Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0. dengan nilai koefisien determinasi (R2) sebesar 0. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa. 28 .0001 L3. Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0.3134 (L = panjang dan W = berat). Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam. berlaku juga pada betinanya. HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0.00008 L 3.9327.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0.0002 L3.Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992). Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0. Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3). Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123.321 dengan nilai koefisien determinasi (R2) sebesar 0.15. Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275.9294.0002x 2 R = 0.1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0.

29 .3213 R2 = 0. memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula.58 mm dengan koefisien pertumbuhan (K) dari jantan. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.38. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3.288 R2 = 0. 70. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65.88 mm dan 70. betina dan total masing masing 1.9327 n = 1192 Gambar 4. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan.63 mm.9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. dengan menggunakan program FiSAT. 1.3. (Gambar 4). Analisis distribusi sebaran cangkang selama periode penelitian. Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128. sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan.5 per tahun.5 dan 1. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3.

Kalkulasi laju mortalitas untuk jantan. Nilai mortalitas total didapat dari negatif slope.56±0.e-1.3922-0.4(t+0. Dari nilai-nilai K dan L” yang telah diperoleh di atas.97. betina dan total masing-masing 99.35 mm.31. Dengan memperhatikan umur maksimum.087) ] Dari beberapa parameter yang diperoleh. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan.038 log10 K.6% per tahun.19–4.41-4. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.0. Gambar kurva LCCC dari kerang jantan.56 X dengan r = -0.087 tahun atau 1. betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut. betina dan total terlihat pada Gambar 7. maka didapat umur kerang terpanjang (life span) adalah t maks = 2. betina dan total masing masing 2.5(t+0. betina dan total dari model yang terbentuk. jantan. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol. betina dan total masing-masing adalah 4. dengan demikian Z untuk jantan. umur to. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol).096 tahun atau 1.61±0. Dari hasil perhitungan t0 terhadap kerang jantan. 2 tahun dan 2.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam.95±0.0% dan 99. betina.e-1. 99.61 X dengan r = -0.33– 4.7%. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu.99. sedangkan untuk panjang maksimun jantan. -0.95 X dengan r = 0.096) ] Betina : Lt = 70.3(t+0.1 tahun.97 bulan dan total .00 bulan. dengan memasukkan formula Log10(-to) = -0.e-1.70 mm. Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65.95(L”) dimasukkan ke dalam persamaan di atas. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm. Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve. kerang betina dengan Y= 10. 4. Rentan hidup (t max) dari jantan.081) ] Total : Lt = 70. dimana dapat dilihat pada Gambar 6. dan jika panjang maksimum (L maks) = 0.43.15 bulan.2752 log10 L” 1. Jika ditinjau dari segi biologi. dan kerang total dengan Y = 11.34 mm dan 67. maka dapat dibentuk dugaan kurva pertumbuhan.081 tahun atau 0.98. K dan L”. 67.63 [1 . maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan. betina dan total masingmasing diperoleh t0 = -0. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment . LCCC yang dibuat dari kehilangan individu setiap kelas ukuran. adalah Y= 10.3 tahun.58 [1 .9957/K + 30 to.88 [1 .65 dan 4. dan total masing-masing 62.

a) JANTAN b) BETINA c) TOTAL Gambar 5.Kurva pertumbuhan kerang jantan: L” = 65. Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan.4 31 . Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya.3 b) Kurva pertumbuhan kerang betina: L” = 70.88 mm dan K =1.5 c) Kurva pertumbuhan kerang total: L” = 71.28 mm dan K =1.Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam.0.31) a). Kurva pertumbuhan kerang A.63 m m dan K =1. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.edentula hasil analisis menggunakan program FiSAT (ver. tetapi ditemukan dalam tubuh induk kerang.

5 1 1.087) ] Gambar 6. kecuali bulan Desember.26%).096) ] 2 2. betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen.e-1.e-1.e-1.12%) dan total gabungan pada bulan Maret (12.5(t+0.67%) dan Mei (20.5 Wak tu (tahun) 2 2.5 3 Total : Lt = 70.77%. Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. Dugaan kurva pertumbuhan kerang Adonontia edentula. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65. Hasil olahan pola rekrutmen tergambar pada Gambar 8.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). yaitu 14.63 [1 .3(t+0.5 3 Betina: Lt = 70. Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0. Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 .081) ] 2 2.5(t+0. Pada kerang jantan.5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0. pada betina pada bulan April (16.88%) dan Agustus (15.5 1 1. namun hal ini cukup berarti bagi kesinambungan populasi di alam.88 [1 . persaingan dan tekanan lingkungan. (a).38%) dan Oktober. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. selain itu terdapat interaksi biotik seperti predator.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0.58 [1 . namun masih memungkinkan keberadaan status populasi kerang ini.5 1 1.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama.

Pendugaan parameter b. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya. (b) betina dan (c) total 33 . Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama. Kurva konversi hasil tangkapan panjang (LCCC) kerang A. 2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif.edentula (a) jantan. Pola pertumbuhan (b) (a) (c) Gambar 7. begitupun jenis yang berbeda bisa mempunyai pola yang sama. Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. koefisien hubungan panjang berat. Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. Penelitian dari Anodontia woodiana (Afanasjev et al.Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik.

47 14.45 0. Persentase rekrutmen bulanan jantan.Yuliana Natan Tabel 1.38 7. betina dan total kerang A.00 Betina 1. 34 .27 16.92 10.52 2.29 8.83 9.00 (a) (b) (c) Gambar 8.64 20. Persentase rekrutmen kerang A.67 8.31 15.95 0.45 12.39 0.35 6.29 2.77 8.12 7.47 12. (b) betina dan (c) total.25 6.22 9.95 8.67 10.94 10.edentula (a) jantan.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.88 11.39 15.19 1.97 0.16 7.98 3.26 18.12 13.00 Total 2.47 12.

Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity. sebesar 13 cm.3 tahun mencapai panjang asimtotik 35 . bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama.58 mm). Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya. memerlukan waktu mencapai panjang asimtotik 10 tahun.34 per tahun menunjukkan pertumbuhan yang lama.5 dan K gabungan = 1. Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi). edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0.227 mencapai umur 10 tahun (Afanajev et al. 2001). Berbeda jenis berbeda pula panjang infinity (L”). Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity.Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. Panjang infinity A. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000.95.3. dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh. K yang ditemukan perairan hutan mangrove desa Passo. Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2.edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya.18 mm dan K = 0. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang. maka panjang infinity adalah 13. Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132.5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm. panjang infinity mencapai 93 mm. dugaan panjang infinity (L”) A. Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Jenis lainnya seperti kerang estuari di Philipina.edentula sangat terbatas. dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi. Koefisien pertumbuhan. menunjukkan kecepatan tumbuh yang cepat. Literatur serta informasi tentang kerang A. maka L” lebih kecil dari di Philipina. K = 0.67 cm. K betina = 1. akan membedakan parameter populasinya. Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70. 2001).

Hal ini menunjukkan bahwa pada kondisi alami. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan. Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. dan gabungan jenis kelamin yaitu 2 tahun. yang sebenarnya ada penambahan individu baru. tetapi bulan Desember pada Tabel 1 tidak kelihatan. Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. selain itu terdapat interaksi . terutama menghindari perubahan lingkungan yang ekstrim. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek. seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003). Laju mortalitas total yang cukup tinggi.Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator. predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. namun hal ini cukup berarti bagi kesinambungan populasi di alam. begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin.3 tahun) dibandingkan dengan betina. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F). Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. Jika dilihat dari strategi hidup kerang.

Shell Shellfish Res. untuk jantan. Laju mortalitas total Z. 2000. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang. Archives of Polish Fisheries. Marine Pollution Bull. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. betina dan total masing-masing adalah 4.5 dan 1. betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14. 4. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi). Fakultas Perikanan Universitas Pattimura. dengan koefisien pertumbuhan (K) dari jantan. 9(1): 123.88 mm dan 70. 2.3. Pada kerang jantan. 37 .Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. betina dan gabungan masing-masing adalah 65. 2003. 11(42).56±0. Bulan Mei adalah puncak rekrutmen tertinggi.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2.26%). sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae). disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh. persaingan dan tekanan lingkungan. 70.95±0.12%) dan total gabungan pada bulan Maret (12. 2001. 17: 299-312. Kraszewski. Del Norte-Campos AG.65 dan 4. betina dan total masing masing 1. 241-245. tahun dan 2. 2004.3 tahun.61±0. yaitu Afanasjev SA. Lebata MJHL. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama..43.131. 2001. Zdanowski & A.38%) dan Oktober. baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan.31. Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia.88%) dan Agustus (15. West Central Philippines. Lebata MJHL. Anodontia edentula (Family Lucinidae). pada betina pada bulan April (16. Elsevier Science Ltd. Pelecypoda: Psammobiidae) from the Beate Bay area. B. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. J. 19(1). Asian publ. dimana ukuran jantan lebih kecil dari betinanya. Elemental Sulphur in the Gills of the Mangrove Mud Clam.1 tahun.67%) dan Mei (20. 1133-1138. 1.Sci. Unionidae) in the Heated Konin Lakes System. Oxygen. Laju mortalitas total yang cukup tinggi.77%.58 mm. Ambon. Latale SS. 58 hal.63 mm.

Shellfish Res. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. Seong. 1975. Computation and interpretation of bological statistics of fish populations. Sekolah Pascasarjana IPB. HDH. Sparre P. Board Can. TK. Murphy. T. Hugh. Venema 1992. Singapore Science Centre. J. Muhammed SZ. Tan. (Desertasi). A Guide to mangrove of Singapore 1. 2001. Bogor 162 hal. 20(3):1273-1278. & HM. Ng PKL.Zool 27:339-343. 2008. T. Introduction to tropical fish assesment. Fish. Lim KKP. Rome. Natan. Ricker WE.Sivasothi. 19:191-382. Yassien. Y. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam. KS. Tan.Ng & N. Animal diversity. Res. &SC. W. 2003. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis.K. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . In P. 2003 (Eds).Yuliana Natan Lebata MJHL. Sivasothi. Morgani. BC. Turkey. FAO Fisheries Departement. Bull. J. Primavera.L. 2001 Gill Structure. Tan. 407 p. N.

The research aimed at evaluating the effect of salinity.80 Bq/gr Cd.2354.09) was appeared in water salinity of 29% and of water temperature 30oC. Blackmore & Wang. It revealed that the small Perna viridis (5. Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. whereas the bigger size of Perna viridis (6. Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit. At the steady state condition green mussel accumulated 72. Perna viridis Kata kunci : Bioakumulasi. A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. panas pada bagian dada. Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik. Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme. radiotracer Cd. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS). Cd. Radiotracer 109Cd was applied in the study. 2002) dinyatakan bahwa kenaikan suhu. Dari berbagai penelitian (Morton 1987. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer.2 cm in length) accumulated 109Cd about 107. Pekanbaru. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. Perunut radioaktif.80 Bq/gr. It was found that both salinity and temperature had significant effect ( P< 0. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 . Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya.21 Bq/gr. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau.6 cm in length) had an uptake of about 72. tertinggi termasuk manusia. penyakit paru-paru akut dan menimbulkan kematian. Key words : Bioaccumulation.21-107.001) on accumulation rate of 109Cd. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Pada gilirannya pada rantai makanan. The highest concentration factor of Cd (31.

sesuai kombinasi taraf perlakuannya. 5. Media uji air laut diganti setiap hari. Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia.Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd. bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a). dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium.46 Bq/ml) yaitu dengan meneteskan 7. Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1. Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra. S1T2 (salinitas 29o/oo dengan suhu 30oC). Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda. dan diberi pakan Chlorella sp. Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional. Secara periodik (dua hari sekali). 210 Pb dan sebagainya). Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). dua kali sehari. Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut.5 dan 6. Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC).6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. hewan uji diaklimitasikan selama seminggu di laboratorium. sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu. Organisme dipisahkan menurut kelompok ukuran (5. S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC). dihitung mengikuti Connell & Miller (1995).6 ml ke setiap aquarium. Untuk menghilangkan stress. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial. Data yang .2. Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut.

Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.21 80.60 3.27 ± 31.50 51.12 30.41 25.36 21.81 73. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.77 28.25 22. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.31 53.65 23.50 28.2 cm 5.07 47.73 39. Model tersebut merupakan permodelan saturasi.89 3.23 ± 41.61 11.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.90 34.09 ± 41.33 53.54 15. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.12.87 19.70 ± 34.84 (Tabel 1a dan 1b).80 90.83 54.94 30.37 ± 20. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.75 49.84 61.08 47.62 29.64 19.09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.29 17. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).74 12.12 47.42 70.99 37.02 43. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.46 55.80 Bq/gr dan 49.72 45.37 4.44 51.77 28.46-73.19 36.90 79.30 ± 4.52 24.23 40.78 28.2 cm 5.01 Keterangan : Css (konsentrasi steady statei).23-54.35 41.27 44.75 70.60 59.48 39.89 4. FKss (faktor konsentrasi steady state) 41 .0.33 14.16 72.61 59.62 52.08 47.98 49.00 51.93 59.65 36.5 cm 6.23 107.65 20.51 52.24 30.5 cm 6.60 32.45 35.70 70.21-107.14 21. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.33 13.91 2.41 54.20 27.6 cm 5.6 cm 30.

42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.09 (Gambar 5).18 36.62 Keterangan: Css (konsentrasi steady statei). FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.97 16.9176 5.46 6 38.5 cm 6.76 19.80 51.38 20.25 13.10 Css FKss 63.2 cm 5. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.56 4.97 16.0667 R = 0.7137x + 8.6 cm Gambar 1.2 cm 5.7137x + 8.21 ± 36.06 1.54 33.01).92 7.82 45.80 17.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.99 1.33 19.26 21.84 ± 34.67 Mean±S 47.6044x + 5.9462 y = 1.9423 B y = 2.5 cm 6.6 cm 5.20 ± E 4.03 25.98 11.70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.35 14.34 92.2 cm 5.69 24.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.9951) .91 16 60.32 10. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.761 R = 0.33 16.51 54. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.59 54. nilai koefisien determinasi untuk salinitas 29o/oo (0.45 18.55 16. ■= 5.46 36.37 3.61 29.22 21.80 51. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata.5 cm 6.5 cm 6.38 49.10 23.85 ± 15.Yusni Ikhwan Siregar Tabel 1b.41 14.84 78.81 22.66 24.43 ± 21.2 cm 5.58 30.6044x + 5.81 33.6 cm 2 25.9462 y = 1. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.99 4 35.09 24.8014 R2 = 0.2 cm 31o/oo) di suhu dan ukuran yang sama (5.0667 R2 = 0.64 35.26 10 44.99 ± 19. Pada Gambar 6.71 19.68 24.41 10.46 35.74 14 60.00 12 57.2673x + 11.01 15.86 13.6 cm 5.06 42.761 R2 = 0.72 37.44 49.49 51.26 3.8014 R2 = 0.88 20.47 25.08 8 41.46 30.72 18 60.89 37.42 17.71 20.10 49.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.6 cm ♦=5.2673x + 11.21 75.5 cm ▲=6.2 cm dan 30oC) pada Tabel 1b.

9 R2 = 0.2052x + 8.2 cm 5. Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0. (Gambar 8).5 cm 6.6 cm ♦=5.7667 2 R = 0.2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5. 43 .529 2 R = 0.9539 B y = 2.9685 y = 1.6186x + 27.2494 R2 = 0.5 cm 6.2 cm 5.9951. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.2 cm dan 29o/oo) pada Tabel 1a dan 1b.968).5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.01).9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.6 cm Gambar 3.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2.0943x + 10. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC. ■= 5.9764 y = 2.29 R2 = 0.6 cm Gambar 2.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.66x + 7. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0. ■= 5.9734 2 4 6 8 5.9668 y = 2.6 cm Waktu Kontak (hari) 5.6 cm ♦=5.2 cm 5.5 cm ▲=6. terlihat pada Gambar 7. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0. Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5.5 cm ▲=6.773 R2 = 0.2 cm 10 5. Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.5 cm 6.9433 y = 1.4495x + 16.8171x + 23.

7x + 53.6 cm 10 0 0 5 5. 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 .5 cm 6. Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.968 A B Gambar 6.6 cm 10 15 20 Waktu Kontak (hari) Gambar 4.057 2 R = 0.43x + 65. oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11. 44 .Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).523 R 2 = 0. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC.9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.2 cm 5.2 c m 5 .5 c m 6 .2 cm 5.5 cm 6.6 c m B Gambar 5.

21 dan 20. 2000). faktor konsentrasi steady state di salinitas 29o/oo 1.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo. Sedangkan pada suhu 28oC.09 kali dalam durasi kontak 14 sampai dengan 16 hari.70.6 c m B Gambar 7.30-41. Pada kondisi tersebut.23 10.43 dimana nilai konsentrasi steady statenya berkisar 30.20-34.84-47.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 . kerang hijau mampu mengakumulasi 109Cd 31.35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9). Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya. 109 45 . konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1. Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31.10-75.01). Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0. dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.23 sampai dengan 54.51 Bq/gr (Tabel 1b). Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19. PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15.5 c m 6 . Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang.2 c m 5 .

Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B). Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.5. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya. Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.6 8 5 x + 7 . Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi. Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31.Yusni Ikhwan Siregar Cd 60 y = 1 1 . pertumbuhan dan metabolisme fisiologi dari organisme laut.09 (Gambar 5). Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3.3 1 R 2 = 0 . .24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0.9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8.9 7 9 1 A B R 2 = 0 . Model tersebut merupakan model saturasi.4 3 x + 1 9 .3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 .01).23 .70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata. pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41. umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah. Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup.

968). S2T2 (3) dan S2T1 (4).6 .5 5 R 2 = 0 .9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.01). Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7). 47 .6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a.5 3 2 R = 0 .Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 . S1T1 (2).8 8 6 8 y = .8 4 R 2 = 0 .9 9 7 2 109 Faktor Konsentrasi rata-rata 5 .5 c m 6 .2.23 + 3. Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.8 1 9 1 y = . Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.4 7 9 x + 6 0 .5 dan 6. Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu. nilai koefisien determinasi untuk salinitas 29o/ (0. Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998). Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5.96X). Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.6 .2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = .7 6 3 x + 3 3 . Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1). 109 Cd oleh Mengacu pada Gambar 6.4 . Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. 5. Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0. dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.6 c m Gambar 9.0 8 8 x + 4 8 . Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis.

48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut.23 10. Proses bioabsorpsi ini bersifat bolak baik dan cepat. dan Ca pada dinding sel digantikan oleh ion-ion logam berat. Mg. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl. Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987).01). Kemudian Sivalingam dalam Coeroli et al. Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut. thiol. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass. Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda. (1984). phosphate. hydroxy. Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya. pertama pertukaran ion di mana ion monovalent dan divalent seperti Na. 1984). Logam berat dapat juga diendapkan pada proses metabolisme dan . bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam. Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. amino. Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0. Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). dan hydroxy-carboxyl yang berada pada dinding sel.Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake.

UI press. Growth of the green mussel. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities. D. MS. Se. Water Treatment with Algae Springer-Verlag and Landes Bioscience. 1998. Orasi Ilmiah. Connel. Jenner. & AH. “ Kimia dan Ekotoksikologi Pencema- ran. YST Wong & CG. dibandingkan dengan kerang hijau yang berukuran besar. Chatterji.) in Edaiyur backwaters. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut. Proceeding of one day seminar Development Radioecology and 49 .1998. 518 hal. in a sea water circulating system. Guru Besar Tetap Ilmu Kimia Lingkungan. G.. VP. Miller. 2004a. HA. 1987.). H. east coast of India. Simpson. Fakultas Matematika dan IPA IPB. Chlorella vulgaris. 1997. Jakarta. Saeni. 17 Rajagopal. A. Reproduction. Ansari. 1758) (Bivalvia: Mytilacea). Biokinetics of Cadmium in Indonesia’s Green Mussel. V. —— 2004b. p. ZA. 2002. Amer. steady state. Serpong September 2004. van der Velde. suhu. Perna viridis: Influences of Body Size. & C. 1995. growth rate and culture potential of the green mussel. Bogor Suseno. Venugopalan.. Cr. Recent innovations in cultivation of molluscs in French Polynesia. Malac. &WX. den Harog. BS. Perna viridis L. salinitas dan lain-lain (Nora et al. 5(2):159-164. Ingole. Removal of Copper by Free and Immobilized Microalgae. Nair. Aquaculture 162:187-202. DW. M. Landret. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. Wang. 1984.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. Parulekar. InterPopulation Differences in Cd. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus. Perna viridis (L. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut. S. 13pp. Hong Kong. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Gaillande. P2PLR BATAN. The Hong Kong University of Science and Technology. & GJ. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. Seminar Nasional Teknologi Limbah. DAFTAR PUSTAKA Blackmore. JP. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. Aquaculture 39:45-67. Morton. KVK. 1998). 1984. Terjemahan Yanti Koestoer. Nora FY. Bull. Coeroli.. B. in: in YukShan & Tam (eds. Aquaculture 40:47-55.

& RCH. Ecol.137:567-575. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. Ser. WX. Wang. 1999. Prog. Mar. Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus. Ser. 2000. 186:161-172. Ecol. WX. Mar. Prog. Dei . Memasukkan: Maret 2009 Diterima: Juli 2009 50 .Yusni Ikhwan Siregar Marine Environment in Indonesia. Wang. Hotel Sahid Jaya Jakarta.

75 – 87. 2 Departemen Ilmu dan Teknologi Kelautan.62 μm.80 C g wet weight-1 hour-1 (15.62 x 46.32 x 69. Keywords: Pinctada maxima. Fak. with three replications. larvae.73 μm – 58. 1997).39 % and stage III: 76. in different levels of temperature and salinity.13 x 47.26 %. larvae. and to know the levels of optimum temperature and salinity. stage II: 57.35 C g wet weight-1 hour-1 (28. and also prerequisite for individual growth and survival. Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia.95 C g wet weight-1 hour-1 (24. Fak.72 – 77. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”.33 μm and stage III: 80.92 %.58 J g wet weight-1 hour-1).07– 19.05) with BE.05) with BE (day 20. Stages III: 4. response. Di pasaran internasional.05) with BE. Stage I: energy budged between 6. 51 . The highest of energy budged for routine metabolism at treatment BF.78 x 17.Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF). & Harpasis S. The research was used randomized block design. Perikanan dan Ilmu Kelautan IPB. PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al.91 – 82.48 – 24. metabolisme.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson).74 J g wet weight-1 hour-1).43 μm (AP x DV). The highest survival rate of larvae was by treatment BF. sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006).57 x 18. Kata kunci: Pinctada maxima.50) and hasn’t significant (P > 0. The result showed that optimal temperature and salinity on P. The quickest time of plantigrade stages have found by treatment BF (day 19.73 – 4. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan.73 – 7. Stages II: 5. fisiology. Sain dan Teknik UNSOED. E-mail: tjwinanto@yahoo. Dedi Soedharma2. physiology. respon.85 – 5. Stage II: 81. but has not higher significant (P e” 0.88 x 69. The aim of this study is to obtained information on energy budget on routine metabolism.18 – 30.29 μm – 80. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. Perikanan dan Ilmu Kelautan. The best of relative growth length of larvae by treatment BF and not significant (P e” 0. metabolism. Ridwan Affandi3.85). Sanusi2 1 Jur. stage I: survival rate between 87. than would be decreased when temperature and salinity increased. at stage I: 29. Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995). Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal.90 J g wet weight-1 hour-1).93 μm – 30.

keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan. Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi. diperlukan kondisi lingkungan yang optimum dan terkendali. Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim. Selama proses produksi spat skala besar di hatchery. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. Dame 1996).000 per cm. Di Australia. Suplai spat merupakan bagian yang krusial dari industri ini. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. 2007). sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. sangat diperlukan informasi tentang pengaruh suhu. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal. harga spat dari hatchery kira-kira $US 0. Martinez-Fernandez et al. dan konsumsi energi oleh metabolisme internal (Crisp 1984. dengan harga sekitar Rp 2.A. seperti untuk pertumbuhan. Asha & Muthiah 2005.143. jika semata-mata hanya menggantungkan pengumpulan spat dari alam.000 ekor. karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. Selama pemeliharaan larva di dalam lab. Affandi & Sanusi Saat ini.1 – 0. Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas. Jika hasilnya positif. salinitas.Winanto. representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4. 2004). perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol. dalam Taylor et al. Soedharma. Inokulum yang digunakan berasal dari biakan murni skala lab. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai. kemudian diperbanyak hingga mencapai kepadatan . konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005. yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994).14 per mm panjang engsel (R. 1997). serta dapat diketahui tingkat suhu dan salinitas optimum. Rose data tidak dipublikasikan. Menurut Gricourth et al. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif.

0001 gr). Pengukuran suhu dila kukan dengan menggunakan termometer Hg. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). Botol A untuk stok air yang dijenuhkan. (II) salinitas. Winanto 2004). 2001. Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. dan (C) 30 oC. untuk meningkatkan suhu air digunakan alat pemana s. maka percobaan dikelompokkan menjadi tiga. kapas sintetik dan ultra violet. (F) 34 ‰. sampel disaring dan ditampung menggunakan planktonet. kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0. 2001. Berdasarkan pada stadia perkembangan larva. dipelihara di dalam wadah percobaan ember plastik volume 20 liter. 2002). Disain percobaan untuk mengetahui laju konsumsi oksigen. maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan. Winanto 2004). dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). (E) 32 ‰. (B) 28 oC. Untuk mengetahui laju metabolisme rutine larva 53 . yaitu berupa satu unit peralatan yang terdiri dari empat botol. botol C untuk mengukur laju konsumsi oksigen. Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. botol B sebagai wadah hewan uji. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). catrage (15.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. Oksigen terlarut diukur dengan alat DO meter (YSI 550A. yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al. maxima stadia bentuk-D (D1). Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001). yaitu (I) suhu. Untuk mengetahui berat larva. dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). sedangkan salinitas diukur dengan refraktometer (Atago. tipe 03J0820 AJ). karena salinitas air di lokasi penelitian e” 34 ‰. Perlakuan yang digunakan terdiri dari 2 faktor. Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3). Larva diberi pakan I. 10 dan 5 mikron). Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. Hewan uji berupa larva P. galbana dan P. Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. Jepang). Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva. Larva diperoleh dari hasil pemijahan Induk P.

Winanto.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml. Pengamatan dimulai dari hari ke 18. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004). Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade. 1 mlO2 = 19. 1990).7 mlO2 (Jeong & Cho 2007). Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993). Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Gambar 1. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC. 1 mgO2 = 0. Soedharma.9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. Waktu pertama kali teridentifikasi stadia plantigrade. maxima. Pengambilan sampel dilakukan setiap jam sebanyak 10 ml. 54 . maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut. Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan. Data-data dengan dua variable seperti laju metabolisme dan berat larva. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al. 1997) dilakukan dengan menggunakan mikrometer okuler. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel. Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P. Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al.

8283).5137).804x – 625. menunjukkan adanya korelasi yang kuat. Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0.05) dengan salinitas 34 ‰ (F). 7963 dan stadia III: 0.483x – 411. Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2.63 %. Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1. salinitas 30 ‰ (AD) (Tabel 2).03x – 1431.27 %. (Gambar 2).7001x2 + 96. Stadia II : Y = -1.37 % dan pada stadia III kembali menurun (49. Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata. Pada stadia I. tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰).55 %.83 %. Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0. 55 . salinitas 30 ‰ (AD). Seda ngkan pa da stadia I dan III korelasinya kurang kuat.8227).05).7946x2 + 102.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0.05) antar perlakuan suhu dan salinitas. Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu. pengaruh suhu terhadap laju metabolisme mencapai 82.09 mgO2/g berat basah/jam (AD). Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C.8227.8283. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C. Stadia II : Y = -0.4855).7963). Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0. Pada stadia I. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC. dan pada stadia III efek suhu meningkat menjadi 82.187x – 1337.5821x2 + 38.80 (R2 = 0. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0. stadia II: 0.64 (R2 = 0.02x – 1532. Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1).16 mgO 2 /g berat basah/jam (BF) dan terendah 1. dengan koefisien determinasi (R2) pada stadia I sekitar 0.10 (R2 = 0. Stadia III: Y = -1.3706x2 + 25.18 (R2 = 0.42 %). pada stadia II meningkat menjadi 51.9387x2 + 110.70 (R2 = 0. pada stadia II menurun sampai 79.5137). maxima tertinggi terjadi pada perlakuan suhu 28 oC. pengaruh salinitas terhadap laju metabolisme sekitar 48. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen.

187x .1532.10 ± 0.7001x 2 + 96.7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1.8 R2 = 0.03c 0.77 ± 0. maxima stadia I.08 ± 0.03d 1.1431. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.8283 Suhu (oC) Gambar 2.03d 1.72 ± 0.04f 0. Soedharma. 56 . II.98 ± 0.05e 0.7946x 2 + 102.41 ± 0.03b 1.03f 0.7 R2 = 0.04e Salinitas (‰) (E) 32 1.39 ± 0.34 ± 0.03b 1.76 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.75 ± 0.34 ± 0.16 ± 0.79 ± 0.Winanto.02f (F) 34 1. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.31 ± 0.03c 1.03b 1.1 R2 = 0.04a 1.32 ± 0.8227 y = -1.02x .03a 1.74 ± 0.03d 1.16 ± 0.03c 1. Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.03x .03a 1. III Tabel 1.03b 1.04f 1.12 ± 0.08d 1.73 ± 0.03d 1.09 ± 0.29 ± 0.65 ± 0.9387x 2 + 110.75 ± 0.03f 1.03b 1.15 ± 0.29 ± 0.1337.03b 2.14 ± 0.30 ± 0.03e 0.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.03d 1.

Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P.7394x2 + 49.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4).856).625.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0. maxima dipengaruhi oleh suhu dan 57 . Stadia III : Y = -0.64 R2 = 0.4855 y = -0.795.17 R2 = 0.5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0. Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan.7394x 2 + 49.3706x 2 + 25. jadi berat (85.023x – 795.4942). maxima. Persamaan yang diperoleh adalah Y = -295. maxima.483x .5821x + 38.856.25x + 29.243 (R2 = 0. stadia II dan stadia III Gambar 4. maxima stadia I. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III). baik untuk aktivitas maupun perkembangan larva P. Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0.411. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P. Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P.18 2 R = 0.804x .023x .4942 31 32 Salinitas (‰) 33 34 35 Gambar 3.17 (R2 = 0.

60 ± 0.14 ± 0. salinitas.20 ± 0.58 ± 0.55 ± 0.64 ± 0. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan.37b 24.92 %) dan terendah pada suhu 26 oC.43b 27.05) dengan 32 ‰ (E).45a 23. Soedharma.45 ± 0.44d 18.50 ± 0. J (B) 28.09 5.70 ± 0.74 ± 0.52 ± 0.69±0.37c 16.36 ± 0.69 4.90a 18.05) dari E dan F. C (C) 30. salinitas 34 ‰ (87.10 4.57e Salinitas (‰) (E) 32 4. J (B) 28.11 10.Winanto. J (B) 28.60a 15.53±1. Affandi & Sanusi Tabel 2.26±0.10 4.75 ± 0.60 ± 0.04 ± 0. C (B) 28.43d 18. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.36b 19. C (A) 26. sintasan tertinggi terjadi pada perlakuan suhu 28 o C. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0.42b 19.11 5.09 ± 2. Pada stadia I. J (C) 30.05) antar perlakuan suhu.67 ± 0. J (C) 30. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0.29f (F) 34 4.12 15.02 ± 0.48 ± 0.07 10.68 ± 0.32 ± 0.09 4.32 ± 0. salinitas dan tahap stadia.39f 3.43d 16.25 ± 0.51f 2. C (A) 26. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26.58 ± 0.45 ± 0.10 3.90 ± 0.08 2.16 15.03 ± 0.05).09 15. C (B) 28.05) antar perlakuan suhu.30 ± 0. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 .47 %). Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0.15 ± 0. C (C) 30. C (Calorie). C (A) 26. baik pada analisis varian maupun uji Tukey (Gambar 5).27 5.07 ± 0.40d 15.68e 2.84 ± 0.40±0.46e 1.62 ± 0.07 ± 0.39 ± 0.12 ± 0.45b 24. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P.01±0. J (Joule).31 ± 0.83 ± 0.10 6. Pada stadia II dan III.09 3.38 ± 0. J Stadia III (A) 26.07 ± 0.14 4.37c 11.02 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas.12d 24.73 ± 0.88 ± 0. sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3).12 4. C (B) 28. C (C) 30. J (C) 30.12 7.12 5.10 4.14 18.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.10 10.14 3.13±0.10 3.09 5.50c 18.62 ± 0.09 18.83 ± 0. J (D) 30 3.80 ± 0.86 ±0.39f 2.41 ± 0. salinitas 30 ‰ (32.41 ± 0. sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.45b 30.37d 24.59f 3. J Stadia II (A) 26.

17 ± 1.33 ± 0.75d 61. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18. PEMBAHASAN Konsumsi oksigen larva P.41 ± 0. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.80b 77.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3. pertumbuhan. Pertumbuhan panjang relatif larva stadia I (D1–D6).17 ± 1. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas. laju konsumsi oksigen dan laju metabolisme. D.29b 87. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 .64d 69.19c 48.61 ± 0.27b 81.95 ±0.80 ± 1.98 ±0.23 ± 0.92 ±1.09d 71.88b 76.73b 82.75f 32.91a 64.81e 21.17a 61.17 ± 0.67 ± 1.91 ± 0.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.91f 32.04c 54.82a 59. & F= salinitas 30. Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.72 ± 0.03b 87. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus.09 ± 0.71 ±1.83e Salinitas (‰) (E) 32 43.26 ± 0. Sintasan (%) larva P.39 ± 0.60f 22. B & C =suhu 26o . E.28d 72.75 ± 1.93 hari) (Gambar 6).04f 22. 28o dan 30o C.77f (F) 34 43.39 ± 0.46 ± 0. stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.71d 70.60 ± 0.86d 60.02 ± 1.20 ± 1.79 ± 1.62c 48.76e 10.67 ± 0.34 ± 0.

75–3 ml O2/jam/g berat kering (Zeuthen. 34 ‰).5 sampai 10 mlO2/jam/g berat kering. berat badan dan tingkat aktivitas. Affandi & Sanusi 2. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan.5 – 5 mlO2/jam/g berat kering. hingga mencapai batas optimum (28 oC.0. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983).80. Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling.70 sampai > 1. maka . Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. 1949 dalam Bayne. gamet dan larva yang berada pada satu seri penelitian. Diduga.856). Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda. bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda. Soedharma. Jika dihitung per unit berat badan. disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0. 1983). maka laju konsumsi oksigen semakin menurun. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0.Winanto. Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan. Lebih lanjut Bayne (1983) menyampaikan. Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0. 1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis. kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat. Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian. Laju konsumsi oksigen pada larva Mytilus edulis antara 0. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat. Hasil korelasi menunjukkan kecenderungan linear positif. tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif.7 dan > 1. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. Dari hasil analisis dapat diinterpretasikan. Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus. 2004). semakin berkembang tahapan stadia larva baik panjang maupun berat.00. 32 ‰.

Seba gai salah satu indika tor. Lama waktu (hari) pencapaian stadia plantigrade larva P.1997). fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983). 61 . Diduga pada kondisi laju konsumsi oksigen tinggi. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7. Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al. Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan. peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Pada P. Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi. 2005).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). maxima pada berbagai tingkat suhu dan salinitas.

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

KESIMPULAN Suhu dan salinitas optimum untuk larva P. diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas. Bayne 1965. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC. BF). salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. (2000) di dalam laguna Great Barrier Reef. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil. dalam O’Connor and Lawler (2004) jumlah larva P.Winanto. Pada suhu optimum aktivitas metabolisme berjalan maksimum. Soedharma. beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994). Pada kisaran salinitas 29–35 ‰. Quensland Utara. 1983). apalagi jika salinitas turun sampai kurang dari 29 ‰. Menurut O’Connor.13 J/g berat basah/jam). 1983). margaritifera antara 23–28 oC. Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P. Berkaitan 66 dengan kompetensi larva untuk menempel. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. Stadia II antara 5. dalam Ala garswa mi et al. salinitas 32 ‰ (BE). imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963.67 C/g . Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas. Penelitian Yukihira et al. Pada stadia I pembelanjaan energi mencapai 6. tetapi pada suhu kurang pengaruhnya. imbricata (Roding) dipengaruhi oleh suhu dan salinitas.74 – 5.02 – 24.83 C/g berat basah/jam (24.53 – 30.39 J/g berat basah/jam) dan pada stadia III antara 4. Disamping adanya variable lain. maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE. per sonal observasi.58 – 7.62 – 4. Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. sehingga larva berkembang dengan baik.20 C/g berat basah/jam (27. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). Australia mencatat bahwa kisaran suhu optimum pa da P. maxima dan P.

UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut. Baker. Kultur Pakan Hidup.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. Survival and Development of Sea cucumber Holothuria spinifera Theel.V. B.33 µm dan stadia III antara 80. Alfaro. Mina Mitra Usaha. Bogor Alagarswami K.73 µm – 58. Dep.32x 69. Pada stadia I pertumbuhan relatif mencapai 33.72 – 77.62 µm. Aquaculture 122: 161-169. serta C. Velayudhan. 2005. Pembenihan Tiram Mutiara (Pinctada maxima). 19.13x7. Aquaculture 246: 285-294. Elsivier Science Publisher. V. Wild versus hatcheryreared larvae. Balai Budidaya Laut Lampung. (BE. 2005. AC. S. Warta Pasar Ikan.58 J/g berat basah/jam). 2006.28 x 21. Salinity and pH on Larval Growth. 67 .75 – 87.91 – 82. Anna .62 x 46.93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰. Rahardjo &. Amsterdam. FPIK. IPB. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould). PS & P. 29: 4-6. Sjafei. Gandhi. TS. J.90 x 20.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49.. _____ 2002. Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC. J. Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Competency to Settle in Oyster Larva e. Stadia II antara 57. Chellam. Ed.55 hari). Asha. Sulistiono 2005. DS. No. Effects of Temperature. ACC Victor & AD. Dharmaraj. Perhiasan Para Bangsawan. 1994. Perna canaliculus. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE. salinitas 34 ‰ (BF.32– 19. Aquaculture 3. Crassostrea virginica. Balai Budidaya Laut Lampung. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata.. Ditjen. Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel. MF.39 % dan stadia III antara 76.26 %. Pada stadia I sintasan antara 87. Balai Budidaya Laut. 287-301.29 µm – 80. Managemen Sumberdaya Perairan. DAFTAR PUSTAKA Affandi R. Aquaculture 250: 823-829. Pengaruh suhu (81. atas bantuan yang diberikan selama penelitian. 18. Pebruari. Pengolahan dan Pemasaran Hasil Perikanan. J.80 µm–34. A.92 %.78 %). Pencernaan dan Penyerapan Makanan.43 µm.88 x 69. Petunjuk Teknis (6): 61 hal. Muthiah. 1983. P. Fisiologi Ikan. Mengenal Mutiara.DKP. Petunjuk Teknis (VII): 106 hal. Stadia II antara 81. 2001.

Davidson. 1996. E. 1963. 1979. DJ.S. J. New York. CRC Press. A. Affandi & Sanusi Bayne. S. 1983. CR. C. 1996. Energy flow measurements.D. 1975. Energy Equivalent of Oxygen Consumption in Animal Energetics. An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. Energy Relation of Marine Invertebra te Larvae. Boca Raton. 2006.. Garcia-Esquivel.. Shellfish Rese. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). In: Holme. Proc. Soedharma. 2003. Biggeleer. 284372. V & H. Bivalve Molluscs. Verdonk. DJ. JAMV. 1974. Academic Press. BL & RC. & MH. Aquaculture 230: 417-423. AcostaSalmon. Farming Jewels. Wilbur (Editors). Wesseran. C.M. Kellner. New York. 2004. 1983. Mechanism of Osmoregulation in Animals. Rangel-Davalos.. Connecticut. In: A. Thallasia Jugosl. AS. 13: 581-604. New Developments in Pearl Farming. Elliot. Kutsner 1990. 22(1): 415-421. Chacon. Development 3(8): 299-336. 130p.. Crisp. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. R. Aquaculture 251: 85-98. N. In: Gilles. Goddard. RF. Viana. Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics. E. Oecologia 19: 195-201. World Aquaculture 29 (3): 5-10. (Eds). Ecology of Marine Bivalves. R.. In: Feed Mana gement in Intensive Aquaculture.. Newell. Coastal Aquaculture 2: 627-632. In: Tompa. O. Bayne. A. Part I. US. H. J. Temperature and Water Quality. JM. 1995. S. Gilles. Gosling.A. Mildford. John Wiley & Sons. Osmoregulation and Ecology in Media of Fluctuating Salinity. Martinez-Fernandez. Maintenance of Cell Volume. Mcintyre. Applied Linear Statistikcal 68 . Feeding. Great Britain. MT. M. Symp. Publ. Dame. NH. 1983. Fishing News Book. The Mollusca IV. Oxford. Biology. Rearing of Bivalve Mollusks.Winanto. Fassler. & W. Neter. 1851) Larvae. BL. Loosanof. Farias. W. Jeuniaux. Blackwell Sc. Mathieu & K. Physiology. Davis. 254 pp. 10: 103-120. Saleuddin and K. Methods for the Study of Marine Benthos. Beureu of Commercial Fisheries Biological Laboratory. 4: 51-73. Physiological Energetics of Marine Molluscs. Vazques & Z. Dharmaraj. Physiological ecology of marine molluscan larvae. L. The Mollusca.M. 2004.. Gricourt. An Ecosystem Approch. 1984. & CH. Crisp. Ecology and Culture. J.

Brasil. Proceeding European Marine Biology Symposium. J. 11:537-554. Toppan Copany. Analysis of Variance and Experiental Designs. K. Soria. RGD & JH. Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. PC.Jr. 44: 1-28. Pinctada maxima and P. Pinctada imbricata Roding. Vernberg. 252: 208-224. RA. Prog. 1979. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures. 1972. Suatu Pendekatan Biometrik. Growth and energy balance during the larva lives of three prosobranch gastropods. Wirahadikusumah. WB & SU. 138 hal.. Rose. pp: 189196. Tokyo. 2007. ITB. KS. 1173 p. J. Aquaculture 270: 451-463. 195: 179-17 ____ 2006.. Vernberg. Biol. O’Connor. Merino & E. In: Kramer. Gramedia Pustaka Utama.. Von Brand. C. Pechenik.. CRC Press. 748 hal. Biomonitoring of coastal waters and estuaries. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture. Yukihira. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster.. Japan. Biokimia: Metabolisme Energi. Margaritifera. Taylor. J. Southgate & CE. 3 rd Edition. Bandung. John Wiley & Sons. Torrie. Widdows. Prinsip dan Prosedur Statistika. Maintenance of Cell Volume. respon in different ways to culture in similar environments. W. The scope for growth of bivalves as an integrated response parameter in biological monitoring. Marine Ecology. The pearl oyster. Jakarta. Sulaiman. Lucas & DW. J.. Aquaculture 153: 31-40. Regression. Karbohidrat dan Lipid. JA. J. JS. Lawler. Boca Raton. G. Laitano & RW. Contoh Kasus dan Pemecahannya. AC & J. Reis F ilho. JJ. 2000.J. Exp. 2004. ES. Ecol. Silverthorn. 1997. Klumpp. Yogyakarta. Mar. New York.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models. Temperature and Osmoregulation in Aquatic Species. Andi Offset. 1985. Mechanism of Osmoregulation in Animals. Taylor. Margaritifera. Metabolicenvironmental interaction in the marine plankton. 1970. J. Aquaculture. Smaal. 1980. M. WA & NF. 5th. 1993. In. Gilles. 2007. 247-267. Steel. Ser. Aquaculture 229: 493506. 1994. (Ed). 2004. Resgalla. Analisis REGRESI Menggunakan SPSS. Aquaculture 270: 464474. pp.. G.M. LTD. WB. R (ed). H..

&Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). in the freshwater pond. Perikanan dan Ilmu Kelautan. Unsoed. warna dan kilau (shine) Sonkar (2007). sized ranging from 12 – 15 cm were studied. khususnya di Danau Biwa. 71 . Keywords: Freshwater mussel. 79 % and 78.9 %. Jur.05) to the deep of 30 cm (0. effect. budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925). 12. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1.co. kedalaman laut 1. Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al. Anodonta woodiana.05) to the deep of 60 cm (1. The result of implantation was followed that 30.7 %. The result showed that best thickness of pearl deposition by 90 cm deep (1. 2008). 2006. Sain dan Teknik. Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s.id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana). Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China. berat. Kovitvadhi et al. Purwokerto E-Email: bufish68@yahoo. Maskur1. level of deep Kata kunci: Kerang air tawar. One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre). PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. Di Jepang. Freshwater pearl Anodonta woodiana.70 mm).10 mm) and biggest significant (P< 0.2 %. Completely randomized design was used with levels of deep treatment (A) 30 cm. was 300 m2 wide and 1 m deep. (B) 60 cm and (C) 90 cm.30 mm) but hasn’t biggest significant (P>0. Tjahjo Winanto2. 12. Berdasarkan kualitasnya yang tinggi. 60 and 90 cm deep were 11.2 %. Hyriopsis schlegeli (Simpson). The objective of this study was to obtain information on best level of depth to culture of pearl. woodiana.0 %. whereas survival rate was followed 79. Anodonta. Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930. to get fast nacre deposition and high quality of pearl. The research was conducted for 9 months. Fak. 2.

Skinner et al. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. konduktivitas. oksigen terlarut. Berdasarkan kualitasnya. Faktor internal meliputi jenis kerang yang digunakan. kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. sehingga mempunyai nilai tambah sebagai perhiasan. seperti suhu. kualitas lapisan mutiara (nacre). Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). karena luwes untuk perhiasan. kecerahan dan kesuburan perairan (Dan & Ruobo 2000. Faktor teknis. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. Faktor eksternal antara lain kualtas air. Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. sehingga dapat diperoleh mutiara berkualitas tinggi. Warna sebenarnya sangat tergantung pada selera konsumen. pH. kalsium. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. Jumlah sampel 250 ekor. internal dan teknis. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. misalnya keterampilan teknisi dalam proses implantasi. Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah. alkalinitas. sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi. Oliver 2000. sehingga kajian mengenai hal tersebut perlu dilakukan. daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. penanganan dan pemeliharaan pasca implantasi. Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik. BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1). Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre). nitrat. 2003). Menurut Pagcatipunan (1986). Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 . sehingga membuat harganya paling mahal (Anonymous 2005).Rachman. kerang berukuran panjang antero-posterior (AP) 10-15 cm. hijau dan biru muda. dengan perlakuan kedalaman pemeliharaan 30. 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. khususnya pada produksi mutiara bulat air tawar. Semakin tinggi karatnya maka harganyapun makin mahal. Anonymous 2007. Sonkar 2007).

Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. sehingga organ dalam terlihat jelas.1992). Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral). Sebelum operasi. Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. Usahakan agar posisi mantel menempel dengan inti (Winanto et al. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan. Dengan menggunakan spatula insang disibakkan. Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. bagian ventral kerang menghadap operator.1992). Pengolahan data dilakukan dengan SPSS ver 15. Secara matematis. sehingga dapat ditemukan 73 . keduanya dimasukkan ke dalam satu saluran.1992). Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. Selanjutnya. Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan. 2007). Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad. Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. al.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor. maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih. yaitu dengan menggunakan metode ekspose (Winanto et al. Pengamatan dilakukan selama 9 bulan (April– Desember). terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. Operasi dilakukan dengan menempatkan kerang pada penjepit. posisi demikian dilakukan selama 2 jam. Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991). kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. Jumlah sampel pada setiap perlakuan adalah 75 ekor. Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian. agar luka tidak menjadi infeksi (Rachman et al. Pasca implantasi.

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

Parameter air lainnya yang perlu diperhatikan adalah kecerahan.04–5.54 15 – 251 <1.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau. 4Summerfelt (2007).5–8. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.03–0.083 6–15 64.90 0.36–0.90 6.03 <0. yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.03–0.09 7–13 68. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk.76–99.00 68.50–7.00–7.70–99.69 6.90 22. seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan.04–0.80–14.62 0.80–25. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp).82 0.12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000).40–25.093 6. Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan. Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%.10 0.32 7. Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik.70 Subur Lumpur berpasir 90 cm 2.20–6. 5Skinner et al (2003). yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian. Kecerahan air di kolam penelitian antara 20 – 60 cm. Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana. tidak menempel pada inti.67 24.01–4.35–0.60–90.40 0.60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6. 3Oliver (2000).17 23.15–3. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 .36–0.00 0. 2Hochheimer (2007). Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5.90–25.

Balai Budidaya Laut Lampung & FAO/UNDP. Part 1: Biology of the species and its present situation in Ireland. AK.35. Ruobo. Bandung. United Kingdom.source. S. Hyriopsis (Hyriopsis) bialatus Simpson. Hongkong. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera. U. Metode Perancangan Percobaan. Areekijseree.1–11–2008. S. A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea. Kovitvadhi. Pagcatipunan. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp. Yuniarti. P. sales@ thepearl. Sonkar. 2008. Imperial Leaflet. M. DAFTAR PUSTAKA Anonymous 2005. Invertebr. Armico. P. &D. A.2 %). Imperial Real Question Real Answer. Thongpan. Machado. Juhaman. U. T. 1986. Sawangwong &J.in. Rachman. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1. 1900. Engkagul. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature. Rojali.T. 1991. 1–11–2008. Gasperz V. Diamon Graphics. dkk pada perairan yang bening. berarus dan mengandung cukup kalsium. Freshwater Pearl Culture and Production in China.357. india. Winanto. Oliver. Cahn. Anonymous 2007. 8. info@pearl.com . R. Memasukkan: Maret 2009 Diterima: Juli 2009 78 . Rome. Moorken. AR. Jakarta. Chinese Academy of Fisheries Sciences. A. S. Pearl Aquaculture Research Foundation. Washington DC. Laporan Tahunan. Kovitvadhi. 1856).. Budidaya Mutiara. EA. 1949. Irish Wildlife Manuals. 2007. Jiangsu Province China. INS/81/008.2 %). Fishing leaflet. DKP. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel. 49: 255-262.. No. 1992. Pontjoprawiro & M. Aquaculture 275: 169-177. 1999. Dev.Rachman.3 mm). Sintasan terbaik pada kedalaman air 30 cm (79. 2006. 2007. Dan. Murdjani. H & G. & K RungruangsakTorrisen. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh. 2000. The Pearl Source. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. G 2000. Kovitvadhi. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12. Reprod. Peterborough. Kovitvadhi. Pearl Culture in Japan. B. FAO.

and determined their positions. Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. hutan dataran rendah. Papua. All trees (dbh. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . and Koordersiodendron pinnatum. Balgooy 1976). Raja Ampat. Ficus-Antocephalus. Antocephalus-Toxotrophis. However floristic compositions varied among plot sites. e”10 cm) within all of 17 plots were measured. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas. Pulau Waigeo. Raja Ampat. Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. Papua Kata kunci: Vegetasi. Toxotrophis illicifolius. Pangium edule. In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. Sterculia-Grewia. dan Pulau Batanta.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. lowland forest. Pulau Salawati. Almost all of common species such as Pometia pinnata. Raja Ampat. Keywords: Vegetation. Anthocephalus macrophyllus. Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. Raja ampat. Aporusa–Pometia. Yensawai (7 plots) and Wailebet (5 plots). which might be a characteristic of vegetation of Papua and the nearby small islands. Pulau Misool. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). and Duabanga-Pterocymbium communities. According to ordination analysis there were five community types. and identify their species. Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat.

dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. 80 . yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi. beraneka burung kakatua dan nuri. kuskus waigeo. Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap. Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil.9" LS. rentan terhadap kerusakan dan peka akan gangguan. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta.3"–0º54’19. Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi.Edi Mirmanto beragam pada saat ini. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas. Namun demikian secara umum kondisi vegetasi masih cukup baik. Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan.4" BT dan 0º47’ 27. yang terbentang antara 130º31’7. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah.2"–130º53’28. cendrawasih Wilson. (Anonim 2006). struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. dengan kondisi vegetasi yang bervariasi pula. yang meliputi daerah datar sampai berbukit. maleo waigeo. di samping pantaipantai berpasir putih yang indah. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air. Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. Yensawai dan Wailebet (Gambar 1). dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006). Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS. Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. dengan ketinggian mulai dari 12 sampai dengan 147 m dpl.

cityseahorse. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib. 8=Kalituris). 2=Kafnain).html. berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua. dengan kondisi medan secara umum datar. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat.com) 81 .Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar.com/irian-jaya. Yensawai (3=Waringkabum. bergelombang sampai berbukit. Rata-rata curah hujan dan temperatur udara di daerah penelitian. Korpak. Vegetasi di daerah ini pada umumnya belum terganggu. Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit. 6=Warai) dan Wailebet (7=Kaliyakut. 5=Korpak. (Peta diperoleh dari httw://www. Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris. dan Warai. dengan kondisi vegetasi yang relatif tidak terganggu. Gambar 1. Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam. 4= Wartandib. Waringkabum. lokasi berdasarkan pengukuran dengan GPS) Gambar 2.

diidentifikasi jenisnya. Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak). Euphorbiaceae. dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. (1965). Anacardiaceae. Dari 40 suku yang tercatat. diukur diameter batang setinggi 1.Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar. Yensawai (7 petak) dan Wailebet (5 petak). beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. kerapatan. ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. dan Rubiaceae. Sapotaceae. Verbenaceae. frekuensi relatif kerapatan relatif. dengan menggunakan perangkat lunak MVSP 3. Flacourtiaceae. sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al. Di salah satu DAS telah dibuat bak penampungan air. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. Alangiaceae. Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA.com). Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting. Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi. yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2).1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. Beberapa suku diantaranya Lauraceae. Sapindaceae. Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). dominansi. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm. Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu . diikuti oleh Sterculiaceae. yang tersebar pada medan maupun kondisi vegetasi yang bervariasi.3 m dari atas tanah. yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). dan nilai penting. 82 dominansi relatif. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak.

Struktur hutan Tabel 1.5 5.1 25.7 41.8 %.1 2. Pada Tabel 2.0 100.0 2.0 100.6 1.8 13.4 3.6 2.9 7.1 0.0 4.9 3. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.0 6.9 16.5 1.4 3.3 14.2 3.7 39.6 24.8 9.0 100.4 17. tetapi memeiliki kerapatan dan frekuensi yang rendah.2 19.1 4.3 100.4 1.1 13.3 17.7 11.7 32.6 30.3 9.0 100.6 17.0 Petak pencuplikan data B C D E F G H I J K 1.2 3.7 8.6 2. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.5 1.0 2.3 2.2 19.1 1.1 3. Pangium edule.4 4.9 17.8 1.5 12.0 100. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi.0 31.1 2.0 18.3 2.5 1.2 2.2 3.6 4.6 25.8 4.4 30. Pometia pinnata bersama Anthocephalus macrophyllus.2 24.5 44.8 14. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3.0 14.4 1.1 8. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).7 13.6 1.4 10.1 5.1 1.3 37.0 100.0 100.7 7.7 6. Toxotrophis illicifolius.2 12.7 1.9 10. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.9 21.0 1.1 13.8 3.0 22.0 100.9 4.0 100.6 3.8 12.8 5.1 3.1 31.0 1. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.0 100.8 21.1 21.6 16.6 34. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.8 2.8 17.1 31.1 17.3 16.7 23. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi.3 25.3 2.5 50.3 17.7 4.2 36.5 11. berukuran besar dengan jumlah individu relatif banyak.9 0.4 25.3 4.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).6 5. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58.9 19.1 6.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi.2 11.0 1.0 33.4 8.4 5.1 6.0 100.7 11.0 2.8 41.4 14.2 2. Jenis-jenis tersebut umumnya tersebar cukup luas.0 2.9 26.1 35.3 1. Berdasarkan nilai penting (NP) tertinggi.9 2.6 100.0 8.0 Rata-2 20.3 8.2 4.7 6.3 13.7 3. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %.0 83 .6 21.0 100.1 15.3 7.4 6.1 21.1 100.0 100.6 4.1 5.4 9.0 7. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.0 100.7 L N O P Q R 14.6 3.4 4.9 1.8 7.1 9.4 19. tetapi dengan pohon-pohon berukuran relatif kecil.0 100. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya.0 1.

Akan tetapi proporsi jumlah individu nampak tidak seimbang. Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon. Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m. Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al.5 dan 18.5 dan 28 m. Gambar 3. pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol. sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan. 6% pohon menempati lapisanII.5 m. Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5). dan lapisan-III antara 9. Gambar 4. ditandai dengan adanya individu pada semua kelas diameter. lapisan-II antara 18.Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal. Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus.5 m merupakan jenis-jenis ternaungi. menunjukkan pola persebaran diameter pohon yang cukup menerus. sedang pepohonan dengan tinggi di bawah 9. Disamping itu diperkirakan bahwa setelah mengalami gangguan. yang menunjukkan adanya rumpang atau daerah terbuka. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 . yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm). Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm. 1965). Sebanyak 2% pepohonan menempati lapisan I. dan 39% pohon menempati lapisan III.

75 1.69 5.40 5.69 2.54 6.73 1.42 2.87 0.24 1.22 3.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon.49 7.35 2.30 1. Tabel 2.02 7.74 4.84 2.04 1.05 9.73 0.34 100.33 3.66 4.68 3.30 2.98 2. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.80 1.27 2.03 2.03 3.87 1.33 5. Pometia pinnata dan Anthocephalus macrophyllus.88 9.03 1.63 37.99 85 .25 4. yang menunjukkan adanya perbedaan pola persebaran.17 3.87 0.80 6.58 2.73 1.43 2.63 3.03 13.12 5. Nilai frekuensi relatif (FR).58 1. Secara keseluruhan persebaran pohon cukup merata.43 0.35 3.60 3.30 0.44 2.77 1. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.01 2.78 1.33 3.66 1.83 1.30 5.00 KR 6.00 DR 7.23 1. Intsia bijuga.98 4.03 2. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.01 4.31 299.09 150.03 50.45 2.43 0.63 2. Penyebaran spasial beberapa jenis disajikan pada Gambar 6.18 2.59 5.02 1.73 2.02 3.00 NP 18.77 2.43 3.44 1.04 10.02 2.16 1.73 7.16 3. baik antar jenis maupun antar lokasi.87 0.86 1. yaitu dengan nilai Indeks Morishita berkisar angka satu.50 2.10 100.87 100.31 6.37 2.43 62.

P). sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi. Kelompok A terdiri atas 2 petak (Q. Anthocephalus cadamba.D) yang terdapat di Yenanas. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6).B. sehingga kemungkinan sudah banyak ditebang. Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat. R) di daerah Wailebet. kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C. ditandai dengan rendahnya individu pada tingkat semai dan belta. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak.E) dan Yensawai (F. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7).G.J). Permudaan alami jenis Instia bijuga berjalan kurang baik. Antiaris toxocaria. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar. 86 . Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. kelompok B terdiri atas 3 petak (A. Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4.L) dan Wailebet (O. Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data.I.Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule. kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H.K.

L-II=pohon pada lapisan II. L-III=pohon pada lapisan III. Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 . L-I=pohon pada lapisan I. Stratifikasi hutan secara umum di daerah penelitian.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5. Gambar 6. (M=pohon menonjol. N= pohonpohon ternaungi).

Jenis-jenis Sterculia cordata. Ke 4 jenis tersebut mencakup 48. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia.4 0. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan.7 % dari total basal area. Pometia pinnata. Grewia paniculata.4 % total basal area dalam komunitas ini. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar.4 Toxotrophis illicfolius. komunitas Aporusa–Pometia. dapat ditentukan menjadi lima tipe komunitas. 0. dengan proporsi dominansinya mencapai 61.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. komunitas Duabanga-Pterocymbium. yaitu 1.4 -0. komunitas Ficus-Antocephalus. yang lebih rendah dari pada dua komunitas sebelumnya.0 SUMBU-X 0. komunitas Sterculia-Grewia. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon.4%. Berdasarkan jenis-jenis dominan pada setiap kelompok.4 Gambar 6. 2. Alangium javanicum dan Pimeleodendron ambinicum. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . Artocarpus altilis. Pometia pinnata. dan 5. komunitas Antocephalus-Toxotrophis. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0. 3. Ke lima jenis dominan tersebut meliputi sebanyak 34. Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus. 4. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea.

Artocarpus altilis. 2006). PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. Ficus variegata. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . tidak terdapat dalam komunitas lain. 1998). Kari-munawa (Yusuf dkk. Pterocymbium tinctorium . Nusakam-bangan (Partomihardjo dkk.Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. Koordersiodendron pinnatum dan Cryptocarya multinervis. Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA. seperti Geser (Mirmanto & Ruskandi 1986). Dari jenis-jenis yang tercatat. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada. Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. misalnya Waigeo (Mirmanto. Canarium maluensis. Pometia pinnata. Simbolon. Hampir semua jenis dominan tersebut. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. data belum dipublikasikan). Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. 2001. maupun luas daerah penelitian. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan. serta dengan komposisi jenis yang berbeda pula. dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. Ficus tinctoria. Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan. 1995. tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. 2003). atau terdapat dalam proporsi yang rendah. Krakatau (Tagawa 1992). Artocarpus communis. yaitu sebanyak 56 jenis pohon. kecuali Koordersiodendron pinnatum. Anthocephalus macrophyllus.

Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Mallotus mollisimus. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. meskipun secara struktural sudah mendekati kondisi hutan alami. Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp. Inocarpus fagiferus dan Instia bijuga. juga mempengaruhi kesamaan komposisi jenis. Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. yang rata-rata berukuran cukup besar. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk). . dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides.. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata.Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder. dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula. Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. Ficus spp. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu. Pimeleodendron ambinicum dan Endospermum moluccanum. Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama. hanya terdapat dalam jumlah yang relatif sedikit.

Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. Partomihardjo. Ellenberg. Sambas & S. Shidei. Nat. MMJ. 2006. D.& Life. Berkaitan dengan kekhasan vegetasi hutan. 2003. I. T. 4: 13-48. 1965.). K. 1976. Yoda. & A. Kyusu Univ. John Wiley & Sons. Propinsi Irian Jaya Barat. Laporan Perjalanan. Maluku. Cilacap-Indonesia. Ogawa. Aims and methods of vegetation ecology. Laporan Teknik 1995. 1-22. Simbolon. Asia of forest vegetation in Thailand. 1995.E. Mirmanto. Analisa vegetasi hutan dataran rendah di pulau Geser. Irian Jaya. van. Prawiroatmodjo. Kabupa91 . Ruskandi. EN. 1986. (Biol. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Sci. D... T. Putrajaya. vegetation and floristic notes of Nusakambangan Island. 2: 215-235. & H. 1972. Ratnawongse & C. Phytogeography. Doc.). of first GTI Regional Workshop in Asia. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. Toxotrophis illicifolius. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak. Fac.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata. Ser. Dalam: H. 2001: 39-48. Roemantyo & S. Puslitbang Biologi-LIPI. Pangium edule.. Anthocephalus macrophyllus. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. E. Comperative ecological study on three main types in S. New Guinea Vegetation. E. 1995.). Mem. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. K. T. 2001. H. Measuring the dispersion of individuals and analysis of distributional patterns. H. M. 1959. Malaysia: 106-111. Ogino. HB. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. In: K. Report and Proc. Simbolon (ed. Apasutaya. Prawiroatmodjo. Global Taxonomy Initiative in Asia. Biological diversity of small islands: Case study on landscape.. Mueller-Dombois. Structure and floristic composition. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. DAFTAR PUSTAKA Anonim. hal 34-45. Tipe-tipe vegetasi cagar alam pulau Supiori. Purwaningsih. New York. Paijmans (ed. Morishita. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. Partomihardjo.

IV. Indonesia. Jakarta. Laporan Teknik 2006. Ruskandi. Laporan Teknik 1995. & JHA. 17-31. Wardi & Dirman. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah.N. Julistiono (ed. Karimunjawa. Jakarta.). Ekol. H. Noordhof-Kolff NV. van. 1992. H. Geo J. Steenis. 92 . 2 (3): 1-11. Flora Malesiana. Studi vegetasi P. Ferguson. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea. 1948. di kawasan T.Edi Mirmanto ten Biak Numfor. FH. Dalam: H. hal 54-72. Irian Jaya. A. Series I. Dalam: AJ Arief. 28 (2): 175-183. Tagawa. Schmidt.). Yusuf. R. No. vol. EB Walujo.. Kementrian Perhubungan. Primary succession and the effect of first arrival on subsequent development of forest types. Karimunjawa dan bebrapa pulau kecil lainnya. hal. Simbolon (ed. 2006.42. Mulyadi & H. Puslitbang BiologiLIPI. Pusat Penelitian Biologi LIPI. 1998. Verhandelingen. 1951. Simbolon. Djawatan Meteorologi dan Geofisika. CGGJ. Irian Jaya.

Muller. APOCYNACEAE Popowia beccarii Scheff.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr.) MA Mallotus rufidulud (Miq. Cynometra ramiflora L. EUPHORBIACEAE Aporusa cf dendroidea Schot.S. CELASTRACEAE Siphonodon celastrinus Griff.Hofm. Lepiniopsis ternatensis Val.Br.) MA Pimeleodendron ambinicum Hassk.) A. Bridelia insulana Claoxylon longifolium (Bl.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1.) Baill. Mangifera indica Parishia insignis Hook. Raja Ampat. DILLENIACEAE Dillenia ovalifolia Hoogl. Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl.) MA Mallotus mollisimus (Geisebr. CLUSIACEAE Garcinia dulcis (Roxb. Endospermum moluccanum Glochidion zeylanicum A. Semecarpus australiensis Engl. Intsia palembanica 93 . Drypetes glabridiscus JJS Drypetes longifolia (Bl. Macaranga tanarius (L.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq.) Pax & K. ARALIACEAE Gastonia papuana Miq. Inocarpus fagiferus Fosb.) Nielson Crudia reticulata Merr. Suregeda glomerulata (Bl. Instia bijuga Kurtz. FABACEAE Archidendron jiringa (Jack.) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. ANNONACEAE Spondias cytherea Sonnerat. Teysmaniodendron hollrungii (Warb. Jass Macaranga aleuritoides F. Tabernaemontana sphaerocarpa Bl. Polyalthia laterifolia King Polyalthia subcordata Bl. Mitrephora diversifolia Miq. Polyalthia diversifolia Miq.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K. Mallotus philippinensis (Lam.) Endi Croton argyratus Bl.) Kosterms. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta. Osmoxyon sessiliflorum (L. Polyalthia glauca Boerl. Alstonia scholaris R.

wieringae Kosterm.f. Litsea firma (Bl.B.Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb. Et Binn.)Kosterm. Ficus variegata Bl. Horsfieldia irja (Gaertn) Warb. Ficus glaberrima Bl. Litsea ladermnniii Tschn.) Forsb Artocarpus communis Artocarpus varieseanus Miq. Aglaia goebeliana Warb Aglaia korthalsii Miq. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park. Horsfieldia bivalvis (Hk.f. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq. Horsfieldia hellwigii (Warb.) Hk.) Benth.)Sleum Gonocarium littorale (Bl. Chisocheton lasiocarpus (Miq.)Schouten Gymnacranthera panniculata Val.)Miq.) Merr.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf. Trophis philippinensis (Bur. Dysoxylum densiflorum (Bl. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud.)Valeton Dysoxylum arborescens Miq.) Boerl. Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. 94 .)Sincl. Purverulenta (Warb. Litsea timoriana Span.) KN Parker Chisocheton ceramicus Miq. Lansium domesticum Correa Sandoricum koetjape (Brom. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl. LECYTHIDACEAE Planchonia sp. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc.f. Cryptocarya multinervis Teschn. Litsea calophylantha K.Rob.)Kost. Litsea glutinosa (Lour.)var. Schum.)C.) Merr. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl. Litsea forstenii (Bl. Cryptocarya caloneura (Scheff. Ficus botrycarpa Miq. Toxotrophis illicfolius Vid.

Pterocymbium tinctorium (Blanco) Merr. Morinda citrifolia L.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp.)Risdl.)Merr. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour. ROSACEAE Prunus javanica Miq. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R.J.) Havil.L Palaquium lobbianum Burck Palaquium obovatum Burck.)Merr. OPILLIACEAE Chaemperia manillana (Bl.f. Br. TILIACEAE Grewia paniculata Ridl.v Muell Sterculia cordata Bl. Psychotria diplococea Landeri Valeton Tarenna barbellata Val.) Merr & Perry Syzygium pteropoda Lauterb. Harpulia petiolans Radlk sub. Myristica curcullata Mgf. Neonauclea clemensii M.) Chew Pipturus argenteus Widd. Anthocephalus macrophyllus (Roxb. Sterculia cymosa Wall. Myristica lanceifolia Bl. RUBIACEAE Adina racemosa (Caw. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L.)Tirveng Anthocephalus cadamba Miq.J. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F. Chrysophyllum roxburgii G. sp. Br.petiolans Pometia pinnata Forst. Don Madhuka leucodermis H. Scott. Pavetta platiclada K. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L. RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl. 95 .P. Schum. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC. Myristica inutilis R. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb. Schum Pertusandian multiflora (Hw. Et K. NYCTAGINACEAE Pisonia longirostris T. Palaquium sp. Et B. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L.

v Will. Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Memasukkan: April 2009 Diterima: Juli 2009 96 . Br. Br.Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R.) F. Vitex quinata (Lour. Vitex glabrata R.

243. cara tersebut antara lain dengan mempergunakan biopestisida. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. Agustina K. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). Kerusakan yang diakibatkan hama tersebut sangat bervariasi. 2 Balai Besar Karantina Ikan Soekarno-Hatta. PCR. Lam 752. These isolates were Jtg 2151. cry1A. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997).7 milyar dolar Amerika (Bent & Yu 1999). maize stemborer. Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). Email: bahagiawati@indo.Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. All of tested isolates showed potentially high toxicity against maize stemborer. and second was 986 bp. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7. PCR. cry1A. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam. thuringiensis. timbulnya hama resisten. 6 of them gave PCR products. yaitu matinya organisme non-target. first was 490 bp. Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984). Oleh karena itu. Kata kunci: B. two DNA bands. Ostrinia furnacalis. Lam 762 and C 522. Cib 551.net. Habib Rizjaani1. diperlukan cara lain selain hanya dengan pestisida. thuringiensis. Ostrinia furnacalis Guenee 1 Bahagiawati1. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. From 59 tested isolates. Ostrinia furnacalis.id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. Key words: B. di antaranya dengan menggunakan insektisida kimia. Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. the expected size of Lep2A-Lep2B primers. the expected size of Lep1A-Lep1B primers.

Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. thuringiensis subsp. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. 2000). thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). kependekan dari kata crystal. Sebagai kontrol negatif dipakai akuades. bubuk biji-bijian. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. Bogor digunakan sebagai bahan dalam penelitian ini. Rizjaani. dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al.Bahagiawati. cukup sensitif. Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan. & Sibuea wati 2002). BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. dan telah diidentifikasi berbagai jenis protein Cry. penggunaan antibodi monoklonal. 1991. Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. 1992) yang dimodifikasi seperti . dan mudah digunakan dalam kegiatan rutin (Carozzi et al. permukaan daun. 1991). Santoso et al. seperti dari tanah. dan berbagai bangkai serangga (Carozzi et al. Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. selanjutnya disebut dengan Bt. 2001). Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. 1991). thuringiensis masih terus dilakukan. strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. Bakteri ini dapat diisolasi dari berbagai bahan. 1991. relatif cepat. Selain itu. Smith et al. Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989). antara lain analisis Southern blot. 1991). kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel.

thuringiensis lokal yang disaring. Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. Jika terdapat perbedaan antara rerata perlakuan yang diuji. (2002). dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. Pembuatan makanan buatan. Uji toksisitas isolat B. Setiap cawan mewakili satu ulangan. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1). diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. furnacalis yang diperbanyak pada makanan buatan. Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. dan masing-masing perlakuan diulang sebanyak 3 kali. (2003). hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. Setelah makanan buatan tersebut membeku. Uji toksisitas. Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. (2003). Rerata persentase kematian. Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm. dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. (2003) dengan modifikasi sebagai berikut. Sebanyak 1 ml suspensi B. berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. furnacalis mengikuti Bahagiawati et al. masing-masing bagian makanan diinokulasi 2 ekor larva. analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. 99 .Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. Pengujian toksisitas dilaksanakan dengan memakai serangga O.0 for windows. lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan. thuringinesis terhadap larva O. Ada tidaknya perbedaan antara data persentase kematian. masingmasing 500 μl. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. Selain itu. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). berat. permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut.

Bahagiawati. furnacalis Data uji toksisitas terhadap larva O.90b (30) 13.33b 96. Analisis data persentase kematian.03 (1) 0.00a 83.03a (1) a 0. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan.94a (1) a 0.78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0. dipel (+). kontrol negatif akuades (-).07a (2) a 0.003 (1) 1.67b 86.20 (1) 0. Rizjaani. Lam762(5) dan C522(6). Cib243(2). Kontrol positip.613a (5) a 0. Produk PCR dari beberapa isolat Bt lokal Jtg2151(1).133a (5) 2. furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1.04 (4) 0.77a (5) 2. & Sibuea Uji toksisitas isolat terhadap O.49b (30) 0.77a (1) 0. furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 . Tabel 1.05.33b 96. Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O.67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5.30b 96. Lam752(4).67b 83.91a (5) a 0. Cib551(3).67b 96.23 (2) 1.

yaitu makanan buatan yang tidak mengandung suspensi Bt.9 mg dan panjang tubuh 13.1137x + 1.7 mm-2. Pada kontrol positif (Dipel).Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0.9753 Gambar 3.409 R2 = 0.13 mg dan panjang tubuh hanya 2.5 mm.0609x + 5. dengan berat tubuh yang relatif kecil yaitu 0. Kedua analisis di atas menunjukkan hubungan yang terbalik. Regresi linier antara: A. Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif.1311x + 13. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt. persentase kematian dan berat tubuh. berat tubuh dan panjang tubuh larva 101 . dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi. kematian serangga mencapai 83. B.3%.0133 R2 = 0.7 mg untuk berat tubuh dan 0. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0. Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan. persentase kematian dan panjang tubuh. Berat tubuh larva-larva tersebut mencapai ratarata 5.9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0.04-0.6 mm untuk panjang tubuh. C.98).9 mm.97). Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0. Larva-larva yang masih hidup ini terlihat lemah. namun berbeda nyata dengan kontrol negatif akuades.9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2.7726 R = 0. demikian juga dengan panjang tubuh larva (R2 = 0.

2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. belum pada tahap bioasai toksisitasnya terhadap hama target. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. Rizjaani. Santoso et al.Lep2B. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. dimana pada tahun 1999 mencapai $300 juta. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda. Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989. Pada waktu Santoso et al. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running. mereka memakai 2 pasang primer. PEMBAHASAN Seperti yang telah dikemukakan. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. Hasil penelitian kami memperlihatkan hasil yang lebih akurat .Bahagiawati. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung. adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O. furnacalis.97) berbanding lurus. yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. masing-masing Lep1A-Lep1B dan Lep2A. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. 1992).7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008).

103 . thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. dan aktifitas makan menurun. KESIMPULAN Dari 59 isolat yang diuji. 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb. thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. 1991). Cib 243. Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva. yaitu bioinsektisida Bt yang telah dikomersilkan. Berdasarkan hasil uji toksisitas isolat B. furnacalis. Pada hasil penelitian Santoso et al. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. 1994). gerakannya lambat. Larva yang memakan toksin Bt. 1998). Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. setelah beberapa hari tampak kecil. Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. Ceron et al. Empat isolat yaitu Jtg2151. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. furnacalis. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O.

Insecticidal crystal protein of Bacillus thuringiensis. James. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. Perta. 1925. Evola & M..insektisida.G.Bahagiawati. 1994. 1997. Kim. P. Covarrubias. Appl. 8(1): 2730. 53(2): 242-255. A F. N..A. Pest of crops in Indonesia. J. A. LGE. FM. B. 2003. Envi. Agrobio 5(1): 21-28 Bahagiawati. J. Econ Ento. WS. cry1A(b). Buletin Agrobio: 4 (1): 1-8. S. Global Review of Commercial Transgenic Crops: 2008. Wereng coklat dan pengendaliannya dalam prespektif. Microbiol. Rijzaani. Oka. H. Rev. Riani Simanjuntak. Listanto. Bent.7(2): 35-38. Ithaca.. oleh Van der Laan. Bio/Technology 10: 271275 Höfte. & N.Y. 2001. & Sibuea DAFTAR PUSTAKA Abbot. Ortiz. Micro. 60: 353-356. 1992. A method of computing the effectiveness of an insecticide. B. C. Carozzi. Brent. Envi. No. J. & Bahagiawati AH. 1989. Pros. Ceron.. Bahagiawati & Amirhusin. 1981. Bravo. Brotonegoro. Advances in Agronomy 66:251298. H. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). Perhim. Santoso. J. Bul. Koziei. 1991. Kramer. cry 1A(c) dengan PCR. JS. 39. Microbiol. Setyawan & Sutrisno. Kalshoven. Payne. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. Indo. ISAAA. Moore. ISAAA Briefs. 1992. Applications of Molecular Biology to Plant Disease and Insect Resistance. Lina & A. Smith & K. Ausubel. GW. Bahagiawati. Seidman. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. Mikro Indo. Rizjaani. Struhl. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. NB.. Bacillus thuringiensis: insects and Beyond. Masalah dan . Indone. Yu. R. 57(11): 3057-3061. JG. Ortiz. PT Ichtiar Baru-Van Hove. RE.. Mikro. E. Warren. & L. & IC. Surabaya 12-14 Maret 1997. Sutrisno. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. M. John Willey. D. 2002. Appl.. 18: 265-267. Sem.A. R. J. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. Jakarta. Penggunaan Bacillus thuringiensis sebagai bio. Kingston. VC. & HR. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. Second Ed. L. New York. IN. 1999. Whiteley. Feitelson. 2008. Soegiarto & MS. L. J. Bahagiawati. 2002. Sarjono. Biotek. DD. E. Quintero. S. 1983. Aranda.

Santoso. Bacillus thuringiensis and its insecticidal crystal proteins.. RA. Mol. D. Perhimpunan Entomologi Indonesia Cabang Bogor. Dean.R. J.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi. E. 1997. Oka. & Soehardjan. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR. Bogor. Crickmore. J. IN. 1991.H. Environ. 1998. Rodiyah. D. Rev. J. Biol. Listanto. Lereclus. Padi-Buku III: 653-680. 2000. Microbiol. 1984. & GA. D. Smith. Oka IN. & Bahagiawati AH. Tantangan entomologi pada abad XXI. N. 63(3):775-806. TJ. Risalah lokakarya penelitian padi. Cibogo. Jurnal Bioteknologi Pertanian 5(2): 53-60. van Rie. E. Schnepf. 57: 311-315. Couche. Zeigler & D. Pengendalian terpadu hama padi. Baum. The phylloplane as a source of Bacillus thuringiensis variants. Appl. Feitelson. 22-24 Maret 1983. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Damayanti & Sutrisno. Memasukkan: April 2009 Diterima : September 2009 105 ..

The soil was collected from numerous places around Pontianak. respectively. and formulated to single and mixed bacterial inoculants. and Nitrosomonas spp. Spaerotillus natans. Nitrosomonas. Keywords: Jatropha curcas L. That selective inoculant has opportunity to be used for jatropha farming. Rhizobium . Azotobacter. Chromobacterium. Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. inoculants. Bacillus.. Nitrosomonas. Bacillus.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Kata kunci: Jatropha curcas L. plant height was accelerated quickly while other inoculants affected to stalk diameter development. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter. Genera of Azotobacter. inoculants. and neither to bare soil dresses with compost. Bacillus. Nitrosomonas. Jl. Raya Jakarta-Bogor km 46. E-mail: widadomon@yahoo. and Spaerotillus natans were soil bacterial isolates. Citrobacter. Kandungan minyak mencapai 40% 107 . Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran. Citrobacter.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI. West Kalimantan. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. Azotobacter. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition.. In the presence of inoculants. Citrobacter. Chromobacterium. Rhizobium . Spaerotillus natans. Cibinong Science Center. Chromobacterium. Rhizobium. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Bacillus. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant. Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Those isolates were used as inoculants.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L).

Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al. 2006). Bacillus. dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Lewis et al. ElGhadban et al.Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. atau setara dengan 1. Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan . Bakteri yang berhasil diisolasi adalah Azotobacter. BAHAN DAN CARA KERJA 1. 2006).9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978). 2002. 2007). Pusat Penelitian Biologi LIPI. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak. Kandeel et al. Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. dan Spaerotillus natans. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. Chromobacterium. Kalimantan Barat. Perlakuan bakteri Azotobacter chroococcum. Azospirillum liboferum. 1991. sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. Nitrosomonas. Citrobacter. Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot). dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008).6 metriks ton minyak jarak hasil produksi tanaman per hektar. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar. serapan hara. Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. 1995. Badran & Safwat 2004. Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. Rhizobium spp.

02 g KCl. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). perlakuan kompos tanpa mikroba (P-8). Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter.2x107 Rhizobium. 0. Media tadi mengandung: 1 g glukosa. 1. Karoho. dan kemudian diformulasikan seperti pada Tabel 1. Sambas.6H 2 O. Mandor. masing-masing sebanyak seperempatnya atau 7. Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera). dan P-17. perlakuan kompos sekam ayam (P-7).001 g MnSO4 H2O. 1. Citrobacter. 2.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit.01 g MgSO4 7H20. yang diisolasi dari tanah asal Rasau Jaya. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran.001 g FeCl 3 . 0. yang diisolasi dari tanah asal Rasau Jaya.05 g (NH4)2SO4.5 g Ca3PO4. digoyang pada kecepatan 150 rotasi per menit. Satu dari tiga kecambah yang terbaik pada setiap pot 109 . P16. Singkawang. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya.3x107 Spaerotillus natans sebagai BahanInokulan (B-I). 1. dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2. atau sebagai inokulancampuran beberapa-genus (multi-genera). dan Nitrosomonas spp. 3x10 7 Chromobacterium.5 ml sediaan dari inokulan Azotobacter. Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan. sebagai inokulan P-3. dan Bacillus spp. kemudian dikondisikan pada pH 7. yang masing-masing diambilkan 10 ml dari BI. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus. kemudian ditempatkan di dalam rumah kaca.8x107 Nitrosomonas. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding. 0. diinkubasi selama 7 hari. Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I.05 g yeast ekstrak dan 0.5x107 Citrobacter. 0. Citrobacter. Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6). Pontianak. 0. Bacillus. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count. dan 2. 0. Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp.

(isolat tanah Karoho) Azotobacter. Citrobacter. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. Citrobacter. Bacillus. dan Rhizobium spp. Bacillus sp. dan Nitrosomonas spp. (isolat tanah Pantai Singkawang) Azotobacter. dan Nitrosomonas spp. Rhizobium sp (isolat tanah Ketapang) Azotobacter. Citrobacter. Citrobacter. Bacillus. Bacillus. Citrobacter. dan Nitrosomonas spp. Bacillus. (isolat tanah Rasau Jaya) Nitrosomonas sp. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. Bacillus. (isolat tanah Singkawang) Citrobacter sp. dan Nitrosomonas spp. Nitrosomonas. Nitrosomonas spp. Bacillus. Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. dan Nitrosomonas spp. (isolat tanah Sambas) Azotobacter. Citrobacter.. Bacillus. Bacillus. beserta kontrolnya.Widawati & Rahmansyah Tabel 1. Azotobacter sp. dan Nitrosomonas spp. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. Chromobacterium. (isolat tanah Mandor) Azotobacter.

P-12. Tanaman yang tidak diberi inokulan pada no. P-2. P-15. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp. P16.1. P-14. dan P-17 untuk perlakuan inokulan satu jenis. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. P-13. dan 14 mst (Gambar 1).305 1 5 13 17 9 UCL = 22. sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst). dan P-17. P-12. P-7. P3. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2. 1. 2.0. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13. yang umumnya berukuran di atas nilai tengah (center). P-14. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5.627 Tinggi tanaman (cm) LCL = 51. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst. P-16. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5. P-10. P-15. 8.377 Center = 17. P-13. dan P-15. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 . sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. P-6. 11. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil. dan P-17.804 UCL = 79.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya. P13. Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. P16. P-4.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh.231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1.

Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10. memperbaiki struktur akar. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. akibatnya dapat memperbaiki serapan air. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis. sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp.. dan Bacillus spp. PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). dan memperlancar serapan hara oleh tanaman (Ogunwole et al. baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis. yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan.95). sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G. P-A. Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan. kompos. Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal. 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. P-B. dan PC bila dibandingkan terhadap P-E. memperkecil erosi. inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. Sekalipun pada hasil yang lain. namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4). atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. dan P-I (Gambar 3). dan P-C (Tabel 2). yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman . Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. P-H. dan P-F sebagai kontrolnya. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos. Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. atau bahan organik lainnya.

627 60 50 40 30 LCL = 51.93 UCL = 19. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5.103 32 10 UCL = 9.231 Center = 17.745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73.66 LCL = 19.647 LCL = 11.52 Center = 15.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.615 9 28 Center = 26. dan 14 mst.486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat. 11.126 70 20 18 16 60 Center = 59.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33.774 UCL = 22.295 24 8 Center = 7.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65.637 LCL = 8.931 50 LCL = 46.377 (mm) tanam an Center = 44. 8. Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata.344 Center = 11.305 UCL = 79. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 .637 7 6 20 LCL = 5.314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14.804 LCL = 13.

Bacillus. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F .kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 . Bacillus.kontrol 2 (tanpa inokulan) . Bacillus.kontrol 1 (tanpa inokulan) . Nitrosomonas spp. Citrobacter. Nitrosomonas. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter. dan Nitrosomonas spp Azotobacter. Citrobacter. Chromobacterium. Azotobacter. Citrobacter. Bacillus.kontrol 3 (tanpa inokulan) . Bacillus. dan Spaerotillus natans Azotobacter. dan Nitrosomonas spp Azotobacter. Citrobacter.Widawati & Rahmansyah Tabel 2. dan Nitrosomonas spp. dan Nitrosomonas spp. Citrobacter. Azotobacter. dan Rhizobium spp Azotobacter. Bacillus. Citrobacter. Bacillus. Bacillus. dan Nitrosomonas spp Azotobacter.

7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0.649 + 1. R^2 = . dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC). Kecepatan tumbuh batang hasil pengamatan 5.60 0.80 0.20 0.00 1. fraksi atau serpih tanah.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4.20 0. Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F). 11. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar.20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1.40 0.904 Gambar 3.80 A C G H 0.60 0. 8. 115 .20 1.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E). dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1. atau tanpa kompos (P-F).40 0.00 0.904 Y = 23. Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al.7 x + 23.00 0. namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus).722 * X. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman. serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya.

Isolat bakteri yang diperoleh dari tanah asal Pontianak. Ch. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. yang diisolasi dari tanah asal. improves seedling . S. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. & TS. luas daun. DAFTAR PUSTAKA Badran.. dan klorofil daun bila dibandingkan terhadap kontrolnya. AC. Rao & B. yang mana keberhasilannya terjadi seperti pada pengujian ini. Johnson. Bakteri Bacillus spp yang diujikan oleh Desai et al.. Bacillus. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. bobot akar. dan Nitrosomonas spp. Egyptian J. Ch Kumari. Rep.: an important biodiesel plant. Narayanaiah.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun. & MS. 2004. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. Seed inoculation with Bacillus spp. Plant Biotech. Kalimantan Barat. Gnanamanickam. 2:7–11 Desai. Venkateswarlu. 2007. biomassa. Safwat. 82(2): 247256. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). Agric. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. FS. M. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri. GR. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. Deore. S. Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. Reddy. 2008. dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. Res. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization.

2008. Agrophysics. Scien. Mangkoedihardjo. Shrivastava. Soils. Int. 2008. 1978. Sharaf-Eldin. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol. AL. M. ES. E. 47(1): 351–371. 5(2): 75-80. Effect of biofertilizers on the growth.. Chaudhary. Fert.. MN. CK. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards. Ogunwole. Cairo. J.. Jatropha curcas L. & M. World Appl. Tropical Hort. Ain Shams Univ. and essential oil content of fennel (Foeniculum vulgare Mill.). Lewis. Chikara. Richaume. Am. A. Maheshwari. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media. 2007.Biol. 84(3): 977-992. Saber. Wani. Kandeel. Annals Agric. S. yield. Osman.) cv. & MA. Patolia. 35(2): 308-311. 3(1):7378. Munoz. SK. S. Sreedevi. SA. volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. Gangrade & KC. SAT. Naglaa & AA. African J. Trivedi. Banerjee. Quantitative and qualitative microscale distribution of bacteria in soil. Soc. Asian Biotechnology and Development Review. El-Ghadban.. D’Silva & TK. Daudu. 58(3): 245 – 251.. Dominguez & OS. Mahfouz. SP. 8(2):11-29. Int. Yousry. Ranjard.Inte. AM.. 2002. & A.. Res. for phytoremediation of lead and cadmium polluted soil. 21: 361-366. 4(4): 519-522. J. Improve livelihoods and environmental protection through biodiesel plantation in Asia. Shalan & TAT. Agric. Egyptian J. Influence of biofertilizers on growth. EAE. In vitro clonal propagation of physic nut (Jatropha curcas L. SK.). JO. Sadek. 2008. 44 (1): 229-234. 39: 27-32. OM.): influence of additives. Elefan. Sci. Kabesh & MS. Biol. 2006. 2008. JS.J. 2001. Ghosh. M. Res. Plant Soil Sci. Agric.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. 1995. 152: 707–716. Sci. Memasukkan: April 2009 Diterima: September 2009 117 .. L. 2006. International Conference on Environmental Research and Technology (ICERT). Effect of mineral vs. & Surahmaida. volatile oil yield and chemical composition of Ocimum basilicum L. 1991. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. 308-312.. Int. Environmental Technology & Management. Vietnamita. biofertilizer on growth. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin. Indian Perfume. plant. DR. LO. Abdel-Latif. Microbiol.

while the female in disk type. titthaheileus. Serat polen mengandung protein lebih dari 60%. Bats have important role on seed dispersal and or plant pollinator. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah. Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda.Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. prolate pollen type has importance for the male of Eonycteris spelaea. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. sphinx. titthaheileus and C. sphinx. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar. 119 . The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. Email: srisoegiharto@gmail. brachyotis and R. Furthermore the male of Macroglossus sobrinus has interested in rotatus. West Jawa. polen dan nektar (Suyanto 2001). oblate type for the male of C. amplexicaudatus like permagnae type (100-200 ì m).co. Email: apkartono@yahoo. Key words: Fruit bats. C. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m). brachyotis and C. pollen identification. oblate spheroidal for the female of Rousettus amplexicaudatus and male of C. and perferesence. Kelelawar kelompok Megachiroptera mengkonsumsi buah. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. Where as the female has interest in campanulatus type.id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. corola types. pollen. Urceolatus type has important for female of C. urban area Kata kunci: Kelelawar buah. while the female of C.com 2 Staf Pengajar Mayor KVT IPB Bogor. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. identifikasi. C. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen. minutus. brachyotis. sphinx. The male of C. tubulosus.

. 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan. brachyotis. titthaheileus. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). pengulangan dilakukan sebanyak tiga kali. sphinx. Macroglossus sobrinus. dan sering terdapat karbohidrat lengkap sporo-pollenin. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. C. yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Rousettus amplexicaudatus dan Eonycteris spelaea. C. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan. Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling. Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. pigmen carotenoid. Nayar (1999) dan Paldat (2005). BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan.00-18. 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga. mulai Maret 2008 hingga Juni 2009.00 – 08. Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan. Pengambilan sampel polen didapat dari isi pencernaan kelelawar. terpenoid.Soegiharto & Kartono hidrokarbon.00 WIB dan pagi hari pada pukul 06. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic. C. Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina. Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. Jaring kabut yang dipasang pada waktu senja hari pada pukul 17.

sedang/mediae (25–50ì m). axis 2 = 0. prolate spheroidal. bintang. dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. tabung dan bulat. Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan. kupu. Bentuk mahkota bunga terbagi kedalam 8 tipe. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. lonceng. Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang. kedok. yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009). Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. Untuk bentuk mahkota lebih kuat mempengaruhi C. 121 .187.5 (Leps & Smilauer 1999). sedangkan betinanya dipengaruhi kuat oleh bentuk disk. (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. dan bulir. sangat besar/ permagnae (100–200ì m). Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). disk. tipe polen dan ukuran polen. axis 3 = 0. Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). C. prolate dan perprolate. kecil/minute (10– 25ì m). sphinx betina.390.241 dengan eigenvalue = 0.466 dengan eigenvalue = 0. Analisis pengaruh karakteristik bentuk bunga. Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok. Pada penelitian ini data yang dihasilkan dalam bentuk persentase. Penyajian data dilakukan dalam 3 bentuk. brachyotis betina. besar/ magnae (50–100ì m). HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar. suboblate. yaitu tabung. Tipe polen terbagi ke dalam 7 tipe yaitu peroblate.116 dengan eigenvalue = 0.753. oblate spheroidal. serta C. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. oblate. jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. titthaheileus betina dan jantan.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. mangkuk. dan raksasa/giganteae (>200 ì m).

Pada Gambar 2b. BU_L= Bulir.88 52.66 25. sphinx betina. minutus jantan. p = jumlah persentase.194. R = Rousettus amplexicaudatus.06 18.74 61. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a.285. MA_K= Mangkuk.86 4.03 9..18 33. dengan eigenvalue = 0.95 18. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b.97 11.4 11.58 42. TA_B= Tabung.95 44.598. CS = C. Spesies C.05 2. Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C.40 21.24 12.15 4. sedangkan spesies C. CT = C. axis 3 = 0.23 43. CB = C. sphinx. axis 2 = 0.77 68. KE_D= Kedok.1 14.08 29.47 30. Untuk jenis C. Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3.886. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal.047 dengan eigenvalue = 0. titthaheileus.39 42.588.53 9. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate. LO_C= Lonceng.091 dengan eigenvalue = 0. brachyotis.11 68.26 9. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1. KU_P= Kupu-kupu. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate. DI_S= Disk. 122 . C. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae.97 100 100 85.74 57.39 48.44 50.7 27. Tabel 1.03 7. menjelaskan bahwa Rousettus amplexicaudatus betina dan C.61 19.08 11.55 9.427.356. dengan eigenvalue = 0.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2. E = Eonycteris spelaea.28 14.09 7. C.99 Keterangan : CM = Cynopterus minutus . axis 2 = 0. BI_T= Bintang. M = Macroglossus sobrinus. Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0. dengan eigenvalue = 0.48 12.84 41.462. brachyotis betina dan R.54 7. menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0.26 7.

2 85.69 39. CT = C.52 86.31 14.65 3.72 14.71 44.29 52.21 100 5.9 85.23 43.69 10.67 29.86 6. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40.97 Keterangan : CM = Cynopterus minutus.26 76.93 64. p = jumlah persentase.95 42.13 Magnae p 15.45 35.13 11. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar.08 41.74 61.52 7. R = Rousettus amplexicaudatus.48 7.59 42.04 Permagnae p 43.87 7.4 Keterangan : CM = Cynopterus minutus.42 6. CT = C.66 56. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36. R = Rousettus amplexicaudatus. E = Eonycteris spelaea.13 12.5 41.94 11.78 20.8 14.83 61. CS = C.16 35. brachyotis.17 23. E = Eonycteris spelaea.01 14.92 44. brachyotis. titthaheileus. sphinx.65 7. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar. p = jumlah persentase 123 .2 64.03 100 1.95 39. CB = C.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2.77 46. M = Macroglossus sobrinus.47 18.23 15.97 34.85 5.04 25.72 14.24 35.01 57.48 13. M = Macroglossus sobrinus. CS = C.34 42. titthaheileus.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14. sphinx.61 4.28 74.56 100 100 100 92. CB = C.92 37.58 53. Tabel 3.

12= Eonycteris spelaea jantan.Soegiharto & Kartono 0. 8=C. sphinx betina. 9= Macroglossus sobrinus jantan. TA_B= Tabung. 6= C.6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. 7= C. sphinx jantan. 13= Eonycteris spelaea betina. 5= C. DI_S= Disk.0 Gambar 1. DI_S -0. titthaheileus betina. brachyotis jantan.4 Axis 1 1.4 Axis 1 1. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2. LO_C= Lonceng. minutus betina. KE_D= Kedok.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0. Keterangan : 1. 10= Macroglossus sobrinus betina..4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a. b) hubungan axis 1 dan axis 3. KU_P= Kupu-kupu. -0. BI_T= Bintang. 2 = C. 4= C.4 b. brachyotis betina. 124 .0 0. BU_L=Bulat. 11= Rousettus amplexicaudatus betina. titthaheileus jantan. 3= C. MA_K= Mangkuk. = Cynopterus minutus jantan.

2 = C. b) hubungan axis 1 dan axis 3.8 b. brachyotis jantan.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0. sphinx betina. titthaheileus jantan. 10= Macroglossus sobrinus betina. bracyotis betina. 13= Eonycteris spelaea betina. titthaheileus betina. 5= C.6 Axis 1 PR_SP 1. 11= Rousettus amplexicaudatus betina. OB_SP= Oblate spheroidal.0 0. 3= C. PR_SP= Prolate Speroidal. 6= C. 9= Macroglossus sobrinus jantan.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0. minutus betina.. 11 -0.0 Axis 1 . SB_OB= Sub Oblate. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen. = Cynopterus minutus jantan.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0. OB -0. sphinx jantan. OB= Oblate. 125 .8 a. 8=C.4= C. Gambar 2. 12= Eonycteris spelaea jantan. Keterangan : 1.6 1. a) hubungan axis 1 dan axis 2. PR= Prolate. PE_PR= Perprolate. PE_OB= Peroblate. 7= C.

. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan. titthaheileus betina. 3= C. minutus betina. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. 10= Macroglossus sobrinus betina. Menurut Graham et al. dan ukuran. bentuk. 4= C. ukuran polen besar dan dalam jumlah banyak. 9= Macroglossus sobrinus jantan. 11= Rousettus amplexicaudatus betina. menghasilkan nektar yang berlimpah. 8=C. Bentuk keberagaman yang ditunjukkan berupa warna. 2 = C. 5= C. titthaheileus jantan. GI = Giganteae. 12= Eonycteris spelaea jantan. (2003) karakteristik kelelawar dalam mencari makan pada malam hari. Keberagaman tersebut dijelaskan oleh Graham et al. 13= Eonycteris spelaea betina. (2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar.Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae. bentuk mahkota bunga mangkuk. tingkat 1. mengeluarkan bau menyengat (asam butyric).4 8 PA 9 12 3 5 7 2 GI 4 11 13 1. Keterangan : 1. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen. MA = Magnae. mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. = Cynopterus minutus jantan. bracyotis betina.2 kebutuhan pakan yang tinggi.0 Axis 1 Gambar 3. 7= C. brachyotis jantan. 6= C. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator). sphinx jantan.0 -1. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. sphinx betina. bau. PA = Permagnae 126 .

tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar. Stroo (2000) mencoba menganalisis pengaruh ukuran polen. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari. [Euphorbiaceae] sp. bunga terbuka dan mudah diakses. 1. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar. ukuran polen tersebut mulai dari magnae. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen. Durio sp. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. Ceiba pentandra. Peneliti lain (Graham et al.2. sedangkan tipe polen. Baringtonia sp. Bauhinia sp. Syzygium sp. Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp. ukuran polen tersebut mulai dari magnae. Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar. brachyotis. spesies Rousettus amplexicaudatus betina dan C. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen. sphinx. namun berbeda kesimpulan tentang sistem aperture. permagnae dan giganteae. C. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 .2 dan Ceiba sp. Ceiba sp. [Orchidaceae] sp. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar.. titthaheileus. serta bunga terletak pada cabang pohon. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus. Ceiba sp. Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah.1. C. C. Pendapat Graham et al.. sphinx jantan lebih memilih oblate spheroidal. menghasilkan nektar yang banyak dan polen yang berlebihan. permagnae dan giganteae..3.. berpendar atau warna kusam. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar. tipe polen.. mengeluarkan bau yang tajam dan menyerupai bau kelelawar.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan.

Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Voigt (2004) dan Bumrungsri et al. . (3) kelelawar lidah pendek/ pemakan buah. Toelch & Winter (2007). kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. C. Perbedaan pendapat Warren & Diaz (2001).Soegiharto & Kartono kelelawar tersebut.. (2009) akan lebih dijelaskan pada hasil penelitian kami. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan. misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. bunga dan daun. yang menjadi pakannya. Bumrungsri et al. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar. C. kedok pada spesies Eonycteris spelaea jantan. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. Rousettus amplexicaudatus dan Eonycteris spelaea. Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. (2) tipe bunga yang mudah diakses polennya. C. titthaheileus. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. yaitu: (1) tipe bunga yang mudah diakses nektarnya. brachyotis. kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering). Durio spp. sphinx.

blogspot. Sridith & PA. LE. Canoco Reference Manual and User ’s Guide to Canoco for Windows. International Bioscence Series Volume XIV. Pearson and Prentice Hall. Ecol 25:85–92. A. 193:265–269 Voigt. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar. New York: Chronica Botanica. T. Ceske Budejovice. Trop. Smilauer. Nayar. Graham. CC. 1998. Syahid. Faculty of Biological Sciences. 2005. Pr. J. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. 2003. Oxford: Oxford Univ. U. 2004. 2007. Illustrated Handbook on Pollen Terminology. Glover. Wilcox. Pollen morphological evolution in bat pollinated plants. Leps. Kelelawar di Indonesia. 2009. Copenhagen: Munksgard. Chongsiri. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae. permagnae dan giganteae. 1952. Suyanto. 2009. Multivariate Analysis of Ecological Data. K. Pusat Penelitian dan Pengembangan Biologi – LIPI. JM.. 2001. 129 . 1943. The pollination ecology of durian (Durio zibethinus. of Palynology Stroo. E. Erdtman. Graham & LW.& Y. G.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. 2007.Evol. TS. http: //abdulsyahid-forum. DAFTAR PUSTAKA Bumrungsri S. New Delhi: Today & Tomorrow’s.com / 2009/04/transformasi-data. Plant Sys. Ithaca: Microcomputer Power Toelch. [20 Juni 2009] ter Braak. Dept. 222: 225–242. Component Phy. University of South Bohemia. Racey. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores. Pollen Flora of Maharashtra State India. Erdtman. Plant Biology. J & P.html. G. Psychometric function for nectar volume perception of a flower-visiting bat. Transformasi Data. A. 1999. Paldat. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan. Understanding Flowers and Flowering:An Inte- grated Approach. Sripaoraya. An Introduction to Pollen Analysis. CJF. A. Smilauer. Bombacaceae) in southern Thailand. BJ. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers. & P. Bogor. 2000. Winter. 1999.

Diaz. 2007. Memasukkan: Juli 2009 Diterima: September 2009 130 .Soegiharto & Kartono Component Physiology 174:541– 548. Bandung. HM. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. Whitney. A twopollinator model for the evolution of floral complexity. Evolutionary Ecology 15:157–166. Morphology and development of floral features recognized by pollinators. 1:147–158. J. Yulianto E. Glover. Arthropod-Plant Inter. 1992. Warren. Preparasi dan dasar determinasi palinologi. & BJ. 2001. & A.

contains of 22 autosomes and 2 sex chromosomes. Based on the statistic test.m. This plant is commonly used as vegetable. Papasan memiliki sulur. Papasan memiliki beberapa nama ilmiah seperti C.30 a. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). Keywords: Coccinia grandis L. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5. The chromosome number of both Papasan is 2n=24. Chromosome.m and 2-2. Cromosom. Fakultas Biologi. UPT BKT Kebun Raya Purwodadi-LIPI 2. berwarna hijau pada saat muda dan berwarna merah pada saat tua.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L.rindyastuti@yahoo. Niedzielski 2002). berbentuk lonceng. Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran. Berbah and Gajah Wong Riverbank). Universitas Gadjah Mada E-mail : ridesti. Papasan.1]non-3-ena-2.30-09.25. found in three population (Ngebel. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983.. C... anti bacterial.30 p.) Voigt) in Three Population in Yogyakarta. Selain itu. Papasan. 131 . Buahnya berbentuk oval dengan panjang 4-6 cm. especially in shape and taste of fruit. batang memanjat.m. The difference R value between Papasan I and II was smaller than 0. and anti diarrhea. cordiflora. indica.30 p. They differ in phenotype. dan aksiler. Papasan is a dioecious plant belongs to the family Cucurbitaceae. Kata kunci: Coccinia grandis L.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11. 11 a. grandis dan C.30 a. while Papasan II at about 08.m-00. The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m). In Daerah Istimewa Yogyakarta.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1. anti diabetic.3. bunga berwarna putih kehijauan. Kariotype. Karyotype. there were two varians of Papasan (Papasan I and II).m. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika.5-dimetilbisiklo[3. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1. Dalam “Flora of Java”.9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006). Character differences between both of Papasan only revealed physiology adaptation. It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L.

Juni 2008. grandis (L. grandis var. Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. Kedua populasi tersebut berbeda karena perbedaan morfologi. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. Varian buah manis yang umumnya dibudidayakan merupa-kan C. 132 grandis var. varietas atau forma. Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. Dengan demikian. Metode preparasi kromosom. bentuk. dua macam Papasan yang ditemukan di populasi Ngebel. wightiana (Roumer) Grab. ukuran. Keduanya berbeda dalam hal rasa. 1996). jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek). Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel.Rindyastuti &Daryono Papasan memiliki satu nama yaitu C. Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003). BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. Fakultas Biologi Universitas Gadjah Mada. Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. cordifolia Auct non. variasi bentuk dan rasa buahnya.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. grandis) yaitu tipe buah manis dan buah pahit. Di Daerah Istimewa Yogyakarta. yaitu dari bulan Oktober 2007. Cogn sebagai nama sinonim. grandis dan varian buah pahit C. warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. yang digunakan adalah metode Squash (Jahier et al. Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype. Yogyakarta selama delapan bulan. Di India ditemukan dua varian Papasan (C.

Identifikasi Papasan (Coccinia grandis (L. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto.49 0-12.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. Ukuran tiap ulangan dirata-rata. Ujung akar diambil.5-25. diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda.00 133 . Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG.68-3. Lengan panjang diukur dari telomer lengan panjang sampai sentromer. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37. Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i.0.49 RLK 1. Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1.00 >7.5 12.0 dan CorelDRAW X3. Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16.01-7. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom.0 untuk konversi skala ukuran kromosom.5-50 25-37.00 3. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7. Pada setiap pemotretan. Lengan pendek diukur dari telomer lengan pendek sampai sentromer. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya. Kromosom difoto dengan mikrofotografi. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering. Untuk menyusun karyogram. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar.00-1.67 1. Bentuk kromosom berdasarkan Indeks Sentromer (IS). Satu persatu. Tabel 1. Hasil pemotongan dicopy dalam format Adobe Photoshop 7.

Ukuran biji (cm) a) panjang b) lebar 3.2. Bentuk daun 2. memiliki rasa buah pahit dan variasi bentuk buah yang banyak.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4.6 .6 0. Biji 1. terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II.7 . tidak berambut 7.11. Tabel 2.9. variasi bentuk dan rasa buahnya.3 .33 tinggi putih Melengkung keluar (recurved) satu 134 .7.64 0.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2.7 manis membulat 0. Perbedaan baru terlihat pada ukuran daun.6 .6 2 .3 . bentuk daun. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan. Seperti tampak pada tabel. Viabilitas 4.0.4 memanjang. Ukuran daun (cm) a) panjang daun b) lebar daun 2.6 .3 8. Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4.9 . Tanaman Papasan I Papasan II membundar berlekuk licin.3 . Rasa 3. membulat-oval.7. banyak variasi Membundar berlekuk licin.2. Permukaan daun 4. berasa manis dengan sedikit variasi bentuk buah.4 7. Buah Papasan I memiliki garisgaris putih. Bentuk biji 2. Warna buah a) muda b) tua 3.4 8 . Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4.5 . Karakter morfologi Papasan I dan II.5 .2 6.25 pahit oval 0.2 oval-bulat variasi sedikit 1.1 . sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua.0. Daun 1.9.3 . Karakter Dari karakter buah. Bentuk 5. Warna 2. Buah 1. Bunga 1.5. Bentuk buah 2. Tepi daun 3. sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar.5.6 2. tidak berambut 6.0. Papasan II memiliki ukuran daun lebih besar daripada Papasan I.0.

biji Papasan berbentuk oval dan mampat. indica yaitu 2n=24.Identifikasi Papasan (Coccinia grandis (L. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955.10-12.00-14. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris. sedangkan daun mahkota Papasan II menggulung keluar (recurved). 2004) sehingga. biji Papasan I memiliki bentuk membulat.30 WIB. 11. Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. Guha et al. chepalandra. 9. 3. Namun.00-12.15 WIB. dengan frekuensi terbanyak pada jam 11. sedangkan prometafase Papasan II banyak ditemukan pada jam 09. Perbedaan karakter terlihat pada daun mahkota. 10. 6. sedangkan biji tanaman Papasan II berbentuk oval. sedangkan yang berbentuk metasentris ada pada autosom nomor 1. Agarwal & Roy 1984. 7.00-11.15. Papasan I lurus.30 WIB. Berdasarkan nilai IS (Tabel 3). Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2). sedangkan kromosom kelamin berbentuk metasentris. sedangkan biji Papasan II sangat mudah berkecambah. Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom.30-09. 4.00-14. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin. Pada Papasan I prometafase banyak ditemukan antara jam 09.30 WIB sedangkan sel Papasan II aktif membelah antara jam 08. 5. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2. dari 24 kromosom Papasan.30 dan 14. Disamping itu. memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil. Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 .20 dan 14. C. 12.15 WIB. Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II.00-11.00-11. diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek. biji Papasan I tidak dapat berkecambah. Sedangkan.20. Sel Papasan I aktif membelah antara jam 08. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3.30 WIB. 11.50-10.50-09. Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2). Secara umum. hirtella dan C. 8. dan 11.

136 . 7. 4. autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. 6. 8. panjang lengan panjang (q) dan panjang absolut kromosom (p+q). Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. dan 11. Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram. Karyogram kromosom Papasan I. 10. Karyogram kromosom Papasan II. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. 3. 2.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). 9. sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p).

75±0.106 1.155 0.073 0.218 1.073 0.135 0.102 0.89±0.092 1.27804 36.) Voigt) di Tiga Populasi Tabel 3.96±0.03±0.79±0.133 0.Identifikasi Papasan (Coccinia grandis (L.60±0.071 0.112 0.211 1.86±0.29±0.44±0.54±0.48±0.22531 45.099 0.108 1.96±0.062 0.61615 44.103 0.129 1. 137 .51±0.48±0.77±0.25±0.83784 45.67±0.230 1.5394 45.109 0.242 1.29±0.249 1.99±0.33331 47.23 1.139 0.077 0.34532 43.075 0.067 0.130 0.112 0.56±0.114 0.255 1. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman.091 0.42±0. Tanaman No.22 1.73±0.26497 46.081 0.107 0.13±0. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.072 0.17±0.77302 43.061 0.095 0.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.116 1.105 1.16±0.71775 47.55±0.13±0.113 1.72±0.73±0.72844 46.78±0.73±0.26413 46.63128 46.74±0.7189 46.162 1.89±0.148 Indeks Sentromer (IS) 35.42±0.53±0.66±0.085 0.075 0.083 0.76±0.33±0.02±0.063 0.64±0.86±0.74±0.083 0.59±0.86±0. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.62±0.80±0.090 0.58±0.121 0.82±0.129 1.78±0.268 2.109 0.94±0. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.70±0.69±0.46603 46.089 1.06±0.069 0.67±0.66±0.078 2.58±0.70±0.230 1. baik autosom maupun kromosom kelamin.91±0.00024 47.085 0.083 0.120 1.82±0.62±0.77649 47.84±0.73±0.122 1.94±0.189 2.37865 47.86±0.50±0.267 0.102 0.70±0.079 0.146 1.34739 44.06673 46.69±0.069 0.254 1.53865 45.80±0.86±0.182 0.128 0.252 1.097 0.074 1.28729 47.70±0.87±0.15998 45.76±0.

Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer. diduga Papasan I dan II masih tergolong dalam satu spesies.51-0.56-1. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0.44 1. Nilai R menunjukkan variasi ukuran kromosom. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata.00 Papasan I Papasan II Gambar 3.50-0. Perbandingan idiogram kromosom Papasan I dan II. Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman.25 35.Rindyastuti &Daryono Tabel 4.01 Papasan II 2n=24=20m+2sm+XX(m) 0.06-2. Berdasarkan hasil uji statistik pada aras 5% (Tabel 5). 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.59-1.77649 2. Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- .16-2.33 1.87 0.34739 2.86 0.13 36. variasi ukuran kromosom juga semakin tinggi.345-47.5394-47. Semakin besar nilai R. Perbandingan karakter kromosom Papasan I dan II.

Berdasarkan Gambar 4. Nilai R antara Papasan I dan II berbeda. cuaca atau kesuburan tanah. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4). Berdasarkan Tabel 5. selisih nilai R antara Papasan I dan II lebih kecil dari 0. X = Pasangan kromosom kelamin betina 139 . karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda. Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0.25.) Voigt) di Tiga Populasi batannya. Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0.Identifikasi Papasan (Coccinia grandis (L. Namun.25. PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II. Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R. artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim. Tabel 5. Untuk membandingkan nilai R Papasan I dan II. NS = Non-signifikan. nilai R kedua Papasan tergolong kecil. Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan.

Oleh sebab itu. antara organ yang satu dengan yang lain dalam satu spesies. 3 = Melon PI 371795.5 Nilai R Nilai R 1 0. Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. Tabel 5. 4 = American muskmelon Gambar 4. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II.01 0. No.5 2 1. bahkan antara tipe sel satu dengan tipe sel yang lain. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain. 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0. Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya.565 Melon PI 371795 0.125 0.Rindyastuti &Daryono Perbandingan Nilai R 2. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas. Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman. 2 = Papasan II.115 0.575 Papasan II 0. perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling .5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1.45 American muskmelon - Menurut Tamarin (1999).

25. Raka Swastika. khususnya atas konsultasi di bidang taksonomi tumbuhan. jumlah. DAFTAR PUSTAKA Agarwal. AAG. Qi-Xing et al. mengindikasikan bahwa berdasarkan karakter kromosom. Roy. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. gracillis berdasarkan selisih nilai R lebih dari 0. S.Identifikasi Papasan (Coccinia grandis (L. yaitu karakter morfologi daun. serta karakter genotip yang meliputi waktu mitosis. bunga dan biji. Meastika Dianeta. Senada dengan hal tersebut. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4).Si. dan Drs. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. bentuk. S. mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. M. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2.25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. KESIMPULAN Berdasarkan perbandingan karakter fenotip. Herlianti Anissa. ukuran.Gen. Qi-Xing et al. S.. buah. maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L.59. Purnomo.25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C.) Voigt. Sc. tetapi Cucumis. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0. perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. Namun melon tidak tergolong dalam genus Coccinia. Disamping itu. M. & RP. yunnanensis dengan rasio 2. PK. 1984. Tuty Arisuryanti. dalam Ferruci (2000) memisahkan Serjania communis dengan S. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0. Si. 2000). atas bantuannya secara teknis. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II. Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi..) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain.71 memiliki kedudukan taksonomi yang sama dengan A. Nogueira et al. Karyotype of Coccinia indica. Dr. grandis L. Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan. & Plant Breeding 44(1): 117-120. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel. atas bantuan konsultasinya. 141 . Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas.25. Indian J.

h a r t w i c k .jp/ article/cytologia/70/1/70_53/article. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. Techniques of Plant Cytogenetics.V Groningen. JM. http://www.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. serta Isolasi dan Identifikasi Senyawanya”.jst. Ramachandran. PJ.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. Russel. New York. & AP. Eber.. 2000. 1998. Smith. George Allens and UNWIN LTD. Inc. 305. MS. 1999. Karyomorphology and Relationships of Amentotaxus Pilg. Oxford University Press. 98-101. MW. H. Subramaniam. Winarno. Memasukkan Agustus 2009 Diterima: September 2009 142 . www. Ciawi. 1979.go. 176182. Bakhuizen van den Brink. 1996. 1996.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id.kalbe. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana. Jstage. 2007. Zhi-Jiang & Y. www.Rindyastuti &Daryono Backer.go.pdf/10Pemanfaatan TumbuhanObatDiare109. Genetics. JM. K. Sundari. Little-knownTropical Drug Plant. 3-5. Luchsinger. California. e d u / P re b u i l t / BiolJBR3_www. 234-325. & AE. Jahier. K & B. CD. Niedzielski. Cheure. Coccinia grandis. Ferruci. RK. Plant Systematics. G.. Yogyakarta. Flora of Java Vol. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia.ac. Walter Noordh off N. Inc. 1999.id/ind/ detailPenelitian. Coccinia indica. Science Publisher. USA. 2004. Delourne & AM. USA. SB. London. Z. Darlington. hartwick. Diakses tanggal 5 November 2007. 1983. Sinha. 1. Fifth edition. Gadjah Mada University Press. 38 (6) : 525532. Science Publisher. Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit.html. A.lemlit. Karakterisasi Kromosom Melon (Cucumis melo L. Econ. 2006. Inc. 1-77. Sin. Evolutionary Genetics. Act Phytotaxo. Wylie. Tjitrosoepomo. 2002. New York. Plant Systematics. Sixth edition. Sinha & S.html?id=4138. 1965. McGraw Hill-Book. Bot. Winarsih.unud. The Netherlands. Comp.co. Y. Yogyakarta. stage. Chromosome Atlas of Flowering Plants. G. Tangui. RH. Fakultas Biologi UGM. F. 2000. ZhongShu. w w. 1998. Principles of Genetics. 51-57. Inc.http:// www. Morfologi Tumbuhan. 1955. 2003. & RC. McGraw HillBook Company.jp/article/ cytologia/70/1/70_53/article.) PI 371795. Singh. Jones. Tamarin. CA. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae.jst. 217-222. & D. Scarlet Gourd. Guha. Qi-Xing. The Benjamin/Cummings Publishing Company. Cytological. R. 37 (4) : 380-383.

degradasi. Salah satunya adalah phenanthrene. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi. yang merupakan salah satu senyawa karsenogenik (Cerniglia. produksi. antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan. and able to degrade phenantrene after 5 hours. Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta. perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu. yang tersusun dari gabungan tiga cincin benzena.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI. Pseudomonas spp. This isolate grew optimum at 300C. The relation between PHB synthesis and phenantrene degradation is due required further investigation. 1992. Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil.bacteria Kata kunci: Phenantren. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. dietil. Phenantrene is one of the most persistent organic substances in environment. maka.5 hours and specific growth rate of 0. maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan. Alcanivorax Borkumensis M5 was isolated from sea water. yang 143 . Jl..8 with a doubling time of 14. 1984) yang sangat berbahaya bagi kesehatan manusia. distribusi. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya. metilpropil).Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) . biostimulasi dan bioaugmentasi. degradation . Keywords: Phenanthrene.. Cycloclasticus pugetti. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH. Menurut Brodkorb et al. but the synthesis was inversely correlated with the cell growth. Polyhydroxybutirate (PHB) was produced during culture growth.0476/hour. About 75 % of phenantrene was degraded after 12 hours. pH 7.

144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi.79 gr NaCl. 0. 89 mg Na2HPO4·7H2O. termasuk pestisida.850 LS. H 3BO 3 . 31 mg NaHCO 3 . dan larutan ketiga mengandung FeCl2.46 gr CaCl2·2H2O. Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22. dan SrCl2 (divalent cation salts). Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH.60 BT dan 5. NaHCO 4 . Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%).6 dengan NaOH). Lo´pez et al.27 gr NH4Cl. 2001. .0 mg FeCl2·4H2O. Na2SO 4. NaF. 2002). 0. Larutan pertama mengandung NaCl. 1. Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan. larutan kedua mengandung MgCl2.98 gr Na2SO 4. BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta.6 mg NaF. 11. CaCl2. oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya. salinitas temperatur dan status nutrisi. Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7.72 gr KCl. 2006 ). 1. Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit. NH 4 Cl. 3. dan 2.0 gr/L) ditambahkan pada larutan pertama. 27 mg H 3 BO 3 . KCl.18 gr MgCl2·6H2O.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. 83 mg NaBr. Noble Agar (Difco) (15. 2. karena memiliki metabolisma yang berbeda dengan mikroba teresterial. Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. 24 mg SrCl2·6H2O. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC). NaBr. Untuk memadatkan media. PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh.3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al. Uyttebroek et al. Letak astronomisnya adalah 106.

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7. Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.6 0.6 0.0143 0.8 Y= 0.3% Salinitas 5% 0 Td (jam) 15.8 0.2 1 0.6 1.94 Y= 0.5 25.4 OD 600 nm 1 0.0437 pH 5.8 pH 5.018 0.0266 1.7 38.4 OD 600 nm 1.9701 R = 0. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 .3% Salin 5% 1.0476 0.3344 Y= 0.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.0476 x + 0.0143x + 0.0266x + 0.2273 R2 = 0.8 0.3 0.17 Gambar 2.302 Y=0.3958 Y=0.501 R2 = 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.018 x +0.4 0.0369 0.6 1.33 14.4 0.79 48.8 dan pH 5.9704 0.2 0.2 1 0.5 0.8 0.25 18.Dyah Supriyati Tabel 2.9685 R2 = 0.9459 R 2 = 0.7 0.0437 x + 0.9977 2 0.6 0.17 30 C 40 0C Salinitas 3.8869 R2 = 0.0369 x +0.9 0.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.4 0.3887 Y= 0.

Pada media dengan pH 7. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat. bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis. 2. Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur. bakteri ini bisa dikategorikan sebagai bakteri laut tropis. seperti misalnya di perairan laut Indonesia. dan produksi sel).8 bakteri M5 mempunyai td 15. Di salinitas 5%. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25.3%.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5. Sedangkan.05 0 Salin3.5 0 Salin3.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3.3 0. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%. laju pertumbuhan.35 0.3% Salin 5% pH 5. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .17 Media Media Gambar 3. pertumbuhan bakteri M5 mulai lemah.3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5.5 jam berarti bakteri mempunyai waktu generasi 14. dengan td 14.. Nilai waktu generasi M5 ini lebih cepat.2 0. Hal ini menunjukkan bahwa.bakteri mempunyai waktu generasi 18.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC.15 0.3 % lebih baik dibandingkan dengan 5. Artinya setiap 14.5 jam di salinitas 3.3% Salin 5% pH 5.5 jam. Dengan td 18. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38. salinitas maupun pH yang serupa dengan asalnya. Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3.25 0.7 jam.7 jam . Dilihat dari 3 parameter di atas (waktu generasi.17 (45.5 Berat sel (gr/l) 1.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas. pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3. Pada media dengan salinitas 3.17 PHB mg/g sel 2 0.5 1 0.17).1 0.3 %.79 jam Nilai waktu generasi M5 ini lebih cepat.4 0.3 %.

Pada media dimana pertumbuhan bakteri M5 terlihat terhambat. Microbiol. Rev. & E A. DAFTAR PUSTAKA Anderson.. Appl. dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0. Dawes. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene. CE. 1984. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. A.Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini.3 % . sel jusru membentuk PHB lebih banyak.8) Kemungkinan isolat M5 mampu membentuk PHB. Media seawater ini dipilih karena menurut Springael. Brodkorb. 58:3117–3121. 1992. Made Sudiana. pada media air laut mengandung phenantrene. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. Dengan tumbuhnya bakteri M5 tersebut.atas bantuan yang diberikan hingga selesainya tulisan ini. 150 . bakteri M5 justru sel membentuk PHB paling sedikit. 30:31–71. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium. Microbiol. suhu 30oC dan pH mendekati netral (7. Microbial degradation of polycyclic aromatic hydrocarbons. Cerniglia. perlu diteliti lebih lanjut. 1990. metabolic role. KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. and industrial uses of bacterial polyhydroxyalkanoates. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L.J. &R L. 54:450–472. Appl. 1990) pada proses anaerobik-aerobik. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%. Pada media yang relatif optimum untuk pertumbuhannya. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene. TS. yang berperan pada proses degradasi phenantrene. metabolism.1%).Adv. tumbuh optimum pada salinitas 3. Environ. Occurrence. Legge. Microbiol.

& U. P. AM. L. Memasukkan: Agustus 2009 Diterima: September 2009 151 . Uyttebroek. Joffe. Ortega-Calvo. J. B. Z. Appl. Microbiol. Bastiaens. Karlson. 1999. Kishira. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil. M. 1:63–70 Johnsen. Karlson. Vila. Microbiol. Metabolism of fluoranthene by Mycobacterium sp. Microbiol. Environ. Chemosphere 43:1085– 1094. S. Breure & WH. Breugelmans.. Lo´pez. Karlson. Janssen. Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models. 2001. Springael. Wattiau.&U. H. JJ. Microbiol. Biotechnol. C. 2004. 70:747–756. 2006. Kasai & K. AR. 8:836–847. Minguillo´n & M. Biotechnol. Mol. U.. Appl. Bendixen. Johnsen. Biotechnol. strain AP1. 2002. Hausner. MP. J. ARK. Grifoll. Ryngaert. 68:2683–2689. A. H. 63:452–459. 2006. Y. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). M. Rulkens. Appl. Mulder. Environ. Microbiol. D. Petroleum biodegradation in marine environments. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. Shutsubo.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama.

A. Jakarta . Perkembangan tanaman polong-polongan utama di Indonesia. NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim. ASM. dan bawah masingmasing 2. Murray. 2000. Batas dari tepi kiri 3 cm. Information for surveys/Estimated of population density.species..E.G. Biol. Bab dalam Buku : Gerhart. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA. χ. Tesis. atas. PEMBAHASAN. & C. Gen. 1982. Penulisan simbol α. Vol 6. No. Apll. 42. Dalam : Gerhart. Bucke. H. & S. Buku : Chaplin. Prosiding : Mubarik. Jakarta. dan tabel disertai CD. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar. Kata dalam bahasa asing dicetak miring. R. BAHAN DAN CARA KERJA. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. 1990. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris. & N. JR. tanpa mengubah jenis huruf. Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali.1. Ueda. Identification of plasmids linked with polyglutamate production in B. Suhartono. Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). Suwanto. NR. HASIL. Indon. dan lain-lain dimasukkan melalui fasilitas insert. Enzyme Technology. Skripsi. MF. Wood. Liquid culture.A. 1999. 29: 345-354. subtilis. P.html. ABSTRAK (bahasa Inggris. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. 15 –18 Oktober 1982. Setiap halaman diberi nomor halaman secara berurutan.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point. Drew. Zhang. Krieg (eds. kanan. 248-277..J. & SW. P. Methods for General and Molecular Bacteriology. J.. D. http//www..net/primates/loris/ lorCp. Cambridge University Press. Pola Pertanian. β. KATA KUNCI (maksimal 6 kata). maksimal 250 kata). Cambridge. W.).R. Disertasi : Kemala. Informasi dari Internet : Schulze. 15-16 Februari 2000. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. S. PENDAHULUAN. Abstrak : Suryajaya. 1983. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris).[Disertasi]. T. Bogor : Institut Pertanian Bogor. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. 1994. 1987. Washington. Abstrak Pertemuan Ilmiah Mikrobiologi. . 151-158. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). foto. Detection and Identification of Lories and Pottos in The Wild. & MT. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah. Microbiol.

J. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Rugayah. Puslit Biologi-LIPI Ir. Hari Sutrisno. Desember 2009: Dr. Majariana Krisanti MSi. Biol. Vol 6. Puslit Biologi-LIPI Ir. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6. No 1. No. Heryanto MSc. Niken Tunjung Murti Pratiwi. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 . Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Indon.

Kartono Identifikasi Papasan (Coccinia grandis (L. No.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 . Ostrinia furnacalis Guenee Bahagiawati. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. Biol.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Vol 6. Indon.J. Habib Rizjaani.