J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

Hg. Limnoharis flava. Keywords: Accumulator plant. vaginalis. Cibinong Science Centre. biomass. Kecamatan Nanggung. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. The aim of this research is to study the potency of Salvinia molesta. Meanwhile S. Hidayati 1). molesta showed the highest biomass followed by M. conjugatum. Based on characteristic of hyperaccumulator plant. this research suggested that S. Desa Bantar Karet. Kemungkinan 1 . Cibinong. Centrosema pubescens. Desa Bantar Karet. Syarif 1) & S. Kabupaten Bogor. F. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. Bogor Titi Juhaeti 1). manure and compost. NPK. P. Bogor E-mail : tihaeti@yahoo. P. Kabupaten Bogor. N. sativa dan C. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). conjugatum dan M. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. Monocharia vaginalis. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. The fertilizer treatments were significantly affected plant growth. Kecamatan Nanggung. Kecamatan Nanggung. molesta also showed the highest capasity to accumulate Hg/year followed by C. Oryza sativa. Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. nudiflora.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. ke sawah ataupun ke kolam ikan.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. accumulation capacity Katakunci: Tumbuhan akumulator. molesta. Hg. Desa Bantar Karet. O. nudiflora. O. The treatments were fertilizer: no fertilizer (as a control). vaginalis. The result showed that the growth of each plant was significantly different. The S. biomas. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. M. sativa and C. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya. Cyperus monocephala. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. nudiflora were selected for fitoremediation of Hg contaminated soil. Paspalum conjugatum. vaginalis.

mata lele). di kebun. 2000. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. Centrosema pubescens. Cyperus monocephala dikenal sebagai teki badot. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). 2004 Dalam Rodriguez et al. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. Kayser etal.. dan kubis. Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya. penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. Salvinia molesta (kiambang. Monochoria vaginalis. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. di daerah Sunda disebut jukut pendul bodas.Juhaeti. Centrosema pubescens Benth. Commelina nudiflora. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. Indian mustard. Chen et al. Mikania cordata. kacang-kacangan. di tepi jalan. dikenal dengan nama sentro. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Terry and Banuelos. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan. Cyperus monocephala. barley. termasuk pohon.. 2007. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung. 2 2001. 2001. gandum. di hutan sekunder. Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. Salvinia molesta. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. merupakan tumbuhan terna memanjat. Pivetz. 2000. rumputrumputan dan tumbuhan air. oat. Hidayati. di tempat yang agak basah seperti di pinggir sungai juga di sawah.

Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Desa Bantar Karet. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Desa Bantar Karet Kec. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman. Kab. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Kecamatan Nanggung. Penelitian dilakukan pada bulan Maret-Oktober 2007. Penelitian in-situ dilakukan di Kampung Leuwibolang. Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. Dalam prakteknya. Ni. Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri. Bogor. dan Cd pada tanaman. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor.S. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. 3 . Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi. Sementara itu. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Nanggung. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. Salvinia molesta D. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn. Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang.

Pupuk kandang 5 kg/petak dan 4. vaginalis. Pada tahap ini jenis tanaman yang diuji dikurangi yakni C. tajuk dan total tanaman. molesta.8 X 2 meter dengan 3 ulangan. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0.) B. Sedangkan perlakuan pemupukannya adalah: 1. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen. petak penelitian tidak tergenang.(tali korang). Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar. 2. Pada saat panen. . pubescens dan M. flava. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. Untuk tanaman air. Commelina nudiflora L. kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman.f. Mikania cordata (Burm.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1. Oryza sativa (padi). Kontrol. HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S. dan 5. Perlakuan pemupukan diberikan pada saat tanam. L.Juhaeti. sedangkan untuk tanaman darat.Robins. Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian. O.f.5 bulan setelah tanam. petak penelitian dijaga supaya selalu tergenang. C. Limnoharis flava (L. NPK 16 g/petak. Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. Setelah itu. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1. Hidayati. Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman. konsentrasi Hg (ppm) di akar dan tajuk. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas). 3.L.) Presl (eceng leutik). Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut. Monocharia vaginalis (Burm. conjugatum. Pengairan menggunakan air yang tidak terkontaminasi merkuri. sativa. 4. 2. 2. 3. 3. cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan. sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat. 4. M. Paspalum conjugatum Berg (jukut pahit). Centrosema pubescens (sentro). seluruh biomassa tanaman berupa akar dan tajuk diambil. Syarif & Hidayat Mitchell(kayambang). P. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama.

33 187. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921.867 bc 59. pubescens dan M .34 a 184. cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3.2 1671.69 b 152.792 bc 70.6 b 2620.617 102. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam. onocephala C.03 a 345.600 c 63.69 427.7273 1464.5 a 1619.0 1337. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.3 2850.0 223.1833 3.cordata tidak ditanam kembali (Tabel 1).95 66.46 241.138 a 87.3417 0.580 Jenis tanaman S.22 a 1110.133 56. dan C.74 106.233 Tdk ditanam Tdk ditanam 77. pubescens M.0 425.23 187.3 12092 996.9 Tdk ditanam Tdk ditanam 693.65 345.6 a 2018.71 72. terlihat dari tingginya produksi biomasa tanaman.8 a 2028. Akan tetapi.66 a 269.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman.6 252.75 95.6 ab 2329. Akan tetapi C. molesta O.667 34.04 153. cordata C. nudiflora Tabel 2. Hal ini dilakukan karena dalam fitoremediasi.67 a 216. flava P. C. sativa M.51 47. Pengaruh pemupukan terhadap pertumbuhan tanaman. pubescens dan M.74 619.4 624.2 b 3 1050.7 b 2257.2 1779.53 c 751. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1.99 a 287.786 b 5 . conjugatum C.88 35.93 9.5 ab 2 1955.0500 3.7 2778. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman.51 a 2 169. Produksi total biomasa tanaman (gram) tiap periode penanaman. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879.841 a 37.37 b 3 78. vaginalis L.6 659.93 b 221.16 212.1 3.9 1523.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala.21 332.6167 2.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257.1917 0.64 161.05 144.6917 2.2833 1.8333 0. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1.

nudiflora.conjugatum. Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman. 6 konsentrasi Hg (ppm) . Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c). T7 = C. T9 = C. T8 = M. T2 = O. masing-masing jenis tanaman menunjukkan kemampuan yang berbeda. T5 = P. dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. Sativa. konsentrasi Hg (ppm) akar tanaman (b). molesta. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk.Juhaeti.pubescens. T 6= C.vaginalis. T3 = M.cordata. T4 = L. kecuali pada M. Monocephala. hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a). Syarif & Hidayat tersebut ke bagian tanaman yang dipanen.flava. Hidayati. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab). Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda.

perlu diperhatikan beberapa kriteria.flava. L. monocephala. Salvinia molesta. vaginalis. T8 = M. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . T5 = P. O. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. C. sativa. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. T9 = C. Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. Monocephala.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2. T3 = M. marginal. flava.conjugatum. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg). cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. T4 = L. T7 = C. T2 = O. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. Diharapkan. (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al. conjugatum.nudiflora. Sativa.pubescens. molesta. pubescens dan M. sedangkan C. P. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman.vaginalis. M. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk. T6 = C.cordata. Pada penelitian ini. dan C.

Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik.flava. pubescens. Hidayati.Juhaeti. potensi produksi biomasa tananaman yang diuji pun cukup tinggi. Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. molesta. hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. . yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air). Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu. C. Kemudian. C. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu. M. Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran.cordata dan C. M. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. (2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. sativa. terbukti dengan adanya konsentrasi logam yang tinggi pada akar. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. P. Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman. Syarif & Hidayat yang tinggi (Reeves 1992). Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk.vaginalis. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O.nudiflora.conjugatum. monocephala. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. L. S. Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal.

M. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S. conjugatum. O. O. nudiflora.vaginalis. T2 = O. jarak tanam. vaginalis. conjugatum. P. sativa. Sativa. molesta.pubescens. molesta. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. C. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. T5 = P. nudiflora. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . Vaginalis.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan. O. conjugatum dan M. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. P. sativa. vaginalis.flava. M.cordata.nudiflora. M. T7 = C. sativa dan C. T6 = C. T4 = L. Gambar 3. T8 = M. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman. T3 = M. molesta. sativa. nudiflora dan P. umur panen. O. Monocephala.conjugatum. P. C. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat. vaginalis. molesta. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata. conjugatum. nudiflora. molesta. C. Tanamantanaman tersebut adalah S. T9 = C.

pubescens M. monephla 36. cordata 859.13 1 O.conjgtum 40. flava O.435 S.568 L. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46.3 2105.55 4 10 .912 P.803 L. flava 44.369 C. flava 4.03 31.5 M. vaginalis L.conjgtum C. molesta O. pubescens S.9 P. sativa M. sativa 4755.529 P. monephal 42.mocephal 35. pubescens M.1 1721.104 31. pubescens M.278 C. vaginalis L. sativa C.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O. pubescens 12558. molesta O. monoephala 2476. pubscens M. cordata C.34 Jenis tanaman Kontrol NPK O.9 C.87 5030. monoephala 10. molesta M.298 M.316 C. molesta 13303.3 10. conjugatum C. flava M.5 M. sativa 85.6 3894. pubescens 3216 5259. conjgam 67. vaginalis 33. sativa 141. molesta 40. monephala M.31 L. conjugatum 5625.Juhaeti. flava P.4 P. molesta 63.848 12. nudiflora 57. nudiflora O.6 O.627 P.2 4644. pubescens S. sativa 159.502 S.401 7. molesta M. nudiflora 18.712 12.605 Kompos S.455 O.11 2 C. flava 18.33 10513.6 5077. molesta C. conjugatum C. Hidayati. sativa M.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S.97 C. conjgtum 55.9 8046. molesta 111. pubscens S.9 6488. flava 13.869. nudiflora 16. cordata C. pubscens M.2 M. mocephal 32. vaginalis C.13 1164. flava P. molesta 10897.643 5. vaginalis L. cordata C. molesta 55.183 M. conjugatum C.456 16. nudiflora 6331.37 C. sativa 6098.471 33.197 C. flava M.55 C.062 L.43 4598.70 6 O. cordata C. vaginalis P.095 19.758 C. monoephala M.214 S.263 32. cordata C. nudiflora S.498 M. moncephala C. puescens M.155 C.7 4742. vaginalis 28. nudiflora P. vaginalis 7682.625 O. conjatum 107. monoephala L. vaginalis 42.conjugtum S.241 Kandang C. flava C.171 C.9 6936. vaginalis 8. Syarif & Hidayat Tabel 3.581 24.558 19. sativa P. flava 24.7 1254. sativa M.937 9. pubescens S. cordata C. nudiflora 107. cordata C.04 5 S. conjgtum 11. nudiflora 63. nudiflora 4504.5 1895. moncephala M. vaginalis L. flava P.253 M.931 C. cordata C. cordata C.357 P.099 9.516 16.765 L. vaginalis 68.907 12.999 3.946 11. sativa L. conjugatum 4542.049.3 O. monoephala C. cordata C. nudiflora 114.03 3949.849 41. molesta 190. sativa 55. cordata C.604 18. nudiflora L.8 C.05 M.14 8.

J. T. Laporan Akhir Penelitian Kompetitif LIPI. N. Rodriguez. Juhaeti & F.Plant. N. 2007. Soil Sci Soc Am J 59:125-133. RD. International JSPS Seminar. 1995. Int. RB. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives. & CL. Di dalam: Backer. Moreno. Hidayat. 2007. Hampshire: Intercept Ltd... Gabbrielli. The Vegetation of Ultramafic (Serpentine) Soils. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). Syarif & M. JS. CWN. T. Rodriguez. Phytoremediation 9(1): 1-13. C. Environ.. Baker. Memasukkan: November 2008 Diterima: Juli 2009 11 . 2006. Bogor. 2004. & O. Vergnano. FN. Reeves (ed). Asencio. Rincon. Chaney. Syarif. 1992. J. Robinson. Angle & AJM. SL. Reeves. R. Juhaeti. 1991. RL. The Hyperaccumulation of Nickel by Serpentine Plants. RD. Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator.. Hidayati. Harapini. S.. Hidayati. L. J. AJM. Mattioni. F. Hlm 253-227.. DAFTAR PUSTAKA Brown. Stewart & BH. Anderson. Practices 6(2): 165-175. J. Nutr 14 : 1067-1080. Proctor. I. 12-20 Oktober 2006..

Dalam tulisan ini diuraikan karakter morfologi. biserialis dan I. Idiosepiidae. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Norman 2000). habitat. Idiosepiidae. picteti hingga saat ini hanya dijumpai di Ambon. Ternate. Hylleberg & Nateewathana 1991b). Austria 2 Museum Zoology Bogor. Keywords: Cephalopoda. Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. Banda. I. pygmaeus. distribution. siklus hidup dan distribusi Idiosepius. jenis sotong ini tidak diminati oleh para nelayan. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I.go. habitat dan distribusi empat jenis sotong mini jenis I. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. Sibolga dan Lombok. habitat. The animals are dorso-ventrally compressed and cigar-shaped. Cibinong 16911 – Indonesia.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. Research Center for Biology – LIPI. Fac. I. biserialis dan I. reproduksi dan siklus hidupnya. The arms are short and robust and almost equal in length. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. Nabhitabhata 1998. Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I. Indo-Pacific Kata kunci: Cephalopoda. Cell Imaging and Ultrastructure Research. distribusi. ovally elongated with the long axis parallel to the body axis (Figure 1).email: rist001@lipi. the fins are small. The females reach maturity at 3 cm length. 1090 Vienna. Karena ukurannya yang sangat kecil. Jackson 1988.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). picteti. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. habitat. of Life Science. Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. pygmaeus herbereri. Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a. One conspicuous morphological character of this genus is the adhesive 13 . Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. pygmaeus khusus dari perairan pantai di Lombok. Balikpapan. Marwoto 2 University of Vienna.

however. they also lie in wait to capture prey swimming by. pygmaeus Steenstrup. Cyran et al. Grimpe (1931) compared the collected material with samples of I. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. revealed that the morphological characteristics were insufficiently different to justify the subspecies. Lombok. 2008. Hiding there. Appellöf discovered I. Joubin (1894a) collected one male holotype sample of I. In 1898. The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). It can be assumed that this species has disappeared or even become extinct. Later. This species was thought to occur only in the Philippines. organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. Indonesia. The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay. 2008). pygmaeus from several institutions and proposed that his specimens differ from I. collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). more than 115 years ago. pygmaeus has a wide distribution in Indonesia.Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. Idiosepius pygmaeus hebereri was . contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). pygmaeus and the other species mostly in size. Examinations by Nesis (1982). picteti at Ambon Island. in females. Collection of Idiosepius in Indonesian waters has long history. up to this day. 1881 in Ternate 14 and Banda-Sea. Unfortunately. Furthermore. In 1927.

Cape Town.166´E) (Kalk. Inhambane Bay (23° 51. Monque (23° 41.215´S. Ekas-Bay.300´S. South Africa (SAM A6520) Type locality: Mozambique. 32° 54. a further species. picteti. Lombok (08° 52.184´S. Adam 1986.487´ E) (von Byern & Klepal 2009) and Ko Pratong. 116° 27.Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I.541´E) (von Byern et al. Japan. 2005).331´S. individuals of I. Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong. The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections). San Jose Mission Station. 1962 (Figure 2A) Holotype: deposited at South African Museum. 98° 25. Nevertheless. 1959. von Byern & Klepal 2009) Japan: Takasu. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00. pygmaeus. In contrast to I. Collector: S. 35° 22. 32° 54. Research Center for Biology – LIPI.December 2007 using a dipnet. Austria) and MZB (Museum Zoologicum Bogoriense). picteti and I.553´E) (von Byern & Klepal 2009). pygmaeus below). biserialis. Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus. it was thought to occur only in African waters (Mozambique) and Thailand. This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals.281´E) (Voss 1962. many questions about their life cycle. was recently discovered in Indonesian waters (von Byern et al. 26° 02. Apart from I. 35° 22. geographical distribution and origin of migration remain. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. 2005) Indonesia: Ekas-Bay. 2005) . Shigeno (von Byern et al. less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia).156´N. I. we report new collection places for Idiosepius in Indonesia and extend the previous type localities. The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. METHODS Idiosepius specimens were collected along the bay of Lombok in November .721´E. Lombok (08° 15 . So far. With the present description and geographical data.020´S. Indonesia. Phuket Island (8° 02. RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss. pygmaeus. Previously. von Byern & Klepal 2009).

116° 27. with a mantle length of 4. 116° 26.Byern & Marwoto 50.35 mm 15. data) Morphological characteristics: This species has the smallest specimens of the genus.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I. The left arm also has two small flaps. at the tip. 16 .38 ± 1.857‘ E) (08° 50. The specimens from Thailand are larger (ML to 5.5 ± 0. collected November 2007 (unpubl. B) I.1 mm females). 1962). biserialis (Voss. Both ventral arms in the male are hectocotylized. slender.54 mm males and 7. In the caught male.3 mm (males) and 7. The fins are more rounded kidney-shaped and A B 14. The fins are semicircular and about ¼ of the mantle length. 1894a) and C) dorsal and ventral view of I. picteti (Joubin. bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm.84 ± 0. the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. 1982). Animals from Mozambique are small. pygmaeus (Nesis. which are nearly constant in size to the end of the club.2 mm C 7.7 ± 1.31 mm (females). 357‘S . 714‘S .781‘ E) . separated by a deep cleft. The clubs of this species bear two rows of small suckers.

1887 Idiosepius pygmaeus Hoyle. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia. 1920 Naefidium picteti Grimpe. The animals from Japan are almost twice as long (6. The left ventral arm is more slender. Idiosepius picteti Joubin. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe. Idiosepius pygmaeus Steenstrup.39 ± 1. The right ventral arm in the male is very short and broad. Denmark (ZMUC CEP52) Type locality: Philippines. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48. The tentacle clubs have two horizontal rows of suckers. 98° 25. Klong Bang Rong (8° 02.34 ± 0.25 ± 0. while the two investigated females have a mantle length of 5. 1881 (Figure 2C). longer and bilobate at the tip. Zamboanga (4° 20´N.1 mm females) with 3 suckers on the left and 5 on the right ventral arm. Our examinations of this specimen reveal that Joubin (1894a) erred. The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm. Copenhagen. Synonymy: Idiosepion pygmaeum Fischer. no additional specimens of this species have ever been found. 1886.35 mm. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”.945´N. sometimes also three or four oblique rows of suckers.107´N. Joubin 1894b. Each ventral arm has a single small sucker near the base.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle. Amboina – according to Joubin. Genève.030´E) (Suwanmala 17 . Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius.89 mm males and 9. Zoologisk Museum. The body is large and elongate (mantle length 14 mm). 98° 24.472´E) (von Byern a & Klepal 2009). The oral face the arm is transversely plicate. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe. Idiosepius picteti has a small tentacle club with four rows of suckers. 1931 Holotype: deposited at Kobenhavns Universitet.

Berlin.5 ± 2.020´S. Jackson 1992.52 mm in males and 16. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm. 116° 27. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898). North Queensland (19° 15´S. data) • Telong Elong (08° 48. Jackson & Choat 1992. rounded and slightly constricted at their base. Balikpappan (Grimpe 1931). short.28 mm males and 15. More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms. another 4/4 suckers on the hectocotyli. The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11. Germany (ZMB) Type locality: Indonesia.51 ± 1. The 18 right ventral arm is stout and thick.012‘ E).637‘ S. Grimpe (1931) .Byern & Marwoto et al. collected December 2007 (unpubl. Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus. both ventral arms have only one sucker at their base. 146° 50´E) (Jackson 1988. while the left arm is thinner and slender.885‘ S.12 mm females) to I. data) • Rinca Island (08° 39.53 ± 1. Jackson 1993. 1995. 116° 42. Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). collected November 2007 (unpubl. collected December 2007 (unpubl.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19.730‘ S. Ekas-Bay. The specimens bear 4 rows of suckers at the club of the tentacle. I.37 mm in females. The fins are small. data) • Gili Lawang (08° 19. 116° 30. collected December 2007 (unpubl.26 ± 4. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay. bilobated at the tip. Museum für Naturkunde der Humboldt-Universität. one individual has 1/1. Idiosepius pygmaeus from Indonesia is similar in size (11.709‘ E). Institut für Systematische Zoologie. 119° 42.937‘ E). 1931 Holotype: deposited at the Zoologisches Museum. Lombok (08° 52. pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe. Semmens et al. According to the description of Steenstrup (1881). Lewis 1991.015‘ E). 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville. 116° 43.244‘ S. Pecl & Moltschaniwskyj 1997.

1962. and African waters. Presently. I. Jackson 1992). picteti (Joubin. biserialis and I. All observations on this genus concerning behaviour. but individuals were also found in cooler Russian waters (Nesis et al. the males of 8. the geographical distributions of all Idiosepius taxa are still only marginally explored. von Byern et al. thailandicus Chotiyaputta et al. I. southern Australia including Tasmania. I. unpubl. Moreover. I. Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. 2005). I. The species are mostly distributed in the tropical Indo-Pacific. 1921. Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss. I. Within the genus. At its base the left arm has 3 suckers. The left ventral arm is longer and bigger than the right arm. DISCUSSION Systematics The relationships among species within this genus remain unknown. Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . 1962. macrocheir Voss. 1894a). pygmaeus). Others like I. paradoxus inhabit sea grass and algae areas. relatively little is known about the biology and life cycles of Idiosepius. I. The fins are small and have a round to almost oval form. minimus (D‘Orbigny. ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. the onset of sexual maturity or postembryonic behaviour. and also has two lobes at its tip. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri.5 mm.g. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. The females of this subspecies have a mean mantle length of 14. paradoxus (Ortmann. notoides Berry. no data are available about its postembryonic life. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982). 1888). I. data). 1881 and I. Japan. while the right arm is more stocky and broad with 2 suckers at the base. pygmaeus Steenstrup. spawning. biserialis has the widest geographical distribution. For example. 1845). but this value needs verification. 2002). 2003). 1991. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983.5 mm.

These observations agree well with other collections of I. biserialis in Africa. pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). 1986. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. Japan and Thailand. 1921. ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. Gili Lawang. garbage. de L´Institut Royal des Sci. such as those along the eastern part of Lombok Island at Gili Sulat. 2005. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. von Byern & Klepal 2009). 47 (1): 39-55. Biology Department and furthermore to Mr.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. On some days this flotsam covers almost the whole water surface. Bull. . Cephalopods of the genera Sepiolidea. 1881 (Mollusca Cephalopoda Decapoda). Sci. SS. A. Cephalopoden von Ternate. During high tide. but are clearly absent in the northern. indicating that this species is specialised for sea grass areas (von Byern et al. individuals of the former I. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. Lalu Japa & Karnan from Mataram University. REFERENCES Adam. 1898. Interestingly. Naturelles de Belgique 56: 149-154. Moreover. The Philip. Moreover. W. Appellöf. pygmaeus could only be found in mangrove forests and belts. Berry. Lombok Island. We still do not know whether the animals stay there at high tide or move elsewhere. J. Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. leaves and other plant material were transported here by the current. the animals were also observed to mate within this flotsam and escape under the waste when threatened. Our thanks go in particular to Mrs. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. So far. von Byern & Klepal 2009). and Idiosepius. the garbage in the water apparently does not affect I. Sepiadarium. I. 2006. Telong Elong and Ekas-Bay. western and south-western shores of the Island. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. In contrast. Additional genetic.

. Bull. Can. Center Res.g. Aquat. Mollusques vivants et fossiles. The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus. Cephalopods of the world . Über die Cephalopoden der SundaExpedition Rensch. Cephalopoda). Libraire F. 1962 (Mollusca. Cyran. Naefidium n. 350-351. J. 1881 (Cephalopoda: Idiosepiidae). 1887.An annotated and illustrated catalogue of cephalopod species 21 . J. 1931. W. Chaitiamvong 1991. Report on the Cephalopoda collected by H. 49: 218-228. GD. Idiosepidae. N. Teuthologische Mitteilungen IV. Jackson. Hylleberg. Report on the Scientific Results of the Voyage of H. J. P. Zoology 16: 1245. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. P. GD. GD. Fish. Bull. Okutani & S. Fishery Bulletin 91: 260-270. Klepal & J. Grimpe. Australia.M. Gide et Cie. Nateewathana 1991a. Jackson. Venus. & CFE. Hylleberg.Sci. T. Jackson. GD &J H. Center Res. Roper 2005. Bull. Nateewathana 1991b. 1886. Challenger during the years 187376. WE. The Jap. Jereb.Challenger during the Years 1873-76. Teuthologische Mitteilungen XIII. Growth in tropical cephalopods: An analysis based on statolith microstructure. D‘Orbigny. & A. 1845. & A. 1920. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus.M. CH. Zool. G. 56: 1-9. Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss.S. sp. Phuket Marine Biol. Phuket Marine Biol. internal anatomy. Anzeiger 51: 208-214. Tome Premier. Malacology 50 (3): 165-174. Paris. ACV. The Veliger 35 (4): 396-401. and biometrics of the cephalopod Idiosepius biserialis Voss. G. 55: 33-42. 1988.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. Savy Paris. pro: Loligo picteti Joubin 1894. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. North Queensland.S. Fischer. 87: 265-272. A new record for the Andaman Sea.. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n. 1962. Fish. Grimpe. Cephalopodes Familie XIII. Choat 1992. von Byern 2008. 1993.J. 1992. Redescription of Idiosepius pygmaeus Steenstrup. Anzeiger 95 (5/8): 149-174. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles. with mention of additional morphological characters. Zool. Jackson. Morphology. (Cephalopoda: Idiosepiidae). Hoyle.

London.A. 1-82. du Musèe d‘Historie Naturelle de Genéve 2: 23-64. 1991. Revue Suisse de Zool. Sepiadariidae. ON. Joubin. Idiosepius thailandicus Chotiyaputta. K. 1894b. 266: 1133-1139. Nabhitabhata. Rome. Hamburg.. V. Mémoires de la Société Zoologique de France 15: 80-145. Distinctive Behaviour of Thai pygmy Squid. 2000. Moscow. 1894a. Idiosepius pygmaeus Steenstrup.. Sepiolidae. L. Translated from Russian by B.S. Nesis. N A. Australia. Moynihan. 1902. 1959. a small tropical cephalopod. African J. M. Sci. Somatic growth processes: how are they altered in captivity ? Proc. Phuket Marine Biological Center Special Publication 18 (1): 25-40. Japonenses 10 (21): 209-213. J. 1982. Semmens. Mocambique. Revue Suisse de Zool. AR. Cephalopods of the World. Sepiidae. Tintenfischfuehrer. Jahrbücher 3: 639670. Sasaki. Revision des Sepiolidae. Zoo. No.: 178-180. 2002. Ruthenica 12 (1): 81-84. On an adhering habit of a pygmy cuttlefish.A. 1888. Publications. 3: 459-460. & N A. 1888) (Cephalopoda) . A. 1998. FAO species catalogue for fishery purpose. Pecl. et Ann. Japanische Cephalopoden. 1921. Ratnikov.Sci. J. The zoogeographical composition of the intertidal fauna at Inhaca Island. L. Katugin & AV. Royal Soc. M. Ortmann. Behavior 85: 42-57. Jahr Verlag. Zool. S. K. Joubin.First record of Idiosepiidae in Russian seas. Joubin. Okutani& Chaitiamvong. Annotationes Zool. 1: Chambered nautiluses and sepioids (Nautilidae. G. Lewis. Céphalopodes d‘Amboine. 4. 1991.. Copyright Agency of the UdSSR for Light and Food Industry Publishing House. North Queens-land. 1987 TFH. MD. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. Nesis. Vol. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. M. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. Food and Agriculture Organization of the United Nations.Byern & Marwoto known to date.P. Pecl. 22 . L. GT & N A. Norman. Moltschaniwskyj 1997. 242: 751-764. Levitov. Moltschaniwskyj & CG. Alexander 1995. Idiosepiidae and Spirulidae). 1983. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae). Kalk. Inc. Ltd. for English Translation. Moltschaniwskyj 1999. J. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. 1st. London. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus.

J. of S. Africa 36 (4): 245-272. J. 2009. von Byern. Pecl.Cent. Steer & GT. K. J. South African cephalopods. and Spirula Lmk. J. L. Hist. Bull. Mar. J. Shigeno 2005: Distribution pattern of a minimalist . & W.Biol. Associate. SR. & Histochemistry 83 (1): 29-46. Cephalopoda): 38-43. Biol. U. Biol.. 2006. Klepal. Nat. 67: 49-51. Occurrence of Idiosepius pygmaeus (Cephalopoda. Voss. 1963. von Byern. With remarks on the two related forms Sepioloidea d´Orb.Occurrence of Idiosepius (Mollusca: Cephalopoda) J. Mus. Idiosepiidae) at Klong Bangrong. 1): 211-242. MA. Res. 234: 1-180..Skrifter Raekke 6 (Bd. von Byern. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. Voss. S. Cyran & W. Thailand.UK.UK. Malacology 15 (5-8): 94-96. 2003.New records for Idiosepius biserialis (Idiosepiidae.danske Vidensk. Yamamoto. Memasukkan:Maret 2009 Diterima: Juli 2009 23 .Wien 108 B: 137-144. J. T. Tracey.. J. Phuket Island. Sepiadarium and Idiosepius two new genera of the family of Sepia. von Byern. Klepal. Klepal 2008. 75: 885897..Mar. von Byern & J. Nürnberger & S. Suwanmala.Selsk. Steenstrup. 1962. J. Idiosepii-dae) in Indonesian waters. Rudoll. Transaction of the Royal Soc. 2007. GL. J. 1949. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea). GL.S.Assoc. 83: 1297-1300. Ann. Bull. Nabhitabhata. Biotech. Malacologica (in press). Cephalopods of the Philippine Islands. Mollusca). Histochemical characterization of the adhesive organ of three Idiosepius spp. Reevaluation of systematic characters of Idiosepius (Cephalopoda.National Mus.. Venus. Phuket Mar. N. & W. the Japan. Observation of Idiosepius pygmaeus (Cephalopoda. 1881. species.

females. mortality.5 and 1. Keywords : Mudflat clam. total mortality rate (Z) of the males. females. there were two unequal pulses.3 years for the males. 4.1 year for males and females combined. Recruitment occurred every month in the males. kematian. (Anodonta edentula) in mangrove ecosystem were determined. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 .26%). and also males and females combined. also males and females combined were 1. females. 70. The peaks of males were in June (12. which indicated a fast growth of the clams in relatively short period.95 ± 0. recruitment. also by the thin and fragile shells of the clams.43. recruitment pattern and mortality) of this tropical mudflat clam. The results showed that asymtotic length (L infinity) of males. pertumbuhan.5 respectively. 1. population parameters of tropical mudflat clam.58 mm. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis. also males and females combined were 65. (Anodontia edentula) in Mangrove Ecosystem.12%). 2 years for the females. and in the males and females combined were in March (12.3. Kata kunci: Kerang lumpur tropis.56 ± 0. The objectives of this research were to study population parameters (growth. and 2.61 ± 0. dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001).67%) and May (20.38%) and October (14. 2001). These high rates were caused by the extreme life condition. Over a 12 months period (Januari 2005 – Desember 2005). females.77%). while in the females were in April (16. growth. rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska.88mm and 70. also males and females combined were 4. Overall. and the size of males was less than females. maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi. which were 2. and 4. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam. Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al.88%) and August (15. annual growth coefficient (K) of males. Subsequently. Berbagai organisme mendiami ekosistem ini.63 mm.31.65. 2001).Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria).

Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. mortalitas dan rekrutmen dari populasi kerang Anodontia edentula.Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. 2001.00 euro/kg. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1). serta ditimbang berat basahnya menurut jenis kelamin. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm. Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. Lebata &Primavera 2001) Demikian pula di Thailand. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara. Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. Pengambilan contoh kerang lumpur Anodontia edentula. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. yaitu musim Barat dan Timur. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3. Aktivitas ekploitasi yang berlebihan. Di Indonesia kerang ini belum mendapat perhatian. . Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan. dilakukan sebulan sekali selama 12 bulan. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000. Di Maluku. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim.

1.Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03.95(L”) dimasukkan ke dalam persamaan diatas. dan jika panjang maksimum (L maks) = 0. dimana K adalah koefisien pertumbuhan.39220. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang. Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: . t adalah umur (atau umur relative. L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i. Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan.038 log10 K (Pauly 1980). Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0.9957/K + to.2752 log10 L” -1. Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur. Persamaan von Bertalanffy bila dijabarkan lebih lanjut. Lokasi penelitian 27 . “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i. dan b adalah sudut/ slope yang merupakan nilai Z. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2.

15. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2).9294.0001 L3. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0. berlaku juga pada betinanya. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123.9658. 28 . Kondisi pola pertumbuhan yang berlaku pada kerang jantan.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0. HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0. Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin.Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992).1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2.3134 (L = panjang dan W = berat).00008 L 3. Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0.9657 n = 2692 3.0002 L3. Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa.321 dengan nilai koefisien determinasi (R2) sebesar 0.0002x 2 R = 0.9327. Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0. dengan nilai koefisien determinasi (R2) sebesar 0.13.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3). Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275.

00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang.9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3. 70. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65. sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan. Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam.9327 n = 1192 Gambar 4.3.63 mm. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3. 1.288 R2 = 0.5 per tahun. betina dan total masing masing 1.5 dan 1.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.88 mm dan 70. 29 . dengan menggunakan program FiSAT. Analisis distribusi sebaran cangkang selama periode penelitian.58 mm dengan koefisien pertumbuhan (K) dari jantan.3213 R2 = 0.38. (Gambar 4). memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula.

2752 log10 L” 1.31. adalah Y= 10.58 [1 .9957/K + 30 to.63 [1 . sedangkan untuk panjang maksimun jantan. betina. 67.98.56±0.7%.65 dan 4. 4.43. dan kerang total dengan Y = 11.096) ] Betina : Lt = 70.97 bulan dan total .0% dan 99. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.3 tahun. Dengan memperhatikan umur maksimum. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol. betina dan total masing masing 2.e-1.5(t+0.61±0.15 bulan. Dari hasil perhitungan t0 terhadap kerang jantan. -0.95 X dengan r = 0. dimana dapat dilihat pada Gambar 6. betina dan total masing-masing 99. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm.081) ] Total : Lt = 70.087 tahun atau 1.0. maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan.99.95±0. betina dan total masing-masing adalah 4.95(L”) dimasukkan ke dalam persamaan di atas.97.56 X dengan r = -0. dengan demikian Z untuk jantan. Nilai mortalitas total didapat dari negatif slope.e-1.88 [1 . Dari nilai-nilai K dan L” yang telah diperoleh di atas. umur to.096 tahun atau 1. Gambar kurva LCCC dari kerang jantan. LCCC yang dibuat dari kehilangan individu setiap kelas ukuran. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol). Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve.61 X dengan r = -0.3(t+0.1 tahun.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam. betina dan total dari model yang terbentuk. betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut. betina dan total terlihat pada Gambar 7.081 tahun atau 0.087) ] Dari beberapa parameter yang diperoleh. Kalkulasi laju mortalitas untuk jantan.33– 4. Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65.19–4.6% per tahun. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu. 99. 2 tahun dan 2.34 mm dan 67.3922-0.41-4. maka didapat umur kerang terpanjang (life span) adalah t maks = 2. K dan L”. dengan memasukkan formula Log10(-to) = -0.70 mm. Rentan hidup (t max) dari jantan. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment . Jika ditinjau dari segi biologi. jantan.038 log10 K.e-1. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan.35 mm.00 bulan. betina dan total masingmasing diperoleh t0 = -0. kerang betina dengan Y= 10.4(t+0. dan jika panjang maksimum (L maks) = 0. dan total masing-masing 62. maka dapat dibentuk dugaan kurva pertumbuhan.

4 31 . a) JANTAN b) BETINA c) TOTAL Gambar 5.edentula hasil analisis menggunakan program FiSAT (ver. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.3 b) Kurva pertumbuhan kerang betina: L” = 70.63 m m dan K =1.88 mm dan K =1. Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan.31) a). tetapi ditemukan dalam tubuh induk kerang.Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam. Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya.0.Kurva pertumbuhan kerang jantan: L” = 65. Kurva pertumbuhan kerang A.5 c) Kurva pertumbuhan kerang total: L” = 71.28 mm dan K =1.

kecuali bulan Desember. namun hal ini cukup berarti bagi kesinambungan populasi di alam.88%) dan Agustus (15.58 [1 . (a).5(t+0.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama.096) ] 2 2.087) ] Gambar 6.63 [1 .e-1. Dugaan kurva pertumbuhan kerang Adonontia edentula.3(t+0.e-1.38%) dan Oktober.5 3 Total : Lt = 70. Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. Hasil olahan pola rekrutmen tergambar pada Gambar 8. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65.88 [1 .5 1 1.081) ] 2 2. Pada kerang jantan. selain itu terdapat interaksi biotik seperti predator.12%) dan total gabungan pada bulan Maret (12.5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0. pada betina pada bulan April (16.5 3 Betina: Lt = 70.26%). Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. yaitu 14.5 1 1.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1).77%.5 Wak tu (tahun) 2 2. betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen. Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 .67%) dan Mei (20.5(t+0. persaingan dan tekanan lingkungan. namun masih memungkinkan keberadaan status populasi kerang ini.e-1.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0.5 1 1.

Penelitian dari Anodontia woodiana (Afanasjev et al. Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu. Pola pertumbuhan (b) (a) (c) Gambar 7. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama. Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. begitupun jenis yang berbeda bisa mempunyai pola yang sama.Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. 2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya. Pendugaan parameter b. Kurva konversi hasil tangkapan panjang (LCCC) kerang A. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. (b) betina dan (c) total 33 . koefisien hubungan panjang berat.edentula (a) jantan.

92 10.31 15. Persentase rekrutmen kerang A. 34 .Yuliana Natan Tabel 1.16 7.19 1. betina dan total kerang A.26 18.38 7.22 9.35 6.67 8.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.29 8.97 0.edentula (a) jantan.77 8.12 13.39 0.00 (a) (b) (c) Gambar 8.67 10.27 16.47 14.00 Total 2.83 9.47 12.12 7. (b) betina dan (c) total.45 12.98 3.25 6.52 2. Persentase rekrutmen bulanan jantan.94 10.00 Betina 1.45 0.88 11.47 12.95 0.39 15.95 8.29 2.64 20.

95. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm. maka L” lebih kecil dari di Philipina. edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0. dugaan panjang infinity (L”) A. Literatur serta informasi tentang kerang A. Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70. memerlukan waktu mencapai panjang asimtotik 10 tahun.5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik. Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh. Koefisien pertumbuhan. Berbeda jenis berbeda pula panjang infinity (L”). Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi). sebesar 13 cm.67 cm.58 mm). akan membedakan parameter populasinya. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang. Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity. Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132. Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya.3 tahun mencapai panjang asimtotik 35 . dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi. K betina = 1.18 mm dan K = 0. Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. Jenis lainnya seperti kerang estuari di Philipina. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000. Panjang infinity A. bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama. 2001). panjang infinity mencapai 93 mm. menunjukkan kecepatan tumbuh yang cepat.34 per tahun menunjukkan pertumbuhan yang lama. K = 0. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya. Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2.edentula sangat terbatas. K yang ditemukan perairan hutan mangrove desa Passo.3. 2001).Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan.227 mencapai umur 10 tahun (Afanajev et al.5 dan K gabungan = 1.edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. maka panjang infinity adalah 13. Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1.

tetapi bulan Desember pada Tabel 1 tidak kelihatan. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek. Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. yang sebenarnya ada penambahan individu baru. Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. Jika dilihat dari strategi hidup kerang.3 tahun) dibandingkan dengan betina.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan. predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator. terutama menghindari perubahan lingkungan yang ekstrim. Laju mortalitas total yang cukup tinggi. Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. namun hal ini cukup berarti bagi kesinambungan populasi di alam. seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003). Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F). Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. selain itu terdapat interaksi . Hal ini menunjukkan bahwa pada kondisi alami. dan gabungan jenis kelamin yaitu 2 tahun.Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya.

56±0.131.65 dan 4. pada betina pada bulan April (16. 19(1).88%) dan Agustus (15. Archives of Polish Fisheries. 4. tahun dan 2. Bulan Mei adalah puncak rekrutmen tertinggi. Laju mortalitas total yang cukup tinggi.58 mm.5 dan 1. 11(42).3 tahun. Lebata MJHL. West Central Philippines.Sci. Zdanowski & A. 37 . dengan koefisien pertumbuhan (K) dari jantan. 1133-1138.1 tahun. Kraszewski.. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi). 9(1): 123. B. Anodontia edentula (Family Lucinidae). Del Norte-Campos AG. Oxygen. 58 hal.88 mm dan 70.95±0. disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh.3. 70. 2003. Marine Pollution Bull. yaitu Afanasjev SA.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2. Asian publ. Latale SS.38%) dan Oktober.31. Pelecypoda: Psammobiidae) from the Beate Bay area.12%) dan total gabungan pada bulan Maret (12. 2004. persaingan dan tekanan lingkungan. Shell Shellfish Res. Laju mortalitas total Z.Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae). 1.43. 2000. Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia. 2001. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12. Elsevier Science Ltd.61±0. 2. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang.77%. 2001. untuk jantan. Pada kerang jantan. J. dimana ukuran jantan lebih kecil dari betinanya. Fakultas Perikanan Universitas Pattimura.26%).67%) dan Mei (20. Lebata MJHL. betina dan total masing-masing adalah 4. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. betina dan total masing masing 1. Elemental Sulphur in the Gills of the Mangrove Mud Clam. baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama. betina dan gabungan masing-masing adalah 65. 241-245. 17: 299-312. Ambon. betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan.63 mm. Unionidae) in the Heated Konin Lakes System.

Res. Tan. Tan. &SC. 20(3):1273-1278. J. Board Can. Tan. T. In P. Introduction to tropical fish assesment. Natan. Ricker WE. FAO Fisheries Departement.Sivasothi. 2001. Computation and interpretation of bological statistics of fish populations. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam.Yuliana Natan Lebata MJHL. Primavera. J. Morgani. Ng PKL. Bull. 2001 Gill Structure. KS. Seong. Fish. Turkey. Yassien. Shellfish Res. Sekolah Pascasarjana IPB. W. HDH. Sparre P. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis. Animal diversity. Lim KKP.Ng & N.L. (Desertasi).Zool 27:339-343. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. T. & HM. TK.K. 19:191-382. Rome. 407 p. N. Muhammed SZ. 2003. Venema 1992. 1975. Bogor 162 hal. Murphy. Y. Sivasothi. Singapore Science Centre. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . A Guide to mangrove of Singapore 1. 2003 (Eds). 2008. Hugh. BC.

The research aimed at evaluating the effect of salinity. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer. Dari berbagai penelitian (Morton 1987. panas pada bagian dada.21 Bq/gr.09) was appeared in water salinity of 29% and of water temperature 30oC. tertinggi termasuk manusia.80 Bq/gr Cd. Radiotracer 109Cd was applied in the study. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. radiotracer Cd. whereas the bigger size of Perna viridis (6. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik. Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme. It revealed that the small Perna viridis (5. Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya. Pekanbaru. Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit.2 cm in length) accumulated 109Cd about 107. 2002) dinyatakan bahwa kenaikan suhu. At the steady state condition green mussel accumulated 72.6 cm in length) had an uptake of about 72. It was found that both salinity and temperature had significant effect ( P< 0.21-107. Blackmore & Wang. penyakit paru-paru akut dan menimbulkan kematian. Key words : Bioaccumulation. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 .80 Bq/gr. The highest concentration factor of Cd (31. Perunut radioaktif. Pada gilirannya pada rantai makanan.2354. Perna viridis Kata kunci : Bioakumulasi. Cd.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS).001) on accumulation rate of 109Cd. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase.

Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional.6 ml ke setiap aquarium.2. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial.Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas. Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1. dua kali sehari. hewan uji diaklimitasikan selama seminggu di laboratorium. dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut. dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. 210 Pb dan sebagainya). sesuai kombinasi taraf perlakuannya. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd. bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a).6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. Secara periodik (dua hari sekali). Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC). Untuk menghilangkan stress.5 dan 6. S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC). S1T2 (salinitas 29o/oo dengan suhu 30oC).46 Bq/ml) yaitu dengan meneteskan 7. Media uji air laut diganti setiap hari. Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia. 5. dan diberi pakan Chlorella sp. Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu. Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut. konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). Organisme dipisahkan menurut kelompok ukuran (5. Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium. BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. dihitung mengikuti Connell & Miller (1995). Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda. Data yang . Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra.

94 30.75 49.60 3. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.99 37.62 52.25 22.33 14. FKss (faktor konsentrasi steady state) 41 .65 20.00 51.54 15.36 21.98 49.73 39.50 51. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.61 59.14 21.16 72.08 47.90 34.07 47.80 Bq/gr dan 49.87 19.62 29.19 36.09 ± 41.6 cm 30.65 36.12.33 13.30 ± 4.41 54.84 (Tabel 1a dan 1b).60 32.33 53.65 23.09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.83 54.6 cm 5.52 24.46 55.48 39.21-107. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).84 61.81 73.20 27. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.74 12.23 40.44 51. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.60 59.90 79.31 53.50 28.93 59.41 25.21 80.23 ± 41.01 Keterangan : Css (konsentrasi steady statei).61 11.0. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.2 cm 5.37 4. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.27 ± 31.08 47.12 47.23 107.35 41. Model tersebut merupakan permodelan saturasi.77 28.72 45.37 ± 20.42 70.24 30.64 19.70 ± 34.02 43.78 28.12 30.89 4.77 28.5 cm 6.91 2.70 70.80 90.23-54.5 cm 6.29 17.45 35.27 44.46-73.51 52.75 70.89 3. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.2 cm 5.

09 24.32 10.09 (Gambar 5).761 R2 = 0.9176 5.0667 R2 = 0. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.5 cm 6.2 cm 5.5 cm 6.99 1.51 54.42 17.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.97 16.22 21.6 cm 5.33 16.26 3.21 75.03 25.58 30. Pada Gambar 6.25 13.61 29.21 ± 36. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata.86 13.34 92.08 8 41.76 19.38 49.56 4.74 14 60.81 33.55 16.6 cm Gambar 1.80 51.9423 B y = 2.2673x + 11. nilai koefisien determinasi untuk salinitas 29o/oo (0.46 6 38.0667 R = 0.06 1.98 11.2 cm 5.49 51. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.54 33.81 22.89 37.10 49.6 cm 2 25.92 7.64 35.47 25.761 R = 0.5 cm ▲=6.72 18 60.6044x + 5.5 cm 6.2 cm dan 30oC) pada Tabel 1b.26 21.26 10 44.82 45.Yusni Ikhwan Siregar Tabel 1b.46 36.45 18.99 4 35.72 37. ■= 5. 42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.5 cm 6.80 51.18 36.01 15.37 3.80 17.69 24.10 Css FKss 63.62 Keterangan: Css (konsentrasi steady statei).97 16.84 78.8014 R2 = 0.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.71 20.33 19.38 20.20 ± E 4.2 cm 31o/oo) di suhu dan ukuran yang sama (5.7137x + 8.46 35.71 19.46 30.68 24.85 ± 15.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.35 14.41 10.2 cm 5.6 cm ♦=5.2 cm 5.66 24. FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.84 ± 34.2673x + 11.10 23. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.06 42.9951) .41 14.8014 R2 = 0.70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.99 ± 19.43 ± 21.6044x + 5.88 20.7137x + 8.44 49.59 54.9462 y = 1.01).9462 y = 1.6 cm 5.67 Mean±S 47.91 16 60.00 12 57.

9734 2 4 6 8 5. Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0.6 cm ♦=5.968). Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.5 cm ▲=6.29 R2 = 0.6 cm Gambar 3.9 R2 = 0. ■= 5.6 cm Gambar 2.66x + 7.6186x + 27.6 cm ♦=5.9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.2 cm 5.9539 B y = 2.9764 y = 2.5 cm 6. (Gambar 8).5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.2 cm dan 29o/oo) pada Tabel 1a dan 1b.9951.9685 y = 1. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0.01).2 cm 5.5 cm 6. 43 .9433 y = 1.2494 R2 = 0.2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.8171x + 23.7667 2 R = 0.2 cm 5.9668 y = 2.4495x + 16. ■= 5. Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5.2 cm 10 5.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5. terlihat pada Gambar 7.5 cm ▲=6.773 R2 = 0.6 cm Waktu Kontak (hari) 5.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2.0943x + 10.5 cm 6. Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.2052x + 8. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.529 2 R = 0.

Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC. Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.523 R 2 = 0.2 c m 5 .6 c m B Gambar 5.6 cm 10 0 0 5 5.2 cm 5.2 cm 5.5 c m 6 .057 2 R = 0. 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 .968 A B Gambar 6.43x + 65.6 cm 10 15 20 Waktu Kontak (hari) Gambar 4.5 cm 6. 44 . oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11.7x + 53.5 cm 6. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5.

51 Bq/gr (Tabel 1b). kerang hijau mampu mengakumulasi 109Cd 31.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 .5 c m 6 . Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0.84-47.43 dimana nilai konsentrasi steady statenya berkisar 30.10-75.20-34. 109 45 .23 sampai dengan 54.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo. 2000).6 c m B Gambar 7.23 10.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo.09 kali dalam durasi kontak 14 sampai dengan 16 hari. faktor konsentrasi steady state di salinitas 29o/oo 1.70. Pada kondisi tersebut.21 dan 20.35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9). konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1.30-41. PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.01). Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang.2 c m 5 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19. Sedangkan pada suhu 28oC.

5.6 8 5 x + 7 . umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah.70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 . Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B). Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0.24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya. Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3.4 3 x + 1 9 . pertumbuhan dan metabolisme fisiologi dari organisme laut.9 7 9 1 A B R 2 = 0 .01).09 (Gambar 5). Model tersebut merupakan model saturasi.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41. pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4. Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31.Yusni Ikhwan Siregar Cd 60 y = 1 1 .3 1 R 2 = 0 . Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup.9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata.23 . . Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.

01).6 . Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.23 + 3.0 8 8 x + 4 8 . S2T2 (3) dan S2T1 (4). Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 .6 c m Gambar 9.2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = .6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a.96X). S1T1 (2). 47 .8 4 R 2 = 0 . Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7).5 3 2 R = 0 . Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu. nilai koefisien determinasi untuk salinitas 29o/ (0. Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998).7 6 3 x + 3 3 . 5.5 c m 6 . Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.8 8 6 8 y = .9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.8 1 9 1 y = .4 7 9 x + 6 0 .2.9 9 7 2 109 Faktor Konsentrasi rata-rata 5 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0. Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis. Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1).5 5 R 2 = 0 .6 . Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5.5 dan 6.4 . 109 Cd oleh Mengacu pada Gambar 6.968).

Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. 1984). Mg. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass. amino. Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0. Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). phosphate. Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda. thiol.01). dan Ca pada dinding sel digantikan oleh ion-ion logam berat.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). dan hydroxy-carboxyl yang berada pada dinding sel. bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt. (1984). Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987). Kemudian Sivalingam dalam Coeroli et al. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl.23 10. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. Logam berat dapat juga diendapkan pada proses metabolisme dan . Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake. Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). Proses bioabsorpsi ini bersifat bolak baik dan cepat. pertama pertukaran ion di mana ion monovalent dan divalent seperti Na. Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut. Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam. hydroxy. Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya. 48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut.Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31.

suhu. 518 hal. Recent innovations in cultivation of molluscs in French Polynesia. & C. steady state. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities.. ZA. Growth of the green mussel. Ingole. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus. east coast of India. B. “ Kimia dan Ekotoksikologi Pencema- ran. Perna viridis (L.. Biokinetics of Cadmium in Indonesia’s Green Mussel. V. JP. in a sea water circulating system. Proceeding of one day seminar Development Radioecology and 49 . Hong Kong. The Hong Kong University of Science and Technology. Malac. G. Amer. Nora FY. 1997. MS. VP. M. KVK. S. Wang. UI press. Aquaculture 39:45-67. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut. Gaillande. Cr. 1998). Serpong September 2004. Morton.. Fakultas Matematika dan IPA IPB. Bogor Suseno. &WX. —— 2004b. 5(2):159-164. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Guru Besar Tetap Ilmu Kimia Lingkungan. HA. Reproduction.) in Edaiyur backwaters. Seminar Nasional Teknologi Limbah. 1984. Water Treatment with Algae Springer-Verlag and Landes Bioscience. H.). 17 Rajagopal. 1984. & AH. Saeni. Terjemahan Yanti Koestoer. 1987. Perna viridis L. den Harog. dibandingkan dengan kerang hijau yang berukuran besar. Chlorella vulgaris. Aquaculture 40:47-55. DW. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut. Se. Simpson. Connel. & GJ. Coeroli. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. Venugopalan. Bull. 13pp.1998. Miller. D. Jakarta. YST Wong & CG. 1998. Ansari. InterPopulation Differences in Cd. in: in YukShan & Tam (eds. A. 1758) (Bivalvia: Mytilacea). DAFTAR PUSTAKA Blackmore. 2004a. growth rate and culture potential of the green mussel.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. Jenner. BS. salinitas dan lain-lain (Nora et al. 1995. Nair. Parulekar. Orasi Ilmiah. van der Velde. p. P2PLR BATAN. Removal of Copper by Free and Immobilized Microalgae. Perna viridis: Influences of Body Size. 2002. Aquaculture 162:187-202. Chatterji. Landret.

Ecol. Hotel Sahid Jaya Jakarta.Yusni Ikhwan Siregar Marine Environment in Indonesia. Memasukkan: Maret 2009 Diterima: Juli 2009 50 . Mar. 2000. Dei . Wang. 1999. Prog.137:567-575. Ecol. & RCH. WX. Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. Ser. Ser. WX. Wang. Prog. 186:161-172. Mar.

32 x 69.78 x 17. Stages III: 4. Fak. Fak. Perikanan dan Ilmu Kelautan IPB. & Harpasis S. with three replications. Ridwan Affandi3. fisiology. 1997).95 C g wet weight-1 hour-1 (24.75 – 87.39 % and stage III: 76. The highest of energy budged for routine metabolism at treatment BF.73 μm – 58. Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995).07– 19. Stages II: 5.29 μm – 80. at stage I: 29. Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal. but has not higher significant (P e” 0. Keywords: Pinctada maxima. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan.93 μm – 30. stage II: 57. The result showed that optimal temperature and salinity on P.33 μm and stage III: 80. larvae. PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al. respon. The quickest time of plantigrade stages have found by treatment BF (day 19.13 x 47. physiology. larvae.35 C g wet weight-1 hour-1 (28.50) and hasn’t significant (P > 0. The highest survival rate of larvae was by treatment BF. response. Di pasaran internasional.Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF).26 %.05) with BE. and also prerequisite for individual growth and survival.05) with BE (day 20.18 – 30. 51 .62 x 46. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. Stage II: 81. in different levels of temperature and salinity.62 μm.80 C g wet weight-1 hour-1 (15.90 J g wet weight-1 hour-1).43 μm (AP x DV).05) with BE. E-mail: tjwinanto@yahoo.92 %. Dedi Soedharma2. than would be decreased when temperature and salinity increased. The research was used randomized block design. sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006).73 – 4.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson).73 – 7. The aim of this study is to obtained information on energy budget on routine metabolism.58 J g wet weight-1 hour-1). 2 Departemen Ilmu dan Teknologi Kelautan.48 – 24.91 – 82. Stage I: energy budged between 6.72 – 77. The best of relative growth length of larvae by treatment BF and not significant (P e” 0. Sain dan Teknik UNSOED. Kata kunci: Pinctada maxima. Perikanan dan Ilmu Kelautan. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”.74 J g wet weight-1 hour-1). metabolisme. stage I: survival rate between 87. and to know the levels of optimum temperature and salinity. metabolism. Sanusi2 1 Jur. Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia.85).85 – 5.88 x 69.57 x 18.

dalam Taylor et al. Soedharma. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005. jika semata-mata hanya menggantungkan pengumpulan spat dari alam. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4.14 per mm panjang engsel (R.1 – 0. Inokulum yang digunakan berasal dari biakan murni skala lab. diperlukan kondisi lingkungan yang optimum dan terkendali. harga spat dari hatchery kira-kira $US 0. dan konsumsi energi oleh metabolisme internal (Crisp 1984. 1997). Martinez-Fernandez et al. Menurut Gricourth et al. kemudian diperbanyak hingga mencapai kepadatan . Rose data tidak dipublikasikan.A. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif.143. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal.Winanto. representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al.000 ekor. yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994). Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi. 2007). karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. dengan harga sekitar Rp 2. Asha & Muthiah 2005. sangat diperlukan informasi tentang pengaruh suhu. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda. Affandi & Sanusi Saat ini. serta dapat diketahui tingkat suhu dan salinitas optimum. Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim. Suplai spat merupakan bagian yang krusial dari industri ini. sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. Selama pemeliharaan larva di dalam lab. Jika hasilnya positif. Selama proses produksi spat skala besar di hatchery. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan. perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol.000 per cm. seperti untuk pertumbuhan. 2004). Di Australia. Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas. salinitas. Dame 1996).

Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. Winanto 2004). karena salinitas air di lokasi penelitian e” 34 ‰. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). tipe 03J0820 AJ). Oksigen terlarut diukur dengan alat DO meter (YSI 550A. untuk meningkatkan suhu air digunakan alat pemana s. 2002). Hewan uji berupa larva P. lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001). dan (C) 30 oC. Pengukuran suhu dila kukan dengan menggunakan termometer Hg. kapas sintetik dan ultra violet. Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3). galbana dan P. Berdasarkan pada stadia perkembangan larva. dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). 10 dan 5 mikron). Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). (F) 34 ‰. Disain percobaan untuk mengetahui laju konsumsi oksigen. yaitu (I) suhu. Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. 2001. catrage (15. Untuk mengetahui laju metabolisme rutine larva 53 . Winanto 2004). Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al. yaitu berupa satu unit peralatan yang terdiri dari empat botol. Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. Larva diperoleh dari hasil pemijahan Induk P. botol C untuk mengukur laju konsumsi oksigen. sedangkan salinitas diukur dengan refraktometer (Atago. maxima stadia bentuk-D (D1). dipelihara di dalam wadah percobaan ember plastik volume 20 liter. Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan. dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). sampel disaring dan ditampung menggunakan planktonet. Untuk mengetahui berat larva.0001 gr). Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. (II) salinitas. Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. Perlakuan yang digunakan terdiri dari 2 faktor. (B) 28 oC. yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. 2001. Jepang). maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. Larva diberi pakan I. botol B sebagai wadah hewan uji. Botol A untuk stok air yang dijenuhkan. maka percobaan dikelompokkan menjadi tiga. (E) 32 ‰. Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva.

54 . 1 mlO2 = 19. Soedharma.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml. Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P.9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC. Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al.7 mlO2 (Jeong & Cho 2007). Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan.Winanto. Data-data dengan dua variable seperti laju metabolisme dan berat larva. Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut. Waktu pertama kali teridentifikasi stadia plantigrade. 1997) dilakukan dengan menggunakan mikrometer okuler. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali. Pengambilan sampel dilakukan setiap jam sebanyak 10 ml. Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Pengamatan dimulai dari hari ke 18. 1 mgO2 = 0. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel. Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004). Gambar 1. maxima. Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al. 1990). Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993).

dan pada stadia III efek suhu meningkat menjadi 82. Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1.09 mgO2/g berat basah/jam (AD). dengan koefisien determinasi (R2) pada stadia I sekitar 0.7946x2 + 102.8283. Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata. 7963 dan stadia III: 0. pada stadia II menurun sampai 79. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0.70 (R2 = 0.37 % dan pada stadia III kembali menurun (49.9387x2 + 110.804x – 625.16 mgO 2 /g berat basah/jam (BF) dan terendah 1. Seda ngkan pa da stadia I dan III korelasinya kurang kuat.7963). Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0.187x – 1337.7001x2 + 96. salinitas 30 ‰ (AD) (Tabel 2).42 %).02x – 1532. pengaruh suhu terhadap laju metabolisme mencapai 82.483x – 411. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC. Pada stadia I.8283). Stadia III: Y = -1.83 %. Pada stadia I.8227).05). maxima tertinggi terjadi pada perlakuan suhu 28 oC.55 %. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0.80 (R2 = 0.18 (R2 = 0.8227. (Gambar 2). pengaruh salinitas terhadap laju metabolisme sekitar 48. Stadia II : Y = -1.63 %. stadia II: 0.5137). Stadia II : Y = -0. Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2. Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu. pada stadia II meningkat menjadi 51.5137). Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen.05) antar perlakuan suhu dan salinitas. menunjukkan adanya korelasi yang kuat. Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0.05) dengan salinitas 34 ‰ (F).64 (R2 = 0.03x – 1431. Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1). tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰). salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C.10 (R2 = 0.4855). Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0. 55 .27 %.3706x2 + 25. salinitas 30 ‰ (AD).5821x2 + 38.

12 ± 0.72 ± 0.03b 1. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.16 ± 0.03f 0. maxima stadia I. II.29 ± 0.74 ± 0.1337.04a 1. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.03f 1.03e 0.8227 y = -1.41 ± 0.15 ± 0. 56 . Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.08d 1.30 ± 0.7946x 2 + 102.75 ± 0.8283 Suhu (oC) Gambar 2.187x .14 ± 0.03c 1.03b 1.98 ± 0.76 ± 0.Winanto.04f 0.03a 1.04e Salinitas (‰) (E) 32 1.03d 1.03a 1.03d 1.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.79 ± 0.03d 1.03d 1.03b 1.73 ± 0.9387x 2 + 110.02x . III Tabel 1.39 ± 0.09 ± 0.03x .03b 2.7 R2 = 0.1431.05e 0.1 R2 = 0.77 ± 0.16 ± 0.75 ± 0.08 ± 0. Soedharma.03b 1.03c 0.32 ± 0.04f 1.03b 1.03d 1.02f (F) 34 1.65 ± 0.1532. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.34 ± 0.03c 1.29 ± 0.10 ± 0.7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1.8 R2 = 0.34 ± 0.31 ± 0.7001x 2 + 96.

Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P.4942).856.804x . Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P.856).243 (R2 = 0. jadi berat (85. stadia II dan stadia III Gambar 4.795.7394x2 + 49. Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan. maxima stadia I. Persamaan yang diperoleh adalah Y = -295.25x + 29.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4).3706x 2 + 25. Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0.625.64 R2 = 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0. baik untuk aktivitas maupun perkembangan larva P.7394x 2 + 49. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III).5821x + 38.483x . Stadia III : Y = -0.023x – 795.5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0.18 2 R = 0.4855 y = -0.17 R2 = 0.4942 31 32 Salinitas (‰) 33 34 35 Gambar 3.17 (R2 = 0. maxima.411.023x . maxima. maxima dipengaruhi oleh suhu dan 57 .

67 ± 0.43d 18. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 .31 ± 0.58 ± 0. salinitas dan tahap stadia. Soedharma.68e 2.69 4.62 ± 0.10 4.39f 3.41 ± 0.11 5.09 5. J (B) 28.47 %).10 4.26±0.40±0.10 10. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0.48 ± 0.86 ±0.44d 18.59f 3.11 10.45b 30.88 ± 0. C (C) 30.03 ± 0.25 ± 0.12 ± 0. J (C) 30.64 ± 0.45b 24.09 5.74 ± 0. J (Joule). C (C) 30. J Stadia III (A) 26.04 ± 0. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0.29f (F) 34 4.09 4. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.39f 2. C (Calorie). J (C) 30. C (A) 26.75 ± 0.43d 16.12 5.10 4.45a 23.90 ± 0.90a 18.13±0.30 ± 0. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P. Affandi & Sanusi Tabel 2.60a 15.70 ± 0.32 ± 0.60 ± 0.37d 24. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas.52 ± 0.83 ± 0.60 ± 0.84 ± 0. sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3).05).14 18.55 ± 0.14 3.08 2.68 ± 0.32 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26.46e 1.20 ± 0.50c 18.16 15. Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0.12 7.07 ± 0. J (B) 28. salinitas 34 ‰ (87.15 ± 0.09 15.53±1.45 ± 0. baik pada analisis varian maupun uji Tukey (Gambar 5). sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.57e Salinitas (‰) (E) 32 4.05) antar perlakuan suhu. C (B) 28.09 ± 2. Pada stadia II dan III.12d 24. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan.37b 24. C (A) 26. C (A) 26.58 ± 0.51f 2.09 18.02 ± 0.38 ± 0.07 ± 0. C (B) 28.10 3.83 ± 0.07 10. C (B) 28. J Stadia II (A) 26.10 6.69±0.62 ± 0.36b 19. salinitas 30 ‰ (32. salinitas. J (D) 30 3.40d 15.12 15. Pada stadia I.43b 27.12 4.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.14 4.92 %) dan terendah pada suhu 26 oC.14 ± 0.01±0. sintasan tertinggi terjadi pada perlakuan suhu 28 o C.42b 19.37c 11.10 3.27 5.05) antar perlakuan suhu.02 ± 0.07 ± 0.37c 16. J (B) 28.05) dengan 32 ‰ (E). J (C) 30.41 ± 0.39 ± 0.Winanto.73 ± 0.05) dari E dan F.80 ± 0.09 3.50 ± 0.45 ± 0. C (C) 30.36 ± 0.

93 hari) (Gambar 6).27b 81. Pertumbuhan panjang relatif larva stadia I (D1–D6).75d 61.19c 48.29b 87.17 ± 1.75 ± 1.60f 22.67 ± 0.33 ± 0.04c 54.17 ± 1.62c 48.75f 32. stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.80b 77.91a 64.91f 32. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 . Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan.20 ± 1.88b 76.73b 82.81e 21.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.92 ±1. 28o dan 30o C.17 ± 0.39 ± 0.71d 70. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.86d 60. D.82a 59.61 ± 0.91 ± 0.26 ± 0. laju konsumsi oksigen dan laju metabolisme.46 ± 0. B & C =suhu 26o .67 ± 1.60 ± 0.80 ± 1.04f 22.83e Salinitas (‰) (E) 32 43. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.41 ± 0. pertumbuhan. PEMBAHASAN Konsumsi oksigen larva P.79 ± 1.71 ±1. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18.77f (F) 34 43.72 ± 0.23 ± 0.64d 69.28d 72.98 ±0.95 ±0.09d 71. E. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas.17a 61.02 ± 1.39 ± 0.34 ± 0.76e 10.03b 87.09 ± 0. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus. & F= salinitas 30. Sintasan (%) larva P.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3.

7 dan > 1. Laju konsumsi oksigen pada larva Mytilus edulis antara 0. 34 ‰). Diduga. Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling. Lebih lanjut Bayne (1983) menyampaikan. hingga mencapai batas optimum (28 oC. variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda. Hasil korelasi menunjukkan kecenderungan linear positif. Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. 2004).80. Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air.70 sampai > 1. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0. kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat. disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0.00. maka laju konsumsi oksigen semakin menurun. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. 1949 dalam Bayne. Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan. 1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis.856).5 sampai 10 mlO2/jam/g berat kering. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat. Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda. Jika dihitung per unit berat badan. tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi. berat badan dan tingkat aktivitas. semakin berkembang tahapan stadia larva baik panjang maupun berat.75–3 ml O2/jam/g berat kering (Zeuthen.5 – 5 mlO2/jam/g berat kering. maka . gamet dan larva yang berada pada satu seri penelitian. Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2. Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian. Affandi & Sanusi 2. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif.Winanto. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983). 32 ‰. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus. 1983).0. Soedharma. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan. Dari hasil analisis dapat diinterpretasikan.

peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. Lama waktu (hari) pencapaian stadia plantigrade larva P. Diduga pada kondisi laju konsumsi oksigen tinggi. maxima pada berbagai tingkat suhu dan salinitas. Seba gai salah satu indika tor. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7. Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose.1997). Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan. merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. 2005). dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi. fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). Pada P. 61 . Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al.

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

Pada suhu optimum aktivitas metabolisme berjalan maksimum. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC. Disamping adanya variable lain.83 C/g berat basah/jam (24. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. salinitas 32 ‰ (BE).67 C/g . Menurut O’Connor. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar. 1983). Pada kisaran salinitas 29–35 ‰. maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE.62 – 4. Bayne 1965.74 – 5. tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia. Berkaitan 66 dengan kompetensi larva untuk menempel.Winanto. maxima dan P. apalagi jika salinitas turun sampai kurang dari 29 ‰. Stadia II antara 5. salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC. Quensland Utara. Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. 1983). imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. KESIMPULAN Suhu dan salinitas optimum untuk larva P. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas. Soedharma. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963. Australia mencatat bahwa kisaran suhu optimum pa da P. margaritifera antara 23–28 oC.58 – 7.02 – 24. diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P. dalam Ala garswa mi et al. Pada stadia I pembelanjaan energi mencapai 6. dalam O’Connor and Lawler (2004) jumlah larva P. (2000) di dalam laguna Great Barrier Reef. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). tetapi pada suhu kurang pengaruhnya. per sonal observasi.13 J/g berat basah/jam). sehingga larva berkembang dengan baik.20 C/g berat basah/jam (27. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. imbricata (Roding) dipengaruhi oleh suhu dan salinitas. beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994). Penelitian Yukihira et al. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil. BF).53 – 30.39 J/g berat basah/jam) dan pada stadia III antara 4.

(BE.V. Pada stadia I sintasan antara 87. Stadia II antara 57. ACC Victor & AD. salinitas 34 ‰ (BF. Managemen Sumberdaya Perairan. DS. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE. Velayudhan. Mina Mitra Usaha. J. Crassostrea virginica.28 x 21. Baker. Wild versus hatcheryreared larvae. Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata. MF. No.58 J/g berat basah/jam). 29: 4-6.93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰.43 µm. Effects of Temperature. Aquaculture 246: 285-294. Gandhi. 1994. _____ 2002. Perna canaliculus. Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel. Dharmaraj. J. B. 1983. UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut. Balai Budidaya Laut. Rahardjo &. Aquaculture 250: 823-829. Perhiasan Para Bangsawan.32– 19. 287-301. Salinity and pH on Larval Growth. IPB. Survival and Development of Sea cucumber Holothuria spinifera Theel. Amsterdam. V.78 %). 2005. S. Petunjuk Teknis (6): 61 hal. Pebruari.39 % dan stadia III antara 76. Anna . Stadia II antara 81. Sulistiono 2005. Pencernaan dan Penyerapan Makanan. Muthiah. Balai Budidaya Laut Lampung. 19. Alfaro. Competency to Settle in Oyster Larva e. A.62 µm. 67 . serta C.29 µm – 80.. FPIK.72 – 77.73 µm – 58.80 µm–34.90 x 20. Mengenal Mutiara. Warta Pasar Ikan.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. Sjafei. J.26 %. 2006. Ditjen. P. Aquaculture 3. Pada stadia I pertumbuhan relatif mencapai 33. Pembenihan Tiram Mutiara (Pinctada maxima). Kultur Pakan Hidup. Fisiologi Ikan.92 %. DAFTAR PUSTAKA Affandi R. Balai Budidaya Laut Lampung. Bogor Alagarswami K. Petunjuk Teknis (VII): 106 hal. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould).75 – 87. 2001. atas bantuan yang diberikan selama penelitian. Elsivier Science Publisher. TS.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49.88 x 69. Pengolahan dan Pemasaran Hasil Perikanan. 18. 2005.33 µm dan stadia III antara 80.13x7. Ed. AC.91 – 82. PS & P.DKP. Aquaculture 122: 161-169.55 hari).. Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva.62 x 46. Asha. Pengaruh suhu (81. Chellam. Dep.32x 69.

1983. Chacon. & CH. Bayne. Vazques & Z. E. H. Aquaculture 251: 85-98.. Boca Raton. New York. BL & RC. Viana. & MH. Martinez-Fernandez. Newell. Coastal Aquaculture 2: 627-632. C. Biggeleer. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). Gosling. 254 pp. Loosanof. Mechanism of Osmoregulation in Animals. 284372. Maintenance of Cell Volume. New Developments in Pearl Farming. Physiological ecology of marine molluscan larvae. AcostaSalmon. Part I. In: Tompa.D.M.. Davis. E. DJ. Jeuniaux. Neter. Gricourt. The Mollusca. Methods for the Study of Marine Benthos. Shellfish Rese. 13: 581-604.Winanto. & W. Temperature and Water Quality. Oxford.. Davidson. 1983. 1979. N. Farias. 2004. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. Goddard. NH. Wilbur (Editors). Dharmaraj. Elliot. Ecology of Marine Bivalves. 1984. New York. 10: 103-120. Kutsner 1990. In: Gilles. Kellner. Fishing News Book. RF. CRC Press. J. Rearing of Bivalve Mollusks. MT. (Eds). An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. Farming Jewels. Applied Linear Statistikcal 68 . The Mollusca IV. M. CR.. In: Holme. Gilles. J. S. Crisp. 1995. V & H. A. 4: 51-73. Connecticut. JAMV. 1996. 2006. Verdonk. Ecology and Culture. Thallasia Jugosl. 130p. 1974. Bivalve Molluscs. JM. J. Physiology.. Saleuddin and K.A. Energy Relation of Marine Invertebra te Larvae. R. Garcia-Esquivel. Dame.. Blackwell Sc. Crisp. AS. Fassler. Oecologia 19: 195-201. 1975. Affandi & Sanusi Bayne. 22(1): 415-421. Soedharma. Energy Equivalent of Oxygen Consumption in Animal Energetics. Mildford. C. Wesseran. S. Osmoregulation and Ecology in Media of Fluctuating Salinity. Proc. Great Britain. DJ. Publ. L. 1963. Mathieu & K. Development 3(8): 299-336. Rangel-Davalos. A.M. In: A. Academic Press. 2003. Feeding. BL. Aquaculture 230: 417-423. Symp. 1983. John Wiley & Sons.S. Energy flow measurements. Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics. W. US. 1996. Mcintyre. In: Feed Mana gement in Intensive Aquaculture. 2004.. World Aquaculture 29 (3): 5-10. Physiological Energetics of Marine Molluscs. O. Beureu of Commercial Fisheries Biological Laboratory. Biology. An Ecosystem Approch. 1851) Larvae. R.

. LTD. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures. O’Connor. Pinctada maxima and P. K. respon in different ways to culture in similar environments. PC. 44: 1-28. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture.. The scope for growth of bivalves as an integrated response parameter in biological monitoring. pp: 189196. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. 138 hal. pp. G. John Wiley & Sons. 2000. Widdows. In: Kramer. Biol. JJ.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models. Temperature and Osmoregulation in Aquatic Species. Boca Raton. Taylor. WA & NF. J. Aquaculture 270: 451-463. In. Aquaculture. 3 rd Edition. 2007. Ser. Reis F ilho. 1980. JS. 247-267. J.. (Ed). The pearl oyster. Prinsip dan Prosedur Statistika. Jakarta.Jr.J. KS. H. Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil.. 252: 208-224. Analysis of Variance and Experiental Designs. Gilles. Growth and energy balance during the larva lives of three prosobranch gastropods. Analisis REGRESI Menggunakan SPSS. Aquaculture 270: 464474. WB. Laitano & RW. Merino & E. ES. W. Biokimia: Metabolisme Energi. Steel. J. Margaritifera. Silverthorn. Maintenance of Cell Volume. R (ed). Pechenik.M. 1985. Karbohidrat dan Lipid. Torrie. C. 1972. Gramedia Pustaka Utama. Suatu Pendekatan Biometrik. J. Soria. JA. Lawler. 748 hal. Southgate & CE. Margaritifera. Proceeding European Marine Biology Symposium. 2004. Yukihira. Contoh Kasus dan Pemecahannya. Exp. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . 2004. RGD & JH. WB & SU. 195: 179-17 ____ 2006. Biomonitoring of coastal waters and estuaries. Toppan Copany. Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster. 11:537-554. Aquaculture 229: 493506. Mar. Bandung. Tokyo. Aquaculture 153: 31-40. Resgalla. 1997. 2007. Marine Ecology. Brasil. 1173 p. 5th... Rose. Von Brand. G. ITB. J. Pinctada imbricata Roding. Andi Offset. Mechanism of Osmoregulation in Animals. CRC Press. J.. Taylor.. Vernberg. Japan. Ecol. Vernberg. Klumpp. Regression. AC & J. Lucas & DW. New York. M. 1979. Wirahadikusumah. Sulaiman. 1994. Metabolicenvironmental interaction in the marine plankton. 1993. Prog. Yogyakarta. 1970. Smaal. RA.

2006. The objective of this study was to obtain information on best level of depth to culture of pearl. 2. The result showed that best thickness of pearl deposition by 90 cm deep (1. 71 . Hyriopsis schlegeli (Simpson). One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre).05) to the deep of 60 cm (1. Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s. Purwokerto E-Email: bufish68@yahoo. Di Jepang. Berdasarkan kualitasnya yang tinggi. maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). khususnya di Danau Biwa. 12. 2008). Sain dan Teknik.0 %. warna dan kilau (shine) Sonkar (2007). Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930. Jur. The result of implantation was followed that 30. sized ranging from 12 – 15 cm were studied. Maskur1. Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al. Tjahjo Winanto2. budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925). Keywords: Freshwater mussel.id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana).7 %.co.10 mm) and biggest significant (P< 0. effect.05) to the deep of 30 cm (0.2 %. Kovitvadhi et al. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk. 12. (B) 60 cm and (C) 90 cm. &Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. 60 and 90 cm deep were 11. kedalaman laut 1. PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. whereas survival rate was followed 79.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1. Freshwater pearl Anodonta woodiana. level of deep Kata kunci: Kerang air tawar. in the freshwater pond. Perikanan dan Ilmu Kelautan.9 %.2 %. Anodonta. Fak. berat. to get fast nacre deposition and high quality of pearl. Unsoed.70 mm). 79 % and 78. was 300 m2 wide and 1 m deep. Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China. woodiana. Anodonta woodiana. The research was conducted for 9 months. Completely randomized design was used with levels of deep treatment (A) 30 cm.30 mm) but hasn’t biggest significant (P>0.

Faktor internal meliputi jenis kerang yang digunakan. Sonkar 2007). 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). sehingga membuat harganya paling mahal (Anonymous 2005). seperti suhu. Menurut Pagcatipunan (1986). daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah. BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1). Warna sebenarnya sangat tergantung pada selera konsumen. dengan perlakuan kedalaman pemeliharaan 30. Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre). Berdasarkan kualitasnya. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi. 2003). Faktor eksternal antara lain kualtas air. penanganan dan pemeliharaan pasca implantasi. kerang berukuran panjang antero-posterior (AP) 10-15 cm. hijau dan biru muda. Anonymous 2007. kualitas lapisan mutiara (nacre). sehingga dapat diperoleh mutiara berkualitas tinggi. kecerahan dan kesuburan perairan (Dan & Ruobo 2000. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. oksigen terlarut. alkalinitas. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. internal dan teknis. konduktivitas. Faktor teknis. Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik. karena luwes untuk perhiasan. sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. Oliver 2000. nitrat. kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. Jumlah sampel 250 ekor. Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 .Rachman. Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. khususnya pada produksi mutiara bulat air tawar. sehingga kajian mengenai hal tersebut perlu dilakukan. kalsium. Semakin tinggi karatnya maka harganyapun makin mahal. misalnya keterampilan teknisi dalam proses implantasi. Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. sehingga mempunyai nilai tambah sebagai perhiasan. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. pH. Skinner et al.

2007). Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. Pengolahan data dilakukan dengan SPSS ver 15. Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. sehingga dapat ditemukan 73 .1992). maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih. dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan. Usahakan agar posisi mantel menempel dengan inti (Winanto et al. Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad. Secara matematis. Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. bagian ventral kerang menghadap operator. Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan. Sebelum operasi.1992). keduanya dimasukkan ke dalam satu saluran. Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. Pengamatan dilakukan selama 9 bulan (April– Desember). Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. Dengan menggunakan spatula insang disibakkan. terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. al. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991). Pasca implantasi. yaitu dengan menggunakan metode ekspose (Winanto et al. sehingga organ dalam terlihat jelas. pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. posisi demikian dilakukan selama 2 jam. Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. Operasi dilakukan dengan menempatkan kerang pada penjepit. agar luka tidak menjadi infeksi (Rachman et al. Jumlah sampel pada setiap perlakuan adalah 75 ekor.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. Selanjutnya. Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral).1992).

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

083 6–15 64. 3Oliver (2000). 5Skinner et al (2003).69 6.60–90.01–4. Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan.60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6.10 0. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 . yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan.54 15 – 251 <1.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2.36–0.67 24. Kecerahan air di kolam penelitian antara 20 – 60 cm. tidak menempel pada inti.70 Subur Lumpur berpasir 90 cm 2.03 <0.00–7.15–3. 4Summerfelt (2007). Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan.00 0.04–5.32 7. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp).09 7–13 68. seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan. Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%.35–0.40 0. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk.36–0.04–0.20–6.03–0.90 22.62 0. yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian. Parameter air lainnya yang perlu diperhatikan adalah kecerahan.40–25.90–25.03–0. Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.90 0.12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000).70–99.50–7.80–14.90 6.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.17 23.5–8. Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5.76–99. 2Hochheimer (2007).00 68.80–25.82 0.093 6.

Sawangwong &J. Armico. Budidaya Mutiara. 1999. Diamon Graphics. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh. Imperial Leaflet. Yuniarti. INS/81/008. 1–11–2008. Chinese Academy of Fisheries Sciences. berarus dan mengandung cukup kalsium. G 2000. Hongkong. Sintasan terbaik pada kedalaman air 30 cm (79. 2007. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12.35. P. Fishing leaflet. Jiangsu Province China. Moorken. Anonymous 2007. Cahn. The Pearl Source. Juhaman. Engkagul. info@pearl.2 %). Ruobo. Irish Wildlife Manuals. Pearl Aquaculture Research Foundation. Pontjoprawiro & M. H & G. DKP. Washington DC. T. DAFTAR PUSTAKA Anonymous 2005. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel.in. Memasukkan: Maret 2009 Diterima: Juli 2009 78 . Winanto. Murdjani. AK. india. Metode Perancangan Percobaan.. 1900. Peterborough. 1991. 49: 255-262. Kovitvadhi. 2007.1–11–2008. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1. P. Thongpan. Machado.3 mm). & K RungruangsakTorrisen. A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea. S. U. Kovitvadhi.T. Freshwater Pearl Culture and Production in China. Dan. Bandung.. R. Jakarta. Oliver. 1949. dkk pada perairan yang bening. Rome. No. 8. Areekijseree. 2008. Sonkar. FAO. Part 1: Biology of the species and its present situation in Ireland. Pagcatipunan. Rachman. 2000. A. Dev.Rachman. Imperial Real Question Real Answer. sales@ thepearl. S.357. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. EA. Laporan Tahunan. Aquaculture 275: 169-177. 1986. 2006. Rojali. A. U. Gasperz V. Reprod. S. M. Hyriopsis (Hyriopsis) bialatus Simpson.2 %). 1856).com . Kovitvadhi. B. Kovitvadhi. AR. Invertebr. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature. United Kingdom. Pearl Culture in Japan.source. Balai Budidaya Laut Lampung & FAO/UNDP. 1992. &D. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp.

and Duabanga-Pterocymbium communities. Raja ampat. and identify their species. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. Aporusa–Pometia. Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. Antocephalus-Toxotrophis. Almost all of common species such as Pometia pinnata. Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . Yensawai (7 plots) and Wailebet (5 plots). Raja Ampat. Anthocephalus macrophyllus. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. Balgooy 1976). which might be a characteristic of vegetation of Papua and the nearby small islands. Toxotrophis illicifolius. Papua. and determined their positions. Raja Ampat. Pulau Misool. Papua Kata kunci: Vegetasi.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. Keywords: Vegetation. e”10 cm) within all of 17 plots were measured. hutan dataran rendah. In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. Pulau Salawati. Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. Ficus-Antocephalus. and Koordersiodendron pinnatum. Raja Ampat. Sterculia-Grewia. All trees (dbh. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat. However floristic compositions varied among plot sites. dan Pulau Batanta. Pangium edule. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. lowland forest. According to ordination analysis there were five community types. Pulau Waigeo. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas.

Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil.9" LS. karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air. dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi. Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora. Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah. struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. cendrawasih Wilson. rentan terhadap kerusakan dan peka akan gangguan. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air.3"–0º54’19. dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. yang terbentang antara 130º31’7. beraneka burung kakatua dan nuri. kuskus waigeo. yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta. Namun demikian secara umum kondisi vegetasi masih cukup baik. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. dengan kondisi vegetasi yang bervariasi pula. (Anonim 2006). Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi.2"–130º53’28. maleo waigeo. di samping pantaipantai berpasir putih yang indah.Edi Mirmanto beragam pada saat ini. Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas.4" BT dan 0º47’ 27. 80 . beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006). dengan ketinggian mulai dari 12 sampai dengan 147 m dpl. Yensawai dan Wailebet (Gambar 1). Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap. yang meliputi daerah datar sampai berbukit. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS.

Yensawai (3=Waringkabum. Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris. Waringkabum.com) 81 . Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat. dengan kondisi vegetasi yang relatif tidak terganggu. dan Warai. Rata-rata curah hujan dan temperatur udara di daerah penelitian. Vegetasi di daerah ini pada umumnya belum terganggu. 8=Kalituris). lokasi berdasarkan pengukuran dengan GPS) Gambar 2.com/irian-jaya.cityseahorse. 2=Kafnain). 6=Warai) dan Wailebet (7=Kaliyakut. 4= Wartandib. bergelombang sampai berbukit.Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar. dengan kondisi medan secara umum datar. berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua. Gambar 1. Korpak. Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam.html. 5=Korpak. (Peta diperoleh dari httw://www.

Dari 40 suku yang tercatat. yang tersebar pada medan maupun kondisi vegetasi yang bervariasi. Flacourtiaceae. 82 dominansi relatif. diidentifikasi jenisnya. beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak. dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). frekuensi relatif kerapatan relatif. Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA. Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. Di salah satu DAS telah dibuat bak penampungan air. Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak).Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar.3 m dari atas tanah. yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2). Sapotaceae. Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. Anacardiaceae.com). Sapindaceae. kerapatan. Euphorbiaceae. ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. dan nilai penting. diukur diameter batang setinggi 1. dengan menggunakan perangkat lunak MVSP 3. Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu .1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. Yensawai (7 petak) dan Wailebet (5 petak). Verbenaceae. diikuti oleh Sterculiaceae. (1965). dan Rubiaceae. Alangiaceae. Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi. Beberapa suku diantaranya Lauraceae. yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). dominansi. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm.

0 1.4 8.9 17.5 1.3 9. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.1 31.2 3.6 2. Pometia pinnata bersama Anthocephalus macrophyllus.0 8.9 7.2 11.3 2.8 1. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3.0 1.6 17.1 35.2 2.0 31. Pada Tabel 2.1 4.1 1. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi. berukuran besar dengan jumlah individu relatif banyak.6 1.0 100.0 Rata-2 20.8 14.2 4.1 8.5 11.6 2.7 1.6 4.7 8.0 1.0 2.4 25.8 21.8 2.2 19.7 23. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).3 37.0 33.7 32.4 1.0 Petak pencuplikan data B C D E F G H I J K 1.1 100. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %.3 16.8 13.1 3.0 100.5 44.6 30.0 100.0 100.2 3.4 4.6 100.5 5.8 9.7 13.4 3.0 100.7 7.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi.7 39. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58.1 25.5 12.3 25.0 100.8 17. Jenis-jenis tersebut umumnya tersebar cukup luas. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.4 10.0 100.6 25.9 4.4 4.0 22.7 41. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.6 16.2 12. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya.1 13.5 1.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).3 8.0 100.4 17. Struktur hutan Tabel 1.0 100.3 1.4 1.7 L N O P Q R 14.0 100.8 4.9 19.2 3.1 13.0 100. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi.6 4. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.9 21.0 100.7 4.5 50.0 100.1 5. Berdasarkan nilai penting (NP) tertinggi.3 17.6 34.1 6.3 14.1 5.2 36. Toxotrophis illicifolius.1 1.7 6.8 5.1 0.3 7.0 14.3 2.8 41.1 17.6 3.0 2.0 2.1 21.9 3.9 16.2 19. tetapi memeiliki kerapatan dan frekuensi yang rendah.6 21.0 100.8 12.2 2.6 1.7 11. tetapi dengan pohon-pohon berukuran relatif kecil.8 3.4 19.1 2.0 7.1 15.0 2.7 11.0 18.2 24.0 100.3 100.7 6.4 5.1 31.1 21.3 13.6 3.5 1.4 14.3 17.6 5.8 %. Pangium edule.7 3.4 6.0 4.6 24.9 0. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.4 9. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.4 30.1 6.8 7.4 3.9 26.0 1.1 2.1 9.0 6.9 10.3 2.9 2.1 3.0 83 .9 1.3 4.

Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon. Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm. Sebanyak 2% pepohonan menempati lapisan I. Gambar 4. Gambar 3. Akan tetapi proporsi jumlah individu nampak tidak seimbang. pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi.5 dan 28 m. sedang pepohonan dengan tinggi di bawah 9. dan 39% pohon menempati lapisan III. ditandai dengan adanya individu pada semua kelas diameter. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 .Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal. lapisan-II antara 18. 1965).5 m. dan lapisan-III antara 9. Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5). yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm).5 m merupakan jenis-jenis ternaungi. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol. Disamping itu diperkirakan bahwa setelah mengalami gangguan. menunjukkan pola persebaran diameter pohon yang cukup menerus. yang menunjukkan adanya rumpang atau daerah terbuka. 6% pohon menempati lapisanII. Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus. Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m. Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al.5 dan 18. sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan.

03 2.99 85 .77 2.22 3.04 10.37 2.10 100.66 1. yang menunjukkan adanya perbedaan pola persebaran.02 3.75 1.16 1.00 NP 18.84 2.30 0.58 2.63 37.63 2.01 4.44 1.02 1.23 1.30 5.35 3.63 3.25 4.34 100.73 1.03 2.60 3.44 2.49 7.12 5.33 3.35 2.31 299. Pometia pinnata dan Anthocephalus macrophyllus.43 62. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.42 2.58 1.87 0. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.98 4. Nilai frekuensi relatif (FR).43 0.03 50.01 2.80 6.69 2. Secara keseluruhan persebaran pohon cukup merata.05 9.66 4.30 1.87 100.16 3. Intsia bijuga. Penyebaran spasial beberapa jenis disajikan pada Gambar 6.73 2.73 1. yaitu dengan nilai Indeks Morishita berkisar angka satu.87 0. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.88 9.98 2.03 3. baik antar jenis maupun antar lokasi.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon.68 3.78 1.03 1.00 DR 7.73 0.33 3.73 7.43 2.87 1.27 2.30 2.77 1.24 1.74 4.83 1.17 3.02 7.40 5.80 1.31 6.03 13.09 150.87 0.04 1. Tabel 2.18 2.43 3.69 5.43 0.50 2.86 1.33 5.45 2.00 KR 6.02 2.59 5.54 6.

Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. sehingga kemungkinan sudah banyak ditebang. ditandai dengan rendahnya individu pada tingkat semai dan belta.G.L) dan Wailebet (O.Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule. kelompok B terdiri atas 3 petak (A. R) di daerah Wailebet.K.D) yang terdapat di Yenanas. Antiaris toxocaria.I. Kelompok A terdiri atas 2 petak (Q. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6). Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak.E) dan Yensawai (F. sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi.P). Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4.J). kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C. Permudaan alami jenis Instia bijuga berjalan kurang baik.B. Anthocephalus cadamba. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7). kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H. Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data. 86 .

(M=pohon menonjol. L-I=pohon pada lapisan I.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5. L-II=pohon pada lapisan II. Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 . L-III=pohon pada lapisan III. Gambar 6. Stratifikasi hutan secara umum di daerah penelitian. N= pohonpohon ternaungi).

Ke lima jenis dominan tersebut meliputi sebanyak 34. dan 5. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0. yaitu 1. 3. Pometia pinnata.4 % total basal area dalam komunitas ini. 0. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar.0 SUMBU-X 0. Grewia paniculata.4 0. komunitas Ficus-Antocephalus.4 Toxotrophis illicfolius. Jenis-jenis Sterculia cordata. 2.4 -0. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. dapat ditentukan menjadi lima tipe komunitas. Alangium javanicum dan Pimeleodendron ambinicum. komunitas Duabanga-Pterocymbium. 4. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia. Berdasarkan jenis-jenis dominan pada setiap kelompok.4%. Artocarpus altilis. Ke 4 jenis tersebut mencakup 48. yang lebih rendah dari pada dua komunitas sebelumnya. Pometia pinnata. Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus.4 Gambar 6. dengan proporsi dominansinya mencapai 61. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea. komunitas Aporusa–Pometia.7 % dari total basal area. komunitas Sterculia-Grewia. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . komunitas Antocephalus-Toxotrophis.

Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada.Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. 1995. Canarium maluensis. Simbolon. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. maupun luas daerah penelitian. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. atau terdapat dalam proporsi yang rendah. serta dengan komposisi jenis yang berbeda pula. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. Kari-munawa (Yusuf dkk. Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. tidak terdapat dalam komunitas lain. Pometia pinnata. Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. 2001. Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA. Nusakam-bangan (Partomihardjo dkk. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Artocarpus altilis. Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. Koordersiodendron pinnatum dan Cryptocarya multinervis. misalnya Waigeo (Mirmanto. seperti Geser (Mirmanto & Ruskandi 1986). Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. 1998). yaitu sebanyak 56 jenis pohon. PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. kecuali Koordersiodendron pinnatum. Ficus variegata. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. Anthocephalus macrophyllus. 2003). Ficus tinctoria. Artocarpus communis. data belum dipublikasikan). Dari jenis-jenis yang tercatat. 2006). Krakatau (Tagawa 1992). Pterocymbium tinctorium . Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan. tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. Hampir semua jenis dominan tersebut.

hanya terdapat dalam jumlah yang relatif sedikit. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. meskipun secara struktural sudah mendekati kondisi hutan alami. Pimeleodendron ambinicum dan Endospermum moluccanum. yang rata-rata berukuran cukup besar. Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk). Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula. juga mempengaruhi kesamaan komposisi jenis. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama. . Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. Inocarpus fagiferus dan Instia bijuga. Mallotus mollisimus. Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides.. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu. Ficus spp. Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp.Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder.

Doc. 2001. van. Anthocephalus macrophyllus. HB. Sci. 1986. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. Kabupa91 . In: K. T. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Dalam: H. Biological diversity of small islands: Case study on landscape. Apasutaya. Prawiroatmodjo. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak. H. Simbolon (ed.E. Fac. Purwaningsih. Partomihardjo.). Asia of forest vegetation in Thailand. Ruskandi. Ogawa. EN. Cilacap-Indonesia. H. M. 2006. Structure and floristic composition.). 1965. 4: 13-48. Shidei. T. & H. Malaysia: 106-111. Report and Proc. Measuring the dispersion of individuals and analysis of distributional patterns. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. John Wiley & Sons. Comperative ecological study on three main types in S. Kyusu Univ. Prawiroatmodjo. 1959. New York. Putrajaya.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata. E. Global Taxonomy Initiative in Asia. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. of first GTI Regional Workshop in Asia. Roemantyo & S. vegetation and floristic notes of Nusakambangan Island. Mirmanto.& Life. & A.. MMJ. Sambas & S. K. New Guinea Vegetation. Puslitbang Biologi-LIPI. Mueller-Dombois. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. 1972. Berkaitan dengan kekhasan vegetasi hutan. 1-22. I. 1976. T. Ser. Laporan Perjalanan. (Biol. hal 34-45. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. Pangium edule. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. Ratnawongse & C. Phytogeography. Ogino. DAFTAR PUSTAKA Anonim. Morishita. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. Laporan Teknik 1995.. E. 2003. Toxotrophis illicifolius. Partomihardjo. D. K. Ellenberg. Tipe-tipe vegetasi cagar alam pulau Supiori. Paijmans (ed.. Maluku.. 1995. Analisa vegetasi hutan dataran rendah di pulau Geser. Propinsi Irian Jaya Barat. Mem. 2001: 39-48. Simbolon. Irian Jaya.). D. Yoda. 1995. Aims and methods of vegetation ecology. Nat. 2: 215-235.

42. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea. Geo J. Mulyadi & H. Julistiono (ed. H. Ruskandi. van. 1951. Jakarta. Wardi & Dirman. Series I. Ferguson. H. Laporan Teknik 2006. Flora Malesiana. 1992. Yusuf. Jakarta. Simbolon (ed. Kementrian Perhubungan. Laporan Teknik 1995. & JHA. Primary succession and the effect of first arrival on subsequent development of forest types. Irian Jaya. Irian Jaya. No. di kawasan T. Steenis.N. CGGJ.Edi Mirmanto ten Biak Numfor. 2 (3): 1-11. Karimunjawa. Karimunjawa dan bebrapa pulau kecil lainnya.. 28 (2): 175-183. Ekol. Studi vegetasi P. Djawatan Meteorologi dan Geofisika. 2006. 1948. R. vol. A. Puslitbang BiologiLIPI. EB Walujo. FH. hal. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah. Schmidt. hal 54-72. Simbolon. Verhandelingen. Tagawa. IV. Indonesia. 1998. Dalam: H. 92 . Pusat Penelitian Biologi LIPI.). Dalam: AJ Arief. Noordhof-Kolff NV.). 17-31.

Mangifera indica Parishia insignis Hook. CELASTRACEAE Siphonodon celastrinus Griff. Cynometra ramiflora L.S. Suregeda glomerulata (Bl.Br. Teysmaniodendron hollrungii (Warb. Macaranga tanarius (L. ANNONACEAE Spondias cytherea Sonnerat. EUPHORBIACEAE Aporusa cf dendroidea Schot.) Baill.) MA Mallotus rufidulud (Miq.) Nielson Crudia reticulata Merr. Lepiniopsis ternatensis Val. Endospermum moluccanum Glochidion zeylanicum A.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta. Bridelia insulana Claoxylon longifolium (Bl. Polyalthia diversifolia Miq. Alstonia scholaris R.) MA Pimeleodendron ambinicum Hassk.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr.) Kosterms. Mallotus philippinensis (Lam. FABACEAE Archidendron jiringa (Jack. ARALIACEAE Gastonia papuana Miq.) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. Polyalthia laterifolia King Polyalthia subcordata Bl. Jass Macaranga aleuritoides F. Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl. Muller.) Pax & K.Hofm.) Endi Croton argyratus Bl. Tabernaemontana sphaerocarpa Bl. Mitrephora diversifolia Miq. Semecarpus australiensis Engl. DILLENIACEAE Dillenia ovalifolia Hoogl. Inocarpus fagiferus Fosb. Instia bijuga Kurtz. Osmoxyon sessiliflorum (L.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1. APOCYNACEAE Popowia beccarii Scheff. Intsia palembanica 93 .) MA Mallotus mollisimus (Geisebr. Polyalthia glauca Boerl.) A. CLUSIACEAE Garcinia dulcis (Roxb. Drypetes glabridiscus JJS Drypetes longifolia (Bl.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K. Raja Ampat.

)Miq. Toxotrophis illicfolius Vid. Ficus glaberrima Bl.) Merr. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud.) Benth. Litsea timoriana Span. Aglaia goebeliana Warb Aglaia korthalsii Miq. LECYTHIDACEAE Planchonia sp. Litsea ladermnniii Tschn.)Kost. Litsea calophylantha K. Cryptocarya multinervis Teschn. Ficus variegata Bl.) Boerl. Schum. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall.) Hk. Litsea firma (Bl. Purverulenta (Warb. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl.)Schouten Gymnacranthera panniculata Val.B. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm.) KN Parker Chisocheton ceramicus Miq.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq.f.)Sleum Gonocarium littorale (Bl. Et Binn. Horsfieldia bivalvis (Hk. Horsfieldia hellwigii (Warb. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc.f.)Valeton Dysoxylum arborescens Miq.)Sincl. Cryptocarya caloneura (Scheff. Dysoxylum densiflorum (Bl. Ficus botrycarpa Miq. Lansium domesticum Correa Sandoricum koetjape (Brom. Horsfieldia irja (Gaertn) Warb. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl.f.) Forsb Artocarpus communis Artocarpus varieseanus Miq.)C. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park. Chisocheton lasiocarpus (Miq. 94 .Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb. wieringae Kosterm.)Kosterm.Rob. Trophis philippinensis (Bur.) Merr.)var.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf. Litsea forstenii (Bl. Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. Litsea glutinosa (Lour.

Br.J. Pterocymbium tinctorium (Blanco) Merr.)Merr. Anthocephalus macrophyllus (Roxb.petiolans Pometia pinnata Forst. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC. Myristica inutilis R. Sterculia cymosa Wall. sp.)Merr. Et K. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb. ROSACEAE Prunus javanica Miq. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl.f.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F. Br. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R. Morinda citrifolia L. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L. Et B. 95 . OPILLIACEAE Chaemperia manillana (Bl. TILIACEAE Grewia paniculata Ridl. Pavetta platiclada K. Palaquium sp. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L. Neonauclea clemensii M. Schum. Chrysophyllum roxburgii G. Myristica curcullata Mgf.)Risdl.) Havil. NYCTAGINACEAE Pisonia longirostris T.v Muell Sterculia cordata Bl.J. Harpulia petiolans Radlk sub.)Tirveng Anthocephalus cadamba Miq.L Palaquium lobbianum Burck Palaquium obovatum Burck. RUBIACEAE Adina racemosa (Caw. RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Don Madhuka leucodermis H. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L.P. Scott.) Chew Pipturus argenteus Widd. Myristica lanceifolia Bl.) Merr & Perry Syzygium pteropoda Lauterb. Schum Pertusandian multiflora (Hw. Psychotria diplococea Landeri Valeton Tarenna barbellata Val.

Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R. Vitex glabrata R. Vitex quinata (Lour. Memasukkan: April 2009 Diterima: Juli 2009 96 . Br. Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Br. v Will.) F.

thuringiensis. Kata kunci: B. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997). Ostrinia furnacalis. Ostrinia furnacalis Guenee 1 Bahagiawati1. Habib Rizjaani1. first was 490 bp. two DNA bands. Oleh karena itu. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7. 6 of them gave PCR products. Cib 551.id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. Lam 752. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. 243. These isolates were Jtg 2151. cara tersebut antara lain dengan mempergunakan biopestisida. Email: bahagiawati@indo. Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). Lam 762 and C 522. thuringiensis. PCR. yaitu matinya organisme non-target. Agustina K. Ostrinia furnacalis. PCR.7 milyar dolar Amerika (Bent & Yu 1999). the expected size of Lep2A-Lep2B primers. Key words: B. diperlukan cara lain selain hanya dengan pestisida. 2 Balai Besar Karantina Ikan Soekarno-Hatta.Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. di antaranya dengan menggunakan insektisida kimia. Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . From 59 tested isolates. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). and second was 986 bp. cry1A. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. cry1A. Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. Kerusakan yang diakibatkan hama tersebut sangat bervariasi. yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984). All of tested isolates showed potentially high toxicity against maize stemborer. timbulnya hama resisten. maize stemborer. the expected size of Lep1A-Lep1B primers.net. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam.

Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan. thuringiensis subsp. thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). antara lain analisis Southern blot. Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. 1991.Bahagiawati. Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. Smith et al. 1991). Bakteri ini dapat diisolasi dari berbagai bahan. dan telah diidentifikasi berbagai jenis protein Cry. dan berbagai bangkai serangga (Carozzi et al. relatif cepat. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. 1991. dan mudah digunakan dalam kegiatan rutin (Carozzi et al. bubuk biji-bijian. 1991). Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. Selain itu. seperti dari tanah. permukaan daun. & Sibuea wati 2002). dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al. BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. Sebagai kontrol negatif dipakai akuades. kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel. karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. kependekan dari kata crystal. thuringiensis masih terus dilakukan. Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. 2001). 1991). strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. Bogor digunakan sebagai bahan dalam penelitian ini. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. selanjutnya disebut dengan Bt. Rizjaani. penggunaan antibodi monoklonal. Santoso et al. 1992) yang dimodifikasi seperti . Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989). 2000). cukup sensitif.

(2003). Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm. Sebanyak 1 ml suspensi B. (2003) dengan modifikasi sebagai berikut. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1). Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. berat. hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. Selain itu. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. Pembuatan makanan buatan. thuringiensis lokal yang disaring. dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. masingmasing 500 μl. furnacalis mengikuti Bahagiawati et al. Uji toksisitas. permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut. Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. Rerata persentase kematian. dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. Setelah makanan buatan tersebut membeku. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. Jika terdapat perbedaan antara rerata perlakuan yang diuji. masing-masing bagian makanan diinokulasi 2 ekor larva. 99 . (2003). Pengujian toksisitas dilaksanakan dengan memakai serangga O. Setiap cawan mewakili satu ulangan. sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. (2002). lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan. thuringinesis terhadap larva O. dan masing-masing perlakuan diulang sebanyak 3 kali. Ada tidaknya perbedaan antara data persentase kematian. berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. Uji toksisitas isolat B. diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. furnacalis yang diperbanyak pada makanan buatan.0 for windows. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril.

Analisis data persentase kematian. kontrol negatif akuades (-).Bahagiawati. Tabel 1.90b (30) 13. Lam762(5) dan C522(6).33b 96.67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5. Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O.77a (1) 0.91a (5) a 0. furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 .78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0.07a (2) a 0. Cib551(3).49b (30) 0.00a 83. Rizjaani.67b 96.613a (5) a 0.003 (1) 1.05. furnacalis Data uji toksisitas terhadap larva O.04 (4) 0. furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1.33b 96. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1.133a (5) 2.77a (5) 2.03a (1) a 0. & Sibuea Uji toksisitas isolat terhadap O. Kontrol positip. Lam752(4).23 (2) 1.94a (1) a 0. Cib243(2).30b 96.67b 83. dipel (+).03 (1) 0.67b 86. Produk PCR dari beberapa isolat Bt lokal Jtg2151(1).20 (1) 0.

9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2. Pada kontrol positif (Dipel). dengan berat tubuh yang relatif kecil yaitu 0. kematian serangga mencapai 83. Regresi linier antara: A.1137x + 1.9 mg dan panjang tubuh 13. B. Kedua analisis di atas menunjukkan hubungan yang terbalik.0133 R2 = 0.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0. demikian juga dengan panjang tubuh larva (R2 = 0.9 mm. yaitu makanan buatan yang tidak mengandung suspensi Bt. Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0. persentase kematian dan berat tubuh.1311x + 13.3%. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0.409 R2 = 0. persentase kematian dan panjang tubuh. berat tubuh dan panjang tubuh larva 101 . namun berbeda nyata dengan kontrol negatif akuades.6 mm untuk panjang tubuh. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt.97).04-0. Berat tubuh larva-larva tersebut mencapai ratarata 5. dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi.7 mg untuk berat tubuh dan 0. C.7726 R = 0. Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif.9753 Gambar 3. Larva-larva yang masih hidup ini terlihat lemah.13 mg dan panjang tubuh hanya 2.9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0.7 mm-2. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan.98). Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan.5 mm.0609x + 5.

masing-masing Lep1A-Lep1B dan Lep2A. Santoso et al. 1992). adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama.7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008). PEMBAHASAN Seperti yang telah dikemukakan. belum pada tahap bioasai toksisitasnya terhadap hama target. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989.Lep2B. Hasil penelitian kami memperlihatkan hasil yang lebih akurat . namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B.97) berbanding lurus. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung. Rizjaani. yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al. Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running. Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. mereka memakai 2 pasang primer. 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O.Bahagiawati. Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. furnacalis. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. 2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. dimana pada tahun 1999 mencapai $300 juta. Pada waktu Santoso et al. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup.

Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. 103 . 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb. 1998). setelah beberapa hari tampak kecil. Pada hasil penelitian Santoso et al. thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel. KESIMPULAN Dari 59 isolat yang diuji. Empat isolat yaitu Jtg2151.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. 1991). yaitu bioinsektisida Bt yang telah dikomersilkan. Ceron et al. Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989. Larva yang memakan toksin Bt. Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. furnacalis. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. Cib 243. dan aktifitas makan menurun. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. Berdasarkan hasil uji toksisitas isolat B. 1994). gerakannya lambat. furnacalis.

Covarrubias. J. Biotek. IN. Ausubel. Microbiol. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. A method of computing the effectiveness of an insecticide. Appl. Aranda. Kingston. Envi.. Rizjaani. WS. PT Ichtiar Baru-Van Hove. Mikro. C. A. New York. 1925. Bent. Struhl... Insecticidal crystal protein of Bacillus thuringiensis. VC. H. No. Rev. cry1A(b).. Perhim. Masalah dan . Micro. Smith & K. Jakarta. 1991. Ortiz. NB.Y. Buletin Agrobio: 4 (1): 1-8. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. 57(11): 3057-3061. 60: 353-356. Ceron. Advances in Agronomy 66:251298. 18: 265-267. ISAAA. 1997. Bio/Technology 10: 271275 Höfte. Bahagiawati. Indone. Quintero.Bahagiawati. & Sibuea DAFTAR PUSTAKA Abbot. Wereng coklat dan pengendaliannya dalam prespektif. Lina & A. 2003. & IC. Rijzaani. Pros. 2001. 2002. Kramer. J. R. J. Indo. 2002. Kalshoven. Penggunaan Bacillus thuringiensis sebagai bio. Moore. B. 39. RE. 1989. Soegiarto & MS. Agrobio 5(1): 21-28 Bahagiawati. Microbiol. Yu. Pest of crops in Indonesia. S. Brotonegoro. & HR.. 1999. 1983. Whiteley. Sem. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. Kim. Mikro Indo. M. FM. cry 1A(c) dengan PCR. Second Ed. L. 1994. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). 53(2): 242-255. Bahagiawati & Amirhusin. B. E. 1992. Surabaya 12-14 Maret 1997. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. & N. JS. Sutrisno. Oka. 8(1): 2730. Bacillus thuringiensis: insects and Beyond. Feitelson.G.insektisida.. Perta. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. S.A. Appl. A F. Listanto. 1992. J. L. Bravo. Evola & M.7(2): 35-38. Koziei. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. Ithaca. oleh Van der Laan. Bahagiawati. Sarjono.. Bul. Payne. D. Applications of Molecular Biology to Plant Disease and Insect Resistance. 2008. Setyawan & Sutrisno. ISAAA Briefs. H. J. 1981. John Willey. R. GW. LGE. Global Review of Commercial Transgenic Crops: 2008. P. N. E. Seidman. J.A. DD. James. Santoso. Warren. JG. & L. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. Ortiz. & Bahagiawati AH. Brent. Econ Ento. Envi. Carozzi. Riani Simanjuntak.

J. Santoso. Padi-Buku III: 653-680. 22-24 Maret 1983. Dean. D. Jurnal Bioteknologi Pertanian 5(2): 53-60. Listanto. Smith. Feitelson. D. Appl. Pengendalian terpadu hama padi. Couche. N. Damayanti & Sutrisno. 1991.. & GA. Perhimpunan Entomologi Indonesia Cabang Bogor. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR.R. Zeigler & D. Bacillus thuringiensis and its insecticidal crystal proteins. & Soehardjan. Microbiol.H. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Tantangan entomologi pada abad XXI. & Bahagiawati AH. Rev. van Rie. 2000.. TJ. J. IN. The phylloplane as a source of Bacillus thuringiensis variants. Mol. Schnepf. 57: 311-315. RA. E. J. D. 1998.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi. Oka IN. Environ. Cibogo. Memasukkan: April 2009 Diterima : September 2009 105 . Crickmore. Bogor. 63(3):775-806. Rodiyah. 1997. E. Risalah lokakarya penelitian padi. Lereclus. Baum. Biol. Oka. 1984.

and formulated to single and mixed bacterial inoculants. and Nitrosomonas spp. Rhizobium . E-mail: widadomon@yahoo. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant. Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Citrobacter. Jl.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Bacillus. Chromobacterium. Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. That selective inoculant has opportunity to be used for jatropha farming. Azotobacter.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L). Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. Nitrosomonas. inoculants. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran. Spaerotillus natans. Bacillus. Those isolates were used as inoculants. Keywords: Jatropha curcas L. Raya Jakarta-Bogor km 46. and neither to bare soil dresses with compost. Nitrosomonas. Spaerotillus natans. The soil was collected from numerous places around Pontianak. Rhizobium . Cibinong Science Center. Kandungan minyak mencapai 40% 107 . Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. Chromobacterium. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). Bacillus.. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. and Spaerotillus natans were soil bacterial isolates. plant height was accelerated quickly while other inoculants affected to stalk diameter development.. Bacillus. inoculants. Citrobacter. Genera of Azotobacter. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Nitrosomonas. Citrobacter. Kata kunci: Jatropha curcas L. West Kalimantan. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition. Chromobacterium. Rhizobium. In the presence of inoculants.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI. Azotobacter. respectively.

Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. 2002. Badran & Safwat 2004. Bakteri yang berhasil diisolasi adalah Azotobacter. Nitrosomonas. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. Pusat Penelitian Biologi LIPI. serapan hara.Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. 2006). Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al. Lewis et al. 1995. dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Kalimantan Barat. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. Kandeel et al. dan Spaerotillus natans. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). ElGhadban et al. Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. atau setara dengan 1. 2006). Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan . Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008). sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot). Bacillus. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar. Perlakuan bakteri Azotobacter chroococcum. BAHAN DAN CARA KERJA 1. Azospirillum liboferum.9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978). 2007). dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. Citrobacter.6 metriks ton minyak jarak hasil produksi tanaman per hektar. Chromobacterium. Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. 1991. Rhizobium spp. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak.

Sambas. dan 2. masing-masing sebanyak seperempatnya atau 7. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2. 3x10 7 Chromobacterium.8x107 Nitrosomonas. Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I. Citrobacter. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya. Citrobacter. Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp. Singkawang. dan Nitrosomonas spp. dan Bacillus spp. kemudian dikondisikan pada pH 7.5x107 Citrobacter. Bacillus. 2. Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan. Media tadi mengandung: 1 g glukosa. 1. 0.001 g MnSO4 H2O. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. 1. atau sebagai inokulancampuran beberapa-genus (multi-genera).3x107 Spaerotillus natans sebagai BahanInokulan (B-I). 0.5 ml sediaan dari inokulan Azotobacter. yang masing-masing diambilkan 10 ml dari BI. perlakuan kompos sekam ayam (P-7). dan kemudian diformulasikan seperti pada Tabel 1. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji. Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6).5 g Ca3PO4. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran. yang diisolasi dari tanah asal Rasau Jaya. digoyang pada kecepatan 150 rotasi per menit. kemudian ditempatkan di dalam rumah kaca. 1. perlakuan kompos tanpa mikroba (P-8). sebagai inokulan P-3. diinkubasi selama 7 hari. Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter. 0.01 g MgSO4 7H20.02 g KCl. 0. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding.2x107 Rhizobium. Satu dari tiga kecambah yang terbaik pada setiap pot 109 . yang diisolasi dari tanah asal Rasau Jaya. 0. Mandor. Pontianak. Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera). P16. Karoho. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos. 0. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus.001 g FeCl 3 .05 g yeast ekstrak dan 0.05 g (NH4)2SO4. dan P-17.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit.6H 2 O.

Bacillus. Nitrosomonas spp.. Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. Citrobacter. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. Chromobacterium. Citrobacter. (isolat tanah Sambas) Azotobacter.Widawati & Rahmansyah Tabel 1. (isolat tanah Mandor) Azotobacter. Citrobacter. (isolat tanah Pantai Singkawang) Azotobacter. Bacillus. Bacillus. dan Rhizobium spp. Bacillus. kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. Rhizobium sp (isolat tanah Ketapang) Azotobacter. Bacillus. (isolat tanah Singkawang) Citrobacter sp. Nitrosomonas. (isolat tanah Rasau Jaya) Nitrosomonas sp. (isolat tanah Karoho) Azotobacter. beserta kontrolnya. dan Nitrosomonas spp. Citrobacter. dan Nitrosomonas spp. dan Nitrosomonas spp. Bacillus. Bacillus sp. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . dan Nitrosomonas spp. dan Nitrosomonas spp. Bacillus. Citrobacter. Citrobacter. Azotobacter sp. dan Nitrosomonas spp. Bacillus.

0. yang umumnya berukuran di atas nilai tengah (center). Tanaman yang tidak diberi inokulan pada no. P-15. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst). P13. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5. P-13.1. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 . P-6. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst. dan P-17. P-4. 8. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2. P-13. 2. dan P-15. P-16. P-14.627 Tinggi tanaman (cm) LCL = 51. P-2. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp.804 UCL = 79. 11.231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. dan P-17. P16. P-15. P-12.377 Center = 17.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. 1. dan 14 mst (Gambar 1).95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. P-14. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13. P3. sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil. P-7. dan P-17 untuk perlakuan inokulan satu jenis. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya.305 1 5 13 17 9 UCL = 22. P-12. sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. P16. P-10.

yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan. atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. akibatnya dapat memperbaiki serapan air.. namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4). atau bahan organik lainnya. 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya. Sekalipun pada hasil yang lain. sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. dan Bacillus spp. Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. memperbaiki struktur akar. PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp. dan P-F sebagai kontrolnya.Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10. Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal. memperkecil erosi. Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan. kompos. sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G. P-A. P-B. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos. dan P-C (Tabel 2). baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis. Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. dan P-I (Gambar 3). yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman .95). dan PC bila dibandingkan terhadap P-E. dan memperlancar serapan hara oleh tanaman (Ogunwole et al. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis. P-H.

931 50 LCL = 46.126 70 20 18 16 60 Center = 59.344 Center = 11. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat. Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata.637 LCL = 8.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65. 8.615 9 28 Center = 26.377 (mm) tanam an Center = 44.305 UCL = 79.231 Center = 17.804 LCL = 13. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73.295 24 8 Center = 7.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2.66 LCL = 19. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 .486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56.774 UCL = 22.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33.647 LCL = 11.314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14.52 Center = 15.93 UCL = 19.627 60 50 40 30 LCL = 51. 11.103 32 10 UCL = 9.637 7 6 20 LCL = 5. dan 14 mst.

dan Nitrosomonas spp Azotobacter. Citrobacter. Nitrosomonas spp. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F . Citrobacter. dan Rhizobium spp Azotobacter.Widawati & Rahmansyah Tabel 2. dan Nitrosomonas spp Azotobacter. dan Nitrosomonas spp. Bacillus. Bacillus.kontrol 1 (tanpa inokulan) . Azotobacter. Citrobacter. Citrobacter.kontrol 2 (tanpa inokulan) . Chromobacterium.kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 . Nitrosomonas. Bacillus. dan Spaerotillus natans Azotobacter. dan Nitrosomonas spp. Citrobacter.kontrol 3 (tanpa inokulan) . Bacillus. Bacillus. dan Nitrosomonas spp Azotobacter. Azotobacter. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter. Citrobacter. Bacillus. Bacillus. Bacillus.

904 Gambar 3.904 Y = 23. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar.60 0.649 + 1. dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1.00 0. fraksi atau serpih tanah. dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC).20 1.20 0. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E).40 0. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman. 11.722 * X. R^2 = .80 A C G H 0. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F).00 1.20 0. 115 .20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1.80 0.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4.40 0. atau tanpa kompos (P-F). namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus).60 0.7 x + 23.7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0. Kecepatan tumbuh batang hasil pengamatan 5.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1. Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al. serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya. 8. Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis.00 0.

S. Bakteri Bacillus spp yang diujikan oleh Desai et al. M. & MS. 2007. 2:7–11 Desai. & TS. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization. GR.. Rao & B. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. FS. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. Isolat bakteri yang diperoleh dari tanah asal Pontianak.: an important biodiesel plant. Deore. yang mana keberhasilannya terjadi seperti pada pengujian ini. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). 2008. Johnson. Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan. improves seedling . Seed inoculation with Bacillus spp. Agric. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri. Ch. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. yang diisolasi dari tanah asal. 82(2): 247256. Plant Biotech. Gnanamanickam. Egyptian J. Reddy. Venkateswarlu. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan.. dan klorofil daun bila dibandingkan terhadap kontrolnya. Kalimantan Barat. luas daun. Bacillus. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. dan Nitrosomonas spp. Safwat. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. Ch Kumari.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun. DAFTAR PUSTAKA Badran. Res. biomassa. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. S. bobot akar. AC. Rep. Narayanaiah. 2004.

1991. Patolia. & A. Indian Perfume. Ain Shams Univ. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media. DR. International Conference on Environmental Research and Technology (ICERT). Ghosh. Elefan. plant. A. Soc.) cv. Tropical Hort. & M. SK. Res. Ogunwole. Wani. 39: 27-32. 2008. J. Gangrade & KC. 21: 361-366. Sadek.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. Ranjard. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol. Effect of mineral vs. EAE. Agric. S. J. Microbiol. Shalan & TAT. Daudu. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards. and essential oil content of fennel (Foeniculum vulgare Mill. Sci.. SK.. Kabesh & MS. 44 (1): 229-234. 1978. Memasukkan: April 2009 Diterima: September 2009 117 . & MA. Asian Biotechnology and Development Review. Cairo. JO. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin. Scien. 2008. African J. 35(2): 308-311.. 308-312. Int. Egyptian J. Yousry. yield. Sreedevi. volatile oil yield and chemical composition of Ocimum basilicum L. L.. Annals Agric. Int. World Appl. 1995. OM. Mangkoedihardjo. 5(2): 75-80.). 47(1): 351–371. CK. Vietnamita. Osman. Banerjee. Sci. Chaudhary. 2001. In vitro clonal propagation of physic nut (Jatropha curcas L. Sharaf-Eldin. 2007. S. Effect of biofertilizers on the growth. Abdel-Latif. Lewis. M. SA. Mahfouz. Biol. Shrivastava. Kandeel. ES. Agric. 2006. Int. 2008.. Jatropha curcas L. D’Silva & TK. Saber. for phytoremediation of lead and cadmium polluted soil. Trivedi. Fert. 2008. AL. biofertilizer on growth. MN. Soils. El-Ghadban. 2002. Plant Soil Sci. Environmental Technology & Management.. Agrophysics. LO. & Surahmaida. 2006.. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. Richaume.Biol. Influence of biofertilizers on growth. AM. Quantitative and qualitative microscale distribution of bacteria in soil. Chikara.. 3(1):7378. M. Maheshwari.J. volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. Munoz. Am. Dominguez & OS. SAT. JS. 8(2):11-29. Naglaa & AA. Res. SP. Improve livelihoods and environmental protection through biodiesel plantation in Asia. E. 4(4): 519-522.). 58(3): 245 – 251.): influence of additives. 84(3): 977-992. 152: 707–716..Inte.

C. while the female in disk type. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. Urceolatus type has important for female of C. and perferesence. Email: srisoegiharto@gmail. brachyotis. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda. urban area Kata kunci: Kelelawar buah. brachyotis and R. minutus. Key words: Fruit bats. West Jawa. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. C.co. titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m). The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. titthaheileus. Furthermore the male of Macroglossus sobrinus has interested in rotatus.Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. sphinx. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi. corola types. Where as the female has interest in campanulatus type. prolate pollen type has importance for the male of Eonycteris spelaea. amplexicaudatus like permagnae type (100-200 ì m). sphinx. identifikasi. oblate type for the male of C. Serat polen mengandung protein lebih dari 60%. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar. brachyotis and C. while the female of C. tubulosus. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. Email: apkartono@yahoo. Bats have important role on seed dispersal and or plant pollinator. oblate spheroidal for the female of Rousettus amplexicaudatus and male of C. pollen identification. polen dan nektar (Suyanto 2001).com 2 Staf Pengajar Mayor KVT IPB Bogor.id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. sphinx. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah. The male of C. 119 . titthaheileus and C. Kelelawar kelompok Megachiroptera mengkonsumsi buah. pollen.

sphinx. Macroglossus sobrinus.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. brachyotis.00-18. Jaring kabut yang dipasang pada waktu senja hari pada pukul 17. mulai Maret 2008 hingga Juni 2009. Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku. Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan. dan sering terdapat karbohidrat lengkap sporo-pollenin. yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan. 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan. titthaheileus. C.00 – 08. terpenoid. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. Rousettus amplexicaudatus dan Eonycteris spelaea. Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan. pengulangan dilakukan sebanyak tiga kali. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. pigmen carotenoid. C. Nayar (1999) dan Paldat (2005). C. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga.Soegiharto & Kartono hidrokarbon. Pengambilan sampel polen didapat dari isi pencernaan kelelawar.00 WIB dan pagi hari pada pukul 06. Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan. . Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina. langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling.

kedok. HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar.187. tipe polen dan ukuran polen. jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. axis 2 = 0. sphinx betina. serta C. suboblate. besar/ magnae (50–100ì m).390. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. kecil/minute (10– 25ì m). bintang. Bentuk mahkota bunga terbagi kedalam 8 tipe. mangkuk. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. Pada penelitian ini data yang dihasilkan dalam bentuk persentase.116 dengan eigenvalue = 0. Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang.466 dengan eigenvalue = 0. prolate dan perprolate. (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. Untuk bentuk mahkota lebih kuat mempengaruhi C. axis 3 = 0. Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan.753. yaitu tabung. Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0. dan raksasa/giganteae (>200 ì m). Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok. Analisis pengaruh karakteristik bentuk bunga. C. 121 . oblate. brachyotis betina. sangat besar/ permagnae (100–200ì m). tabung dan bulat.241 dengan eigenvalue = 0. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009). lonceng.5 (Leps & Smilauer 1999). sedangkan betinanya dipengaruhi kuat oleh bentuk disk. Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). disk. dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies. sedang/mediae (25–50ì m). kupu. prolate spheroidal. titthaheileus betina dan jantan.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. Tipe polen terbagi ke dalam 7 tipe yaitu peroblate. dan bulir. oblate spheroidal. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. Penyajian data dilakukan dalam 3 bentuk.

Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3.11 68. TA_B= Tabung.26 9.047 dengan eigenvalue = 0. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae.77 68. Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0.08 29. Pada Gambar 2b. dengan eigenvalue = 0.48 12.54 7.40 21. CS = C. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate. LO_C= Lonceng. BU_L= Bulir.97 100 100 85. Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C.4 11.18 33. R = Rousettus amplexicaudatus. KU_P= Kupu-kupu.74 57. C.26 7.24 12. CB = C.05 2.03 7.598. axis 2 = 0.39 48.53 9. brachyotis betina dan R.194. dengan eigenvalue = 0. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b.74 61.95 18. sedangkan spesies C.427. KE_D= Kedok.1 14. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate.356. axis 3 = 0.28 14.97 11. M = Macroglossus sobrinus. Tabel 1.09 7. sphinx betina.886.88 52.091 dengan eigenvalue = 0.95 44.7 27. E = Eonycteris spelaea.55 9.47 30. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a. axis 2 = 0.285.462. brachyotis. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal.39 42. BI_T= Bintang. 122 .15 4. C. DI_S= Disk.44 50.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2.06 18. minutus jantan. menjelaskan bahwa Rousettus amplexicaudatus betina dan C.23 43.66 25.61 19.99 Keterangan : CM = Cynopterus minutus . Untuk jenis C..58 42. p = jumlah persentase. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1. Spesies C.08 11.03 9. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal. CT = C. MA_K= Mangkuk. titthaheileus.84 41. sphinx.588. dengan eigenvalue = 0.86 4. menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0.

71 44.34 42.2 64. sphinx.03 100 1. CT = C.42 6. titthaheileus.94 11.13 Magnae p 15.78 20. p = jumlah persentase 123 .28 74.69 10.04 Permagnae p 43.92 44.77 46. CS = C.47 18. Tabel 3.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14.8 14. CB = C. CS = C.48 13.13 12.01 57. E = Eonycteris spelaea.17 23.74 61.23 43.01 14. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40. brachyotis.93 64.31 14.65 3.23 15.16 35.2 85. R = Rousettus amplexicaudatus.26 76.97 Keterangan : CM = Cynopterus minutus.13 11.95 42.61 4. brachyotis. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36.08 41. p = jumlah persentase. CB = C.86 6.85 5.24 35.66 56.59 42. sphinx.48 7.52 86. M = Macroglossus sobrinus.21 100 5. CT = C.87 7.69 39.72 14.97 34.56 100 100 100 92. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar.29 52.83 61. E = Eonycteris spelaea. M = Macroglossus sobrinus.04 25.67 29.5 41. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar.4 Keterangan : CM = Cynopterus minutus.58 53. R = Rousettus amplexicaudatus.45 35.92 37.95 39.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2.52 7. titthaheileus.72 14.9 85.65 7.

6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. 11= Rousettus amplexicaudatus betina. 124 . 10= Macroglossus sobrinus betina. KU_P= Kupu-kupu. DI_S -0. BI_T= Bintang. sphinx jantan. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2.. LO_C= Lonceng.0 Gambar 1. Keterangan : 1.0 0. 3= C. 5= C. b) hubungan axis 1 dan axis 3. 8=C. KE_D= Kedok.4 b. 4= C. 6= C. = Cynopterus minutus jantan. brachyotis betina.4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a. minutus betina. brachyotis jantan. BU_L=Bulat. titthaheileus betina. 12= Eonycteris spelaea jantan. 9= Macroglossus sobrinus jantan. 13= Eonycteris spelaea betina.4 Axis 1 1. -0. TA_B= Tabung. 7= C.4 Axis 1 1. sphinx betina. titthaheileus jantan. 2 = C. MA_K= Mangkuk.Soegiharto & Kartono 0.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0. DI_S= Disk.

11 -0. 7= C. 5= C. PR_SP= Prolate Speroidal. OB -0. 10= Macroglossus sobrinus betina. a) hubungan axis 1 dan axis 2. titthaheileus jantan. 9= Macroglossus sobrinus jantan.6 Axis 1 PR_SP 1. 11= Rousettus amplexicaudatus betina. Gambar 2. 8=C.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0. = Cynopterus minutus jantan. b) hubungan axis 1 dan axis 3. 2 = C. 3= C. OB_SP= Oblate spheroidal. 125 .0 0. 13= Eonycteris spelaea betina.4= C.6 1. 6= C. PE_PR= Perprolate. sphinx betina.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0. PR= Prolate. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen. bracyotis betina. sphinx jantan.8 a. titthaheileus betina.. 12= Eonycteris spelaea jantan.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0. OB= Oblate.0 Axis 1 . minutus betina. brachyotis jantan. PE_OB= Peroblate.8 b. Keterangan : 1. SB_OB= Sub Oblate.

(2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar. 9= Macroglossus sobrinus jantan. titthaheileus betina.. tingkat 1. 7= C. dan ukuran. (2003) karakteristik kelelawar dalam mencari makan pada malam hari.0 Axis 1 Gambar 3. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen.2 kebutuhan pakan yang tinggi. Bentuk keberagaman yang ditunjukkan berupa warna. bau. Menurut Graham et al. 13= Eonycteris spelaea betina. PA = Permagnae 126 . 8=C. bentuk mahkota bunga mangkuk. 12= Eonycteris spelaea jantan.0 -1. sphinx betina. sphinx jantan. bentuk. 6= C. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. MA = Magnae. ukuran polen besar dan dalam jumlah banyak.Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae. bracyotis betina. menghasilkan nektar yang berlimpah. 5= C. Keterangan : 1. GI = Giganteae. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan. Keberagaman tersebut dijelaskan oleh Graham et al. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator). 2 = C. 3= C. 4= C. brachyotis jantan. mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. 11= Rousettus amplexicaudatus betina. mengeluarkan bau menyengat (asam butyric). titthaheileus jantan. minutus betina. 10= Macroglossus sobrinus betina. = Cynopterus minutus jantan.4 8 PA 9 12 3 5 7 2 GI 4 11 13 1.

Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. bunga terbuka dan mudah diakses. tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar. Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen. sedangkan tipe polen.2 dan Ceiba sp. ukuran polen tersebut mulai dari magnae. permagnae dan giganteae.. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar.3.. Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. C. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari.. Stroo (2000) mencoba menganalisis pengaruh ukuran polen. Ceiba sp. Durio sp. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen. sphinx. 1. namun berbeda kesimpulan tentang sistem aperture. Pendapat Graham et al. [Orchidaceae] sp.1.. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar.2. tipe polen. Peneliti lain (Graham et al. Syzygium sp. mengeluarkan bau yang tajam dan menyerupai bau kelelawar. ukuran polen tersebut mulai dari magnae. [Euphorbiaceae] sp. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar. spesies Rousettus amplexicaudatus betina dan C. berpendar atau warna kusam. Ceiba pentandra. Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 . C. permagnae dan giganteae. Bauhinia sp. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. Ceiba sp.. sphinx jantan lebih memilih oblate spheroidal. menghasilkan nektar yang banyak dan polen yang berlebihan. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. titthaheileus. C. serta bunga terletak pada cabang pohon. brachyotis. Baringtonia sp.

seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan. misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea. yang menjadi pakannya. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. Rousettus amplexicaudatus dan Eonycteris spelaea. Durio spp. sphinx. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. C. yaitu: (1) tipe bunga yang mudah diakses nektarnya. kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar. Perbedaan pendapat Warren & Diaz (2001). Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. C. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. (2) tipe bunga yang mudah diakses polennya. (3) kelelawar lidah pendek/ pemakan buah. Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. (2009) akan lebih dijelaskan pada hasil penelitian kami. Bumrungsri et al. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. brachyotis. Voigt (2004) dan Bumrungsri et al.Soegiharto & Kartono kelelawar tersebut. seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. kedok pada spesies Eonycteris spelaea jantan. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. . titthaheileus. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. C. kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering). Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. bunga dan daun.. Toelch & Winter (2007). sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram.

Multivariate Analysis of Ecological Data. Copenhagen: Munksgard. LE. 2009. Ithaca: Microcomputer Power Toelch. 222: 225–242. Dept. 2000. Winter. Pollen morphological evolution in bat pollinated plants. Racey. E. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. Suyanto. Ceske Budejovice. Plant Sys. 2007. of Palynology Stroo. K. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores. Graham & LW. 2005. Oxford: Oxford Univ. J & P. Faculty of Biological Sciences. 1999. DAFTAR PUSTAKA Bumrungsri S. TS. BJ. Leps. Kelelawar di Indonesia. International Bioscence Series Volume XIV. Understanding Flowers and Flowering:An Inte- grated Approach. & P. Bombacaceae) in southern Thailand. Glover. Pusat Penelitian dan Pengembangan Biologi – LIPI. Smilauer. An Introduction to Pollen Analysis. 2001. Pollen Flora of Maharashtra State India. Nayar. A. 2003. 1998. University of South Bohemia. Pearson and Prentice Hall. Erdtman. Canoco Reference Manual and User ’s Guide to Canoco for Windows. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan. 129 . T. G. Bogor. U. http: //abdulsyahid-forum. 2009. Sridith & PA. 193:265–269 Voigt. Wilcox. Trop. CC. 1952. Component Phy. 1999. CJF. Smilauer. Paldat. Sripaoraya. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers. A.. Syahid. Erdtman.com / 2009/04/transformasi-data. A. The pollination ecology of durian (Durio zibethinus. Pr.Evol. Illustrated Handbook on Pollen Terminology.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. J. Chongsiri. New York: Chronica Botanica. Transformasi Data. Ecol 25:85–92. 2004. permagnae dan giganteae. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae. New Delhi: Today & Tomorrow’s. Psychometric function for nectar volume perception of a flower-visiting bat. 2007.blogspot.& Y. [20 Juni 2009] ter Braak. 1943. G. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar. Plant Biology.html. Graham. JM.

1:147–158. 1992. Yulianto E. Warren. Preparasi dan dasar determinasi palinologi. 2007. Glover. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. J. & BJ. & A. 2001. Morphology and development of floral features recognized by pollinators. HM. A twopollinator model for the evolution of floral complexity. Arthropod-Plant Inter. Diaz. Whitney. Bandung. Memasukkan: Juli 2009 Diterima: September 2009 130 .Soegiharto & Kartono Component Physiology 174:541– 548. Evolutionary Ecology 15:157–166.

Karyotype. This plant is commonly used as vegetable. Kata kunci: Coccinia grandis L. Universitas Gadjah Mada E-mail : ridesti. cordiflora.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1. In Daerah Istimewa Yogyakarta. Based on the statistic test. dan aksiler.30-09.) Voigt) in Three Population in Yogyakarta. found in three population (Ngebel. Buahnya berbentuk oval dengan panjang 4-6 cm. Niedzielski 2002). 131 . batang memanjat. Selain itu. The difference R value between Papasan I and II was smaller than 0. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m). 11 a. They differ in phenotype.3.m. C. Dalam “Flora of Java”. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika.. Papasan.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L. It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L. berwarna hijau pada saat muda dan berwarna merah pada saat tua.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L. Character differences between both of Papasan only revealed physiology adaptation.30 a.m.5-dimetilbisiklo[3. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5.m and 2-2.. Papasan. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983. Papasan memiliki sulur. UPT BKT Kebun Raya Purwodadi-LIPI 2. Papasan is a dioecious plant belongs to the family Cucurbitaceae.. while Papasan II at about 08.9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006). Fakultas Biologi. and anti diarrhea. Berbah and Gajah Wong Riverbank). Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran.m-00. indica.m. anti diabetic. berbentuk lonceng.30 p. The chromosome number of both Papasan is 2n=24. Chromosome. Keywords: Coccinia grandis L. Papasan memiliki beberapa nama ilmiah seperti C. Cromosom. especially in shape and taste of fruit. Kariotype.25. anti bacterial. bunga berwarna putih kehijauan. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11.1]non-3-ena-2. contains of 22 autosomes and 2 sex chromosomes.30 p. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1. there were two varians of Papasan (Papasan I and II).rindyastuti@yahoo. grandis dan C.30 a.

Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. Cogn sebagai nama sinonim. Di Daerah Istimewa Yogyakarta. varietas atau forma. bentuk. Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. Kedua populasi tersebut berbeda karena perbedaan morfologi. Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. grandis dan varian buah pahit C. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel. Dengan demikian. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . 132 grandis var. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. yang digunakan adalah metode Squash (Jahier et al. grandis (L.Rindyastuti &Daryono Papasan memiliki satu nama yaitu C. Keduanya berbeda dalam hal rasa. Metode preparasi kromosom. warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). variasi bentuk dan rasa buahnya. perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. yaitu dari bulan Oktober 2007. dua macam Papasan yang ditemukan di populasi Ngebel. Varian buah manis yang umumnya dibudidayakan merupa-kan C. wightiana (Roumer) Grab.Juni 2008. Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. grandis) yaitu tipe buah manis dan buah pahit. 1996). Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. ukuran. jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek). Yogyakarta selama delapan bulan. Fakultas Biologi Universitas Gadjah Mada. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. cordifolia Auct non. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003). Di India ditemukan dua varian Papasan (C. grandis var.

49 0-12. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7. Pada setiap pemotretan. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog. Lengan panjang diukur dari telomer lengan panjang sampai sentromer. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7. Hasil pemotongan dicopy dalam format Adobe Photoshop 7.0 untuk konversi skala ukuran kromosom. Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i.00 133 .00 >7.00 3.68-3. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto.Identifikasi Papasan (Coccinia grandis (L.0 dan CorelDRAW X3. Tabel 1.00-1.5 12.0. Lengan pendek diukur dari telomer lengan pendek sampai sentromer. Ukuran tiap ulangan dirata-rata. Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya.01-7. Bentuk kromosom berdasarkan Indeks Sentromer (IS).49 RLK 1. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37. Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG. diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda. Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3. Satu persatu.5-25.5-50 25-37. Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom. Kromosom difoto dengan mikrofotografi.67 1. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. Untuk menyusun karyogram. Ujung akar diambil.

3 . banyak variasi Membundar berlekuk licin. Warna 2.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2.5. variasi bentuk dan rasa buahnya. Bentuk daun 2. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan.6 .9.3 . Tepi daun 3. sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua.9 .5 .64 0.3 . Papasan II memiliki ukuran daun lebih besar daripada Papasan I. membulat-oval.3 8.0. Karakter Dari karakter buah.4 7.6 2 .6 2. tidak berambut 6.4 memanjang.25 pahit oval 0.2 oval-bulat variasi sedikit 1. Buah Papasan I memiliki garisgaris putih.0. Biji 1.7.7 . Permukaan daun 4.7. Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4.6 0. Bunga 1.33 tinggi putih Melengkung keluar (recurved) satu 134 . Seperti tampak pada tabel. Karakter morfologi Papasan I dan II.6 .2 6. terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II.9.0. Bentuk buah 2. bentuk daun. Tanaman Papasan I Papasan II membundar berlekuk licin. tidak berambut 7.11.7 manis membulat 0. berasa manis dengan sedikit variasi bentuk buah. Bentuk 5.3 . Warna buah a) muda b) tua 3. Rasa 3.2. Perbedaan baru terlihat pada ukuran daun.2.6 . memiliki rasa buah pahit dan variasi bentuk buah yang banyak. Viabilitas 4. Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4. Tabel 2.1 .0. Ukuran biji (cm) a) panjang b) lebar 3. sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar. Bentuk biji 2. Buah 1.5.4 8 . Ukuran daun (cm) a) panjang daun b) lebar daun 2.5 . Daun 1.

Agarwal & Roy 1984.15. Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24. Pada Papasan I prometafase banyak ditemukan antara jam 09. Berdasarkan nilai IS (Tabel 3). chepalandra. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2. 8.10-12. dengan frekuensi terbanyak pada jam 11. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris. Perbedaan karakter terlihat pada daun mahkota. memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil.30 WIB. C.20.30 WIB sedangkan sel Papasan II aktif membelah antara jam 08. Sel Papasan I aktif membelah antara jam 08. sedangkan prometafase Papasan II banyak ditemukan pada jam 09. 7. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. 3. sedangkan kromosom kelamin berbentuk metasentris.Identifikasi Papasan (Coccinia grandis (L. 12. Disamping itu.00-14. sedangkan daun mahkota Papasan II menggulung keluar (recurved). Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C.20 dan 14.00-11. hirtella dan C.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2). 9. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955.30-09. Secara umum.15 WIB.00-14. Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2. dan 11. Guha et al.15 WIB. Namun. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom. biji Papasan berbentuk oval dan mampat.50-09. biji Papasan I memiliki bentuk membulat. indica yaitu 2n=24.30 dan 14. 2004) sehingga. 6. 11. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3. Sedangkan. sedangkan biji tanaman Papasan II berbentuk oval. 5.00-11. sedangkan yang berbentuk metasentris ada pada autosom nomor 1. 10.30 WIB.00-12. 4. sedangkan biji Papasan II sangat mudah berkecambah. diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek. 11. dari 24 kromosom Papasan.30 WIB. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2). Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 . Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II. biji Papasan I tidak dapat berkecambah.50-10.00-11. Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II. Papasan I lurus.

Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II. autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. Karyogram kromosom Papasan II. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p). Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram. 10. 7. Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. 3.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). Karyogram kromosom Papasan I. 136 . 6. Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. 8. 9. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. 4. 2. sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. dan 11. panjang lengan panjang (q) dan panjang absolut kromosom (p+q).

82±0.29±0.230 1.96±0.76±0.108 1.70±0.72±0.091 0.075 0.249 1.89±0.254 1.135 0.71775 47.16±0.139 0.22531 45.69±0.82±0.73±0.255 1.94±0.106 1.27804 36.77±0.34532 43.267 0.15998 45.64±0.84±0.00024 47.109 0.097 0.69±0.02±0.083 0.28729 47.73±0.112 0.162 1.44±0.7189 46.268 2.80±0.155 0.5394 45.59±0.081 0.063 0.62±0.48±0.) Voigt) di Tiga Populasi Tabel 3.062 0.79±0.102 0.22 1.86±0.121 0.60±0.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.96±0.86±0.242 1.189 2.46603 46.252 1.77302 43.91±0.87±0.109 0.103 0.73±0. 137 .071 0.085 0.073 0.94±0.112 0.128 0.70±0.105 1.113 1.33331 47.53865 45.114 0.069 0.58±0.86±0.230 1.67±0.122 1.083 0.061 0.146 1.55±0. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.80±0.089 1.50±0.133 0.090 0.092 1.218 1.078 2. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman.077 0.61615 44.Identifikasi Papasan (Coccinia grandis (L. Tanaman No.085 0.72844 46.99±0.13±0.74±0.107 0.54±0.63128 46.86±0.26413 46.06±0. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.083 0.66±0.23 1.25±0.129 1.37865 47.58±0.079 0.095 0.073 0. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.120 1. baik autosom maupun kromosom kelamin.42±0.102 0.116 1.89±0.83784 45.06673 46.73±0.53±0.78±0.03±0.099 0.86±0.072 0.51±0.70±0.129 1.29±0.13±0.33±0.074 1.211 1.075 0.74±0.66±0.76±0.67±0.130 0.182 0.067 0.17±0.70±0.069 0.34739 44.48±0.62±0.148 Indeks Sentromer (IS) 35.26497 46.77649 47.56±0.78±0.75±0.42±0.

25 35.86 0.33 1.16-2.50-0.5394-47. 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.13 36. diduga Papasan I dan II masih tergolong dalam satu spesies. variasi ukuran kromosom juga semakin tinggi. Perbandingan karakter kromosom Papasan I dan II.01 Papasan II 2n=24=20m+2sm+XX(m) 0. Semakin besar nilai R. Berdasarkan hasil uji statistik pada aras 5% (Tabel 5). Nilai R menunjukkan variasi ukuran kromosom.59-1. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata. Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer.51-0. Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman. Perbandingan idiogram kromosom Papasan I dan II.06-2.Rindyastuti &Daryono Tabel 4. Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- .00 Papasan I Papasan II Gambar 3.34739 2.87 0. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0.44 1.77649 2.56-1.345-47.

Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar. PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda.Identifikasi Papasan (Coccinia grandis (L. NS = Non-signifikan. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II. Nilai R antara Papasan I dan II berbeda. Untuk membandingkan nilai R Papasan I dan II. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4). Berdasarkan Gambar 4.25. Berdasarkan Tabel 5. X = Pasangan kromosom kelamin betina 139 . selisih nilai R antara Papasan I dan II lebih kecil dari 0. Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim.25.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0. nilai R kedua Papasan tergolong kecil. cuaca atau kesuburan tanah. karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda.) Voigt) di Tiga Populasi batannya. artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah. Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0. Namun. Tabel 5. Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R.

5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1. Tabel 5. 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0.115 0. Oleh sebab itu. Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya. Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.565 Melon PI 371795 0.5 Nilai R Nilai R 1 0. No. Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.Rindyastuti &Daryono Perbandingan Nilai R 2.125 0. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas.45 American muskmelon - Menurut Tamarin (1999). bahkan antara tipe sel satu dengan tipe sel yang lain.5 2 1. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling .01 0. 3 = Melon PI 371795. 4 = American muskmelon Gambar 4. Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman. 2 = Papasan II.575 Papasan II 0. perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan. antara organ yang satu dengan yang lain dalam satu spesies.

gracillis berdasarkan selisih nilai R lebih dari 0. Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan. Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. ukuran. KESIMPULAN Berdasarkan perbandingan karakter fenotip. & Plant Breeding 44(1): 117-120. S. dalam Ferruci (2000) memisahkan Serjania communis dengan S.. Purnomo. yaitu karakter morfologi daun. Raka Swastika. Sc. Meastika Dianeta. yunnanensis dengan rasio 2. PK.Gen. jumlah. S.71 memiliki kedudukan taksonomi yang sama dengan A. M. DAFTAR PUSTAKA Agarwal. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. mengindikasikan bahwa berdasarkan karakter kromosom. Roy. maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L. Dr. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4). mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. Qi-Xing et al. Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi.) Voigt. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0. 141 .25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. grandis L. atas bantuan konsultasinya. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel. Tuty Arisuryanti.59. Senada dengan hal tersebut. khususnya atas konsultasi di bidang taksonomi tumbuhan.Si. Herlianti Anissa.25. Disamping itu. atas bantuannya secara teknis. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas.25. Namun melon tidak tergolong dalam genus Coccinia. perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. serta karakter genotip yang meliputi waktu mitosis. AAG. Indian J. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II. buah. bentuk.. & RP. Si. Nogueira et al. S. 2000).Identifikasi Papasan (Coccinia grandis (L. M. tetapi Cucumis. Qi-Xing et al. dan Drs.25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C.) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain. 1984. bunga dan biji. Karyotype of Coccinia indica.

Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit. Subramaniam. Singh. Plant Systematics. JM. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia. Jahier. Evolutionary Genetics. & AE. George Allens and UNWIN LTD. Darlington. & RC. USA. Bakhuizen van den Brink. Science Publisher. Techniques of Plant Cytogenetics. e d u / P re b u i l t / BiolJBR3_www. 1998. Sixth edition. 1965. K. K & B. stage. Y. 1996. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana.co. 1955.jp/ article/cytologia/70/1/70_53/article. www. h a r t w i c k .pdf/10Pemanfaatan TumbuhanObatDiare109. 37 (4) : 380-383. Delourne & AM. Ramachandran. www. Inc. Coccinia indica. Jstage. 1-77. Gadjah Mada University Press. Niedzielski. Sinha. R. Eber. 38 (6) : 525532. 1996. New York. Russel. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. Plant Systematics. RK. Qi-Xing. Chromosome Atlas of Flowering Plants.unud. Walter Noordh off N. Smith. H. serta Isolasi dan Identifikasi Senyawanya”. McGraw Hill-Book. Z. 2002. Yogyakarta. Comp. New York. 1998. RH. 1983. Yogyakarta. Wylie. Jones. Sinha & S.jst.ac. ZhongShu. Luchsinger. 217-222. 2003. Cheure. McGraw HillBook Company. Zhi-Jiang & Y. USA. California. Inc. CA. Morfologi Tumbuhan. Genetics. The Benjamin/Cummings Publishing Company.id/ind/ detailPenelitian. F.html?id=4138. The Netherlands.go.) PI 371795. Guha. MW. 3-5. G. Inc. 1. Cytological. 2004. Oxford University Press. Tjitrosoepomo. 51-57. Science Publisher. Econ. CD.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. Flora of Java Vol.go.lemlit.jst. Bot. Diakses tanggal 5 November 2007. Scarlet Gourd. Little-knownTropical Drug Plant. Memasukkan Agustus 2009 Diterima: September 2009 142 .kalbe. 2000..jp/article/ cytologia/70/1/70_53/article. Karyomorphology and Relationships of Amentotaxus Pilg. Sin. Inc. 2006. Sundari. MS. Fakultas Biologi UGM. 2000. Ferruci.http:// www. & AP. Karakterisasi Kromosom Melon (Cucumis melo L.. hartwick.Rindyastuti &Daryono Backer.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id. A.V Groningen. 2007. 1999.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. 98-101. Act Phytotaxo. 234-325. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae. Ciawi. PJ. 305. Principles of Genetics. & D. Winarno. London. JM.html. Winarsih. Tangui. 1979. Coccinia grandis. Tamarin. SB. http://www. w w. 176182. 1999. G. Fifth edition.

Jl. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi. maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan.. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu.bacteria Kata kunci: Phenantren. distribusi. Cycloclasticus pugetti. dietil.. metilpropil). Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. but the synthesis was inversely correlated with the cell growth. degradation . maka.8 with a doubling time of 14. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH. yang 143 .Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) . Polyhydroxybutirate (PHB) was produced during culture growth. yang tersusun dari gabungan tiga cincin benzena. 1984) yang sangat berbahaya bagi kesehatan manusia.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI. Keywords: Phenanthrene. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. yang merupakan salah satu senyawa karsenogenik (Cerniglia. Pseudomonas spp. biostimulasi dan bioaugmentasi. pH 7. produksi. Salah satunya adalah phenanthrene. The relation between PHB synthesis and phenantrene degradation is due required further investigation. antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan.0476/hour. This isolate grew optimum at 300C. Alcanivorax Borkumensis M5 was isolated from sea water. About 75 % of phenantrene was degraded after 12 hours. Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil. 1992. and able to degrade phenantrene after 5 hours. degradasi. Menurut Brodkorb et al. Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya.5 hours and specific growth rate of 0. Phenantrene is one of the most persistent organic substances in environment.

11. termasuk pestisida. dan 2. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC). 2006 ). Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%).6 mg NaF. NaF.27 gr NH4Cl. 2001.0 mg FeCl2·4H2O. . CaCl2. 27 mg H 3 BO 3 .6 dengan NaOH). Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit.3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}.72 gr KCl. Uyttebroek et al. oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya. Letak astronomisnya adalah 106. Larutan pertama mengandung NaCl. 0. 144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi. salinitas temperatur dan status nutrisi. H 3BO 3 . NaHCO 4 .98 gr Na2SO 4. 2. Untuk memadatkan media.60 BT dan 5. PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. larutan kedua mengandung MgCl2. KCl. Lo´pez et al.0 gr/L) ditambahkan pada larutan pertama. 1. BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta. Na2SO 4. Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. 24 mg SrCl2·6H2O. Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7. 3. NH 4 Cl. 83 mg NaBr. dan larutan ketiga mengandung FeCl2. Noble Agar (Difco) (15. Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. NaBr. Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH. karena memiliki metabolisma yang berbeda dengan mikroba teresterial. 2002).79 gr NaCl. 1. Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan.18 gr MgCl2·6H2O. Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. 0. 89 mg Na2HPO4·7H2O. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al.46 gr CaCl2·2H2O.850 LS. Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22. 31 mg NaHCO 3 . dan SrCl2 (divalent cation salts).

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

3344 Y= 0.17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7.0437 pH 5.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.0143 0.6 1.9704 0.94 Y= 0.3958 Y=0.0266x + 0.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.4 OD 600 nm 1 0.4 OD 600 nm 1. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 . Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.0369 x +0.17 30 C 40 0C Salinitas 3.9685 R2 = 0.3% Salinitas 5% 0 Td (jam) 15.9977 2 0.7 0.0143x + 0.79 48.3% Salin 5% 1.9701 R = 0.018 0.33 14.8 pH 5.17 Gambar 2.9459 R 2 = 0.302 Y=0.2 0.5 0.4 0.3887 Y= 0.018 x +0.0476 0.0476 x + 0.8869 R2 = 0.6 1.5 25.8 Y= 0.8 dan pH 5.8 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.3 0.Dyah Supriyati Tabel 2.6 0.6 0.4 0.9 0.25 18.6 0.4 0.0369 0.8 0.501 R2 = 0.0266 1.0437 x + 0.2 1 0.7 38.2273 R2 = 0.2 1 0.8 0.

5 1 0.bakteri mempunyai waktu generasi 18.3% Salin 5% pH 5. laju pertumbuhan.3% Salin 5% pH 5.8 bakteri M5 mempunyai td 15.17 Media Media Gambar 3. dengan td 14.17 PHB mg/g sel 2 0. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur.79 jam Nilai waktu generasi M5 ini lebih cepat.15 0.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%.3 % lebih baik dibandingkan dengan 5. pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3. Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini.5 jam..17 (45.3%. Hal ini menunjukkan bahwa.7 jam. Sedangkan.5 0 Salin3.3 %. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat.17). Pada media dengan pH 7. Dilihat dari 3 parameter di atas (waktu generasi. seperti misalnya di perairan laut Indonesia.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5.25 0.5 Berat sel (gr/l) 1. Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3. bakteri ini bisa dikategorikan sebagai bakteri laut tropis. salinitas maupun pH yang serupa dengan asalnya.5 jam berarti bakteri mempunyai waktu generasi 14. Nilai waktu generasi M5 ini lebih cepat.2 0. Dengan td 18.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC. dan produksi sel). 2.1 0. Artinya setiap 14.35 0.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5.05 0 Salin3. Pada media dengan salinitas 3.3 0.7 jam .5 jam di salinitas 3. pertumbuhan bakteri M5 mulai lemah. bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5. Di salinitas 5%.3 %.4 0.

DAFTAR PUSTAKA Anderson. Microbiol. & E A. 150 . Media seawater ini dipilih karena menurut Springael. 1990) pada proses anaerobik-aerobik. Occurrence. 58:3117–3121. &R L.Pada media dimana pertumbuhan bakteri M5 terlihat terhambat. Appl. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. Microbial degradation of polycyclic aromatic hydrocarbons.3 % . dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0. sel jusru membentuk PHB lebih banyak. Environ. Rev. Microbiol.J. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. and industrial uses of bacterial polyhydroxyalkanoates.atas bantuan yang diberikan hingga selesainya tulisan ini. Brodkorb. 1984. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L. Dawes. Appl. 1992.Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini. suhu 30oC dan pH mendekati netral (7.8) Kemungkinan isolat M5 mampu membentuk PHB. Cerniglia. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. TS. metabolism. yang berperan pada proses degradasi phenantrene. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%. metabolic role. tumbuh optimum pada salinitas 3. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene. pada media air laut mengandung phenantrene. 1990. Pada media yang relatif optimum untuk pertumbuhannya. Dengan tumbuhnya bakteri M5 tersebut. bakteri M5 justru sel membentuk PHB paling sedikit. CE. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene.Adv.. 30:31–71. 54:450–472. A. perlu diteliti lebih lanjut. KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. Made Sudiana. Legge.1%). Microbiol.

Microbiol. strain AP1. Biotechnol. Z.. Bendixen. Lo´pez. P. U. Biotechnol. MP. Uyttebroek. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil. J. 68:2683–2689. Bastiaens. Appl. 1999. Biotechnol. Environ. Ortega-Calvo. Karlson. H. Breugelmans. 2006. Joffe. S. B. Y. 70:747–756. Microbiol.. 1:63–70 Johnsen. J. & U. M. C.&U. Breure & WH. Rulkens. Appl. Springael. AR. M. 8:836–847. Johnsen. L. 2002. ARK. Mol. H. Wattiau. A. Janssen. Memasukkan: Agustus 2009 Diterima: September 2009 151 . Kasai & K. Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. Shutsubo. 2004. Chemosphere 43:1085– 1094. AM. Karlson. Vila. Karlson. 63:452–459. Kishira.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama. Appl. Ryngaert. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). Grifoll. Metabolism of fluoranthene by Mycobacterium sp. Mulder. Hausner. 2006. D. Microbiol. JJ. Minguillo´n & M. Petroleum biodegradation in marine environments. Microbiol. Microbiol. Environ. 2001.

Bucke. Cambridge. Prosiding : Mubarik. Kata dalam bahasa asing dicetak miring. 1990. & MT. & N. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris). & C. Murray. Buku : Chaplin. Jakarta .A. Setiap halaman diberi nomor halaman secara berurutan. 151-158.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point. 42. D. Identification of plasmids linked with polyglutamate production in B. Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim. dan bawah masingmasing 2. P. Zhang. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris.. subtilis. dan tabel disertai CD. HASIL. A. Ueda. β. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. Methods for General and Molecular Bacteriology. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar.. Suhartono. Wood. http//www. . Krieg (eds. H. Pola Pertanian. Bab dalam Buku : Gerhart. Informasi dari Internet : Schulze. Drew. R. Suwanto. foto. Microbiol. 1983. Skripsi.G. Washington.E.1. NR. W.J. Abstrak : Suryajaya. kanan.. 15-16 Februari 2000. J. ASM. KATA KUNCI (maksimal 6 kata). Bogor : Institut Pertanian Bogor. 1999. 248-277. Batas dari tepi kiri 3 cm. 1987. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. 15 –18 Oktober 1982. Biol. & S. χ.species. Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali. Cambridge University Press. Abstrak Pertemuan Ilmiah Mikrobiologi.[Disertasi]. JR. tanpa mengubah jenis huruf. Vol 6. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). Detection and Identification of Lories and Pottos in The Wild. Perkembangan tanaman polong-polongan utama di Indonesia. dan lain-lain dimasukkan melalui fasilitas insert. Dalam : Gerhart. 29: 345-354. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. PEMBAHASAN. Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). Apll. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. & SW. 2000. Tesis. Information for surveys/Estimated of population density. Penulisan simbol α. 1982. PENDAHULUAN. Disertasi : Kemala.). S. BAHAN DAN CARA KERJA. 1994.. maksimal 250 kata). No. atas. Enzyme Technology. P. Jakarta.html. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA. Indon.net/primates/loris/ lorCp. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah. ABSTRAK (bahasa Inggris.R. Gen. NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). Liquid culture. T. MF.

Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 . Puslit Biologi-LIPI Ir. Puslit Biologi-LIPI Ir. No. Indon. Heryanto MSc. No 1.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6. Majariana Krisanti MSi. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr.J. Biol. Hari Sutrisno. Desember 2009: Dr. Niken Tunjung Murti Pratiwi. Rugayah. Vol 6.

No. Vol 6. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. Indon.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 . Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.J. Agustina K. Biol. Habib Rizjaani. Ostrinia furnacalis Guenee Bahagiawati. Kartono Identifikasi Papasan (Coccinia grandis (L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P.

Sign up to vote on this title
UsefulNot useful