J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

NPK. sativa and C.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. Hg. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. The treatments were fertilizer: no fertilizer (as a control). manure and compost. Kemungkinan 1 . vaginalis. nudiflora were selected for fitoremediation of Hg contaminated soil. Oryza sativa. M. Monocharia vaginalis. this research suggested that S. P. nudiflora. The fertilizer treatments were significantly affected plant growth. F. molesta showed the highest biomass followed by M. vaginalis. The S. Hidayati 1). biomass. Bogor Titi Juhaeti 1). Meanwhile S. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. molesta also showed the highest capasity to accumulate Hg/year followed by C. conjugatum. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. Cibinong Science Centre. O.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. Desa Bantar Karet. conjugatum dan M. Desa Bantar Karet. Keywords: Accumulator plant. Hg. Based on characteristic of hyperaccumulator plant. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. N. O. sativa dan C. Kabupaten Bogor. nudiflora. biomas. vaginalis. ke sawah ataupun ke kolam ikan. The result showed that the growth of each plant was significantly different. Kecamatan Nanggung. Syarif 1) & S. The aim of this research is to study the potency of Salvinia molesta. Cyperus monocephala. Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. molesta. Limnoharis flava. accumulation capacity Katakunci: Tumbuhan akumulator. P. Kecamatan Nanggung. Desa Bantar Karet. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). Kabupaten Bogor. Bogor E-mail : tihaeti@yahoo. Cibinong. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. Centrosema pubescens. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. Paspalum conjugatum. Kecamatan Nanggung.

Juhaeti. Kayser etal. penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan. dikenal dengan nama sentro. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. dan kubis. rumputrumputan dan tumbuhan air. merupakan tumbuhan terna memanjat. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. kacang-kacangan. 2007. Hidayati. di hutan sekunder. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Commelina nudiflora. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. Terry and Banuelos. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. 2001. oat. termasuk pohon. di kebun. 2000.. mata lele). Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. 2 2001. Chen et al. 2004 Dalam Rodriguez et al. Pivetz. di tepi jalan.. Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . di daerah Sunda disebut jukut pendul bodas. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung. Centrosema pubescens Benth. gandum. Monochoria vaginalis. Cyperus monocephala. Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya. barley. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. Indian mustard. Mikania cordata. di tempat yang agak basah seperti di pinggir sungai juga di sawah. Cyperus monocephala dikenal sebagai teki badot. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis. Salvinia molesta. 2000. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum. Salvinia molesta (kiambang. Centrosema pubescens.

BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri.S. Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Sementara itu. Nanggung. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor. Ni. Penelitian dilakukan pada bulan Maret-Oktober 2007. 3 . Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Bogor.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. Kecamatan Nanggung. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. Desa Bantar Karet. Kab. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman. Salvinia molesta D. dan Cd pada tanaman. Penelitian in-situ dilakukan di Kampung Leuwibolang. Desa Bantar Karet Kec. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan. Dalam prakteknya. Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi.

dan 5. Setelah itu. Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama. Commelina nudiflora L. Paspalum conjugatum Berg (jukut pahit). Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut.Juhaeti. Centrosema pubescens (sentro). sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat.) B.Robins. Untuk tanaman air. NPK 16 g/petak. tajuk dan total tanaman. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. sedangkan untuk tanaman darat. sativa. Oryza sativa (padi). Limnoharis flava (L. 3. M. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0. Sedangkan perlakuan pemupukannya adalah: 1. Hidayati. 2. 2. conjugatum. 3. L. Pada saat panen. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen. seluruh biomassa tanaman berupa akar dan tajuk diambil. 4. 3. Kontrol. Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1.) Presl (eceng leutik). Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian. Monocharia vaginalis (Burm. molesta. P. petak penelitian dijaga supaya selalu tergenang. Pupuk kandang 5 kg/petak dan 4. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1.8 X 2 meter dengan 3 ulangan. Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman. Pengairan menggunakan air yang tidak terkontaminasi merkuri.(tali korang). Mikania cordata (Burm. HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S. O. Pada tahap ini jenis tanaman yang diuji dikurangi yakni C. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. 4.f. 2. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas).f. pubescens dan M. flava.5 bulan setelah tanam. konsentrasi Hg (ppm) di akar dan tajuk. . Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. vaginalis. cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan. petak penelitian tidak tergenang. Perlakuan pemupukan diberikan pada saat tanam. C. Syarif & Hidayat Mitchell(kayambang).L.

3 12092 996.21 332.600 c 63. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921.93 b 221.74 106.cordata tidak ditanam kembali (Tabel 1). onocephala C. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi.0 223.93 9. nudiflora Tabel 2.2 1671.71 72.6 b 2620.792 bc 70.6 a 2018.04 153.46 241.74 619.3 2850.2833 1.1 3.2 b 3 1050.6 252.580 Jenis tanaman S. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman. Akan tetapi. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman.138 a 87. dan C.1833 3.3417 0.7273 1464. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.7 2778.16 212.75 95.6917 2.66 a 269.667 34. pubescens M.6167 2.9 Tdk ditanam Tdk ditanam 693. conjugatum C. vaginalis L.22 a 1110.0 1337.23 187. Hal ini dilakukan karena dalam fitoremediasi.2 1779.8333 0.617 102.841 a 37.99 a 287.34 a 184.69 427.0 425. cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3. molesta O.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257. sativa M.1917 0. cordata C.03 a 345.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala.133 56.51 a 2 169.51 47.8 a 2028.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589.88 35. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1. Produksi total biomasa tanaman (gram) tiap periode penanaman.65 345.5 a 1619. Akan tetapi C.867 bc 59.9 1523.233 Tdk ditanam Tdk ditanam 77.64 161.33 187.53 c 751. pubescens dan M .05 144.69 b 152.4 624.6 ab 2329. pubescens dan M.6 659. terlihat dari tingginya produksi biomasa tanaman. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam.0500 3.37 b 3 78.95 66.786 b 5 .5 ab 2 1955.7 b 2257. C. Pengaruh pemupukan terhadap pertumbuhan tanaman.67 a 216. flava P.

T7 = C. kecuali pada M. konsentrasi Hg (ppm) akar tanaman (b). molesta. Syarif & Hidayat tersebut ke bagian tanaman yang dipanen. T9 = C. 6 konsentrasi Hg (ppm) .pubescens. dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a). masing-masing jenis tanaman menunjukkan kemampuan yang berbeda.flava. T 6= C. Monocephala. T8 = M.nudiflora. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab). Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda. T2 = O. Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. Hidayati. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c).vaginalis.conjugatum. Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman.cordata.Juhaeti. T4 = L. T3 = M. T5 = P. Sativa.

nudiflora. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg). dan C. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman. perlu diperhatikan beberapa kriteria.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2. sativa. flava. marginal. T6 = C. sedangkan C. Salvinia molesta. Sativa. cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. pubescens dan M.pubescens. M. L. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S. monocephala. Diharapkan. vaginalis.conjugatum. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. Monocephala. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. T5 = P. T3 = M. T8 = M. T4 = L. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. T2 = O. T7 = C.cordata. O. (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al. C. P.flava. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk. molesta.vaginalis. conjugatum. T9 = C. Pada penelitian ini.

yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu.flava. sativa. pubescens. Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk. M. Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran. yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air). C.cordata dan C. (2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal. P. hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik. C.Juhaeti. Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. Syarif & Hidayat yang tinggi (Reeves 1992). potensi produksi biomasa tananaman yang diuji pun cukup tinggi. molesta. M. . terbukti dengan adanya konsentrasi logam yang tinggi pada akar. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O.vaginalis. S. Kemudian. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik. Hidayati. Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu.conjugatum. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. monocephala. L. Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman.nudiflora. Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu.

conjugatum. T3 = M. P. M. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman. T9 = C. molesta. nudiflora. nudiflora. conjugatum. C. M. vaginalis. conjugatum dan M. molesta. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. conjugatum. Gambar 3. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. molesta. Tanamantanaman tersebut adalah S. T4 = L. T7 = C. T6 = C. umur panen.pubescens.conjugatum.nudiflora.cordata. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat. vaginalis. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata. sativa. jarak tanam. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S. O. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. O. O. P. Sativa. sativa. T5 = P. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman. molesta.flava. sativa dan C. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . P. Monocephala.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan. C. T8 = M. T2 = O. O. vaginalis. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S. Vaginalis. nudiflora dan P. sativa. nudiflora. M.vaginalis. C. molesta.

cordata C. conjatum 107. cordata C.33 10513. sativa 141.062 L.581 24. nudiflora L. vaginalis L.643 5. monoephala C. conjgam 67. nudiflora 114. pubescens S. nudiflora 107.214 S.471 33.9 8046.099 9.31 L. molesta M. conjgtum 55. pubscens M. sativa M.13 1 O.529 P.605 Kompos S. flava C.912 P. mocephal 32.627 P. Syarif & Hidayat Tabel 3. nudiflora 63.316 C.369 C. conjugatum C.6 O.70 6 O. molesta 40. molesta C. vaginalis L.803 L. vaginalis 42. conjugatum C. flava P. molesta 190. molesta O.55 4 10 .9 C. pubscens M.9 6936. pubescens M.498 M. moncephala M.712 12.931 C. cordata C.43 4598.502 S. cordata C.849 41. molesta 13303. sativa 85. conjugatum 4542. vaginalis L. monoephala 2476. cordata C. sativa C.6 5077. cordata C. cordata C.conjgtum 40.241 Kandang C. flava 13. sativa L.558 19.5 M. molesta O. molesta 63.6 3894.171 C. cordata C.9 6488.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O.Juhaeti. flava 4. vaginalis P. flava P.298 M.conjgtum C. sativa 4755. conjgtum 11. nudiflora 16.03 3949. cordata C. vaginalis C.278 C. vaginalis L. monoephala M.401 7. monephala M.13 1164. flava P.456 16. cordata 859.3 O.263 32.869. cordata C.183 M.4 P.5 M.7 4742.14 8.3 10.197 C. pubescens S.8 C. sativa M. pubescens M.848 12. sativa 6098. nudiflora P. vaginalis 8. nudiflora 18.9 P. molesta M. molesta 111. pubscens S.435 S. vaginalis 7682. nudiflora 57.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S.568 L. monoephala L.625 O. monoephala 10.34 Jenis tanaman Kontrol NPK O. flava 24.765 L.758 C. sativa P. molesta 10897.5 1895.049.2 M. flava O.104 31.455 O. pubescens 3216 5259. nudiflora 4504. pubescens M.937 9.155 C.907 12. flava 18.05 M.97 C.516 16.37 C.095 19. nudiflora O. pubescens 12558. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46.04 5 S.mocephal 35. Hidayati.999 3. flava M.253 M. nudiflora 6331. sativa M. conjugatum 5625.55 C. nudiflora S.946 11. vaginalis 28. conjugatum C. vaginalis 68.conjugtum S. sativa 55. vaginalis 33. puescens M. moncephala C.87 5030. monephal 42. sativa 159. flava 44. flava M. molesta 55.3 2105.11 2 C.1 1721.03 31.7 1254. monephla 36. pubescens S.2 4644. cordata C.604 18.357 P.

I. J. 1995. 1992. Rincon.. 2006. Nutr 14 : 1067-1080. T. FN. Hidayat. Rodriguez. Harapini. Robinson. Laporan Akhir Penelitian Kompetitif LIPI. Environ. The Hyperaccumulation of Nickel by Serpentine Plants. Reeves (ed). N. T. Angle & AJM. Syarif. SL. RB. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation. Di dalam: Backer. Baker.. Stewart & BH. Gabbrielli. L. Vergnano. 2007. AJM. Syarif & M. J..Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). Phytoremediation 9(1): 1-13. Moreno. Chaney. DAFTAR PUSTAKA Brown. Hlm 253-227.Plant. & O. Bogor. Reeves. J. Asencio. JS. S. International JSPS Seminar. 2007. Proctor.. 1991. Int. Mattioni. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution. Memasukkan: November 2008 Diterima: Juli 2009 11 . 12-20 Oktober 2006. F. The Vegetation of Ultramafic (Serpentine) Soils. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator. Soil Sci Soc Am J 59:125-133. Hampshire: Intercept Ltd. 2004. Juhaeti.. N. Hidayati.. Practices 6(2): 165-175. Juhaeti & F. CWN. & CL. Rodriguez.. Anderson. C. RL. R. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives. J. Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation. RD. Hidayati. RD.

Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a. Idiosepiidae. habitat.email: rist001@lipi. of Life Science. Research Center for Biology – LIPI.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. I.go. biserialis dan I. distribution. reproduksi dan siklus hidupnya. ovally elongated with the long axis parallel to the body axis (Figure 1). Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I. biserialis dan I. Dalam tulisan ini diuraikan karakter morfologi. Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. One conspicuous morphological character of this genus is the adhesive 13 . Austria 2 Museum Zoology Bogor. siklus hidup dan distribusi Idiosepius. 1090 Vienna. pygmaeus herbereri. pygmaeus. Hylleberg & Nateewathana 1991b). Keywords: Cephalopoda. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. Idiosepiidae. Banda. picteti. Indo-Pacific Kata kunci: Cephalopoda. habitat dan distribusi empat jenis sotong mini jenis I. picteti hingga saat ini hanya dijumpai di Ambon. Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. Cibinong 16911 – Indonesia. Karena ukurannya yang sangat kecil. The females reach maturity at 3 cm length. The arms are short and robust and almost equal in length. I. Jackson 1988. Cell Imaging and Ultrastructure Research. the fins are small. habitat.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. Ternate. Norman 2000). Balikpapan. except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). pygmaeus khusus dari perairan pantai di Lombok. jenis sotong ini tidak diminati oleh para nelayan. habitat. Nabhitabhata 1998. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. The animals are dorso-ventrally compressed and cigar-shaped. Sibolga dan Lombok. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik. Fac. Marwoto 2 University of Vienna. distribusi.

pygmaeus Steenstrup. collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I.Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. It can be assumed that this species has disappeared or even become extinct. in females. Furthermore. Grimpe (1931) compared the collected material with samples of I. contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). This species was thought to occur only in the Philippines. Idiosepius pygmaeus hebereri was . In 1898. Collection of Idiosepius in Indonesian waters has long history. more than 115 years ago. Indonesia. 1881 in Ternate 14 and Banda-Sea. The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). Unfortunately. 2008). pygmaeus and the other species mostly in size. Cyran et al. Lombok. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). Examinations by Nesis (1982). In 1927. however. Hiding there. revealed that the morphological characteristics were insufficiently different to justify the subspecies. picteti at Ambon Island. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay. Later. they also lie in wait to capture prey swimming by. Appellöf discovered I. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. pygmaeus from several institutions and proposed that his specimens differ from I. Joubin (1894a) collected one male holotype sample of I. organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. up to this day. 2008. He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. pygmaeus has a wide distribution in Indonesia.

was recently discovered in Indonesian waters (von Byern et al. 32° 54. 2005) . we report new collection places for Idiosepius in Indonesia and extend the previous type localities.166´E) (Kalk. geographical distribution and origin of migration remain. Nevertheless. 32° 54. Austria) and MZB (Museum Zoologicum Bogoriense). Ekas-Bay. pygmaeus. The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections). Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong.December 2007 using a dipnet. picteti and I. it was thought to occur only in African waters (Mozambique) and Thailand. 98° 25. von Byern & Klepal 2009) Japan: Takasu. METHODS Idiosepius specimens were collected along the bay of Lombok in November . 2005).020´S. Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus. Lombok (08° 52. von Byern & Klepal 2009). pygmaeus below).331´S. Collector: S. Inhambane Bay (23° 51. RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss.553´E) (von Byern & Klepal 2009).541´E) (von Byern et al. Cape Town.300´S. Monque (23° 41. Japan. The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. individuals of I. a further species.Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I. many questions about their life cycle. Indonesia. 26° 02.487´ E) (von Byern & Klepal 2009) and Ko Pratong. Research Center for Biology – LIPI. Phuket Island (8° 02. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. I.721´E.215´S. In contrast to I. pygmaeus. 35° 22. South Africa (SAM A6520) Type locality: Mozambique. Lombok (08° 15 . So far. Previously. 116° 27. San Jose Mission Station. Shigeno (von Byern et al.281´E) (Voss 1962. 1962 (Figure 2A) Holotype: deposited at South African Museum. picteti. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00.184´S. Apart from I. 2005) Indonesia: Ekas-Bay.156´N. less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia). This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals. 35° 22. With the present description and geographical data. Adam 1986. 1959. biserialis.

Byern & Marwoto 50.857‘ E) (08° 50.5 ± 0. B) I. slender. 16 . 1962). Both ventral arms in the male are hectocotylized.54 mm males and 7.84 ± 0.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I. with a mantle length of 4.7 ± 1. biserialis (Voss. collected November 2007 (unpubl.3 mm (males) and 7. bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm. which are nearly constant in size to the end of the club. 116° 26.31 mm (females). picteti (Joubin. the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. 714‘S . 1982).38 ± 1. at the tip.2 mm C 7. In the caught male. Animals from Mozambique are small. pygmaeus (Nesis. 116° 27. The clubs of this species bear two rows of small suckers. The specimens from Thailand are larger (ML to 5. The left arm also has two small flaps. data) Morphological characteristics: This species has the smallest specimens of the genus. separated by a deep cleft. 357‘S . The fins are more rounded kidney-shaped and A B 14.1 mm females). The fins are semicircular and about ¼ of the mantle length. 1894a) and C) dorsal and ventral view of I.781‘ E) .35 mm 15.

The body is large and elongate (mantle length 14 mm). Zamboanga (4° 20´N.89 mm males and 9. while the two investigated females have a mantle length of 5. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”.1 mm females) with 3 suckers on the left and 5 on the right ventral arm.39 ± 1. The oral face the arm is transversely plicate. longer and bilobate at the tip. Our examinations of this specimen reveal that Joubin (1894a) erred. Idiosepius picteti has a small tentacle club with four rows of suckers. 98° 25. Copenhagen. 1881 (Figure 2C). Denmark (ZMUC CEP52) Type locality: Philippines.472´E) (von Byern a & Klepal 2009). sometimes also three or four oblique rows of suckers. Joubin 1894b. Synonymy: Idiosepion pygmaeum Fischer. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle. The right ventral arm in the male is very short and broad.107´N. Each ventral arm has a single small sucker near the base. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available.030´E) (Suwanmala 17 . The animals from Japan are almost twice as long (6.34 ± 0. Idiosepius picteti Joubin. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle.35 mm. 98° 24. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male. Idiosepius pygmaeus Steenstrup. 1886. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48. Klong Bang Rong (8° 02. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe.25 ± 0. 1887 Idiosepius pygmaeus Hoyle. Amboina – according to Joubin.945´N. Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius. Genève. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe. Zoologisk Museum. 1931 Holotype: deposited at Kobenhavns Universitet. The left ventral arm is more slender. 1920 Naefidium picteti Grimpe. The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm. The tentacle clubs have two horizontal rows of suckers. no additional specimens of this species have ever been found.

709‘ E). 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville.Byern & Marwoto et al. data) • Rinca Island (08° 39. data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11. 116° 27. 116° 42. North Queensland (19° 15´S. Lombok (08° 52.244‘ S. Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). collected December 2007 (unpubl. The specimens bear 4 rows of suckers at the club of the tentacle. Institut für Systematische Zoologie. both ventral arms have only one sucker at their base.885‘ S. Jackson & Choat 1992.937‘ E). The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). Balikpappan (Grimpe 1931). The fins are small. Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus.52 mm in males and 16. According to the description of Steenstrup (1881).730‘ S. Pecl & Moltschaniwskyj 1997. Germany (ZMB) Type locality: Indonesia. data) • Telong Elong (08° 48. data) • Gili Lawang (08° 19. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19. 119° 42.5 ± 2. 116° 43. Ekas-Bay. More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms.51 ± 1.28 mm males and 15. Grimpe (1931) . rounded and slightly constricted at their base. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898).53 ± 1. Jackson 1993. 116° 30. Lewis 1991. Idiosepius pygmaeus from Indonesia is similar in size (11. I. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay. collected November 2007 (unpubl. 1995.012‘ E). one individual has 1/1.637‘ S. Semmens et al. Berlin. 146° 50´E) (Jackson 1988. collected December 2007 (unpubl. short.26 ± 4.37 mm in females.015‘ E). Museum für Naturkunde der Humboldt-Universität. pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe. The 18 right ventral arm is stout and thick. collected December 2007 (unpubl. while the left arm is thinner and slender.12 mm females) to I. another 4/4 suckers on the hectocotyli. Jackson 1992. bilobated at the tip. 1931 Holotype: deposited at the Zoologisches Museum.020´S.

1845). Japan. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. I. and African waters. Presently. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al. 2003). notoides Berry.5 mm. embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983. the males of 8. 1888). spawning. I. The fins are small and have a round to almost oval form. I. biserialis and I. 1921. data). southern Australia including Tasmania. I. while the right arm is more stocky and broad with 2 suckers at the base. For example. The females of this subspecies have a mean mantle length of 14. The species are mostly distributed in the tropical Indo-Pacific. macrocheir Voss. ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. Others like I. paradoxus inhabit sea grass and algae areas. 1881 and I. picteti (Joubin. Within the genus.g. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. Moreover. DISCUSSION Systematics The relationships among species within this genus remain unknown. Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss.5 mm. relatively little is known about the biology and life cycles of Idiosepius. I. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). All observations on this genus concerning behaviour. paradoxus (Ortmann. unpubl. pygmaeus). Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. 2002). Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . I. but individuals were also found in cooler Russian waters (Nesis et al. The left ventral arm is longer and bigger than the right arm. and also has two lobes at its tip. 1962. 2005). I. 1991. 1894a). thailandicus Chotiyaputta et al. pygmaeus Steenstrup. biserialis has the widest geographical distribution. minimus (D‘Orbigny. but this value needs verification. von Byern et al.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri. no data are available about its postembryonic life. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982). At its base the left arm has 3 suckers. I. the geographical distributions of all Idiosepius taxa are still only marginally explored. the onset of sexual maturity or postembryonic behaviour. 1962. Jackson 1992).

Naturelles de Belgique 56: 149-154. Moreover. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. 1881 (Mollusca Cephalopoda Decapoda). We still do not know whether the animals stay there at high tide or move elsewhere. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. I. leaves and other plant material were transported here by the current. J. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. Cephalopods of the genera Sepiolidea. So far. Bull. . garbage. SS. Lalu Japa & Karnan from Mataram University. biserialis in Africa. Biology Department and furthermore to Mr. In contrast. individuals of the former I.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. Appellöf. Lombok Island. and Idiosepius. western and south-western shores of the Island. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. Sepiadarium. Gili Lawang. Telong Elong and Ekas-Bay. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. 1898. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. REFERENCES Adam. the animals were also observed to mate within this flotsam and escape under the waste when threatened. W. During high tide. Interestingly. the garbage in the water apparently does not affect I. Cephalopoden von Ternate. Our thanks go in particular to Mrs. Japan and Thailand. Sci. The Philip. such as those along the eastern part of Lombok Island at Gili Sulat. 1986. A. indicating that this species is specialised for sea grass areas (von Byern et al. 2005. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. 1921. de L´Institut Royal des Sci. von Byern & Klepal 2009). Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. These observations agree well with other collections of I. pygmaeus could only be found in mangrove forests and belts. Moreover. von Byern & Klepal 2009). ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. On some days this flotsam covers almost the whole water surface. pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). but are clearly absent in the northern. 47 (1): 39-55. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. Additional genetic. Berry. 2006.

Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss. 56: 1-9.. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles. Paris. Teuthologische Mitteilungen XIII. Malacology 50 (3): 165-174. Grimpe. Cephalopodes Familie XIII. P. 1962 (Mollusca. with mention of additional morphological characters. Jereb. P. Center Res. Okutani & S. ACV. Savy Paris. 1920. Anzeiger 95 (5/8): 149-174. Phuket Marine Biol. GD &J H. Can. Report on the Scientific Results of the Voyage of H. Zool. Naefidium n. Hylleberg. Idiosepidae. Zoology 16: 1245. The Jap. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. sp. 1887. WE. Cephalopoda). Aquat. 1881 (Cephalopoda: Idiosepiidae).Sci. J. 1992. Fishery Bulletin 91: 260-270. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n. D‘Orbigny. Cephalopods of the world . internal anatomy. 87: 265-272.M. 55: 33-42.g. & A. Bull. 1886. von Byern 2008. Roper 2005. Zool. Über die Cephalopoden der SundaExpedition Rensch. The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus. Phuket Marine Biol. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. 1988. Hylleberg. GD. Jackson. Fish. Report on the Cephalopoda collected by H. Australia.S. Cyran. Challenger during the years 187376. Venus. Anzeiger 51: 208-214. & CFE. and biometrics of the cephalopod Idiosepius biserialis Voss. GD. Jackson. Bull. Nateewathana 1991a. CH. Mollusques vivants et fossiles. Redescription of Idiosepius pygmaeus Steenstrup. J. G. Jackson.M. Fish. The Veliger 35 (4): 396-401. 350-351. Klepal & J. 1962. Morphology..J. Teuthologische Mitteilungen IV. Fischer.Challenger during the Years 1873-76. 1993. Growth in tropical cephalopods: An analysis based on statolith microstructure. J. Center Res. W. Bull. N. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus. G. pro: Loligo picteti Joubin 1894. Chaitiamvong 1991. 49: 218-228. GD. Gide et Cie. North Queensland. A new record for the Andaman Sea. Tome Premier. (Cephalopoda: Idiosepiidae). 1845. & A. Grimpe.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. Choat 1992.S. T. Jackson. Libraire F. Nateewathana 1991b. 1931.An annotated and illustrated catalogue of cephalopod species 21 . Hoyle.

Copyright Agency of the UdSSR for Light and Food Industry Publishing House. London. Idiosepius thailandicus Chotiyaputta.. Mémoires de la Société Zoologique de France 15: 80-145. Food and Agriculture Organization of the United Nations. North Queens-land. Japanische Cephalopoden. Ltd. Moltschaniwskyj & CG. On an adhering habit of a pygmy cuttlefish. Mocambique. African J. 1902. Okutani& Chaitiamvong. N A. Pecl. 2002. Ratnikov. Nesis. Australia. Hamburg.. 1-82. L. Behavior 85: 42-57. Jahrbücher 3: 639670.S. Revue Suisse de Zool. a small tropical cephalopod. 1st. K. Norman. AR. Ortmann. Jahr Verlag. Nesis. Céphalopodes d‘Amboine. 1894b. Phuket Marine Biological Center Special Publication 18 (1): 25-40. J. for English Translation. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. Katugin & AV. V. Revision des Sepiolidae.: 178-180. 1982. Kalk. S. Lewis. No. 1983. Publications. 1894a. 1888) (Cephalopoda) .P. du Musèe d‘Historie Naturelle de Genéve 2: 23-64. Sepiolidae. Royal Soc. Japonenses 10 (21): 209-213. & N A. Inc. Rome. Cephalopods of the World. K. M. Zoo. A. J. 1888. Tintenfischfuehrer. Moynihan. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus. Sasaki. 1987 TFH. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. The zoogeographical composition of the intertidal fauna at Inhaca Island. ON. Joubin. Vol.First record of Idiosepiidae in Russian seas. Sci. Sepiidae. Moscow. M. Sepiadariidae. 22 .Byern & Marwoto known to date.. Revue Suisse de Zool. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. Levitov. GT & N A. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae).Sci. FAO species catalogue for fishery purpose. 2000. Idiosepiidae and Spirulidae).A. Semmens. 1998. L. Idiosepius pygmaeus Steenstrup. Zool. Somatic growth processes: how are they altered in captivity ? Proc. 1: Chambered nautiluses and sepioids (Nautilidae. G. et Ann. Nabhitabhata. 266: 1133-1139. London. Pecl. 1959. Moltschaniwskyj 1997. 3: 459-460. L. Joubin. Moltschaniwskyj 1999. MD. 1921. Alexander 1995. Joubin. J.A. Ruthenica 12 (1): 81-84. 1991. M. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. 1991. 242: 751-764. Annotationes Zool. Distinctive Behaviour of Thai pygmy Squid. 4. Translated from Russian by B.

Klepal. Steenstrup.New records for Idiosepius biserialis (Idiosepiidae. Sepiadarium and Idiosepius two new genera of the family of Sepia.. Venus. SR. Phuket Island. J. Nabhitabhata. J. 1881. 1963. Ann. Cephalopods of the Philippine Islands. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. J. 234: 1-180. Biol. Bull. South African cephalopods.Mar. S. Res. Transaction of the Royal Soc. L. 2007. Biol. & W. J. N. 1962.Selsk. Thailand.Biol. 75: 885897. Shigeno 2005: Distribution pattern of a minimalist . J. K. Observation of Idiosepius pygmaeus (Cephalopoda. Mollusca). 2003. U. Cephalopoda): 38-43. Biotech. Tracey. GL. Associate. & W. Voss. MA. Mar. Malacology 15 (5-8): 94-96. J. 2006. Idiosepii-dae) in Indonesian waters.S..UK.Occurrence of Idiosepius (Mollusca: Cephalopoda) J. Africa 36 (4): 245-272.Skrifter Raekke 6 (Bd. Yamamoto. Rudoll. 83: 1297-1300. 2009. Pecl. Histochemical characterization of the adhesive organ of three Idiosepius spp.. Voss. Bull. Cyran & W. Malacologica (in press). von Byern. 1949. the Japan.Assoc.National Mus.danske Vidensk.Cent. T.Wien 108 B: 137-144. von Byern. Steer & GT. von Byern & J. J. J. Reevaluation of systematic characters of Idiosepius (Cephalopoda. Hist. Klepal 2008. With remarks on the two related forms Sepioloidea d´Orb.. Nürnberger & S. von Byern. Mus. & Histochemistry 83 (1): 29-46. Idiosepiidae) at Klong Bangrong.. Nat. von Byern. Klepal. J. 1): 211-242. GL. Occurrence of Idiosepius pygmaeus (Cephalopoda. and Spirula Lmk. of S. 67: 49-51. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea). Suwanmala. Phuket Mar.UK. Memasukkan:Maret 2009 Diterima: Juli 2009 23 . species.

12%). The results showed that asymtotic length (L infinity) of males. Recruitment occurred every month in the males. 4.95 ± 0. kematian. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria).1 year for males and females combined. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam. also by the thin and fragile shells of the clams.43. These high rates were caused by the extreme life condition.77%).3. total mortality rate (Z) of the males. which indicated a fast growth of the clams in relatively short period. pertumbuhan.88mm and 70.65.88%) and August (15. also males and females combined were 1. dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001). while in the females were in April (16. and 2.5 and 1.58 mm. Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al.56 ± 0. and in the males and females combined were in March (12. Kata kunci: Kerang lumpur tropis. and the size of males was less than females.3 years for the males. which were 2. 2001). Keywords : Mudflat clam. females. (Anodontia edentula) in Mangrove Ecosystem.Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan.61 ± 0. females.38%) and October (14. population parameters of tropical mudflat clam. The peaks of males were in June (12.26%). Berbagai organisme mendiami ekosistem ini. growth.5 respectively. 70. recruitment. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis. Over a 12 months period (Januari 2005 – Desember 2005). and also males and females combined. also males and females combined were 4. rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska. annual growth coefficient (K) of males. Overall. and 4. there were two unequal pulses. (Anodonta edentula) in mangrove ecosystem were determined.67%) and May (20. 2001). The objectives of this research were to study population parameters (growth. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000. females.31. Subsequently. 2 years for the females. recruitment pattern and mortality) of this tropical mudflat clam.63 mm. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 . 1. mortality. also males and females combined were 65. maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi. females.

Di Maluku. Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan.00 euro/kg. Lebata &Primavera 2001) Demikian pula di Thailand. Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1). serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. Pengambilan contoh kerang lumpur Anodontia edentula. Di Indonesia kerang ini belum mendapat perhatian. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim. . Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm.Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. dilakukan sebulan sekali selama 12 bulan. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula. 2001. serta ditimbang berat basahnya menurut jenis kelamin. Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang. Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. yaitu musim Barat dan Timur. mortalitas dan rekrutmen dari populasi kerang Anodontia edentula. Aktivitas ekploitasi yang berlebihan.

Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan. dan b adalah sudut/ slope yang merupakan nilai Z.39220.038 log10 K (Pauly 1980). yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang. Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur. Persamaan von Bertalanffy bila dijabarkan lebih lanjut. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i. dimana K adalah koefisien pertumbuhan. t adalah umur (atau umur relative.9957/K + to. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i.1. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami.95(L”) dimasukkan ke dalam persamaan diatas. dan jika panjang maksimum (L maks) = 0. Lokasi penelitian 27 . Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2. Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: .2752 log10 L” -1.Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03. “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i.

Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa.9327.15. dengan nilai koefisien determinasi (R2) sebesar 0. Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam. 28 . Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123.321 dengan nilai koefisien determinasi (R2) sebesar 0. Kondisi pola pertumbuhan yang berlaku pada kerang jantan.0002 L3. HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2).13.00008 L 3.3134 (L = panjang dan W = berat). Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0. Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0. Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin. Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0.Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992).9657 n = 2692 3.1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2.0001 L3.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3).9294.0002x 2 R = 0.9658. berlaku juga pada betinanya.

38.5 per tahun.9327 n = 1192 Gambar 4.58 mm dengan koefisien pertumbuhan (K) dari jantan. 70. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3. memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula.5 dan 1.63 mm. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65. 29 .3213 R2 = 0.288 R2 = 0. Analisis distribusi sebaran cangkang selama periode penelitian.00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang.88 mm dan 70.3. betina dan total masing masing 1. 1. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0. sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan.9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam. (Gambar 4). dengan menggunakan program FiSAT.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128.

dengan memasukkan formula Log10(-to) = -0.31.63 [1 .6% per tahun. 2 tahun dan 2. 4. betina. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment . K dan L”.88 [1 . maka didapat umur kerang terpanjang (life span) adalah t maks = 2. maka dapat dibentuk dugaan kurva pertumbuhan.95 X dengan r = 0.35 mm. dan total masing-masing 62.95±0.99. Kalkulasi laju mortalitas untuk jantan.087 tahun atau 1.4(t+0. betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut. kerang betina dengan Y= 10. betina dan total masingmasing diperoleh t0 = -0. dan jika panjang maksimum (L maks) = 0.61 X dengan r = -0.98.096 tahun atau 1.95(L”) dimasukkan ke dalam persamaan di atas. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol).038 log10 K.58 [1 .00 bulan.e-1.5(t+0.087) ] Dari beberapa parameter yang diperoleh.15 bulan.70 mm. LCCC yang dibuat dari kehilangan individu setiap kelas ukuran.97. Jika ditinjau dari segi biologi.3922-0.e-1. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam.3(t+0.97 bulan dan total .33– 4.9957/K + 30 to.65 dan 4. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan.e-1.096) ] Betina : Lt = 70.081) ] Total : Lt = 70. -0.2752 log10 L” 1.3 tahun. Nilai mortalitas total didapat dari negatif slope.0.081 tahun atau 0. dimana dapat dilihat pada Gambar 6. adalah Y= 10.0% dan 99. sedangkan untuk panjang maksimun jantan. Dengan memperhatikan umur maksimum. betina dan total masing masing 2. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. Dari hasil perhitungan t0 terhadap kerang jantan. Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve. Dari nilai-nilai K dan L” yang telah diperoleh di atas.7%.56 X dengan r = -0.41-4.56±0. 99. jantan. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol. dan kerang total dengan Y = 11. maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan. dengan demikian Z untuk jantan. Rentan hidup (t max) dari jantan.43. betina dan total dari model yang terbentuk. umur to. betina dan total masing-masing 99. Gambar kurva LCCC dari kerang jantan.61±0.34 mm dan 67. Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65. betina dan total terlihat pada Gambar 7.19–4.1 tahun. 67. betina dan total masing-masing adalah 4.

Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam.Kurva pertumbuhan kerang jantan: L” = 65. Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya. tetapi ditemukan dalam tubuh induk kerang.5 c) Kurva pertumbuhan kerang total: L” = 71.3 b) Kurva pertumbuhan kerang betina: L” = 70.31) a).63 m m dan K =1. Kurva pertumbuhan kerang A. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.edentula hasil analisis menggunakan program FiSAT (ver. Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan.28 mm dan K =1.0.88 mm dan K =1.4 31 . a) JANTAN b) BETINA c) TOTAL Gambar 5.

5 1 1.081) ] 2 2.58 [1 .e-1. (a).e-1. Hasil olahan pola rekrutmen tergambar pada Gambar 8. Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0.5 1 1.e-1.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 . pada betina pada bulan April (16.26%). Pada kerang jantan.3(t+0.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama.5(t+0. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65.38%) dan Oktober.63 [1 . betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen.5(t+0. selain itu terdapat interaksi biotik seperti predator. yaitu 14. persaingan dan tekanan lingkungan.12%) dan total gabungan pada bulan Maret (12.88 [1 .67%) dan Mei (20.5 1 1.5 3 Betina: Lt = 70. namun hal ini cukup berarti bagi kesinambungan populasi di alam.096) ] 2 2. Dugaan kurva pertumbuhan kerang Adonontia edentula.5 Wak tu (tahun) 2 2.77%. namun masih memungkinkan keberadaan status populasi kerang ini. kecuali bulan Desember.88%) dan Agustus (15.087) ] Gambar 6. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.5 3 Total : Lt = 70.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0.5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0.

Pola pertumbuhan (b) (a) (c) Gambar 7. begitupun jenis yang berbeda bisa mempunyai pola yang sama. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. (b) betina dan (c) total 33 . Pendugaan parameter b. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik.edentula (a) jantan. Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama. Kurva konversi hasil tangkapan panjang (LCCC) kerang A.Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. 2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif. Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. koefisien hubungan panjang berat. Penelitian dari Anodontia woodiana (Afanasjev et al. Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu.

31 15.47 12.98 3.45 0.25 6.12 7.00 (a) (b) (c) Gambar 8. (b) betina dan (c) total. 34 .19 1.95 8.77 8.39 15. betina dan total kerang A.95 0.45 12.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.88 11.16 7.47 12. Persentase rekrutmen bulanan jantan. Persentase rekrutmen kerang A.00 Total 2.26 18.52 2.47 14.35 6.67 10.edentula (a) jantan.29 8.67 8.29 2.97 0.27 16.00 Betina 1.Yuliana Natan Tabel 1.92 10.83 9.94 10.38 7.22 9.64 20.12 13.39 0.

2001). Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh.5 dan K gabungan = 1. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000. Koefisien pertumbuhan. dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70. panjang infinity mencapai 93 mm.58 mm). Panjang infinity A. Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya.227 mencapai umur 10 tahun (Afanajev et al. menunjukkan kecepatan tumbuh yang cepat. Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity. memerlukan waktu mencapai panjang asimtotik 10 tahun. maka L” lebih kecil dari di Philipina. 2001). bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama. dugaan panjang infinity (L”) A.95. K betina = 1. maka panjang infinity adalah 13.5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik.67 cm. K = 0. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm.Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan. Literatur serta informasi tentang kerang A. K yang ditemukan perairan hutan mangrove desa Passo. Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132. Berbeda jenis berbeda pula panjang infinity (L”).3. Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2.3 tahun mencapai panjang asimtotik 35 . Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi). akan membedakan parameter populasinya.34 per tahun menunjukkan pertumbuhan yang lama. sebesar 13 cm.edentula sangat terbatas. dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. Jenis lainnya seperti kerang estuari di Philipina. Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1.18 mm dan K = 0. edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0.edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity.

Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. Laju mortalitas total yang cukup tinggi. namun hal ini cukup berarti bagi kesinambungan populasi di alam. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator.Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek. Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. tetapi bulan Desember pada Tabel 1 tidak kelihatan. selain itu terdapat interaksi . Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F). seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003).3 tahun) dibandingkan dengan betina. Hal ini menunjukkan bahwa pada kondisi alami. predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). Jika dilihat dari strategi hidup kerang. Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin. terutama menghindari perubahan lingkungan yang ekstrim.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. dan gabungan jenis kelamin yaitu 2 tahun. Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. yang sebenarnya ada penambahan individu baru. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan.

sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae).95±0. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi). betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan. 70.26%). Laju mortalitas total yang cukup tinggi. baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan.. Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia.43.77%. Lebata MJHL. Asian publ. dengan koefisien pertumbuhan (K) dari jantan. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. Pelecypoda: Psammobiidae) from the Beate Bay area. 58 hal. Oxygen.31. J.131. Ambon.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2. Marine Pollution Bull. 2004. Elemental Sulphur in the Gills of the Mangrove Mud Clam. 37 . B.12%) dan total gabungan pada bulan Maret (12. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang. Zdanowski & A. 2003. 2001. tahun dan 2. betina dan total masing-masing adalah 4. Fakultas Perikanan Universitas Pattimura.3 tahun. pada betina pada bulan April (16.Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. yaitu Afanasjev SA. 19(1).56±0.5 dan 1. Shell Shellfish Res. Kraszewski. Lebata MJHL.1 tahun. 2. 4. 2001. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14. untuk jantan. 2000. 17: 299-312.88 mm dan 70. Unionidae) in the Heated Konin Lakes System.38%) dan Oktober. betina dan total masing masing 1. Del Norte-Campos AG. betina dan gabungan masing-masing adalah 65.Sci. Pada kerang jantan.3.65 dan 4. Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.63 mm. 1133-1138. persaingan dan tekanan lingkungan. West Central Philippines. 9(1): 123.67%) dan Mei (20.61±0. 1. 11(42). Anodontia edentula (Family Lucinidae).58 mm.88%) dan Agustus (15. Archives of Polish Fisheries. disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh. Latale SS. 241-245. Elsevier Science Ltd. Bulan Mei adalah puncak rekrutmen tertinggi. dimana ukuran jantan lebih kecil dari betinanya. Laju mortalitas total Z. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama.

J. 1975. Murphy. Tan. A Guide to mangrove of Singapore 1. 2003 (Eds). Sekolah Pascasarjana IPB. Morgani. Ng PKL. T. HDH. 2001 Gill Structure.Sivasothi. 407 p. BC. KS. Bogor 162 hal. Tan. Ricker WE. N. Y. & HM.K. Primavera. FAO Fisheries Departement. Seong. In P. (Desertasi).Ng & N. Tan.Yuliana Natan Lebata MJHL. 2008. Res. &SC. 2003. Rome. Yassien. Lim KKP.Zool 27:339-343. Turkey. 20(3):1273-1278. Computation and interpretation of bological statistics of fish populations.L. Board Can. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . Introduction to tropical fish assesment. TK. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. 19:191-382. Bull. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis. 2001. T. Singapore Science Centre. Animal diversity. Hugh. Venema 1992. Shellfish Res. Natan. Fish. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam. J. Sivasothi. Sparre P. W. Muhammed SZ.

Perna viridis Kata kunci : Bioakumulasi. Blackmore & Wang. Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit. Perunut radioaktif. The highest concentration factor of Cd (31. penyakit paru-paru akut dan menimbulkan kematian.80 Bq/gr Cd. 2002) dinyatakan bahwa kenaikan suhu. It was found that both salinity and temperature had significant effect ( P< 0.21 Bq/gr. Radiotracer 109Cd was applied in the study. panas pada bagian dada. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer. Pada gilirannya pada rantai makanan.2354. The research aimed at evaluating the effect of salinity.6 cm in length) had an uptake of about 72.001) on accumulation rate of 109Cd. Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik. whereas the bigger size of Perna viridis (6.80 Bq/gr. Dari berbagai penelitian (Morton 1987. At the steady state condition green mussel accumulated 72.2 cm in length) accumulated 109Cd about 107.21-107. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 . A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. Pekanbaru. Key words : Bioaccumulation. It revealed that the small Perna viridis (5. Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Cd.09) was appeared in water salinity of 29% and of water temperature 30oC. radiotracer Cd. Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS). tertinggi termasuk manusia. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase.

Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra.5 dan 6.2. sesuai kombinasi taraf perlakuannya. Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia. dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). dan diberi pakan Chlorella sp. Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). 210 Pb dan sebagainya).Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas. BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial. S1T2 (salinitas 29o/oo dengan suhu 30oC). Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC). Organisme dipisahkan menurut kelompok ukuran (5.6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC). Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd. Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional. Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut. Media uji air laut diganti setiap hari. 5. dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu. bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a). dihitung mengikuti Connell & Miller (1995).46 Bq/ml) yaitu dengan meneteskan 7. hewan uji diaklimitasikan selama seminggu di laboratorium. Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda. Data yang .6 ml ke setiap aquarium. Untuk menghilangkan stress. Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut. Secara periodik (dua hari sekali). dua kali sehari. Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1.

64 19.09 ± 41.24 30.29 17.84 61.98 49.87 19.81 73.41 25.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.27 44.23 ± 41. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.07 47. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.23-54.2 cm 5.60 3.70 70.5 cm 6.00 51.52 24.73 39.80 90.33 53.23 107.19 36.83 54.80 Bq/gr dan 49.93 59.50 28. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.65 20.61 59. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.62 29. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).33 14.20 27.21-107.90 34.27 ± 31.35 41. Model tersebut merupakan permodelan saturasi.09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.60 59.08 47.12.25 22.70 ± 34.91 2.94 30.75 49.89 4.37 4.16 72.02 43.41 54.21 80.77 28. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.6 cm 30.89 3.72 45.01 Keterangan : Css (konsentrasi steady statei).48 39.6 cm 5.12 30.36 21.60 32.08 47.42 70.51 52.65 36.45 35. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.37 ± 20.0.46-73.44 51.84 (Tabel 1a dan 1b).2 cm 5.33 13.31 53.61 11.23 40.78 28. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.50 51.30 ± 4.46 55.77 28.14 21.75 70. FKss (faktor konsentrasi steady state) 41 .54 15.12 47.5 cm 6.62 52.90 79.74 12.99 37.65 23.

Pada Gambar 6.71 19.81 33.32 10.2 cm 5.89 37.99 4 35. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata.5 cm 6.97 16.9176 5. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.18 36.33 19.7137x + 8.99 ± 19. nilai koefisien determinasi untuk salinitas 29o/oo (0.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.85 ± 15.80 51.55 16.9462 y = 1.00 12 57.88 20.0667 R = 0.38 20.86 13.80 17.62 Keterangan: Css (konsentrasi steady statei).92 7.41 10.2 cm 5.03 25.7137x + 8.54 33.37 3.84 ± 34.20 ± E 4.8014 R2 = 0.25 13.6 cm 2 25.06 42.67 Mean±S 47.6 cm 5.09 24.46 36.6 cm ♦=5.8014 R2 = 0.45 18. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.38 49.46 35.5 cm 6.49 51.2673x + 11.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.0667 R2 = 0.72 37. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.21 ± 36.46 6 38.34 92.41 14.21 75.2 cm 31o/oo) di suhu dan ukuran yang sama (5.26 10 44. FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.2 cm dan 30oC) pada Tabel 1b.01 15.84 78.82 45.10 Css FKss 63.91 16 60.98 11.47 25.68 24.08 8 41.9462 y = 1.81 22.2 cm 5.71 20.6044x + 5.9951) .58 30.69 24.61 29.761 R = 0.761 R2 = 0.59 54.46 30.6044x + 5.43 ± 21.2 cm 5.5 cm 6.97 16.26 21.10 49.44 49.66 24.56 4.51 54.06 1.99 1. ■= 5.33 16.64 35. 42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.26 3.70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.5 cm 6.22 21.80 51.01).2673x + 11.74 14 60.35 14.6 cm 5.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.6 cm Gambar 1.9423 B y = 2.10 23.76 19.42 17.5 cm ▲=6.09 (Gambar 5).72 18 60. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.Yusni Ikhwan Siregar Tabel 1b.

43 . Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC. (Gambar 8).9539 B y = 2.9685 y = 1.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0. terlihat pada Gambar 7.2 cm 5. ■= 5.6 cm ♦=5.2 cm 10 5.2 cm 5.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2. ■= 5.9668 y = 2.9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.5 cm 6. Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5.7667 2 R = 0.0943x + 10.2 cm 5.6 cm ♦=5.2 cm dan 29o/oo) pada Tabel 1a dan 1b. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas. Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0.6186x + 27.9 R2 = 0. Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.5 cm ▲=6.2052x + 8.5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.29 R2 = 0.6 cm Gambar 2. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.66x + 7.6 cm Waktu Kontak (hari) 5.5 cm ▲=6.9734 2 4 6 8 5.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.9951.968).6 cm Gambar 3.9433 y = 1.5 cm 6. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0.529 2 R = 0.773 R2 = 0.8171x + 23.4495x + 16.2494 R2 = 0.9764 y = 2.5 cm 6.01).

5 cm 6.523 R 2 = 0.2 c m 5 .968 A B Gambar 6. Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.7x + 53. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).6 cm 10 15 20 Waktu Kontak (hari) Gambar 4. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC.2 cm 5.Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5. 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 .9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.057 2 R = 0.6 cm 10 0 0 5 5. 44 . oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11.5 cm 6.6 c m B Gambar 5.43x + 65.5 c m 6 .2 cm 5.

PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15.6 c m B Gambar 7.35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9). Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang. Pada kondisi tersebut. Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0.2 c m 5 .5 c m 6 .84-47.43 dimana nilai konsentrasi steady statenya berkisar 30. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo.20-34.23 sampai dengan 54.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 . faktor konsentrasi steady state di salinitas 29o/oo 1.30-41.10-75.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo.23 10.70. 2000).01). kerang hijau mampu mengakumulasi 109Cd 31. Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19.51 Bq/gr (Tabel 1b). Sedangkan pada suhu 28oC. 109 45 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1.09 kali dalam durasi kontak 14 sampai dengan 16 hari.21 dan 20.

4 3 x + 1 9 .01). Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup. Model tersebut merupakan model saturasi.6 8 5 x + 7 . Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi. pertumbuhan dan metabolisme fisiologi dari organisme laut. umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah. Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B). Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0.3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 . Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata.70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.5.23 . Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3.9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8.24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar.3 1 R 2 = 0 . pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4. Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.Yusni Ikhwan Siregar Cd 60 y = 1 1 . Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut. .09 (Gambar 5). dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.9 7 9 1 A B R 2 = 0 .

23 + 3.9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.9 9 7 2 109 Faktor Konsentrasi rata-rata 5 . Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998). Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0. Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7).5 c m 6 . Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.6 .01). nilai koefisien determinasi untuk salinitas 29o/ (0. Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu.6 .0 8 8 x + 4 8 . Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis.8 1 9 1 y = .96X).8 8 6 8 y = .4 7 9 x + 6 0 . Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. S2T2 (3) dan S2T1 (4).7 6 3 x + 3 3 . Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1). 47 . Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 .5 5 R 2 = 0 . 109 Cd oleh Mengacu pada Gambar 6.4 . dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.5 dan 6.2. 5.8 4 R 2 = 0 . Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5.6 c m Gambar 9.968).5 3 2 R = 0 . S1T1 (2).6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = .

Mg. Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987). 1984). Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam.Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda. Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut.23 10. phosphate. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl. Proses bioabsorpsi ini bersifat bolak baik dan cepat. Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. dan hydroxy-carboxyl yang berada pada dinding sel. Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass. thiol. Logam berat dapat juga diendapkan pada proses metabolisme dan . bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt. Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. (1984). Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). amino.01). 48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut. Kemudian Sivalingam dalam Coeroli et al. dan Ca pada dinding sel digantikan oleh ion-ion logam berat. hydroxy.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. pertama pertukaran ion di mana ion monovalent dan divalent seperti Na. Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0.

Coeroli. growth rate and culture potential of the green mussel. Perna viridis L. Reproduction. BS. 1995. Saeni. KVK. Gaillande. 2002. —— 2004b. Simpson. Recent innovations in cultivation of molluscs in French Polynesia.1998. &WX. 1758) (Bivalvia: Mytilacea). DW. p. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus. steady state. Perna viridis (L. Fakultas Matematika dan IPA IPB. Bogor Suseno. VP. Wang. “ Kimia dan Ekotoksikologi Pencema- ran. Landret. 1984.). 518 hal. JP. 1987. Aquaculture 40:47-55. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. Orasi Ilmiah. 2004a. Serpong September 2004. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut. den Harog. Growth of the green mussel. Connel. Water Treatment with Algae Springer-Verlag and Landes Bioscience. V. Ansari. Amer.) in Edaiyur backwaters. InterPopulation Differences in Cd. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities. HA. Malac. B.. Jakarta. Parulekar. M. The Hong Kong University of Science and Technology. DAFTAR PUSTAKA Blackmore. P2PLR BATAN.. 1984. Perna viridis: Influences of Body Size. Cr. 17 Rajagopal. H. G. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. Jenner. & C. Guru Besar Tetap Ilmu Kimia Lingkungan. in a sea water circulating system. UI press. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. Removal of Copper by Free and Immobilized Microalgae. in: in YukShan & Tam (eds. & GJ. 1998). Terjemahan Yanti Koestoer. dibandingkan dengan kerang hijau yang berukuran besar. 1998. S. suhu. Biokinetics of Cadmium in Indonesia’s Green Mussel. D. Miller. Se. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Proceeding of one day seminar Development Radioecology and 49 . 13pp. 1997.. Aquaculture 39:45-67. Chatterji. & AH.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. Morton. MS. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut. 5(2):159-164. salinitas dan lain-lain (Nora et al. A. Nair. Aquaculture 162:187-202. east coast of India. Bull. van der Velde. Nora FY. Venugopalan. Seminar Nasional Teknologi Limbah. Chlorella vulgaris. Hong Kong. ZA. YST Wong & CG. Ingole.

Mar.Yusni Ikhwan Siregar Marine Environment in Indonesia. & RCH. Ser. Wang. Prog. Prog. Mar. 1999. Ser. 186:161-172. WX. 2000. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. WX. Ecol. Memasukkan: Maret 2009 Diterima: Juli 2009 50 . Ecol. Wang. Dei . Hotel Sahid Jaya Jakarta.137:567-575. Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus.

1997).85 – 5.32 x 69.80 C g wet weight-1 hour-1 (15. Stages III: 4. with three replications. The highest survival rate of larvae was by treatment BF.72 – 77. and also prerequisite for individual growth and survival. physiology.73 μm – 58.29 μm – 80.95 C g wet weight-1 hour-1 (24.62 μm. stage II: 57. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF).Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗.43 μm (AP x DV). The quickest time of plantigrade stages have found by treatment BF (day 19. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. The aim of this study is to obtained information on energy budget on routine metabolism. Sanusi2 1 Jur. than would be decreased when temperature and salinity increased. The highest of energy budged for routine metabolism at treatment BF.92 %. in different levels of temperature and salinity.58 J g wet weight-1 hour-1).88 x 69.39 % and stage III: 76. larvae. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson).74 J g wet weight-1 hour-1). E-mail: tjwinanto@yahoo. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”. Keywords: Pinctada maxima.07– 19. Di pasaran internasional.73 – 4. The best of relative growth length of larvae by treatment BF and not significant (P e” 0.73 – 7. Perikanan dan Ilmu Kelautan. response.78 x 17.48 – 24.35 C g wet weight-1 hour-1 (28. Kata kunci: Pinctada maxima. and to know the levels of optimum temperature and salinity. Fak. sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006).33 μm and stage III: 80. but has not higher significant (P e” 0. Sain dan Teknik UNSOED. respon.91 – 82. larvae. Ridwan Affandi3.18 – 30.05) with BE. 51 .90 J g wet weight-1 hour-1).50) and hasn’t significant (P > 0.05) with BE (day 20. Stage II: 81.85).75 – 87. Fak.05) with BE. The research was used randomized block design. Stages II: 5. Stage I: energy budged between 6.93 μm – 30. Perikanan dan Ilmu Kelautan IPB. Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal. 2 Departemen Ilmu dan Teknologi Kelautan. stage I: survival rate between 87. The result showed that optimal temperature and salinity on P. metabolism. Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995). & Harpasis S. fisiology.13 x 47.62 x 46. PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al. Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia.26 %. at stage I: 29. Dedi Soedharma2. metabolisme.57 x 18.

Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal. Affandi & Sanusi Saat ini. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4.143. Selama proses produksi spat skala besar di hatchery. Menurut Gricourth et al. konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005. dan konsumsi energi oleh metabolisme internal (Crisp 1984. Selama pemeliharaan larva di dalam lab. Suplai spat merupakan bagian yang krusial dari industri ini. dalam Taylor et al. Inokulum yang digunakan berasal dari biakan murni skala lab. Soedharma. sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. Martinez-Fernandez et al. kemudian diperbanyak hingga mencapai kepadatan .A. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas. 2007). 2004). Jika hasilnya positif. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda. yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994). Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. diperlukan kondisi lingkungan yang optimum dan terkendali.Winanto. seperti untuk pertumbuhan. 1997).14 per mm panjang engsel (R. harga spat dari hatchery kira-kira $US 0. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif. Rose data tidak dipublikasikan. perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol. sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi. representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al. sangat diperlukan informasi tentang pengaruh suhu. karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. jika semata-mata hanya menggantungkan pengumpulan spat dari alam. Di Australia. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai.000 ekor.1 – 0.000 per cm. keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan. Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. Asha & Muthiah 2005. serta dapat diketahui tingkat suhu dan salinitas optimum. salinitas. dengan harga sekitar Rp 2. Dame 1996).

Pengukuran suhu dila kukan dengan menggunakan termometer Hg. Winanto 2004). lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001). kapas sintetik dan ultra violet. 10 dan 5 mikron). Jepang). dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0. yaitu berupa satu unit peralatan yang terdiri dari empat botol. Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3).0001 gr). dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). Untuk mengetahui laju metabolisme rutine larva 53 . Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva. yaitu (I) suhu. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). (E) 32 ‰. Berdasarkan pada stadia perkembangan larva. Disain percobaan untuk mengetahui laju konsumsi oksigen. karena salinitas air di lokasi penelitian e” 34 ‰. Botol A untuk stok air yang dijenuhkan. Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. catrage (15. Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. (B) 28 oC. Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan. maxima stadia bentuk-D (D1). Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. Winanto 2004). yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. galbana dan P. Untuk mengetahui berat larva. (F) 34 ‰. sedangkan salinitas diukur dengan refraktometer (Atago. 2001. Oksigen terlarut diukur dengan alat DO meter (YSI 550A. sampel disaring dan ditampung menggunakan planktonet. botol C untuk mengukur laju konsumsi oksigen. 2001. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). Larva diberi pakan I. 2002). maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. Perlakuan yang digunakan terdiri dari 2 faktor. maka percobaan dikelompokkan menjadi tiga. Hewan uji berupa larva P. Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. untuk meningkatkan suhu air digunakan alat pemana s. Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. dan (C) 30 oC. Larva diperoleh dari hasil pemijahan Induk P. (II) salinitas. tipe 03J0820 AJ). Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. dipelihara di dalam wadah percobaan ember plastik volume 20 liter. botol B sebagai wadah hewan uji.

selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004).7 mlO2 (Jeong & Cho 2007). maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut. maxima. Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. Soedharma. 1 mgO2 = 0. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC. Pengambilan sampel dilakukan setiap jam sebanyak 10 ml. 1 mlO2 = 19. Data-data dengan dua variable seperti laju metabolisme dan berat larva. Pengamatan dimulai dari hari ke 18. 54 . Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade. Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al. Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan. Waktu pertama kali teridentifikasi stadia plantigrade. Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993).9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml.Winanto. 1990). Gambar 1. 1997) dilakukan dengan menggunakan mikrometer okuler.

5821x2 + 38. (Gambar 2). Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2. dengan koefisien determinasi (R2) pada stadia I sekitar 0. pada stadia II menurun sampai 79. Stadia III: Y = -1.64 (R2 = 0. Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1).8227.09 mgO2/g berat basah/jam (AD). Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0.05) antar perlakuan suhu dan salinitas. pada stadia II meningkat menjadi 51.5137). menunjukkan adanya korelasi yang kuat.483x – 411.187x – 1337. salinitas 30 ‰ (AD) (Tabel 2).70 (R2 = 0.42 %). Stadia II : Y = -0.05).8283. 55 . 7963 dan stadia III: 0. Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu.9387x2 + 110.16 mgO 2 /g berat basah/jam (BF) dan terendah 1. Seda ngkan pa da stadia I dan III korelasinya kurang kuat. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C. Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata.63 %. dan pada stadia III efek suhu meningkat menjadi 82. Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0.18 (R2 = 0.02x – 1532.80 (R2 = 0. stadia II: 0. salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC.5137).4855).27 %.03x – 1431. Pada stadia I.8227). salinitas 30 ‰ (AD).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P.8283).804x – 625.55 %.10 (R2 = 0. maxima tertinggi terjadi pada perlakuan suhu 28 oC. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen. pengaruh suhu terhadap laju metabolisme mencapai 82.7963). Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C. tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰).37 % dan pada stadia III kembali menurun (49.05) dengan salinitas 34 ‰ (F).7001x2 + 96.3706x2 + 25. Pada stadia I. pengaruh salinitas terhadap laju metabolisme sekitar 48. Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1.83 %. Stadia II : Y = -1. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0.7946x2 + 102. Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0.

31 ± 0. 56 .8283 Suhu (oC) Gambar 2.7001x 2 + 96.16 ± 0.05e 0.03d 1.73 ± 0.03b 1.04f 1. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.03c 0.08d 1.04e Salinitas (‰) (E) 32 1.1337. III Tabel 1.03d 1.12 ± 0.1 R2 = 0.02x .14 ± 0.74 ± 0.03b 1.03d 1.03a 1.03e 0.03b 1.03b 2.03x .8 R2 = 0. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.30 ± 0.34 ± 0.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %. Soedharma.7 R2 = 0. Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.75 ± 0.8227 y = -1.7946x 2 + 102.39 ± 0.65 ± 0.1431.32 ± 0.187x .7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1. maxima stadia I.08 ± 0.03f 0.03f 1.03a 1.02f (F) 34 1.72 ± 0.75 ± 0.09 ± 0.98 ± 0.29 ± 0.76 ± 0.10 ± 0.34 ± 0.Winanto.04f 0.03b 1.03d 1.03d 1.15 ± 0. II.03c 1. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.41 ± 0.29 ± 0.77 ± 0.03b 1.79 ± 0.1532.9387x 2 + 110.16 ± 0.03c 1.04a 1.

Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P.023x – 795.625.7394x2 + 49. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P. maxima dipengaruhi oleh suhu dan 57 .25x + 29.804x . Stadia III : Y = -0.4942 31 32 Salinitas (‰) 33 34 35 Gambar 3. jadi berat (85. Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III).411. maxima stadia I.483x . Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0.795. maxima.3706x 2 + 25.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0.5821x + 38.17 R2 = 0.856). maxima. stadia II dan stadia III Gambar 4.4855 y = -0.5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0.64 R2 = 0. Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan.4942). baik untuk aktivitas maupun perkembangan larva P.023x .18 2 R = 0.7394x 2 + 49. Persamaan yang diperoleh adalah Y = -295.17 (R2 = 0.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4).243 (R2 = 0.856.

07 ± 0.60a 15.12d 24. J (B) 28.12 5.09 18. C (B) 28. C (A) 26.68e 2.32 ± 0.14 ± 0.84 ± 0. sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3).80 ± 0. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0.67 ± 0.64 ± 0. C (A) 26.45b 30. salinitas 30 ‰ (32. sintasan tertinggi terjadi pada perlakuan suhu 28 o C.13±0. J (B) 28. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P.47 %).05).03 ± 0. Pada stadia II dan III.09 3.59f 3.40d 15.60 ± 0.45 ± 0.62 ± 0.37b 24.14 18.36b 19. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0.69 4.60 ± 0.07 10.44d 18. J (C) 30.92 %) dan terendah pada suhu 26 oC. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26. C (Calorie).48 ± 0.62 ± 0. C (C) 30.09 15.09 ± 2.37c 16.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.12 4.04 ± 0.86 ±0.10 3.20 ± 0.46e 1. salinitas. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 .Winanto.37d 24.39f 2.39 ± 0.45 ± 0.10 4.09 4.15 ± 0.05) antar perlakuan suhu. J (D) 30 3.07 ± 0.73 ± 0. C (C) 30.45b 24.10 4.58 ± 0.75 ± 0. Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0.37c 11.45a 23.05) antar perlakuan suhu.55 ± 0.90a 18. J Stadia III (A) 26.42b 19.10 10.40±0. C (C) 30. J (C) 30.68 ± 0.02 ± 0.69±0.57e Salinitas (‰) (E) 32 4. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas.83 ± 0. salinitas 34 ‰ (87.50 ± 0. Affandi & Sanusi Tabel 2.12 ± 0. J Stadia II (A) 26.38 ± 0.10 6.41 ± 0.09 5. C (B) 28. J (Joule). baik pada analisis varian maupun uji Tukey (Gambar 5).05) dengan 32 ‰ (E). sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.39f 3. Pada stadia I.31 ± 0.12 7.50c 18.29f (F) 34 4.51f 2. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.53±1. C (B) 28. C (A) 26.12 15.58 ± 0.90 ± 0.43b 27.43d 16.36 ± 0.30 ± 0.32 ± 0.27 5.88 ± 0. salinitas dan tahap stadia.83 ± 0. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan. Soedharma.11 10.52 ± 0.05) dari E dan F.14 3.70 ± 0.02 ± 0.11 5.01±0.14 4.16 15.10 3.26±0.25 ± 0.08 2.10 4.09 5.43d 18.07 ± 0.74 ± 0.41 ± 0. J (C) 30. J (B) 28.

92 ±1.39 ± 0.73b 82.67 ± 0.28d 72.72 ± 0. Pertumbuhan panjang relatif larva stadia I (D1–D6).64d 69.33 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.17 ± 1.04f 22.80b 77. Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan.91a 64. E. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.46 ± 0.02 ± 1.95 ±0.80 ± 1.75f 32. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus.09d 71.17 ± 1.23 ± 0. D.27b 81. 28o dan 30o C. pertumbuhan.03b 87.75d 61.93 hari) (Gambar 6). laju konsumsi oksigen dan laju metabolisme.79 ± 1.19c 48. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas.71d 70.75 ± 1.26 ± 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3. B & C =suhu 26o .86d 60.88b 76.20 ± 1.98 ±0.91f 32.61 ± 0.60 ± 0.17 ± 0.39 ± 0.91 ± 0. & F= salinitas 30.81e 21. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18.17a 61.77f (F) 34 43. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 .60f 22.67 ± 1. Sintasan (%) larva P.09 ± 0.34 ± 0.41 ± 0.29b 87.83e Salinitas (‰) (E) 32 43.04c 54. stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.82a 59. PEMBAHASAN Konsumsi oksigen larva P.71 ±1.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.62c 48.76e 10.

1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis.7 dan > 1. hingga mencapai batas optimum (28 oC. maka . bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda.0. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan. Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. Dari hasil analisis dapat diinterpretasikan. Diduga. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling.5 sampai 10 mlO2/jam/g berat kering. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983). variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif. 1949 dalam Bayne. disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0. Soedharma. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0. 32 ‰. berat badan dan tingkat aktivitas. Jika dihitung per unit berat badan. 34 ‰). gamet dan larva yang berada pada satu seri penelitian. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. maka laju konsumsi oksigen semakin menurun. Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi.75–3 ml O2/jam/g berat kering (Zeuthen. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus. Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air. Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0.5 – 5 mlO2/jam/g berat kering. Affandi & Sanusi 2.856). Laju konsumsi oksigen pada larva Mytilus edulis antara 0.00. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat. Lebih lanjut Bayne (1983) menyampaikan. Hasil korelasi menunjukkan kecenderungan linear positif. Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan. semakin berkembang tahapan stadia larva baik panjang maupun berat. Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2. 2004). Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian.70 sampai > 1. 1983). kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat.80.Winanto.

Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7. fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983). merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. Lama waktu (hari) pencapaian stadia plantigrade larva P. 61 .1997). Diduga pada kondisi laju konsumsi oksigen tinggi. Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Pada P. 2005). Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose. maxima pada berbagai tingkat suhu dan salinitas. Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). Seba gai salah satu indika tor. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi.

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994). maxima dan P. Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. dalam O’Connor and Lawler (2004) jumlah larva P.83 C/g berat basah/jam (24.53 – 30. per sonal observasi.Winanto. salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC. Pada stadia I pembelanjaan energi mencapai 6. Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P.58 – 7. maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE. (2000) di dalam laguna Great Barrier Reef. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. BF). sehingga larva berkembang dengan baik. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas.62 – 4. Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas.74 – 5. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil. tetapi pada suhu kurang pengaruhnya. Pada suhu optimum aktivitas metabolisme berjalan maksimum.20 C/g berat basah/jam (27. margaritifera antara 23–28 oC. Menurut O’Connor. apalagi jika salinitas turun sampai kurang dari 29 ‰. Berkaitan 66 dengan kompetensi larva untuk menempel. 1983). Australia mencatat bahwa kisaran suhu optimum pa da P.67 C/g . Penelitian Yukihira et al. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). imbricata (Roding) dipengaruhi oleh suhu dan salinitas. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. Quensland Utara. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa. salinitas 32 ‰ (BE).13 J/g berat basah/jam). Soedharma. dalam Ala garswa mi et al.39 J/g berat basah/jam) dan pada stadia III antara 4. Bayne 1965. 1983). Disamping adanya variable lain. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia.02 – 24. diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. Pada kisaran salinitas 29–35 ‰. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar. Stadia II antara 5. KESIMPULAN Suhu dan salinitas optimum untuk larva P. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC.

29 µm – 80. UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut. Aquaculture 250: 823-829. Velayudhan.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49. 19. PS & P. Muthiah. Pada stadia I pertumbuhan relatif mencapai 33. (BE. Pencernaan dan Penyerapan Makanan. 287-301.39 % dan stadia III antara 76.43 µm.32– 19. No. Mina Mitra Usaha. DAFTAR PUSTAKA Affandi R. Stadia II antara 81.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. 2005. 1983. Bogor Alagarswami K.32x 69. J. Ditjen. Asha.58 J/g berat basah/jam). Pengaruh suhu (81. 1994. Stadia II antara 57. IPB.80 µm–34. ACC Victor & AD. Pengolahan dan Pemasaran Hasil Perikanan. S. Elsivier Science Publisher. Survival and Development of Sea cucumber Holothuria spinifera Theel. Crassostrea virginica. Kultur Pakan Hidup. atas bantuan yang diberikan selama penelitian. Wild versus hatcheryreared larvae. _____ 2002.72 – 77. 67 . Balai Budidaya Laut Lampung. Amsterdam. 2006. Perna canaliculus. Mengenal Mutiara. Dep. P.. Rahardjo &. Salinity and pH on Larval Growth. Dharmaraj.V. Effects of Temperature. 29: 4-6.92 %.78 %). MF. Pada stadia I sintasan antara 87. Anna .28 x 21.75 – 87. Competency to Settle in Oyster Larva e. Balai Budidaya Laut Lampung. Aquaculture 3. Pembenihan Tiram Mutiara (Pinctada maxima). Warta Pasar Ikan. FPIK.91 – 82. DS. J. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata. V. salinitas 34 ‰ (BF.62 x 46. 2001. Fisiologi Ikan. Perhiasan Para Bangsawan. Ed.88 x 69. A. Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. 18. Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel. Sulistiono 2005.DKP. Chellam. Pebruari. 2005.26 %. TS. Managemen Sumberdaya Perairan. serta C. B. Petunjuk Teknis (VII): 106 hal.73 µm – 58. Baker. Aquaculture 246: 285-294.90 x 20.62 µm. J.13x7.33 µm dan stadia III antara 80.. Balai Budidaya Laut. Gandhi. Petunjuk Teknis (6): 61 hal. AC. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould). Sjafei.93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE. Alfaro. Aquaculture 122: 161-169.55 hari). Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC.

1974. Jeuniaux. 1996. BL. Oxford. 1996. Farming Jewels. Biggeleer. 254 pp. Gosling.S. An Ecosystem Approch. Dharmaraj. Academic Press. AcostaSalmon.. Soedharma. Beureu of Commercial Fisheries Biological Laboratory. In: Gilles. 130p. Fishing News Book. CR. Vazques & Z.. & W. JAMV. Energy Equivalent of Oxygen Consumption in Animal Energetics. JM. 2004. 1983. Aquaculture 230: 417-423. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. BL & RC. John Wiley & Sons.Winanto. Mathieu & K. J. New Developments in Pearl Farming. A. Chacon. NH. Kutsner 1990. 1983. Part I. 10: 103-120. 2006. Boca Raton. An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. Publ. Temperature and Water Quality. Feeding. 1975. Kellner. O. Ecology of Marine Bivalves. E. Wesseran. The Mollusca. Bivalve Molluscs. L. 4: 51-73. RF. Gilles. Great Britain. Shellfish Rese. N. Bayne. Maintenance of Cell Volume. E. 2004. Rearing of Bivalve Mollusks. New York. C. 1851) Larvae. In: A. In: Holme. Thallasia Jugosl. AS. 22(1): 415-421. 1984. Physiology. CRC Press. 13: 581-604. Applied Linear Statistikcal 68 . Viana. Saleuddin and K. Martinez-Fernandez. Oecologia 19: 195-201. S. 1995. Garcia-Esquivel.. Mcintyre.M. R. J. Coastal Aquaculture 2: 627-632. Newell. Crisp. New York. V & H. Affandi & Sanusi Bayne.. Davis. 2003. Development 3(8): 299-336.. Ecology and Culture. Wilbur (Editors). & MH. Fassler.D. MT. H. In: Tompa.A. Gricourt.. Methods for the Study of Marine Benthos. Elliot. Neter. Aquaculture 251: 85-98. Proc. Farias. & CH. DJ. Osmoregulation and Ecology in Media of Fluctuating Salinity. Energy flow measurements. W. Mechanism of Osmoregulation in Animals. S. Loosanof. The Mollusca IV. Symp. 1983.M. Crisp. Dame. Mildford. 284372. Connecticut. A. US. DJ. Davidson. Rangel-Davalos. (Eds). Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics. R. Blackwell Sc. Biology.. Energy Relation of Marine Invertebra te Larvae. C. Physiological Energetics of Marine Molluscs. Goddard. M. World Aquaculture 29 (3): 5-10. In: Feed Mana gement in Intensive Aquaculture. Verdonk. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). 1979. 1963. Physiological ecology of marine molluscan larvae. J.

R (ed). (Ed). Margaritifera.. Resgalla. Gramedia Pustaka Utama.. Ser. Proceeding European Marine Biology Symposium. In. Marine Ecology. 1997. JJ. JS. Merino & E. 195: 179-17 ____ 2006. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. G. Toppan Copany. 1979. Analisis REGRESI Menggunakan SPSS. J. ITB. G. Bandung. Suatu Pendekatan Biometrik. Taylor. WA & NF. New York. 1980.Jr. 252: 208-224. Karbohidrat dan Lipid. Andi Offset. John Wiley & Sons. LTD. Pechenik... Boca Raton. Silverthorn. Brasil.J. 138 hal. Rose. Biomonitoring of coastal waters and estuaries. Jakarta. ES. Growth and energy balance during the larva lives of three prosobranch gastropods. 1994. 1993. 2007. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures. Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster. pp. Yukihira. C. J. Maintenance of Cell Volume. Widdows. Smaal. Vernberg. 2004... Metabolicenvironmental interaction in the marine plankton. In: Kramer. Lawler. Aquaculture 229: 493506. Regression. 2004. Laitano & RW. Margaritifera. Tokyo. Lucas & DW. The pearl oyster. Ecol. 44: 1-28. Vernberg. Steel. 2000. Reis F ilho. Aquaculture 153: 31-40. Yogyakarta.M. Biol. Aquaculture 270: 451-463. 5th. PC. Gilles. pp: 189196. Soria. J.. 748 hal. RA. Sulaiman. Aquaculture 270: 464474. J. AC & J. Pinctada maxima and P. Prog. Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil. 11:537-554. RGD & JH. Klumpp. respon in different ways to culture in similar environments. W. KS. Wirahadikusumah. 1173 p. Contoh Kasus dan Pemecahannya. Analysis of Variance and Experiental Designs. 1972. J. Japan. Biokimia: Metabolisme Energi.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models. WB & SU. J.. Torrie. Von Brand. The scope for growth of bivalves as an integrated response parameter in biological monitoring. Taylor. Southgate & CE. CRC Press. Prinsip dan Prosedur Statistika. WB. Pinctada imbricata Roding. Mechanism of Osmoregulation in Animals. O’Connor. K. 1970. 1985. Aquaculture. 2007. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . JA. Mar. H. 247-267. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture. Temperature and Osmoregulation in Aquatic Species. 3 rd Edition. M. Exp.

Sain dan Teknik. Purwokerto E-Email: bufish68@yahoo. Di Jepang.0 %. Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al.10 mm) and biggest significant (P< 0. Keywords: Freshwater mussel.30 mm) but hasn’t biggest significant (P>0. warna dan kilau (shine) Sonkar (2007). (B) 60 cm and (C) 90 cm. sized ranging from 12 – 15 cm were studied. to get fast nacre deposition and high quality of pearl.70 mm). 12. Anodonta woodiana. Hyriopsis schlegeli (Simpson). 71 . The result of implantation was followed that 30. The objective of this study was to obtain information on best level of depth to culture of pearl.co. Maskur1. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk. level of deep Kata kunci: Kerang air tawar.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1. The research was conducted for 9 months. maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). 2. 60 and 90 cm deep were 11. in the freshwater pond. Completely randomized design was used with levels of deep treatment (A) 30 cm. The result showed that best thickness of pearl deposition by 90 cm deep (1. khususnya di Danau Biwa. whereas survival rate was followed 79. was 300 m2 wide and 1 m deep. Kovitvadhi et al. 2008). 79 % and 78. &Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi.2 %. 12. Tjahjo Winanto2. Anodonta.7 %. woodiana. Berdasarkan kualitasnya yang tinggi. budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925). 2006. Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s. Freshwater pearl Anodonta woodiana. Fak. Perikanan dan Ilmu Kelautan. berat. PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. kedalaman laut 1.05) to the deep of 30 cm (0. One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre).05) to the deep of 60 cm (1.id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana).2 %. Jur.9 %. Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China. effect. Unsoed. Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930.

BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1). Faktor eksternal antara lain kualtas air. Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik. Menurut Pagcatipunan (1986). Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre).Rachman. pH. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. seperti suhu. Jumlah sampel 250 ekor. sehingga mempunyai nilai tambah sebagai perhiasan. misalnya keterampilan teknisi dalam proses implantasi. kerang berukuran panjang antero-posterior (AP) 10-15 cm. penanganan dan pemeliharaan pasca implantasi. kalsium. sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. sehingga kajian mengenai hal tersebut perlu dilakukan. sehingga dapat diperoleh mutiara berkualitas tinggi. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah. nitrat. alkalinitas. Anonymous 2007. Skinner et al. internal dan teknis. 2003). Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. khususnya pada produksi mutiara bulat air tawar. Sonkar 2007). Faktor internal meliputi jenis kerang yang digunakan. hijau dan biru muda. karena luwes untuk perhiasan. dengan perlakuan kedalaman pemeliharaan 30. oksigen terlarut. masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. konduktivitas. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. Oliver 2000. daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. Berdasarkan kualitasnya. Warna sebenarnya sangat tergantung pada selera konsumen. Semakin tinggi karatnya maka harganyapun makin mahal. Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi. kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. Faktor teknis. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 . Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. kecerahan dan kesuburan perairan (Dan & Ruobo 2000. sehingga membuat harganya paling mahal (Anonymous 2005). kualitas lapisan mutiara (nacre).

Usahakan agar posisi mantel menempel dengan inti (Winanto et al. Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. Pasca implantasi. Jumlah sampel pada setiap perlakuan adalah 75 ekor. 2007). Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. Sebelum operasi. Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991).1992). Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. Selanjutnya. maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih. Secara matematis.1992). terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. bagian ventral kerang menghadap operator. Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. Operasi dilakukan dengan menempatkan kerang pada penjepit. Pengolahan data dilakukan dengan SPSS ver 15. Dengan menggunakan spatula insang disibakkan. yaitu dengan menggunakan metode ekspose (Winanto et al. Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. keduanya dimasukkan ke dalam satu saluran.1992). Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. sehingga organ dalam terlihat jelas. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor. posisi demikian dilakukan selama 2 jam. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan. Pengamatan dilakukan selama 9 bulan (April– Desember).Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral). agar luka tidak menjadi infeksi (Rachman et al. dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan. al. Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad. Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. sehingga dapat ditemukan 73 .

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

90–25.03–0.04–5.80–25.36–0. yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian.00 0.10 0.03–0. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau.40 0.76–99.093 6.70–99. Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5.69 6. tidak menempel pada inti. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk.67 24.80–14.15–3.54 15 – 251 <1. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 .60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6.01–4. Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%.62 0.36–0. 3Oliver (2000).12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000). yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan.09 7–13 68.40–25.03 <0.90 22. Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik.90 0.083 6–15 64.00–7.5–8. Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana. Parameter air lainnya yang perlu diperhatikan adalah kecerahan. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp). 4Summerfelt (2007).90 6.32 7.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.82 0. 2Hochheimer (2007). 5Skinner et al (2003).00 68. seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan. Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan.70 Subur Lumpur berpasir 90 cm 2.17 23. Kecerahan air di kolam penelitian antara 20 – 60 cm.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2.35–0. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.04–0.60–90. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan.20–6.50–7.

Chinese Academy of Fisheries Sciences. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera. dkk pada perairan yang bening. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12. Yuniarti. Imperial Leaflet. 1856). Pearl Aquaculture Research Foundation. 1900. Armico. DKP. Dev. AR. Invertebr. 2007. H & G. DAFTAR PUSTAKA Anonymous 2005. Areekijseree. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. S. Pontjoprawiro & M. Balai Budidaya Laut Lampung & FAO/UNDP. 1991. G 2000. Moorken. Hyriopsis (Hyriopsis) bialatus Simpson. EA. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel. P. No.2 %). Fishing leaflet. Rome. R. Thongpan. Oliver.. Irish Wildlife Manuals. Hongkong. Jiangsu Province China. Kovitvadhi. M. Dan. B. U. 1999. Jakarta. Rojali. Kovitvadhi. Budidaya Mutiara. Washington DC.35. INS/81/008. Cahn. 2008. Freshwater Pearl Culture and Production in China. 1–11–2008.2 %). S. 2000. United Kingdom. Machado.1–11–2008. info@pearl. Imperial Real Question Real Answer. Murdjani. Engkagul. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature. Diamon Graphics. Pearl Culture in Japan. Anonymous 2007. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1. Gasperz V. Memasukkan: Maret 2009 Diterima: Juli 2009 78 .T. Kovitvadhi.Rachman. Part 1: Biology of the species and its present situation in Ireland. Winanto. Sintasan terbaik pada kedalaman air 30 cm (79.357. Rachman. Aquaculture 275: 169-177. Bandung. india. berarus dan mengandung cukup kalsium. 1986. Kovitvadhi.in. A. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp. A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea.source. AK. 1949. Peterborough. 2006. Reprod. T. Pagcatipunan. Juhaman. 1992. U. P. &D. A. 49: 255-262. S. The Pearl Source. Laporan Tahunan.. Sonkar. sales@ thepearl. 2007. Ruobo.3 mm). Metode Perancangan Percobaan. Sawangwong &J. FAO. & K RungruangsakTorrisen. 8.com .

Pulau Waigeo. According to ordination analysis there were five community types. Pangium edule. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas. All trees (dbh.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. Raja Ampat. Pulau Misool. lowland forest. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. Pulau Salawati. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. and Duabanga-Pterocymbium communities. Anthocephalus macrophyllus. Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. which might be a characteristic of vegetation of Papua and the nearby small islands. Papua. In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. Ficus-Antocephalus. Toxotrophis illicifolius. Balgooy 1976). and determined their positions. Raja ampat. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). dan Pulau Batanta. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. Raja Ampat. hutan dataran rendah. e”10 cm) within all of 17 plots were measured. Aporusa–Pometia. and identify their species. Keywords: Vegetation. However floristic compositions varied among plot sites. Sterculia-Grewia. Raja Ampat. Antocephalus-Toxotrophis. Papua Kata kunci: Vegetasi. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. Almost all of common species such as Pometia pinnata. and Koordersiodendron pinnatum. Yensawai (7 plots) and Wailebet (5 plots).

beraneka burung kakatua dan nuri.Edi Mirmanto beragam pada saat ini. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. (Anonim 2006). yang terbentang antara 130º31’7. Namun demikian secara umum kondisi vegetasi masih cukup baik. Yensawai dan Wailebet (Gambar 1). 80 . yang meliputi daerah datar sampai berbukit. dengan kondisi vegetasi yang bervariasi pula.3"–0º54’19. dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air.2"–130º53’28. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi.4" BT dan 0º47’ 27. Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta. Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora. rentan terhadap kerusakan dan peka akan gangguan. di samping pantaipantai berpasir putih yang indah. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas.9" LS. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS. yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. kuskus waigeo. cendrawasih Wilson. Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi. Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil. Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut. maleo waigeo. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006). dengan ketinggian mulai dari 12 sampai dengan 147 m dpl. Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap.

Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam. 8=Kalituris).Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar. Yensawai (3=Waringkabum. lokasi berdasarkan pengukuran dengan GPS) Gambar 2. Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris. bergelombang sampai berbukit. dan Warai. (Peta diperoleh dari httw://www. berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat. 2=Kafnain).com) 81 . Korpak. dengan kondisi vegetasi yang relatif tidak terganggu. Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit.cityseahorse. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib. 4= Wartandib. 5=Korpak. dengan kondisi medan secara umum datar. 6=Warai) dan Wailebet (7=Kaliyakut. Gambar 1. Rata-rata curah hujan dan temperatur udara di daerah penelitian.com/irian-jaya.html. Vegetasi di daerah ini pada umumnya belum terganggu. Waringkabum.

Di salah satu DAS telah dibuat bak penampungan air. Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi. Alangiaceae. Verbenaceae. Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA. dominansi. kerapatan. Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak). Sapindaceae. frekuensi relatif kerapatan relatif. diidentifikasi jenisnya. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak. dengan menggunakan perangkat lunak MVSP 3. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu . (1965). Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). dan nilai penting. Euphorbiaceae. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm. Dari 40 suku yang tercatat. dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). diikuti oleh Sterculiaceae. yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2). ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. Beberapa suku diantaranya Lauraceae.1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. yang tersebar pada medan maupun kondisi vegetasi yang bervariasi. Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting. diukur diameter batang setinggi 1.Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar. Flacourtiaceae. Anacardiaceae.com).3 m dari atas tanah. dan Rubiaceae. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al. 82 dominansi relatif. yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). Sapotaceae. Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. Yensawai (7 petak) dan Wailebet (5 petak).

7 39.0 18. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.0 4.4 17.1 31.9 2.8 41.5 50.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).1 1. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3.8 7.0 1.9 21.1 6.1 21. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58.1 21.9 0.6 2.9 1.1 1.9 19. Pometia pinnata bersama Anthocephalus macrophyllus.2 3.5 5.2 3.2 36.1 5.3 37.9 3.0 100.0 100.7 11.6 25.3 2.3 7.2 2.1 9.8 21.4 4.0 100.4 6.2 3. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya.4 4.1 6.0 100.9 10.0 2.2 19.3 2. tetapi memeiliki kerapatan dan frekuensi yang rendah.3 100. Pangium edule.6 16.7 1.6 5.5 1.6 30.0 2.4 3.0 1.1 3.1 100.9 4.3 16.0 31.4 10.1 15.6 17.7 8.8 2.0 14. tetapi dengan pohon-pohon berukuran relatif kecil.4 8.6 2. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi.8 17.6 4.6 1.6 34.1 2.3 2.1 17.0 100.8 1.6 4.7 3. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi.7 13.8 12.1 4.6 3.6 24.3 17.6 3.1 3.8 3.4 30.4 1.0 100.4 3.0 83 .7 7.5 1.0 1.0 Rata-2 20.5 44.4 1.8 5.8 14.4 9.0 33.9 26.1 13. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.1 5.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).0 100.2 11.6 21. Toxotrophis illicifolius.0 100.0 100.0 7.7 4.7 6.3 1.8 9.0 2.1 2.3 8.7 11.3 17. Struktur hutan Tabel 1.8 %.2 4.2 2.0 100.0 100.0 2.1 13.8 4.9 16. Pada Tabel 2.0 100. berukuran besar dengan jumlah individu relatif banyak.0 100.5 11.0 8.1 8.7 41. Berdasarkan nilai penting (NP) tertinggi.3 13.1 25.3 25.7 32.0 100. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.4 25.2 19.6 100.3 4.4 14.7 23.9 7.1 31.4 5.0 Petak pencuplikan data B C D E F G H I J K 1.5 12.6 1.0 1.7 6.9 17.2 12.1 0.5 1.0 6.8 13.1 35.0 22.4 19. Jenis-jenis tersebut umumnya tersebar cukup luas. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.0 100. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.3 14.2 24. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.3 9.7 L N O P Q R 14.

Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al. Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon.5 dan 18. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol. yang menunjukkan adanya rumpang atau daerah terbuka. Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm. dan lapisan-III antara 9. Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5).5 m. Gambar 4. 1965). Akan tetapi proporsi jumlah individu nampak tidak seimbang. Disamping itu diperkirakan bahwa setelah mengalami gangguan. Sebanyak 2% pepohonan menempati lapisan I.5 dan 28 m. menunjukkan pola persebaran diameter pohon yang cukup menerus. sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan. Gambar 3. yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm). ditandai dengan adanya individu pada semua kelas diameter. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 . pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi. 6% pohon menempati lapisanII. dan 39% pohon menempati lapisan III. sedang pepohonan dengan tinggi di bawah 9. lapisan-II antara 18. Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus.5 m merupakan jenis-jenis ternaungi. Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m.Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal.

80 6.73 2.59 5.33 3.00 DR 7.34 100.17 3.03 13.01 2.44 2.02 2. Penyebaran spasial beberapa jenis disajikan pada Gambar 6.30 0.31 299. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.00 NP 18.43 0.35 3.88 9.43 0.09 150. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.03 1.98 4. yaitu dengan nilai Indeks Morishita berkisar angka satu.98 2. Pometia pinnata dan Anthocephalus macrophyllus. Secara keseluruhan persebaran pohon cukup merata.25 4.05 9.58 2.16 3.87 0.02 1.40 5.24 1.87 1.43 3. Nilai frekuensi relatif (FR).63 37.87 0.73 1.86 1.33 3.80 1.43 62.68 3. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.00 KR 6.03 50.37 2.77 2.74 4.30 5.87 0.83 1.66 4.27 2.50 2.42 2.69 2.73 0.73 7.63 2. baik antar jenis maupun antar lokasi.44 1.18 2.49 7.99 85 .03 3.75 1. yang menunjukkan adanya perbedaan pola persebaran.16 1.23 1.66 1.31 6.30 2. Tabel 2.43 2.73 1.04 10.69 5.02 7.04 1.35 2.58 1.87 100.10 100.30 1.33 5. Intsia bijuga.78 1.12 5.03 2.77 1.45 2.03 2.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon.63 3.60 3.54 6.02 3.01 4.84 2.22 3.

J).G. Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6). sehingga kemungkinan sudah banyak ditebang.I. R) di daerah Wailebet. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar.E) dan Yensawai (F. kelompok B terdiri atas 3 petak (A. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7). 86 . Antiaris toxocaria. Permudaan alami jenis Instia bijuga berjalan kurang baik.P). Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4.K. ditandai dengan rendahnya individu pada tingkat semai dan belta. Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak.L) dan Wailebet (O. Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data. sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi. Kelompok A terdiri atas 2 petak (Q.B.D) yang terdapat di Yenanas. kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H. Anthocephalus cadamba. kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C.Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule.

L-II=pohon pada lapisan II. Gambar 6.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5. L-III=pohon pada lapisan III. Stratifikasi hutan secara umum di daerah penelitian. (M=pohon menonjol. N= pohonpohon ternaungi). L-I=pohon pada lapisan I. Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 .

komunitas Aporusa–Pometia.4 % total basal area dalam komunitas ini. Berdasarkan jenis-jenis dominan pada setiap kelompok. 2. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan. komunitas Sterculia-Grewia. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea. komunitas Antocephalus-Toxotrophis. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia.4 -0. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia. dan 5. 3. dapat ditentukan menjadi lima tipe komunitas.4 0.4 Gambar 6. Ke 4 jenis tersebut mencakup 48. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar. Alangium javanicum dan Pimeleodendron ambinicum. Grewia paniculata. 0. Ke lima jenis dominan tersebut meliputi sebanyak 34. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus. dengan proporsi dominansinya mencapai 61.4%. Jenis-jenis Sterculia cordata.0 SUMBU-X 0. 4. yaitu 1. yang lebih rendah dari pada dua komunitas sebelumnya. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0. komunitas Duabanga-Pterocymbium.4 Toxotrophis illicfolius.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. Artocarpus altilis.7 % dari total basal area. Pometia pinnata. komunitas Ficus-Antocephalus. Pometia pinnata.

2003). tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. Ficus variegata. data belum dipublikasikan). tidak terdapat dalam komunitas lain. Artocarpus altilis. Koordersiodendron pinnatum dan Cryptocarya multinervis. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. atau terdapat dalam proporsi yang rendah. Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. 2001. Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. misalnya Waigeo (Mirmanto. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. serta dengan komposisi jenis yang berbeda pula. Hampir semua jenis dominan tersebut. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Artocarpus communis. Simbolon. Canarium maluensis. kecuali Koordersiodendron pinnatum. PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. yaitu sebanyak 56 jenis pohon. Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA. Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. seperti Geser (Mirmanto & Ruskandi 1986). Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan. Kari-munawa (Yusuf dkk. Nusakam-bangan (Partomihardjo dkk.Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . maupun luas daerah penelitian. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. 1998). Pterocymbium tinctorium . Dari jenis-jenis yang tercatat. Pometia pinnata. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada. 1995. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Krakatau (Tagawa 1992). Ficus tinctoria. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. Anthocephalus macrophyllus. 2006). dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan.

hanya terdapat dalam jumlah yang relatif sedikit. Mallotus mollisimus. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. Inocarpus fagiferus dan Instia bijuga. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata. meskipun secara struktural sudah mendekati kondisi hutan alami. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. Pimeleodendron ambinicum dan Endospermum moluccanum. Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk).Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder. dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu. yang rata-rata berukuran cukup besar. Ficus spp. dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp. Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. juga mempengaruhi kesamaan komposisi jenis.. . Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama.

& Life. Irian Jaya. Yoda. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. 1972. Roemantyo & S. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. 1959. van. Prawiroatmodjo. MMJ. H. D. Toxotrophis illicifolius. 2001.E. John Wiley & Sons. Cilacap-Indonesia. 1965. 4: 13-48. & H. (Biol. 1986. Sci. Kyusu Univ. Pangium edule. Anthocephalus macrophyllus. H. Ogino. Phytogeography.). Tipe-tipe vegetasi cagar alam pulau Supiori. In: K. HB. Laporan Perjalanan. Dalam: H. New Guinea Vegetation. Kabupa91 . Partomihardjo.. Mueller-Dombois. New York. of first GTI Regional Workshop in Asia.). Partomihardjo. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak. Sambas & S. Morishita.. Propinsi Irian Jaya Barat. E. Apasutaya. vegetation and floristic notes of Nusakambangan Island. Mem. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Doc. Malaysia: 106-111. E. Laporan Teknik 1995. 2001: 39-48. Structure and floristic composition. 1995. Puslitbang Biologi-LIPI. Ellenberg. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. Mirmanto. Shidei. 1976. T. T. Global Taxonomy Initiative in Asia. Ratnawongse & C.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata.. Purwaningsih. 2003. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. Prawiroatmodjo. Report and Proc. 2006. Simbolon. Ruskandi. K. Ogawa. Ser. Paijmans (ed.). Biological diversity of small islands: Case study on landscape. 1-22. Analisa vegetasi hutan dataran rendah di pulau Geser. EN. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. Putrajaya. 2: 215-235. Maluku. M. Simbolon (ed. Measuring the dispersion of individuals and analysis of distributional patterns. 1995. Asia of forest vegetation in Thailand. T. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. Nat. Fac. K. hal 34-45. I. D. & A.. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. Aims and methods of vegetation ecology. Berkaitan dengan kekhasan vegetasi hutan. DAFTAR PUSTAKA Anonim. Comperative ecological study on three main types in S.

hal. No. H. Irian Jaya. & JHA. Yusuf. 2006.N. Simbolon. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea. 17-31. EB Walujo. CGGJ. 28 (2): 175-183. 1951. Dalam: H. Irian Jaya. Pusat Penelitian Biologi LIPI. 1992. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah. H. van. Dalam: AJ Arief. Laporan Teknik 1995. Ekol.). Julistiono (ed. Laporan Teknik 2006. Indonesia. Jakarta. vol. Ferguson. Flora Malesiana. Studi vegetasi P. R.. IV. Karimunjawa. Schmidt. 92 . FH. Mulyadi & H. A. Tagawa. Ruskandi. Karimunjawa dan bebrapa pulau kecil lainnya. 2 (3): 1-11. Steenis. hal 54-72. Series I. Jakarta. Puslitbang BiologiLIPI.).42. 1948. Noordhof-Kolff NV. di kawasan T. Primary succession and the effect of first arrival on subsequent development of forest types. Simbolon (ed. 1998.Edi Mirmanto ten Biak Numfor. Verhandelingen. Kementrian Perhubungan. Geo J. Wardi & Dirman. Djawatan Meteorologi dan Geofisika.

) Nielson Crudia reticulata Merr. Endospermum moluccanum Glochidion zeylanicum A.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr. DILLENIACEAE Dillenia ovalifolia Hoogl.) Endi Croton argyratus Bl. Semecarpus australiensis Engl. Jass Macaranga aleuritoides F. Muller. Intsia palembanica 93 .) Pax & K.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1. Alstonia scholaris R. Mangifera indica Parishia insignis Hook. Instia bijuga Kurtz.) MA Mallotus mollisimus (Geisebr. Mallotus philippinensis (Lam. Tabernaemontana sphaerocarpa Bl. Raja Ampat. Inocarpus fagiferus Fosb. Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl.Br.) MA Mallotus rufidulud (Miq. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta. Osmoxyon sessiliflorum (L. CELASTRACEAE Siphonodon celastrinus Griff. Drypetes glabridiscus JJS Drypetes longifolia (Bl. FABACEAE Archidendron jiringa (Jack.) Kosterms.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K. Polyalthia glauca Boerl. Polyalthia diversifolia Miq. Bridelia insulana Claoxylon longifolium (Bl. Cynometra ramiflora L.Hofm. Macaranga tanarius (L. CLUSIACEAE Garcinia dulcis (Roxb.) MA Pimeleodendron ambinicum Hassk. Polyalthia laterifolia King Polyalthia subcordata Bl.) A.) Baill. Suregeda glomerulata (Bl. EUPHORBIACEAE Aporusa cf dendroidea Schot. ANNONACEAE Spondias cytherea Sonnerat. Lepiniopsis ternatensis Val. ARALIACEAE Gastonia papuana Miq.) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. Mitrephora diversifolia Miq. APOCYNACEAE Popowia beccarii Scheff.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq.S. Teysmaniodendron hollrungii (Warb.

Litsea ladermnniii Tschn. Aglaia goebeliana Warb Aglaia korthalsii Miq.) Hk. Cryptocarya caloneura (Scheff.f.Rob.)Schouten Gymnacranthera panniculata Val.)Kost. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc. Dysoxylum densiflorum (Bl.f.) KN Parker Chisocheton ceramicus Miq.) Forsb Artocarpus communis Artocarpus varieseanus Miq.) Benth. Litsea forstenii (Bl. Cryptocarya multinervis Teschn.)C. Litsea timoriana Span. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl. Litsea firma (Bl. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park. Horsfieldia hellwigii (Warb. Chisocheton lasiocarpus (Miq. Ficus glaberrima Bl. Litsea glutinosa (Lour.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq. Horsfieldia bivalvis (Hk. Et Binn. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf. Horsfieldia irja (Gaertn) Warb.f.)Miq.)Sincl.)var. Ficus botrycarpa Miq. Ficus variegata Bl. Toxotrophis illicfolius Vid. Trophis philippinensis (Bur.Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb. LECYTHIDACEAE Planchonia sp.) Boerl.) Merr.)Valeton Dysoxylum arborescens Miq.)Kosterm. Litsea calophylantha K.) Merr. Schum. Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl.B. wieringae Kosterm.)Sleum Gonocarium littorale (Bl. Purverulenta (Warb. 94 . Lansium domesticum Correa Sandoricum koetjape (Brom.

Schum. 95 . TILIACEAE Grewia paniculata Ridl. Morinda citrifolia L. Et K. RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Schum Pertusandian multiflora (Hw. Myristica curcullata Mgf. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC.f. Psychotria diplococea Landeri Valeton Tarenna barbellata Val. Br. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L.)Merr.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp. Chrysophyllum roxburgii G. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L.)Risdl. sp. Pavetta platiclada K.) Chew Pipturus argenteus Widd.) Havil. Pterocymbium tinctorium (Blanco) Merr.J. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F.J.)Tirveng Anthocephalus cadamba Miq.v Muell Sterculia cordata Bl. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour.petiolans Pometia pinnata Forst. Myristica lanceifolia Bl. Scott. RUBIACEAE Adina racemosa (Caw. Neonauclea clemensii M. Palaquium sp.L Palaquium lobbianum Burck Palaquium obovatum Burck.) Merr & Perry Syzygium pteropoda Lauterb. OPILLIACEAE Chaemperia manillana (Bl. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R.)Merr. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L. Sterculia cymosa Wall. Harpulia petiolans Radlk sub. Et B. Anthocephalus macrophyllus (Roxb.P. ROSACEAE Prunus javanica Miq. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl. Myristica inutilis R. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb. NYCTAGINACEAE Pisonia longirostris T. Don Madhuka leucodermis H. Br.

Br. v Will.Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R. Vitex quinata (Lour. Memasukkan: April 2009 Diterima: Juli 2009 96 . Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Vitex glabrata R. Br.) F.

Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). All of tested isolates showed potentially high toxicity against maize stemborer. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997). Kerusakan yang diakibatkan hama tersebut sangat bervariasi. Ostrinia furnacalis. PCR. 2 Balai Besar Karantina Ikan Soekarno-Hatta. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). cry1A. Cib 551. 243. and second was 986 bp. the expected size of Lep1A-Lep1B primers. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam. thuringiensis. yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984).id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. Habib Rizjaani1. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. These isolates were Jtg 2151.Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. timbulnya hama resisten. diperlukan cara lain selain hanya dengan pestisida. thuringiensis. Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . first was 490 bp. yaitu matinya organisme non-target. From 59 tested isolates. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7.7 milyar dolar Amerika (Bent & Yu 1999). maize stemborer. 6 of them gave PCR products. Ostrinia furnacalis. two DNA bands.net. Oleh karena itu. Ostrinia furnacalis Guenee 1 Bahagiawati1. Agustina K. Lam 752. Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. Key words: B. Email: bahagiawati@indo. cara tersebut antara lain dengan mempergunakan biopestisida. the expected size of Lep2A-Lep2B primers. PCR. Kata kunci: B. cry1A. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. di antaranya dengan menggunakan insektisida kimia. Lam 762 and C 522.

penggunaan antibodi monoklonal. Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. dan berbagai bangkai serangga (Carozzi et al. thuringiensis subsp. kependekan dari kata crystal. Santoso et al. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. antara lain analisis Southern blot. cukup sensitif. strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. dan mudah digunakan dalam kegiatan rutin (Carozzi et al. Bakteri ini dapat diisolasi dari berbagai bahan. thuringiensis masih terus dilakukan. & Sibuea wati 2002). 1991). bubuk biji-bijian.Bahagiawati. dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. 1991. Smith et al. Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. Bogor digunakan sebagai bahan dalam penelitian ini. Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. 1991). thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). Sebagai kontrol negatif dipakai akuades. permukaan daun. dan telah diidentifikasi berbagai jenis protein Cry. relatif cepat. Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan. Rizjaani. 2000). Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989). karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. seperti dari tanah. 1991). 2001). Selain itu. Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. 1991. BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. selanjutnya disebut dengan Bt. 1992) yang dimodifikasi seperti . Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel.

masingmasing 500 μl. masing-masing bagian makanan diinokulasi 2 ekor larva. permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut. Pengujian toksisitas dilaksanakan dengan memakai serangga O. Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm. Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). furnacalis mengikuti Bahagiawati et al. Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10. Uji toksisitas. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. Rerata persentase kematian. (2003). Pembuatan makanan buatan. Uji toksisitas isolat B. hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. Setelah makanan buatan tersebut membeku. analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. (2002). berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. Sebanyak 1 ml suspensi B. dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. (2003) dengan modifikasi sebagai berikut. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. thuringinesis terhadap larva O. lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan. sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. furnacalis yang diperbanyak pada makanan buatan. Selain itu. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. Setiap cawan mewakili satu ulangan. 99 . Jika terdapat perbedaan antara rerata perlakuan yang diuji. thuringiensis lokal yang disaring. Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1). (2003). dan masing-masing perlakuan diulang sebanyak 3 kali. Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. Ada tidaknya perbedaan antara data persentase kematian.0 for windows. berat.

Bahagiawati.94a (1) a 0.613a (5) a 0. Cib243(2). Analisis data persentase kematian.03 (1) 0. Tabel 1. Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O.07a (2) a 0.49b (30) 0.23 (2) 1. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan.33b 96. Lam752(4). furnacalis Data uji toksisitas terhadap larva O.33b 96. furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1. Rizjaani.00a 83.67b 83.03a (1) a 0.78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0. Kontrol positip.77a (1) 0.04 (4) 0.003 (1) 1.133a (5) 2.91a (5) a 0.67b 96. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 .67b 86. kontrol negatif akuades (-). furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1. Cib551(3).77a (5) 2.20 (1) 0. Lam762(5) dan C522(6). Produk PCR dari beberapa isolat Bt lokal Jtg2151(1). & Sibuea Uji toksisitas isolat terhadap O. dipel (+).67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5.90b (30) 13.05.30b 96.

C.0133 R2 = 0.98).Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel.97).409 R2 = 0. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan. Larva-larva yang masih hidup ini terlihat lemah. namun berbeda nyata dengan kontrol negatif akuades.04-0. kematian serangga mencapai 83.5 mm.9 mm. dengan berat tubuh yang relatif kecil yaitu 0. Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0.13 mg dan panjang tubuh hanya 2.1137x + 1. dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi.7 mm-2. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0.7726 R = 0.9 mg dan panjang tubuh 13. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt. Kedua analisis di atas menunjukkan hubungan yang terbalik. B.0609x + 5. Berat tubuh larva-larva tersebut mencapai ratarata 5. yaitu makanan buatan yang tidak mengandung suspensi Bt. berat tubuh dan panjang tubuh larva 101 .9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0.6 mm untuk panjang tubuh.1311x + 13.9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2. Regresi linier antara: A.7 mg untuk berat tubuh dan 0.3%.9753 Gambar 3. Pada kontrol positif (Dipel). persentase kematian dan berat tubuh. Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0. demikian juga dengan panjang tubuh larva (R2 = 0. Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan. persentase kematian dan panjang tubuh.

PEMBAHASAN Seperti yang telah dikemukakan. Santoso et al. namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B. belum pada tahap bioasai toksisitasnya terhadap hama target. adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama. Rizjaani. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. 1992). mereka memakai 2 pasang primer.97) berbanding lurus. furnacalis. Hasil penelitian kami memperlihatkan hasil yang lebih akurat . Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung.Lep2B.7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008). 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0. Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda. masing-masing Lep1A-Lep1B dan Lep2A. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt. 2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. Pada waktu Santoso et al. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup. Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. dimana pada tahun 1999 mencapai $300 juta.Bahagiawati.

Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb. Berdasarkan hasil uji toksisitas isolat B. Cib 243. thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. 1994). Ceron et al. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. dan aktifitas makan menurun. Empat isolat yaitu Jtg2151. furnacalis. yaitu bioinsektisida Bt yang telah dikomersilkan. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. Pada hasil penelitian Santoso et al. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. Larva yang memakan toksin Bt. 103 . 1991). tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva. 1998). setelah beberapa hari tampak kecil. Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989. Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. KESIMPULAN Dari 59 isolat yang diuji. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. gerakannya lambat. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. furnacalis. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel.

Bravo. 57(11): 3057-3061.Bahagiawati. Pros. Advances in Agronomy 66:251298. Econ Ento. Brent. 39. J. Biotek. 1991. Wereng coklat dan pengendaliannya dalam prespektif. FM. Lina & A. J. RE. E. Kingston. Santoso. oleh Van der Laan. Mikro. Microbiol. Ithaca. 1983. PT Ichtiar Baru-Van Hove. DD. L. Perta. Moore. 60: 353-356. H. Bacillus thuringiensis: insects and Beyond. Smith & K.Y.A.G. Perhim. L. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. E. Envi. Whiteley. & HR. Indo.. James. Struhl. 53(2): 242-255. Microbiol. & N. Rijzaani. cry 1A(c) dengan PCR. Listanto. Warren. Jakarta. Quintero.insektisida. Second Ed. M. ISAAA. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). J. WS. cry1A(b). Ausubel. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. Aranda. Insecticidal crystal protein of Bacillus thuringiensis. Bio/Technology 10: 271275 Höfte. Appl. Soegiarto & MS. 1999. B. J. John Willey... A F. C. 1989. Covarrubias. Bahagiawati. & L. ISAAA Briefs. Indone. Payne. NB. 2008. & Sibuea DAFTAR PUSTAKA Abbot. J. Pest of crops in Indonesia. Masalah dan . 18: 265-267. Ortiz. Carozzi. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. S. No. Kim.. Micro. J. Kramer. Applications of Molecular Biology to Plant Disease and Insect Resistance. Envi. Ortiz. Appl. 2002.. Rev. JG. Oka. Seidman. Feitelson.A. Kalshoven. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. 1994. Global Review of Commercial Transgenic Crops: 2008. 1992. GW. R. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. Riani Simanjuntak. New York. D. Koziei. Bahagiawati. A. IN. Surabaya 12-14 Maret 1997. Ceron. 1981. & IC. 1925.. Sutrisno. A method of computing the effectiveness of an insecticide. Rizjaani. Yu. Bul. H. Evola & M. 8(1): 2730. 2003. Agrobio 5(1): 21-28 Bahagiawati. Sem.7(2): 35-38. 1992. 2002. N. Bent. VC. R. S. LGE. B. Sarjono. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. Mikro Indo. 1997. Buletin Agrobio: 4 (1): 1-8. Penggunaan Bacillus thuringiensis sebagai bio. JS.. Bahagiawati & Amirhusin. P. & Bahagiawati AH. Brotonegoro. Setyawan & Sutrisno. 2001.

Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi. Baum. 57: 311-315. Crickmore. Environ. & GA. Pengendalian terpadu hama padi. Dean.H. Santoso. Smith. Mol. Feitelson. N.. Schnepf. Bogor. IN. Oka IN. Memasukkan: April 2009 Diterima : September 2009 105 . The phylloplane as a source of Bacillus thuringiensis variants. J.. E. J. Lereclus. Rodiyah. Padi-Buku III: 653-680. Perhimpunan Entomologi Indonesia Cabang Bogor. D. 1984. & Soehardjan. Risalah lokakarya penelitian padi. Jurnal Bioteknologi Pertanian 5(2): 53-60. Bacillus thuringiensis and its insecticidal crystal proteins. Damayanti & Sutrisno. TJ. 1991. J. 22-24 Maret 1983. Rev. van Rie. & Bahagiawati AH. Zeigler & D. Oka. Cibogo. Biol. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR. 63(3):775-806.R. 1998. Tantangan entomologi pada abad XXI. RA. D. Appl. Microbiol. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Couche. D. E. 1997. Listanto. 2000.

Jl. Nitrosomonas. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. Bacillus. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Chromobacterium. Spaerotillus natans. Azotobacter. Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. Citrobacter. Nitrosomonas. and Spaerotillus natans were soil bacterial isolates.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI. Citrobacter. Bacillus. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. Rhizobium . Chromobacterium.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L). E-mail: widadomon@yahoo. Those isolates were used as inoculants. The soil was collected from numerous places around Pontianak. Rhizobium. Bacillus. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition. Raya Jakarta-Bogor km 46. Nitrosomonas. West Kalimantan. Bacillus. Keywords: Jatropha curcas L. Kata kunci: Jatropha curcas L. and neither to bare soil dresses with compost.. respectively. Spaerotillus natans. plant height was accelerated quickly while other inoculants affected to stalk diameter development. inoculants. Azotobacter. Kandungan minyak mencapai 40% 107 . Genera of Azotobacter. Citrobacter. Rhizobium . Cibinong Science Center. In the presence of inoculants. Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. and formulated to single and mixed bacterial inoculants. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran. Chromobacterium.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. and Nitrosomonas spp.. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). That selective inoculant has opportunity to be used for jatropha farming. inoculants.

Azospirillum liboferum. Badran & Safwat 2004. atau setara dengan 1. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. Bacillus. dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. Lewis et al.6 metriks ton minyak jarak hasil produksi tanaman per hektar. Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. BAHAN DAN CARA KERJA 1. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak. dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. Nitrosomonas. Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot). 2007). Perlakuan bakteri Azotobacter chroococcum. Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. Chromobacterium. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). Pusat Penelitian Biologi LIPI. ElGhadban et al. Bakteri yang berhasil diisolasi adalah Azotobacter. Citrobacter. Kandeel et al. Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008). sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. dan Spaerotillus natans. 1995. Kalimantan Barat. Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. serapan hara. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar. 1991. Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan .9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978).Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. Rhizobium spp. sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. 2006). 2002. 2006). yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al.

05 g (NH4)2SO4. 2. perlakuan kompos tanpa mikroba (P-8).6H 2 O. kemudian dikondisikan pada pH 7. dan P-17. sebagai inokulan P-3. yang diisolasi dari tanah asal Rasau Jaya. Citrobacter.05 g yeast ekstrak dan 0. P16. masing-masing sebanyak seperempatnya atau 7.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit.5 ml sediaan dari inokulan Azotobacter. dan Bacillus spp. Satu dari tiga kecambah yang terbaik pada setiap pot 109 . dan Nitrosomonas spp. 0. 0. 0. 0.5 g Ca3PO4. 1.5x107 Citrobacter.01 g MgSO4 7H20. Singkawang. dan 2. 0.2x107 Rhizobium. Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera). 1. atau sebagai inokulancampuran beberapa-genus (multi-genera). yang diisolasi dari tanah asal Rasau Jaya. 0. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding.001 g FeCl 3 . Bacillus. digoyang pada kecepatan 150 rotasi per menit. yang masing-masing diambilkan 10 ml dari BI.8x107 Nitrosomonas. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos. Pontianak. Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter.3x107 Spaerotillus natans sebagai BahanInokulan (B-I). Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6). Media tadi mengandung: 1 g glukosa. Mandor. dan kemudian diformulasikan seperti pada Tabel 1. Sambas. Citrobacter. kemudian ditempatkan di dalam rumah kaca. dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2.001 g MnSO4 H2O. 1. 3x10 7 Chromobacterium. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus. Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan. perlakuan kompos sekam ayam (P-7). diinkubasi selama 7 hari. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count. Karoho. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji.02 g KCl. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya.

Nitrosomonas spp. (isolat tanah Rasau Jaya) Nitrosomonas sp. dan Nitrosomonas spp. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. (isolat tanah Karoho) Azotobacter. (isolat tanah Singkawang) Citrobacter sp. (isolat tanah Mandor) Azotobacter. Rhizobium sp (isolat tanah Ketapang) Azotobacter. dan Nitrosomonas spp. Bacillus. Bacillus. Chromobacterium. Bacillus. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . Citrobacter. Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. Bacillus sp.Widawati & Rahmansyah Tabel 1. Citrobacter. Citrobacter. Bacillus. dan Nitrosomonas spp. (isolat tanah Sambas) Azotobacter. Nitrosomonas. Bacillus. Citrobacter. dan Nitrosomonas spp. Citrobacter. kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. Bacillus. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. Bacillus. Bacillus. Azotobacter sp. (isolat tanah Pantai Singkawang) Azotobacter. beserta kontrolnya. Citrobacter. dan Nitrosomonas spp. dan Rhizobium spp.. dan Nitrosomonas spp.

Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh. P-12. P3. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 .305 1 5 13 17 9 UCL = 22. P-13.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp. P-14. P-6. P-15. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5. P-4. sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. 8. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. dan P-17. P-16. 1. yang umumnya berukuran di atas nilai tengah (center). P-7. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13.0. P-14. P16. dan P-15.231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst. 2. P-12. P-10. sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst). sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. Tanaman yang tidak diberi inokulan pada no. P-13. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2.377 Center = 17.627 Tinggi tanaman (cm) LCL = 51. dan P-17 untuk perlakuan inokulan satu jenis. P-2.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. P13. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5. P16. dan P-17. P-15. dan 14 mst (Gambar 1).804 UCL = 79. 11.1.

atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos. 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya.95). Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. dan Bacillus spp. namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4).. P-A. inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp. yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman . sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. akibatnya dapat memperbaiki serapan air. P-H. atau bahan organik lainnya. Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. dan P-I (Gambar 3). memperkecil erosi. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. kompos. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. dan PC bila dibandingkan terhadap P-E. dan P-F sebagai kontrolnya. Sekalipun pada hasil yang lain. dan P-C (Tabel 2). P-B. PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan. dan memperlancar serapan hara oleh tanaman (Ogunwole et al. Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. memperbaiki struktur akar. sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis. baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal.Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10.

95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2.93 UCL = 19.931 50 LCL = 46.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.103 32 10 UCL = 9.377 (mm) tanam an Center = 44.344 Center = 11.314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14. dan 14 mst.126 70 20 18 16 60 Center = 59. 8.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33.627 60 50 40 30 LCL = 51.305 UCL = 79.774 UCL = 22. Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata.745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73.295 24 8 Center = 7.66 LCL = 19.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65.637 LCL = 8.615 9 28 Center = 26. 11. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 .486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56.647 LCL = 11.231 Center = 17.52 Center = 15. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5.637 7 6 20 LCL = 5. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.804 LCL = 13. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat.

dan Nitrosomonas spp Azotobacter. Bacillus. dan Rhizobium spp Azotobacter.kontrol 2 (tanpa inokulan) . Citrobacter. Citrobacter.Widawati & Rahmansyah Tabel 2. Nitrosomonas spp. Citrobacter. dan Spaerotillus natans Azotobacter. Bacillus. dan Nitrosomonas spp Azotobacter. Bacillus. Citrobacter. dan Nitrosomonas spp. Bacillus. dan Nitrosomonas spp. Citrobacter. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F . Bacillus.kontrol 1 (tanpa inokulan) . Bacillus. Chromobacterium. dan Nitrosomonas spp Azotobacter. Bacillus. Nitrosomonas. Citrobacter. Azotobacter.kontrol 3 (tanpa inokulan) . Bacillus. Azotobacter.kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 .

80 A C G H 0.7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0. 8. dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC).00 1.904 Gambar 3. dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman.00 0. Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis.60 0.80 0. atau tanpa kompos (P-F).20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1.40 0. 115 .722 * X.20 1.20 0.40 0.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar. R^2 = . namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus).649 + 1. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F).60 0.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4. fraksi atau serpih tanah.904 Y = 23. Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al. Kecepatan tumbuh batang hasil pengamatan 5. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E).20 0. serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya. 11.7 x + 23.00 0.

dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. dan klorofil daun bila dibandingkan terhadap kontrolnya. Venkateswarlu. Gnanamanickam. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri. Johnson. M. Plant Biotech. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. FS. AC. Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan.. Bacillus. Narayanaiah. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. 2004. Isolat bakteri yang diperoleh dari tanah asal Pontianak.: an important biodiesel plant. Rao & B. improves seedling . & TS. Ch. 2:7–11 Desai. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. Bakteri Bacillus spp yang diujikan oleh Desai et al. Agric. biomassa. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan. 82(2): 247256.. Seed inoculation with Bacillus spp. 2007.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. Ch Kumari. S. & MS. yang mana keberhasilannya terjadi seperti pada pengujian ini. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization. Deore. Rep. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. Egyptian J. Res. luas daun. GR. S. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. 2008. Kalimantan Barat. Reddy. dan Nitrosomonas spp. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. DAFTAR PUSTAKA Badran. bobot akar. Safwat. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). yang diisolasi dari tanah asal.

Res. Wani. A. Shrivastava. Mangkoedihardjo. Vietnamita. Agrophysics. J. International Conference on Environmental Research and Technology (ICERT).Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. Scien. L. Daudu.Inte. Chikara. Gangrade & KC.): influence of additives.. Soils. ES. Ain Shams Univ. 58(3): 245 – 251. Effect of biofertilizers on the growth. 21: 361-366. Elefan. Maheshwari. Patolia. for phytoremediation of lead and cadmium polluted soil. Influence of biofertilizers on growth. 2001. 39: 27-32. Dominguez & OS. Environmental Technology & Management. M.) cv. Banerjee. 3(1):7378. Ghosh. Richaume. Trivedi. African J. Yousry. DR. Kabesh & MS.). Lewis. Am. 2006. 2007. 2008.. E. Agric. JO. Tropical Hort. & MA. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. Naglaa & AA. biofertilizer on growth. Ogunwole. SK. In vitro clonal propagation of physic nut (Jatropha curcas L. yield.J. Abdel-Latif. M. Fert. Mahfouz.. 8(2):11-29.. Sci. Int. 4(4): 519-522. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards.). OM. & Surahmaida. Saber. Asian Biotechnology and Development Review.. Cairo. Jatropha curcas L. 47(1): 351–371. 1995. J. Ranjard. Indian Perfume. S. SA. 2008. LO. 152: 707–716. 35(2): 308-311. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin. & M.. SAT. Microbiol. 5(2): 75-80. & A. Soc. MN.. EAE. Shalan & TAT. 308-312. Biol. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol.Biol. Plant Soil Sci. Sreedevi.. Annals Agric. CK. Improve livelihoods and environmental protection through biodiesel plantation in Asia. volatile oil yield and chemical composition of Ocimum basilicum L. Sharaf-Eldin. Munoz. S. D’Silva & TK. Chaudhary.. Kandeel. Int. 2008. Agric. 44 (1): 229-234. and essential oil content of fennel (Foeniculum vulgare Mill. Sci. 2008. volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. AL. Res. Sadek. 2002. Int. World Appl. 84(3): 977-992. 1978. SP. Effect of mineral vs. El-Ghadban. Osman. Memasukkan: April 2009 Diterima: September 2009 117 . plant. AM. Egyptian J. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media. Quantitative and qualitative microscale distribution of bacteria in soil. JS. 2006. SK. 1991.

C. oblate spheroidal for the female of Rousettus amplexicaudatus and male of C. West Jawa. while the female of C. urban area Kata kunci: Kelelawar buah. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen. and perferesence. titthaheileus and C. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. pollen.id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. C. prolate pollen type has importance for the male of Eonycteris spelaea. Serat polen mengandung protein lebih dari 60%.co. titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m).Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. Email: srisoegiharto@gmail. polen dan nektar (Suyanto 2001). Urceolatus type has important for female of C. pollen identification.com 2 Staf Pengajar Mayor KVT IPB Bogor. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. sphinx. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. Kelelawar kelompok Megachiroptera mengkonsumsi buah. sphinx. brachyotis and R. brachyotis and C. identifikasi. Key words: Fruit bats. minutus. titthaheileus. Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda. while the female in disk type. brachyotis. sphinx. amplexicaudatus like permagnae type (100-200 ì m). The male of C. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar. Bats have important role on seed dispersal and or plant pollinator. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. corola types. Email: apkartono@yahoo. Where as the female has interest in campanulatus type. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi. 119 . The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. oblate type for the male of C. tubulosus. Furthermore the male of Macroglossus sobrinus has interested in rotatus.

titthaheileus. BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. brachyotis. Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. . C. mulai Maret 2008 hingga Juni 2009. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling. dan sering terdapat karbohidrat lengkap sporo-pollenin. C. Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan. Pengambilan sampel polen didapat dari isi pencernaan kelelawar. langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic. Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. pengulangan dilakukan sebanyak tiga kali. Nayar (1999) dan Paldat (2005). sphinx.00-18. Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). Rousettus amplexicaudatus dan Eonycteris spelaea. pigmen carotenoid. Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina. C. yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. Jaring kabut yang dipasang pada waktu senja hari pada pukul 17. Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku.00 WIB dan pagi hari pada pukul 06.00 – 08. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan. Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan. terpenoid. Macroglossus sobrinus. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan.Soegiharto & Kartono hidrokarbon. Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga.

dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. bintang. (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. 121 . Untuk bentuk mahkota lebih kuat mempengaruhi C. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. C. jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. Pada penelitian ini data yang dihasilkan dalam bentuk persentase. dan bulir. kedok. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a.753. mangkuk. besar/ magnae (50–100ì m). sedang/mediae (25–50ì m). kecil/minute (10– 25ì m). Tipe polen terbagi ke dalam 7 tipe yaitu peroblate.390. Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies.187. axis 3 = 0. titthaheileus betina dan jantan.5 (Leps & Smilauer 1999). Bentuk mahkota bunga terbagi kedalam 8 tipe. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. disk. brachyotis betina. prolate dan perprolate. tipe polen dan ukuran polen. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. oblate spheroidal.116 dengan eigenvalue = 0. Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang. Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. oblate. yaitu tabung. sedangkan betinanya dipengaruhi kuat oleh bentuk disk. yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. prolate spheroidal. Penyajian data dilakukan dalam 3 bentuk.241 dengan eigenvalue = 0. Analisis pengaruh karakteristik bentuk bunga. sangat besar/ permagnae (100–200ì m). Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). lonceng.466 dengan eigenvalue = 0. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009). serta C. kupu. Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan. sphinx betina. suboblate. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok. HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar. dan raksasa/giganteae (>200 ì m). tabung dan bulat. axis 2 = 0.

menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae.97 11.61 19. dengan eigenvalue = 0. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate. brachyotis. dengan eigenvalue = 0.427.7 27..39 48. LO_C= Lonceng. sedangkan spesies C.54 7.24 12. 122 .03 9. p = jumlah persentase. axis 2 = 0. C. KE_D= Kedok.66 25.4 11. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal. Pada Gambar 2b.40 21. titthaheileus. TA_B= Tabung.047 dengan eigenvalue = 0.74 57. BI_T= Bintang. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a.091 dengan eigenvalue = 0.28 14.08 29.23 43. menjelaskan bahwa Rousettus amplexicaudatus betina dan C.598.53 9. dengan eigenvalue = 0. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b. Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0. Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C.06 18. CB = C.48 12.26 7.47 30.285.18 33.356. axis 2 = 0.44 50. axis 3 = 0. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate.74 61.84 41. brachyotis betina dan R.1 14.194. Spesies C. sphinx betina. Tabel 1.11 68.58 42.588. sphinx.95 18. minutus jantan. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1. E = Eonycteris spelaea.08 11.09 7. KU_P= Kupu-kupu.95 44. MA_K= Mangkuk.77 68. C.26 9. CT = C.97 100 100 85.88 52.05 2.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2.886. M = Macroglossus sobrinus. Untuk jenis C.55 9.462.15 4. BU_L= Bulir.39 42.03 7. CS = C.99 Keterangan : CM = Cynopterus minutus . DI_S= Disk. Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3.86 4. R = Rousettus amplexicaudatus.

78 20.85 5.26 76.74 61.83 61.94 11. E = Eonycteris spelaea.29 52.72 14. M = Macroglossus sobrinus.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14.13 Magnae p 15.08 41.58 53.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2.72 14. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36.01 57.61 4.24 35.16 35.65 7. sphinx.45 35.48 13.93 64.92 44. R = Rousettus amplexicaudatus. CB = C.23 43.52 7.23 15.21 100 5.56 100 100 100 92. Tabel 3. CT = C. brachyotis.03 100 1. p = jumlah persentase. E = Eonycteris spelaea. CS = C. titthaheileus.97 Keterangan : CM = Cynopterus minutus.69 10. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar. titthaheileus. sphinx. p = jumlah persentase 123 . M = Macroglossus sobrinus. brachyotis.28 74.59 42.31 14. CT = C.8 14.92 37.4 Keterangan : CM = Cynopterus minutus.13 12.42 6.2 85.9 85.5 41.95 42.77 46.04 Permagnae p 43.01 14. R = Rousettus amplexicaudatus.17 23.34 42.67 29.95 39.04 25.13 11. CB = C. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar.86 6.48 7.69 39.52 86.87 7.71 44.97 34. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40.47 18.2 64.66 56.65 3. CS = C.

6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. 4= C. 13= Eonycteris spelaea betina. -0. 12= Eonycteris spelaea jantan. 11= Rousettus amplexicaudatus betina. = Cynopterus minutus jantan.Soegiharto & Kartono 0. 9= Macroglossus sobrinus jantan.4 Axis 1 1. Keterangan : 1. b) hubungan axis 1 dan axis 3. 3= C. KE_D= Kedok. MA_K= Mangkuk. BI_T= Bintang. brachyotis betina. 124 . 10= Macroglossus sobrinus betina.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0.4 Axis 1 1.. 5= C.0 0. sphinx jantan. brachyotis jantan. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2. BU_L=Bulat. 7= C. DI_S= Disk. DI_S -0.4 b. 8=C. KU_P= Kupu-kupu.0 Gambar 1. 6= C. titthaheileus jantan. LO_C= Lonceng. minutus betina. TA_B= Tabung.4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a. 2 = C. titthaheileus betina. sphinx betina.

OB -0. 3= C. Gambar 2.8 a. 10= Macroglossus sobrinus betina. sphinx jantan. titthaheileus betina. bracyotis betina. 8=C. brachyotis jantan. PE_PR= Perprolate.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0. Keterangan : 1. PE_OB= Peroblate. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen.. 12= Eonycteris spelaea jantan. a) hubungan axis 1 dan axis 2.6 1. 5= C. OB_SP= Oblate spheroidal. b) hubungan axis 1 dan axis 3. 11 -0. SB_OB= Sub Oblate. 11= Rousettus amplexicaudatus betina. = Cynopterus minutus jantan. 125 . titthaheileus jantan.4= C.0 0.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0.8 b. 7= C. 2 = C. minutus betina.6 Axis 1 PR_SP 1.0 Axis 1 . OB= Oblate. sphinx betina. 6= C. PR= Prolate. 13= Eonycteris spelaea betina. PR_SP= Prolate Speroidal. 9= Macroglossus sobrinus jantan.

PA = Permagnae 126 . 4= C. 6= C. 10= Macroglossus sobrinus betina. titthaheileus betina. mengeluarkan bau menyengat (asam butyric). mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. MA = Magnae. menghasilkan nektar yang berlimpah. 13= Eonycteris spelaea betina.0 Axis 1 Gambar 3. brachyotis jantan.0 -1. titthaheileus jantan. ukuran polen besar dan dalam jumlah banyak. 5= C.2 kebutuhan pakan yang tinggi. Keterangan : 1. 7= C. bentuk mahkota bunga mangkuk. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. dan ukuran. Menurut Graham et al. tingkat 1. bracyotis betina. 2 = C. 12= Eonycteris spelaea jantan.4 8 PA 9 12 3 5 7 2 GI 4 11 13 1. Bentuk keberagaman yang ditunjukkan berupa warna. bau. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan. bentuk. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator). sphinx jantan.Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae.. 8=C. = Cynopterus minutus jantan. 3= C. Keberagaman tersebut dijelaskan oleh Graham et al. (2003) karakteristik kelelawar dalam mencari makan pada malam hari. 11= Rousettus amplexicaudatus betina. (2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar. sphinx betina. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen. 9= Macroglossus sobrinus jantan. minutus betina. GI = Giganteae.

3. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 . Baringtonia sp. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar. Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah. menghasilkan nektar yang banyak dan polen yang berlebihan. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar. Bauhinia sp. Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp. sphinx jantan lebih memilih oblate spheroidal. permagnae dan giganteae. [Orchidaceae] sp. 1. Ceiba sp. C.1.. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari. sphinx. berpendar atau warna kusam.2. namun berbeda kesimpulan tentang sistem aperture. tipe polen. Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar. C. brachyotis. titthaheileus. Ceiba pentandra. ukuran polen tersebut mulai dari magnae. ukuran polen tersebut mulai dari magnae. Peneliti lain (Graham et al. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen.. Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. Pendapat Graham et al. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar. Syzygium sp. mengeluarkan bau yang tajam dan menyerupai bau kelelawar.. [Euphorbiaceae] sp. tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar.. permagnae dan giganteae. Durio sp. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus..Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. Stroo (2000) mencoba menganalisis pengaruh ukuran polen. C. serta bunga terletak pada cabang pohon.2 dan Ceiba sp. bunga terbuka dan mudah diakses. spesies Rousettus amplexicaudatus betina dan C. Ceiba sp. sedangkan tipe polen.

C. (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. Bumrungsri et al. Voigt (2004) dan Bumrungsri et al. kedok pada spesies Eonycteris spelaea jantan. Durio spp. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. C. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan. . seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. yaitu: (1) tipe bunga yang mudah diakses nektarnya. C. Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar. titthaheileus. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. (2009) akan lebih dijelaskan pada hasil penelitian kami. bunga dan daun. Rousettus amplexicaudatus dan Eonycteris spelaea. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. brachyotis. sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. (2) tipe bunga yang mudah diakses polennya. misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea.Soegiharto & Kartono kelelawar tersebut. Toelch & Winter (2007). sphinx.. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram. yang menjadi pakannya. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar. Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. Perbedaan pendapat Warren & Diaz (2001). Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. (3) kelelawar lidah pendek/ pemakan buah. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering).

2000. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores. Ithaca: Microcomputer Power Toelch. http: //abdulsyahid-forum. Paldat. A. JM. 2001. J & P. Erdtman. LE. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan. 129 . Erdtman. Copenhagen: Munksgard. Understanding Flowers and Flowering:An Inte- grated Approach. New Delhi: Today & Tomorrow’s. Bogor. Component Phy. CC. Glover. A. 2009. DAFTAR PUSTAKA Bumrungsri S. Psychometric function for nectar volume perception of a flower-visiting bat. Kelelawar di Indonesia. Chongsiri. Pearson and Prentice Hall. T.Evol. Dept. Ceske Budejovice. 2003. Sridith & PA.blogspot. 193:265–269 Voigt. Faculty of Biological Sciences. Graham & LW.html. 2007. International Bioscence Series Volume XIV.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. Ecol 25:85–92. CJF. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. Canoco Reference Manual and User ’s Guide to Canoco for Windows. Suyanto. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers.& Y. E. Smilauer. K. TS. Sripaoraya. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae. 1999. G. 2007. Trop. Plant Sys. Pollen Flora of Maharashtra State India. Illustrated Handbook on Pollen Terminology. Winter. J. New York: Chronica Botanica. U. Graham. University of South Bohemia. G. Leps. 2009. 1998. Pr. & P.com / 2009/04/transformasi-data. Bombacaceae) in southern Thailand. Transformasi Data. Smilauer. BJ. Pusat Penelitian dan Pengembangan Biologi – LIPI. Multivariate Analysis of Ecological Data. 2005. 1943. Pollen morphological evolution in bat pollinated plants. The pollination ecology of durian (Durio zibethinus. 1952. Syahid. Nayar. permagnae dan giganteae. A. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar. 2004. An Introduction to Pollen Analysis. Plant Biology. Racey. of Palynology Stroo. Wilcox. 1999. [20 Juni 2009] ter Braak. 222: 225–242.. Oxford: Oxford Univ.

Diaz. Evolutionary Ecology 15:157–166. 1:147–158. 2001. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. HM. J. & A. 2007. Memasukkan: Juli 2009 Diterima: September 2009 130 . A twopollinator model for the evolution of floral complexity.Soegiharto & Kartono Component Physiology 174:541– 548. Arthropod-Plant Inter. Preparasi dan dasar determinasi palinologi. Bandung. Warren. Glover. Whitney. 1992. & BJ. Morphology and development of floral features recognized by pollinators. Yulianto E.

This plant is commonly used as vegetable.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1. They differ in phenotype. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983. Cromosom. It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L. The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m).rindyastuti@yahoo.30 p.30 p. Keywords: Coccinia grandis L. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11. Fakultas Biologi.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L. The chromosome number of both Papasan is 2n=24.30-09. indica.m. C. batang memanjat. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L.. Universitas Gadjah Mada E-mail : ridesti.25. In Daerah Istimewa Yogyakarta. and anti diarrhea. 131 . Papasan is a dioecious plant belongs to the family Cucurbitaceae. Karyotype. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika.30 a.9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006). Niedzielski 2002). Based on the statistic test. found in three population (Ngebel. grandis dan C. while Papasan II at about 08. anti bacterial.. Papasan. Papasan memiliki beberapa nama ilmiah seperti C. Berbah and Gajah Wong Riverbank). Selain itu. berwarna hijau pada saat muda dan berwarna merah pada saat tua. Buahnya berbentuk oval dengan panjang 4-6 cm.m and 2-2.5-dimetilbisiklo[3.1]non-3-ena-2. Chromosome.m-00.m.. there were two varians of Papasan (Papasan I and II). Kariotype. especially in shape and taste of fruit. bunga berwarna putih kehijauan. dan aksiler. Papasan. contains of 22 autosomes and 2 sex chromosomes.30 a. cordiflora. Character differences between both of Papasan only revealed physiology adaptation. The difference R value between Papasan I and II was smaller than 0. Kata kunci: Coccinia grandis L. Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran. Papasan memiliki sulur. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). berbentuk lonceng. 11 a. anti diabetic. Dalam “Flora of Java”.m.3.) Voigt) in Three Population in Yogyakarta. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5. UPT BKT Kebun Raya Purwodadi-LIPI 2.

cordifolia Auct non. grandis) yaitu tipe buah manis dan buah pahit. BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. Metode preparasi kromosom. Kedua populasi tersebut berbeda karena perbedaan morfologi. Di Daerah Istimewa Yogyakarta. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel. yang digunakan adalah metode Squash (Jahier et al. Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003). Di India ditemukan dua varian Papasan (C.Juni 2008. perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. 132 grandis var. grandis var. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype. grandis (L.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. dua macam Papasan yang ditemukan di populasi Ngebel. wightiana (Roumer) Grab.Rindyastuti &Daryono Papasan memiliki satu nama yaitu C. ukuran. Fakultas Biologi Universitas Gadjah Mada. varietas atau forma. Varian buah manis yang umumnya dibudidayakan merupa-kan C. Yogyakarta selama delapan bulan. Keduanya berbeda dalam hal rasa. Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. Cogn sebagai nama sinonim. yaitu dari bulan Oktober 2007. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. grandis dan varian buah pahit C. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. variasi bentuk dan rasa buahnya. Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . Dengan demikian. Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel. bentuk. jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek). 1996).

Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i.5 12. Bentuk kromosom berdasarkan Indeks Sentromer (IS). Tabel 1.67 1. Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom.5-25.00 3.0 dan CorelDRAW X3.0. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7.00-1.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog.00 >7. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37. Ujung akar diambil. Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG.49 0-12. Pada setiap pemotretan. Ukuran tiap ulangan dirata-rata.Identifikasi Papasan (Coccinia grandis (L. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7.49 RLK 1.01-7. Hasil pemotongan dicopy dalam format Adobe Photoshop 7. diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3.68-3. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar. Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1. Lengan panjang diukur dari telomer lengan panjang sampai sentromer. Kromosom difoto dengan mikrofotografi. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto.5-50 25-37.00 133 . Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16. Lengan pendek diukur dari telomer lengan pendek sampai sentromer.0 untuk konversi skala ukuran kromosom. Satu persatu.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades. Untuk menyusun karyogram.

berasa manis dengan sedikit variasi bentuk buah.25 pahit oval 0.6 . Tepi daun 3.9. Bentuk daun 2.2. memiliki rasa buah pahit dan variasi bentuk buah yang banyak.7 . Ukuran daun (cm) a) panjang daun b) lebar daun 2.9.2. Bentuk buah 2. Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4.7. Bentuk biji 2.2 6.64 0.7. Ukuran biji (cm) a) panjang b) lebar 3.6 2 .2 oval-bulat variasi sedikit 1. Buah 1.9 . Tanaman Papasan I Papasan II membundar berlekuk licin.5.6 2.4 8 . Seperti tampak pada tabel.1 .6 . Warna buah a) muda b) tua 3.0. variasi bentuk dan rasa buahnya. Karakter Dari karakter buah. Biji 1. tidak berambut 7.11. Rasa 3.3 . sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar. Papasan II memiliki ukuran daun lebih besar daripada Papasan I.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4.3 8.6 0.33 tinggi putih Melengkung keluar (recurved) satu 134 . Karakter morfologi Papasan I dan II. Warna 2. Buah Papasan I memiliki garisgaris putih. Perbedaan baru terlihat pada ukuran daun.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2. membulat-oval. banyak variasi Membundar berlekuk licin.0. tidak berambut 6.5.4 memanjang.6 .7 manis membulat 0. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan.5 . Viabilitas 4. sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua.3 . Daun 1. Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4. Tabel 2. bentuk daun.3 .3 .4 7. terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II. Bentuk 5. Bunga 1.0.0.5 . Permukaan daun 4.

Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II.15.15 WIB. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2). 2004) sehingga. 4.10-12. sedangkan prometafase Papasan II banyak ditemukan pada jam 09. Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C. Papasan I lurus. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3. biji Papasan I memiliki bentuk membulat. Namun. C.00-11. Sedangkan. Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24.30-09.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2).30 WIB sedangkan sel Papasan II aktif membelah antara jam 08.00-14.00-14. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2. Secara umum. chepalandra. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom. Disamping itu. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin.Identifikasi Papasan (Coccinia grandis (L.30 WIB. 6.50-09. sedangkan daun mahkota Papasan II menggulung keluar (recurved).30 WIB. 11.00-11.20.50-10. sedangkan yang berbentuk metasentris ada pada autosom nomor 1. dengan frekuensi terbanyak pada jam 11. 11.20 dan 14. sedangkan biji Papasan II sangat mudah berkecambah.00-11. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. 8. Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II.15 WIB. 7. 3. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955. biji Papasan berbentuk oval dan mampat. Guha et al. 12. 5. Agarwal & Roy 1984.30 dan 14. biji Papasan I tidak dapat berkecambah. sedangkan kromosom kelamin berbentuk metasentris. Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 . memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil. sedangkan biji tanaman Papasan II berbentuk oval. dari 24 kromosom Papasan. dan 11. Sel Papasan I aktif membelah antara jam 08. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris. Perbedaan karakter terlihat pada daun mahkota.30 WIB. Berdasarkan nilai IS (Tabel 3). Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2. diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek. indica yaitu 2n=24. 9. hirtella dan C. Pada Papasan I prometafase banyak ditemukan antara jam 09. 10.00-12.

sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. 4. 136 . 7. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). 3. 10. 8. dan 11. 9. sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. Karyogram kromosom Papasan I. Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p). panjang lengan panjang (q) dan panjang absolut kromosom (p+q). Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II. 6. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. Karyogram kromosom Papasan II. 2.

70±0.87±0.82±0.267 0.255 1.112 0.06±0.77649 47.17±0.114 0.48±0.54±0.48±0.86±0.53865 45.76±0.074 1.80±0.99±0.089 1.73±0.268 2.099 0.061 0.96±0.249 1.085 0.28729 47.70±0.75±0.113 1.072 0.085 0.80±0.73±0.242 1.29±0.075 0.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.96±0.76±0. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.79±0.86±0.84±0.67±0.097 0.090 0. baik autosom maupun kromosom kelamin.075 0.69±0.079 0.069 0.091 0.081 0.83784 45.02±0.103 0.128 0.60±0.59±0.129 1.86±0.77302 43.78±0.73±0.86±0.37865 47.254 1.146 1.89±0.94±0.73±0.46603 46.211 1.22531 45.077 0.74±0.66±0.071 0. 137 .29±0.63128 46.107 0.073 0.120 1.42±0. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman.162 1.Identifikasi Papasan (Coccinia grandis (L.116 1.083 0.15998 45.13±0.155 0.092 1. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.50±0.133 0.5394 45.102 0.94±0.23 1.067 0.42±0.26497 46.121 0.64±0.44±0.27804 36.230 1.72±0.66±0.069 0.189 2.102 0.22 1.129 1.69±0.13±0.56±0.00024 47.33331 47.61615 44.70±0.230 1.252 1.71775 47.083 0.139 0. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.91±0.03±0.182 0.34739 44.58±0.062 0.218 1.063 0.25±0.106 1.078 2.148 Indeks Sentromer (IS) 35.51±0.083 0.130 0.108 1.74±0.122 1.53±0.) Voigt) di Tiga Populasi Tabel 3.7189 46.86±0.70±0.62±0.109 0.62±0.26413 46.33±0.105 1.095 0.16±0.67±0.109 0.112 0.135 0.77±0.78±0.58±0.82±0.55±0.06673 46.34532 43.89±0.72844 46. Tanaman No.073 0.

Rindyastuti &Daryono Tabel 4.5394-47.06-2. 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.33 1. Nilai R menunjukkan variasi ukuran kromosom. Perbandingan idiogram kromosom Papasan I dan II. Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman. diduga Papasan I dan II masih tergolong dalam satu spesies.00 Papasan I Papasan II Gambar 3.345-47.77649 2. Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata.59-1.50-0.34739 2.51-0.56-1.13 36. Perbandingan karakter kromosom Papasan I dan II. Berdasarkan hasil uji statistik pada aras 5% (Tabel 5).16-2.44 1.25 35. Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- .87 0. Semakin besar nilai R. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0.86 0. variasi ukuran kromosom juga semakin tinggi.01 Papasan II 2n=24=20m+2sm+XX(m) 0.

Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R. Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan. artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah. NS = Non-signifikan. cuaca atau kesuburan tanah. selisih nilai R antara Papasan I dan II lebih kecil dari 0. Berdasarkan Tabel 5.25. Namun. nilai R kedua Papasan tergolong kecil. X = Pasangan kromosom kelamin betina 139 . Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0. PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda. Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar. Tabel 5. Untuk membandingkan nilai R Papasan I dan II. Nilai R antara Papasan I dan II berbeda.) Voigt) di Tiga Populasi batannya. Berdasarkan Gambar 4. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4).Identifikasi Papasan (Coccinia grandis (L.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim.25. karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II.

Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.115 0. 2 = Papasan II.45 American muskmelon - Menurut Tamarin (1999). Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya. 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0.125 0. 4 = American muskmelon Gambar 4.5 2 1. antara organ yang satu dengan yang lain dalam satu spesies. bahkan antara tipe sel satu dengan tipe sel yang lain.565 Melon PI 371795 0.5 Nilai R Nilai R 1 0. Oleh sebab itu.Rindyastuti &Daryono Perbandingan Nilai R 2. Tabel 5. Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman. No. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling .01 0. Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II.575 Papasan II 0. 3 = Melon PI 371795.5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas. perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan.

maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L. 2000). Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan. Qi-Xing et al.Identifikasi Papasan (Coccinia grandis (L. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II. khususnya atas konsultasi di bidang taksonomi tumbuhan. mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. S. Qi-Xing et al. Senada dengan hal tersebut. 1984. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel.25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. Nogueira et al. dan Drs. atas bantuannya secara teknis.71 memiliki kedudukan taksonomi yang sama dengan A. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0.) Voigt.. yunnanensis dengan rasio 2. grandis L. M. & RP. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. serta karakter genotip yang meliputi waktu mitosis. dalam Ferruci (2000) memisahkan Serjania communis dengan S. S. Herlianti Anissa. AAG. Meastika Dianeta. S. jumlah. tetapi Cucumis. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. Si. 141 . Tuty Arisuryanti. buah. Disamping itu. M. ukuran. atas bantuan konsultasinya. Karyotype of Coccinia indica. PK. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4). Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi..25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C. Sc. bentuk. DAFTAR PUSTAKA Agarwal. Roy. Dr.) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain. yaitu karakter morfologi daun.Si. KESIMPULAN Berdasarkan perbandingan karakter fenotip. & Plant Breeding 44(1): 117-120. bunga dan biji. Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. Indian J. Purnomo. mengindikasikan bahwa berdasarkan karakter kromosom. Namun melon tidak tergolong dalam genus Coccinia.25. perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas.59. Raka Swastika.Gen. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2. gracillis berdasarkan selisih nilai R lebih dari 0.25.

G. The Benjamin/Cummings Publishing Company. Plant Systematics. Cytological. Delourne & AM.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id. SB. CA. Techniques of Plant Cytogenetics. California. www. Flora of Java Vol. h a r t w i c k . 1955. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia. serta Isolasi dan Identifikasi Senyawanya”. Z.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. 2000. 1998. & RC. Cheure. Niedzielski..V Groningen. New York. 1998. RH. Principles of Genetics. stage.go. Coccinia indica. Winarno. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae. Luchsinger. K & B. ZhongShu. Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit. CD. 2002. 2006. Inc. & D. 1999. 98-101. 234-325. 305. Act Phytotaxo. 1-77. RK. & AP. MS. 51-57. Science Publisher. 2007. Evolutionary Genetics.html. Bakhuizen van den Brink. Winarsih. MW. & AE. Morfologi Tumbuhan. e d u / P re b u i l t / BiolJBR3_www. Inc. McGraw HillBook Company. www.unud. 1965. Little-knownTropical Drug Plant. Memasukkan Agustus 2009 Diterima: September 2009 142 . Genetics. Qi-Xing.jp/ article/cytologia/70/1/70_53/article. Ferruci. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. http://www.kalbe. 217-222.jst. Gadjah Mada University Press. JM. Econ.co. Tangui.Rindyastuti &Daryono Backer. JM. Scarlet Gourd. Inc. 1. 1996.ac. Jones. 1996.jst. Sinha. Karyomorphology and Relationships of Amentotaxus Pilg.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. 2003. Darlington. Chromosome Atlas of Flowering Plants. 3-5. Ramachandran. Yogyakarta. Tjitrosoepomo. Sixth edition. hartwick. Eber. Sin.. A. Jahier. Comp. Oxford University Press. Singh. The Netherlands. 1983. USA. Plant Systematics. Fakultas Biologi UGM. F. Inc. Tamarin. Yogyakarta. 38 (6) : 525532.lemlit. Karakterisasi Kromosom Melon (Cucumis melo L. 1999. Walter Noordh off N. Coccinia grandis. Zhi-Jiang & Y. Smith. Ciawi. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana. 2004. USA. Science Publisher.pdf/10Pemanfaatan TumbuhanObatDiare109.jp/article/ cytologia/70/1/70_53/article. 37 (4) : 380-383. Y. H.) PI 371795. Guha. 2000. Sundari. K. New York. Russel. Jstage. Diakses tanggal 5 November 2007. Subramaniam. McGraw Hill-Book. London.html?id=4138. Fifth edition. 176182. Wylie. w w. George Allens and UNWIN LTD. Sinha & S. 1979.id/ind/ detailPenelitian. Bot.http:// www.go. G. PJ. R.

Cycloclasticus pugetti.. and able to degrade phenantrene after 5 hours. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. degradation . Polyhydroxybutirate (PHB) was produced during culture growth. biostimulasi dan bioaugmentasi.0476/hour. but the synthesis was inversely correlated with the cell growth.bacteria Kata kunci: Phenantren. yang merupakan salah satu senyawa karsenogenik (Cerniglia. perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu. Keywords: Phenanthrene. maka. antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan. Salah satunya adalah phenanthrene. yang 143 . maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya. yang tersusun dari gabungan tiga cincin benzena.5 hours and specific growth rate of 0. pH 7. distribusi. 1984) yang sangat berbahaya bagi kesehatan manusia. produksi. dietil. The relation between PHB synthesis and phenantrene degradation is due required further investigation.Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) .8 with a doubling time of 14. 1992. This isolate grew optimum at 300C. degradasi. About 75 % of phenantrene was degraded after 12 hours. Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH. Alcanivorax Borkumensis M5 was isolated from sea water. Pseudomonas spp. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. Jl. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI. Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta. Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. Phenantrene is one of the most persistent organic substances in environment.. metilpropil). Menurut Brodkorb et al.

Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7.27 gr NH4Cl.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. NH 4 Cl. Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit. Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC). NaF. Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. H 3BO 3 . 27 mg H 3 BO 3 . 83 mg NaBr. Untuk memadatkan media. 144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi. dan larutan ketiga mengandung FeCl2.98 gr Na2SO 4.60 BT dan 5.79 gr NaCl. larutan kedua mengandung MgCl2. termasuk pestisida. 2006 ). salinitas temperatur dan status nutrisi. Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. 2001. NaHCO 4 . 1. NaBr.6 dengan NaOH). dan SrCl2 (divalent cation salts). Na2SO 4. CaCl2. 3.0 mg FeCl2·4H2O. Letak astronomisnya adalah 106. Lo´pez et al. . oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya. Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. 1. KCl. 11. PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh.72 gr KCl. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al. Uyttebroek et al. Larutan pertama mengandung NaCl.6 mg NaF. 2002).46 gr CaCl2·2H2O. 0. Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%). Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan. Noble Agar (Difco) (15.850 LS. 24 mg SrCl2·6H2O. 89 mg Na2HPO4·7H2O.3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}. Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH. karena memiliki metabolisma yang berbeda dengan mikroba teresterial.0 gr/L) ditambahkan pada larutan pertama. dan 2. 2. BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta. 31 mg NaHCO 3 . 0.18 gr MgCl2·6H2O.

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

2273 R2 = 0.9459 R 2 = 0. Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.0437 x + 0.9701 R = 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.3344 Y= 0.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.2 1 0.0266 1.7 0.17 30 C 40 0C Salinitas 3.9977 2 0.8869 R2 = 0.6 0.6 1.9685 R2 = 0.501 R2 = 0.0369 x +0.17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7.79 48.0266x + 0.9 0.2 1 0.4 OD 600 nm 1 0.3958 Y=0.7 38.018 x +0.4 0.3% Salinitas 5% 0 Td (jam) 15.018 0.4 OD 600 nm 1.3 0.25 18.0437 pH 5.8 Y= 0.94 Y= 0.4 0.6 1.8 dan pH 5.6 0.0476 0.2 0.302 Y=0.17 Gambar 2.8 0.9704 0. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 .8 0.Dyah Supriyati Tabel 2.6 0.33 14.0143x + 0.5 25.3887 Y= 0.8 pH 5.4 0.8 0.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.5 0.0143 0.0476 x + 0.0369 0.3% Salin 5% 1.

Pada media dengan salinitas 3. bakteri ini bisa dikategorikan sebagai bakteri laut tropis. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5. dan produksi sel).15 0.79 jam Nilai waktu generasi M5 ini lebih cepat.3 %. Pada media dengan pH 7.7 jam . pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3.3% Salin 5% pH 5.4 0. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%.3%.3 0. seperti misalnya di perairan laut Indonesia. Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini.5 jam di salinitas 3.17 Media Media Gambar 3.17 (45.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5.35 0. Hal ini menunjukkan bahwa.25 0. laju pertumbuhan. Sedangkan.5 jam. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat. salinitas maupun pH yang serupa dengan asalnya.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas.5 1 0.2 0. Artinya setiap 14..05 0 Salin3. Dilihat dari 3 parameter di atas (waktu generasi. pertumbuhan bakteri M5 mulai lemah.17). dengan td 14.3% Salin 5% pH 5.17 PHB mg/g sel 2 0. Dengan td 18. 2.5 Berat sel (gr/l) 1.7 jam. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur.3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC.1 0.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25.bakteri mempunyai waktu generasi 18.5 jam berarti bakteri mempunyai waktu generasi 14. Di salinitas 5%. Nilai waktu generasi M5 ini lebih cepat. Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3.3 %.3 % lebih baik dibandingkan dengan 5. bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .5 0 Salin3.8 bakteri M5 mempunyai td 15.

Brodkorb. 1990. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. DAFTAR PUSTAKA Anderson. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L. KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. metabolic role.8) Kemungkinan isolat M5 mampu membentuk PHB. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene. 30:31–71. Media seawater ini dipilih karena menurut Springael. Microbial degradation of polycyclic aromatic hydrocarbons.1%).Adv. perlu diteliti lebih lanjut. pada media air laut mengandung phenantrene. metabolism. 1992. 58:3117–3121. yang berperan pada proses degradasi phenantrene. Microbiol. Dengan tumbuhnya bakteri M5 tersebut. tumbuh optimum pada salinitas 3. Cerniglia. Appl.J. 1984. & E A. Environ. A. Dawes. TS. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%.atas bantuan yang diberikan hingga selesainya tulisan ini. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. Microbiol. Appl. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene. dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0. 1990) pada proses anaerobik-aerobik. Microbiol. sel jusru membentuk PHB lebih banyak. and industrial uses of bacterial polyhydroxyalkanoates. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium..Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini. CE. Made Sudiana. bakteri M5 justru sel membentuk PHB paling sedikit. Occurrence. 150 . Rev.Pada media dimana pertumbuhan bakteri M5 terlihat terhambat.3 % . 54:450–472. &R L. Pada media yang relatif optimum untuk pertumbuhannya. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. suhu 30oC dan pH mendekati netral (7. Legge.

Microbiol. Microbiol. MP. Kasai & K. Breugelmans. Karlson. 2001.. C. Microbiol. Chemosphere 43:1085– 1094. P. Microbiol. strain AP1. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil. 70:747–756. 2006. 68:2683–2689. Z. Bendixen. 2002. M. Metabolism of fluoranthene by Mycobacterium sp. 63:452–459. Appl. Karlson. ARK. J. Y. 1999. 8:836–847. Hausner. Karlson. L. Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models.&U. Ryngaert. Appl. Breure & WH. Ortega-Calvo. Environ. AM. 2004. U. B. JJ. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. Uyttebroek. Lo´pez. 1:63–70 Johnsen. Microbiol. Mulder. Johnsen. Kishira. A. D. Grifoll. 2006. M. Wattiau. Minguillo´n & M. Springael. Appl. Rulkens. Environ. Memasukkan: Agustus 2009 Diterima: September 2009 151 . S. Petroleum biodegradation in marine environments. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). H. & U. Bastiaens. Biotechnol. AR.. Shutsubo. Joffe. J.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama. Janssen. Biotechnol. Biotechnol. H. Vila. Mol.

248-277. Suhartono. Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). Ueda. β. subtilis.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point.A. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. Bab dalam Buku : Gerhart.. Disertasi : Kemala. dan bawah masingmasing 2. KATA KUNCI (maksimal 6 kata). dan tabel disertai CD. Cambridge.net/primates/loris/ lorCp. Gen. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. NR. Skripsi. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris).).species. & MT. T. Perkembangan tanaman polong-polongan utama di Indonesia. dan lain-lain dimasukkan melalui fasilitas insert.R. Cambridge University Press. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA. R. Prosiding : Mubarik. 29: 345-354. . NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim. Identification of plasmids linked with polyglutamate production in B. Wood.html. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). Kata dalam bahasa asing dicetak miring. Pola Pertanian. Murray. Detection and Identification of Lories and Pottos in The Wild. ASM. HASIL. Drew. Abstrak Pertemuan Ilmiah Mikrobiologi. & SW. 1987. No.[Disertasi]. Indon. Washington. Informasi dari Internet : Schulze. Bucke. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah. Microbiol. Dalam : Gerhart. Liquid culture. & N. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. 1982. Enzyme Technology. foto. JR. kanan. 1999. 15 –18 Oktober 1982. ABSTRAK (bahasa Inggris.1. 1990. Apll. Bogor : Institut Pertanian Bogor. Suwanto. Tesis. Krieg (eds. J. PEMBAHASAN. MF. 2000.. PENDAHULUAN. 1994. H. & S. Jakarta. Batas dari tepi kiri 3 cm. D.J. Biol.G. A. Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali. Jakarta . http//www. Penulisan simbol α. P. Zhang. 151-158. Vol 6. maksimal 250 kata). 15-16 Februari 2000. S. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. Setiap halaman diberi nomor halaman secara berurutan. & C. tanpa mengubah jenis huruf. atas. 1983.E. BAHAN DAN CARA KERJA. Information for surveys/Estimated of population density. W. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar. Abstrak : Suryajaya.. Buku : Chaplin. χ. 42.. P. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris. Methods for General and Molecular Bacteriology.

Niken Tunjung Murti Pratiwi. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Indon. Hari Sutrisno. Puslit Biologi-LIPI Ir. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Biol. Puslit Biologi-LIPI Ir. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Vol 6. Majariana Krisanti MSi. No.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6.J. Heryanto MSc. Desember 2009: Dr. No 1. Rugayah. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 .

Vol 6. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. Biol. Habib Rizjaani. Kartono Identifikasi Papasan (Coccinia grandis (L. No.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 .) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P.J. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Agustina K. Ostrinia furnacalis Guenee Bahagiawati. Indon.

Sign up to vote on this title
UsefulNot useful