J. Biol. Indon. Vol 6, No.

1 (2009) ISSN 0854-4425

JURNAL BIOLOGI INDONESIA
Akreditasi: No 816/D/08/2009 Vol. 6, No. 1, Desember 2009
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan 1

13

25

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut 39 Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto 51

71

79

BOGOR, INDONESIA

J. Biol. Indon. Vol 6, No. 1 (2009)
Jurnal Biologi Indonesia diterbitkan oleh Perhimpunan Biologi Indonesia. Jurnal ini memuat hasil penelitian ataupun kajian yang berkaitan dengan masalah biologi yang diterbitkan secara berkala dua kali setahun (Juni dan Desember). Editor Pengelola Dr. Ibnu Maryanto Dr. I Made Sudiana Dr. Anggoro Hadi Prasetyo

Dr. Izu Andry Fijridiyanto
Dewan Editor Ilmiah Dr. Abinawanto, F MIPA UI Dr. Achmad Farajalah, FMIPA IPB Dr. Ambariyanto, F. Perikanan dan Kelautan UNDIP Dr. Aswin Usup F. Pertanian Universitas Palangkaraya Dr. Didik Widiyatmoko, PK Tumbuhan, Kebun Raya Cibodas-LIPI Dr. Dwi Nugroho Wibowo, F. Biologi UNSOED Dr. Parikesit, F. MIPA UNPAD Prof. Dr. Mohd.Tajuddin Abdullah, Universiti Malaysia Sarawak Malaysia Assoc. Prof. Monica Suleiman, Universiti Malaysia Sabah, Malaysia Dr. Srihadi Agung priyono, F. Kedokteran Hewan IPB Y. Surjadi MSc, Pusat Penelitian ICABIOGRAD Drs. Suharjono, Pusat Penelitian Biologi-LIPI Dr. Tri Widianto, Pusat Penelitian Limnologi-LIPI Dr. Witjaksono Pusat Penelitian Biologi-LIPI Alamat Redaksi

Sekretariat Oscar efendi SSi MSi
d/a Pusat Penelitian Biologi - LIPI Jl. Ir. H. Juanda No. 18, Bogor 16002 , Telp. (021) 8765056 Fax. (021) 8765068 Email : jbi@bogor.net Website : http://biologi.or.id Jurnal ini telah diakreditasi ulang dengan nilai A berdasarkan SK Kepala LIPI 816/ D/2009 tanggal 28 Agustus 2009.

J. Biol. Indon. Vol 6, No.1 (2009)
DAFTAR ISI
Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang, Desa Bantar Karet, Kecamatan Nanggung, Bogor Titi Juhaeti, N. Hidayati, F. Syarif & S. Hidayat Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern & Ristiyanti M. Marwoto Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) Tjahjo Winanto, Dedi Soedharma, Ridwan Affandi, & Harpasis S. Sanusi Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman, Tjahjo Winanto, Maskur, &Yade Sukmajaya Analisis Vegetasi Hutan Pamah di Pulau Batanta, Raja Ampat, Papua Edi Mirmanto Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung, Ostrinia furnacalis Guenee Bahagiawati, Habib Rizjaani, Agustina K. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P. Kartono Identifikasi Papasan (Coccinia grandis (L.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 1

13

25

39

51

71

79

97

107

119

131

143

nudiflora were selected for fitoremediation of Hg contaminated soil. Keywords: Accumulator plant. accumulation capacity Katakunci: Tumbuhan akumulator. Paspalum conjugatum. Desa Bantar Karet. Logam termasuk kontaminan yang unik karena tidak dapat mengalami degradasi baik secara biologis maupun kimiawi yang dapat menurunkan kadar racunnya sehingga dampaknya bisa berlangsung sangat lama. Bogor Titi Juhaeti 1). ke sawah ataupun ke kolam ikan. Kecamatan Nanggung. Monocharia vaginalis. Limnoharis flava. Cibinong Science Centre. N. biomas. conjugatum dan M. Mikania cordata and Commelina nudiflora to accumulate Hg from contaminated soil. kapasitas akumulasi PENDAHULUAN Salah satu penyebab terjadinya kontaminasi lahan oleh merkuri adalah kegiatan penambangan emas tanpa izin (PETI). Desa Bantar Karet. O. Hg. manure and compost. conjugatum. O. Kecamatan Nanggung. vaginalis. Based on characteristic of hyperaccumulator plant. P. Oryza sativa. Cyperus monocephala. nudiflora. Bogor E-mail : tihaeti@yahoo. sativa and C. Hidayat2) 1) Bidang Botani Pusat Penelitian Biologi LIPI. this research suggested that S. Kabupaten Bogor. Meanwhile S. M. Cibinong. vaginalis. molesta. Kemungkinan 1 . biomass. Hidayati 1). The result showed that the growth of each plant was significantly different. Kabupaten Bogor. sedangkan air limbahnya dibuang ke sungai Cikaniki yang letaknya tepat bersebelahan dengan kampung tersebut. molesta showed the highest biomass followed by M. Kecamatan Nanggung. molesta also showed the highest capasity to accumulate Hg/year followed by C. The aim of this research is to study the potency of Salvinia molesta. Salah satu lokasi kegiatan PETI adalah di daerah Pongkor tepatnya di Kampung Leuwi Bolang. Hal ini terjadi karena para penambang menggunakan merkuri untuk mendapatkan emasnya. P. Centrosema pubescens.com 2) Pusat Konservasi Tumbuhan Kebun Raya Bogor ABSTRACT The research were carried out in Hg contaminated paddy field in Kampung Leuwibolang. nudiflora. NPK. Hg.Jurnal Biologi Indonesia 6 (1):1-11 (2009) Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Lingkungan Tercemar Akibat Kegiatan Penambangan Emas Tanpa Izin (PETI) di Kampung Leuwi Bolang. Desa Bantar Karet. Syarif 1) & S. The treatments were fertilizer: no fertilizer (as a control). vaginalis. Production of biomass and accumulation capasity of contaminant were the characteristic of accumulator plant. F. Kegiatan PETI di area ini berlangsung di lingkungan rumah penduduk setempat. sativa dan C. The S. The fertilizer treatments were significantly affected plant growth.

oat. 2000. Limnocharis flava (genjer) dan Monochoria vaginalis (eceng leutik) adalah tumbuhan yang tumbuh di sawahsawah dan potensial sebagai pembersih merkuri karena mampu tumbuh dengan . Mikania cordata. penyerapan oleh tumbuhan dan bioakumulasi pada rantai makanan. di kebun. Salah satu strategi fitoremediasi yang sudah digunakan secara komersial maupun masih dalam taraf riset yakni yang berlandaskan pada kemampuan tumbuhan dalam mengakumulasi kontaminan (fitoekstraksi). Limnocharis flava mampu mengakumulasi merkuri dalam jumlah yang lebih tinggi dibandingkan jenis lainnya. dikenal dengan nama sentro. Salvinia molesta (kiambang. gandum. Dewasa ini telah dikembangkan teknologi alternatif pembersihan lahan yang dikenal dengan fitoremediasi. Hal ini menjadi perhatian karena dapat menjadi potensi polusi pada permukaan tanah maupun air tanah dan dapat menyebar ke daerah sekitarnya melalui air. merupakan tumbuhan terna memanjat. 2 2001. Tumbuh di tempat dengan cahaya penuh sampai yang sangat terlindung. termasuk pohon. 2004 Dalam Rodriguez et al. 2001. Potensi ini akan dimanfaatkan lebih lanjut untuk pembersih limbah pada areal yang terkontaminasi melalui teknologi fitoremediasi. Teknologi ini telah terbukti lebih mudah diaplikasikan disamping menawarkan biaya lebih rendah dibandingkan metoda seperti pencucian secara kimiawi ataupun pengerukan.Juhaeti. Salvinia molesta. Cyperus monocephala. rumputrumputan dan tumbuhan air. Centrosema pubescens. Hidayati. Chen et al. Commelina nudiflora. di tempat yang agak basah seperti di pinggir sungai juga di sawah. Fitoremediasi adalah pencucian polutan yang dimediasi oleh tumbuhan berfotosintesis. Kayser etal. 2007. Monochoria vaginalis. Cyperus monocephala dikenal sebagai teki badot. di daerah Sunda disebut jukut pendul bodas.. dan kubis. Indian mustard. di hutan sekunder. Centrosema pubescens Benth. 2000. Umumnya ketersediaan logam berat untuk akar tanaman merupakan faktor pembatas keberhasilan tehnik remediasi ini (Kabata Pendias and Pendias. Terry and Banuelos. mata lele). di tepi jalan. Ada dua pendekatan yang umum dilakukan untuk fitoekstraksi logam berat ini yaitu penggunaan tumbuhan hiperakumulator alami yang memiliki kekecualian dalam kapasitasnya mengakumulasi logam berat dan penggunaan tanamanan budidaya yang memiliki produksi biomasa tinggi seperti jagung. Commelina nudiflora merupakan jenis tumbuhan yang tersebar luas baik di daerah tropis maupun sub tropis. Pivetz. barley. Tumbuh di tempat yang agak teduh atau tidak terlalu banyak sinar matahari. Syarif & Hidayat yang terjadi adalah logam akan mengalami transformasi sehingga dapat meningkatkan mobilitas dan sifat racunnya. kacang-kacangan. Paspalum conjugatum merupakan jenis rumput mampu tumbuh dengan baik di tempat yang miskin hara bahkan di tempat yang banyak mengandung merkuri. Hasil penelitian Kelompok Penelitian Fisiologi Stress Bidang Botani-Puslit Biologi LIPI menunjukkan bahwa Paspalum conjugatum..

Penelitian ini bertujuan untuk melakukan uji jenis tumbuhan potensial secara in-situ untuk membuktikan kemampuan jenis-jenis tumbuhan terpilih dalam mengatasi lingkungan tercemar. Kunci dari keberhasilan adalah pada pemilihan jenis tumbuhan yang sesuai dan penerapan praktek-praktek agronomis serta pemberian perlakuan baik pada tanah maupun pada tumbuhan untuk pengoptimalkan akumulasi logam. Jenis tanaman yang diamati ada 9 jenis yang terdiri dari 4 jenis tanaman yang memerlukan air banyak yaitu 1. Ni. Pemanenan dilakukan secara periodik (sesuai dengan umur tanaman untuk tanaman semusim). Sawah tersebut terairi oleh air buangan gelundung yang terletak tepat di sebelahnya. Kab. Beberapa penelitian membuktikan bahwa manipulasi pH dan kesuburan tanah dapat meningkatkan akumulasi Zn. Nanggung. Penelitian menggunakan Rancangan Acak kelompok yang disusun secara faktorial dengan 2 faktor.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi baik di sawah yang terdeteksi tercemar merkuri. Dalam prakteknya. Untuk mendapatkan jenis-jenis tanaman yang diuji dalam penelitian ini sebelumnya telah dilakukan serangkaian penelitian berupa seleksi jenis tanaman potensial dari areal PETI dan penelitian peningkatan potensi aukmulasinya di rumah kaca melalui berbagai perlakuan agronomi. Kecamatan Nanggung. Desa Bantar Karet Kec. dan Cd pada tanaman. Desa Bantar Karet. Penelitian in-situ dilakukan di Kampung Leuwibolang. fitoremediasi adalah menanam areal terkontaminasi dengan tumbuhan hiperakumulator. Kabupaten Bogor yang lebih dikenal dengan nama wilayah Pongkor. Salvinia molesta D. Bila setelah pemanenan ternyata kandungan bahan pencemar masih tinggi maka penanaman diulang lagi hingga sebagian besar bahan kontaminan terserap oleh tanaman hingga kontaminan di dalam tanah mencapai tingkat aman. 3 . Sementara itu. Meningkatkan potensi tumbuhan dalam fungsinya sebagai hiperakumulator pada dasarnya adalah meningkatkan potensi akumulasi kontaminan yang tinggi dalam tajuknya dan meningkatkan produksi biomassa. BAHAN DAN CARA KERJA Penelitian dilakukan di lahan sawah di Kampung Leuwibolang. Di Indonesia penelitian jenis-jenis tumbuhan untuk tujuan fitoremediasi pada umumnya dan untuk fitoremediasi merkuri secara khusus masih sangat terbatas. Pemupukan merupakan cara yang umum dilakukan untuk meningkatkan produksi biomassa tanaman. Biomassa hasil panen yang mengandung kontaminan diabukan dan diisolasi atau diaplikasikan ke lokasi lain yang mengalami kekurangan. Penelitian dilakukan pada bulan Maret-Oktober 2007. Bogor. Faktor pertama adalah jenis tanaman sedangkan faktor ke dua adalah pemupukan. Indonesia dengan kekayaan floranya diyakini memiliki banyak jenis yang potensial untuk digunakan dalam fitoremediasi.S. Selama ini sawah ditanami padi yang hasil panennya untuk konsumsi sendiri.

Oryza sativa (padi). Pengamatan yang dilakukan pada tiap kali panen adalah pengukuran produksi biomasa tanaman berupa bobot basah dan bobot kering akar.L. conjugatum. Paspalum conjugatum Berg (jukut pahit). Pada tahap ini jenis tanaman yang diuji dikurangi yakni C.Juhaeti. konsentrasi Hg (ppm) di akar dan tajuk. 2. Pada periode penanaman ke-1 ditanam 9 jenis tanaman dan panen dilakukan pada umur 1. vaginalis. sativa. Pupuk kandang 5 kg/petak dan 4. pubescens dan M. 4. Kompos sebanyak 3 kg/petak Tanaman ditanam dalam petakpetak berukuran 0. Pengairan menggunakan air yang tidak terkontaminasi merkuri. Syarif & Hidayat Mitchell(kayambang). Hal ini dilakukan karena tanaman sudah tumbuh dengan baik pada umur 1 bulan setelah tanam tersebut. O. NPK 16 g/petak.f. Dalam pemeliharaannya diupayakan kondisi yang optimal untuk tiap jenis tanaman.Robins. Pada saat panen. sumbernya diusahakan berasal dari tempat penampungan air bersih yang biasa dipergunakan masyarakat setempat. Sesuai dengan prinsip aplikasi fitoremediasi yakni menanam areal yang tercemar dengan tumbuhan akumulator dengan perlakuan agronomis untuk meningkatkan potensinya dalam suatu kurun waktu tertentu untuk kemudian biomassanya dipanen. Segera setelah panen tahap 2 tersebut dilakukan penanaman tahap ke-3. Sedangkan perlakuan pemupukannya adalah: 1. Commelina nudiflora L. L. sedangkan untuk tanaman darat. Cyperus monocephala sinonim Cyperus kyllingia Endl (jukut pendul bodas). Centrosema pubescens (sentro). Untuk tanaman air.) B. P. cordata tidak lagi diuji karena pertumbuhannya yang kurang memuaskan. Limnoharis flava (L. tajuk dan total tanaman.5 bulan setelah tanam.f. 2. molesta. Setelah itu. Mikania cordata (Burm. HASIL Pertumbuhan tanaman Hasil pengamatan terhadap pertumbuhan tanaman menunjukkan bahwa S.(tali korang). kandungan Hg (konsentrasi Hg X total bobot kering biomasa tanaman) di akar dan tajuk tanaman. Perlakuan pemupukan diberikan pada saat tanam.8 X 2 meter dengan 3 ulangan. kemudian di tempat yang sama dilakukan penanaman kembali sampai 3 kali tanam dengan jenis tanaman yang sama. C. . petak penelitian tidak tergenang. 2. Perlakuan pemupukan yang diberikan sama dengan pada tahap ke-2 dan panen dilakukan pada umur 1 bulan setelah tanam. flava. Air limbah dari gelundung PETI diupayakan untuk tidak lagi masuk ke area penelitian. seluruh biomassa tanaman berupa akar dan tajuk diambil. ditempat yang sama dilakukan periode penanaman tahap ke2 tetapi panen dilakukan lebih awal yakni pada umur 1 bulan setelah tanam. 3. 3.) Buchenau (genjer) dan 5 jenis tanaman darat yaitu 1. 4. dan 5.) Presl (eceng leutik). Monocharia vaginalis (Burm. petak penelitian dijaga supaya selalu tergenang. Kontrol. M. 3. Hidayati. maka penelitian insitu ini dilakukan selama 1 tahun yang 4 terdiri dari 3 kali penanaman dan 3 kali panen.

867 bc 59.71 72.1917 0.04 153.65 345. Hal ini dilakukan karena dalam fitoremediasi.841 a 37.3 12092 996.6167 2.786 b 5 .99 a 287.7273 1464.7 b 2257.617 102.2 1671. cordata C.75 95.6 252.6 ab 2329.9 1523. pubescens dan M.74 619. Akan tetapi C. pemupukan tidak menunjukkan pengaruh nyata pada produksi bobot kering biomasa hasil panen dari periode penanaman ke-1.0500 3.88 35.21 332. Bobot basah total (gram) biomasa hasil penanaman ke: Pemupukan Kontrol NPK Kandang Kompos 1 1879.138 a 87.51 a 2 169.2833 1.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Monocephala. pubescens M. Produksi total biomasa tanaman (gram) tiap periode penanaman. Hasilnya menunjukkan bahwa pemupukan berpengaruh nyata terhadap pertumbuhan tanaman berupa bobot basah tanaman pada semua periode tanam. sativa M. molesta O.0 223.69 b 152.233 Tdk ditanam Tdk ditanam 77.6 659.6 b 2620.69 b Bobot kering total (gram) biomasa hasil penanaman ke: 1 257. terlihat dari tingginya produksi biomasa tanaman. C.51 47. vaginalis L. Akan tetapi.03 a 345.33 187.cordata tidak ditanam kembali (Tabel 1).93 9.64 161.34 a 184. Tabel 2 menunjukkan pengaruh pemupukan terhadap pertumbuhan tanaman.8333 0.1833 3.0 1337.133 56.1 3.66 a 269. onocephala C.0 425. nudiflora menunjukkan pertumbuhan yang baik pada semua periode penanaman.667 34.74 106.37 b 3 78. flava P.0 Bobot kering total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 589.5 ab 2 1955.9 Tdk ditanam Tdk ditanam 693.2 1779.67 a 216.600 c 63.5 a 1619. tanaman yang diinginkan adalah yang mampu menyerap logam berat polutan dan melakukan translokasi logam berat Tabel 1.23 187.22 a 1110.6 a 2018.6917 2.580 Jenis tanaman S. cordata pertumbuhannya kurang baik pada penanaman ke-1 dan ke-2 sehingga pada penanaman ke-3.4 624. Pengaruh pemupukan terhadap pertumbuhan tanaman.8 a 2028.16 212. nudiflora Tabel 2.7 2778.05 144.792 bc 70. Pemupukan dengan NPK menunjukkan produksi biomasa tertinggi. pubescens dan M .3417 0.69 427.2 b 3 1050. conjugatum C.53 c 751.46 241.3 2850.93 b 221. Bobot basah total (gram) biomasa tanaman hasil penanaman ke : 1 2 3 6921. Konsentrasi dan akumulasi Hg pada tanaman Pengamatan terhadap konsentrasi dan akumulasi Hg pada tanaman dipisahkan antara tajuk dan akar.95 66. dan C.

Sedangkan pada Gambar 2 menunjukkan potensi kandungan (akumulasi) Hg (mg/bobot kering biomasa) pada tanaman. Hidayati. vaginalis 70 60 50 40 30 20 10 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 (Gambar 1c).nudiflora. molesta. Hasilnya pengamatan menunjukkan bahwa tanaman yang diuji mampu menyerap Hg yang ada dalam media tumbuhnya tetapi kemampuan penyerapan masing-masing jenis tanaman berbeda-beda (Gambar 1ab).Juhaeti. T2 = O. T7 = C. Hasilnya menunjukkan bahwa Hg yang dapat diakumulasi bervariasi antar jenis tanaman PEMBAHASAN Hasil pengamatan menunjukkan bahwa masing-masing jenis tanaman mempunyai kemampuan tumbuh yang berbeda. kecuali pada M. Begitu pula dalam hal translokasi logam berat dari akar ke tajuk. T8 = M. Monocephala.pubescens. dan rasio konsentrasi Hg tajuk/akar tanaman (c) Keterangan : T1 = S. T4 = L. konsentrasi Hg (ppm) akar tanaman (b).vaginalis. Hasil pengamatan menunjukkan bahwa nilai ratio konsentrasi Hg di tajuk/akar yang lebih dari 1 muncul pada hampir semua jenis tanaman. T5 = P. T 6= C. T3 = M.flava. terlihat dari beragamnya nilai ratio konsentrasi Hg tajuk/akar pada setiap jenis tanaman. masing-masing jenis tanaman menunjukkan kemampuan yang berbeda. T9 = C. hal ini berhubungan dengan kemampuan tanaman tersebut dalam mengatasi kondisi lingkungannya yang 140 120 100 80 60 40 20 0 T2 T3 T4 T5 T6 T7 T8 T9 Jenis tanaman Konsentrasi Hg (ppm) Jenis tanaman Ratio konsentrasi Hg tajuk/akar 6 5 4 3 2 1 0 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 1 : Konsentrasi Hg (ppm) di tajuk tanaman (a).conjugatum. Sativa. Syarif & Hidayat tersebut ke bagian tanaman yang dipanen. 6 konsentrasi Hg (ppm) .cordata.

T5 = P.conjugatum. Kandungan Hg (mg/bobot kering biomasa) tanaman pada tiap kali tanam Keterangan: T1 = S.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi 30 Kandungan Hg tanaman 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Panen 1 Panen 2 Panen 3 Jenis tanaman Gambar 2. Kriteria suatu jenis tumbuhan dapat dolongkan sebagai hiperakumulator adalah : (1) Tahan terhadap unsur logam dalam konsentrasi tinggi pada jaringan akar dan tajuk. Perlakuan pemupukan dimaksudkan untuk meningkatkan produksi biomassa tanaman. sedangkan C. flava. Dalam menentukan apakah suatu tumbuhan berpotensi sebagai akumulator logam berat (dalam hal ini Hg).pubescens.vaginalis. Salvinia molesta. Diharapkan. pemupukan NPK memberikan pengaruh yang terbaik terhadap pertumbuhan tanaman. T2 = O. Pada penelitian ini pemupukan berpengaruh nyata terhadap pertumbuhan tanaman. T8 = M. T7 = C. conjugatum. (2) Tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lain. 1995) dan (4) Secara ideal memiliki potensi produksi biomasa 7 . marginal. P.nudiflora. sativa. T6 = C. perlu diperhatikan beberapa kriteria.flava. C. Sativa. M. (3) Memiliki kemampuan mentranslokasi dan mengakumulasi unsur logam dari akar ke tajuk dengan laju yang tinggi (Brown et al. Salah satu hasil penelitian melapokan bahwa kandungan (konsentrasi logam x total berat kering tanaman) Zn dan Cd pada tanaman yang diberi pupuk organik meningkat 3 – 10 kali dibanding kontrol. dengan meningkatnya produksi biomassa ini maka banyaknya polutan yang diserap akan meningkat. O. T4 = L. nudiflora menunjukkan toleransi yang tinggi terhadap lingkungannya. molesta. vaginalis. L. Hal ini sesuai dengan hasil penelitian yang menunjukkan bahwa secara umum pemupukan dapat meningkatkan serapan logam oleh tanaman. cordata toleransinya lebih rendah sehingga pertumbuhannya kurang baik. pubescens dan M. dan C. T3 = M. Pada penelitian ini. T9 = C. monocephala.cordata. Monocephala.

(2) Proses penyerapan logam oleh akar pada tumbuhan hiperakumulator lebih cepat dibandingkan tumbuhan normal.vaginalis. Gambar 3 menunjukkan kandungan (akumulasi) Hg pada tanaman dari 3 kali periode penanaman. C. Akar tumbuhan hiperakumulator memiliki daya selektifitas yang tinggi terhadap unsur logam tertentu. (3) Sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. molesta. Syarif & Hidayat yang tinggi (Reeves 1992). Kemudian. yaitu proses interaksi akar tanaman dengan media tumbuh (tanah dan air). Hal ini sesuai dengan hasil penelusuran pustaka yang menunjukkan bahwa sejumlah tumbuhan dari banyak famili terbukti memiliki sifat hipertoleran. S. Hasil pengamatan menunjukkan bahwa masing-masing jenis tumbuhan menunjukkan kemampuan yang berbeda dalam mengakumulasi Hg dari media tumbuhnya. Dalam hal ini tumbuhan hiperakumulator memiliki kemampuan untuk melarutkan unsur logam pada rizosfer dan menyerap logam bahkan dari fraksi tanah yang tidak bergerak sehingga menjadikan penyerapan logam oleh tumbuhan hiperakumulator melebihi tumbuhan normal.flava.conjugatum. sativa.cordata dan C. . hal ini dibuktikan oleh ratio konsentrasi logam di tajuk/akar pada tumbuhan hiperakumulator lebih dari satu. Hal ini dibuktikan oleh rasio konsentrasi logam tajuk/akar pada tumbuhan hiperakumulator lebih dari satu.Juhaeti. monocephala. Gabbrielli et al (1991) menerangkan bahwa sistem translokasi unsur dari akar ke tajuk pada tumbuhan hiperakumulator lebih efisien dibandingkan tanaman normal. terbukti dengan adanya konsentrasi logam yang tinggi pada akar. potensi produksi biomasa tananaman yang diuji pun cukup tinggi. Mekanisme biologis dari hiperakumulasi logam pada dasarnya meliputi proses-proses: (1) Interaksi rizosferik. P. Pada penelitian yang telah dilakukan sebelumnya juga didapatkan data bahwa jenis-jenis tanaman yang diuji pada penelitian ini memiliki tingkat laju penyerapan unsur dari tanah yang tinggi dibanding tanaman lainnya. M. M. pubescens. C. L. yakni mampu tumbuh dan mengakumulasi logam dengan konsentrasi tinggi pada akar dan tajuknya dan sifat hiperakumulator yakni dapat mengaku-mulasi unsur logam tertentu dengan konsentrasi tinggi pada tajuknya yang dapat digunakan untuk tujuan fitoekstraksi. Hasil penelitian ini menunjukkan bahwa tanaman yang diuji memiliki konsentrasi Hg di akar dan tajuk yang tinggi dan tanaman tersebut tetap dapat tumbuh dengan baik. Selain itu dari Gambar 1c terlihat bahwa tanaman juga memiliki kemampuan untuk mentranslokasi dan mengakumulasi logam dari akar ke tajuk yang ditunjukkan oleh ratio konsentrasi Hg tajuk/akar yang lebih besar dari satu. Hal ini berarti bahwa tanaman-tanaman tersebut dapat memenuhi kriteria tahan terhadap unsur 8 logam yang tinggi pada jaringan akar dan tajuk. Hidayati. Hasilnya menunjukkan bahwa potensi kandungan Hg total yang dapat diakumulasi masing-masing jenis tanaman dari 3 kali periode tanam berturut-turut dari yang tertinggi adalah O.nudiflora.

cordata. molesta. nudiflora. P. molesta.Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Tabel 3 menunjukkan urutan tanaman dalam memproduksi biomasa dan mengakumulasi Hg pada berbagai perlakuan pemupukan yang diberikan. Vaginalis.vaginalis. M. O. vaginalis. kondisi bibit/benih serta pengontrolan limbah yang masuk ke areal penelitian. vaginalis. Gambar 3. T3 = M. conjugatum dan M. T8 = M. Tanamantanaman tersebut adalah S. T6 = C. nudiflora dan P. molesta.nudiflora. O. sativa. O. Sativa. vaginalis.flava. molesta. T7 = C. jarak tanam. C. T9 = C. C. M.pubescens. T5 = P. nudiflora. 35 30 25 20 15 10 5 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 Hg total Jenis tanaman Keterangan: T1 = S. T2 = O. P. nudiflora. sativa dan C. sativa. Berdasarkan karakteristik tumbuhan hiperakumulator maka jenis tanaman yang potensial untuk fitoremediator merkuri adalah S. Berdasarkan kriteria tumbuhan akumulator maka 5 jenis tanaman yang diuji potensial memenuhi syarat sebagai tanaman akumulator merkuri. C. sedangkan urutan 5 tanaman yang menunjukkan kapasitas membersihkan polutan (kemampuan mengakumulasi Hg) tertinggi adalah S. Untuk meningkatkan potensi sebagai akumulator masih diperlukan serangkaian penelitian baik Kandungan Hg total (mg/total bobot kering) melalui penerapan tehnik budidaya maupun melalui pemuliaan tanaman. KESIMPULAN DAN SARAN Pertumbuhan jenis tanaman yang diuji berbeda nyata.conjugatum. Monocephala. M. O. conjugatum. umur panen. conjugatum. Masih banyak aspek teknik di lapangan yang perlu diperbaiki diantaranya aplikasi pemupukan dengan dosis yang tepat. T4 = L. conjugatum. Hasilnya menunjukkan urutan tanaman yang menghasilkan biomasa tertinggi yakni S. Pemupukan yang diberikan berpengaruh nyata terhadap pertumbuhan tanaman. sativa. Kandungan Hg (mg/total bobot kering) tanaman hasil 3 kali tanam 9 . molesta. P.

3 10.581 24.937 9. cordata C.369 C.5 1895. flava 24.9 8046.869. sativa P. molesta 13303.conjugtum S.14 8. conjugatum 5625.9 6488.3 2105. pubescens S.999 3.2 M. moncephala M. monoephala 2476.05 M. cordata C. monoephala C. nudiflora 57. nudiflora 63.9 6936. sativa M.4 P. molesta O. pubscens M. pubscens M. nudiflora S.11 2 C.758 C.mocephal 35.604 18.605 Kompos S. vaginalis 42. sativa C. nudiflora 16.498 M.912 P.6 O. vaginalis C.7 4742. molesta 40.214 S. molesta C. pubescens M. vaginalis P.97 C.70 6 O.803 L.529 P. monoephala L.2 4644.627 P.Juhaeti. vaginalis L. pubescens M.263 32. molesta 55. pubescens S. nudiflora 4504. cordata C.55 4 10 . molesta M. flava P.099 9.625 O.7 1254.33 10513. Urutan jenis tanaman berdasarkan kriteria tumbuhan akmulator Ranking berdasarkan Kandungan Hg total (mg) Panen 1+2+3 Jenis tanaman Hg Total (mg) 46.5 M.1 1721. vaginalis L.37 Kapasitas membersihkan/tahun (mg) Jenis tanaman Kapasitas (mg) O.471 33. sativa 159. pubescens 12558.848 12. vaginalis L. flava M. sativa 4755.049.712 12. molesta M. molesta 190.04 5 S. flava C. vaginalis 8. vaginalis 7682. conjgtum 55.435 S.03 3949. conjgtum 11. monephla 36.946 11. conjugatum C. puescens M. cordata C. conjatum 107. conjugatum C. flava 13. pubescens S. flava 44.253 M. nudiflora P. nudiflora O. vaginalis 68.104 31. conjgam 67.5 M. sativa 85.455 O. vaginalis 33.765 L.8 C. flava M.278 C.43 4598. cordata C. monoephala M.183 M. sativa M.298 M. conjugatum 4542.095 19.456 16.37 C. conjugatum C. flava 4. nudiflora 18.13 1 O.568 L. cordata C. molesta 111. flava O.conjgtum 40.401 7. cordata C.197 C. nudiflora L. nudiflora 6331.9 C. sativa 55. molesta 63.849 41. Syarif & Hidayat Tabel 3.171 C.587 Perlakuan pemupukan Biomassa total(gr) panen 1+2+3 Total biomas (gr) S.3 O.55 C.87 5030. cordata C.907 12.34 Jenis tanaman Kontrol NPK O.6 3894. vaginalis 28.13 1164.conjgtum C. sativa L. molesta O. monoephala 10. monephal 42. pubescens M.241 Kandang C.558 19.6 5077. flava 18.502 S.03 31. monephala M.062 L. molesta 10897. pubescens 3216 5259. cordata 859. sativa 141.357 P.643 5.516 16.316 C. flava P. sativa 6098. nudiflora 107. cordata C. moncephala C.9 P. mocephal 32. Hidayati. sativa M. cordata C. nudiflora 114. pubscens S.31 L. vaginalis L. flava P. cordata C.931 C.155 C.

RL. Hidayati. Stewart & BH. Di dalam: Backer. 2004. Vergnano. Rodriguez. T..Uji Potensi Tumbuhan Akumulator Merkuri untuk Fitoremediasi Perlu sosialisasi kepada masyarakat tentang adanya pencemaran di lahan pertanian dan cara pembersihannya secara mudah dan murah (fitoremediasi). N. Phytoremediation 9(1): 1-13.. 1992. The Vegetation of Ultramafic (Serpentine) Soils. Hlm 253-227. Zinc and Cadmium Uptake by Hyperaccumulator Thlaspi caerulescens Grown in Nutrient Solution. Mattioni.. Practices 6(2): 165-175. & O. J. R.Plant. Moreno. L. The Hyperaccumulation of Nickel by Serpentine Plants. Hidayat. International JSPS Seminar. Capability of Selected Crop Plants for Shoot Mercury Accumulation from Polluted Soils: Phytoremediation Perspectives. SL. Phytoremediation of MercuryContaminated Mine Tailings by Induced Plant-Mercury Accumulation. Nutr 14 : 1067-1080. Reeves. 12-20 Oktober 2006. Gabbrielli. Harapini. Angle & AJM. Syarif. 2006. N. 1995. Juhaeti. RD. FN. & CL. Laporan Akhir Penelitian Kompetitif LIPI. Accumlation Mechanism and Heavy Metal Tolerance of a Nickel Accumulator. C. Rincon. Juhaeti & F. T. RD. Reeves (ed). F.. Bogor. Syarif & M. S. Asencio. Hampshire: Intercept Ltd. JS. 2007. Memasukkan: November 2008 Diterima: Juli 2009 11 . Robinson. Soil Sci Soc Am J 59:125-133. Int.. I. Anderson. Proctor. Mercury and Cyanide Contamination in Aquatic Environments Around Two Gold Mine Areas and Possible Solution of Using Green Technology of Phytoremediation. CWN... RB. J. Hidayati. J. Baker. Chaney. DAFTAR PUSTAKA Brown. J. 2007. Environ. 1991. Rodriguez. AJM.

picteti. Hylleberg & Nateewathana 1991b). Norman 2000). pygmaeus herbereri.Jurnal Biologi Indonesia 6 (1):13-23 (2009) Occurrence of Idiosepius (Mollusca: Cephalopoda) in Indonesian waters Janek von Byern 1 1 & Ristiyanti M. Ternate. jenis sotong ini tidak diminati oleh para nelayan. reproduksi dan siklus hidupnya. siklus hidup dan distribusi Idiosepius. Hasil studi ini mencatat lokasi baru (new record) ditemukannya sotong mini jenis I. pygmaeus khusus dari perairan pantai di Lombok. Austria 2 Museum Zoology Bogor. habitat dan distribusi empat jenis sotong mini jenis I. habitat. Banda. distribution. sehingga hanya sedikit data yang diketahui mengenai pertumbuhan. One conspicuous morphological character of this genus is the adhesive 13 . picteti hingga saat ini hanya dijumpai di Ambon. Keywords: Cephalopoda. Karena ukurannya yang sangat kecil.go.email: rist001@lipi. pygmaeus. The arms are short and robust and almost equal in length. Idiosepiidae. meskipun pernah dilaporkan setidaknya ada tiga jenis dijumpai di Ambon. Both sexes can be distinguished easily by the modified fourth arm pair in males (Yamamoto 1949. Idiosepiidae. Penelitian ini bertujuan untuk memberikan gambaran ringkas tentang sistematik.id ABSTRAK Jenis Idiosepius (Mollusca: Cephalopoda) di perairan Indonesia. Marwoto 2 University of Vienna. Balikpapan. biserialis dan I. 1090 Vienna. habitat. The animals are dorso-ventrally compressed and cigar-shaped. biserialis dan I. habitat. Cell Imaging and Ultrastructure Research. Hasil penelitian juga menunjukkan bahwa beberapa jenis Idiosepius memiliki sebaran yang luas di perairan Indonesia kecuali jenis I. The females reach maturity at 3 cm length. of Life Science. Dalam tulisan ini diuraikan karakter morfologi. Jackson 1988. Fac. Nabhitabhata 1998. Norman 2000) with a body weight ranging from 6 mg (Idiosepius biserialis) to 1 g (Idiosepius pygmaeus) (Hylleberg & Nateewathana 1991a. Research Center for Biology – LIPI. distribusi. Informasi dan penelitian tentang sotong mini “pygmy squid” marga Idiosepius yang ada di Indonesia sangat kurang. Indo-Pacific Kata kunci: Cephalopoda. except for one arm that is always shorter (Hylleberg & Nateewathana 1991b). Indo-Pacific Introduction The genus Idiosepius has the smallest species within the cephalopods and is also named “pygmy squid”. Hasil studi diharapakan menambah khasanah pengetahuan tentang sotong mungil ini sekaligus memacu para peneliti untuk lebih memperhatikan genus ini. whereas the males of some species reach sexual maturity at < 1 cm (Joubin 1902. ovally elongated with the long axis parallel to the body axis (Figure 1). Cibinong 16911 – Indonesia. the fins are small. Sibolga dan Lombok. I. I.

pygmaeus and the other species mostly in size. Rensch collected 14 specimens of the genus Idiosepius at Ekas Bay. Hiding there. secretion of glue serves to stick the eggs on sea grass (Nesis 1982). The animals are small in size and live exclusively in mangrove areas in the Indo-Pacific area down to Australia. up to this day. Lombok. picteti at Ambon Island. In 1927. contour of the adhesive organ and expression of the hectocotylus (Grimpe 1931). This species was thought to occur only in the Philippines. 2008). Furthermore. Idiosepius pygmaeus hebereri was . more than 115 years ago. Examinations by Nesis (1982). revealed that the morphological characteristics were insufficiently different to justify the subspecies. 1881 in Ternate 14 and Banda-Sea. however. collections by Grimpe in 1931 in Balikpappan and Sibolga showed that I. in females. 2008. Collection of Idiosepius in Indonesian waters has long history. Later. In 1898. pygmaeus has a wide distribution in Indonesia. Joubin (1894a) collected one male holotype sample of I. Appellöf discovered I. He therefore regarded his specimens as the subspecies Idiosepius pygmaeus hebereri. pygmaeus from several institutions and proposed that his specimens differ from I.Byern & Marwoto Figure 1: Individual of the species Idiosepius pygmaeus. The animals use the glue from the adhesive glands to stick to sea grass leaves or algae for camouflage when threatened by predators (Sasaki 1921). Cyran et al. attempts to re-collect individuals of this species in its original type locations or neighbouring island were unsuccessful. Indonesia. pygmaeus Steenstrup. Unfortunately. organ (also named adhesive gland) located on the posterior part of the dorsal mantle side (von Byern et al. It can be assumed that this species has disappeared or even become extinct. Grimpe (1931) compared the collected material with samples of I. they also lie in wait to capture prey swimming by.

pygmaeus below).300´S. San Jose Mission Station. Ekas-Bay. Lombok (08° 52. less is known about the geographical distribution and habitat of this species (see section Habitat conditions in Indonesia). Nevertheless. picteti. Japan. Collector: S. 32° 54. Morrumbene Geographical distribution of the species or /and material examined: Thailand: Bang Rong. was recently discovered in Indonesian waters (von Byern et al. This will shed light on the ecology and distribution of Idiosepius and yield new insights into the habitat conditions of Indonesian individuals. So far.215´S. Research Center for Biology – LIPI. picteti and I. 1962 (Figure 2A) Holotype: deposited at South African Museum. it was thought to occur only in African waters (Mozambique) and Thailand.156´N. von Byern & Klepal 2009). 2005) . RESULT Description of Indonesian Idiosepius species Idiosepius biserialis Voss. von Byern & Klepal 2009) Japan: Takasu. 35° 22. Austria) and MZB (Museum Zoologicum Bogoriense). 26° 02.553´E) (von Byern & Klepal 2009). 2005) Indonesia: Ekas-Bay. 98° 25. Adam 1986. Shigeno (von Byern et al. Apart from I. pygmaeus. In contrast to I. 116° 27.December 2007 using a dipnet.281´E) (Voss 1962. 2005). many questions about their life cycle. biserialis. Further collections coupled with ecological and behavioral investigations are necessary to complete our picture of this genus.721´E. pygmaeus could still be located at their type locality (von Byern & Klepal 2007) as well as in new localities (see description of I. 1959. we report new collection places for Idiosepius in Indonesia and extend the previous type localities. pygmaeus. 32° 54. Lombok (08° 15 .184´S. The specimens are deposited at the NMW (Naturhistoris- ches Museum Wien. a further species. Indonesia. Phuket Island (8° 02.020´S.487´ E) (von Byern & Klepal 2009) and Ko Pratong. Previously. individuals of I. With the present description and geographical data. Ranong (Hylleberg & Nateewathana 1991a) Mozambique: Inhaca Island (26° 00. Monque (23° 41.166´E) (Kalk. Cape Town. The specimens were then preserved with ethanol 95% (partly for DNA) and 70 % (for ordinary preserved collections).Occurrence of Idiosepius (Mollusca: Cephalopoda) therefore referred to I.331´S.541´E) (von Byern et al. Inhambane Bay (23° 51. METHODS Idiosepius specimens were collected along the bay of Lombok in November . geographical distribution and origin of migration remain. South Africa (SAM A6520) Type locality: Mozambique. 35° 22. I.

The clubs of this species bear two rows of small suckers. which are nearly constant in size to the end of the club.38 ± 1.84 ± 0. picteti (Joubin. data) Morphological characteristics: This species has the smallest specimens of the genus. 1982). In the caught male. separated by a deep cleft. 116° 26. 16 . 116° 27.31 mm (females).781‘ E) . The specimens from Thailand are larger (ML to 5. 1962). bearing 1-5 suckers on the left (ventral view) and 3-8 suckers on the right ventral arm. The left arm also has two small flaps.3 mm Figure 2: Schematic drawing of the known Idiosepius species in Indonesian waters: A) I.3 mm (males) and 7. Animals from Mozambique are small. the hectocotyli arms are almost unequal in length: the left arm is shorter than the right one. 1894a) and C) dorsal and ventral view of I.5 ± 0. pygmaeus (Nesis. slender.2 mm C 7.7 ± 1.857‘ E) (08° 50.Byern & Marwoto 50. The fins are semicircular and about ¼ of the mantle length. collected November 2007 (unpubl. with a mantle length of 4.1 mm females). 357‘S . 714‘S . Both ventral arms in the male are hectocotylized. at the tip. biserialis (Voss.54 mm males and 7.35 mm 15. The fins are more rounded kidney-shaped and A B 14. B) I.

Genève. 1881 (Figure 2C). Idiosepius picteti has a small tentacle club with four rows of suckers. 1920 Holotype: deposited at the Muséum d’Histoire Naturelle. Copenhagen. longer and bilobate at the tip.107´N. Idiosepius pygmaeus Steenstrup. 1894b (today Ambon Island) Geographical distribution: only known from the type locality Morphological characteristics: So far only the holotype is available. 107° 20´E) Geographical distribution of the species or/and material examined: Philippines: Jolo Habor (Adam 1986) Thailand: Klong Mudong (7° 48. Our examinations of this specimen reveal that Joubin (1894a) erred. 1920 Naefidium picteti Grimpe.472´E) (von Byern a & Klepal 2009).39 ± 1.1 mm females) with 3 suckers on the left and 5 on the right ventral arm. Synonymy: Idiosepion pygmaeum Fischer. Joubin 1894b. 1886. Appellöf 1898 Idiosepius pygmaeus pygmaeus Grimpe. The oral face the arm is transversely plicate. Klong Bang Rong (8° 02. while the two investigated females have a mantle length of 5.945´N. Denmark (ZMUC CEP52) Type locality: Philippines. Idiosepius picteti Joubin. 98° 24. Each ventral arm has a single small sucker near the base. sometimes also three or four oblique rows of suckers. Zoologisk Museum. The animals from Japan are almost twice as long (6. The right ventral arm in the male is very short and broad. Switzerland (MHNG M 3/75 747/27) Type locality: Indonesia. The tentacle clubs have two horizontal rows of suckers. Idiosepius picteti has an adhesive organ on the dorsal mantle side and is referred to the genus Idiosepius.89 mm males and 9. 1894b (Figure 2B) Synonymy: Loligo picteti Grimpe. The specimens from Indonesia have a mantle length of 3 mm (and 4 suckers on each hectocotylized arm) in the one available male. The body is large and elongate (mantle length 14 mm). Amboina – according to Joubin.Occurrence of Idiosepius (Mollusca: Cephalopoda) attached to the body at an angle. The left ventral arm is more slender.25 ± 0. 98° 25. 1931 Holotype: deposited at Kobenhavns Universitet. Zamboanga (4° 20´N. Joubin (1894b) wrote that the examined specimen has no adhesive organ on its dorsal side: “Pas d´impression dorsale entre les nageoires”.34 ± 0.35 mm. The hectocotylized arms also bear 2-4/2-5 suckers on the left/right ventral arm.030´E) (Suwanmala 17 . no additional specimens of this species have ever been found. 1887 Idiosepius pygmaeus Hoyle.

1931 Holotype: deposited at the Zoologisches Museum. pygmaeus from Thailand and bears 2 or 3 suckers on the left and 3 suckers on the right ventral arm.51 ± 1. bilobated at the tip.885‘ S. Ekas-Bay.709‘ E). Semmens et al. 116° 30. collected December 2007 (unpubl.244‘ S. Idiosepius pygmaeus from Indonesia is similar in size (11. Jackson 1992. North Queensland (19° 15´S. The range of sucker combinations varies from 0 to 4 suckers on the hectocotylized arms (Thailand). rounded and slightly constricted at their base.37 mm in females. one individual has 1/1. 116° 27. Pecl & Moltschaniwskyj 1999) Micronesia: Palau (Belau) Islands (Moynihan 1983) Indonesia: Ternate (Appellöf 1898). Later examination of this species revealed more numerous suckers in different variations on the ventral arms (Appellöf 1898). 146° 50´E) (Jackson 1988.5 ± 2. 1995.28 mm males and 15. Jackson 1993. collected December 2007 (unpubl. 116° 42. collected November 2007 (unpubl. Institut für Systematische Zoologie.53 ± 1. another 4/4 suckers on the hectocotyli.12 mm females) to I.52 mm in males and 16. data) Morphological characteristics: The species has a sepiolid body shape with a mean mantle length of 11.015‘ E). The 18 right ventral arm is stout and thick.26 ± 4. Grimpe (1931) . both ventral arms have only one sucker at their base. The specimens bear 4 rows of suckers at the club of the tentacle.937‘ E). Berlin. while the left arm is thinner and slender. Germany (ZMB) Type locality: Indonesia. 116° 43. According to the description of Steenstrup (1881).012‘ E). Jackson & Choat 1992.541´E) (von Byern & Klepal 2007) · Gili Sulat (08° 19. collected December 2007 (unpubl. data) • Rinca Island (08° 39. Lombok Geographical distribution: only known from the type locality Morphological characteristics: Because of the close morphology to Idiosepius pygmaeus. 119° 42. Lewis 1991. Lombok (08° 52. data) • Telong Elong (08° 48.Byern & Marwoto et al. Balikpappan (Grimpe 1931). Pecl & Moltschaniwskyj 1997.020´S.637‘ S. short. pygmaeus (= Idiosepius pygmaeus hebereri) Grimpe. Museum für Naturkunde der Humboldt-Universität. I. data) • Gili Lawang (08° 19. The fins are small. Sibolga (Grimpe 1931) and Banda-Sea (Appellöf 1898) New localities in Indonesia • Ekas-Bay. 2006) and Ao Chalong (Hylleberg & Nateewathana 1991b) Singapore: Tempenisi (Adam 1986) Australia: Townsville. More than 30% of the specimens bear 2/3 suckers on the left/right or 3 suckers on both ventral arms.730‘ S.

biserialis and I. pygmaeus). The species are mostly distributed in the tropical Indo-Pacific. At its base the left arm has 3 suckers. 2005). I. biserialis has the widest geographical distribution.g. the males of 8. 1881 and I. Others like I. but individuals were also found in cooler Russian waters (Nesis et al. I.5 mm. I. 1962. Japan. Habitat of Idiosepius in Indonesia Idiosepius biserialis was caught in November 2007 at low tide with a dipnet 19 . but this value needs verification.5 mm. This may be explained by their small size and habitat conditions: observing specimens in their natural habitat is still difficult. thailandicus Chotiyaputta et al. paradoxus (Ortmann. Presently. The fins are small and have a round to almost oval form. Moreover. Morphologically the species can be identified by the arrangement of suckers on the club (two or four rows) and the number of suckers on the ventral arms (hectocotyli) (Nesis 1982). notoides Berry. 1845). von Byern et al. embryonic development and life cycle have only been made with wild-caught specimens in aquarium cultivation (Moynihan 1983. 2002). For example. The females of this subspecies have a mean mantle length of 14. and also has two lobes at its tip. Within the genus. 1894a). paradoxus inhabit sea grass and algae areas. Jackson 1992). spawning. unpubl. I. I. Jereb & Roper (2005) currently place eight species within the genus: Idiosepius biserialis Voss. no data are available about its postembryonic life. while the right arm is more stocky and broad with 2 suckers at the base. pygmaeus Steenstrup. I. DISCUSSION Systematics The relationships among species within this genus remain unknown. 1991. ranging from Japan to the Indo-Pacific (Thailand and Indonesia) (Voss 1963. southern Australia including Tasmania. minimus (D‘Orbigny. Habitat and life cycle The habitat occurrence varies within the genus: some species occur in mangrove areas (e. The left ventral arm is longer and bigger than the right arm. macrocheir Voss. All observations on this genus concerning behaviour. relatively little is known about the biology and life cycles of Idiosepius. I. data). the geographical distributions of all Idiosepius taxa are still only marginally explored.Occurrence of Idiosepius (Mollusca: Cephalopoda) subordinated this species as Idiosepius pygmaeus hebereri. 1888). and African waters. Some authors assume a life cycle lasting 3 months (from egg development until death) (Tracey et al. it has also been recorded in Mozambique (incorrectly annotated by Voss in 1962 as South Africa). I. the onset of sexual maturity or postembryonic behaviour. Grimpe (1931) did not describe the number of rows on the club but later re-examination of the holotype material showed that the specimens have four rows of suckers (von Byern. picteti (Joubin. 1962. 1921. 2003).

biserialis in Africa. Cephalopoden von Ternate. Biology Department and furthermore to Mr. the animals were also observed to mate within this flotsam and escape under the waste when threatened. but are clearly absent in the northern. During high tide. pygmaeus hebereri were collected in the eastern part of the Ekas-Bay in April 2004 (von Byern & Klepal 2007). Lombok Island. 1921. Their occurrence between a flotsam of garbage indicates the ability to adapt to new habitats. no individuals of this species were ever found in sea grass or algal habitats (Suwanmala et al. Gili Lawang. Moreover. western and south-western shores of the Island. 2005. . REFERENCES Adam. Additional genetic. I. On some days this flotsam covers almost the whole water surface. W. Telong Elong and Ekas-Bay. ACKNOWLEDGMENTS We are very grateful to Didik Santoso. von Byern & Klepal 2009). We still do not know whether the animals stay there at high tide or move elsewhere. Cephalopods of the genera Sepiolidea. J. individuals of the former I. 1986. La radula et les mandibules de quelques espéces d´Idiosepius Steenstrup. 2006. ecological and behavioral investigations are necessary to provide a more complete picture of 20 the genus Idiosepius and provide more knowledge about their occurrence and geographical distribution in Indonesian waters. A. Toifl from the ASEA-UNINET of the University of Vienna for promoting the research trip of the first author to and within Indonesia and Dr. and Idiosepius. Our thanks go in particular to Mrs. 1881 (Mollusca Cephalopoda Decapoda). Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 24 (4): 570637. Michael Stachowitsch from the University of Vienna for critically reading the manuscript. Japan and Thailand. These observations agree well with other collections of I. Lalu Japa & Karnan from Mataram University. Naturelles de Belgique 56: 149-154. von Byern & Klepal 2009). Sci. Interestingly. pygmaeus could only be found in mangrove forests and belts. indicating that this species is specialised for sea grass areas (von Byern et al. Moreover.Byern & Marwoto in two sea grass areas in the northern area of Ekas-Bay. Appellöf. de L´Institut Royal des Sci. pygmaeus: even compact and strongly agitated waste had no influence on their behaviour and movement. such as those along the eastern part of Lombok Island at Gili Sulat. garbage. SS. So far. 47 (1): 39-55. Bull. In contrast. the garbage in the water apparently does not affect I. The Philip. 1898. leaves and other plant material were transported here by the current. Berry. Mady Marcuo and the Staff of Rinca Island for helping collect the samples presented here. Sepiadarium.

with mention of additional morphological characters. Klepal & J. Seasonal Abundance of the small tropical Sepioid Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) at two Localities off Townsville. The Jap. Chaitiamvong 1991. Jackson. 1886. Mollusques vivants et fossiles. The use of statolith microstructures to analyse lifehistory events in the small tropical cephalopod Idiosepius pygmaeus. Can. WE. Center Res. & CFE. Zool. Nateewathana 1991a. N. Growth in tropical cephalopods: An analysis based on statolith microstructure. Hoyle. Malacology 50 (3): 165-174. W. Grimpe. Cephalopoda). Anzeiger 51: 208-214. Okutani & S. 1992. Teuthologische Mitteilungen IV. Naefidium n. Grimpe. Bull. 1845.. 1931. internal anatomy. A new record for the Andaman Sea.g. Hylleberg. Jackson.S. Ultrastructural characterization of the adhesive organ of Idiosepiidae Voss. Jackson.J. Hylleberg. T. D‘Orbigny. Australia. Nateewathana 1991b. Jackson. 1962 (Mollusca. GD. North Queensland. Cyran.. (Cephalopoda: Idiosepiidae). Libraire F. Fish. GD. ACV.S. Tome Premier. G. Roper 2005. pro: Loligo picteti Joubin 1894. von Byern 2008. 1920.M. 1962. Phuket Marine Biol. 350-351. Venus. G. 56: 1-9. A new pygmy cuttlefish from the Gulf of Thailand Idiosepius thailandicus n. Paris. 1881 (Cephalopoda: Idiosepiidae). Challenger during the years 187376. P. sp. & A. Teuthologische Mitteilungen XIII. Redescription of Idiosepius pygmaeus Steenstrup. Cephalopods of the world . The Veliger 35 (4): 396-401. Choat 1992. GD &J H. Gide et Cie. P. GD. 1993.An annotated and illustrated catalogue of cephalopod species 21 . CH. Jereb.Occurrence of Idiosepius (Mollusca: Cephalopoda) Chotiyaputta. and biometrics of the cephalopod Idiosepius biserialis Voss. Center Res. Fishery Bulletin 91: 260-270. Zoology 16: 1245. Aquat. Seasonal variation in reproductive investment in the tropical loliginid squid Loligo chinesis and the small tropical sepioid Idiosepius pygmaeus. Zool. Manuel Conchyliologie et de Paleontologie Conchyiologique ou Histoire Naturelle des Molleusques vivants et fossiles.Sci. Phuket Marine Biol. Report on the Scientific Results of the Voyage of H. 49: 218-228.M. Anzeiger 95 (5/8): 149-174. Fish. J. J. Fischer. Savy Paris. 55: 33-42. Bull. 3 rd International Symposium “Coleoid cephalopods through time”: 97-98. J. & A. Idiosepidae. Bull. Über die Cephalopoden der SundaExpedition Rensch. 1988. Cephalopodes Familie XIII. Morphology. Report on the Cephalopoda collected by H. 1887. 87: 265-272.Challenger during the Years 1873-76.

Idiosepius thailandicus Chotiyaputta. Moynihan. 1888.A. Okutani& Chaitiamvong. Effect of feeding on the structure of the digestive gland of the tropical sepioid Idiosepius pygmaeus. FAO species catalogue for fishery purpose. for English Translation. 2002. 1: Chambered nautiluses and sepioids (Nautilidae. 1st. Japanische Cephalopoden. Royal Soc. MD. Revue Suisse de Zool. Semmens. London.Byern & Marwoto known to date. Sasaki. African J. Joubin. Pecl. du Musèe d‘Historie Naturelle de Genéve 2: 23-64. On an adhering habit of a pygmy cuttlefish. 1983. Alexander 1995. Phuket Marine Biological Center Special Publication 18 (1): 25-40. Inc. Ruthenica 12 (1): 81-84. Behavior 85: 42-57. Sepiadariidae. Japonenses 10 (21): 209-213. 4. Jahrbücher 3: 639670. Joubin. Publications. 1-82. Vol. 1991. Translated from Russian by B. Rome.. Zool.Sci. Distinctive Behaviour of Thai pygmy Squid. Moscow. M. Joubin. Ltd. Mocambique. 2000. L. Moltschaniwskyj 1999. Reproductive Biology of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae) from waters near Townsville. J. 22 . The zoogeographical composition of the intertidal fauna at Inhaca Island. Zoo. et Ann. K. Cephalopods of the World. a small tropical cephalopod.First record of Idiosepiidae in Russian seas. GT & N A. 1894b.. Australia. Revision des Sepiolidae. Note complementaire sur un Céphalopods d‘Amboine Loligo picteti= Idiosepius picteti. Moltschaniwskyj 1997. Sepiidae. AR. Nabhitabhata. 1888) (Cephalopoda) . 1998. 1902. Sepiolidae. Katugin & AV. ON. Lewis. 1921. V. Pygmy cuttlefish Idiosepius paradoxus (Ortmann. London. 1982. Ortmann. J. A. K. 266: 1133-1139. Ratnikov. 1894a. N A.A. M. Moltschaniwskyj & CG.. Pecl. Céphalopodes d‘Amboine. Somatic growth processes: how are they altered in captivity ? Proc. Tintenfischfuehrer. Nesis. Hamburg.: 178-180. 242: 751-764. Mémoires de la Société Zoologique de France 15: 80-145. 1987 TFH. No. Idiosepius pygmaeus Steenstrup. 1959. J. Nesis.S. L. Idiosepiidae and Spirulidae). Levitov. Changes in muscle structure associated with somatic growth in Idiosepius pygmaeus. 1991. Norman. Food and Agriculture Organization of the United Nations. Kalk. Sci. G. Notes on the behavior of Idiosepius pygmaeus (Cephalopoda: Idiosepiidae). Annotationes Zool. & N A. S. Jahr Verlag. 3: 459-460. M. Copyright Agency of the UdSSR for Light and Food Industry Publishing House. Revue Suisse de Zool.P. North Queens-land. L.

Wien 108 B: 137-144. Klepal.. Suwanmala.Cent. Observation of Idiosepius pygmaeus (Cephalopoda. 234: 1-180. & W.UK. GL.Biol. Phuket Mar. von Byern. J. Occurrence of Idiosepius pygmaeus (Cephalopoda. Associate. Malacologica (in press).Occurrence of Idiosepius (Mollusca: Cephalopoda) J. K. Sexual dimorphism of Loligo bleckeri and Idiosepius paradoxus on their mantle length. Voss. 1962. 1881. Yamamoto.danske Vidensk.. Ann. von Byern. S.Assoc. Bull. Nat. of S. U. Klepal 2008. J. Cyran & W. Venus. J. Life history traits of the temperature mini-maximalist Idiosepius notoides (Cephalopoda:Sepioidea). Idiosepii-dae) in Indonesian waters. Sepiadarium and Idiosepius two new genera of the family of Sepia. Mus. & W. SR. 2009. Steenstrup. J. Bull. Cephalopods of the Philippine Islands... 1963. Idiosepiidae) at Klong Bangrong. Africa 36 (4): 245-272. Biol. Shigeno 2005: Distribution pattern of a minimalist .S. 2003. Transaction of the Royal Soc. and Spirula Lmk. Klepal. 2006. species. With remarks on the two related forms Sepioloidea d´Orb. J. von Byern. Res. GL. 75: 885897. Voss. & Histochemistry 83 (1): 29-46. Malacology 15 (5-8): 94-96. Thailand.National Mus. Hist.Selsk.UK. Nürnberger & S. 2007. Reevaluation of systematic characters of Idiosepius (Cephalopoda. the Japan. Rudoll. 83: 1297-1300. L. Nabhitabhata. Mar. T. 1949. J. 67: 49-51. J.Skrifter Raekke 6 (Bd. Cephalopoda): 38-43. Pecl. von Byern & J.New records for Idiosepius biserialis (Idiosepiidae. Mollusca). South African cephalopods. Tracey. 1): 211-242. Biol. J.. J. Phuket Island. von Byern. MA. Memasukkan:Maret 2009 Diterima: Juli 2009 23 . Biotech. N. Histochemical characterization of the adhesive organ of three Idiosepius spp. Steer & GT.Mar.

and in the males and females combined were in March (12.3 years for the males.88mm and 70.67%) and May (20. 4. total mortality rate (Z) of the males. Overall. kematian. also by the thin and fragile shells of the clams. The peaks of males were in June (12.95 ± 0. mortality. Over a 12 months period (Januari 2005 – Desember 2005). Subsequently. there were two unequal pulses.58 mm.31. dan dapat hidup pada kondisi anoxic dengan sedimen mengandung banyak sulfida (Lebata & Primavera 2001). maka spesies ini mampu menyerap sulfida dalam jumlah yang banyak untuk dimanfaatkan sebagai nutrisi.1 year for males and females combined.38%) and October (14. (Anodontia edentula) in Mangrove Ecosystem. annual growth coefficient (K) of males.61 ± 0.43. which indicated a fast growth of the clams in relatively short period.12%). 2001). Berbagai organisme mendiami ekosistem ini. The objectives of this research were to study population parameters (growth. Kata kunci: Kerang lumpur tropis. also males and females combined were 4. salah satunya adalah kerang lumpur tropis Anodontia edentula dari famili lucinidae yang hidup di daerah tropis.Jurnal Biologi Indonesia 6(1): 25-38 (2009) Parameter Populasi Kerang Lumpur Tropis Anodontia edentula Di Ekosistem Mangrove Yuliana Natan Fakultas Perikanan dan Ilmu Kelautan. growth.5 and 1. also males and females combined were 1. (Anodonta edentula) in mangrove ecosystem were determined. and the size of males was less than females. Keywords : Mudflat clam. recruitment. Recruitment occurred every month in the males. Dengan adanya bakteri pengoksidasi sulfur pada insangnya (endosymbiont bacteria). Spesies tersebut menggali lubang pada daerah pantai berlumpur (mudflat) di zona intertidal sampai subtidal dan hidupnya berkelompok (Lim et al.56 ± 0. 1.65. females. These high rates were caused by the extreme life condition. and 4.5 respectively.63 mm. which were 2. Universitas Pattimura Ambon ABSTRACT Population Parameters of Tropical Mudflat Clam. and also males and females combined. also males and females combined were 65.3. while in the females were in April (16. 2001). rekrutmen PENDAHULUAN Salah satu ekosistem perairan wilayah pesisir yang produktif adalah ekosistem mangrove yang kaya akan sumberdaya moluska. population parameters of tropical mudflat clam. 2 years for the females. pertumbuhan. The results showed that asymtotic length (L infinity) of males. and 2. females. recruitment pattern and mortality) of this tropical mudflat clam. females. Karena itu kerang ini dapat digunakan sebagai biofilter pada budidaya tambak dalam 25 . 70.77%). females.26%).88%) and August (15. Selain itu spesies ini membenamkan diri pada dasar berlumpur sekitar estuari pada daerah hutan mangrove pada kedalaman 20 – 50 cm (Lebata 2000.

Di Maluku. kerang ini bernilai ekonomis yang dijual dengan harga sekitar 3. Penelitian serta informasi tentang kerang ini di Indonesia terutama di perairan Maluku masih minim. Lebata &Primavera 2001) Demikian pula di Thailand. padahal kerang ini merupakan makanan yang mengandung protein tinggi dan mempunyai nilai ekonomis sehingga dapat dikembangkan menjadi konsumsi lokal dan komoditi ekspor yang akan menambah devisa bagi Negara.00 euro/kg. sehingga populasi kerang ini akan mengalami tekanan bila tidak dikelola dengan baik. mortalitas dan rekrutmen dari populasi kerang Anodontia edentula. sehingga diharapkan dapat menentukan status populasi kerang Anodontia edentula. Pengambilan contoh kerang di kedalaman substrat antara 20 – 50 cm. yaitu musim Barat dan Timur. Persamaan di atas dilakukan baik secara jenis kelamin maupun per bulan pengamatan. dilakukan sejak Januari 2005Desember 2005 di perairan pantai desa Passo Teluk Ambon Bagian Dalam selama setahun dengan alasan bahwa terdapat dua musim. Penelitian yang telah dilakukan seperti oleh Latale (2003) tentang eksplorasi sumberdaya Anodontia edentula dan Natan (2008) tentang studi ekologi dan reproduksi Anodontia edentula. serta penekanan terhadap kondisi habitat alami dari kerang itu sendiri mengakibatkan penurunan populasi yang cukup mengkhawatirkan. Di Indonesia kerang ini belum mendapat perhatian. Pengambilan contoh kerang lumpur Anodontia edentula. kini dieksploitasi dan merupakan sumber makanan bagi keluarga (Lebata 2000. Di Philipina kerang Anodontia edentula yang dikenal dengan nama imbao. kerang ini dimanfaatkan bila terjadi musim paceklik dimana ikan sebagai sumber protein hewani sulit diperoleh. dilakukan sebulan sekali selama 12 bulan. 2001. Aktivitas ekploitasi yang berlebihan. Semua individu Anodontia edentula yang didapat dihitung jumlahnya dan diukur panjang cangkang. serta ditimbang berat basahnya menurut jenis kelamin. .Yuliana Natan memperbaiki serta menjaga kualitas air budidaya. Tujuan penelitian ini dilakukan untuk mengkaji aspek pertumbuhan. Analisis data Pola pertumbuhan kerang dapat diketahui melalui hubungan panjang cangkang dengan bobot tubuh kerang (berat basah) yang dianalisis melalui hubungan persamaan regresi kuasa (power regression) sebagai berikut (Ricker 1975): W = aLb atau log W = log a + b log L W = berat basah (g) L = panjang cangkang (mm) a dan b = konstanta Untuk menguji apakah konstanta b sama dengan tiga atau tidak (isometrik atau allometrik) dilakukan uji t. 26 BAHAN DAN CARA KERJA Penelitian ini dilakukan di daerah intertidal pada ekosistem mangrove yang terletak di Desa Passo Teluk Ambon Bagian dalam (Gambar 1).

dimana K adalah koefisien pertumbuhan.Parameter Populasi Kerang Lumpur Tropis Parameter pertumbuhan K dan L” dianalisis dengan metode frekuensi panjang dari kerang dengan (ELEFAN I) dari perangkat lunak FiSAT ver 03. dihitung dengan to = 0) berhubungan dengan nilai tengah kelas ke i. “t = waktu yang diperlukan bagi ikan bertumbuh pada kelas panjang ke i.95(L”) dimasukkan ke dalam persamaan diatas. Length Converted Catch Curve (LCCC) dengan formulanya: ln(Ni/”ti) = a + b · ti N= jumlah ikan pada kelas panjang i.038 log10 K (Pauly 1980). t adalah umur (atau umur relative. L” adalah panjang asimtot dan t0 (parameter kondisi awal) adalah umur dimana panjang sama dengan nol Rentang hidup alamiah (longetivity) merupakan rentang waktu hidup bagi suatu spesies sebagai rentang waktu hidup yang dicapai oleh suatu spesies dalam suatu kohort hingga 99% dari seluruh anggota kohort mencapai kematian hanya secara alami.39220. yang dikenal dengan nama kurva hasil tangkapan yang dikonversi ke panjang.1. Penambahan individu pertama ke populasi kerang (rekrutmen) dari data frekuensi panjang dibantu dengan suatu metoda pendekatan yang difasilitasi oleh Gambar 1: .2752 log10 L” -1. maka didapatkan umur ikan terpanjang (life span) adalah t maks = 2. Pendugaan umur kerang pada waktu lahir (t0) dimaksudkan untuk medapatkan informasi mengenai kerang yang juga disandingkan dengan informasi puncak pemijahan. Persamaan von Bertalanffy bila dijabarkan lebih lanjut. maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o. Nilai t0 dapat diperoleh melalui nilai-nilai K dan L” yang diterapkan dalam persamaan Log10(-to) = -0.9957/K + to. dan jika panjang maksimum (L maks) = 0. Lokasi penelitian 27 . dan b adalah sudut/ slope yang merupakan nilai Z. Pendugaan mortalitas total (Z) diduga melalui hubungan linear antara logaritma natural dari perubahan jumlah ikan per waktu bertumbuh kelas ke i dengan umur.

00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang jantan adalah tidak seimbang (Gambar 3). HASIL Hubungan Panjang-Berat Hubungan panjang cangkang dan berat kerang total digambarkan berdasarkan persamaan model hubungan W = 0. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar dari 3 (allometrik positif) dimana t = 123.0001 L3. Uji t (t student) terhadap koefisien b menunjukkan bahwa b lebih besar dari 3 (allometrik posif) dengan nilai t = 275.9294.00) yang berarti bahwa antara laju pertumbuhan berat dan panjang total kerang di perairan hutan mangrove pantai Passo Teluk Ambon Bagian Dalam adalah tidak seimbang (Gambar 2).13.1343 120 100 B e ra t (g r) 80 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 Gambar 2. 28 .0002x 2 R = 0. Kondisi pola pertumbuhan yang berlaku pada kerang jantan. Kurva hubungan panjang dan berat cangkang kerang total di perairan ekositem mangrove pantai Passo teluk Ambon Bagian Dalam. Program ini merekonnstruksi pulsa rekrutmen dari suatu runutan data frekuensi panjang yang disesuaikan dengan persamaan von Bertalanffy growth (VBGF) untuk mendeterminasi jumlah pulsa per tahun dan kekuatan relatif setiap pulsa.9657 n = 2692 3.288 dengan nilai koefisien determinasi (R 2 ) sebesar 0.321 dengan nilai koefisien determinasi (R2) sebesar 0. Dari hasil uji lanjut dengan uji t (t student) terhadap koefisien b menunjukan bahwa nilai b lebih besar y = 0.00008 L 3.9327.0002 L3. dengan nilai koefisien determinasi (R2) sebesar 0. Hasil tersebut diperkuat dengan uji hipotesis yang menyatakan bahwa hipotesis nol ditolak (p = 0.15. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.3134 (L = panjang dan W = berat). berlaku juga pada betinanya. diperoleh hubungan panjang berat kerang jantan diekspresikan sebagai: W = 0.9658.Yuliana Natan perangkat lunak FiSAT (Sparre &Venema 1992). Hasil analisis menunjukan bahwa pola pertumbuhannya bersifat allometrik positif seperti yang ditunjukan pada persamaan model hubungan dimana W = 0. Hasil analisis data panjang dan berat kerang dapat dipisahkan menurut jenis kelamin.

sub program ELEFAN maka diperoleh nilai koefisien pertumbuhan panjang asimtotik atau panjang infinity (L”) jantan. Hal ini diperkuat lagi dengan hasil uji hipotesis (p=0.5 dan 1. dengan menggunakan program FiSAT.3.3213 R2 = 0.Parameter Populasi Kerang Lumpur Tropis dari 3 (allometrik positif) dimana t = 128. betina dan total masing masing 1. 1. Pertumbuhan Hasil analisis parameter pertumbuhan berdasarkan data frekuensi panjang yang dikoleksi selama 12 bulan. betina 90 80 70 60 Berat (gr) 50 40 30 20 10 0 0 10 20 30 dan total (tanpa pemisahan jenis kelamin) masing-masing 65. 29 .63 mm. Kurva hubungan panjang berat cangkang kerang jantan di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam 120 100 80 Berat (gr) 60 40 20 0 0 10 20 30 40 Panjang (mm) 50 60 70 80 y = 8E-05x 3.288 R2 = 0.5 per tahun.58 mm dengan koefisien pertumbuhan (K) dari jantan.38.9327 n = 1192 Gambar 4. memberikan nilai beberapa parameter pertumbuhan yang merupakan dasar dalam pembentukan kurva pertumbuhan von Bertalanffy dari kerang Anadontia edentula. 70. (Gambar 4).00) yang menunjukan bahwa hipotesis nol ditolak yang berarti bahwa antara laju pertumbuhan berat dan panjang kerang betina adalah tidak seimbang.88 mm dan 70.9294 n = 1154 40 50 60 70 Panjang (mm) Gambar 3. betina serta total (gabungan) berasal dari perairan intertidal sekitar hutan mangrove Total Jantan y = 1E-04x3. Analisis distribusi sebaran cangkang selama periode penelitian. Gambar 5 memperlihatkan kurva pertumbuhan von Bertalanffy kerang jantan. Kurva hubungan panjang berat cangkang kerang betina di perairan ekosistem mangrove pantai Passo teluk Ambon Bagian Dalam.

betina dan total masingmasing diperoleh t0 = -0.2752 log10 L” 1. Dengan mengepas (fit) umur relatif dari contoh (dt) melawan logaritma natural jumlah individu setiap kelas (ln N/dt) dihasilkan suatu persamaan linear dari kerang jantan.6% per tahun. Ukuran-ukuran kerang dipisahkan kedalam kelompok ukuran dengan interval 5 mm.33– 4. Rentan hidup (t max) dari jantan.61±0.56±0. maka dapat dibentuk dugaan kurva pertumbuhan. K dan L”.081) ] Total : Lt = 70.88 [1 .0. umur to. Dengan memperhatikan umur maksimum.98.19–4. Dari nilai-nilai K dan L” yang telah diperoleh di atas.95 X dengan r = 0. betina dan total masing-masing 99.15 bulan.5(t+0.97. Mortalitas Mortalitas kerang diduga melalui Length Converted Catch Curve. 67.41-4.096) ] Betina : Lt = 70.087 tahun atau 1.43. Nilai mortalitas total didapat dari negatif slope. maka didapat umur kerang terpanjang (life span) adalah t maks = 2.97 bulan dan total .99. dan total masing-masing 62.0% dan 99. Dari hasil perhitungan t0 terhadap kerang jantan.95(L”) dimasukkan ke dalam persamaan di atas.31. dan kerang total dengan Y = 11.9957/K + 30 to.95±0. hal ini tidak berarti karena pertumbuhan dimulai pada saat telur menetas ketika larva memiliki panjang tertentu. 99.7%. betina dan total masing masing 2.3(t+0. betina dan total terlihat pada Gambar 7. Jika ditinjau dari segi biologi. kerang betina dengan Y= 10. dengan memasukkan formula Log10(-to) = -0. Umur t 0 dinamakan juga sebagai parameter kondisi awal (the initial condition parameter) yang menentukan titik dalam ukuran waktu ketika (ikan/ kerang) memiliki panjang nol.3 tahun.e-1. -0.61 X dengan r = -0.e-1.096 tahun atau 1.087) ] Dari beberapa parameter yang diperoleh. dengan demikian Z untuk jantan.038 log10 K.70 mm. Kalkulasi laju mortalitas untuk jantan. 4. 2 tahun dan 2. Penambahan individu baru Hasil analisis menggunakan program FiSAT dangan sub program recruitment . dimana dapat dilihat pada Gambar 6.34 mm dan 67.65 dan 4.e-1.1 tahun.58 [1 . maka akan diperoleh persamaan t = log10 (1-L t/ L”)/K + t o.00 bulan.56 X dengan r = -0.081 tahun atau 0. LCCC yang dibuat dari kehilangan individu setiap kelas ukuran. betina dan total dari model yang terbentuk.35 mm.4(t+0. adalah Y= 10. maka kita dapat menentukan rentang hidup (longevity) untuk kerang jantan.Yuliana Natan desa Passo di Teluk Ambon Bagian Dalam. sedangkan untuk panjang maksimun jantan. betina. Dari hasil analisis parameter pertumbuhan didapatkan persamaan von Bertalanffy sebagai berikut: Jantan : Lt = 65. dan jika panjang maksimum (L maks) = 0. Gambar kurva LCCC dari kerang jantan.63 [1 . betina dan total masing-masing adalah 4.3922-0. jantan. maka selanjutnya dilakukan analisis untuk mendapatkan to (umur pada saat panjang sama dengan nol). betina dan total Persamaan von Bertalanffy bila dijabarkan lebih lanjut.

28 mm dan K =1.0. tetapi ditemukan dalam tubuh induk kerang. Dalam penelitian ini walaupun pengamatan secara langsung terhadap kehadiran juvenil kerang di alam jarang ditemukan.edentula hasil analisis menggunakan program FiSAT (ver.Parameter Populasi Kerang Lumpur Tropis pattern menunjukkan bahwa selama penelitian berlangsung telah terjadi penambahan individu baru yang turut pula mempengaruhi dinamika populasi kerang di alam. Kurva pertumbuhan kerang A.3 b) Kurva pertumbuhan kerang betina: L” = 70.31) a). a) JANTAN b) BETINA c) TOTAL Gambar 5.63 m m dan K =1.4 31 . Dengan data hasil analisis menggunakan program FiSAT dihasilkan persentase rekrutmen (Tabel 1) dan ini mengindikasikan bahwa di lokasi penelitian telah terjadi penambahan individu baru pada setiap bulannya.88 mm dan K =1.Kurva pertumbuhan kerang jantan: L” = 65. Penambahan individu baru pada suatu populasi merupakan suatu hal yang positif bagi kestabilan populasi itu sendiri.5 c) Kurva pertumbuhan kerang total: L” = 71.

5 3 Wak tu (tahun) 80 70 Panjang (m ) m 60 50 40 30 20 10 0 0 0. namun masih memungkinkan keberadaan status populasi kerang ini.5(t+0.5 Wak tu (tahun) 2 2.Yuliana Natan Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1).77%.096) ] 2 2.38%) dan Oktober. Hasil olahan pola rekrutmen tergambar pada Gambar 8.26%).5(t+0. Dugaan kurva pertumbuhan kerang Adonontia edentula. Selama ini tekanan terhadap populasi kerang di pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. namun hal ini cukup berarti bagi kesinambungan populasi di alam.5 keseluruhan telah terjadi dua puncak pulsa yang tidak sama. PEMBAHASAN Hubungan panjang berat dari hewan-hewan akuatik dimaksudkan untuk menduga pola pertumbuhan dari Jantan : Lt = 65.63 [1 .e-1.12%) dan total gabungan pada bulan Maret (12. yaitu 14.67%) dan Mei (20. betina maupun gabungan total kerang menunjukkan hampir setiap bulan terjadi rekrutmen.88 [1 . Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.e-1.58 [1 . Kurva pertumbuhan jantan (b) Kurva pertumvbuhan betina (c) Kurva Pertumbuhan gabungan 32 .88%) dan Agustus (15. kecuali bulan Desember. Pada kerang jantan.5 1 1. (a).081) ] 2 2. selain itu terdapat interaksi biotik seperti predator.087) ] Gambar 6. persaingan dan tekanan lingkungan. Secara 70 60 P anjang (m ) m 50 40 30 20 10 0 0 0. pada betina pada bulan April (16.5 1 1.5 1 1.e-1.3(t+0.5 3 Betina: Lt = 70.5 3 Total : Lt = 70.5 Wak tu (tahun) 80 70 60 P n g(m ) a ja m 50 40 30 20 10 0 0 0.

Hasil tersebut berarti bahwa pertambahan berat (cangkang ditambah dengan berat daging atau viscera wieght) lebih cepat bertambah dibandingkan panjangnya seiring dengan waktu. 2001) di Polandia menghasilkan pola pertumbuhan allometrik negatif. Hubungan tersebut dapat diestimasi melalui kecenderungan penyebaran data panjang dan berat yang diperoleh dari pengukuran komponen morfometrik. koefisien hubungan panjang berat. Penelitian dari Anodontia woodiana (Afanasjev et al.Parameter Populasi Kerang Lumpur Tropis hewan-hewan tersebut. (b) betina dan (c) total 33 .edentula (a) jantan. Pendugaan parameter b. Pola pertumbuhan dari jenis yang sama belum tentu menghasilkan nilai yang sama. dianalisis melalui pendekatan hubungan kuasa yang disederhanakan melalui transformasi linear Hubungan antara komponen panjang cangkang dengan berat cangkang mengindikasikan terjadinya pertumbuhan yang allometrik dimana laju pertambahan berat tidak seiring dengan pertambahan panjangnya. maka ada pertumbuhan yang bersifat allometrik (positif maupun negatif) dan ada pula yang bersifat isometrik dimana laju pertumbuhan panjang cangkang adalah sama dengan laju pertumbuhan beratnya. Kondisi tersebut menandakan bahwa ada pengumpulan energi yang didapat lewat makanan dan kondisi lingkungan yang baik. Jika dibandingkan dengan hasil penelitian bivalvia lainnya. Kurva konversi hasil tangkapan panjang (LCCC) kerang A. begitupun jenis yang berbeda bisa mempunyai pola yang sama. Pola pertumbuhan (b) (a) (c) Gambar 7.

47 14.19 1.94 10.52 2.67 10.95 0.29 8.22 9.00 Betina 1.47 12.27 16. betina dan total kerang A.95 8. 34 .97 0.39 15.83 9.35 6.29 2. Persentase rekrutmen bulanan jantan.00 (a) (b) (c) Gambar 8.edentula (a) jantan.77 8.45 0.12 13. Persentase rekrutmen kerang A.67 8.12 7.47 12.31 15.25 6.39 0.26 18.16 7.88 11.64 20.00 Total 2.edentula Bulan Januari 2005 Februari Maret April Mei Juni Juli Agustus September Oktober November Desember % Rekrutmen Jantan 1.92 10. (b) betina dan (c) total.38 7.45 12.98 3.Yuliana Natan Tabel 1.

Nilai (K) berbeda antara satu jenis dengan jenis lainnya. Koefisien pertumbuhan (K) merupakan faktor penting untuk mengetahui laju pertumbuhan kerang mencapai ukuran infinity. seperti yang terjadi pada Anodontia woodiana dimana panjang infinity bisa mencapai 23 cm. Literatur serta informasi tentang kerang A.edentula sangat terbatas. Lain lagi jika K yang didapatkan pada spesies kerang mutiara (Pinctada radiata) di perairan Qatar semenanjung Arab (Muhammed & Yassien 2003) dengan panjang 132. Nilai koefisien pertumbuhan K menunjukkan seberapa cepat suatu spesies mencapai panjang atau berat infinity.3. Berbeda jenis berbeda pula panjang infinity (L”).5) dapat dikatakan sangat cepat dimana jantannya sedikit lebih lama mencapai panjang asimtotik. edentula berdasarkan rumus Pauly (1980) yaitu Lmax dibagi 0. Koefisien pertumbuhan.18 mm dan K = 0.58 mm). Panjang infinity A. maka L” lebih kecil dari di Philipina. Del Norte-Campos (2004) yang meneliti sunset elongate clam di air tawar dan estuari mendapatkan nilai K=1 dan dia menyimpulkan K dari spesies tersebut merupakan spesies yang cepat tumbuh. dimana jika makanan berlimpah maka laju penambahan berat semakin cepat dan menghasilkan pertumbuhan yang allometrik positif. K = 0. Salah satu jenis mussel Anodontia woodiana dengan nilai L asimtot 23 cm. Jadi berbeda lokasi dan jenis maka berbeda pula panjang infinitynya. panjang infinity mencapai 93 mm. 2001).Parameter Populasi Kerang Lumpur Tropis tergantung dari ketersediaan makanan. Panjang infinity atau panjang asimtot menunjukkan seberapa besar ukuran cangkang yang dapat dicapai oleh suatu individu kerang. bahkan perbedaan tersebut dapat terjadi pada jenis yang sama dengan lokasi yang sama. K betina = 1.3 tahun mencapai panjang asimtotik 35 .edentula di perairan hutan mangrove Desa Passo merupakan suatu informasi awal. Jika menggunakan data/nilai panjang maksimum yang ditemukan oleh Lebata (2000. akan membedakan parameter populasinya. maka panjang infinity adalah 13. Nilai panjang asimtotik (infinity) jantan lebih kecil dari betina pada perairan hutan mangrove Desa Passo menandakan bahwa secara genetis jantan lebih kecil dari betinanya.227 mencapai umur 10 tahun (Afanajev et al. Begitupun K yang didapatkan dari Anadontia edentula di perairan hutan mangrove Passo (K jantan = 1. sebesar 13 cm. Apabila dibandingkan dengan apa yang didapatkan di perairan hutan mangrove desa Passo (L” total = 70.95.34 per tahun menunjukkan pertumbuhan yang lama. K yang ditemukan perairan hutan mangrove desa Passo. Lebata (komunikasi personal) mengatakan bahwa perbedaan tempat (lokasi). dugaan panjang infinity (L”) A. Laju pertumbuhannya memerlukan waktu yang pendek yaitu antara 2 sampai 2. dan akan dimonitor ukuran parameter tersebut di masa akan datang yang dijadikan baseline data untuk pemantauan parameter populasi. memerlukan waktu mencapai panjang asimtotik 10 tahun. 2001).5 dan K gabungan = 1. Jenis lainnya seperti kerang estuari di Philipina.67 cm. menunjukkan kecepatan tumbuh yang cepat.

Selama ini tekanan terhadap populasi kerang di parairan pantai hutan mangrove Passo berasal dari manusia pada musim paceklik. seperti yang dialami oleh kerang Pinctada radiata (Muhammed & Yassien 2003).3 tahun) dibandingkan dengan betina. dimana mortalitas terdiri atas laju mortalitas karena alami (M) dan penangkapan/pemanfaatan (F). namun hal ini cukup berarti bagi kesinambungan populasi di alam. karena satuan waktu yang dibutuhkan untuk mencapai ukuran infinitif relatif lebih pendek.Walaupun secara umum penambahan individu baru yang relatif tidak terlalu besar (Tabel 1). predator ataupun interaksi biotik (biotik 36 interaction) seperti eutrofikasi (Del Norte-Campos 2004). tetapi bulan Desember pada Tabel 1 tidak kelihatan. begitupun juga parameter koefisien pertumbuhan K kerang jantan lebih kecil dari kerang betina maupun gabungan jenis kelamin. Jika dilihat dari strategi hidup kerang. yang sebenarnya ada penambahan individu baru. Hal ini menunjukkan bahwa pada kondisi alami. Bulan Desember tersebut tidak dilewati oleh puncak-puncak rekrutmen. Hal ini juga dibarengi dengan rentang waktu hidup jantan relatif lebih lama (2. Kurangnya penelitian tentang seberapa besar mortalitas yang dipengaruhi oleh penyebab alami (M) Ditemukannya ukuran anakan dalam induk dewasa mengindikasikan bahwa strategi hidup kerang dilindungi dalam tubuh induknya. Laju mortalitas total yang cukup tinggi. terutama menghindari perubahan lingkungan yang ekstrim.Yuliana Natan Hasil analisis terhadap parameter pertumbuhan memperlihatkan bahwa panjang infinitif (L”) kerang jantan relatif lebih kecil dari kerang betina maupun gabungan jenis kelaminnya. Bulan Mei adalah bulan dengan presentase rekruitmen tertinggi dan dindikasikan bahwa bulan tersebut adalah bulan musim penghujan dengan rekrutmen tertinggi. Diketahui bahwa habitat hewan ini pada kondiisi oksigen yang rendah dan sulfit yang tinggi Setiap bulan terjadi penambahan individu baru. maka kerang tersebut hidup pada kondisi yang ekstrim dan cangkang yang cukup tipis mudah diserang predator seperti cangkang yang dibor oleh predator. Mortalitas karena penangkapan/pemanfaatan ini kemungkinan disebabkan oleh pemanfaatan kerang karena musim paceklik dimana ikan sulit didapatkan bahkan tidak ada ikan sedangkan mortalitas alami disebabkan oleh sebabsebab alami seperti penyakit. untuk mencapai panjang cangkang asimtotik kerang betina ataupun gabungan jenis kelamin memiliki kecepatan tumbuh yang lebih cepat dari kerang jantan. Koefisien pertumbuhan K merupakan parameter penting dalam persamaan von Bertalanffy. selain itu terdapat interaksi . Pada Tabel 1 tersebut biasanya perhitungan jatuh pada tanggal 15 setiap bulan. karena dapat menggambarkan laju pertumbuhan kerang untuk mencapai ukuran maksimum serta dapat pula dipakai untuk membandingkan laju pertumbuhan dari jenis-jenis yang berbeda ataupun jenis yang sama dan berasal dari lingkungan yang berbeda. dan gabungan jenis kelamin yaitu 2 tahun.

Puncak rekrutmen pada kerang jantan terjadi pada bulan Juni (12.67%) dan Mei (20. 1133-1138. disebabkan oleh kondisi hidup yang ekstrim dan cangkang yang cukup tipis dan rapuh. J. 4. Laju mortalitas total Z. Elemental Sulphur in the Gills of the Mangrove Mud Clam. Archives of Polish Fisheries. Asian publ. namun masih memungkinkan keberadaan status populasi kerang ini KESIMPULAN 14.. Shell Shellfish Res. 2004. 2000. 2.31. 17: 299-312.5 dan 1. Fakultas Perikanan Universitas Pattimura.63 mm. dengan koefisien pertumbuhan (K) dari jantan. 37 .26%). Latale SS.88 mm dan 70. 58 hal. 19(1). Bulan Mei adalah puncak rekrutmen tertinggi. Secara keseluruhan telah terjadi dua puncak pulsa yang tidak sama. 2003. baik secara total ataupun pemisahan kelamin jantan maupun betina di perairan hutan mangrove pantai Passo teluk Ambon Bagian Dalam adalah tidak seimbang (allometrik) Panjang asimtot (L infinity) dicapai oleh kerang jantan. Marine Pollution Bull. sulphide and nutrient uptake of the mangrove mud clam Anodontia edentula (Family: Lucinidae).Parameter Populasi Kerang Lumpur Tropis biotik seperti predator. persaingan dan tekanan lingkungan. Anodontia edentula (Family Lucinidae). Unionidae) in the Heated Konin Lakes System. Elsevier Science Ltd.58 mm. betina dan total masing masing 1. betina dan total masing-masing adalah 4.77%.65 dan 4.38%) dan Oktober.3 tahun. Pada kerang jantan. Ambon. Kraszewski. Pelecypoda: Psammobiidae) from the Beate Bay area.12%) dan total gabungan pada bulan Maret (12. 2001. B. betina maupun gabungan total kerang menunjukkan rekrutmen terjadi setiap bulan. Oxygen. 9(1): 123. Lebata MJHL. Zdanowski & A. Laju mortalitas total yang cukup tinggi. untuk jantan.56±0.131. pada betina pada bulan April (16. Some aspects of the population biology of the subset elongate clam Gari elongate (Lamarck 1818) (Mollusca. 70. West Central Philippines. betina dan gabungan masing-masing adalah 65. 2001.1 tahun.5 per tahun yang mengindikasikan pertumbuhan yang cepat dari kerang ini dengan laju pertumbuhannya memerlukan waktu yang pendek yaitu masingmasing 2.Sci.3. 11(42). 1. tahun dan 2.61±0. dimana ukuran jantan lebih kecil dari betinanya. DAFTAR PUSTAKA Laju pertumbuhan berat dan panjang cangkang kerang. Growth and population structure of the mussel Anodonta woodiana (Lea 1834) (Bivalvia. Del Norte-Campos AG. yaitu Afanasjev SA.88%) dan Agustus (15. 241-245. Studi pendahuluan eksplorasi sumberdaya Anodontia edentula pada perairan pantai desa Passo Teluk Ambon Bagian Dalam (Skripsi).95±0.43. Lebata MJHL.

Introduction to tropical fish assesment. Lim KKP. 2003. In P. W. Anatomy and Habitat of Anodontia edentula :Evidence of endosymbiosis. 1975.Yuliana Natan Lebata MJHL. Y. 2001 Gill Structure. Sivasothi. Studi ekologi dan reproduksi populasi kerang lumpur Anodontia edentula pada ekosistem mangrove Teluk Ambon Bagian Dalam. &SC. Singapore Science Centre. T. Natan. BC. 19:191-382. Yassien.Ng & N. TK. Ng PKL. Sparre P. Sekolah Pascasarjana IPB. Muhammed SZ. Bull. Turkey. J. Population parameters of the pearl oyster Pinctada radiata (Leach) in Qatari waters Arab gulf. Fish. HDH. 20(3):1273-1278. Ricker WE. Res. Primavera. Murphy. Bogor 162 hal. T. Venema 1992. Board Can. Tan. (Desertasi). Tan. 2003 (Eds). Animal diversity. N. KS.L. Morgani. & HM. 407 p. Hugh. 2008. Rome. Memasukkan: Maret 2009 Diterima: Juli 2009 38 . J. FAO Fisheries Departement. A Guide to mangrove of Singapore 1.Zool 27:339-343. Computation and interpretation of bological statistics of fish populations. Seong. Shellfish Res.Sivasothi.K. Tan. 2001.

2002) dinyatakan bahwa kenaikan suhu. penyakit paru-paru akut dan menimbulkan kematian.21 Bq/gr. The highest concentration factor of Cd (31. radiotracer Cd.Jurnal Biologi Indonesia 6(1): 39-50 (2009) Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Dengan Aplikasi Perunut Radioaktif Yusni Ikhwan Siregar Pasca Sarjana Ilmu Lingkungan Universitas Riau. Perna viridis Kata kunci : Bioakumulasi. Wright dalam Blackmore & Wang (2002) menambahkan bahwa banyak eksperimen menunjukkan pertambahan pengambilan radiotracer 39 . Dalam biota perairan jumlah logam berat yang terakumulasi akan terus mengalami peningkatan (biomagnifikasi) karena tidak dapat didegradasi oleh mikroorga- nisme.21-107. Radiotracer 109Cd was applied in the study. Pekanbaru. It was found that both salinity and temperature had significant effect ( P< 0. Perna viridis PENDAHULUAN Kadmium (Cd) adalah salah satu logam berat dengan penyebaran yang luas di ekosistem akuatik.80 Bq/gr.80 Bq/gr Cd.09) was appeared in water salinity of 29% and of water temperature 30oC.001) on accumulation rate of 109Cd. A laboratory experiment on the accumulation of Cadmium (Cd) by green mussel (Perna viridis) has been conducted. It revealed that the small Perna viridis (5. panas pada bagian dada. Cd. Dari berbagai penelitian (Morton 1987. At the steady state condition green mussel accumulated 72. temperature and size on uptake of radiotracer 109Cd by green mussel (Perna viridis) from dissolved phase. Key words : Bioaccumulation. Di alam Cd bersenyawa dengan Belerang (S) sebagai greennocckite (CdS) yang ditemui bersamaan dengan senyawa spalerite (ZnS). Blackmore & Wang. Kadmium merupakan logam lunak (ductile) berwarna putih perak dan mudah teroksidasi oleh udara bebas dan gas Amonia (NH3) (Saeni 1997). Cd akan mengalami proses biotransformasi dan bioakumulasi dalam berbagai tingkatan organisme hidup. tertinggi termasuk manusia. Perubahan sifat fisika air laut seperti suhu dan salinitas akan mempengaruhi biota laut (kerang hijau) dalam mengakumulasi kadmium dari lingkungannya. penurunan pH dan salinitas perairan dapat menyebabkan tingkat bioakumulasi logam berat semakin besar. Cd terakumulasi pada taraf yang tinggi yang bisa menimbulkan rasa sakit. Pada gilirannya pada rantai makanan. whereas the bigger size of Perna viridis (6. Riau ABSTRACT Bioacumulation of Cadmium on Green Mussel (Perna viridis) Using Radiotracer.6 cm in length) had an uptake of about 72. Perunut radioaktif.2 cm in length) accumulated 109Cd about 107.2354. The research aimed at evaluating the effect of salinity.

6 ml ke setiap aquarium. dua kali sehari. bahkan di luar negeri sudah dikembangkan sejak dahulu (Suseno2004a). Untuk menghilangkan stress. hewan uji diaklimitasikan selama seminggu di laboratorium. Secara periodik (dua hari sekali). Kombinasi taraf perlakuan eksperimen terdiri dari S1-T1 (salinitas 29o/oo dengan suhu 28oC). BAHAN DAN CARA KERJA Hewan uji Perna viridis dikumpulkan dari Perairan Teluk Jakarta dengan teknik penyelaman tradisional. sesuai kombinasi taraf perlakuannya. 5.5 dan 6. S2T1 (salinitas 31o/oo dengan suhu 28oC) dan S2T 2 (salinitas 31o/oo dengan suhu 30oC). Pengamatan pengambilan 109Cd dari fase terlarut dilakukan dengan meletakan Perna viridis ke dalam empat aquarium. Hal ini bertujuan untuk mempertahankan konsentrasi 109Cd dalam air laut. Penelitian ini bertujuan mempelajari proses pengambilan perunut 109Cd dari fase terlarut oleh kerang hijau yang berbeda ukuran pada salinitas dan temperatur berbeda. dihitung mengikuti Connell & Miller (1995).2. Konsentrasi 109Cd yang dipakai adalah konsentrasi kecil (1.46 Bq/ml) yaitu dengan meneteskan 7. dan terkoneksi dengan komputer dan dihubungkan dengan spektrometer gamma serta dilengkapi detektor NaT1 yang diameternya 10 cm dan tinggi 40 cm buatan Bicron Corp tipe HQ 490 seri 2M2/2. Metoda yang digunakan yaitu metoda eksperimen dengan rancangan percobaan faktorial.Yusni Ikhwan Siregar oleh berbagai biota laut terjadi ketika menurunnya salinitas. Pengambilan (uptake) kontaminan yang diamati dan dihitung adalah faktor konsentrasi (FK). dapat dilakukan percobaan dengan biota dalam jumlah yang lebih sedikit dibandingkan dengan teknik konvensional. Pemberian kontaminan dihentikan ketika konsentrasi 109Cd masuk pada Perna viridis sama dengan konsentrasi 109 Cd yang keluar (steady state). konsentrasi tunak atau steady state (Css) dan faktor konsentrasi steady state (FKss). 210 Pb dan sebagainya). Media uji air laut diganti setiap hari. Pengukuran biokinetik dalam waktu panjang dengan menggunakan biota dalam jumlah terbatas serta mekanisme transfer kontaminan dalam berbagai kompartemen tubuh organisme sangat sulit dilakukan dengan teknik konvensional. Data yang . Aplikasi teknik nuklir untuk menentukan kemampuan akumulasi polutan pada biota laut telah mulai dikembangkan di Indonesia. sedangkan manfaat yang didapat yaitu informasi mengenai kemampuan akumulasi kerang hijau (Perna viridis) terhadap logam berat akibat fluktuasi salinitas dan suhu.6 cm) dan kemudian dibersihkan dari organisme 40 lain yang menempel. Menggunakan polutan yang berlabel radioisotop (misal 109 Cd. Pencacahan dilakukan untuk memperoleh data pengambilan 109Cd dari fase terlarut. Perna viridis dicacah menggunakan MCA (Multi Channel Analyser) yang terintegrasi dalam sistem inspektor buatan Kanberra. S1T2 (salinitas 29o/oo dengan suhu 30oC). dan diberi pakan Chlorella sp. Organisme dipisahkan menurut kelompok ukuran (5.

09 dengan nilai konsentrasi dan faktor konsentrasi dalam steady state yaitu 72.90 34.37 ± 20.70 70. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 30oC.08 47.37 4.21-107.89 3.83 54.48 39.51 52.98 49.54 15.42 70.78 28.31 53.01 Keterangan : Css (konsentrasi steady statei).99 37.60 3.36 21.94 30.60 59.27 ± 31. Model tersebut merupakan permodelan saturasi.14 21. Pengaruh salinitas terhadap bioakumulasi 109 Cd pada Perna viridis Pengaruh salinitas dapat diketahui dengan membandingkan faktor konsentrasi rerata kedua salinitas (29 dan Tabel 1a.25 22.07 47.09 ± 41.75 70.23-54.72 45.33 13.75 49.65 36.89 4.21 80.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) diperoleh dianalisa dengan ANOVA menggunakan program SPSS v.81 73.77 28.84 (Tabel 1a dan 1b).08 47.24 30.00 51.62 29.23 ± 41.65 23.60 32.62 52.61 11.61 59.80 Bq/gr dan 49.46 55. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo pada suhu 28 o C (Gambar 3) sedangkan pada salinitas 29o/oo dan 31o/oo di suhu 30oC (Gambar 4).33 14.90 79. Durasi (hari) 2 4 6 8 10 12 14 16 18 Mean±S E Css FKss Faktor Konsentrasi 109Cd (Bq/gr) Salinitas 29o/oo Salinitas 31o/oo 5.12 47.2 cm 5.46-73. Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.74 12.2 cm 5.0.77 28.30 ± 4.12 30.50 51.29 17.41 54.41 25. dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya. Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.73 39.65 20.84 61.5 cm 6.6 cm 30.93 59.91 2.45 35.6 cm 5.44 51.02 43.12.87 19.19 36.5 cm 6.70 ± 34. FKss (faktor konsentrasi steady state) 41 .23 107.52 24.35 41.27 44.16 72.23 40.50 28.64 19.20 27.33 53. HASIL Biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dan 31o/oo di suhu 28oC dan 30oC Hasil percobaan menunjukkan ratarata faktor konsentrasi tertinggi di berbagai ukuran Perna viridis didapat pada salinitas 29o/oo dengan suhu 30oC yaitu berkisar 31.80 90.

0667 R2 = 0.33 19.84 ± 34.7137x + 8.8014 R2 = 0. nilai koefisien determinasi untuk salinitas 29o/oo (0. Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P < 0.33 16.38 49.7137x + 8.6 cm 5.6 cm ♦=5.9176 5.10 Css FKss 63.46 35.44 49.89 37.76 19.32 10.72 37.761 R2 = 0.8014 R2 = 0.2 cm 5.09 (Gambar 5).09 24.00 12 57.41 14.2 cm 31o/oo) di suhu dan ukuran yang sama (5.64 35.9951) .71 20.99 4 35.42 17.18 36.2 cm 5.55 16.99 ± 19.2673x + 11.82 45.72 18 60.99 1.2 cm 5.69 24.91 16 60.9462 y = 1.6044x + 5.26 21.54 33.6 cm 5.74 14 60.21 ± 36.9423 2 109Cd Faktor konsentrasi Faktor konsentrasi A y = 2.45 18.47 25.38 20.49 51.9462 y = 1.92 7.71 19.06 1. FKss (faktor konsentrasi steady state) 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41.25 13.35 14.98 11.9423 B y = 2.9176 2 109Cd 60 50 40 30 20 10 0 0 2 4 6 8 10 12 14 16 18 20 Waktu kontak (hari) y = 0.68 24.21 75.2 cm dan 30oC) pada Tabel 1b.81 33. Data biokinetika pengambilan 109Cd dari fase terlarut oleh Perna viridis pada salinitas 29o/oo dengan 31o/oo di suhu 28oC.5 cm 6.66 24.46 6 38.5 cm ▲=6.84 78.97 16. ■= 5.80 51.58 30.10 49.46 36.5 cm 6.Yusni Ikhwan Siregar Tabel 1b.20 ± E 4.01).6044x + 5.06 42.03 25.80 17.88 20.51 54.70 jika dibandingkan pada kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54. Pada Gambar 6.6 cm Gambar 1.37 3.22 21.80 51.43 ± 21.81 22.67 Mean±S 47.85 ± 15.56 4.26 3.2 cm 5.2673x + 11.97 16.46 30.01 15.10 23.26 10 44. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 28o C.5 cm 6.08 8 41.61 29.0667 R = 0.761 R = 0.34 92.59 54.62 Keterangan: Css (konsentrasi steady statei). 42 Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.5 cm 6.6 cm 2 25. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109 Cd memberikan pengaruh yang sangat berbeda nyata. Faktor Konsentrasi 109Cd (Bq/gr) Durasi Salinitas 29o/oo Salinitas 31o/oo (hari) 5.86 13.41 10.

6 cm Gambar 3.9734 2 4 6 8 5. (Gambar 8).9685 y = 1.773 R2 = 0.529 2 R = 0. Pengaruh suhu terhadap tingkat bioakumulasi Perna viridis memberikan pengaruh yang sangat signifikan (P < 0.5 cm ▲=6. ■= 5.5 cm 6.66x + 7.9 R2 = 0.9791) lebih kecil jika dibandingkan dengan suhu 30oC yang nilainya sebesar 0.968). Model proses pengambilan konsentrasi 109Cd oleh Perna viridis pada salinitas 29o/ (A) dan salinitas 31o/oo (B) di suhu 28oC.9433 y = 1.2052x + 8.7667 2 R = 0.2494 R2 = 0. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besarkecilnya nilai bioakumulasi disebabkan oleh suhu.9668 y = 2.2 cm dan 29o/oo) pada Tabel 1a dan 1b. Pengaruh suhu terhadap bioakumulasi 109Cd pada Perna viridis Pengaruh suhu dapat diketahui dengan melakukan perbandingan ratarata faktor konsentrasi kedua suhu (28 dan 30oC) pada salinitas dan ukuran yang sama (5.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) Faktor Konsentrasi 109Cd Faktor Konsentrasi 109Cd 80 70 60 50 40 30 20 10 0 0 60 50 40 30 20 10 0 0 A y = 2. terlihat pada Gambar 7.6 cm ♦=5. 43 .5 cm 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20 Waktu Kontak (hari) 6.2 cm 5.8171x + 23.29 R2 = 0.6 cm ♦=5.6 cm Gambar 2.2 cm 5.01).2 cm 70 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.2 cm 10 5.9539 B y = 2.9951.0943x + 10. Faktor konsentrasi perunut 109Cd dalam Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC. Selanjutnya nilai koefisien determinasi untuk suhu 28oC (0.5 cm 6.6186x + 27.9764 y = 2. ■= 5.2 cm oo lebih besar jika dibandingkan dengan salinitas 31o/oo (0.6 cm Waktu Kontak (hari) 5.4495x + 16. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar kecilnya nilai bioakumulasi disebabkan oleh salinitas.2 cm 5.5 cm ▲=6.5 cm 6.6 cm 60 50 40 30 20 10 0 0 5 10 15 20 Waktu K ontak (hari) 5.

43x + 65.5 c m 6 .2 cm 5. Hubungan pengaruh salinitas terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis salinitas 29o/oo (A) dan salinitas 31o/oo (B).7x + 53. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di salinitas 29o/ (A) dan salinitas 31o/oo (B) pada suhu 30oC.057 2 R = 0.523 R 2 = 0.Yusni Ikhwan Siregar 80 70 60 50 40 30 20 60 50 40 30 20 10 0 0 5 10 15 20 Waktu Kontak (hari) 5.5 cm 6. 70 60 50 40 30 20 10 0 A S a l in i t a s ( / o o ) o 5 . oo Faktor Konsentrasi rata-rata 60 50 40 Cd 109 y = -11.9951 30 20 10 0 0 1 2 3 4 U kuran K erang H ijau (cm ) y = -10.2 c m 5 .968 A B Gambar 6.6 cm 10 0 0 5 5. 44 .2 cm 5. Konsentrasi Model proses pengambilan 109Cd oleh Perna viridis pada salinitas 29o/oo (A) dan salinitas 31o/oo (B) di suhu 30oC.6 c m B Gambar 5.6 cm 10 15 20 Waktu Kontak (hari) Gambar 4.5 cm 6.

Pada kondisi tersebut. Sedangkan pada suhu 28oC. Pengaruh ukuran perna viridis terhadap bioakumulasi 109Cd Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P<0.23 10. PEMBAHASAN Rata-rata faktor konsentrasi terendahnya didapat pada salinitas 31o/ dengan suhu 28 o C yang kisaran oo nilainya 15.84-47. Faktor konsentrasi rata-rata bioakumulasi 109Cd pada Perna viridis di suhu 28oC (A) dan suhu 30oC (B) pada salinitas 29o/oo.23 kali lebih besar dibandingkan dengan di salinitas 31o/oo.30-41. kerang hijau mampu mengakumulasi 109Cd 31.23 sampai dengan 54. Hal tersebut berarti pada salinitas 29 o/ oo dengan suhu 30oC merupakan kondisi yang menyebabkan proses akumulasi Cd meningkat karena perubahan salinitas dan suhu dapat merubah laju metabolisme pada organisme laut (Wang. Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31.5 c m 6 .35X) atau semakin kecil ukuran kerang hijau maka tingkat akumulasi logam beratnya semakin besar (Gambar 9).20-34.6 c m B Gambar 7. dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd.2 c m 5 . konsentrasi steady state Faktor konsentrasi steady state di kondisi salinitas 29o/oo dengan suhu 30oC 1.10-75.21 dan 20. Pada salinitas 29o/oo dengan suhu 28oC dan salinitas 31o/oo dengan suhu 30oC didapat rata-rata faktor konsentrasi yang tidak ekstrim seperti di dua kondisi lainnya yaitu dengan kisaran 19.51 Bq/gr (Tabel 1b). Pengaruh lamanya waktu kontak terhadap faktor konsentrasi dapat dilihat pada Gambar 1 dan 2 yang menunjukkan adanya hubungan positif diantara keduanya.70. faktor konsentrasi steady state di salinitas 29o/oo 1.09 kali dalam durasi kontak 14 sampai dengan 16 hari.Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 70 60 50 40 30 20 10 0 A Suhu ( C) o 5 . 109 45 .43 dimana nilai konsentrasi steady statenya berkisar 30.33 kali lebih besar dibandingkan dengan kondisi salinitas 31o/oo.01). 2000).

Hubungan pengaruh suhu terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis pada suhu 28oC (A) dan suhu 30oC (B). umumnya mengalami penambahan akumulasi logam berat ketika salinitas rendah. Hal tersebut berarti bahwa perbedaan salinitas terhadap proses bioakumulasi 109Cd memberikan pengaruh yang sangat berbeda nyata.23 .2 cm terjadi tidak begitu besar dengan nilai faktor konsentrasi rata-rata 41. pada salinitas 29o/oo dan 31o/oo di suhu 30oC ditunjukkan pada Gambar 4. Perlakuan salinitas terhadap proses bioakumulasi yang direpresentasikan oleh faktor konsentrasi 109Cd dalam kerang hijau mempunyai hubungan yang negatif (Y = 31. Dari Gambar 1 dan 2 dapat dibuat gambar model proses pengambilan 109Cd oleh kerang hijau dari fase terlarut.01).Yusni Ikhwan Siregar Cd 60 y = 1 1 .3 3 7 50 40 30 20 10 0 0 1 2 3 4 y = 1 3 . dimana permodelan mengasumsikan masuknya kontaminan ke dalam organisme dan terakumulasi sampai pada kondisi tunak di dalam tubuhnya. pertumbuhan dan metabolisme fisiologi dari organisme laut.24X) atau tingkat akumulasi perunut 109Cd oleh kerang hijau akan besar jika nilai salinitas rendah tetapi akumulasi logam berat akan semakin kecil apabila salinitas lebih besar. Model proses pengambilan 109Cd yang direpresentasikan dalam faktor konsentrasi pada salinitas 29o/oo dan 31o/oo di suhu 28oC ditunjukkan pada Gambar 3.3 1 R 2 = 0 .5. Model tersebut merupakan model saturasi.9 9 5 1 Faktor Konsentrasi rata-rata 109 U k u r a n K e r a n g H ija u (c m ) Gambar 8. Hal ini disebabkan perubahan salinitas dapat mempengaruhi kelangsungan hidup. . Hal tersebut diatas sesuai dengan teori yang menyatakan bahwa pertambahan akumulasi logam berat dan toksisitas berhubungan dengan berkurangnya salinitas menambahkan bahwa pengambilan logam berat dari fase terlarut oleh Perna viridis yang berasal dari perairan laut bersalinitas rendah dan bersalinitas tinggi.4 3 x + 1 9 .6 8 5 x + 7 .9 7 9 1 A B R 2 = 0 . Perbedaan salinitas memberikan pengaruh yang sangat signifikan terhadap proses bioakumulasi 109Cd oleh kerang hijau (P<0. Pada saat salinitas 31 o / oo proses bioakumulasi logam berat oleh Perna viridis ukuran 5.09 (Gambar 5).70 jika dibandingkan pada 46 kondisi salinitas 29o/oo yang nilai rata-rata faktor konsentrasinya 54.

6 . Sehingga dapat disimpulkan bahwa perlakuan suhu mempunyai hubungan yang positif dengan proses bioakumulasi perunut 109Cd (Y = 31.0 8 8 x + 4 8 . S1T1 (2).5 dan 6. Chatteraji et al (1984) menyatakan pertumbuhan yang signifikan pada kerang hijau dipengaruhi oleh suhu. Kedua koefisien determinasi tersebut berarti bahwa variasi yang terjadi terhadap besar-kecilnya nilai bioakumulasi disebabkan oleh salinitas.8 8 6 8 y = . Pengaruh ukuran Perna viridis dapat digambarkan dengan membandingkan faktor konsentrasi rata-rata ketiga ukuran (5.5 5 R 2 = 0 .Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) 60 Cd 50 40 5 .5 3 2 R = 0 . Hal ini berarti bahwa semakin tinggi suhu media (air laut) maka akan menyebabkan nilai bioakumulasi semakin tinggi.968).6 cm) di salah satu taraf kombinasi perlakuan antara salinitas dan suhu (salinitas 29o/oo dengan suhu 30 o C) pada Tabel 1a.5 c m 6 .7 6 3 x + 3 3 .9951) lebih besar jika dibandingkan oo dengan salinitas 31o/oo (0.6 . Hubungan pengaruh ukuran terhadap proses bioakumulasi perunut Perna viridis pada S1T2 (1). Pengaruh perbedaan ukuran Perna viridis terhadap proses pengambilan 109 Cd dari fase terlarut adalah sangat signifikan (P < 0.2.2 c m 30 20 10 0 0 1 2 3 4 5 K o m b in a s i T a r a f P e r la k u a n y = .4 . Fluktuasi suhu memberikan pengaruh yang berbeda terhadap nilai tingkat bioakumulasi oleh Perna viridis. Hal ini disebabkan karena Perna viridis berukuran kecil lebih banyak membutuhkan nutrien (per satuan berat) untuk pertumbuhan dan kondisi dimana sistem metabolismenya menuju kesempurnaan (Rajagopal et al 1998). Kemudian Sivalingam dalam Coreoli et al (1984) menambahkan bahwa kisaran suhu antara 10-35oC merupakan suhu yang dapat ditoleransi sampai 50% oleh Perna viridis. 109 Cd oleh Mengacu pada Gambar 6. nilai koefisien determinasi untuk salinitas 29o/ (0.96X). dimana masingmasing ukuran memberikan pengaruh yang berbeda nyata terhadap hasil akumulasi 109Cd. 47 .23 + 3.6 c m Gambar 9.9 9 7 2 109 Faktor Konsentrasi rata-rata 5 . 5. Kenaikan nilai bioakumulasi terjadi pada saat kondisi suhu berada di 30oC tetapi pada saat suhu media 28 o C nilai bioakumulasi logam perunut 109Cd oleh kerang hijau menjadi turun (Gambar 7).8 1 9 1 y = .01).4 7 9 x + 6 0 . S2T2 (3) dan S2T1 (4).8 4 R 2 = 0 .

Kerang hijau memanfaatkan turunnya atau berkurangnya salinitas untuk memperpanjang kelangsungan hidupnya sejak mulai berkurangnya salinitas (Morton 1987). amino. dan hydroxy-carboxyl yang berada pada dinding sel. thiol.Yusni Ikhwan Siregar Ukuran kerang hijau mempunyai hubungan yang negatif terhadap proses bioakumulasi perunut 109Cd (Y = 31. Ukuran merupakan faktor biologi yang penting dalam mengontrol akumulasi logam berat pada bivalva laut (Wang & Dei 1999). Hal tersebut diatas dapat disimpulkan bahwa interaksi antar faktor eksperimen memberikan pengaruh yang tidak berbeda nyata terhadap tingkat akumulasi perunut 109Cd oleh Perna viridis dari fase terlarut. (1984). hydroxy. Kemudian Sivalingam dalam Coeroli et al. dan kedua adalah formasi kompleks antara ion-ion logam berat dengan carbonyl.01). bahwa bivalva seperti kerang hijau dapat mentoleransi salinitas dengan kisaran antara 24-80 ppt. Proses bolak balik ikatan ion logam berat di permukaan sel ini dapat terjadi pada sel mati dan sel hidup dari suatu biomass.23 10.35X) atau semakin kecil ukuran kerang hijau tingkat akumulasi logam beratnya semakin besar (Gambar 9). Walaupun ukuran tubuh lebih kecil tetapi luas permukaan dan rasio volume dengan konsentrasi enzim memainkan peranan yang sangat penting (Suseno 2004b). Kenaikan konsentrasi 109 Cd pada setiap ukuran Perna viridis terjadi setiap hari selama proses pengamatan walaupun dalam durasi tertentu kenaikannya tidak sebesar pada waktu kontak lainnya. Mg. Perna viridis berukuran kecil lebih cepat mencapai kondisi tunak jika dibandingkan dengan yang berukuran besar. Logam berat dapat juga diendapkan pada proses metabolisme dan . Pengaruh interaksi antar faktor eksperimen terhadap proses bioakumulasi perunut 109Cd oleh Perna viridis dari fase terlarut tidak signifikan (P>0. Kondisi tersebut disebabkan karena masing-masing faktor mempunyai pengaruh yang kuat dalam mempengaruhi proses bioakumulasi perunut 109Cd dari fase terlarut. Hal ini sesuai dengan Suseno (2004b) yang menyatakan bahwa ada korelasi yang signifikan antara konsentrasi kontaminan di lingkungan dengan konsentrasi kontaminan dalam tubuh organisme. pertama pertukaran ion di mana ion monovalent dan divalent seperti Na. phosphate. Sedangkan active uptake terjadi sejalan dengan konsumsi ion logam untuk pertumbuhan organisme atau/dan akumulasi intraselular ion logam. dan Ca pada dinding sel digantikan oleh ion-ion logam berat. Mekanisme akumulasi 109Cd oleh Perna viridis melalui proses passive uptake dan active uptake. 48 Berdasarkan nilai faktor konsentrasi tersebut di atas maka dapat disimpulkan bahwa faktor salinitas merupakan faktor yang paling dominan mempengaruhi tingkat akumulasi perunut 109Cd oleh kerang hijau dari fase terlarut. Proses bioabsorpsi ini bersifat bolak baik dan cepat. 1984). Hal ini disebabkan karena pertumbuhan ratarata tertinggi kerang hijau berhubungan dengan salinitas dan kelimpahan Fitoplankton (Chatterji et al. Passive uptake terjadi ketika ion logam berat mengikat dinding sel dengan dua cara yang berbeda.

Bioakumulasi Kadmium Pada Kerang Hijau (Perna viridis) ekresi pada tingkat ke dua. van der Velde. sedangkan perbedaan suhu memberikan pengaruh positif yang sangat signifikan terhadap tingkat akumulasi 109 Cd dari fase terlarut. DW. JP. M. 1984.. Miller. suhu. Fakultas Matematika dan IPA IPB. dibandingkan dengan kerang hijau yang berukuran besar. &WX. 1997. YST Wong & CG. MS. 2002. Nair. Reproduction. D. Parulekar.).) in Edaiyur backwaters. den Harog. Morton. Simpson. Amer. 13pp. Ansari. InterPopulation Differences in Cd. & C. Jakarta. The Hong Kong University of Science and Technology. G. S. Wang. 2004a. 1995. 1987. Aquaculture 162:187-202. & AH. Gaillande. Growth of the green mussel. A. Hong Kong. VP. HA. P2PLR BATAN. 1758) (Bivalvia: Mytilacea). Saeni. 1998. east coast of India. Seminar Nasional Teknologi Limbah. KVK. Water Treatment with Algae Springer-Verlag and Landes Bioscience. Guru Besar Tetap Ilmu Kimia Lingkungan. growth rate and culture potential of the green mussel. Chlorella vulgaris. Removal of Copper by Free and Immobilized Microalgae. “ Kimia dan Ekotoksikologi Pencema- ran. Se. Aquaculture 40:47-55. Venugopalan. Nora FY. UI press. Connel. B.1998. Proceeding of one day seminar Development Radioecology and 49 .. 1984. Kerang hijau yang berukuran kecil lebih cepat mencapai kondisi tunak. 17 Rajagopal. Jenner. The functional morphology of the organs of the mantle cavity of Perna viridis (Linnaeus. Perna viridis: Influences of Body Size. Proses ini tergantung dari energi yang terkandung dan sensitifitasnya terhadap parameterparameter yang berbeda seperti pH. V. Aquaculture 39:45-67. DAFTAR PUSTAKA Blackmore. steady state. Bogor Suseno. Cr. Terjemahan Yanti Koestoer. BS. Landret. Penentuan Tingkat Pencemaran Logam Berat dengan Analisis Rambut.. Bull. Serpong September 2004. in: in YukShan & Tam (eds. salinitas dan lain-lain (Nora et al. Coeroli. 518 hal. Pendekatan Teknik Nuklir untuk Studi Biokinetik Akumulasi dan Depurasi Kadmium pada Gastropoda Laut Teluk Jakarta. H. Orasi Ilmiah. 5(2):159-164. in a sea water circulating system. and Zn Accumulation by the Green Mussel Perna viridis Acclimated at Different Salinities. ZA. —— 2004b. 1998). Chatterji. Recent innovations in cultivation of molluscs in French Polynesia. Perna viridis L. Malac. Biokinetics of Cadmium in Indonesia’s Green Mussel. KESIMPULAN Perbedaan ukuran kerang hijau dan salinitas memberikan pengaruh negatif yang sangat signifikan. Perna viridis (L. Ingole. & GJ. p.

Hotel Sahid Jaya Jakarta. 1999. WX. Ecol. Wang. 186:161-172.Yusni Ikhwan Siregar Marine Environment in Indonesia. Memasukkan: Maret 2009 Diterima: Juli 2009 50 . 2000. WX. Prog. Uptake and Depuration of Cesium in the Green Mussel Perna viridis. Dei . Ecol. Factors Affecting Trace Element Uptake in the Black Mussel Septifer virgatus. Ser. Prog.137:567-575. Ser. Mar. Mar. Wang. & RCH.

43 μm (AP x DV). Stages III: 4. response.73 μm – 58. respon. larvae. mutiara yang diproduksi sering kali disebut dengan nama “South Sea Pearl”. The best of relative growth length of larvae by treatment BF and not significant (P e” 0. The highest survival rate of larvae was by treatment BF. larvae. than would be decreased when temperature and salinity increased. Stages II: 5.50) and hasn’t significant (P > 0. 51 . The quickest time of plantigrade stages have found by treatment BF (day 19. The aim of this study is to obtained information on energy budget on routine metabolism. Perikanan dan Ilmu Kelautan.05) with BE.73 – 4.90 J g wet weight-1 hour-1).05) with BE (day 20. Fak.26 %.35 C g wet weight-1 hour-1 (28. Keywords: Pinctada maxima.Jurnal Biologi Indonesia 6 (1): 51-69 (2009) Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Larva Tiram Mutiara Pinctada maxima (Jameson) ∗ Tjahjo Winanto1∗. maxima larvae was 28 oC and 32 – 34 ‰ (BE and BF). Perkembangan usaha budidaya mutiara saat ini sudah mengarah pada kegiatan industri yang terintegrasi (Fassler 1995).93 μm – 30. E-mail: tjwinanto@yahoo.33 μm and stage III: 80.92 %.75 – 87. Stage II: 81. stage I: survival rate between 87.57 x 18. Di pasaran internasional.05) with BE. Produksi mutiara berbasis budidaya merupakan aktivitas usaha yang menguntungkan. Stage I: energy budged between 6.18 – 30.85).62 μm.95 C g wet weight-1 hour-1 (24. Indonesia termasuk salah satu negara penghasil mutiara (South Sea Pearl) yang cukup diskenal di pasaran dunia. metabolisme. but has not higher significant (P e” 0. metabolism. The research was used randomized block design.62 x 46. physiology. 1997).48 – 24.85 – 5. PENDAHULUAN Pinctada maxima adalah spesies akuakultur yang mempunyai nilai ekonomi tinggi (Taylor et al. The highest of energy budged for routine metabolism at treatment BF.58 J g wet weight-1 hour-1).13 x 47. Fak. stage II: 57. with three replications. in different levels of temperature and salinity.91 – 82. and to know the levels of optimum temperature and salinity. Perikanan dan Ilmu Kelautan IPB. at stage I: 29. Energy budget is one of the most sensitive tools available for individual assessing environmental changes like temperature and salinity. Sain dan Teknik UNSOED.com ABSTRACT The Effect of Temperature and Salinity to The Physiological Respons on The Larvae of Pinctada maxima (Jameson). 2 Departemen Ilmu dan Teknologi Kelautan.73 – 7.07– 19. Energy budget to routine metabolism increased was attributed to increased temperature and salinity due to the optimal. Dedi Soedharma2.78 x 17. Kata kunci: Pinctada maxima.72 – 77. fisiology.29 μm – 80. sebagian besar produksi South Sea Pearl yang dipasarkan berasal dari hasil budidaya (Anna 2006). The result showed that optimal temperature and salinity on P. Ridwan Affandi3. and also prerequisite for individual growth and survival. & Harpasis S.32 x 69.88 x 69. Sanusi2 1 Jur.39 % and stage III: 76.80 C g wet weight-1 hour-1 (15.74 J g wet weight-1 hour-1).

Selama pemeliharaan larva di dalam lab. harga spat dari hatchery kira-kira $US 0. BAHAN DAN CARA KERJA Kultur Pakan Hidup Pakan hidup dipersiapkan satu bulan sebelum percobaan dimulai.143. produksi kerang jenis ini dari tahun ke tahun terus mengalami penurunan. salinitas. 2007). Oleh sebab itu jika terjadi perubahan lingkungan pemeliharaan dapat mengakibatkan mortalitas. dalam Taylor et al. Jika hasilnya positif.Winanto.000 per cm. Ketersediaan spat merupakan kendala utama dalam pengembangan budidaya tiram mutiara. diperlukan kondisi lingkungan yang optimum dan terkendali. 2004). jika semata-mata hanya menggantungkan pengumpulan spat dari alam. Dame 1996). Affandi & Sanusi Saat ini.1 – 0. Suplai spat merupakan bagian yang krusial dari industri ini. Asha & Muthiah 2005. Syarat utama untuk kelangsungan hidup berbagai organisme adalah berdasarkan pada pengelolaan keseimbangan energi yang positif.A. karena pada 52 stadia tersebut kondisinya masih sangat rentan dan peka. Martinez-Fernandez et al. Salah satu faktor penyebab turunnya produksi mutiara karena semakin sulitnya mendapatkan tiram ukuran implantasi dan ketersediaan spat yang dipengaruhi musim. konsumsi oksigen dan pakan terhadap pertumbuhan dan sintasan (Alfaro 2005. representasi energi yang digunakan untuk tumbuh (jaringan somatik) dan atau untuk reproduksi (Resgalla et al. Jenis pakan hidup yang digunakan adalah fitoplankton Isochrysis galbana dan Pavlova lutheri. sehingga dapat diperoleh sintasan dan pertumbuhan yang tinggi. Rose data tidak dipublikasikan. keseimbangan energi ini dapat didefinisikan sebagai skope untuk pertumbuhan. seperti untuk pertumbuhan. Di Australia. Tujuan dari percobaan ini adalah untuk mendapatkan informasi tentang pembelanjaan energi untuk metabolisme rutin pada tingkat suhu dan salinitas berbeda. Keseimbangan energi dapat diestimasi oleh perbedaan antara energi yang diperoleh dari makanan yang sesuai. perkembangan dan proses-proses fisiologis yang mengatur organisme tetap dalam kondisi seimbang dan terkontrol. serta dapat diketahui tingkat suhu dan salinitas optimum.000 ekor. 1997). Selama proses produksi spat skala besar di hatchery. (2006) untuk memproduksi larva dan spat baik secara kualitas maupun kuantitas diperlukan kondisi lingkungan pemeliharaan yang optimal. Menurut Gricourth et al. Peluang usaha penjualan spat (benih) sangat menja njikan karena setiap tahunnya diperkirakan ada permintaan spat ukuran 5 – 7 cm sebesar 4. dan konsumsi energi oleh metabolisme internal (Crisp 1984. sangat diperlukan informasi tentang pengaruh suhu. yang mana berkaitan langsung dengan kualitas lingkungan (Smaal & Widdows 1994).14 per mm panjang engsel (R. Inokulum yang digunakan berasal dari biakan murni skala lab. sehingga berbagai kajian yang berkaitan dengan pemeliharaan larva di laboratorium sangat diperlukan. Soedharma. dengan harga sekitar Rp 2. kemudian diperbanyak hingga mencapai kepadatan .

Untuk mendapatkan salinitas (S) yang sesuai dengan perlakuan (30 dan 32 ‰) ditambahkan air tawar. Metode pengenceran air laut merupakan hasil kali dari volume air laut (liter) yang diencerkan (a) dengan tingkat salinitas (‰) yang akan diencerkan (St). dibadingkan dengan hasil kali volume air tawar yang ditambahkan (n) dan volume (liter) air laut yang diencerkan (a). dan botol D sebagai tempat menampung sisa air buangan (Gambar 1). karena salinitas air di lokasi penelitian e” 34 ‰. yaitu (I) suhu. 2002). Stadia II (D7 – D14) dengan kepadatan larva 3 ekor/ml dan Stadia III (D15 – D20) dengan kepadatan larva 2 ekor/ml (Winanto et al. Hewan uji berupa larva P. tipe 03J0820 AJ). (B) 28 oC. Percobaan ini menggunakan disain Rancangan acak kelompok faktorial (RAK-FAKTORIAL 3x3). sampel disaring dan ditampung menggunakan planktonet. galbana dan P. (E) 32 ‰. Untuk mengetahui laju metabolisme rutine larva 53 . Berdasarkan pada stadia perkembangan larva. Faktor II terdiri dari tiga taraf faktor yaitu salinitas (D) 30 ‰. Pengukuran laju konsumsi oksigen dilakukan dengan menempatkan hewan uji di dalam botol plastik gelap dengan volume 200 ml. Perlakuan yang digunakan terdiri dari 2 faktor. yaitu Stadia I (D1 – D6) dengan kepadatan larva 5 ekor/ ml. kemudian ditimbang menggunakan timbangan analitik Dever Instrumen (d = 0. Jepang). Larva diperoleh dari hasil pemijahan Induk P. catrage (15. dipelihara di dalam wadah percobaan ember plastik volume 20 liter. 2001. Faktor I terdiri dari tiga taraf faktor yaitu suhu (A) 26 oC. botol C untuk mengukur laju konsumsi oksigen. Winanto 2004). (II) salinitas. untuk meningkatkan suhu air digunakan alat pemana s. Media air laut yang digunakan untuk memelihara larva telah melalui beberapa tahapan proses penyaringan seperti sand filter. 10 dan 5 mikron). maka percobaan dikelompokkan menjadi tiga. yaitu berupa satu unit peralatan yang terdiri dari empat botol. Metabolisme rutine diukur pada kondisi larva tetap diberi pakan dua kali seha ri selama percobaan. Percobaan dila kukan di dalam ruangan dengan alat pendingain (AC). maxima dengan menggunakan kombinasi metode kejut suhu dan fluktuasi suhu (Winanto et al. maxima stadia bentuk-D (D1). Pengukuran suhu dila kukan dengan menggunakan termometer Hg. kapas sintetik dan ultra violet. Disain percobaan untuk mengetahui laju konsumsi oksigen. Botol A untuk stok air yang dijenuhkan. Winanto 2004). botol B sebagai wadah hewan uji. sedangkan salinitas diukur dengan refraktometer (Atago. (F) 34 ‰. Media pupuk untuk kultur pakan hidup adalah formula Walne dan Hirata (Balai Budidaya Laut 2001. dan (C) 30 oC. lutheri dengan jumlah dan waktu pemberian mengacu pada Balai Budidaya Laut (2001).0001 gr).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi sekitar 8 – 10 juta sel/ml. Larva diberi pakan I. 2001. Untuk mengetahui berat larva. Oksigen terlarut diukur dengan alat DO meter (YSI 550A. Pengelompokan dilakukan berdasarkan pada tahap perkembangan stadia larva.

54 . Pengukuran panjang antero-posterior (AP) dan tinggi dorso-ventral (DV) (Taylor et al. maxima. dianalisis dengan regresi sederhana (Y = a + bX) (Sulaiman 2004). Affandi & Sanusi dilakukan dengan mengkonversi jumlah O2 yang dikonsumsi ke dalam satuan energi sebagai berikut. 1 mlO2 = 19. Pengamatan waktu pencapaian stadia hanya dilakukan terhadap waktu pencapaian stadia akhir larva yang masih bersifat pla nktonis yaitu stadia plantigrade. Waktu pertama kali teridentifikasi stadia plantigrade. Soedharma. Data yang diperoleh dianalisis dengan uji Fischer dan dilanjutkan uji rerata Tukey (Steel &Torrie 1993).7 mlO2 (Jeong & Cho 2007). 1997) dilakukan dengan menggunakan mikrometer okuler. Sintasan dihitung berdasarkan pada persentase jumlah spat pada akhir pengamatan dibandingkan dengan jumlah spat pada awal pengamatan. Gambar 1.9 Joule (Elliot & Davison 1975) dan 1 kalori = 4. 1 mgO2 = 0. Data-data dengan dua variable seperti laju metabolisme dan berat larva. Disain percobaan untuk pengukuran laju konsumsi oksigen larva tiram mutiara P. Untuk mendapatkan nilai optimum suhu dan salinitas digunakan model regresi polinomial (Neter et al. Pengambilan sampel dilakukan setiap jam sebanyak 10 ml. 1990).Winanto. Pengolahan data dilakukan dengan menggunakan software SPSS 15 PC. Jumlah larva dihitung dengan menggunakan sedgwick rafter sel. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40 kali. selanjutnya dilakukan pengamatan di bawah mikroskop dengan perbesaran 40–60 kali.184 Joule Untuk mengetahui sintasan dilakukan pengambilan sampel sebanyak 10 ml. Pertumbuhan relatif diketahui dengan menghitung persentase selisih antara ukuran individu akhir pengamatan dan ukur an individu awal pengamatan dibandingkan dengan ukuran individu awal pengamatan. Pengamatan dimulai dari hari ke 18. maka saat itu ditetapkan sebagai waktu pencapaian stadia tersebut.

18 (R2 = 0.7001x2 + 96. Pada stadia I: laju konsumsi oksigen tertinggi mencapai 2.05). Stadia II : Y = -0.8283. Analisis hubungan antara laju metabolisme rutin larva dengan salinitas menunjukkan korelasi yang cukup kuat hanya pada stadia II (R2 = 0. dan pada stadia III efek suhu meningkat menjadi 82.7946x2 + 102. maxima tertinggi terjadi pada perlakuan suhu 28 oC.3706x2 + 25.42 %).05) antar perlakuan suhu dan salinitas.02x – 1532.9387x2 + 110. (Gambar 2). salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 o C.8227).10 (R2 = 0. Sedangkan perlakuan suhu dan tiap tahap stadia berbeda nyata. tetapi E dan F berbeda nyata lebih besar dari perlakuan D salinitas (30 ‰).187x – 1337. pada stadia II meningkat menjadi 51.16 mgO 2 /g berat basah/jam (BF) dan terendah 1. Analisis varian dan uji nilai tengah Tukey menunjukkan adanya pola dan hasil sama dengan analisis data laju konsumsi oksigen. sedangkan interaksi antara suhu dan salinitas tidak nyata pengaruhnya (P e” 0.5137).4855). 7963 dan stadia III: 0. Hubungan antara salinitas dengan laju metabolisme rutin (Gambar 3) disampaikan dalam persamaan berikut: stadia I : Y= -0. Hal yang sama juga terjadi pada stadia II dan stadia III (Tabel 1).8283). Stadia III: Y = -1. Persa-maan hubungan laju metabolisme rutin dengan suhu adalah: Stadia I : Y = -1. pengaruh salinitas terhadap laju metabolisme sekitar 48.7963). salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC. salinitas 30 ‰ (AD) (Tabel 2). Hubungan laju metabolisme dengan suhu dan salinitas Analisis hubungan antara laju metabolisme rutin larva dengan suhu.63 %.80 (R2 = 0.5821x2 + 38. Hasil analisis varian laju konsumsi oksigen menunjukkan adanya perbedaan nyata (P ≤ 0.83 %. dengan koefisien determinasi (R2) pada stadia I sekitar 0. Pada stadia I.64 (R2 = 0.09 mgO2/g berat basah/jam (AD).03x – 1431. Laju Metabolisme Hasil pengamatan menunjukkan bahwa pembelanjaan energi [C(J)/g/jam] untuk metabolisme rutin larva tertinggi terjadi pada perlakuan suhu 28 o C.70 (R2 = 0.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi HASIL Konsumsi Oksigen Hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva P. Seda ngkan pa da stadia I dan III korelasinya kurang kuat. pengaruh suhu terhadap laju metabolisme mencapai 82.804x – 625. menunjukkan adanya korelasi yang kuat. salinitas 30 ‰ (AD).5137). Stadia II : Y = -1.8227.483x – 411. pada stadia II menurun sampai 79.37 % dan pada stadia III kembali menurun (49.27 %. stadia II: 0. Pada stadia I.55 %.05) dengan salinitas 34 ‰ (F). 55 . Uji nilai tengah Tukey menunjukkan bahwa perlakuan salinitas 32 ‰ (E) tidak berbeda nyata lebih kecil (P e” 0.

08d 1.76 ± 0.05e 0.10 ± 0. III Tabel 1.7 R2 = 0.14 ± 0.74 ± 0.29 ± 0.75 ± 0. 56 .30 ± 0.03b 1. Konsumsi oksigen (mgO2/g berat basah/jam) larva P.1532.72 ± 0.Winanto.03f 1.03d 1.75 ± 0.34 ± 0.1337.98 ± 0.04f 0.41 ± 0.08 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 1.09 ± 0.04a 1.73 ± 0.03c 1.03c 1.39 ± 0.9387x 2 + 110.04f 1.12 ± 0.32 ± 0.65 ± 0.03x .31 ± 0.03b 2.1431.7963 25 26 27 28 29 30 31 Suhu (oC) 25 Suhu (oC) Stadia III Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 25 26 27 28 29 30 31 y = -1.03f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.16 ± 0.03c 0. maxima stadia I.03b 1.8 R2 = 0.02x .03a 1. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan suhu pada larva P.03b 1.79 ± 0.187x .03d 1.8227 y = -1.03a 1.7001x 2 + 96.03d 1.03d 1.8283 Suhu (oC) Gambar 2. II.03e 0. Affandi & Sanusi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Stadia II Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 25 26 27 28 29 30 31 y = -1.29 ± 0.03b 1.1 R2 = 0.15 ± 0.77 ± 0.04e Salinitas (‰) (E) 32 1.03f 0.7946x 2 + 102.16 ± 0.03b 1. Soedharma.02f (F) 34 1.03d 1.34 ± 0.

4942 31 32 Salinitas (‰) 33 34 35 Gambar 3.17 R2 = 0.4942).856. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan berat basah larva P.856). maxima dipengaruhi oleh suhu dan 57 . stadia II dan stadia III Gambar 4. maxima.64 R2 = 0.795. Secara umum belanja energi terbesar terjadi pada berat paling rendah atau larva stadia I dan kebutuhan energi menurun seiring dengan semakin bertambah beratnya larva (stadia II – III). maxima stadia I.625. Sintasan dan Pertumbuhan Larva Hasil percobaan menunjukkan bahwa sintasan dan pertumbuhan larva P. Hubungan laju metabolisme dengan berat larva Hasil analisis hubungan laju metabolisme rutin dengan berat larva menunjukkan adanya hubungan linear negatif dengan koefisien determinasi (R2) 0. Hubungan laju metabolisme rutin (J/g berat basah/jam) dengan salinitas pada larva P.4855 y = -0.483x . jadi berat (85.023x . maxima.243 (R2 = 0. Pola laju metabolisme rutin yang diamati dapat menggambarkan besarnya belanja energi yang dikeluarkan. baik untuk aktivitas maupun perkembangan larva P.18 2 R = 0. Stadia III : Y = -0.3706x 2 + 25.60 %) berpengaruh terhadap laju metabolisme larva (Gambar 4).7394x2 + 49.804x .5137 29 30 31 32 33 34 35 2 Salinitas (‰) Salinitas (‰) 25 Laju Metabolisme Rutin (J/g/jam) 20 15 10 5 0 29 30 Stadia III y = -0.25x + 29. Persamaan yang diperoleh adalah Y = -295.411.5821x + 38.023x – 795.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi 35 Stadia I Laju Metabolisme Rutin (J/g/jam) 30 25 20 15 10 5 Laju Metabolisme Rutin (J/g/jam) Stadia II 30 25 20 15 10 29 30 31 32 33 34 35 y = -0.7394x 2 + 49.17 (R2 = 0.

10 3.09 5.90a 18.10 3.83 ± 0. J (B) 28.09 3.50 ± 0.41 ± 0.09 4.37b 24.07 ± 0.10 6. J (C) 30. tetapi interaksi antara suhu dan salinitas tidak berbeda nyata (P e” 0.45b 24.73 ± 0.70 ± 0. sintasan tertinggi terjadi pada perlakuan suhu 28 o C.11 10. salinitas 30 ‰ (32. Hasil uji nilai tengah Tukey menunjukkan perbedaan nyata (P ≤ 0.45 ± 0.07 10.64 ± 0.37c 16.14 ± 0.69±0.43b 27.62 ± 0.12d 24.60 ± 0.39f 2.32 ± 0.10 10.30 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26.48 ± 0. Pembelanjaan energi untuk metabolisme rutin (C-J/g berat basah/jam) larva P.15 ± 0.84 ± 0.45b 30.68e 2. Hasil analisis varian menunjukkan adanya perbedaan yang nyata (P ≤ 0. salinitas.69 4.20 ± 0.09 ± 2.16 15.58 ± 0.86 ±0.05) dari E dan F.02 ± 0.80 ± 0.50c 18. C (Calorie). C (C) 30.38 ± 0.14 4. Pada stadia II dan III.05). C (C) 30.39f 3.03 ± 0.29f (F) 34 4.57e Salinitas (‰) (E) 32 4.40±0. C (B) 28. baik pada analisis varian maupun uji Tukey (Gambar 5). J (D) 30 3.59f 3.36b 19.07 ± 0. J Stadia III (A) 26.45a 23.45 ± 0.10 4. C (B) 28.12 15. salinitas dan tahap stadia.37c 11.41 ± 0. C (A) 26.62 ± 0.52 ± 0.04 ± 0. J (Joule).07 ± 0. Pada stadia I.58 ± 0. maxima (rata-rata ± SD) pada berbagai suhu dan salinitas.09 5.02 ± 0.46e 1.36 ± 0.44d 18.40d 15.27 5.92 %) dan terendah pada suhu 26 oC. salinitas 34 ‰ (87.53±1. J Stadia II (A) 26.90 ± 0.32 ± 0.68 ± 0.51f 2. namun perla kuan salinitas 34 ‰ (F) tidak nyata berbeda (P e” 0.37d 24.Winanto.83 ± 0.88 ± 0.13±0. Waktu Pencapaian Stadia Hasil pengamatan menunjukkan bahwa lama waktu pencapaian stadia plantigrade tercepat dicapai pada suhu 58 . sintasan tertinggi juga terjadi pada perlakuan yang sama (Tabel 3).01±0.67 ± 0.09 15.43d 18.05) antar perlakuan suhu. Pengamatan terhadap pertumbuhan larva menunjukkan pola dan hasil yang sama dengan sintasan.12 4.05) dengan 32 ‰ (E).47 %). J (B) 28.12 7.12 5. Affandi & Sanusi Tabel 2.11 5.10 4.42f Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.10 4.42b 19. C (A) 26.09 18.14 3. J (C) 30.55 ± 0. J (C) 30. J (B) 28. C (A) 26.14 18.39 ± 0.60a 15. C (C) 30.25 ± 0.75 ± 0. sedangkan salinitas 30 ‰ (D) berbeda nyata lebih kecil (P ≤ 0.05) antar perlakuan suhu.26±0.31 ± 0.43d 16.08 2. Soedharma. C (B) 28.12 ± 0.74 ± 0.60 ± 0.

91f 32.26 ± 0. stadia II (D7–D14) dan stadia III (D15–D20) pada berbagai kisaran suhu dan salinitas (A.72 ± 0.86d 60.17a 61.75 ± 1.67 ± 0. 80 AD BD CD AE BE CE AF BF CF Pertumbuhan Panjang Relatif (µm) 70 60 50 40 30 20 10 0 1 S tadia II S tadia III S tadia I 2 3 4 5 6 7 8 9 Suhu (oC) dan Salinitas (‰) Gambar 5.62c 48. Sintasan (%) larva P. B & C =suhu 26o .93 hari) (Gambar 6).03b 87.95 ±0.28d 72. Analisis varian dan uji nilai tengah Tukey menunjukkan pola dan hasil yang sama dengan hasil analisis sintasan.17 ± 1.85f Stadia II Stadia III Keterangan: Angka yang diikuti huruf berbeda pada baris dan kolom yang sama menunjukkan adanya berbedaan nyata antar perlakuan pada taraf 5 %.76e 10.71 ±1.09 ± 0.19c 48. Pertumbuhan panjang relatif larva stadia I (D1–D6).75d 61.67 ± 1.09d 71.88b 76.04f 22.04c 54.60f 22.92 ±1.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Tabel 3.64d 69.39 ± 0.29b 87.39 ± 0.71d 70. E.80 ± 1.02 ± 1.17 ± 1.80b 77.17 ± 0.91a 64. pertumbuhan.91 ± 0.82a 59. 28o dan 30o C.61 ± 0.77f (F) 34 43.23 ± 0. maxima dalam kajian ini berbeda dengan hasil penelitian Pechenik (1980) pada larva veliger (prosobranch) Nassarius obsoletus.33 ± 0.41 ± 0.27b 81.98 ±0.34 ± 0. Umur Stadia I Faktor II Faktor I Suhu (oC): (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (A) 26 (B) 28 (C) 30 (D) 30 22.60 ± 0.79 ± 1. 32 & 34%o) 28 oC dan salinitas 34 ‰ (18.83e Salinitas (‰) (E) 32 43. PEMBAHASAN Konsumsi oksigen larva P. & F= salinitas 30. D.81e 21. laju konsumsi oksigen dan laju metabolisme. nilai laju konsumsi oksigen veliger kecil sampai besar berkisar antara 59 .20 ± 1.46 ± 0. maxima (rata-rata ± SD) (n = 30) pada berbagai tingkat suhu dan salinitas.75f 32.73b 82.

maka . 1953) dalam Bayne (1983) pada satu individu larva Mytilus edulis. hasil pengukuran hubungan antara konsumsi oksigen dan bera t daging kering menunjukkan koefisien korelasi (R2 ) sebesar 0. Diduga. semakin berkembang tahapan stadia larva baik panjang maupun berat.75–3 ml O2/jam/g berat kering (Zeuthen. Laju konsumsi oksigen pada larva Mytilus edulis antara 0. 1949 dalam Bayne. Laju konsumsi oksigen larva Ostrea edulis berkisar antara 3 – 6 mlO2/jam/g berat kering (Gosling. Soedharma. 2004).5 – 5 mlO2/jam/g berat kering. kemudian konsumsi oksigen akan menurun pada kondisi suhu dan salinitas yang meningkat. Menurut Bayne (1983) pengaruh suhu dan salinitas pada laju konsumsi oksigen bervariasi antar spesies dan dipengaruhi oleh kondisi sebelum perlakuan pada induk. 1983). variabel penyebab perbedaan nilai konsumsi oksigen adalah penggunaan spesies dan metode pengukura n yang berbeda. Pada larva veliger Crepidula formicate laju konsumsi oksigen antara 2.856). Affandi & Sanusi 2. Lebih lanjut Bayne (1983) menyampaikan. Hasil korelasi menunjukkan kecenderungan linear positif.Winanto. Eksponen yang berka itan dengan hubungan laju konsumsi oksigen dengan berat daging bervariasi antara 0. Dari hasil analisis dapat diinterpretasikan. Perkembangan larva menunjukkan korelasi linear negatif dengan laju konsumsi oksigen (R2 = 0. Menurut Chacon et al (2003) perbedaan spesies dan metodologi mungkin dapat dijadikan alasan untuk menjelaskan terjadinya perbedaan hasil penelitian. Pola laju konsumsi oksigen selama masa 60 perkembangan larva menunjukkan.00. tujuannya untuk mengetahui kandungan protein dan lemak sebagai cadangan energi. bahwa tidak ada cara sederhana yang dapat digunakan untuk menghitung laju konsumsi oksigen pada kondisi yang berbeda. Laju konsumsi oksigen dipengaruhi oleh beberapa faktor termasuk suhu air. Jika dihitung per unit berat badan. 34 ‰). Studi yang sangat hati-hati telah dilakukan Zeuthen (1947. disampaikan nilai eksponen yang berkaitan dengan laju konsumsi oksigen dan berat tubuh hasilnya bervariasi antara 0. 32 ‰. makin meningkat suhu dan salinitas maka laju konsumsi oksigen akan semakin meningkat.0. hingga mencapai batas optimum (28 oC.5 sampai 10 mlO2/jam/g berat kering. Nila i koefisien determinasi yang diperoleh sama dengan hasil penelitian Bayne (1983) pada larva prosobranch Nassarius obsoletus.70 sampai > 1. Crisp (1974) menggunakan nilai rata-rata konsumsi oksigen 5 mlO2/jam/berat kering untuk menduga kelangsungan hidup larva berkaitan dengan waktu di puasakan. yaitu semakin bertambah berat maka akan diikuti dengan meningkatnya konsumsi oksigen (Bayne 1983). gamet dan larva yang berada pada satu seri penelitian. berat badan dan tingkat aktivitas.7 dan > 1. maka laju konsumsi oksigen semakin menurun.80. oleh sebab itu hubungan laju konsumsi oksigen dengan berat kerang pada beberapa spesies bivalvia dan gastropoda diduga tidak ada perbedaan kuantitatif.

Kajian ini juga mencatat hal yang sama yaitu pada laju konsumsi oksigen tertinggi (BF) diikuti oleh sintasan (BF) dan laju perumbuhan (BF) yang tinggi pula (Gambar 2). fucata laju konsumsi oksigen meningkat tinggi selama jam pertama tiram dimasukkan kembali ke dalam air dan laju konsumsi normal dicatat setelah waktu tersebut (Darmaraj 1983). Seba gai salah satu indika tor. maxima pada berbagai tingkat suhu dan salinitas. 2005). Diduga pada kondisi laju konsumsi oksigen tinggi. maka laju metabolisme akan meningkat sehingga larva dapat dengan maksimal memanfaatkan pakan yang diberikan. peningkatan konsentrasi oksigen dapat dijadikan sebagai indikasi meningkatnya jumlah penempelan larva dan mengurangi mortalitasnya (Alfaro. Tanda-tanda waktu penyesuaian tiram dari kondisi ekspose yang terpenting adalah waktu membuka cangkang untuk tujuan bernafas. merefleksikan aktivitas hasil ekskretori nitrogen dari jaringan yang meningkat 35 tinggi. dan ini terefleksi dari laju pertumbuhan serta sintasan yang tinggi.1997).Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi individu kecil lebih banyak menggunakan oksigen dibanding besar (Goddard 1996). Data laju konsumsi oksigen dapat merefleksikan karakteristik kondisi larva tiram mutiara pada berbagai suhu dan salinitas media. Sebaliknya pada perlakuan AD laju konsumsi oksigen Waktu Pencapaian Stadia (hari) 30 25 20 15 10 5 0 AD BD 1 CD AE BE 2 CE AF BF 3 CF Suhu (oC) dan Salinitas (‰) Gambar 7. Peningkatan pada cardiac dan aktivitas respirasi bivalvia Arctica islandica mengikuti periode penutupan cangkang yang digunakan sebagai interpretasi representasi pembayaran kembali “utang oksigen” sela ma masa anaerob (Taylor et al. 61 . Lama waktu (hari) pencapaian stadia plantigrade larva P. Opini yang disampaikan Boyden (1972) tentang meningkatnya konsumsi oksigen setelah diekspose. Pada P.

Winanto, Soedharma, Affandi & Sanusi

paling rendah, maka sintasan dan laju pertumbuhan juga rendah. Menurut Goddard (1996) pada kondisi oksigen terlarut rendah organisme menunjukkan tanda-tanda stress. Ini merupakan tanda umum pertama yang direfleksikan dengan menunjukkan berkurangnya nafsu makan, akibatnya pola renang dan distribusinya menjadi tidak normal. Pada hewan air, besarnya energi yang dibutuhkan untuk metabolisme dapat diestimasi melalui pengukuran tingkat konsumsi oksigen. Metabolisme rutin didefinisikan sebagai tingkat pembelanjaan energi pada kondisi normal, untuk mempertahankan struktur dan fungsi jaringan agar organisme tersebut tetap hidup. Pengukuran metabolisme rutin ini dilakukan pada kondisi organisme tetap diberi pakan selama percobaan, atau masih diberi pakan sesuai jadwal sampai sebelum dilakukan pengukuran laju konsumsi oksigen (Affandi dkk. 2005; Gosling 2004; Soria et al. 2007). Hasil analisis laju metabolisme rutin yang diperoleh dapat digunakan untuk menjelaskan mengapa sintasan dan pertumbuhan tertinggi terjadi pada perlakuan suhu 28 oC dan salinitas 34 ‰ (BF) dan terendah pada perlakuan suhu 26 oC dan salinitas 30 ‰ (AD). Pada suhu 28 oC, salinitas 34 ‰ energi yang dibelanjakan larva mencapai 19,58 – 30,13 J/g/jam (4,67 – 7,20 C/g/jam), sedangkan pada suhu 26 oC, salinitas 30 ‰ pembelanjaan energi lebih rendah yaitu 4,70–15,15 J/g/jam (1,12–3,62 C/g/ jam). Lebih jelas diperoleh gambaran bahwa untuk aktivitas setiap tahap perkembangan stadia larva dialokasikan energi yang berbeda sehingga larva 62

mampu menyesuaikan diri dengan suhu dan salinitas perlakuan. Berdasar hasil percobaan diketahui, bahwa laju metabolisme rutin menurun dengan meningkatnya stadia perkembangan larva. Diduga laju metabolisme tertinggi terjadi pada saat aktivitas larva meningkat paling tinggi. Pada stadia I, larva mempunyai kebiasaan a ktif berenang-renang, jika diamati dengan seksama mulai D3 sampai D6 aktivitasnya sangat tinggi hingga membentuk gerakan massa larva yang berputar-putar dan kebiasaan itu terus berlangsung selama stadia tersebut. Pada stadia II, aktifitas renang larva mulai menurun, diduga pada stadia umbo akhir cangkangnya semakin berkem-bang, bertambah tebal dan berat sehingga menghambat gera kan larva. Disamping ter jadi meta morfose dari sta dia eye-spot menjadi pediveliger. Pada stadia III, laju metabolisme paling rendah selama stadia larva, diduga selain cangkang bertambah berat, pada stadia ini terjadi metamorfose dan mengalami perubahan tingkah laku (masa transisi) dari kehidupan planktonis menjadi bentik, sehingga larva mulai banyak berada di bagian tengah badan air dengan gerakan lambat. Sampai saat ini belum banyak publikasi yang berkaitan dengan laju metabolisme larva, khususnya pada larva tiram mutiara P. maxima. Beberapa hasil penelitian yang dirangkum Bayne (1983) salah satunya tentang konsumsi oksigen pada veliger moluska (prosobranch), hasil pengukuran menunjukkan bahwa laju konsumsi oksigen larva veliger ukuran kecil sampai besar antara 2,5 – 10,0 ml O2/gram berat kering/jam. Jika dikonversi

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

menurut Sor ia et al (2007) ya itu diasumsikan 1 ml O2 sama dengan 19,90 Joule, maka dalam bentuk kalori untuk metabolisme rutin setara dengan 49,75 – 199 J/g berat kering/jam. Konsumsi oksigen larva Metilus edulis berkisar antara 3 – 6 ml O2/g berat kering/jam (Gosling, 2004) atau setara dengan 59,70 – 119,40 J/g/jam untuk laju metabolisme rutin. Analisis ya ng lebih mendasar dilakukan untuk melihat pengaruh suhu dan salinitas terhadap laju metabolisme rutin larva P. maxima. Hasil analisis korelasi menunjukkan bahwa pengaruh suhu (rata-rata 81,58 %) terhadap laju meta bolisme lebih kuat dibanding salinitas (49,78 %). Menurut Gosling (2004) suhu berpengaruh kuat terhadap laju metabolisme dan belanja metabolisme akan mengikat jika suhu meningkat. Dalam percobaan ini, laju metabolisme mulai meningkat dari dari stadia I ke stadia II kemudian menurun kembali pada stadia III. Berdasarkan hasil korelasi tersebut dapat dijelaskan bahwa laju metabolisme meningkat dengan meningkatnya suhu sehingga mencapai batas optimum (28 oC), selanjutnya akan menurun seiring dengan meningkatnya suhu. Diduga, suhu 30 oC terlalu tinggi untuk aktivitas metabolisme larva sehingga metabolisme tidak berlangsung efektif akibatnya laju pertumbuhan lebih rendah dibanding pada suhu 28 o C. Demikian juga pada suhu 26 o C laju pertumbuhan larva lebih rendah dibanding pada suhu 28 oC dan 30 oC, diduga suhu 26oC relatif rendah dan kurang efektif untuk proses metabolisme, sehingga

berimplikasi pada perkembangan dan pertumbuhan larva. Menurut Goddard (1996), salah satu faktor yang mempengaruhi laju konsumsi oksigen adalah suhu air. Suhu akan mempengaruhi mekanisme transport ion yang berimplikasi pada osmoregulasi dengan melibatkan berbagai reaksi kimia. Mediasi transport ion ditimbulkan oleh meningkat dan menurunnya suhu. Oleh sebab itu osmoregulasi fluida ekstraseluler lebih efektif pada suhu tinggi dibanding suhu rendah. Sebagai gambaran, terdapat beberapa spesies yang dapat bertahan lebih baik pada kondisi fluktuasi salinitas dari pada suhu tinggi (Gilles & Jeuniaux 1979). Gastropoda Nassarius reticulates tetap hidup pada salinitas 20–30 ‰, suhu 25 o C tetapi itu hanya terjadi pada kisaran salinitas yang luas antara 10 – 40 ‰ dan pada suhu lingkungan hidupnya sekitar 5 o C (Erikson & Tallmark 1974, dalam Gilles & Jeuniaux 1979). Terlepas dari pengaruh salinitas, suhu memberikan pengaruh signifikan terhadap perkembangan larva, selisih perlakuan suhu (2 oC) yang digunakan dalam penelitian ini ternyata memberikan efek yang signifikan pada sintasan dan pertumbuhan larva. Menurut Yukihira et al (2000; 2006) perbedaan suhu selama pemeliharaan walaupun kecil atau sekitar 1–2 o C berpengaruh kuat terhadap laju pertumbuhan. Suhu berpengaruh terhadap proses metabolisme larva, makin rendah suhu maka laju metabolisme semakin menurun, sehingga laju pertumbuhan larva jadi lambat. Sebaliknya semakin tinggi suhu maka laju metabolisme makin meningkat dan akan 63

Winanto, Soedharma, Affandi & Sanusi

diikuti dengan meningkatnya laju pertumbuhan larva. Dikemukakan juga oleh Bayne (1983); Gosling (20004) laju pertumbuhan larva menunjukkan peningkatan dengan meningkatnya suhu hingga mencapai batas optimum dan kemudian pertumbuhan akan menurun bersamaan dengan meningkatnya suhu. Percobaan ini membatasi perlakuan sampai salinitas 34 ‰, karena selain berdasarkan studi pendahuluan dan rujukan literatur juga mempertimbangkan habitat alami tiram mutiara yang umumnya hidup di perairan yang dipengaruhi oseanik, sehingga diduga perlakuan pada salinitas lebih dari 34 ‰ tidak signifikan. Ternyata hasil penelitian juga menunjukkan bahwa sintasan, laju pertumbuhan, konsumsi oksigen dan pembelanjaan energi untuk metabolisme rutin pada salinitas 32 ‰ secara nyata tidak berbeda (P e” 0,05) dengan salinitas 34 ‰. Hasil penelitian yang mendukung dikemukakan Soria et al (2007), konsumsi oksigen juvenil sca llop (Agropecten purpuratus) pada salinitas 34 ‰ lebih besar dibandingkan pada salinitas 38 ‰, tetapi konsumsi oksigen pada perlakuan salinitas 38 ‰ dan 42 ‰ tida k berbeda nyata. Selanjutnya disampaikan, tidak ada perbedaan siknifikan (P > 0,05) laju konsumsi oksigen pada salinitas 34, 38 atau 42 ‰ dengan suhu 10 oC dan 22 oC. Sebaliknya perubahan salintas dapat berpengaruh terhadap toleransi suhu organisme akuatik poikiloterm. Misalnya pada ikan Fundulus heterochitus, suhu kematian lebih tinggi pada salinitas 32 ‰ dari pada di air tawar. Terjadinya resistensi tinggi karena stres suhu perlu 64

dicermati, oleh sebab itu salinitas dapat menyelaraskan isoosmotisitas antara darah dan media di luar (Vernberg & Silverthorn 1979). Toleransi terhadap suhu maksimum yang ditunjukkan oleh hewan isoosmotik yang berada pada lingkungannya merupakan ciri umum hewan invertebrata. Perlu dicatat, pada sejumlah spesies tidak menunjukkan atau hanya mempunyai kekuatan osmoregulasi ekstraseluler kecil, mekanisme regulasi isoosmotik intraseluler akan membawa sejumlah volume sel regulasi dan itu merupakan strategi adaptasi terbaik dalam medium. Sebagai contoh, kerang spesies M. granosissimus yang berasal dari laut dengan salinitas > 32 ‰, kemudian diadaptasikan ke salinitas 3 ‰, maka akan mengalami stress dan mungkin akan mati jika tidak dikembalikan ke laut. Pada spesies tertentu, media air tidak lebih hanya sebagai penyebab stres salinitas, sehingga variabelnya tergantung pada kemampuan adaptasi masing-masing spesies (Gilles & Jeuniaux 1979). Hasil analisis menunjukkan, bahwa belanja energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Hasil percobaan ini berbeda dengan hasil penelitian Bayne (1983) tentang adanya korelasi linear positif antara laju konsumsi oksigen larva veliger Prosobranch dengan berat, dijelaskan laju konsumsi oksigen meningkat dengan bertambahnya berat. Diduga selain spesies yang diamati berbeda, juga lama wartu pengamatan yang berbeda. Peneliti tersebut dilakukan secara partial, yaitu hanya mengamati stadia veliger (prosobranch) kecil (D1)

Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi

sampai veliger besar (D5). Sedangkan dalam percobaan ini dimulai dari larva stadia veliger bentuk-D (D1) sampai stadia plantigrade umur 20 hari (D20). Sumber perbedaan lainya diduga berasal dari pengukuran berat, dalam penelitian ini digunakan sampel berat basah larva, sedangkan mereka menggunakan berat kering. Menurut Chacon et al. (2003) perbedaan spesies-spesifik dan metodologi yang berbeda dapat digunakan untuk menjelaskan hasil penelitian yang bertentangan atau terdapat kontradiksi. Hasil penelitian yang mendukung disampaikan Vernberg (1972) dan Pechenik (1980), keduanya mengamati larva Nassarius obsoletus mengalami penurunan konsumsi oksigen, manakala berkembang atau mengalami metamorfose dari stadia berenang aktif berubah menjadi pediveliger yang mempunyai beha vior ber enang berputar-putar (crawling). Kajian toleransi larva terhadap suhu dan salinitas memberikan hasil yang komparable utamanya pada toleransi larva tiram mutiara P. maxima yang dipelihara di dalam wadah terbatas dan diberi perlakuan berbagai suhu dan salinitas. Menurut Gosling (2004) pada saat ini akan lebih bermanfaat apabila dilakukan pengkajian dengan melihat pengaruh kombinasi suhu dan salinitas terhadap pertumbuhan. Suhu dan salinitas berpengaruh terhadap kecepatan dan keberhasilan pertumbuhan awal larva P. imbricata (O’Connor &Lawler 2004). Berdasarkan hasil percobaan ini, sintasan dan pertumbuhan larva P. maxima dari stadia veliger sampai plantigrade nyata dipengaruhi oleh suhu

dan salinitas. Hal ini terlihat dari hasil analisis varian dan uji lanjut Tukey yang nyata pengaruhnya (P d” 0,05) pada setiap perlakuan suhu dan salinitas, tetapi tidak ditemukan pengaruh nyata (P e” 0,05) pada interaksi suhu dan salinitas. Sehingga diinterpretasikan tidak ada sinergi antara suhu dan salinitas dalam mempengaruhi sintasan dan pertumbuhan larva P. maxima. Penelitian O’Connor & Lawler (2004) juga menemukan tidak ada pengaruh sinergi suhu dan salinitas, walaupun ada pengaruh signifikan suhu dan salinitas terhadap perkembangan lar va P. imbricata. Dalam penelitian ini sintasan tertinggi terjadi pada perlakuan suhu 28 o C, salinitas 32 ‰ dan 34 ‰. Sintasan terendah terjadi pada perlakuan suhu 26 o C, salinitas 30 ‰. Rendahnya sintasan diduga karena suhu dan salinitas media relatif rendah untuk perkembangan larva P. maxima sehingga proses metabolisme dan osmoregulasi fluida ekstraseluler tidak dapat berlangsung efektif. Pendapat yang dikemukakan didukung oleh data yang menunjukkan adanya pengaruh suhu dan salinitas yang signifikan (P d” 0,05) terhadap laju metabolisme rutin. Hasil penelitian yang tidak jauh berbeda disampaikan O’Connor & Lawler (2004) yaitu adanya pengaruh suhu serta salinitas pada sintasan larva P. imbricata dan terlepas dari adanya pengaruh suhu, sintasan tertinggi ditemukan pada salinitas 32 dan 35 ‰. Sebaliknya tingkat mortalitas tertinggi terjadi pada salinitas d” 23 ‰, umumnya mortalitas terjadi dengan cepat dan sangat tinggi pada percobaan suhu ekstrim 14 dan 26 oC. Larva P. 65

Affandi & Sanusi imbricata mempunyai toleransi yang rendah terhadap salinitas. larva tidak dapat berkembang pada suhu rendah dan ekstrim sekitar 14 oC. 1983). apalagi jika salinitas turun sampai kurang dari 29 ‰. maxima dan P. Disamping adanya variable lain. maxima adalah 28 oC dan 32 – 34 ‰ (BE dan BF). diduga suhu dan salinitas rendah merupakan penyebab utama mengapa larva memperpanjang waktu stadia planktonisnya (Alagarswami et al. imbricata stadia D-veliger menurun seiring dengan meningkatnya salinitas. tetapi keduanya memberikan pengaruh yang nyata terhadap lama waktu pencapaian stadia.83 C/g berat basah/jam (24. Penundaan waktu metamorfosa larva bivalvia biasanya ber asosiasi dengan suhu (Loosanof & Davis 1963. (2000) di dalam laguna Great Barrier Reef. persentase perkembangan embrio sampai stadia Dveliger meningkat signifikan seiring dengan meningkatnya salinitas. sehingga larva berkembang dengan baik.20 C/g berat basah/jam (27. maxima adalah suhu 28 oC dan salinitas 32 – 34 ‰ (BE. Pada kajian ini ditemukan tidak ada pengaruh sinergi antara suhu dan salinitas. salinitas 34 ‰ (BF) dan tidak berbeda nyata dengan suhu 28 oC.13 J/g berat basah/jam). dalam O’Connor and Lawler (2004) jumlah larva P. per sonal observasi. KESIMPULAN Suhu dan salinitas optimum untuk larva P. Hasil pengamatan terhadap lama waktu pencapaian stadia plantigrade semakin mempertegas bahwa kondisi lingkungan optimum untuk larva P. Pembelanjaan energi untuk metabolisme rutin tertinggi terdapat pada perlakuan suhu 28 oC. dalam Ala garswa mi et al. Australia mencatat bahwa kisaran suhu optimum pa da P. imbricata (Roding) dipengaruhi oleh suhu dan salinitas. Pada stadia I pembelanjaan energi mencapai 6. BF). Soedharma.Winanto. margaritifera antara 23–28 oC. Oleh sebab itu ukuran larva pada suhu 22 dan 26 oC variasinya kecil.39 J/g berat basah/jam) dan pada stadia III antara 4. Penelitian Yukihira et al.58 – 7. ternyata pada suhu dan salinitas optimum tidak tampak adanya pengaruh perbedaan yang besar. Berkaitan 66 dengan kompetensi larva untuk menempel. salinitas 32 ‰ (BE). Hasil penelitian yang hampir sama dikemukakan oleh O’Connor and Lawler (2004) bahwa pencapaian stadia Dveliger larva P. Pada kisaran salinitas 29–35 ‰.02 – 24. tetapi tidak ditemukan adanya pengaruh sinergi antara suhu dan salinitas. Bayne 1965. 1983). tetapi pada suhu kurang pengaruhnya.74 – 5. Stadia II antara 5. Berkaitan dengan ontogeni atau perkembangan organisme dari sigot sampai dewasa. Pada suhu optimum aktivitas metabolisme berjalan maksimum. Sedangkan suhu 26 oC diduga relatif rendah untuk perkembangan larva dan sebaliknya suhu 30 oC relatif tinggi untuk perkembangan lava. Quensland Utara.53 – 30. Menurut O’Connor.62 – 4. beberapa peneliti mengamati bahwa planktonis larva bisa dijumpai sampai hari ke tiga jika kondisi lingkungan tidak sesuai dan tidak menemukan substrat yang cocok untuk menempel (Baker 1994).67 C/g .

FPIK. Perhiasan Para Bangsawan. Petunjuk Teknis (VII): 106 hal. Wild versus hatcheryreared larvae. Velayudhan. PS & P. TS. Balai Budidaya Laut. Baker.55 hari). serta C.58 J/g berat basah/jam).78 %)..43 µm. Amsterdam. Salinity and pH on Larval Growth.72 – 77.V. Sintasan tertinggi terjadi pada perlakuan BF dan tidak berbeda nyata. Managemen Sumberdaya Perairan.58 %) terhadap pembelanjaan energi untuk metabolisme rutin lebih besar jika dibanding salinitas (49. 287-301.32– 19.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi berat basah/jam (19. Aquaculture 250: 823-829.73 µm – 58. 67 . Perna canaliculus. Waktu pencapaian stadia akhir larva (plantigrade) tercepat terjadi pada perlakuan suhu 28 oC.39 % dan stadia III antara 76. Aquaculture 122: 161-169. Pertumbuhan panjang relatif (AP x DV) tertinggi pada perlakuan BF dan tidak berbeda nyata namun lebih besar dengan BE. Dharmaraj. IPB.28 x 21. Dep. _____ 2002. Pada stadia I sintasan antara 87. Stadia II antara 81. Pengolahan dan Pemasaran Hasil Perikanan. Petunjuk Teknis (6): 61 hal. MF. 1983. Pada stadia I pertumbuhan relatif mencapai 33. UCAPAN TERIMAKASIH Penulis mengucapkan banyak terima kasih kepada Pimpinan dan temanteman di Balai Besar Pengembangan Budidaya Laut. Gandhi. S. Ditjen. 29: 4-6.DKP. 2005. Pembenihan Tiram Mutiara (Pinctada maxima). J. (BE. Ed. V. No. 18.32x 69. J. Warta Pasar Ikan. Pengaruh suhu (81. Pebruari. Balai Budidaya Laut Lampung. Alfaro. 2001. Asha. Crassostrea virginica. Stadia II antara 57. DS.26 %.91 – 82. Aquaculture 246: 285-294. Competency to Settle in Oyster Larva e.92 %. Balai Budidaya Laut Lampung.90 x 20. Sjafei. Sulistiono 2005. P. A.29 µm – 80. salinitas 34 ‰ (BF. Mengenal Mutiara. Kultur Pakan Hidup. Aquaculture 3.33 µm dan stadia III antara 80. Chellam.62 µm. atas bantuan yang diberikan selama penelitian. Larva Rearing and Production of Spat of Pearl Oyster Pinctada fucata (Gould). Effects of Temperature.13x7. Pencernaan dan Penyerapan Makanan. Pembelanjaan energi untuk metabolisme rutin menurun seiring dengan meningkatnya berat badan larva. Muthiah. Bogor Alagarswami K.62 x 46. 2006. Fisiologi Ikan. AC. J. Elsivier Science Publisher. DAFTAR PUSTAKA Affandi R. Effect of Water Flow and Oxygen Concentration on Early Settlement of The Zealand Greenlipped Mussel.75 – 87. B. ACC Victor & AD. Anna . 1994. 2005. 19.93 hari) dan tidak berbeda nyata lebih kecil dari suhu 28 oC dan salinitas 32 ‰.80 µm–34. Rahardjo &.88 x 69. Survival and Development of Sea cucumber Holothuria spinifera Theel. Mina Mitra Usaha..

M. Soedharma. John Wiley & Sons. Martinez-Fernandez. Bayne. Applied Linear Statistikcal 68 . R. N. Loosanof. 1983. CRC Press. DJ. 1974. Ingestion and Digestion of 10 Species of Microalgae by Wing Pearl Oyster Pteria sterna (Gould. The Mollusca. 10: 103-120.S. Farias. Gilles. Fassler.. MT. Crisp.Winanto.D. S. Kellner. Gricourt. Bivalve Molluscs. JM. Maintenance of Cell Volume. 2003. C. J. RF. Wilbur (Editors). JAMV. J. 1996. Mildford. Vazques & Z. (Eds). Development 3(8): 299-336. World Aquaculture 29 (3): 5-10. S. 2004. Elliot.A. In: Gilles. E. Rearing of Bivalve Mollusks. 2006. C. M. H. Mcintyre. BL. New Developments in Pearl Farming. 1983.. W. In: Feed Mana gement in Intensive Aquaculture. Viana. 1979. Aquaculture 251: 85-98. Mechanism of Osmoregulation in Animals. Blackwell Sc. Part I.. In: A. DJ. 1963. Aquaculture 230: 417-423. 1984. Academic Press. Ecology and Culture. Energy flow measurements. Feeding. Physiological Energetics of Marine Molluscs. Thallasia Jugosl. 2004. Rangel-Davalos. Jeuniaux. Shellfish Rese. Osmoregulation and Ecology in Media of Fluctuating Salinity. Oecologia 19: 195-201. Dame. R. L. In: Holme.. & CH. CR. Symp. Boca Raton. V & H. New York. An Insulin-Like System Involved in The Control of Pacific Oyster Crassostrea gigas Reproduction: hrlGF-1 Effect on Germinal Cell Proliferation and Maturation Assosiated with Expression Of an Homologous Insulin Receptorrelated Receptor. Publ. Ecology of Marine Bivalves. Crisp. Davidson. Verdonk. Davis.. 1851) Larvae. Gosling. 130p. Farming Jewels. Physiology. A. Beureu of Commercial Fisheries Biological Laboratory. 13: 581-604.M. Dharmaraj. 1995. 1996. Coastal Aquaculture 2: 627-632. O. An Ecosystem Approch. Proc. E. & MH. Newell. AcostaSalmon. Temperature and Water Quality. Physiological ecology of marine molluscan larvae. Fishing News Book. 254 pp. Oxygen Consumtion in Pearl Oyster Pinctada fucata (Gould) and Pinctada sugilata (Reeve). 22(1): 415-421. AS. Wesseran. Biology. BL & RC.. & W. Great Britain. Methods for the Study of Marine Benthos. Circadian metabolic rate and short-term response of juvenile green abalone (Haliotis fulgens Philippi) ti three anesthetics. 284372. Energy Equivalent of Oxygen Consumption in Animal Energetics. Goddard.. 1983. Chacon. US. J. A. In: Tompa. New York. Garcia-Esquivel. Saleuddin and K. Biggeleer. 1975. Connecticut. Oxford. The Mollusca IV. NH. 4: 51-73. Neter. Kutsner 1990. Mathieu & K. Affandi & Sanusi Bayne. Energy Relation of Marine Invertebra te Larvae.

Ser. 1970. Temperature and Osmoregulation in Aquatic Species. Pinctada maxima and P. Metabolicenvironmental interaction in the marine plankton. RA. 1979. Analisis REGRESI Menggunakan SPSS.Jr. Steel. WB & SU. WA & NF. AC & J. JS. 5th. Maintenance of Cell Volume. Margaritifera. Silverthorn.. Contoh Kasus dan Pemecahannya. Jakarta. J.. 3 rd Edition. Klumpp.Pengaruh Suhu dan Salinitas Terhadap Respon Fisiologi Models. Gilles. pp: 189196. Suatu Pendekatan Biometrik. Taylor. J. 11:537-554. Aquaculture 270: 464474. Regression. John Wiley & Sons. Widdows. Merino & E. The scope for growth of bivalves as an integrated response parameter in biological monitoring. In: Kramer. Vernberg. J. Ecol. 1993. New York. Andi Offset. Vernberg. Reis F ilho. Gramedia Pustaka Utama. J. Effect of increasing salinity on physiological response in juvenile scallop Agropecten purpuratus at two rearing temperatures. 2004. M. Mar. Tokyo. ITB. Pinctada imbricata Roding.J. Analysis of Variance and Experiental Designs. H. pp.. 2000. Smaal. Japan. Prog. Aquaculture 153: 31-40. O’Connor. Pechenik. 247-267.. Aquaculture 270: 451-463. Effects of Stocking Density on Growth and Survival of Early Juvenile Silverlip Pearl Oyster Pinctada maxima (Jameson) Held in Suspended Nursery Culture. Laitano & RW. Von Brand. Taylor. PC. Biol. 1985. Yukihira. 1972. Boca Raton. J. Salinity and Temperature Tolerance of Embryos and Juveniles of The Pearl Oyster. 1173 p. ES. Aquaculture 229: 493506. Biomonitoring of coastal waters and estuaries. G.M. Karbohidrat dan Lipid. Torrie. 1994. RGD & JH. K. KS. 2007. Memasukkan: Maret 2009 Diterima: Juli 2009 69 . CRC Press.. The pearl oyster. Lawler. 1997. J. Yogyakarta. Proceeding European Marine Biology Symposium.. 44: 1-28. LTD. Prinsip dan Prosedur Statistika. Southgate & CE. 748 hal. Margaritifera. Mechanism of Osmoregulation in Animals.. W. Growth and energy balance during the larva lives of three prosobranch gastropods. Sulaiman. Exp. C. Bandung. 1980. Toppan Copany. (Ed). Soria. Lucas & DW. 195: 179-17 ____ 2006. G. JJ. JA. 138 hal. 252: 208-224. respon in different ways to culture in similar environments. Comparative effects of temperature on suspension feeding andenergy budgets of the pearl oyster Pinctada maxima and P. Resgalla. Marine Ecology. Brasil. In. Biokimia: Metabolisme Energi.. 2004. WB. R (ed). Physioecology of the mussel Perna perna (Mytilidae) in Southern Brazil. Rose. Aquaculture. 2007. Wirahadikusumah.

2 %. The result showed that best thickness of pearl deposition by 90 cm deep (1. Kovitvadhi et al. warna dan kilau (shine) Sonkar (2007). One of the affecting factors to the quality of pearl culture is the thickness of pearl depositions (nacre). budidaya mutiara air tawar sudah dilakukan sejak periode “Taisho” (1911–1925). Perikanan dan Ilmu Kelautan.2 %.Jurnal Biologi Indonesia 6 (1): 71-78 (2009) Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Pada Kerang Air Tawar (Anodonta woodiana) Boedi Rachman1. Secara umum kualitas mutiara sangat dipengaruhi oleh: bentuk. 2008).id ABSTRACT The Effect of Depth to Deposition Process on Round Nucleus of Fresh Water Mussel (Anodonta woodiana). Keywords: Freshwater mussel. Jur. Purwokerto E-Email: bufish68@yahoo. Produksi mutiara air tawar berasal dari jenis bivalvia seperti kerang air tawar Oriental Cristaria alicata (Clessin) dan kerang air tawar Schlegel’s. 12. 60 and 90 cm deep were 11.05) to the deep of 60 cm (1. to get fast nacre deposition and high quality of pearl.9 %. 2. level of deep Kata kunci: Kerang air tawar.70 mm). in the freshwater pond. sized ranging from 12 – 15 cm were studied. (B) 60 cm and (C) 90 cm. Tjahjo Winanto2. Anodonta woodiana.10 mm) and biggest significant (P< 0. 79 % and 78. maka mutiara dari Danau Biwa dipergunakan sebagai standar kualitas mutiara air tawar dunia hingga tahun 1985 (Anonymous 2005). 71 . effect. PENDAHULUAN Mutiara air tawar sudah cukup lama dikenal dan dibudidayakan. whereas survival rate was followed 79. The result of implantation was followed that 30. Di Jepang.05) to the deep of 30 cm (0. kedalaman laut 1. &Yade Sukmajaya1 Balai Besar Pengembangan Budidaya Air Tawar Sukabumi.co. Saat ini mutiara air tawar telah dibudidayakan secara besarbesaran di China. Produksi mutiara bulat air tawar di Danau Biwa mulai dilakukan secara komersial pada tahun 1930. Sedangkan di Thailand mengembangkan jenis endemik kerang mutiara air tawar Hyriopsis (Limnoscapha) myersiana (Lea 1856) (Arrekijseree et al. Berdasarkan kualitasnya yang tinggi. Completely randomized design was used with levels of deep treatment (A) 30 cm. woodiana. The objective of this study was to obtain information on best level of depth to culture of pearl. 2006. The research was conducted for 9 months. Hyriopsis schlegeli (Simpson). Unsoed.7 %. Fak. berat. was 300 m2 wide and 1 m deep. Sain dan Teknik. Anodonta. Maskur1.30 mm) but hasn’t biggest significant (P>0. 12. khususnya di Danau Biwa. Freshwater pearl Anodonta woodiana.0 %.

Sonkar 2007). internal dan teknis. Jumlah sampel 250 ekor. oksigen terlarut. BAHAN DAN CARA KERJA Penyediaan Hewan Uji Hewan uji yang digunakan dalam penelitian ini adalah kerang air tawar jenis Anodonta woodiana (Gambar 1).Rachman. Karakteristik mutiara yang berkualitas tinggi salah satunya adalah mampu memantulkan cahaya. Skinner et al. dkk Mutiara berbentuk bulat paling digemari dan banyak dicari. daya tahan kerang setelah operasi dan umur kerang (Dan & Ruobo 2000. penanganan dan pemeliharaan pasca implantasi. sedangkan berat sangat berkaitan dengan nilai karat dari mutiara. Selanjutnya kerang dibersihkan dari kotoran dan organisme penempel. sehingga kajian mengenai hal tersebut perlu dilakukan. kalsium. khususnya pada produksi mutiara bulat air tawar. kerang berukuran panjang antero-posterior (AP) 10-15 cm. Berdasarkan kualitasnya. Anonymous 2007. alkalinitas. Penelitian ini bertujuan untuk mendapatkan informasi tentang kedalaman pemeliharaan terbaik. Disain penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL). Warna sebenarnya sangat tergantung pada selera konsumen. Mengingat prosesnya cukup lama maka diperlukan suatu rekayasa pada saat pemeliharaannya. seperti suhu. 60 dan 90 cm dan masing-masing perlakuan diulang tiga kali. Oliver 2000. hijau dan biru muda. karena luwes untuk perhiasan. Kerang diperoleh dari dasar kolam pemeliharaan ikan di daerah Sukabumi. kecerahan dan kesuburan perairan (Dan & Ruobo 2000. Faktor eksternal antara lain kualtas air. Semakin tinggi karatnya maka harganyapun makin mahal. sehingga dapat diperoleh mutiara berkualitas tinggi. produksi mutiara dipengaruhi oleh tiga faktor yaitu faktor eksternal. kualitas lapisan mutiara (nacre). Sebelum implantasi kerang-kerang diseleksi dan dikondisikan agar 72 . nitrat. 2003). masa produksi yang diperlukan untuk mutiara air tawar sekitar 2 sampai 3 tahun. konduktivitas. misalnya keterampilan teknisi dalam proses implantasi. sehingga mempunyai nilai tambah sebagai perhiasan. Diduga kedalaman air pemeliharaan pasca implantasi berpengaruh terhadap kecepatan proses pelapisan mutiara dan kualitas mutiara. pH. kemudian dimasukkan ke dalam keranjang pemeliharaan (koja) dan di gantungkan pada kedalaman 30 cm dari permukaan air. Faktor internal meliputi jenis kerang yang digunakan. Menurut Pagcatipunan (1986). Hingga saat ini belum banyak dilakukan penelitian mengenai pengaruh kedalaman air terhadap ketebalan pelapisan mutiara (nacre). namun secara umum warna mutiara air tawar yang paling banyak diminati adalah merah. sehingga membuat harganya paling mahal (Anonymous 2005). Faktor teknis. dengan perlakuan kedalaman pemeliharaan 30. sehingga dapat diperoleh pelapisan mutiara yang cepat dan mendapatkan mutiara berkualitas tinggi.

Kerang yang tidak memutahkan inti dan kondisinya bagus dipersiapkan sebagai bahan penelitian. Usahakan agar posisi mantel menempel dengan inti (Winanto et al. Beberapa saat kemudian cangkang akan terbuka secara alami dan segera masukkan baji (pada bagian ventral) agar cangkang tidak tertutup kembali. Pengamatan dilakukan selama 9 bulan (April– Desember). Sebelum operasi. Pengolahan data dilakukan dengan SPSS ver 15. Selanjutnya. Pasca implantasi. untuk menghindari stres yang dapat mengakibatkan kematian dan memudahkan pengamatan.1992). Parameter yang diamati selama penelitian antara lain : Pelapisan inti Untuk mengetahui pertambahan pelapisan mutiara pada inti. Secara hati–hati masukkan potongan mantel dengan menggunakan mantel carrier dan inti (Ø 4 mm) dengan alat nucleus carrier. Dengan menggunakan spatula insang disibakkan. pertambahan pelapisan mutiara (G) dapat diketahui dengan melihat selisih antara hasil pengukuran akhir (mm)(Wt) dan hasil pengukuran awal (mm)(Wo) atau: G = Wt – Wo Hasil Implantasi Keberhasilan implantasi inti mutiara dapat dilihat dengan cara membedah kerang. agar luka tidak menjadi infeksi (Rachman et al. sehingga organ dalam terlihat jelas. Kerangkerang diaklimatisasikan pada kondisi kolam percobaan selama 30 hari dan dipelihara pada kedalaman 30 cm dari permukaan air. keduanya dimasukkan ke dalam satu saluran. terlebih dahulu dipersiapkan potongan mantel dengan ukuran 2–3 mm 2. dilakukan dengan cara mengukur diameter inti pada awal dan akhir pengamatan.1992). sehingga dapat ditemukan 73 . Operasi dilakukan dengan menempatkan kerang pada penjepit. Jumlah sampel pada setiap perlakuan adalah 75 ekor. bagian ventral kerang menghadap operator. kerang direndam dalam larutan antibiotik 5 ppm selama 10 menit. Kerang diletakkan dengan posisi mulut cangkang menghadap ke atas (ventral). Secara matematis. Selanjutnya dengan menggunakan pisau dibuat sayatan dan saluran dari bagian pangkal kaki ke arah dekat otot adductor. al.1992). maka kerang dikondisikan selama 2 minggu di dalam bak yang berisi air bersih.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat cangkangnya terbuka secara alami. yaitu dengan menggunakan metode ekspose (Winanto et al. Kerang yang berisi inti dimasukan ke dalam wadah (koja) dengan kepadatan 5 ekor/koja. 2007). Cangkang kerang sebaiknya tidak cacat/rusak dan warnanya cerah. Kondisi gonad pada stadia awal atau kosong sangat baik untuk mengurangi tingkat dimutahkannya inti setelah implantasi (Winanto et. Ekspose dilakukan dengan mengeluarkan kerang dari dalam air dan diletakkan di dalam talam plastik (40x30x5 cm) dengan posisi umbo di bawah. posisi demikian dilakukan selama 2 jam. Data yang diperoleh dianalisis dengan ANOVA (Gasperz 1991). Seleksi berdasarkan pada morfologi cangkang dan tingkat kematangan gonad.

Rachman, dkk

mutiara di dalamnya. Untuk mengetahui jumlah kerang yang berhasil memproduksi mutiara, maka dapat dihitung dari persentase jumlah kerang (ekor) yang berisi mutiara (Mt) dibandingkan dengan jumlah kerang (ekor) awal (Mo) atau diformulasikan dengan persamaan : Hasil Implantasi =

Kualitas air Pemantauan kualitas air dilakukan setiap bulan, parameter yang diukur antara lain Temperatur, pH, DO (oksigen terlarut), CO2 (karbon dioksida), Nitrite, Nitrat, pH, dan kecerahan. HASIL Pelapisan Inti Hasil pengukuran terhadap mutiara yang dipanen menunjukan adanya pertambahan besar ukuran inti atau ketebalan lapisan mutiara. Rerata ketebalan lapisan mutiara yang dipelihara pada kedalaman 60 dan 90 cm, berturut–

Mt x 100 Mo

Sintasan Sintasan kerang dapat diketahui dengan menghitung persentase jumlah kerang pada akhir pengamatan dibagi dengan jumlah kerang pada awal pengamatan.

Gambar 1. Kerang air tawar Anodonta woodiana

Gambar 2. Hasil mutiara pada perlakuan kedalaman (1) 30 (2) 60 dan (3) 90 cm.

Gambar 3. Mutiara dengan bentuk tetes air

74

Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat

turut adalah 1,10 dan 1,30 mm atau diameter inti bertambah besar menjadi 5,1 mm dan 5,3 mm. Sedangkan pada kedalaman 30 cm, inti bertambah besar menjadi 4,70 mm (0,70 mm). Hasil analisis varian menunjukkan bahwa ketebalan lapisan mutiara pada kedalaman 60 cm (1,10 mm) tidak berbeda nyata (P>0,05) dengan kedalaman 90 cm (1,30 mm), namun keduanya berbeda nyata (P<0,05) dengan kedalaman 30 cm dengan ketebalan lapisan mutiara 0,7 mm (Tabel 1). Hasil penelitian menunjukkan bahwa warna dan kilau mutiara yang dihasilkan pada kedalaman 90 cm lebih baik jika dibandingkan pada kedalaman 30 dan 60 cm (Gambar 2). Implantasi Hasil implantasi terbaik diperoleh pada perlakuan kedalaman 60 cm (12,2 %), kemudian secara berurutan adalah perlakuan 90 cm (12,0%) dan 30 cm (11,9 %). Tetapi hasil analisis varian dan uji lanjut Tukey menunjukkan tidak ada perbedaan yang nyata (P< 0,05) antar perlakuan (Tabel 1). Sebagai besar mutiara hasil penelitian (80 %) berbentuk tetes air atau droplet (Gambar 3), diduga hal ini disebabkan oleh ukuran potongan mantel

yang relatif lebar, sehingga proses pelapisan tidak terfokus pada inti. Sintasan Sintasan tertinggi terjadi pada kedalaman 30 cm (79,2 %), menurun pada kedalaman 60 cm (79,0 %) dan terendah pada kedalaman 90 cm (78,7 %) Gambar 5). Hasil analisis varian dan uji nilai tengah Tukey menunjukkan bahwa sintasan pada ke 3 perlakuan kedalaman pemeliharaan yaitu 30, 60 dan 90 cm secara nyata tidak berbeda (P > 0,05) (Tabel 1). Hasil pengamatan mencatat bahwa sebenarnya penunurunan sintasan kerang sudah teramati sejak bulan ke dua penelitian dan mortalitas mulai meningkat pada bulan ke 4 – 5. Kematian kerang yang dipelihara diduga akibat infeksi setelah operasi. Hal ini dapat dilihat dari bekas luka sayatan yang membusuk. PEMBAHASAN Berdasarkan hasil kajian diketahui bahwa ketebalan pelapisan mutiara pada kedalaman 30 cm lebih tipis jika dibandingkan pada kedalaman 60 cm dan 90 cm. Diduga hal ini berkaitan dengan posisi kedalaman (30 cm) yang relatif

Tabel 1. Ketebalan pelapisan mutiara, hasil implantasi dan sintasan kerang Anodonta woodiana (rerata ± SD) pada berbagai tingkat kedalaman.
Perlakuan (m) Kedalaman : 0,30 m 0,60 m 0,90 m Ketebalan Lapisan Mutiara (mm) 0,7±1.83 a 1,1±1.59 b 1,3±1.24 b Hasil Implantasi (%) 11,9±2.17 a 12,2±1.80 a 12,0±1.65 a Sintasan (%) 79,2±2.35 a 79,0±2.19 a 78,7±2.10 a

75

Rachman, dkk

dekat dengan permukaan air. Seperti diketahui, kondisi lingkungan di dekat permukaan air relatif tidak stabil, dibandingkan dengan lingkungan di dasar kolam yang merupakan habitat alaminya. Apalagi jika dikaitkan dengan kelimpahan pakan alami (plankton), bahan organik maupun parameter kualitas air lainnya. Salah satu parameter lingkungan yang nyata pengaruhnya terhadap proses pelapisan di kedalaman 30 cm adalah suhu (Tabel 2). Menurut Dan & Ruobo (2000) kisaran suhu yang baik untuk kelangsungan hidup dan pertumbuhan antara 15 0C–25 0 C. Pada kondisi lingkungan yang tidak sesuai, tiram akan berkonsentrasi mengalokasikan energi tubuh lebih banyak untuk beradaptasi dengan lingkungan daripada aktivitas lain seperti pelapisan inti selama proses pembentukan mutiara, sehingga lapisan mutiara yang terbentuk menjadi lebih tipis (Tun et al. 1988).
120 100

Sebaliknya pada kedalaman 60 cm dan 90 cm, dengan kondisi lingkungan yang sesuai, menyebabkan kompensasi energi yang digunakan untuk beradaptasi lebih rendah. Menurut Mulyanto (1987) setelah kantong (pearl sack) terbentuk konsentrasi energi lebih banyak digunakan untuk menahan stress sebagai akibat penempatan inti di dalam jaringan tubuh. Proses biofisiologis yang tampak adalah kerang akan melapisi inti dengan lendir dan mensekresikan zat–zat pembentuk mutiara yang terdiri dari Crystaline calcium carbonat, Crystall hexagonal calsite dan Conchiolin (Cahn 1949). Ditambahkan oleh Pagcatipunan (1996) aktivitas sekresi zat–zat pembentuk mutiara ini akan dilakukan oleh permukaan kantong yang bersentuhan dengan inti selama kerang hidup. Persentase hasil implantasi yang rendah diduga disebabkan oleh beberapa faktor tehnis, misalnya potongan mantel
30 cm 60 cm 90 cm

Sintasan (%)

80 60 40 20 0 1 2 3 4 5 6 7 8 9

Lama Pemeliharaan (bulan)
Gambar 4. Sintasan kerang Anodonta woodiana selama masa penelitian (9 bulan).

76

03–0.093 6.80–14.60 Subur Lumpur berpasir Kisaran ideal ≥ 31 6. Menurut Dan & Ruobo (2000) dan Anonymous (2007) produksi budidaya mutiara air tawar dengan bentuk bulat sempurna (around) hanya sekitar 2 – 3%. hal ini terjadi karena perubahan musim dari penghujan ke musim kemarau.03 <0.90 6.70–99.80–25. Sedimen yang menempel pada kerang dan wadah pemeliharaan ternyata juga menyebabkan hadirnya organisme pengganggu seperti cacing (Mystis sp). 2Hochheimer (2007). yang meningkatkan kekeruhan dan menurunnya debit air di kolam pemeliharaan. tidak menempel pada inti.5–8. Kualitas air Menurut Dan & Ruobo (2000) dan Oliver (2000) monitoring kualitas air selama proses pelapisan mutiara pada pemeliharaan kerang air tawar penting dilakukan.40–25. Kecerahan air di kolam penelitian antara 20 – 60 cm.Pengaruh Kedalaman Terhadap Proses Pelapisan Inti Bulat Tabel 2.67 24.90 0.69 6. posisi peletakan inti yang tidak tepat sehingga mutiara tidak terbentuk. Penurunan sintasan pada bulan tersebut diduga disebabkan oleh kualitas air yang kurang baik.76–99.90 22.82 0.90–25. 5Skinner et al (2003).62 0.03–0. 4Summerfelt (2007). seleksi tingkat kematangan gonad yang kurang akurat dan lubang sayatan terlalu lebar sehingga inti mudah dimutahkan.36–0.20–6.60–90.04–5. Secara umum sintasan pada setiap kedalaman mulai meningkat ketika memasuki bulan ke 5. Beberapa parameter kualitas air yang disarankan untuk kegiatan budidaya kerang air tawar Parameter DO (ppm) pH Temperatur (0C) Nitrat (ppm) Nitrit (ppm) Kalsium (ppm) Alkalinitas (ppm) Kecerahan (cm) Kesuburan Perairan Subtrat 30 cm 2.50–7.10 0. karena kualitas air sangat berpengaruh terhadap sintasan dan kualitas mutiara yang dihasilkan.00–7.54 15 – 251 <1.12 <103 150–2002 40 -505 Subur (Oligotropik5) Pasir berbatu5 Keterangan: 1Dan and Ruobo (2000).36–0. Menurut Moorkens (1999) untuk pemeliharaan kerang mutiara air tawar akan lebih baik 77 .35–0.17 23. yang hidup dan melubangi permukaan cangkang sehingga aktivitas fisiologis kerang terganggu dan dapat mengakibatkan kematian.70 Subur Lumpur berpasir 90 cm 2.00 0. 3Oliver (2000).083 6–15 64.00 68.04–0. Secara umum kualitas air yang diukur selama masa penelitian masih berada pada kisaran ideal untuk pemeliharaan kerang Anodonta woodiana.01–4.65 40–60 Subur Lumpur berpasir Hasil Penelitian 60 cm 2.09 7–13 68. Parameter air lainnya yang perlu diperhatikan adalah kecerahan.32 7.15–3.40 0.

U. H & G. Diamon Graphics.in. Juhaman. Cahn. P. U. 49: 255-262. Rome. Hyriopsis (Hyriopsis) bialatus Simpson. Pontjoprawiro & M. Tehnik Implantasi Untuk Menghasilkan Mutiara pada Kerang Air Tawar Margaritifera sp.. Rachman. P. &D.35. 1949. The Pearl Source. Conservation objectives for the freshwater pearl mussel (Margaritifera margaritifera) Report to English nature. A. Peterborough. KESIMPULAN Proses pelapisan mutiara terbaik terjadi pada kedalaman air 90 cm (1. R.2 %). Part 1: Biology of the species and its present situation in Ireland. Pearl Aquaculture Research Foundation.. Kovitvadhi. Sawangwong &J. 1856). Moorken. 8. info@pearl. 1999. Machado. Imperial Real Question Real Answer. M. Jakarta. Sintasan terbaik pada kedalaman air 30 cm (79. 2000. & K RungruangsakTorrisen. EA. 1900. Yuniarti. 2007. S. 1986. Pearl Culture in Japan. Dan. Areekijseree. B. Washington DC. Jiangsu Province China. Laporan Tahunan.357. Sonkar. Invertebr. Development of Digestive Enzymes and In Vitro Digestibility of Different Species of Phytoplankton for Culture of Early Juveniles of The Freshwater Mussel. Freshwater Pearl Culture and Production in China. Irish Wildlife Manuals. T. Chinese Academy of Fisheries Sciences. S. Aquaculture 275: 169-177. Oliver. DKP. FAO. Kovitvadhi.1–11–2008. 2007. 1992. DAFTAR PUSTAKA Anonymous 2005. Balai Besar Pengembangan Budidaya Air Tawar Sukabumi. Budidaya Mutiara. Winanto. United Kingdom. Thongpan. Kovitvadhi. S. Conservation Management of The Freshwater Pearl Mussel Margaritifera margaritifera. Manual On Techniques And Methodology For Freshwater Pearl Culture In Bangladesh. 1–11–2008. Engkagul. Reprod. Ruobo. Hasil implantasi tertinggi terdapat pada kedalaman air 60 cm (12. Hongkong. AK. Dev. G 2000.com . 2006. Murdjani. Kovitvadhi. berarus dan mengandung cukup kalsium. Memasukkan: Maret 2009 Diterima: Juli 2009 78 . Fishing leaflet. Balai Budidaya Laut Lampung & FAO/UNDP. Gasperz V. Rojali. Anonymous 2007. Imperial Leaflet. Metode Perancangan Percobaan. INS/81/008.3 mm). A Laboratory-scale Resirculating Aquaculture System for Juveniles of Freshwater Pearl Mussel Hyriopsis (Limnoscapha) myersiana (Lea. Bandung.source. No. AR. dkk pada perairan yang bening. Armico. sales@ thepearl. A. 2008. 1991.T.2 %). Pagcatipunan. india.Rachman.

Raja Ampat. Raja Ampat. In total there were 171 tree species recorded within plots and belonging to 108 genera and 40 families. Aporusa–Pometia. Almost all of common species such as Pometia pinnata. Pometia pinnata was the most common species followed by Anthocephalus macrophyllus. hutan dataran rendah. Papua PENDAHULUAN Melanesia diakui sebagai kawasan yang memiliki keanekaragaman flora dan tipe vegetasi yang tertinggi di dunia. and Koordersiodendron pinnatum. Pulau Misool. and Duabanga-Pterocymbium communities. Pangium edule. Sterculia-Grewia. Anthocephalus macrophyllus. Raja ampat. Kepulauan ini terdiri atas empat gugusan pulau terbesar yaitu. Papua Kata kunci: Vegetasi. Keywords: Vegetation. Yensawai (7 plots) and Wailebet (5 plots). Kepulauan Raja Ampat merupakan kepulauan yang berada di sebelah barat Kepala Burung pulau Papua di provinsi Irian Jaya Barat. and identify their species. Pulau Salawati. lowland forest. e”10 cm) within all of 17 plots were measured. Toxotrophis illicifolius. Raja Ampat. which might be a characteristic of vegetation of Papua and the nearby small islands. Papua. and determined their positions. Celtis hidebrandii and Intsia bijuga were observed as the emergent and/or canopy trees. According to ordination analysis there were five community types. Pengetahuan dan informasi tentang flora dan vegetasi Papua dan pulau-pulau kecil di sekitarnya masih sangat terbatas. Balgooy 1976). Secara geografis posisi pulau Papua terletak di antara Asia-Malesia Barat dan AustraliaPasifik yang memungkinkan terjadinya percampuran flora dan fauna dari 2 wilayah tersebut sehingga lebih memper- kaya keanekaragaman hayati di Papua dan sekitarnya (van Steenis 1948. However floristic compositions varied among plot sites.Jurnal Biologi Indonesia 6 (1): 79-96 (2009) Analisis Vegetasi Hutan Pamah di Pulau Batanta. Papua merupakan pulau terbesar di dalam kawasan Malesia dan dikenal sebagai wilayah utama hutan hujan tropika alami dengan berbagai tipe vegetasi dan flora terdapat di dalamnya. Perairan Kepulauan Raja Ampat diakui memiliki flora dan fauna bawah air yang sangat 79 . dan Pulau Batanta. Ficus-Antocephalus. Pulau Waigeo. Papua Edi Mirmanto Pusat Penelitian Biologi-LIPI ABSTRACT Vegetation Analysis of Lowland Forest in Batanta Island. Antocephalus-Toxotrophis. A vegetation analysis of Batanta lowland forest has been made by setting up 17 plots of each 30-m x 30-m distributed in 3 study sites were Yenanas (5 plots). All trees (dbh.

Edi Mirmanto beragam pada saat ini. dimana beberapa sungaisungai kecil yang berhulu di hutan alami merupakan sumber air bersih utama bagi masyarakat. cendrawasih Wilson. Adapun tujuan utama analisis vegetasi adalah untuk mempelajari dan mengungkapkan komposisi flora. Di pulau Batanta keberadaan hutan alami mempunyai arti penting dalam penyediaan air. rentan terhadap kerusakan dan peka akan gangguan. Oleh sebab itu keberadaan hutan alami di pulau Batanta perlu dipertahankan. maleo waigeo. kuskus waigeo. karena sebagian besar hutan di pulau kecil merupakan sisa ekosistem alami daratan dengan biodiversitas yang tinggi. Kondisi vegetasi di sebagian tempat menunjukkan adanya bekas gangguan yang terjadi pada masa silam. Seiring dengan berjalannya proses isolasi geografis yang lama menyebabkan terbentuknya polapola vegetasi yang khas dan terdapatnya jenis-jenis endemik pada sebagian besar pulau-pulau kecil. yang terbentang antara 130º31’7. beragam jenis anggrek serta jenis-jenis tumbuhan (Anonim 2006). karena dengan rusaknya hutan akan berpengaruh paling tidak terhadap pasokan air. Keberadaan vegetasi hutan di dalam pulau kecil merupakan sesuatu yang perlu dipertahankan. gugusan pulau-pulau karst dan flora-fauna daratan yang unik endemik seperti cendrawasih merah.4" BT dan 0º47’ 27.2"–130º53’28. baik secara ekologis maupun ekonomis bagi masyarakat yang menghuni di dalamnya. Di samping itu fungsi dan potensi vegetasi hutan di pulau kecil yang cukup memegang peranan penting. struktur hutan dan pola komunitas vegetasi hutan pamah di pulau Batanta dan kaitannya dengan kondisi habitanya. Namun demikian secara umum kondisi vegetasi masih cukup baik. Yensawai dan Wailebet (Gambar 1). Medan di daerah tersebut bervariasi dari agak datar sampai berbukit. yang ditekankan pada analisis vegetasi hutan pamah di pulau Batanta. Tulisan berikut ini merupakan sebagian hasil dari penelitian tersebut.3"–0º54’19. Daerah penelitian meliputi tiga desa yaitu daerah-daerah Yenanas. beraneka burung kakatua dan nuri. 80 . Secara umum kondisi medan di tiga daerah penelitian cukup bervariasi. dengan kondisi vegetasi yang bervariasi pula.9" LS. dengan ketinggian yang bervariasi dari 5 sampai sekitar 450 m dpl. Pencuplikan data vegetasi di daerah Yenanas telah dilakukan di daerah Iyat dan Kafnain. BAHAN DAN CARA KERJA Pulau Batanta secara geografis terbentang diantara 130o24’0"–130o55’ 48"BT dan 0o46’12" – 0o54’0" LS. (Anonim 2006). yang meliputi daerah datar sampai berbukit. dengan ketinggian mulai dari 12 sampai dengan 147 m dpl. di samping pantaipantai berpasir putih yang indah. Dilain pihak pengetahuan dan informasi tentang biodiversitas di pulau Batanta belum banyak terungkap. di samping akan timbulnya dampak negatif yang lain karena ekosistem pulau kecil sangat Sehubungan dengan itu perjalanan ke pulau Batanta telah dilakukan untuk melakukan penelitian dan eksplorasi flora dan fauna di pulau Batanta.

Vegetasi di daerah ini pada umumnya belum terganggu.cityseahorse.com) 81 . Yensawai (3=Waringkabum. Keamanan hutan di daerah ini nampaknya berkaitan dengan adanya aktivitas yang dilakukan oleh suatu organisasi yang peduli terhadap pelestarian alam. berdasarkan data dari Stasiun Meteorologi Sentani dalam kurun waktu 1997 – 2006 (http://bwspapua. 4= Wartandib.Analisis Vegetasi Hutan Pamah di Pulau Batanta khususnya di daerah perbukitan yang ditandai dengan masih banyaknya pepohonan yang berukuran besar. Rata-rata curah hujan dan temperatur udara di daerah penelitian. Secara umum kondisi habitat di daerah ini bervariasi dari datar sampai berbukit. 5=Korpak.com/irian-jaya. Gambar 1. dengan kondisi medan secara umum datar. 8=Kalituris). bergelombang sampai berbukit. Korpak. Waringkabum. Pencuplikan data vegetasi di Yensawai telah dilakukan di daerahdaerah Wartandib. dan Warai. (Peta diperoleh dari httw://www. Di daerah Wailebet pencuplikan data vegetasi telah dilakukan di daerah Kaliyakut dan Kalituris. 6=Warai) dan Wailebet (7=Kaliyakut. lokasi berdasarkan pengukuran dengan GPS) Gambar 2.html. Peta pulau dan lokasi penelitian di daerah Yenanas (1=Iyat. dengan kondisi vegetasi yang relatif tidak terganggu. 2=Kafnain).

yang tersebar pada medan maupun kondisi vegetasi yang bervariasi. Jenis dan nilai pentingnya di setiap petak digunakan sebagai matrik dalam analisis ordinasi PCA. sedangkan analisis persebaran vertical (startifikasi hutan) mengikuti cara Ogawa et al.Edi Mirmanto kerapatan pohon yang cukup tinggi dan dengan pohon-pohon berukuran cukup besar. Beberapa suku diantaranya Lauraceae. yang rencananya untuk memasok air minum bagi penduduk di desa Wailebet Curah hujan secara umum cukup tinggi dengan rata-rata bulanan selalu di atas 100 mm (Gambar 2). Flacourtiaceae. Anacardiaceae. (1965).1 (Multi Variate Statistical Packet Berdasarkan analisis ini diperoleh pengelompokan petak-petak berdasarkan kesamaan komposisi jenisnya. Yensawai (7 petak) dan Wailebet (5 petak). Analisis persebaran horizontal dilakukan dengan mengikuti cara Morishita (1959). Ketiga lokasi penelitian tersebut merupakan daerah aliran sungai yang cukup penting. Kondisi semacam ini menurut klasifikasi Schmidt & Ferguson (1951) digolongkan beriklim selalu basah. Sebanyak 17 petak pencuplikan data vegetasi dengan ukuran masing-masing 30-m x 30-m telah dibuat di daerah Yenanas (5 petak). dan Rubiaceae. Secara lokal tercatat ada beberapa suku yang dominan pada tipe komunitas atau habitat tertentu. Sapindaceae. Burseraceae dan Tiliaceae meskipun secara umum tidak tercatat sebagai suku dominan tetapi masing-masing mendominasi habitat atau komunitas tertentu . Dari 40 suku yang tercatat. diidentifikasi jenisnya. Suku Moraceae tercatat memiliki nilai dominansi yang tertinggi. diikuti oleh Sterculiaceae. 82 dominansi relatif. Masing-masing petak dibagi menjadi 9 anak petak (10-m x 10m). yang tergolong ke dalam 108 marga dan 40 suku (Lampiran 1). dengan curah hujan tinggi terjadi pada antara bulan April dan Juni-Juli dan terendah antara September dan dengan suhu udara bulanan yang cukup bervariasi (25 – 34° C) (http://bwspapua. dan nilai penting. kerapatan. diukur diameter batang setinggi 1. dengan menggunakan perangkat lunak MVSP 3. Alangiaceae. Euphorbiaceae. Verbenaceae.3 m dari atas tanah. beberapa diantaranya ditentukan sebagai suku-suku dominan di daerah penelitian berdasarkan nilai kumulatif dari nilai dominansi jenis (Tabel 1). Data yang terkumpul dianalisis mengikuti metode Mueller-Dombois (1983) untuk mendapatkan nilai frekuensi. dominansi. HASIL Komposisi jenis pohon Berdasarkan pencacahan dalam 17 petak contoh (30-m x 30-m) tercatat 171 jenis pohon dengan dimeter > 10 cm. Sapotaceae. Setiap jenis yang tercatat dibuat spesimen bukti ekologi untuk keperluan identifikasi lebih lanjut di Herbarium Bogoriense. Setiap pohon dengan diameter e” 10 cm yang terdapat di setiap anak petak.com). frekuensi relatif kerapatan relatif. ditaksir tinggi total dan bebas cabang serta ditentukan posisinya. Di salah satu DAS telah dibuat bak penampungan air.

5 11.8 %.1 5.8 3.4 3.2 24. Jenis-jenis tersebut umumnya tersebar cukup luas.6 17.9 0.1 31.3 7.0 100.8 2. Toxotrophis illicifolius.7 7.6 3.4 6.dan Koordersiodendron pinnatum dapat ditentukan sebagai jenis-jenis utama di daerah penelitian (Tabel 2).3 17. Ini memberikan gambaran adanya variasi jenis yang tinggi diantara petak-petak contoh.1 0.3 9.0 100.6 30. Dengan kata lain bahwa antar petak mempunyai perbedaan komposisi jenis yang cukup tinggi.0 100. begitu pula dengan nilai frekuensi dan kerapatan relatifnya.7 3.0 2. Namun demikian tercatat 6 % jenis yang mencapai frekuensi > 40 %.0 2.6 3.1 1.4 9.5 12.0 14.8 12.7 8.0 83 .1 25.3 100.4 5.5 1.9 7.4 1.0 100.7 41. Jenis lain seperti Antiaris toxicaria juga tercatat mempunyai persebaran cukup tinggi.4 14.3 4.0 2.6 2.1 6.7 11.6 25.4 3.2 4.6 5.9 2.0 100.0 31.5 44.1 21.0 100.0 Rata-2 20.4 8.6 1.0 1.8 4.6 34.2 2. Pada Tabel 2. tetapi dengan pohon-pohon berukuran relatif kecil.7 4.2 11.0 1.3 14.1 3.0 100.3 25.2 3.7 23.0 100.5 50.2 3.8 5.2 36.1 100.6 16.6 21.4 10.5 5.0 22. berukuran besar dengan jumlah individu relatif banyak.0 100.2 2.1 35.1 17.0 8.0 100.8 13.8 21.9 19. Pangium edule.2 19.9 21. Keberadaan jenis tersebut di atas sesuai dengan apa yang telah diketahui secara umum bahwa jenis tersebut memang tersebar luas di daerah Papua dan sekitarnya.7 39.0 6.3 1.7 1.0 1. Berdasarkan nilai penting (NP) tertinggi.Analisis Vegetasi Hutan Pamah di Pulau Batanta Tingkat heterogenitas jenis pohon tercatat cukup tinggi.1 31.4 1.1 3. sehingga secara keseluruhan dapat dikatakan bahwa vegetasi hutan di Batanta merupakan komunitas yang cukup heterogen.3 2.3 17.3 37.8 14.7 L N O P Q R 14.0 100.0 100.5 1. dan 1 jenis diantaranya yaitu Pometia pinnata dengan frekuensi 58. tetapi memeiliki kerapatan dan frekuensi yang rendah.0 4.4 17.6 2.1 21.4 25.6 100.0 Petak pencuplikan data B C D E F G H I J K 1.3 2.7 32.3 16.1 6.6 4.1 8.8 9.9 17.9 3.0 2.0 18.1 5.8 41.0 7.4 4.1 9.2 3. Pometia pinnata bersama Anthocephalus macrophyllus.1 4. Di lain pihak walaupun Intsia bijuga dan Sterculia cordata cukup domian.9 16.3 13. yang menunjukkan bahwa jenis-jenis tersebut hanya terdapat di beberapa petak pencuplikan data.4 19.1 2. yang tercermin dari banyaknya (83 %) jenis dengan frekuensi rendah (< 20 %) (Gambar 3).6 4.8 1.1 13.9 26.2 19.7 11.8 7.7 6. terlihat bahwa Pometia pinnata dengan nilai dominansi relatif tertinggi.3 8.8 17.4 4.5 1.6 24.2 12.6 1.1 13. Rata-rata nilai dominansi beberapa suku pohon yang tercatat beserta nilai dominannya di setiap petak pencuplikan data vegetasi Suku Moraceae Sapindaceae Euphorbiaceae Sterculiaceae Rubiaceae Flacourtiaceae Anacardiaceae Lauraceae Burseraceae Fabaceae Apocynaceae Tiliaceae Alangiaceae Ulmaceae Celastraceae Sapotaceae Suku lain (24) Jumlah A 3.0 100.1 1.0 33.9 4.4 30.9 1.7 6.1 2. Struktur hutan Tabel 1.1 15.3 2.0 100.7 13.9 10.0 100.0 1.

Adanya kerusakan hutan juga tercermin pada pola stratifikasi hutan yang tidak menerus. Lapisan-I terdiri atas pohon-pohon dengan tinggi antara 28 dan 34 m. Disamping itu diperkirakan bahwa setelah mengalami gangguan.5 m. Pepohonan dengan tinggi di atas 34 m merupakan jenis-jenis pohon menonjol. dan 39% pohon menempati lapisan III. Stratifikasi hutan secara umum (keseluruhan) menunjukkan bahwa hutan di daerah penelitian terdiri atas tiga lapisan kanopi (Gambar 5).5 dan 28 m. sedang pepohonan dengan tinggi di bawah 9.Edi Mirmanto Secara umum struktur hutan dapat tercermin dari pola penyebaran horisontal dan vertikal. Namun demikian persebaran diameter di daerah penelitian masih menggambarkan pola umum hutan tropis yang dinamis (Ogawa et al. Dilain pihak hanya sekitar 3 % dari pohon yang tercacah mencapai diameter > 60 cm. Akan tetapi proporsi jumlah individu nampak tidak seimbang. Gambar 4. yaitu hampir setengah dari pohon yang tercacah berukuran kecil (< 30 cm). dan lapisan-III antara 9. menunjukkan pola persebaran diameter pohon yang cukup menerus. sedangkan penyebaran vertikal terlihat dari ketinggian pepohonan.5 m merupakan jenis-jenis ternaungi. 1965). ditandai dengan adanya individu pada semua kelas diameter. lapisan-II antara 18. Sebanyak 2% pepohonan menempati lapisan I.5 dan 18. yang menunjukkan adanya rumpang atau daerah terbuka. Gambar 3. 6% pohon menempati lapisanII. Penyebaran horisontal terlihat dari penyebaran kelas diameter pohon. pertumbuhan pohon relatif lambat sehingga keberadaan pohon berukuran kecil cukup tinggi. Jumlah jenis yang tercatat di daerah penelitian menurut kelas frekuensinya 84 .

63 2.80 1.60 3.25 4.35 3. dominansi relatif (DR) dan kerapatan relatif (KR) serta nilai penting (NP) beberapa jenis yang tercatat di dalam petak-petak pencuplikan data Species Pometia pinnata Anthocephalus macrophyllus Pangium edule Toxotrophis illicifolius Koordersiodendron pinnatum Ficus variegata Artocarpus altilis Antiaris toxicaria Alstonia scholaris Artocarpus communis Ficus comitis Ficus tinctoria Sterculia cordata Instia bijuga Canarium maluensis Alangium javanicum Duabanga moluccana Grewia paniculata Intsia palembanica Aporusa cf dendroidea Celtis hildebrandii Jenis-jenis lain (81) Total FR 4.87 0.43 3.63 3.66 4.30 0.22 3.02 3.59 5. sedangkan pohon menonjol hanya mencakup 1% pohon yang terdiri atas jenis-jenis Celtis hidebrandii.87 0. Intsia bijuga.44 2.09 150.27 2.87 1.02 2.30 5. Penyebaran spasial beberapa jenis disajikan pada Gambar 6.34 100. yang menunjukkan adanya perbedaan pola persebaran.18 2.02 7.44 1.01 4.03 13.88 9.43 0.73 0.45 2.30 1.33 3.77 1.73 2.73 1.99 85 .43 2.04 1.42 2. Secara keseluruhan persebaran pohon cukup merata.73 1.00 DR 7.87 0.16 3.23 1.33 3.03 3.35 2.03 2.43 0. tetapi analisis beberapa jenis terpilih menunjukkan pola yang bervariasi.24 1.98 4.33 5.78 1.31 299.30 2.04 10.16 1. yaitu dengan nilai Indeks Morishita berkisar angka satu.00 KR 6.37 2.49 7.17 3.43 62.02 1.86 1.03 50.00 NP 18.Analisis Vegetasi Hutan Pamah di Pulau Batanta Pohon yang ternaungi meliputi 52% pohon.01 2.31 6.73 7.77 2.66 1.50 2. Pometia pinnata dan Anthocephalus macrophyllus.80 6.87 100.03 1.74 4.69 2.83 1.40 5. baik antar jenis maupun antar lokasi.05 9. Nilai frekuensi relatif (FR).63 37.68 3.10 100.69 5. Tabel 2.03 2.98 2.75 1.58 1.54 6.58 2.84 2.12 5.

Edi Mirmanto Hampir semua jenis yang dianalisis (Pangium edule. kelompok C terdiri atas 5 petak yang terdapat di Yensawai (H.P). kelompok B terdiri atas 3 petak (A. Ini menunjukkan bahwa jenis Alstonia scholaris mampu beradaptasi terhadap berbagai kondisi habitat.J). Kelompok A terdiri atas 2 petak (Q. Keberadaan jenis Intsia bijuga saat penelitian berlangsung diperkirakan merupakan pohon-pohon Gambar 4.E) dan Yensawai (F. dan kelompok E terdiri atas 1 petak yaitu Intsia bijuga tersebar secara acak. Pola komunitas Analisis data vegetasi dengan PCA menunjukkan adanya lima pengelompokan petak-petak contoh berdasarkan kesamaan komposisi jenis pohon (Gambar 7). Persebaran kelas diameter pohon yang tercacah dalam petak-petak pencuplikan data. Dua jenis lain yaitu Alstonia scholaris tersebar secara teratur dan yang tersisa dan tersebar secara terpencar. sedangkan jenis Instia bijuga kemungkinan berkaitan dengan keberadaannya sudah tidak utuh lagi.G. R) di daerah Wailebet.L) dan Wailebet (O. Permudaan alami jenis Instia bijuga berjalan kurang baik.K. Toxocarpus illicifolius) tersebar secara mengelompok yang memberikan gambaran bahwa jenis-jenis tersebut cenderung menyukai habitat tertentu (Gambar 6).B. Jenis tersebut merupakan kayu yang mempunyai nilai ekonomi tinggi. kelompok D terdiri atas 6 petak yang terdapat di Yenanas (C. sehingga kemungkinan sudah banyak ditebang.D) yang terdapat di Yenanas.I. Antiaris toxocaria. 86 . Anthocephalus cadamba. ditandai dengan rendahnya individu pada tingkat semai dan belta.

L-III=pohon pada lapisan III. L-II=pohon pada lapisan II.Analisis Vegetasi Hutan Pamah di Pulau Batanta 45 M (1%) 30 Tinggi total (m) L-I (2%) L-II (6%) 15 L-III (39%) N (52%) 0 0 15 30 45 Tinggi bebas cabang (m) Gambar 5. Stratifikasi hutan secara umum di daerah penelitian. Nilai Indeks Morishita beberapa jenis pohon yang tercacah di daerah penelitian 87 . N= pohonpohon ternaungi). Gambar 6. L-I=pohon pada lapisan I. (M=pohon menonjol.

komunitas Duabanga-Pterocymbium. Komunitas Antocephalus-Toxotrophis terdiri atas 37 jenis pohon dengan Anthocephalus macrophyllus.4 Toxotrophis illicfolius.Edi Mirmanto petak N (Wailebet) yang nampak terpisah dari petak lainnya. yaitu 1. dapat ditentukan menjadi lima tipe komunitas. Di dalam komunitas Aporusa–Pometia terkandung sebanyak 22 jenis pohon yang didominasi oleh Aporusa cf dendroidea. komunitas Antocephalus-Toxotrophis. 4. Jenis-jenis Sterculia cordata. Indeks kesamaan di antara ketiga komunitas tersebut cukup besar. 0.4 % total basal area dalam komunitas ini. yang lebih rendah dari pada dua komunitas sebelumnya. Pangium edule dan Pometia pinnata tercatat mendominasi komunitas Sterculia-Grewia. dengan proporsi dominansinya mencapai 61. 2. Vitex coffasus dan Sterculia morobensii tercatat sebagai jenis-jenis dominan. Pola pengelompokan petak-petak pencuplikan data berdasarkan analisis PCA dengan parameter nilai penting jenis pada setiap petak 88 . Pometia pinnata. Berdasarkan jenis-jenis dominan pada setiap kelompok.4 0. Ke lima jenis dominan tersebut meliputi sebanyak 34. komunitas Ficus-Antocephalus. Pometia pinnata. terutama disebabkan oleh keberadaan jenis-jenis sekunder F J S UMBU-Y I G C E 0 H P O K L D A N B R Q -0.0 SUMBU-X 0. Alangium javanicum dan Pimeleodendron ambinicum. komunitas Sterculia-Grewia. Grewia paniculata.4 -0.4 Gambar 6. komunitas Aporusa–Pometia. Ke 4 jenis tersebut mencakup 48. Artocarpus altilis. 3. dan 5. Dalam komunitas ini hanya tercatat sebanyak 22 jenis pohon. lebih kecil dari pada proporsi jenis dominan pada komunitas Aporusa– Pometia.7 % dari total basal area.4%.

Canarium maluensis. Akan tetapi dibanding-kan dengan pulau kecil yang berdekatan. seperti Geser (Mirmanto & Ruskandi 1986). yaitu sebanyak 56 jenis pohon. baik pada tingkat ekosistem (tipe vegetasi) maupun tingkat jenis. PEMBAHASAN Secara keseluruhan jumlah jenis yang tercatat dalam penelitian ini relatif lebih tinggi dibandingkan dengan beberapa pulau kecil di sekitar Papua (Purwaningsih 1995. Ini menunjukkan bahwa komposisi jenis juga dipengaruhi 89 . maupun luas daerah penelitian. dan saat penelitian dilakukan kondisi hutan dalam masa perkembangan ke arah klimaks. Anthocephalus macrophyllus. 2006). Kari-munawa (Yusuf dkk. dengan demikian diperkirakan bahwa masing-masing pulau kecil mempunyai tipe vegetasi dengan komposisi jenis yang bervariasi. Pometia pinnata. Perbedaan dalam komposisi jenis juga nampak nyata jika dibandingkan dengan beberapa pulau kecil yang berjarak jauh. data belum dipublikasikan). 2001. 1995. Artocarpus altilis. dan salah satunya adalah Pometia pinnata yang selalu menjadi jenis dominan. 1998). Krakatau (Tagawa 1992). Karena itu dalam setiap pulau kecil akan memiliki keragaman yang unik dan spesifik. Nusakam-bangan (Partomihardjo dkk. Di dalam komunitas DuabangaPterocymbium tercatat sebanyak 19 jenis pohon dan merupakan komunitas dengan kekayaan jenis terendah. kecuali Koordersiodendron pinnatum. Adanya perbedaan komposisi jenis dapat dipahami karena proses pembentukan vegetasi di pulau kecil pada umumnya melalui berbagai bentuk penyesuaian terhadap lingkungan yang cukup bervariasi. Jenis-jenis pohon yang mendominasi komunitas ini adalah Duabanga moluccana. Artocarpus communis. Perbedaan komposisi dan proporsi jenis-jenis primer yang mungkin menyebabkan ketiga komunitas tersebut terpisah dalam analisis PCA.Analisis Vegetasi Hutan Pamah di Pulau Batanta yang merupakan komponen penyusun ke tiga komunitas tersebut. Pterocymbium tinctorium . Ficus tinctoria. tercatat mempunyai kesamaan jenis yang relatif cukup tinggi. Hal yang perlu dicatat dalam komunitas ini adalah banyaknya jenis-jenis Ficus dan beberapa di antaranya termasuk jenis dominan. Dari jenis-jenis yang tercatat. serta dengan komposisi jenis yang berbeda pula. 2003). Simbolon. Komunitas Ficus-Antocephalus memiliki jumlah jenis terbanyak di antara tipe komunitas yang ada. Ficus variegata. Hampir semua jenis dominan tersebut. Ficus comitis dan Intsia palembanica merupakan jenis-jenis yang menguasai komunitas ini. Secara fisiognomi tercermin bahwa ke tiga komunitas tersebut diperkirakan pernah mengalami gangguan. misalnya Waigeo (Mirmanto. Koordersiodendron pinnatum dan Cryptocarya multinervis. tidak terdapat dalam komunitas lain. Perbedaan jumlah jenis kemungkinan berkaitan dengan perbedaan dalam jumlah dan/atau luas petak yang dibuat. Beberapa jenis komponen hutan primer sudah dijumpai dalam ketiga komunitas tersebut. atau terdapat dalam proporsi yang rendah.

hanya terdapat dalam jumlah yang relatif sedikit. Ficus spp. Begitu pula antara hutan yang terganggu dan hutan tidak terganggu dengan IS < 20 %. Lebih dari itu pemulihan hutan melalui proses suksesi berjalan dengan lambat karena dominasi jenis-jenis sekunder mampu bertahan cukup lama. Penururnan kekayaan jenis primer pada hutan terganggu menunjukkan ketahanan yang rendah dari vegetasi pulau kecil yang dikenal sangat rentan terhadap gangguan. Beberapa jenis primer yang umum terdapat di daerah Papua seperti Pometia pinnata. Pada umumnya pada komunitas hutan sekunder selalu ditemukan jenis-jenis pioner khas daerah tropik seperti Macaranga spp. Persebaran horizontal beberapa jenis menunjukkan pola yang mengelompok. Hasil sementara analisis kesesuaian habitat menujukkan adanya kecenderungan pengelompokan jenis menurut kondisi habitat. Struktur dan komposisi jenis antar ke lima tipe vegetasi cukup berbeda. yang kemungkinan disebabkan karena rendahnya kekayaan jenis primer pada hutan-hutan terganggu. meskipun secara struktural sudah mendekati kondisi hutan alami. juga mempengaruhi kesamaan komposisi jenis.Edi Mirmanto oleh jarak antar pulau kecil Selain itu pengaruh gangguan yang menghasilkan vegetasi hutan sekunder. KESIMPULAN Lima tipe komunitas hutan di daerah penelitian merupakan ciri khas vegetasi Indonesia Timur dan masing-masing tersebar pada kondisi habitat yang bervariasi. Dalam hal pola persebaran Instia bijuga yang tersebar secara acak dapat dipahami sebagai akibat penebangan pohon jenis tersebut pada masa lalu disamping permudaan alamnya yang kurang baik. tetapi masih didominasi oleh jenis-jenis pohon sekunder seperti Macaranga aleuritoides.. Mallotus mollisimus. . Namun analisis ini masih perlu ditambahkan parameter lingkungan seperti kandungan hara tanah untuk lebih memastikan pola pengelompokan tersebut. Inocarpus fagiferus dan Instia bijuga. Pimeleodendron ambinicum dan Endospermum moluccanum. Dengan demikian pengaruh gangguan terhadap penurunan kekayaan jenis juga berlaku di daerah penelitian. Tercatat bahwa komunitas dalam hutan terganggu (ditandai dengan bekas atau sisa penebangan berupa 90 tunggul yang sudah melapuk). Kesamaan komposisi jenis antar komunitas dengan ketinggian berbeda menunjukkan nilai indek kesamaan (IS) yang relatif rendah (IS < 30 %). Jenis-jenis tersebut merupakan jenis nonkomersial yang tidak dimanfaatkan oleh masyarakat secara intensif atau jenisjenis tersebut diperkirakan sebagai jenis yang tumbuh setelah terjadinya gangguan. yang rata-rata berukuran cukup besar. dan hanya 2 jenis yaitu Instia bijuga yang tersebar secara acak dan Alstonia scholaris yang tersebar secara teratur. dll (Whimore 1964) Komposisi jenis dan struktur hutan dari masing-masing komunitas hutan di daerah penelitian menunjukkan adanya keterkaitan dengan keberadaan vegetasi dan kondisi habitat yang bervariasi pula.

Apasutaya. Putrajaya. New York. K. Untuk itu segala aktivitas yang menyebabkan terjadinya gangguan terhadap hutan hendaknya ditekan seminimal mungkin. I. (Biol. Report and Proc.E. Perbedaan kekayaan dan komposisi jenis terhadap beberapa pulau kecil lain merupakan keunikan dan kekhasan dari vegetasi lahan pamah di pulau Batanta. Partomihardjo. Partomihardjo. van. Morishita. vegetation and floristic notes of Nusakambangan Island. Ser. hal 34-45. Global Taxonomy Initiative in Asia. tetapi rentan terhadap gangguan dan lambatnya proses regenerasi alami maka pengelolaan hutan di daerah ini perlu dilakukan dengan hati-hati dan dengan perhitungan yang tepat. Ratnawongse & C. & A. Anthocephalus macrophyllus. DAFTAR PUSTAKA Anonim. MMJ. Ellenberg. Pangium edule. Mirmanto. Berkaitan dengan kekhasan vegetasi hutan. In: K. E. T. Simbolon (ed. 1976. D. Keanekaragaman jenis tumbuhan dan tipe vegetasi Pulau Nusakambangan. Dalam: H. John Wiley & Sons. Simbolon. 1995. Analisa vegetasi hutan dataran rendah di pulau Geser. Atlas Sumber Daya Pesisir Kabupaten Raja Ampat. EN.& Life. Prawiroatmodjo. Ruskandi. Toxotrophis illicifolius. Phytogeography. 1-22. Irian Jaya. T. M. H. Kerjasama Pemerintah Kabupaten Raja Ampat dengan Konsorsium Atlas Sumberdaya Pesisir Kabupaten Raja Ampat Balgooy. Doc. Sci. Kyusu Univ. HB.Analisis Vegetasi Hutan Pamah di Pulau Batanta Jenis-jenis Pometia pinnata. 1959. Prosiding Seminar dan Lokakarya Nasional Nusakambangan. 2001: 39-48. of first GTI Regional Workshop in Asia. Prawiroatmodjo. Mem. Paijmans (ed. Laporan Teknik 1995. 1995. 1965. Propinsi Irian Jaya Barat. Measuring the dispersion of individuals and analysis of distributional patterns. Yoda. Nat. E. 2: 215-235. Malaysia: 106-111. Tipe-tipe vegetasi cagar alam pulau Supiori. 1972. & H. Laporan Perjalanan. dan Koordersiodendron pinnatum merupakan jenisjenis utama di daerah penelitian. Maluku. D. Asia of forest vegetation in Thailand... Aims and methods of vegetation ecology.).. Kabupa91 . Sambas & S. sehingga kelestarian hutan dapat terjaga dalam jangka panjang dan berkesinambungan. 2003. Shidei. K. 4: 13-48. Purwaningsih. Ogino. Fac. 1986. Mueller-Dombois. T. Biological diversity of small islands: Case study on landscape. 2001. Ogawa. H.). 2006. Roemantyo & S. Cilacap-Indonesia.. New Guinea Vegetation. Puslitbang Biologi-LIPI. Comperative ecological study on three main types in S.). Structure and floristic composition. Komposisi jenis dan struktur vegetasi hutan primer dan hutan sekunder pulau Biak.

& JHA. 1948. van. Puslitbang BiologiLIPI. FH. Laporan Teknik 1995. Geo J.N. R. 17-31. Mulyadi & H. Schmidt. Indonesia. Karimunjawa dan bebrapa pulau kecil lainnya. H. 92 .). Karimunjawa. 2006. hal 54-72. Steenis. Simbolon (ed. hal. 1992.42. Djawatan Meteorologi dan Geofisika. Series I. H. Yusuf.Edi Mirmanto ten Biak Numfor. Noordhof-Kolff NV. Kementrian Perhubungan. No. di kawasan T. Perubahan floristik dan keadaan hutan pada beberapa lokasi penelitian di cagar alam pulau Yapen Tengah. Flora Malesiana. EB Walujo. Irian Jaya. Ruskandi. Ferguson. Verhandelingen. Wardi & Dirman.. Tagawa. 28 (2): 175-183. vol. Primary succession and the effect of first arrival on subsequent development of forest types. IV. Pusat Penelitian Biologi LIPI. Dalam: AJ Arief. Jakarta. Julistiono (ed. Laporan Teknik 2006. Rain fall types based on wet and dry period ratios for Indonesia with weatern New Guinea. Ekol. A.). Studi vegetasi P. 1951. Jakarta. Irian Jaya. CGGJ. 2 (3): 1-11. 1998. Simbolon. Dalam: H.

Polyalthia diversifolia Miq. Lepiniopsis ternatensis Val. Polyalthia glauca Boerl.) Kurz COMBRETTACEAE Terminalia canaliculata Exell Terminalia complonata K.S. Mitrephora diversifolia Miq.) Nielson Crudia reticulata Merr. CELASTRACEAE Siphonodon celastrinus Griff.) Baill. Cynometra ramiflora L.) MA Mallotus rufidulud (Miq. DILLENIACEAE Dillenia ovalifolia Hoogl. Inocarpus fagiferus Fosb. Raja Ampat. CLUSIACEAE Garcinia dulcis (Roxb. Jass Macaranga aleuritoides F. Papua SUKU / Jenis ALANGIACEAE Alangium javanicum (Bl.) Pax & K. Endospermum moluccanum Glochidion zeylanicum A. Alstonia scholaris R. APOCYNACEAE Popowia beccarii Scheff. Bridelia insulana Claoxylon longifolium (Bl. Muller. Drypetes glabridiscus JJS Drypetes longifolia (Bl.) MA Pimeleodendron ambinicum Hassk. ANNONACEAE Spondias cytherea Sonnerat.) MA Mallotus mollisimus (Geisebr. Instia bijuga Kurtz.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1.) Kosterms. Jenis-jenis pohon yang tercatat dalam 18 petak pencuplikan data di pulau Batanta. Mallotus philippinensis (Lam.) Endi Croton argyratus Bl.Br. Intsia palembanica 93 .) Philipson BURSERACEAE Canarium denticulatum Canarium hirsutum Canarium maluensis Lauterb. Osmoxyon sessiliflorum (L.Hofm.) Wang ANACARDIACEAE Dracontomelon dao (Blanco) Merr & Ralf Duabanga moluccana Koordersiodendron pinnatum (Blanco) Merr. EUPHORBIACEAE Aporusa cf dendroidea Schot.) A.Schum CONVOLVULACEAE Erycibe sp DATICACEAE Octomeles sumatrana Miq. FABACEAE Archidendron jiringa (Jack. Polyalthia laterifolia King Polyalthia subcordata Bl. Suregeda glomerulata (Bl. Mangifera indica Parishia insignis Hook. Tabernaemontana sphaerocarpa Bl. Teysmaniodendron hollrungii (Warb. Semecarpus australiensis Engl. ARALIACEAE Gastonia papuana Miq. Macaranga tanarius (L.

LECYTHIDACEAE Planchonia sp. Schum. Beilschmeidia aruensis Koetermans Beilschmeidia gammiflora(Bl. Toxotrophis illicfolius Vid. Litsea forstenii (Bl. Aglaia goebeliana Warb Aglaia korthalsii Miq. Ficus botrycarpa Miq. Horsfieldia hellwigii (Warb.)Miq. Horsfieldia irja (Gaertn) Warb.)Kosterm.) Benth. Pangium edule Trichadenia philippinensis Merr GNETACEAE Gnetum gnemon ICACINACEAE Gomphandra papuana (Becc.)Valeton Dysoxylum arborescens Miq. Cryptocarya multinervis Teschn.B. LEEACEAE Leea indica MELIACEAE Aglaia argentea Blume Aglaia elliptica Bl.) Merr.) Hk.) Boerl.Rob. MORACEAE Antiaris toxicaria Lesch Artocarpus altilis (Park.) Merr. Chisocheton lasiocarpus (Miq.f. Litsea timoriana Span. wieringae Kosterm. Litsea calophylantha K.)C. 94 . Cryptocarya palmensis Allen Dehaasia incrassata (Jack) Kosterm. Purverulenta (Warb. Litsea ladermnniii Tschn.)Schouten Gymnacranthera panniculata Val. Ficus glaberrima Bl. Et Binn.)var.)Sleum Gonocarium littorale (Bl.)Sincl.) Sleum Medusanthera laxiflora Rhyticaryum oleaceum LAURACEAE Beilschmedia cf.f.) KN Parker Chisocheton ceramicus Miq.Edi Mirmanto Lampiran 1: Lanjutan Maniltoa brownoides Harm Maniltoa ptylogyne Harms FLACOURTIACEAE Peltophorum pterocarpa (DC) Homalium foetidum (Roxb. Ficus variegata Bl. Horsfieldia bivalvis (Hk. Aglaia lawii (Wibht)Saldanha ex Ramamoonthy Aglaia leucoclada Apanamixis polystachya (Wall. Cryptocarya caloneura (Scheff.f.) Corner MYRISTICACEAE Gymnacranthera farguhariana (Miq. Trophis philippinensis (Bur. Ficus comitis King Ficus complexa Corner Ficus cupiosa Steud. Litsea firma (Bl.) Forsb Artocarpus communis Artocarpus varieseanus Miq. Lansium domesticum Correa Sandoricum koetjape (Brom. Litsea glutinosa (Lour.)Kost. Ficus lepicarpa Ficus melinocarpa Ficus minahasae Ficus nodosa Teysm. Dysoxylum densiflorum (Bl.

RUTACEAE Evodia latifolia DC Rhodamnia cf pachyloba A. Myristica curcullata Mgf. Sterculia cymosa Wall.)Merr. Xerospermum wallichii King SAPOTACEAE Chrysophyllum lanceolatum DC. Chrysophyllum roxburgii G. Scott. TILIACEAE Grewia paniculata Ridl.J. sp. Psychotria diplococea Landeri Valeton Tarenna barbellata Val. Morinda citrifolia L. Schum. 95 . Schum Pertusandian multiflora (Hw.)Merr. Anthocephalus macrophyllus (Roxb. Planchonella oxyeda DUB Planchonella ripicola Royen SIMARUBACEAE Picrasma javnica Bl. Br. RUBIACEAE Adina racemosa (Caw. ULMACEAE Celtis hildebrandii Soepadmo URTICACEAE Dendrochide stimulans (L. Pavetta platiclada K. Et B.Analisis Vegetasi Hutan Pamah di Pulau Batanta Lampiran 1: Lanjutan Myristica sp. ROSACEAE Prunus javanica Miq. NYCTAGINACEAE Pisonia longirostris T.P. Sterculia macrorhylla Sterculia morobensii Tantra Sterculia shillinglawi F.petiolans Pometia pinnata Forst. Myristica inutilis R.)Tirveng Anthocephalus cadamba Miq. STERCULIACEAE Ailanthus integrifolia Lamk Kleinhovia hospital L. Neonauclea clemensii M. Melochia umbellate (Houtt) Staff Pterocymbium javanicum R.)Risdl.) Havil. OPILLIACEAE Chaemperia manillana (Bl.J. POLYGALACEAE Xanthophyllum tenuipetalum Meijen RHAMNACEAE Zizyphus angustifolia RHIZOPHORACEAE Carallia brachiata (Lour. SAPINDACEAE Gonophyllum filcatum Harpulia capanoides Roxb. Harpulia petiolans Radlk sub.v Muell Sterculia cordata Bl.) Chew Pipturus argenteus Widd. Myristica lanceifolia Bl. Don Madhuka leucodermis H.f. Pterocymbium tinctorium (Blanco) Merr.) Merr & Perry Syzygium pteropoda Lauterb. Br. Et K. Palaquium sp. MYRTACEAE Syzygium jamboloides Syzygium leptopodium Merr & Perry Syzygium longipes Merr & Perry Syzygium malaccense (L.L Palaquium lobbianum Burck Palaquium obovatum Burck.

Vitex quinata (Lour.) F. Premna sterculifolia King & Gamble Villebrunea rubescens Vitex coffasus Reinw. Br. v Will.Edi Mirmanto Lampiran 1: Lanjutan VERBENACEAE Premna obtusifolia R. Br. Vitex glabrata R. Memasukkan: April 2009 Diterima: Juli 2009 96 .

diperlukan cara lain selain hanya dengan pestisida. Di Indonesia kerugian yang disebabkan oleh serangan hama wereng padi pada tahun 1976/1977 mencapai 100 juta dollar Amerika (Oka & Bahagiawati 1983). maize stemborer. PCR. cara tersebut antara lain dengan mempergunakan biopestisida. Email: bahagiawati@indo. Key words: B. The objectives of this experiment were to detect the presence of cry1A sequences from several local Bacillus thuringiensis isolates multiplied by Lep1A-Lep1B and Lep2A-Lep2B primers using PCR technique and to determine their toxicity against Ostrinia furnacalis. All of tested isolates showed potentially high toxicity against maize stemborer. Cib 551. Agustina K. and second was 986 bp. thuringiensis. Jika diuangkan kerugian yang disebabkan oleh serangan hama di Amerika Serikat mencapai 7. Kerusakan yang diakibatkan hama tersebut sangat bervariasi.Jurnal Biologi Indonesia 6 (1): 97-105 (2009) Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung.id ABSTRACT Cry genes isolated from Bacillus thuringiensis produce crystal proteins that exhibit a high insecticidal activity against several plant pests. PENDAHULUAN Salah satu kendala dalam bidang pertanian yang dihadapi para petani jagung di Indonesia adalah serangan serangga hama Ostrinia furnacalis (Guenée) (Pyralidae) (Kalshoven 1981). Usaha pengendalian serangan hama telah dilakukan dengan berbagai cara. Habib Rizjaani1. timbulnya hama resisten. Ostrinia furnacalis Guenee 1 Bahagiawati1. the expected size of Lep1A-Lep1B primers. Sibuea2 Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. cry1A. Oleh karena itu. yaitu matinya organisme non-target. These isolates were Jtg 2151. thuringiensis. Ostrinia furnacalis.7 milyar dolar Amerika (Bent & Yu 1999). From 59 tested isolates. Kata kunci: B. 243. Penggunaan bahan tersebut memberikan dampak negatif terhadap kelestarian alam. two DNA bands. cry1A.net. serta penumpukan residu pada hasil panen dan di dalam tanah (Oka & Soehardjan 1997). Biopestisida yang paling popular dan digunakan secara komersil sejak tahun 1950-an adalah Bacillus thuringiensis (Bahagia97 . PCR. Lam 752. yaitu dari kerusakan tanaman dan penurunan kualitas hingga kuantitas panen (Oka & Bahagiawati 1984). di antaranya dengan menggunakan insektisida kimia. the expected size of Lep2A-Lep2B primers. Ostrinia furnacalis. first was 490 bp. 2 Balai Besar Karantina Ikan Soekarno-Hatta. Lam 762 and C 522. 6 of them gave PCR products.

Bt merupakan bakteri yang menghasilkan protein kristal dalam inclusion body saat bersporulasi. Salah satu gen cry ialah gen cry1A yang mengode protein yang bersifat insektisida terhadap serangga hama Lepidoptera dengan bobot molekul 130-140 kilodalton (kDa) (Hofte & Whiteley 1989). Dua set primer digunakan dalam penelitian ini yaitu Lep1A (5’ CCGGTGCTGGATTTGTGTTA 3’) dan Lep1B (5’ AATCCCGTATTGTACC AGCG 3’) serta Lep2A (5’CCGAGA AAGTCAAACATGCG) dan Lep 2B (Lep2B (5’TACATGCCCTTTCAG GTTCC) (Carozzi et al. thuringiensis subsp. Gen pengkode protein kristal tersebut dikenal sebagai gen cry. seperti dari tanah. 1991. Penelitian ini dilakukan untuk mengidentifikasi 59 isolat Bt lokal koleksi Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian apakah mengandung gen cry 1A dan untuk mengetahui tingkat toksisitas isolat-isolat B. Bakteri ini dapat diisolasi dari berbagai bahan. Protein kristal yang bersifat insektisida itu disebut δ-endotoksin. permukaan daun. penggunaan antibodi monoklonal. Selain itu. relatif cepat. 1991). Meskipun telah banyak ada produk komersial yang sudah dipakai secara luas. BAHAN DAN CARA KERJA Sejumlah 59 isolat Bt berasal dari koleksi Balai Besar Penelitian Bioteknologi dan Sumberdaya Genetik Pertanian. kependekan dari kata crystal. 1991). 2001). Smith et al. 1991. thuringiensis masih terus dilakukan. antara lain analisis Southern blot. kurstaki HD-7 berasal dari produk komersial dengan nama dagang Dipel. Deteksi gen cry 1A Deteksi gen cry1A dimulai dengan isolasi DNA plasmid dari masing-masing isolat dan dilakukan berdasarkan metode lisis alkali Birnboim dan Doly (Ausubel et al. karena sejumlah besar serangga hama belum dapat dikendalikan dengan menggunakan toksin yang telah ada. Rizjaani. 1991). cukup sensitif. Beberapa metode mutakhir untuk mendeteksi gen cry telah dikembangkan. 1992) yang dimodifikasi seperti . & Sibuea wati 2002). dan telah diidentifikasi berbagai jenis protein Cry. Santoso et al. thuringiensis yang tersebut terhadap Ostrinia furnacalis (Pyralidae). bubuk biji-bijian. dan mudah digunakan dalam kegiatan rutin (Carozzi et al. Sebagai kontrol negatif dipakai akuades. namun penelitian dalam usaha mengisolasi dan menidentifikasi strain-strain B. dan analisis elektroforesis hasil polymerase chain reaction (PCR) dengan menggunakan primer spesifik (Carozzi et al. dan berbagai bangkai serangga (Carozzi et al. selanjutnya disebut dengan Bt. strain-strain baru juga diperlukan untuk menyediakan alternatif bila muncul resistensi serangga hama terhadap strain Bt tertentu (Bahagiawati. Bogor digunakan sebagai bahan dalam penelitian ini. Sebagai kontrol positif dipakai isolat yang mengandung bahan aktif B. Analisis PCR dengan primer spesifik merupakan pilihan terbaik karena hasilnya dapat menen98 tukan secara cepat keberadaan sekuen gen cry. 2000).Bahagiawati.

Selain itu. 99 . Rerata persentase kematian. (2003). Pada penelitian ini isolat kontrol positf (Dipel) juga memperlihatkan keberadaan kedua pita DNA tersebut. Uji toksisitas isolat B. analisis dilanjutkan dengan uji jarak ganda Duncan untuk membandingkan semua pasangan rataan perlakuan. berat tubuh dan panjang tubuh larva yang hidup kemudian dianalisis dengan analisis regresi linier. (2003). Sebanyak 1 ml suspensi B. Setelah itu dilaksanakan analisis dengan PCR seperti tercantum pada Bahagiawati et al. Sepuluh ekor larva instar I dimasukkan ke dalam setiap cawan petri. yang satu berukuran kira-kira 490 pb yaitu produk dari Lep1A-Lep1B dan yang kedua berukuran 986 pb yang merupakan produk Lep2A-Lep2B (Gambar 1). Penelitian disusun dalam Rancangan Acak Lengkap (RAL) dengan 3 ulangan dan data diolah dengan menggunakan program komputer statistical product and service solutions (SPSS) base 10. diamati juga berat dan panjang tubuh larva yang hidup pada hari yang sama. masingmasing 500 μl. dan cara memperbanyak serangganya dapat dilihat pada Bahagiawati et al. thuringinesis terhadap larva O. Ada tidaknya perbedaan antara data persentase kematian. thuringiensis dari masing-masing perlakuan diencerkan dengan 9 ml air suling steril. (2002). Setelah makanan buatan tersebut membeku. HASIL Penyaringan isolat-isolat mengandung gen cry1A dengan PCR Dari 59 isolat B. Setiap cawan mewakili satu ulangan. Pengujian toksisitas dilaksanakan dengan memakai serangga O. masing-masing bagian makanan diinokulasi 2 ekor larva. hanya 6 isolat yang memperlihatkan reaksi positif dimana menunjukkan dua pita DNA. Uji toksisitas. Makanan buatan yang telah dicampur suspensi bakteri tersebut dimasukkan ke dalam cawan petri berukuran 50 mm x 9 mm.0 for windows.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry tercantum dalam Bahagiawati et al. Pembuatan makanan buatan. Pembagian menjadi 5 bagian ini hanya untuk memudahkan pengamatan. thuringiensis lokal yang disaring. (2003) dengan modifikasi sebagai berikut. Penghitungkan persentase kamatian larva dilakukan pada hari ke-6 setelah inokulasi berdasarkan Abbot (1925). Setiap cawan petri berisi 2500 μl makanan buatan yang terbagi lagi menjadi 5 bagian. furnacalis mengikuti Bahagiawati et al. sedangkan kontrol negatif tidak memperlihatkan adanya pita DNA. permukaan makanan dilukai dengan tusuk gigi steril untuk memudahkan larva memakan dan hidup dalam makanan buatan tersebut. Jika terdapat perbedaan antara rerata perlakuan yang diuji. berat. furnacalis yang diperbanyak pada makanan buatan. dan masing-masing perlakuan diulang sebanyak 3 kali. dan panjang tubuh larva dari setiap perlakuan diuji dengan uji statistika Kruskal-Wallis. lalu 1 ml suspensi bakteri yang telah diencerkan tersebut dicampurkan ke dalam 9 ml makanan buatan.

90b (30) 13.67b 83.67b 86.00a 83.03 (1) 0. panjang dan berat tubuh larva yang masih hidup diuji dengan jarak ganda Duncan untuk membandingkan semua pasangan perlakuan dan menunjukkan seluruh isolat memiliki toksisitas yang tidak Gambar 1. furnacalis Data uji toksisitas terhadap larva O.49b (30) 0. Cib243(2).77a (1) 0. kontrol negatif akuades (-).33b 96.78a (4) Keterangan: Angka-angka yang diikuti oleh huruf yang sama dalam setiap kolom tidak berbeda nyata dengan uji jarak ganda Duncan pada taraf kepercayaan α = 0.003 (1) 1.07a (2) a 0. Lam752(4). Rizjaani.03a (1) a 0.04 (4) 0.133a (5) 2. Angka dalam kurung adalah jumlah total serangga yang hidup per perlakuan 100 . furnacalis pada hari ke-6 setelah infestasi pada seluruh perlakuan dapat dilihat pada Tabel 1.67b 96.67b Uji Duncan* Rerata berat Rerata panjang tubuh larva tubuh larva yang hidup yang hidup (mg) (mm) 5. Hasil uji KriskalWallis terhadap semua parameter me- nunjukkan beda antara perlakuan. Cib551(3).613a (5) a 0. Lam762(5) dan C522(6). dipel (+).30b 96. Toksisitas beberapa isolat Bt lokal yang mengandung gen cry1A terhadap hama O. Tabel 1.05.20 (1) 0.33b 96.91a (5) a 0. furnacalis Kode isolat Rerata kematian (%) Kontrol negatif (akuades) Kontrol positif (Dipel) Jtg 2151 Cib 243 Cib 551 Lam 752 Lam 762 C 522 0. Kontrol positip. & Sibuea Uji toksisitas isolat terhadap O.Bahagiawati. Analisis data persentase kematian.94a (1) a 0.77a (5) 2. Produk PCR dari beberapa isolat Bt lokal Jtg2151(1).23 (2) 1.

9 mm. Berat tubuh larva-larva tersebut mencapai ratarata 5. Pada kontrol positif (Dipel).6 mm untuk panjang tubuh. semakin besar A 7 6 b erat tu b u h (mg ) B 16 panjang tubuh (m m ) 14 12 10 8 6 4 2 0 y = -0. Di samping itu juga terlihat aktivitas makan dari larva-larva itu dimana ditandai dengan banyak terdapat kotoran serangga disekitar makanan. dari 30 larva yang diinokulasikan hanya 5 larva yang dapat bertahan hidup pada hari ke6 setelah inokulasi.5 mm. B. Regresi linier antara: A.04-0. kematian serangga mencapai 83.1311x + 13. Analisis regresi linier (Gambar 3) menunjukkan adanya hubungan erat antara persentase kematian dan berat tubuh larva (R2 = 0.1137x + 1. Keseluruh larva yang diinokulasikan yaitu berjumlah 30 larva tetap hidup pada waktu dilakukan pengamatan. demikian juga dengan panjang tubuh larva (R2 = 0. Larva-larva yang masih hidup pada makanan yang mengandung isolat uji baik berat tubuh dan panjang tubuh tidak berbeda nyata dengan larva pada kontrol positif dimana berkisar antara 0. Larva-larva yang masih hidup ini terlihat lemah.9848 5 4 3 2 1 0 -1 0 20 40 60 y = -0. berat tubuh dan panjang tubuh larva 101 . persentase kematian dan panjang tubuh.9 mg dan panjang tubuh 13.9753 Gambar 3.7 mg untuk berat tubuh dan 0.7726 R = 0.98).409 R2 = 0.0609x + 5.7 mm-2. namun berbeda nyata dengan kontrol negatif akuades.9726 2 C 80 100 120 0 20 40 60 kematian (%) 80 100 120 kematian (%) 16 panjang tubuh (mm) 14 12 10 8 6 4 2 0 0 1 2 3 4 5 6 7 berat tubuh (mg) y = 2.3%. Oleh sebab itu larva-larva tersebut mempunyai bobot badan dan panjang tubuh yang sangat berat dan panjang dibandingkan dengan larva-larva yang tetap bertahan hidup pada makanan buatan yang mengandung Bt. dengan berat tubuh yang relatif kecil yaitu 0.97). C.0133 R2 = 0.13 mg dan panjang tubuh hanya 2. persentase kematian dan berat tubuh. Pada pegujian toksisitas ini tidak seekorpun dari larva instar I mati pada perlakuan kontrol negatif. Kedua analisis di atas menunjukkan hubungan yang terbalik. yaitu makanan buatan yang tidak mengandung suspensi Bt.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry berbeda nyata dengan kontrol positif Dipel.

furnacalis. mereka memakai 2 pasang primer. 2003) dimana dilakukan bioasai terhadap hama utama jagung yaitu O. Bioinsektisida Bt umumnya dikomersilkan dalam bentuk spora berbentuk tepung. Perkembangan tanaman transgenik ini juga pesat yaitu dimulai hanya meliputi 1. masing-masing Lep1A-Lep1B dan Lep2A. Kenaikan investasi industri Bt ini diperkirakan 11% per tahun. Beberapa penelitian isolasi bakteri Bt dengan memakai teknik PCR telah dilakukan di Indonesia (Listanto et al 1997. Santoso et al.97) berbanding lurus. 2000 melaksanakan penelitian identifikasi gen cry1A pada 33 isolat Bt lokal. Lain halnya regresi linier antara berat tubuh dan panjang tubuh larva yang hidup dimana menunjukkan hubungan yang erat (R2= 0.7 ha pada tahun 1996 yang hanya ditanam di 4 negara berkembang menjadi 125 juta ha yang tersebar di 25 negara pada tahun 2007 (James 2008). Penelitian yang lebih lengkap yaitu identifikasi gen cry1A yang diikuti oleh bioasai mulai dilakukan pada tahun 2003 (Bahagiawati et al. misalnya pada tahun 1980 investasi industri bioinsektisida ini mencapai $24 juta US dolar dan menjadi $107 juta US dolar di tahun 1989. Rizjaani. dimana pada tahun 1999 mencapai $300 juta. Hal ini 102 dimungkinkan oleh berkembangnya teknologi rekayasa genetika dimana gen cry yang terdapat di dalam bakteri Bt kemudian diintroduksi ke jaringan tanaman sehingga tanaman tersebut dapat memproduksi protein yang bersifat mematikan serangga ini. namun pada penelitian ini identifikasi gen cry1A dilakukan hanya memakai sepasang primer yaitu Lep 1A-Lep1B. Proses PCR dari tiap pasang primer ini dilakukan satu per satu pada PCR running yang berbeda. Potensi toksisitasnya berlipat dibandingkan dengan pestisida misalnya 300 kali dibandingkan dengan sintetik pyrethroid (Feitelson et al. belum pada tahap bioasai toksisitasnya terhadap hama target.Bahagiawati. & Sibuea persentase kematian larva maka semakin kecil berat tubuh larva dan panjang tubuh larva yang masih hidup. adanya kekawatiran akan pengaruh negatif tentang pemakaian agrokimia telah meningkatkan perhatian masarakat kepada bioinsektisida sebagai alternatif teknologi untuk menurunkan populasi hama. Hasil penelitian kami memperlihatkan hasil yang lebih akurat . Pada awal tahun1995/1996 mulai berkembang bentuk lain dari insektisida Bt ini. Pada waktu Santoso et al. Pada penelitian kami sekarang ini PCR dilakukan dengan mempergunakan 2 set primer di atas sekaligus dalam satu kali running. semakin berat tubuh larva maka semakin panjang tubuh larva yang masih hidup pada hari ke-6 setelah inokulasi. 2000) namun baru pada tahap penentuan keberadaan gen cry1A saja. 1992). Produksi bioinsektisida Bt ini telah dimulai sejak tahun 1950-an dan sangat berkembang pada tahun-tahun berikutnya. yaitu diproduksi dengan sendirinya oleh jaringan tanaman transgenik. PEMBAHASAN Seperti yang telah dikemukakan. Salah satu bioinsektisida yang banyak digunakan adalah bioinsektisida yang berbahan aktif Bt.Lep2B.

1991). dan aktifitas makan menurun. thuringiensis terhadap larva instar I dapat disimpulkan bahwa semua isolat B. 103 . thuringiensis yang diuji menunjukkan toksisitas yang tinggi terhadap larva instar I O. 6 isolat menunjukkan reaksi positif PCR dengan menghasilkan dua pita DNA yang berukuran masing-msing 490 kb dan 986 kb. Empat isolat yaitu Jtg2151. Ceron et al. 1998). Suatu isolat Bt diduga kuat mengandung gen cry1A apabila kedua pasang primer menghasilkan produk PCR sebesar 490 dan 908/986 (Carozzi et al. Pada penelitian ini ditemukan 6 isolat Bt lokal yang bersifat toksik terhadap O. 1994). KESIMPULAN Dari 59 isolat yang diuji. yaitu bioinsektisida Bt yang telah dikomersilkan. Lam752 dan Lam762 toksisitasnya melebihi toksisitas Dipel. (2000) ditemukan banyak pita DNA yang tidak spesifik untuk tiap set primer. yaitu Lep1A-Lep1B pada posisi 310-800 dan Lep2A-Lep2B pada posisi 2158-3066. Proses isolasi dan identifikasi bakteri Bt masih terus berlanjut sampai kini. Dengan demikian penelitian kami ini lebih memberikan kemajuan dari dahulu karena dapat menghemat waktu dan biaya serta hasilnya lebih akurat karena hanya pita spesifik saja yang didapatkan dari hasil visualisasi hasil PCR dengan gel elektroforesis. Hal ini jelas menunjukkan bahwa toksin Bt tersebut sangat mengganggu metabolisme serangga sehingga mengakibatkan fisik serangga yang tidak sehat pula dan berakhir dengan kematian. Toksin Bt pada isolat yang diuji ini tidak hanya menyebabkan kematian larva.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry dimana ditemukan hanya 2 pita DNA spesifik untuk cry1A. Larva yang memakan toksin Bt. Kematian larva terjadi karena adanya aktivitas protein kristal Cry1A pada usus bagian tengah larva. gerakannya lambat. Pada penelitian kami didapatkan 6 isolat Bt lokal yang berpotensi membunuh serangga O furnacalis. Larva yang mati berwarna hitam/gelap dan tubuhnya mudah hancur. Cib 243. Berdasarkan hasil uji toksisitas isolat B. Protein kristal yang dimakan larva larut bersifat protoksi dan di dalam usus tengah serangga berubah menjadi toksin. tetapi juga menurunkan berat tubuh dan panjang tubuh larva yang berhasil tetap hidup. furnacalis. Pada hasil penelitian Santoso et al. Kemudian toksin tersebut akan berikatan (binding) dengan reseptor spesifik pada sel-sel epitel usus bagian tengah ini dan membentuk pori-pori pada membran sel yang menyebabkan tekanan osmosis yang tinggi di dalam sel dan selanjutnya menyebabkan sel-sel epitelium lisis/pecah dan pada akhirnya kematian larva (Schnepf et al. Pasangan primer Lep1ALep1B dan Lep2A dan Lep2B mengamplifikasi segmen DNA gen cry1A pada posisi nukleotida yang berlainan. setelah beberapa hari tampak kecil. furnacalis. Toksisitas isolatisolat tersebut disebabkan oleh keberadaan gen cry1A yang mengkode protoksin yang spesifik bagi serangga ordo Lepidoptera (Höfte & Whiteley 1989.

57(11): 3057-3061. Struhl. S. JG. Brent.. Microbiol. PT Ichtiar Baru-Van Hove. Yu. Managemen resistensi serangga hama pada pertanaman tanaman transgenik Bt. & N. 1989. Perhim. L. H. Global Review of Commercial Transgenic Crops: 2008. Metode PCR sederhana untuk menapis isolat Bacillus thuringiensis yang membawa gen cry V. Moore. Agrobio 5(1): 21-28 Bahagiawati. Kramer. LGE. Short protocols in molecular biology: A compendium of methods from current protocols in molecular biology. Indo. Feitelson. 39. Microbiol. GW. Sutrisno. Prediction of insecticidal activity of 104 Bacillus thuringiensis strain by Polymerase Chain Reaction product profiles. Oka. Rijzaani. 2008.Y. Appl. VC. Brotonegoro. L. J. ISAAA Briefs. Smith & K. Santoso.G. John Willey. A method of computing the effectiveness of an insecticide. Koziei. C.A. Biotek. Ceron. J. Kalshoven. Buletin Agrobio: 4 (1): 1-8. James. Applications of Molecular Biology to Plant Disease and Insect Resistance. Penggunaan Bacillus thuringiensis sebagai bio.. 1994.insektisida. B. & Bahagiawati AH. RE. H. WS. Micro. Pros. Bacillus thuringiensis: insects and Beyond. No. Bio/Technology 10: 271275 Höfte. Indone. Seidman. Ortiz. S.. R. 60: 353-356. R. M. Deteksi gen cry 1A Bacillus thuringiensis dengan teknik PCR dan toksisitas-nya terhadap Ostrinia furnacalis Guenee. 1992. cry 1A(c) dengan PCR. DD. Masalah dan . Warren. & Sibuea DAFTAR PUSTAKA Abbot. Second Ed. oleh Van der Laan. 2002. Advances in Agronomy 66:251298. E.. IN. Soegiarto & MS. FM. E. Mikro Indo. Ausubel. New York. Perta. Listanto. N. Kim. Setyawan & Sutrisno. Bahagiawati. Terjemahan dari De plagen van de cultuurgewassen in Indonesie. Ithaca. JS.Bahagiawati. 18: 265-267. Ortiz. 2001. & HR. 1991. Envi. 2003. 2002. Jakarta..7(2): 35-38. J. J. J. Whiteley. 1992. 1997. cry1A(b). 8(1): 2730. Aranda. Evola & M. & IC. Carozzi. NB. B. P. Mikro. Payne.A. PCR analysis of the cry1 insecticidal crystal family genes from Bacillus thuringiensis. 1925. Surabaya 12-14 Maret 1997. Quintero. 53(2): 242-255. Bent. Pest of crops in Indonesia. Covarrubias. Rev. Insecticidal crystal protein of Bacillus thuringiensis. Bul. Bravo. Sem. Bahagiawati & Amirhusin. Econ Ento. Lina & A. & L. 1981. Bahagiawati. Envi. ISAAA.. Deteksi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A(a). Wereng coklat dan pengendaliannya dalam prespektif. Rizjaani.. Riani Simanjuntak. Kingston. Appl. J. 1999. A. D. 1983. A F. Sarjono.

J. & Bahagiawati AH. N. Lereclus.R. Zeigler & D. RA. Listanto. TJ. Santoso. J. Bacillus thuringiensis and its insecticidal crystal proteins. 63(3):775-806. Pengendalian terpadu hama padi. 1998. Identifikasi isolat Bacillus thuringiensis Indonesia yang mengandung gen cry1A menggunakan teknik PCR. Crickmore. Baum. Oka IN. Jurnal Bioteknologi Pertanian 5(2): 53-60. & GA. van Rie. Oka. 1984. 2000. D. Rev. Environ.H. Appl. Perhimpunan Entomologi Indonesia Cabang Bogor. Feitelson. J. IN. E. Cibogo. Prosiding seminar nasional Tantangan entomologi pada abad ke XXI. Tantangan entomologi pada abad XXI. Biol. Rodiyah. E. 1991. D. Couche. 22-24 Maret 1983. D. 57: 311-315.. Schnepf. Smith. Dean. Microbiol. Memasukkan: April 2009 Diterima : September 2009 105 . 1997.Toksisitas Isolat Bacillus thuringiensis yang Mengandung Gen cry Hasil penelitian Padi.. Padi-Buku III: 653-680. The phylloplane as a source of Bacillus thuringiensis variants. Risalah lokakarya penelitian padi. Damayanti & Sutrisno. Mol. & Soehardjan. Bogor.

inoculants. Biji jarak pagar mengandung minyak yang bisa dijadikan bahan baku minyak bakar (bio-diesel) penggerak mesin. Bacillus. West Kalimantan. Citrobacter. The increasing of shoot biomass accumulation was three times as caused by single inoculants (Bacillus sp). Cibinong Science Center. Chromobacterium.. Nitrosomonas. Rhizobium . E-mail: widadomon@yahoo. and Spaerotillus natans were soil bacterial isolates. and this basic study is meaningful to jatropa cultivation for standing to bio-fuel resources. Rhizobium . Jl. Pemanfaatan minyak nabati sebagai sumber bahan bakar menjadi salah satu pilihan pengganti. Raya Jakarta-Bogor km 46. Keywords: Jatropha curcas L. Bacillus. maupun pencemaran udara akibat emisi nitrogen oksida karena penggunaan pupuk kimia yang tidak tepat takaran. then used to stimulate the early growth of jatropha seedling in 15 weeks at greenhouse condition. and neither to bare soil dresses with compost. Produksi minyak nabati diawali dengan aktivitas produksi biomassa yang memerlukan dukungan sistem agronomi yang efisien. Spaerotillus natans. Bacillus. Those isolates were used as inoculants. Kandungan minyak mencapai 40% 107 . Chromobacterium. The soil was collected from numerous places around Pontianak. Spaerotillus natans. inoculants. Citrobacter. Azotobacter. Daily growth performance of jatropha peaked in 8 and 11 weeks after inoculation of Citrobacter and Nitrosomonas bacterial component were used as single inoculant. Chromobacterium.. respectively. Pemanfaatan pupuk hayati (biofertilizer) secara ekologis menguntungkan dalam menekan pencemaran tanah dan air. PENDAHULUAN Semakin menipisnya deposit bahan bakar fosil di dalam perut bumi mengakibatkan terpicunya penggalian sumber energi alternatif. Azotobacter. and Nitrosomonas spp. Nitrosomonas.com ABSTRACT Bacterial inoculants affect the early growth of Jatropha (Jatropha curcas L). Bacterial inoculations caused better growth performance compared to its control as pure soil garden medium without inoculations. Citrobacter. and formulated to single and mixed bacterial inoculants. and the highest one up to four times of biomass weight caused by a mixture inoculants as consortium of Azotobacter.Jurnal Biologi Indonesia 6 (1):107-117 (2009) Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Nitrosomonas. Genera of Azotobacter. plant height was accelerated quickly while other inoculants affected to stalk diameter development. Bacillus. Rhizobium.) Sri Widawati & Maman Rahmansyah Pusat Penelitian Biologi LIPI. Kata kunci: Jatropha curcas L. In the presence of inoculants. That selective inoculant has opportunity to be used for jatropha farming.

Bacillus.9% biomassa tanaman kacang akibat meningkatnya ketersediaan fosfor di tanah yang dapat diserap tumbuhan (Yousry et al 1978). Capaian hasil masih berpeluang ditingkatkan melalui pemupukan dengan memanfaatkan mikroba simbion maupun nonsimbion sebagai pelengkap komponen pada pupuk hayati (Elefan 2008). dan Bacillus megatherium terhadap tanaman Foeniculum vulgare Mill. Pusat koleksi mikroba Bidang Mikrobiologi Puslit Biologi LIPI menyimpan koleksi yang isolatnya diperoleh dari tanah yang berasal dari berbagai daerah di Pontianak. Rhizobium spp.6 metriks ton minyak jarak hasil produksi tanaman per hektar. 2002. Badran & Safwat 2004. Citrobacter. Pemberian inokulan Bacillus megatherium dapat meningkatkan 10. Pusat Penelitian Biologi LIPI.Widawati & Rahmansyah sebagai trigliserida berviskositas sedang. Kalimantan Barat. Nitrosomonas. sebagai isolat bakteri tanah dari beberapa daerah asal Pontianak. Perlakuan bakteri Azotobacter chroococcum. Tujuannya adalah untuk mendapatkan formula isolat terbaik untuk menunjang pertumbuhan jarak pagar. Chromobacterium. serapan hara. Inokulan bakteri Bacillus pumilus berpengaruh terhadap pertumbuhan bagian atas tanaman (shoot). 2006). Bakteri yang berhasil diisolasi adalah Azotobacter. Isolat tersebut digunakan untuk membuat inokulan dan diujikan kepada tanaman jarak pagar. Kandeel et al. 1995. yang diinokulasikan secara tunggal maupun gabungan mampu meningkatkan bobot biomassa dan kandungan minyak atsiri (Mahfouz & Sharaf-Eldin 2007). dan Spaerotillus natans. Lewis et al. dan efisiensi fotosintesa pada tanaman sehingga mampu meningkatkan produksi dan kualitas biomassa (Maheswari et al. Pembuatan pupuk hayati memerlukan ketersediaan isolat mikroba yang dapat direproduksi dan teruji atas fungsi metabolik yang dimilikinya. yang secara agronomi cukup menguntungkan baik terhadap segi ekonomi maupun lingkungan (Wani et al. Evaluasi efek pemberian inokulan ditelaah melalui produksi biomassa dan percepatan tumbuh tanaman yang ditumbuhkan secara terkontrol di dalam rumah kaca sampai umur 15 minggu setelah perkecambahan. 2006). ElGhadban et al. Bakteri Azotobacter chroococcum selain sebagai bakteri penambat nitrogen yang hidup bebas di tanah (free living microorganism) juga mampu menghasilkan fitohormon serupa asam giberelin dan indol asetat yang bisa meningkatkan pertumbuhan. Penyediaan benih dan isolat untuk bahan inokulan Biji jarak pagar dipilih yang ukurannya seragam untuk digunakan sebagai bibit. sedangkan inokulasi Bacillus polymyxa mempengaruhi pertumbuhan 108 akar jarak pagar sampai umur 42 hari setelah perkecambahan (Desai et al. Azospirillum liboferum. Bakteri diperoleh dari koleksi mikroba Bidang Mikrobiologi. 2007). 1991. atau setara dengan 1. Setiap jenis bakteri ditumbuhkan dalam 100 ml media cair di dalam botol yang telah disterilkan . BAHAN DAN CARA KERJA 1.

0.5 g Ca3PO4.05 g yeast ekstrak dan 0. 0. Media tadi mengandung: 1 g glukosa. Demikian pula cara yang dilakukan untuk mempersiapkan inokulan tunggal dari genus Azotobacter. perlakuan kompos sekam ayam (P-7). Pontianak. dan Bacillus spp. yang diisolasi dari tanah asal Rasau Jaya. masing-masing 3 ulangan) diisi dengan 3 kg tanah kebun (komposisi seperti pada Tabel 1). 1. Mandor.5 ml sediaan dari inokulan Azotobacter. Citrobacter. diinkubasi selama 7 hari. Karoho. Satu dari tiga kecambah yang terbaik pada setiap pot 109 .8x107 Nitrosomonas. Biji dikecambahkan dengan membenamkannya di dalam masing-masing pot sebanyak 3 biji.02 g KCl. Kontrol tersebut terdiri dari perlakuan kompos-plus-mikroba (P-6). atau sebagai inokulancampuran beberapa-genus (multi-genera). 3x10 7 Chromobacterium. dan P-17. 0. dan perlakuan P-9 sebagai media tanah kebun tanpa diberi penambahan inokulan maupun kompos. dan 2. Formula inokulan adalah perlakuan yang ditentukan dengan inokulan bakteri-satu-genus (monogenera). yang diisolasi dari tanah asal Rasau Jaya. kemudian dikondisikan pada pH 7. 0. perlakuan kompos tanpa mikroba (P-8).5x107 Citrobacter. 0. Mempersiapkan inokulan P-1 sebanyak 30 ml sebagai “inokulancampuran-beberapa-genus” adalah merupakan campuran beberapa B-I. dan Nitrosomonas spp. Setiap biji di dalam pot disiram dengan masing-masing 10 ml inokulan sesuai perlakuan. Populasi bakteri di dalam 100 ml inokulan cair masing-masing terhitung 4x10 7 Azotobacter:5x10 7 Bacillus. dan 4 macam perlakukan inokulansejenis maka digunakan kontrol pupuk hayati lainnya sebagai pembanding. dan setelah proses inkubasi kemudian dihitung populasinya dengan metode plate count.05 g (NH4)2SO4.2x107 Rhizobium. dan kemudian diformulasikan seperti pada Tabel 1. Penanaman jarak pagar dan pengamatan pertumbuhannya Sebanyak 51 pot plastik (untuk 13 macam perlakuan dan 4 macam kontrolnya. masing-masing sebanyak seperempatnya atau 7. Singkawang. 1.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan sebelumnya dengan autoklaf 121 OC selama 15 menit. Citrobacter.001 g MnSO4 H2O. 2.3x107 Spaerotillus natans sebagai BahanInokulan (B-I). Untuk mempersiapkan “inokulanbakteri-satu-genus” sebagai inokulan P2 adalah mencampurkan B-I dari Nitrosomonas spp. 0. digoyang pada kecepatan 150 rotasi per menit. Bacillus. dan Mempawah masing-masing sebanyak 5 ml sehingga jumlahnya mencapai 30 ml inokulan P-2. sebagai inokulan P-3. P16.01 g MgSO4 7H20. Sambas. 1.6H 2 O. Dalam mengevaluasi pengaruh inokulan-bakteri yang diformulasikan menjadi 9 perlakuaan inokulan-campuran. yang masing-masing diambilkan 10 ml dari BI. kemudian ditempatkan di dalam rumah kaca.001 g FeCl 3 . Demikian pula untuk penyiapan inokulan campuran yang lainnya yang dicampurkan masing-masing menurut jumlah dan asal tanahnya sehingga diperoleh 30 ml inokulan.

(isolat tanah Mandor) Azotobacter. Citrobacter. Bacillus. dan Nitrosomonas spp.Widawati & Rahmansyah Tabel 1. Citrobacter. Nitrosomonas. Bacillus. Citrobacter. (isolat tanah Karoho) Azotobacter. Azotobacter sp. dan Nitrosomonas spp. dan Nitrosomonas spp. Nitrosomonas spp. Bacillus. Bacillus. Bacillus. Chromobacterium. Bacillus.. Citrobacter. dan Nitrosomonas spp. (isolat tanah Rasau Jaya) Nitrosomonas sp. (isolat tanah Sambas) Azotobacter. Rhizobium sp (isolat tanah Ketapang) Azotobacter. dan Spaerotillus natans (isolat tanah Mempawah) Azotobacter. dan Nitrosomonas spp. Inokulan bakteri sejenis dan banyak jenis yang diinokulasikan ke media tumbuh jarak pagar. Bacillus. Bacillus sp. Citrobacter. kontrol – 1 (tanpa inokulan) kontrol – 2 (tanpa inokulan) kontrol – 3 (tanpa inokulan) kontrol – 4 (tanpa inokulan) Azotobacter. Bacillus. beserta kontrolnya. (isolat tanah Singkawang) Citrobacter sp. (isolat tanah Pantai Singkawang) Azotobacter. dan Nitrosomonas spp. Komposisi Media tumbuh jarak pagar (3 kg) 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan banyak jenis Tanah & Kompos Plus (3:1) Tanah & Sekam Ayam (3 : 1) Tanah & Kompos (3 : 1) 3 kg tanah 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan banyak jenis 3 kg tanah & 30 ml inokulan satu jenis 3 kg tanah & 30 ml inokulan satu jenis Keterangan P-1 P-2 P-3 P-4 P-5 P-6 P-7 P-8 P-9 P-10 P-11 P-I P-D P-E P-F - Perlakuan-1 Perlakuan-2 Perlakuan-I Perlakuan-3 Perlakuan-4 Perlakuan-5 Perlakuan-6 Perlakuan-7/ Perlakuan-D Perlakuan-8/ Perlakuan-E Perlakuan-9/ Perlakuan-F Perlakuan-10 Perlakuan-11 P-12 P-13 P-14 P-A P-B Perlakuan-12 Perlakuan-13/ Perlakuan-A Perlakuan-14/ Perlakuan-B Perlakuan-15/ Perlakuan-C Perlakuan-16/ Perlakuan-G Perlakuan-17/ Perlakuan-H P-15 P-16 P-17 P-C P-G P-H 110 . Citrobacter. Notasi “Kode Perlakuan” pada tabel ini melengkapi keterangan Gambar 2 (P-1 sampai P-17) Kode Perlakuan Bakteri yang digunakan untuk bahan inokulan dan asal isolatnya Azotobacter. dan Rhizobium spp.

Perlakuan P-1 sebagai inoulan campuran 4 jenis bakteri lebih menstimulasi pertambahan diameter batang. Panjang batang dan diameternya digunakan sebagai parameter pertumbuhan jarak pagar sampai 14 mst (foto kiri). P-12. 11. P-6. P16. P16. Pertumbuhan awal jarak pagar yang terbaik sampai umur tanaman 15 mst 90 80 70 60 50 40 30 24 22 20 18 16 14 12 1 5 13 17 9 10 LCL = 13. P-10. dan 14 mst (Gambar 1).804 UCL = 79.305 1 5 13 17 9 UCL = 22. Pengamatan bobot biomassa dilakukan pada tanaman berumur 15 mst.627 Tinggi tanaman (cm) LCL = 51. sedangkan pada inokulan banyak jenis terjadi pada perlakuan P12. Efek perlakuan terjadi sebaliknya karena perlakuan P-2 yang menghasilkan pertumbuhan tinggi tanaman menjadi lebih cepat dibanding diameternya. Percepatan pertumbuhan tinggi tanaman pada perlakuan P-2 terjadi karena adanya rangsangan faktor tumbuh.377 Center = 17. dan P-17 untuk perlakuan inokulan satu jenis. P-12. dan P-17. 8.231 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 Diameter (mm) Gambar 1. Keseimbangan pertumbuhan tinggi dan diameter terjadi pada perlakuan P-3. P-7. Data pada tabel dan gambar adalah nilai rata-rata 3 ulangan dan dianalisis dengan StatView SAS Version 5. yang umumnya berukuran di atas nilai tengah (center). P-14. sementara dua kecambah lainnya dipangkas pada umur 3 minggu setelah tanam (mst).0. dan P-17.1. Tanaman yang tidak diberi inokulan pada no. P13. P3. P-13. HASIL Pertumbuhan Tanaman Pertumbuhan tinggi tanaman terjadi secara cepat (Gambar 2) pada jarak pagar yang mendapat perlakuan P-2. 2. Pemekaran diameter batang yang terjadi di atas ratarata terjadi pada tanaman yang mendapat perlakuan P-1. P-14. 1.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan dibiarkan tumbuh. dan P-15. Pengamatan tinggi dan diameter batang dilakukan pada tanaman berumur 5. P-4. P-15. P-13. yang pada media tumbuhnya terdapat bakteri Nitrosomonas sp. P-2. sedangkan pertumbuhan ke arah panjang batang menjadi kurang berhasil.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Center = 65. dan 3 terbelakang pertumbuhannya dibanding dengan tanaman yang medianya mendapat inokulan bakteri seperti pada tanaman no 4 dan 5 (foto kanan) 111 . P-15. P-16.

PEMBAHASAN Memperhatikan telaahan Ranjard dan Richaume (2001). atau bahan organik lainnya. Perlakuan P-D sebagai media yang mengandung bahan organik dari kompos sekam ayam menghasilkan pertumbuhan yang berefek sama seperti karena perlakuan inokulan bakteri sejenis 112 maupun banyak jenis. Percepatan tumbuh masih meningkat antara 8 sampai 11 mst karena perlakuan P-G sebagai akibat perlakuan inokulan sejenis Citrobacter sp. baik akibat perlakuan inokulan bakteri sejenis maupun banyak jenis. akibatnya dapat memperbaiki serapan air. Sekalipun pada hasil yang lain. namun kemudian menurun pada pertumbuhan 11 sampai 14 mst (Gambar 4). kompos. sehingga menghasilkan pertumbuhan yang optimal kepada tanaman jarak pagar. Penggunaan ketiga formula inokulan tersebut menjadikan bobot biomassa tanaman berbeda sangat nyata sampai empat kali lebih besar dari kontrolnya (P9) yang tumbuh di tanah tanpa pemberian inokulan. Pertumbuhan tercepat terjadi ketika tanaman berumur antara 5 sampai 8 mst. inokulan sejenis juga ada yang mampu mengakumulasi biomassa yang tinggi seperti karena penggunaan inokulan Citrobacter spp. atau terjadinya penambahan biomasa secara signifikan karena perlakuan pupuk hayati. dan P-C (Tabel 2).. apabila memperoleh tambahan bahan organik dan ketersediaan nitrogen yang cukup seperti yang terkandung pada kompos sekam ayam. dan memperlancar serapan hara oleh tanaman (Ogunwole et al. P-B. Penggunaan inokulan banyak jenis berpengaruh lebih dominan bila dibandingkan dengan inokulan sejenis. yang menyatakan bahwa persebaran bakteri pada lapisan kompartemen tanah secara kualitas dan kuantitas dipengaruhi oleh keragaman .Widawati & Rahmansyah akibat pemberian pupuk hayati terjadi karena P-10. Jarak pagar sebagai tanaman yang secara alami sintas di lahan marginal. sedangkan akibat inokulan bakteri sejenis terjadi pada perlakuan P-G. Hasil akumulasi biomassa tertinggi akibat perlakuan inokulan banyak jenis terjadi pada perlakuan P-A. Percepatan tumbuh semakin menurun pada pertumbuhan 11 sampai 14 mst. dan P-I (Gambar 3). Efek percepatan tumbuh pada diameter batang tidak menghasilkan angka yang signifikan untuk dapat diperbandingkan. dan Bacillus spp. memperkecil erosi. memperbaiki struktur akar. yang diasumsikan bahwa penyusutan kadar air bernilai sebanding pada masingmasing perlakuan. dan P-F sebagai kontrolnya. Nilai bobot biomassa segar terhadap bobot biomassa kering mendapatkan angka korelasi yang signifikan (r = 0. P-H. P-A. Penggunaan inokulan banyak jenis membuka peluang terjadinya sinergi di antara jenis. bahkan hampir terhenti pertumbuhannya pada tanaman kontrol yang tumbuh pada media tanah tanpa pemberian bahan organik atau kompos.95). 2008) Percepatan tumbuh tanaman (cm/ hari) akibat pemberian inokulan berbeda nyata terhadap kontrolnya. dan PC bila dibandingkan terhadap P-E.

Nilai yang relatif baik terletak di antara “batas kontrol nilai tertinggi (upper control limit = UCL)” dan di atas nilai rata-rata.737 40 14 12 10 1 5 13 17 9 30 17 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 90 80 70 Center = 65. Tinggi dan diameter tanaman yang bernilai di atas rata-rata (center) adalah gambaran pertumbuhan yang pesat.804 LCL = 13.52 Center = 15.295 24 8 Center = 7. Data dianalisis dengan menggunakan StatView SAS berdasar “base sigma on subgroup SDs” 13 5 113 .745 30 1 10 11 12 13 14 15 16 17 2 3 4 5 6 7 8 9 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Diameter Tinggi UCL = 73.529 12 11 10 9 13 1 5 17 9 9 9 8 (cm) tanaman 40 35 LCL = 32.377 (mm) tanam an Center = 44.774 UCL = 22.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan UCL = 33.314 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 15 14 13 17 9 UCL = 14.627 60 50 40 30 LCL = 51.66 LCL = 19.103 32 10 UCL = 9.486 5 4 13 17 1 5 9 16 13 1 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 60 55 50 45 UCL = 56.637 7 6 20 LCL = 5.305 UCL = 79. Nilai untuk perlakuan P-8 dan P-9 (kontrol) berada di bawah “batas kontrol nilai terendah (lower control limit = LCL)”.615 9 28 Center = 26. Pengaruh perlakuan terhadap tinggi (gambar kiri) dan diameter (gambar kanan) yang diamati pada tanaman umur 5.931 50 LCL = 46.231 Center = 17. 11. dan 14 mst.93 UCL = 19.647 LCL = 11. 8.95 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 24 22 20 18 16 14 12 1 13 17 5 10 1 5 13 17 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Per l ak u a n Per l ak u a n Gambar 2.344 Center = 11.637 LCL = 8.126 70 20 18 16 60 Center = 59.

dan Nitrosomonas spp.kontrol 3 (tanpa inokulan) . Bacillus. dan Rhizobium spp Azotobacter. dan Nitrosomonas spp Azotobacter. dan Nitrosomonas spp Azotobacter. Citrobacter. dan Nitrosomonas spp Azotobacter. Nitrosomonas. Perbedaan bobot segar tanaman jarak pagar umur 15 mst akibat perlakuan inokulan bakteri satu jenis dan bakteri banyak jenis dibandingkan dengan kontrolnya Kode Perlakuan Bakteri bahan inokulan Inokulan sejenis P-2 P-3 P-4 P-16 P-17 P-I P-G P-H Nitrosomonas sp Azotobacter sp Rhizobium sp Citrobacter sp Bacillus sp 152 258 84 172 244 Inokulan banyak jenis P-1 P-5 P-10 P-11 Azotobacter. dan Nitrosomonas spp Kontrol P-6 P-7 P-8 P-9 P-D P-E P-F . Bacillus. Chromobacterium. Citrobacter. Bacillus. dan Nitrosomonas spp. Bacillus. Azotobacter. Citrobacter.Widawati & Rahmansyah Tabel 2.kontrol 1 (tanpa inokulan) .kontrol 2 (tanpa inokulan) . Bacillus. Azotobacter. Citrobacter. Citrobacter. Citrobacter. Bacillus. Nitrosomonas spp. dan Spaerotillus natans Azotobacter.kontrol 4 (tanpa inokulan) 162 210 102 86 180 172 64 60 200 194 88 60 181 192 85 57 BCDEFGHIJ ABCDEFG LK L 208 76 184 84 170 74 310 200 187 78 249 143 ABCDEFGH LK A DEFGHIJKL 180 124 144 212 224 218 162 200 238 178 183 181 143 207 215 ABCDEFGHI BCDEFGHIJ DEFGHIJKL ABCDEF ABCDE Bobot segar (g) I II III Rataan (LSD 5%) 108 328 200 30 P-12 - 190 188 300 226 ABCD P-13 P-A 272 194 274 247 AB P-14 P-B 146 125 196 156 CDEFGHIJK P-15 P-C 206 234 282 241 ABC 114 . Bacillus. Bacillus.

8. Sokongan inokulan bakteri Bacillus pumilus dan Bacillus polymyxa yang diteliti oleh Desai et al. Kecepatan tumbuh batang hasil pengamatan 5.Pengaruh Inokulasi Bakteri TerhadapPertumbuhan 300 250 200 150 Bobot Basah y = 1. dan pada sisi parameter lainnya menunjukkan korelasi yang signifikan antara bobot basah terhadap bobot kering 1.904 Gambar 3.60 0. Oleh karena itu bakteri yang diintroduksi melalui inokulan dapat menempati kompartemen menurut fungsi ekologis masing-masing jenis bakteri sehingga tidak bergantung kepada banyak jenis.00 0. R^2 = .20 0.80 0.00 0. serta ada hubungan preferensi dari bakteri terhadap lingkungan edapiknya.60 0.722 * X.00 E F E F 5 mst 8 mst 11 mst 14 mst 5 mst 8 mst 11 mst 14 mst Gambar 4. (2007) terhadap tanaman jarak pagar memperlihatkan fungsi yang efektif dari masing-masing inokulan bakteri terhadap pertumbuhan hijauan dan perakaran tanaman.40 0. yang masing-masing dibandingkan terhadap tanaman pada media tanah tanpa diinokulasi namun diberi kompos (P-E).7 x + 23. namun masih sebanding dengan perlakuan P-D (kontrol dengan kompos plus).40 0. Pengaruh perlakuan terhadap biomassa tanaman (1 dan 2) menghasilkan bobot yang berbeda nyata dari kontrolnya (P-E dan P–F). fraksi atau serpih tanah. namun lebih kepada dominasi kompatibilitas dalam mendukung pertumbuhan jarak pagar.80 A C G H 0.20 Kecepatan tumbuh (cm/hari) Kecepatan tumbuh (cm/hari) 1. dan 14 mst pada tanaman yang diberi inokulan satu jenis (P-G dan P-H) dan inokulan banyak jenis (P-A dan PC).7 100 50 0 0 30 60 90 120 Bobot Kering 150 180 r2 = 0.904 Y = 23. atau tanpa kompos (P-F). 11.20 0. 115 .00 1.649 + 1.20 1.

Safwat. Rep. Venkateswarlu. luas daun. & MS. bobot akar. Egyptian J. Bakteri Bacillus spp yang diujikan oleh Desai et al. dan Shrivastava & Banerjee (2008) berhasil memperbanyak dengan sistem klonal secara in-vitro dalam memperoleh perbanyakan bibit. GR.: an important biodiesel plant. 2008. Penelaahan efektifitas inokulan pupuk hayati lebih lanjut pada kondisi lahan marginal dapat memperkaya referensi karakter bakteri yang kompatibel dengan jarak pagar karena tanaman tersebut dikenal sebagai tanaman yang sintas tumbuh di lahan marginal. menjadi koleksi referensi yang telah diketahui manfaatnya untuk pembuatan pupuk hayati. Agric. improves seedling . Penambahan variasi bahan organik kitin terhadap inokulan dalam penggunaannya sebagai pupuk hayati memberikan efek lebih baik terhadap biomassa tumbuhan. Res. 2:7–11 Desai. apabila dibandingkan dengan kontrolnya yang tidak mendapatkan pasokan inokulan bakteri. karena terbukti berhasil mendukung pertumbuhan awal jarak pagar. Gnanamanickam. Teknik pemeliharaan terhadap koleksi kultur bakteri menjadi langkah lanjut dalam mempertahankan karakter agar sifat dan fungsi yang telah diperoleh menjadi karakter kunci tersebut tidak mengalami perubahan selama penyimpanan. (2007) sebagai inkulan terhadap media tumbuh jarak pagar berefek nyata terhadap panjang tanaman. AC.Widawati & Rahmansyah Deore & Johnson (2008) berhasil memperbanyak tanaman jarak pagar dengan cara kultur jaringan daun.. M. S. yang diisolasi dari tanah asal.. Narayanaiah. Rao & B. Reddy. 82(2): 247256. Deore. Isolat bakteri yang diperoleh dari tanah asal Pontianak. dan perlakuan P-10 selaku inokulan banyak jenis (Azotobacter. Seed inoculation with Bacillus spp. Johnson. Ch Kumari. dan Nitrosomonas spp. Untuk menunjang produktivitas tanaman secara optimal pada skala besar perlu dipolakan efisiensi pemupukan sebagai perpaduan pupuk hayati dan pupuk kimia secara terkontrol. Ch. yang mana keberhasilannya terjadi seperti pada pengujian ini. biomassa. 2004. Plant Biotech. Namun untuk menunjang pertumbuhan bibit selanjutnya tetap memerlukan bantuan penambahan pupuk hayati. Efek perlakuan P-17 (=P-H) hasil inokulan sejenis (Bacillus sp). & TS. dan klorofil daun bila dibandingkan terhadap kontrolnya. 116 KESIMPULAN DAN SARAN Penambahan inokulan bakteri pada media tumbuh berpengaruh kuat terhadap pertumbuhan dan biomassa tanaman jarak pagar sampai umur 14-15 mst. S. Response of fennel plants to organic manure and bio-fertilizers in replacement of chemical fertilization. Kalimantan Barat. FS. Bacillus. Perlu adanya pengamatan berlanjut tentang efek inokulan terseleksi. DAFTAR PUSTAKA Badran. Highfrequency plant regeneration from leaf-disc cultures of Jatropha curcas L. 2007.

World Appl.).Pengaruh Inokulasi Bakteri TerhadapPertumbuhan vigour in oil-seed plant Jatropha curcas L. Agric. Sadek.) cv. Improve livelihoods and environmental protection through biodiesel plantation in Asia. SAT. DR. Int. Mangkoedihardjo. 39: 27-32. OM. Effect of mineral vs. 2007. Kandeel. AL. Int. ES. & MA. Sharaf-Eldin. Mahfouz. 4(4): 519-522. Banerjee. S. Environmental Technology & Management. Osman. 2008. 152: 707–716. Sci. Maheshwari. Scien. Res. SK. JO. 2001. SA. Soc. 84(3): 977-992. biofertilizer on growth. 21: 361-366. Agric. Indian Perfume. 308-312. plant. Jatropha curcas L. 2006. Effect of time and method of Azotobacter chroococcum application on the cultivation of garlic (Allium sativum L. Trivedi. Lewis. Ogunwole. 3(1):7378. Richaume. & A. Ain Shams Univ. Soils. Manganese availability in a calcareous soil as a result of phosphate fertilization and inoculation with phosphobacterin. Chaudhary... Yousry. Ghosh. 47(1): 351–371. Dominguez & OS. 1978.Inte. LO. M. International Conference on Environmental Research and Technology (ICERT). volatile oil yield and constituents of fennel (Foeniculum vulgare Mill. 44 (1): 229-234. Tropical Hort. Vietnamita.Biol.J. Res. L. Asian Biotechnology and Development Review. Chikara. 1991. Saber. Biofertilizers for Jatropha curcas L (Euphorbiaceae) grown in different planting media.. Daudu. Plant Soil Sci. A. volatile oil yield and chemical composition of Ocimum basilicum L. Effect of biofertilizers on the growth. J. Microbiol. Naglaa & AA. Patolia. Quantitative and qualitative microscale distribution of bacteria in soil. 8(2):11-29. 35(2): 308-311. CK.. JS.. Kabesh & MS. African J. Influence of biofertilizers on growth. El-Ghadban. Agrophysics.). Shalan & TAT. 2008. Int. Memasukkan: April 2009 Diterima: September 2009 117 . S. AM. Am. Annals Agric. MN. 58(3): 245 – 251. Wani.. & M. Sci. for phytoremediation of lead and cadmium polluted soil.. Shrivastava. Munoz. yield. 2002. 2008. Elefan. Comparative response of palmarosa to Azotobacter and nitrogen under rainfall and irrigated swards. Sreedevi. Gangrade & KC. Egyptian J. SP. D’Silva & TK. and essential oil content of fennel (Foeniculum vulgare Mill.. 2008. SK. Contribution of Jatropha curcas to soil quality improvement in a degraded Indian entisol. J. 1995. & Surahmaida. EAE.. 2006. Biol. Fert. In vitro clonal propagation of physic nut (Jatropha curcas L. 5(2): 75-80.): influence of additives. E. M. Abdel-Latif. Ranjard. Cairo.

oblate type for the male of C. and perferesence. Email: apkartono@yahoo. Bats have important role on seed dispersal and or plant pollinator. while the female in disk type. The identification of flower and their pollens as the feed resource for bats was conducted in Bogor Botanical Gargen. perkotaan PENDAHULUAN Kelelawar masih menjadi salah satu satwa yang masih jauh dari perhatian upaya konservasi. Email: srisoegiharto@gmail. The resultsof this study showed that Eonycteris spelaea male has interests in with personatus corola type flower. 119 . minutus. The campanulatus and papilionaceus types has a potential to be visitd by Cynopterus minutus male and female of C. sedangkan pada lapisan terluar dinding polen (exin) mengandung lemak netral. tubulosus. sphinx. C. identifikasi. while the female of C. The male of C. Furthermore the male of Macroglossus sobrinus has interested in rotatus. titthaheileus and female of Macroglossus sobrinus has interests in gigantic type (>200 ì m). sphinx. pollen. oblate spheroidal for the female of Rousettus amplexicaudatus and male of C.Jurnal Biologi Indonesia 6 (1): 119-130 (2009) Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto1) & Agus P. pollen identification. amplexicaudatus like permagnae type (100-200 ì m). Key words: Fruit bats. Kartono2) 1 Peneliti Balai Besar Dipterocarpa Samarinda.com 2 Staf Pengajar Mayor KVT IPB Bogor. sphinx. titthaheileus and C. polen dan nektar (Suyanto 2001).id ABSTRACT Food TypeCharacteristic of the Fruit Bats at Urban Area: A Case Study in Bogor Botanical Garden. Where as the female has interest in campanulatus type. Dalam upaya konservasi kelelawar terlebih dulu yang harus diketahui adalah jenis makanan apa yang disukai kelelawar. sehingga perlu upaya analisis karakteristik jenis pakan yang disukai. Kelelawar kelompok Megachiroptera mengkonsumsi buah. Alasan tersebut dikarenakan lemahnya pengetahuan masyarakat akan arti penting kelelawar dalam rangkaian mata rantai ekologi. prolate pollen type has importance for the male of Eonycteris spelaea. brachyotis and C. brachyotis. corola types. brachyotis and R. titthaheileus. urban area Kata kunci: Kelelawar buah. C. Serat polen mengandung protein lebih dari 60%. Urceolatus type has important for female of C. The male of Macroglossus sobrinus and female of Eonycteris spelaea has interests to visit the flower with suboblate and prolate spheroidal pollen types. West Jawa. Kesukaan kelelawar dalam memilih makanannya belum diketahui pasti secara ilmiah.co.

Dari uraian tersebut maka perlu melakukan penelitian ini dengan beberapa tujuan. untuk tiap bulannya dilakukan dengan selang waktu 2 minggu sekali. Setelah tujuan diatas tercapai diharapkan dapat memberikan manfaat antara lain: 1) mengetahui karakteristik jenis tumbuhan pakan kelelawar dalam upaya mendukung konservasi di daerah perkotaan. titthaheileus. dan sering terdapat karbohidrat lengkap sporo-pollenin. Polen yang ditemukan di dalam perut kemudian diidentifikasi sampai tingkat famili dan genus menurut kunci determinasi Erdmant (1952). Nayar (1999) dan Paldat (2005). Macroglossus sobrinus. 2) memberikan informasi kepada masya-rakat akan perlunya upaya konservasi terhadap jenis-jenis kelelawar di daerah perkotaan. C. Peng-gunaan gliserol pada analisis ini diperuntukkan sebagai bahan pengawet (Yulianto 1992). Rousettus amplexicaudatus dan Eonycteris spelaea. BAHAN DAN CARA KERJA Penelitian dilakukan di Kebun Raya Bogor (KRB) selama 16 bulan. Spesies kelelawar yang berhasil diidentikasi ada di Kebun Raya Bogor adalah Cynopterus minutus. Untuk penempatan misnet (jaring kabut) ditempatkan menggunakan teknik purposive sampling sedangkan pengambilan sampel kelelawar menggunakan teknik random sampling. Endapan yang dihasilkan dari proses sentrifuse diletakkan di gelas objek sebanyak satu tetes kemudian ditetesi dengan gliserol dan ditutup dengan cover glass dan pada bagian tepinya direkatkan menggunakan kuteks kuku. pigmen carotenoid.Soegiharto & Kartono hidrokarbon. C.00 – 08. terpenoid.00 WIB dan pagi hari pada pukul 06. Pengambilan sampel kelelawar dilakukan di KRB setiap dua minggu sekali sebanyak 2 ekor setiap spesies tertangkap di 13 lokasi penangkapan. sphinx. pengulangan dilakukan sebanyak tiga kali. Hasil dari isi pencernaan kemudian dicampur kedalam alkohol 70% dan dimasukkan ke dalam tabung reaksi dan dilakukan setrifuse dengan putaran 2000 rpm selama 30 menit. 2) menentukan pengaruh faktor tumbuhan pakan (tipe mahkota bunga. Lapisan dinding dalam polen (intin) terdiri atas selulosa dan pektin serta nutrisi cytoplasmic.00 WIB dilakukan pengecekan jaring kabut dan pengam120 bilan kelelawar. . langkah selanjutnya dilakukan pembuangan cairan alkohol yang digunakan dan diganti dengan alkohol yang baru. Jumlah sampel kelelawar yang diambil tiap 2 minggu sekali berjumlah 1-2 ekor untuk tiap masing-masing jenis kelelawar. yaitu 1) mengidenti-fikasi jenisjenis tumbuhan pakan yang dimakan kelelawar. tipe polen dan ukuran polen) dalam pemilihan jenis tumbuhan pakan kelelawar. Pengambilan sampel polen didapat dari isi pencernaan kelelawar. C. mulai Maret 2008 hingga Juni 2009.00-18. Pengambilan kelelawar dipilih untuk tiap jenis yang mewakili spesiesnya masing-masing jantan dan betina. Jaring kabut yang dipasang pada waktu senja hari pada pukul 17. brachyotis. Pengambilan sampel kelelawar dilakukan selama kurun waktu 12 bulan.

Matriks data tersebut terdiri atas jenis kelelawar sebagai spesies. 121 . besar/ magnae (50–100ì m). kedok. sedangkan betinanya dipengaruhi oleh bentuk mahkota lonceng. titthaheileus betina dan jantan. HASIL Hasil analisis polen ditemukan jumlah persentase polen masing-masing spesies kelelawar. Untuk ukuran polen terbagi menurut Erdtman (1943) yaitu sangat kecil/ perminute (<10ì m). axis 2 = 0. axis 3 = 0. dan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 1b. kecil/minute (10– 25ì m). kupu. tipe polen dan ukuran polen. brachyotis betina. dan bulir.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Data yang dihasilkan kemudian ditranformasi sesuai dengan sebaran data. Hasil analisis hCCA dari karakteristik mahkota bunga disajikan pada Gambar 1 menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik mahkota bunga adalah untuk axis 1 = 0. yaitu (1) persentase pakan kelelawar dengan jenis mahkota bunga disajikan pada Tabel 1. disk. oblate. serta C. C. sphinx betina.466 dengan eigenvalue = 0.241 dengan eigenvalue = 0. sedangkan betinanya dipengaruhi kuat oleh bentuk disk. suboblate.5 (Leps & Smilauer 1999). Penentuan pengaruh karakteristik jenis tumbuhan pakan yang akan dianalisis dengan menggunakan pendekatan analisis multivariate hiper Canonical Corespondence Analysis (hCCA) menurut ter Braak & Smilauer (1998). Pada penelitian ini data yang dihasilkan dalam bentuk persentase. tipe dan ukuran polen dengan hCCA menggunakan software Canoco for Windows 4. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 1a. (2) persentase pakan kelelawar dengan tipe polen disajikan pada Tabel 2. Pada gambar 1b untuk hubungan axis 1 dan axis 3 menerangkan lebih lanjut bahwa bentuk mahkota bunga lonceng dan kupu-kupu mempengaruhi kuat pada Cynopterus minutus jantan. lonceng.753. prolate dan perprolate. sangat besar/ permagnae (100–200ì m). (3) persentase pakan kelelawar dengan ukuran polen disajikan pada Tabel 3. Tipe polen terbagi ke dalam 7 tipe yaitu peroblate. oblate spheroidal. Penggunaan metode hCCA ini bertujuan untuk menentukan hubungan dalam bentuk grafik serta mengungkap informasi maksimum dari suatu matriks data dengan faktor lingkungan secara bersamaan. Analisis pengaruh karakteristik bentuk bunga. sehingga bentuk transformasi yang digunakan adalah transformasi arcsin (Syahid 2009).116 dengan eigenvalue = 0. sedang/mediae (25–50ì m). bintang. jenis tumbuhan yang teridentifikasi sebagai sampel dan 3 parameter lingkungan yaitu tipe mahkota bunga. Untuk bentuk mahkota lebih kuat mempengaruhi C.187. Spesies Macroglossus sobrinus jantan dipengaruhi oleh bentuk mahkota bintang. prolate spheroidal. tabung dan bulat. mangkuk. Bentuk mahkota bunga terbagi kedalam 8 tipe. Penyajian data dilakukan dalam 3 bentuk.390. yaitu tabung. dan raksasa/giganteae (>200 ì m). Spesies Eonycteris spelaea jantan dipengaruhi kuat oleh bentuk mahkota bunga kedok.

menjelaskan bahwa Rousettus amplexicaudatus betina dan C.28 14. CT = C. dengan eigenvalue = 0.26 7.598.61 19.39 48. DI_S= Disk. BI_T= Bintang.44 50.24 12.08 29.88 52.95 44.99 Keterangan : CM = Cynopterus minutus . CB = C.74 57.Soegiharto & Kartono Hasil analisis hCCA dari karakteristik tipe polen tersaji pada Gambar 2. Spesies Eonycteris spelaea jantan dipengaruhi oleh bentuk polen prolate. E = Eonycteris spelaea. sedangkan hubungan antara axis 1 dan axis 3 disajikan pada Gambar 2b. C. dengan eigenvalue = 0..427.95 18. Spesies C.48 12.47 30. amplexi- Persentase polen yang dimakan oleh kelelawar berdasarkan bentuk mahkota bunga Mahkota Bunga Sex ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ TA_B BI_T DI_S KU_P LO_C MA_K KE_D BU_L 1. Tabel 1.886. sedangkan spesies C. TA_B= Tabung.08 11.11 68.26 9.23 43.06 18.356. sphinx betina.55 9. C. brachyotis. M = Macroglossus sobrinus. Hubungan antara axis 1 dan axis 2 disajikan pada Gambar 2a.091 dengan eigenvalue = 0.40 21.39 42. KE_D= Kedok.97 100 100 85.7 27. Jenis Kelelawar CM CB CS CT M R E brachyotis jantan dan C. dengan eigenvalue = 0. menunjukkan hubungan yang bisa diterangkan antara spesies dengan karakteristik tipe polen adalah untuk axis 1 = 0.66 25. axis 2 = 0. titthaheileus jantan dan Macroglossus sobrinus betina dipengaruhi oleh ukuran polen giganteae. minutus jantan.53 9. brachyotis betina dan R.86 4. CS = C.58 42. Hubungan yang bisa diterangkan antara spesies dengan karakteristik ukuran polen adalah untuk axis 1 = 0.047 dengan eigenvalue = 0. titthaheileus jantan dipengaruhi kuat oleh bentuk polen oblate.4 11. Spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina dipengaruhi kuat oleh bentuk polen suboblate dan prolate spheroidal. sphinx. 122 . Untuk jenis C. Hasil analisis hCCA dari karakteristik ukuran polen tersaji pada Gambar 3. axis 3 = 0.05 2. R = Rousettus amplexicaudatus.84 41. BU_L= Bulir. p = jumlah persentase.194.462. titthaheileus. KU_P= Kupu-kupu.54 7.588.77 68.15 4.74 61. MA_K= Mangkuk.97 11.285. sphinx jantan dipengaruhi oleh bentuk oblate spheroidal.09 7. LO_C= Lonceng. Pada Gambar 2b.03 9.18 33. axis 2 = 0.1 14.03 7.

08 41.85 5.57 Mediae p Menute p Permenute p ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 14.83 61.31 14. Jenis Kelelawar CM CB CS CT M R E Ukuran Polen Sex Gigantea p 40.24 35. CB = C. Tabel 3.74 61. CS = C. CB = C.65 3.28 74.01 57. titthaheileus.21 100 5.67 29. M = Macroglossus sobrinus. brachyotis.78 20.2 64.17 23.94 11.59 42. p = jumlah persentase 123 .Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar Tabel 2.92 37.72 14.65 7. E = Eonycteris spelaea.72 14. brachyotis.47 18. CT = C.97 Keterangan : CM = Cynopterus minutus. sphinx.4 Keterangan : CM = Cynopterus minutus.01 14.61 4.42 6.95 42.87 7.13 Magnae p 15.56 100 100 100 92.48 13.45 35.13 12.5 41.77 46. M = Macroglossus sobrinus. E = Eonycteris spelaea.9 85.52 7.69 10. titthaheileus.04 Permagnae p 43.2 85. R = Rousettus amplexicaudatus. CT = C.86 6. Persentase ukuran polen yang ditemukan pada masing-masing jenis kelelawar. p = jumlah persentase.34 42.71 44.03 100 1.23 43.66 56. Jenis Kelelawar CM CB CS CT M R E Persentase tipe polen yang ditemukan pada masing-masing jenis kelelawar.95 39.58 53.23 15. Tipe Polen Sex Peroblate p Oblate p SubOblate p Oblate Spheroidal p Prolate Spheroidal p Prolate p PerProlate P ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ 36. sphinx.29 52.97 34. R = Rousettus amplexicaudatus.16 35.26 76.48 7.93 64.04 25.52 86.8 14.92 44.69 39.13 11. CS = C.

Keterangan : 1. titthaheileus jantan. -0.4 b. MA_K= Mangkuk. 9= Macroglossus sobrinus jantan. brachyotis betina. 13= Eonycteris spelaea betina. titthaheileus betina. BU_L=Bulat. DI_S= Disk.4 Axis 1 1.6 BI_T 9 TA_B 12 KE_D Axis 2 BU_L 13 DI_S -0. KU_P= Kupu-kupu. 5= C. Grafik pengaruh karakteristik mahkota bunga a) hubungan axis 1 dan axis 2. brachyotis jantan.0 Gambar 1. 124 .4 2 3 6 5 MA_K 4 10 LO_C 7 8 11 1 KU_P a. LO_C= Lonceng. 4= C. 7= C.Soegiharto & Kartono 0. BI_T= Bintang.0 0. = Cynopterus minutus jantan. 2 = C. 10= Macroglossus sobrinus betina. KE_D= Kedok. b) hubungan axis 1 dan axis 3. sphinx betina. 11= Rousettus amplexicaudatus betina.4 Axis 1 1. 3= C. minutus betina. DI_S -0. 8=C. sphinx jantan. 6= C. TA_B= Tabung.8 BU_L 11 Axis 3 BI_T 5 LO_C 6 KU_P 10 7 4 8 MA_K 1 9 TA_B 2 13 3 KE_D 12 -0.. 12= Eonycteris spelaea jantan.

PE_PR= Perprolate. 3= C. PR_SP= Prolate Speroidal. b) hubungan axis 1 dan axis 3. titthaheileus jantan. 13= Eonycteris spelaea betina.6 1. a) hubungan axis 1 dan axis 2. SB_OB= Sub Oblate. 6= C.4= C. sphinx betina.0 0. 9= Macroglossus sobrinus jantan. brachyotis jantan.6 Axis 1 PR_SP 1.6 10 9 PR_SP PR SB_OB 13 PE_PR PE_OB 2 3 OB 7 1 12 6 8 4 OB_SP Axis 2 5 -0. 11= Rousettus amplexicaudatus betina. 11 -0. Keterangan : 1. PE_OB= Peroblate.8 a. 8=C. bracyotis betina. OB -0. sphinx jantan. PR= Prolate.. 7= C. 125 . minutus betina.0 Axis 1 . Gambar 2. OB_SP= Oblate spheroidal. 2 = C.8 7 11 9 SB_OB PE_PR 2 1 PE_OB 8 3 6 12 4 PR 10 OB_SP 5 Axis 3 13 -0.8 b. = Cynopterus minutus jantan. Grafik analisis hCCA jenis kelelawar berdasarkan tipe polen. 10= Macroglossus sobrinus betina. 12= Eonycteris spelaea jantan. 5= C. titthaheileus betina.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar 0. OB= Oblate.

Keterangan : 1. 4= C. 5= C. Grafik analisis hCCA jenis kelelawar berdasarkan ukuran polen. mata kelelawar yang buta warna dan indera penciumannya yang tajam berpengaruh pada bunga yang dipilih. (2003) karakteristik kelelawar dalam mencari makan pada malam hari. = Cynopterus minutus jantan. 2 = C.0 Axis 1 Gambar 3.2 kebutuhan pakan yang tinggi. Menurut Graham et al. 13= Eonycteris spelaea betina. tingkat 1. 10= Macroglossus sobrinus betina. 12= Eonycteris spelaea jantan. minutus betina. 9= Macroglossus sobrinus jantan. Glover (2007) menyebutkan bahwa karakteristik tumbuhan yang diserbuki kelelawar adalah memiliki bunga yang berwarna putih. 3= C.Soegiharto & Kartono caudatus dipengaruhi oleh ukuran polen permagnae. Bentuk keberagaman yang ditunjukkan berupa warna. ukuran polen besar dan dalam jumlah banyak. sphinx betina. 8=C. 7= C. GI = Giganteae. Dengan demikian hubungan timbal balik antara bunga dan penyerbuk menjadi hubungan yang saling berkaitan.0 -1. menghasilkan nektar yang berlimpah.4 8 PA 9 12 3 5 7 2 GI 4 11 13 1. 6= C. Keberagaman tersebut dijelaskan oleh Graham et al. brachyotis jantan. Hasil penelitian kami membenarkan pendapat Glover (2007) tentang ukuran polen yang MA 1 Axis 2 10 6 -0. bracyotis betina. bentuk.. PEMBAHASAN Menurut Whitney & Glover (2007) secara alami keberagaman bunga angiospermae beradaptasi terhadap agen penyerbuk (pollinator). sphinx jantan. 11= Rousettus amplexicaudatus betina. MA = Magnae. PA = Permagnae 126 . dan ukuran. mengeluarkan bau menyengat (asam butyric). titthaheileus betina. bau. (2003) dan Glover (2007) pada karakteristik bunga yang disebuki oleh kelelawar. bentuk mahkota bunga mangkuk. titthaheileus jantan.

Untuk hasil penelitian kami yang tidak sependapat dari hasil penelitian Stroo (2000) yaitu tipe polen mempengaruhi pemelihan masingmasing jenis kelelawar. tipe aperture dari 130 spesies tanaman yang diserbuki kelelawar. Ceiba sp.. Pengaruh tipe polen tersebut adalah spesies Macroglossus sobrinus jantan dan Eonycteris spelaea betina lebih memilih tipe polen suboblate dan prolate spheroidal. ukuran polen tersebut mulai dari magnae. ukuran polen tersebut mulai dari magnae. spesies Rousettus amplexicaudatus betina dan C. Pernyataan Toelch & Winter (2007) ini didukung hasil analisis dimana indra penciuman kelelawar lebih tajam dibandingkan dengan lebah. Peneliti lain (Graham et al.1. Hasil penelitian kami yang sependapat dengan Stroo (2000) adalah ukuran polen yang diserbuki atau dimakan kelelawar dengan ukuran yang besar. Pendapat Warren & Diaz (2001) sependapat dengan penelitian kami yang mana menemukan jenis spesifik pemakan buah juga memakan polen yaitu spesies Cynopterus minutus. namun berbeda kesimpulan tentang sistem aperture. (2003) juga memperkuat hasil penelitian kami pada tipe bunga yang mekar pada malam hari seperti ditemukan pada sampel polen bunga Durio zibethinus.3. bunga terbuka dan mudah diakses. Ceiba pentandra. 2003) menambahkan karakter tumbuhan yang diserbuki kelelawar adalah bunga yang mekar pada malam hari. C. sphinx jantan lebih memilih oblate spheroidal. permagnae dan giganteae.2. Menurut Warren & Diaz (2001) kelelawar lebih memilih polen dibandingkan nektar pada tipe bunga sederhana dan kompleks manakala bunga tersebut dapat dengan mudah diakses oleh kelelawar. berpendar atau warna kusam.. permagnae dan giganteae. sistem aperture dan ornamen exin secara umum tidak berpengaruh terhadap pemilihan. Syzygium sp. Kesimpulan akhir yang didapat Stroo adalah ukuran polen menjadi faktor utama pemilihan polen. Voigt (2004) berpendapat bahwa perilaku kelelawar dalam memakan nektar sangat bergantung pada ukuran 127 . Hasil penelitian kami membenarkan pendapat Stroo (2000) tentang faktor ukuran polen namun tidak sependapat dengan tipe polen. sphinx. Baringtonia sp.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar diserbuki atau dimakan kelelawar dengan ukuran yang besar. sehingga akan lebih diterima jika alasan kelelawar menyerbuki bunga dikarenakan oleh alasan nektar. sedangkan tipe polen. Durio sp. mengeluarkan bau yang tajam dan menyerupai bau kelelawar. brachyotis. 1. Pendapat yang bertolak belakang dikemukakan oleh Toelch & Winter (2007) yang menyebutkan bahwa spesies Glossophaga soricina memilih bunga dengan kandungan nektar yang lebih banyak. menghasilkan nektar yang banyak dan polen yang berlebihan.. tetapi tidak menunjang pada beberapa bunga seperti Hisbiscus sp..2 dan Ceiba sp. serta bunga terletak pada cabang pohon. C. Ceiba sp. C. [Euphorbiaceae] sp.. tipe polen. titthaheileus. Bauhinia sp. Pendapat Graham et al. [Orchidaceae] sp. Stroo (2000) mencoba menganalisis pengaruh ukuran polen.

yang menjadi pakannya. titthaheileus. (2) tipe bunga yang mudah diakses polennya. kelelawar ini mempunyai kecenderungan memakan nektar dengan hinggap (hovering). (2009) akan lebih dijelaskan pada hasil penelitian kami. C. seperti bentuk bunga disk pada spesies Eonycteris spelaea betina. kelelawar kelompok ini misalnya Eonycteris spelaea dengan berat kurang lebih 70 gram akan memilih tipe makanan polen dibandingkan nektar. Spesies kelelawar kecil (Glossophaga soricina) yang beratnya 10 gram lebih efektif memakan nektar dengan hinggap (hovering) dibandingkan dengan memanjat ranting. Hal ini dikarenakan kelelawar pada kelompok ini dapat mengakses letak nektar dalam bunga dengan lidahnya yang berukuran kecil dan panjang. Voigt (2004) dan Bumrungsri et al. seperti tipe bunga bintang dan tabung pada spesies Macroglossus sobrinus jantan.Soegiharto & Kartono kelelawar tersebut.. Untuk spesies kelelawar yang lebih besar akan lebih efektif memakan nektar dengan memanjat ranting dibandingkan dengan hinggap. Toelch & Winter (2007). Perbedaan pendapat Warren & Diaz (2001). (2009) mencatat bahwa Eonycteris spelaea menyerbuki Durio zibethinus dan Orchidaceae. Bumrungsri et al. Untuk kemudahan akses sumber pakan polen pada tipe bunga oleh kelelawar harus dibedakan kedalam 2 kelompok. Spesies kelelawar yang masuk dalam kelompok ini misalnya Cynopterus minutus. Pada bunga yang ukurannya relatif besar seperti Ceiba pentandra. brachyotis. Sebagai contoh adalah 128 spesies Glosso-phaga soricina dengan berat kurang lebih 10 gram dan Macroglossus sobrinus dengan berat kurang lebih 20 gram. Dari ketiga spesies tersebut yang memiliki berat kurang lebih 20 gram adalah Macroglossus sobrinus. (2) kelelawar lidah panjang (long tongued bats) ukuran sedang yaitu dengan berat lebih dari 20 gram. C. Durio spp. 1) kelelawar lidah panjang (long tongued bats) ukuran kecil yaitu dengan berat 10–20 gram. misalnya kerusakan bunga Anggrek (Orchidaceae) akibat didatangi oleh Eonycteris spelaea. kedok pada spesies Eonycteris spelaea jantan. Hal ini dikarenakan alasan lebih mudah mengakses polen dibandingkan nektar. kelelawar kelompok ini memakan polen karena tidak sengaja tertelan akibat ikut termakan pada buah. yaitu: (1) tipe bunga yang mudah diakses nektarnya. Kelelawar spesies ini jika memilih makanan tipe nektar akan berakibat pada rusaknya bunga yang dikunjungi. Hasil penelitian kami mencoba mengambil kesimpulan bahwa pembagian kelelawar berdasarkan berat tubuh dan panjang lidah dibedakan kedalam 3 kelompok yaitu. bunga dan daun. Pada penelitian kami ditemukan 3 spesies kelelawar sebagai spesifik pemakan nektar dan polen yaitu spesies Macroglossus sobrinus. sedangkan yang memiliki berat kurang lebih 70 gram adalah spesies Rousettus amplexicaudatus dan Eonycteris spelaea. (3) kelelawar lidah pendek/ pemakan buah. Rousettus amplexicaudatus dan Eonycteris spelaea. C. sphinx. sangat dimungkinkan kelelawar jenis ini dapat mengakses nektar sehingga polen yang ditemukan tertelan bersa-maan nektar. .

Smilauer. Oxford: Oxford Univ. Erdtman. Ithaca: Microcomputer Power Toelch. J & P. Pollen Flora of Maharashtra State India. Smilauer. 2004. Ketertarikan spesies kelelawar dalam memilih sumber pakan kemungkinan besar tergantung pada berat tubuh dan ukuran lidah kelelawar serta kemudahan dalam mengakses sumber pakan.. Graham. 2000. E. Sridith & PA. Plant Biology.blogspot. K. Suyanto. Pearson and Prentice Hall. T. Pollen morphological evolution in bat pollinated plants.com / 2009/04/transformasi-data. Component Phy.Karakteristik Jenis Pakan Kelelawar Pemakan Buah dan Nektar KESIMPULAN Bentuk bunga mempengaruhi spesies kelelawar dalam mengakses sumber polen dan sumber nektar. 222: 225–242.Evol. Sehingga perlu dikaji lagi kedepan pengaruh berat tubuh dan ukuran lidah kelelawar serta kemudahan akses sumber pakan dalam analisis hCCA yang berbeda. Syahid. G. Pollen Morphology and Plant Taxonomy Angiosperms: An introduction to the study pollen grains and spores. New York: Chronica Botanica. University of South Bohemia. Trop. DAFTAR PUSTAKA Bumrungsri S. Canoco Reference Manual and User ’s Guide to Canoco for Windows. Chongsiri. Transformasi Data. 2007. Leps. Erdtman. http: //abdulsyahid-forum. 1999. Ceske Budejovice. CJF. 2005. Ecol 25:85–92. J. Copenhagen: Munksgard. The pollination ecology of durian (Durio zibethinus. CC. [20 Juni 2009] ter Braak. Glover. 2009. Faculty of Biological Sciences. Pr. International Bioscence Series Volume XIV. 2007. Winter. Sripaoraya. of Palynology Stroo. LE. 1943. 2009. Illustrated Handbook on Pollen Terminology. G. A. Understanding Flowers and Flowering:An Inte- grated Approach. Plant Sys. A. An Introduction to Pollen Analysis. Racey. JM. Bogor. 2001. 129 . U. New Delhi: Today & Tomorrow’s. Nayar.html.& Y. 1999. Paldat. Pengaruh tipe polen bervariasi untuk masing-masing jenis kelelawar. Multivariate Analysis of Ecological Data. Psychometric function for nectar volume perception of a flower-visiting bat. TS. & P. Ukuran polen yang dipilih kelelawar adalah berukuran besar mulai dari magnae. Kelelawar di Indonesia. 1998. 1952. 193:265–269 Voigt. Pusat Penelitian dan Pengembangan Biologi – LIPI. Graham & LW. A. BJ. permagnae dan giganteae. 2003. Dept. The power requirements (Glossophaginae: Phyllostomidae) in nectar-feeding bats for clinging to flowers. Wilcox. Bombacaceae) in southern Thailand.

2007. & A. 1:147–158. & BJ. Morphology and development of floral features recognized by pollinators. J. A twopollinator model for the evolution of floral complexity. Arthropod-Plant Inter. Laporan studi praktek Jurusan Teknik Geologi Fakultas Teknologi Mineral ITB. Yulianto E. Preparasi dan dasar determinasi palinologi. Whitney. Diaz. Warren. 1992. Memasukkan: Juli 2009 Diterima: September 2009 130 . 2001. Bandung. Evolutionary Ecology 15:157–166. Glover.Soegiharto & Kartono Component Physiology 174:541– 548. HM.

. Based on the statistic test. dan aksiler. UPT BKT Kebun Raya Purwodadi-LIPI 2.com ABSTRACT Species Identification of Scarlet gourd (Coccinia grandis (L. Keywords: Coccinia grandis L. found in three population (Ngebel. Character differences between both of Papasan only revealed physiology adaptation.30 a. It revealed that the both of Papasan is closely related and belongs to the same species of Coccinia grandis L. Dalam “Flora of Java”. berwarna hijau pada saat muda dan berwarna merah pada saat tua. contains of 22 autosomes and 2 sex chromosomes.m and 2-2.m-00. In Daerah Istimewa Yogyakarta. Kata kunci: Coccinia grandis L. Fakultas Biologi. They differ in phenotype. Papasan is a dioecious plant belongs to the family Cucurbitaceae. The karyotype formulas of Papasan I and II were 2n=24=20m+2sm+XX(m).9dion yang terbukti efektif terhadap Micrococcus luteus dan Escherichia coli (Ciawi 2006).3. while Papasan II at about 08. 11 a. Chromosome. cordiflora. Karyotype. indica. PENDAHULUAN Papasan (Coccinia grandis) merupakan salah satu angggota Cucurbitaceae yang diduga berasal dari Asia dan Afrika. The difference R value between Papasan I and II was smaller than 0. daun Coccinia cordiflora dapat dimanfaatkan sebagai obat diare (Winarno & Sundari 1996). bunga berwarna putih kehijauan.m.1]non-3-ena-2.Jurnal Biologi Indonesia 6 (1): 131-142 (2009) Identifikasi Papasan (Coccinia grandis (L. Niedzielski 2002). Buahnya berbentuk oval dengan panjang 4-6 cm. especially in shape and taste of fruit.30-09.5-dimetilbisiklo[3.m.30 p. grandis dan C. Kariotype. and anti diarrhea. anti diabetic.30 p. Papasan. Selain itu. Papasan memiliki beberapa nama ilmiah seperti C. The chromosome number of both Papasan is 2n=24.m. sedangkan ekstrak daun dan akarnya sebagai obat diabetes (Ramachandran & Subramaniam 1983.) Voigt) in Three Population in Yogyakarta. significant difference on chromosomes character between Papasan I and II was only in short arm of autosome pair number 5.. C. Papasan dilaporkan mengandung ester dioktil heksadionat dan 1. Cromosom.. Papasan memiliki sulur. Papasan.rindyastuti@yahoo. Masyarakat India dan Afrika memanfaatkan buah Papasan sebagai sayuran. berbentuk lonceng. there were two varians of Papasan (Papasan I and II).30 a. Genotype observation using squash method on the root tips with modification in the duration of maceration were used in this research indicated that cells devided of Papasan I at about 8-11. 131 .25. Universitas Gadjah Mada E-mail : ridesti.) Voigt) di Tiga Populasi di Yogyakarta Ridesti Rindyastuti1&Budi Setiadi Daryono2 1. Berbah and Gajah Wong Riverbank). batang memanjat. anti bacterial. This plant is commonly used as vegetable.

Yogyakarta selama delapan bulan. 132 grandis var. Keanekaragaman spesies dapat ditinjau dari keanekaragaman fenetik dan keanekaragaman genetik. grandis) yaitu tipe buah manis dan buah pahit. Ujung akar Papasan dipotong ± 3-4 mm pada saat jam pembelahan sel. Metode preparasi kromosom. Keduanya berbeda dalam hal rasa. yang digunakan adalah metode Squash (Jahier et al. 1996). Populasi Ngebel memiliki bentuk buah oval sampai bulat memanjang dengan rasa manis sedangkan populasi Berbah dan Bantaran Sungai Gajah Wong memiliki karakter buah berbentuk membulat sampai oval dengan rasa pahit. Ujung akar difiksasi dengan asam asetat 45% pada suhu ± 4º C selama 15 menit kemudian dicuci sebanyak 3 kali dengan akuades. perbedaan karakter fenotip maupun genotip kedua Papasan dapat digunakan untuk mengidentifikasi spesies Papasan di tiga populasi Daerah Istimewa Yogyakarta. jumlah dan karyotype kromosom serta nilai R (rasio pasangan kromosom absolut terpanjang dengan terpendek). dua macam Papasan yang ditemukan di populasi Ngebel. warna dan pola garis buahnya (Ramachandran & Subramaniam 1983). Berbah dan Bantaran Sungai Gajah Wong yaitu Papasan I dan Papasan II juga dijumpai adanya perbedaan karakter morfologi. grandis dan varian buah pahit C. Berbah dan Bantaran Sungai Gajah Wong Daerah Istimewa Yogyakarta dikarakterisasi dan dibandingkan masing-masing dengan 3 ulangan. Fakultas Biologi Universitas Gadjah Mada.) Voigt (Backer & Bakhuizen van den Brink 1965) dengan C. Cogn sebagai nama sinonim. variasi bentuk dan rasa buahnya.Rindyastuti &Daryono Papasan memiliki satu nama yaitu C. BAHAN DAN CARA KERJA Penelitian ini dilakukan di Laboratorium Genetika. cordifolia Auct non. wightiana (Roumer) Grab. Di Daerah Istimewa Yogyakarta. grandis (L. Ujung akar dimaserasi dengan HCL 1 N selama ± 5-8 menit (tergantung keras dan lunaknya ujung akar) pada suhu ± 55º C . varietas atau forma. Russel (1998) dan Singh (1999) menyatakan bahwa dua organisme yang hubungan kekerabatannya berdekatan dapat memiliki karyotype berbeda karena berbeda pada kategori takson infraspesifik seperti subspesies. Perbedaan karakter morfologi antara dua macam tanaman sering dikuti oleh perbedaan karyotype. Untuk mempertegas status takson kedua varian tersebut masih diperlukan data pendukung lainnya selain data morfologi. Bagian-bagian tanaman Papasan (I dan II) dari populasi Ngebel. ukuran. Penelitian tentang perbandingan karakter fenotip dan genotip Papasan yang akan dilakukan meliputi jam pembelahan sel. Di India ditemukan dua varian Papasan (C. yaitu dari bulan Oktober 2007. Dengan demikian. Kedua populasi tersebut berbeda karena perbedaan morfologi. bentuk.Juni 2008. grandis var. Varian buah manis yang umumnya dibudidayakan merupa-kan C. Karakterisasi Papasan mengacu pada karakter morfologi tanaman (Tjitrosoepomo 2003).

Pengukuran lengan pendek (p) dan lengan panjang kromosom (q) dilakukan dengan aplikasi Polyline dan Arc pada software AutoCAD Map 2000i.00-1. Satu persatu. Rasio pasangan kromosom absolut terpanjang dengan terpendek (R) masing-masing ulangan dihitung dengan rasio panjang absolut pasangan kromosom terpanjang dan terpendek Karyogram dan idiogram dibuat dengan aplikasi program Adobe Photoshop 7.Identifikasi Papasan (Coccinia grandis (L. Lengan pendek diukur dari telomer lengan pendek sampai sentromer. Preparat ditutup dengan gelas penutup dan bagian tepi diberi cutex bening agar tidak mengering.0 untuk mengetahui beda nyata ukuran kromosom antara kedua varian. Pada setiap pemotretan.00 133 . Ukuran tiap ulangan dirata-rata.49 0-12. Indeks Sentromer (IS) dihitung dengan membandingkan antar lengan pendek kromoson dengan panjang absolut kromosom.00 >7. Bentuk kromosom berdasarkan Indeks Sentromer (IS). Ujung akar diambil.68-3.0. obyek mikrometer difoto dengan perbesaran yang sama untuk konversi skala ke ukuran sebenarnya. kromosom disusun dalam format CorelDRAW X3 berdasarkan urutan ukuran panjang absolut kromosom dari yang terbesar sampai terkecil beserta kromosom homolog. gambar kromosom dipotong menggunakan Polligonal lasso tools pada program Adobe Photoshop 7. Ukuran kromosom Papasan I dan II diuji dengan uji T pada taraf 5% menggunakan program SPSS (Statistic Package for Social Science) versi 16.67 1.5 12. Cetak foto diubah ke format digital dan disimpan dalam file JPEG/JPG. Jumlah kromosom dihitung dari tiga akar dengan masing-masing 2-3 ulangan sel. Posisi sentromer Median Submedian Subterminal Terminal Bentuk kromosom Metasentris Submetasentris Subtelosentris Telosentris Simbol m sm st t IS 37. Tabel 1. diletakkan di atas gelas benda kemudian ditekan sampai membentuk lapisan tipis pada gelas benda.00 3.5-50 25-37. Untuk menyusun karyogram.0 dan CorelDRAW X3. Idiogram berupa diagram batang lengan panjang dan pendek kromosom dibuat dalam format CorelDRAW X3.01-7.49 RLK 1.0 untuk konversi skala ukuran kromosom. Kromosom difoto dengan mikrofotografi. Ujung akar direndam dalam larutan aceto-orcein 1% selama 24 jam pada suhu kamar. Bentuk kromosom ditentukan dengan mengacu bentuk kromosom yang secara ringkas ditampilkan pada Tabel 1.) Voigt) di Tiga Populasi kemudian dicuci 3 kali dengan akuades. Kromosom dihitung secara langsung saat pengamatan preparat maupun secara tidak langsung dari hasil foto.5-25. Hasil pemotongan dicopy dalam format Adobe Photoshop 7. Lengan panjang diukur dari telomer lengan panjang sampai sentromer.

0. tidak berambut 6.Rindyastuti &Daryono HASIL Karakter fenotip Karakter morfologi Papasan I dan II yang ditemukan di Daerah Istimewa Yogyakarta secara umum ditampilkan pada Tabel 2. Buah 1.0.6 2 .9.25 pahit oval 0. Karakter morfologi Papasan I dan II.5.7. tepi daun dan permukaan daun Papasan I dan II relatif tidak ada perbedaan.4 7.4 8 . Karakter Dari karakter buah.9 .2. Bentuk 5. sedangkan Papasan II hanya memiliki bercak-bercak putih yang samar.2 6.5 . Perbedaan baru terlihat pada ukuran daun.7 manis membulat 0.1 . Bentuk buah 2. banyak variasi Membundar berlekuk licin.11. Bentuk biji 2. variasi bentuk dan rasa buahnya.0.3 . Rasa 3. Biji 1.6 .5 . terdapat sedikit perbedaan bentuk dan ukuran buah Papasan I dan II. bentuk daun. berasa manis dengan sedikit variasi bentuk buah. Tanaman Papasan I Papasan II membundar berlekuk licin.2 oval-bulat variasi sedikit 1. Tabel 2. Permukaan daun 4.3 .4 memanjang. Tepi daun 3.4 sangat rendah putih lurus satu hijau dengan bercak-bercak putih memanjang dari pangkal sampai ujung buah merah 4.33 tinggi putih Melengkung keluar (recurved) satu 134 .64 0.6 .6 .0.5.3 8.2.6 0. Daun 1. Bentuk daun 2. Ukuran daun (cm) a) panjang daun b) lebar daun 2. Jumlah cabang sulur hijau dengan garis-garis putih memanjang dari pangkal sampai ujung buah merah 4.7 . Papasan II memiliki ukuran daun lebih besar daripada Papasan I. memiliki rasa buah pahit dan variasi bentuk buah yang banyak. Bunga 1.3 . Ukuran biji (cm) a) panjang b) lebar 3.3 .6 2. Warna 2. Ukuran buah (cm) a) panjang buah b) lebar buah c) keliling buah 4. Warna buah a) muda b) tua 3.9. Viabilitas 4. membulat-oval. Buah Papasan I memiliki garisgaris putih.7. tidak berambut 7. sedangkan perbedaan besar terlihat pada warna buah baik pada waktu masih muda maupun pada saat sudah tua. Seperti tampak pada tabel.

10.) Voigt) di Tiga Populasi Karakter umum bunga kedua Papasan relatif sama (Tabel 2). 12.30 WIB sedangkan sel Papasan II aktif membelah antara jam 08. chepalandra. sedangkan biji Papasan II sangat mudah berkecambah. 22 kromosom merupakan autosom sedangkan dua kromosom lainnya merupakan kromosom kelamin.30 dan 14. Secara umum.00-14. biji Papasan I tidak dapat berkecambah. sedangkan yang berbentuk metasentris ada pada autosom nomor 1. Jumlah kromosom Papasan yang diteliti sesuai dengan jumlah kromosom C. 9.30-09. Waktu mitosis Papasan I memiliki selang mitosis yang lebih lama daripada Papasan II.00-14. biji Papasan I memiliki bentuk membulat. Pada Papasan I prometafase banyak ditemukan antara jam 09. 7. Sedangkan. Agarwal & Roy 1984.15 WIB. Keduanya tidak menunjukkan adanya ukuran kromosom yang ekstrim yang dapat menandakan kromosom jantan. hirtella dan C. 8.50-09.00-11.00-11. Berdasarkan nilai IS (Tabel 3). Perbedaan karakter terlihat pada daun mahkota. 4. dan 11.50-10. diketahui bahwa kromosom kedua Papasan memiliki ukuran kecil dan pendek.20 dan 14. 11.00-11.30 WIB. bentuk autosom Papasan I dan II adalah metasentris dan submetasentris. Karyotype dan ukuran kromosom Karyogram Papasan I dan II dapat dilihat pada Gambar 1 dan 2.20. Papasan merupakan tanaman dioecious atau berumah dua (Darlington & Wylie 1955. Guha et al. 11. dari 24 kromosom Papasan. C.15. memiliki salut biji berair yang tebal serta permukaan kulit biji berbintil-bintil kecil. Hal ini dapat diketahui dari adanya perbedaan waktu mitosis antara Papasan I dan II. 5.30 WIB. Jumlah kromosom Jumlah kromosom Papasan I dan II sama yaitu 2n=24. Autosom Papasan I dan II yang berbentuk metasentris adalah pasangan nomor 2.00-12.10-12. indica yaitu 2n=24. ukuran kromosom dan Indeks Sentromer Papasan I dan II ditampilkan pada Tabel 3. Disamping itu. dengan frekuensi terbanyak pada jam 11. sedangkan biji tanaman Papasan II berbentuk oval.15 WIB. Papasan I lurus. Sel Papasan I aktif membelah antara jam 08. biji Papasan berbentuk oval dan mampat.30 WIB. Bentuk autosom dan kromosom kelamin Papasan I dan II menunjukkan adanya kesamaan 135 . 2004) sehingga. sedangkan kromosom kelamin berbentuk metasentris. 3. Hal tersebut mengindikasikan bahwa sampel Papasan I dan II yang diteliti merupakan tanaman betina karena tidak ditemukan kromosom Y yang memiliki ukuran yang jauh lebih besar daripada autosom.Identifikasi Papasan (Coccinia grandis (L. Kromosom Papasan I dan II tidak mempunyai satelit kromosom. Namun. sedangkan daun mahkota Papasan II menggulung keluar (recurved). sedangkan prometafase Papasan II banyak ditemukan pada jam 09. 6. Berdasarkan ukuran panjang absolut terpendek dan terpanjang (Tabel 3) dan karyogram (Gambar 1 dan 2).

dan 11. 8. 7. 2. Perbandingan ukuran lengan panjang dan panjang kromosom antara Papasan I dan II dapat dilihat pada idiogram yang tersaji pada Gambar 3. 6. menunjukkan bahwa tidak terdapat perbedaan nyata pada ukuran lengan pendek pasangan kromosom kedua tanaman. 10. 9. Pada pasangan nomor 5 ukuran lengan pendek kromosom terdapat beda nyata antara Papasan I dengan Papasan II.Rindyastuti &Daryono formula karyotype yaitu 2n=2x=24= 20m+2sm+XX(m) (Tabel 4). Karyogram kromosom Papasan I. namun hasil uji statistik pada aras 5% terhadap panjang lengan pendek (p). autosom dan kromosom kelamin Papasan I relatif lebih besar dan panjang daripada kromosom Papasan II. sm Keterangan : m = metasentris sm=submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 2. 4. 3. sehingga ukuran lengan pendek pasangan autosom nomor 5 dapat menjadi karakter pembeda antara kedua tanaman yang diteliti. sm Keterangan : m = metasentris sm = submetasentris Formula karyotype : 2n=24=20m+2sm+XX(m) Gambar 1. Ukuran pasangan kromosom yang tidak berbeda nyata adalah kromosom kelamin dan pasangan autosom nomor 1. Karyogram kromosom Papasan II. 136 . Walaupun terlihat adanya perbedaan ukuran kromosom (Tabel 3). Berdasarkan ukuran panjang absolut pasangan kromosom dan idiogram. panjang lengan panjang (q) dan panjang absolut kromosom (p+q).

91±0.26497 46.255 1.56±0.77±0.86±0.53865 45.66±0.22 1.86±0.72844 46.182 0.29±0.03±0.55±0.135 0.33331 47.33±0.072 0.099 0.075 0.252 1. Pasangan Kromosom 1 2 3 4 5 Papasan I 6 7 8 9 10 11 X 1 2 3 4 5 Papasan II 6 7 8 9 10 11 X Panjang Kromosom (μm) Lengan Lengan Panjang Pendek Panjang Absolut 0.113 1.58±0.76±0.48±0.76±0.073 0.99±0.218 1.46603 46. demikian juga dengan panjang absolut pasangan autosom maupun kromosom kelamin kedua tanaman. Tanaman No.60±0.267 0.86±0.37865 47.16±0.097 0.67±0.80±0.109 0.121 0.095 0.02±0.23 1.230 1.114 0.74±0.162 1.94±0.130 0.72±0.268 2.51±0.28729 47.5394 45.061 0.211 1.146 1.078 2.62±0.108 1.70±0.70±0.13±0.34532 43.26413 46.29±0.105 1.189 2. baik autosom maupun kromosom kelamin.58±0.78±0.17±0.70±0.092 1.073 0.Identifikasi Papasan (Coccinia grandis (L.69±0.73±0.83784 45.7189 46.067 0.120 1.77649 47.44±0.67±0.94±0.61615 44.42±0.13±0.129 1.155 0.112 0.42±0.96±0.34739 44.25±0.50±0.96±0.081 0.84±0.87±0.82±0.69±0.122 1.) Voigt) di Tiga Populasi Tabel 3.53±0.03352 Bentuk Kromosom sm m m m m m m m m m m m sm m m m m m m m m m m m Keterangan : X = Pasangan kromosom kelamin betina Hasil uji statistik terhadap panjang lengan panjang (q) (Tabel 5) menyatakan bahwa tidak terdapat perbedaan nyata ukuran lengan panjang pasangan kromosom Papasan I dan II.80±0. Rata-rata ukuran kromosom dan Indeks Sentromer (IS) Papasan I dan II.128 0.77302 43.129 1.083 0.109 0.071 0.89±0.116 1.254 1.069 0.069 0.062 0.230 1.091 0.74±0.085 0.106 1.89±0.077 0.59±0.06±0.079 0.102 0.074 1.089 1.06673 46.73±0.148 Indeks Sentromer (IS) 35. Karakter ukuran lengan panjang dan panjang absolut pasangan kromosom tidak dapat dijadikan karakter pembeda kedua tanaman Papasan.71775 47.083 0.64±0.075 0.242 1.73±0.107 0.063 0.103 0.54±0.112 0.249 1.63128 46.102 0.70±0.139 0.22531 45.083 0.27804 36.73±0.133 0.82±0.66±0.78±0.48±0.62±0.86±0.79±0.15998 45.090 0.00024 47. 137 .75±0.085 0.86±0.

Berdasarkan hasil uji statistik pada aras 5% (Tabel 5). Nilai R menunjukkan variasi ukuran kromosom.77649 2.33 1.5394-47. variasi ukuran kromosom juga semakin tinggi.50-0.13 36. Selisih nilai R dua tanaman mengindikasikan perbedaan karakter kromosom dan hubungan kekera- . diduga Papasan I dan II masih tergolong dalam satu spesies. nilai IS antara autosom maupun kromosom kelamin Papasan I dan II tidak berbeda nyata. Karakter Kromosom Formula karyotype Panjang lengan pendek (μm) Panjang lengan panjang (μm) Panjang absolut (μm) Indeks Sentromer (IS) Rasio panjang absolut (R) Papasan I 2n=24=20m+2sm+XX(m) 0.345-47.16-2.59-1. 138 Nilai R Nilai R merupakan rasio panjang absolut kromosom terpanjang dengan panjang absolut kromosom terpendek.34739 2. Perbandingan karakter kromosom Papasan I dan II.56-1.44 1.87 0.25 35.86 0.06-2.00 Papasan I Papasan II Gambar 3. Hal ini berarti bahwa nilai IS tidak dapat digunakan sebagai karakter pembeda antara kedua tanaman. Perbandingan idiogram kromosom Papasan I dan II. Semakin besar nilai R.51-0.01 Papasan II 2n=24=20m+2sm+XX(m) 0. Berdasarkan hasil uji statistik ukuran kromosom dan Indeks Sentromer.Rindyastuti &Daryono Tabel 4.

25.25 sedangkan selisih nilai R Papasan I dan II dengan American muskmelon lebih besar dari 0. Perbedaan karakter morfologi diduga menunjukkan perbedaan kategori infraspesifik yaitu kultivar. X = Pasangan kromosom kelamin betina 139 . NS = Non-signifikan.25. berikut disajikan perbandingan nilai R dengan anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon (Winarsih 2007) (Gambar 4). Nilai R antara Papasan I dan II berbeda. Berdasarkan Gambar 4. Perbedaan nilai R tersebut dinyatakan sebagai selisih nilai R. nilai R kedua Papasan tergolong kecil. Namun.Identifikasi Papasan (Coccinia grandis (L. Untuk membandingkan nilai R Papasan I dan II. artinya variasi ukuran diantara kromosomkromosom Papasan I dan II relatif rendah. karakter morfologi tersebut belum cukup dijadikan dasar untuk memisahkan dua macam Papasan ke dalam spesies yang berbeda. Tabel 5. Selisih nilai R Papasan I dan II dengan Melon PI 371795 kurang dari 0. Pasangan kromosom 1 2 3 4 5 6 7 8 9 10 11 X Lengan Pendek NS NS NS NS S NS NS NS NS NS NS NS Lengan Panjang NS NS NS NS NS NS NS NS NS NS NS NS Panjang absolut NS NS NS NS NS NS NS NS NS NS NS NS Indeks Sentromer NS NS NS NS NS NS NS NS NS NS NS NS Keterangan : S = Signifikan. PEMBAHASAN Perbedaan karakter morfologi antara Papasan I dan II memunculkan dugaan bahwa kedua Papasan merupakan varian yang berbeda. Hal ini disebabkan karena kedua tanaman yang diteliti tumbuh di habitat yang berbeda dan pengukuran karakter morfologi tidak dilakukan secara bersamaan sehingga kemungkinan kedua varian tersebut terjadi akibat adaptasi fisiologis terhadap faktor lingkungan seperti musim.) Voigt) di Tiga Populasi batannya. cuaca atau kesuburan tanah. Berdasarkan Tabel 5. Hasil uji statistik (Uji T aras 5%) ukuran pasangan kromosom Papasan I dan Papasan II. selisih nilai R antara Papasan I dan II lebih kecil dari 0.

01 0.565 Melon PI 371795 0. Perbedaan pada satu karakter panjang lengan pasangan kromosom mengindikasikan bahwa Papasan II masih tergolong satu spesies dengan Papasan I sehingga perbedaan takson antara Papasan I dan II diduga terdapat pada kategori infraspesifik yaitu varietas.115 0.45 American muskmelon - Menurut Tamarin (1999). Tabel 5. Matriks selisih nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon. Apabila nilai R kedua Papasan dibandingkan dengan nilai R anggota Cucurbitaceae lain yaitu Melon PI 371795 dan American muskmelon diketahui bahwa Papasan I memiliki variasi ukuran kromosom paling . Perbandingan nilai R Papasan I dan II dengan Melon PI 371795 dan American muskmelon.5 0 1 2 3 4 Jenis tanam an Keterangan : 1 = Papasan 1. No. 3 = Melon PI 371795.575 Papasan II 0. 2 = Papasan II.5 Nilai R Nilai R 1 0.125 0. bahkan antara tipe sel satu dengan tipe sel yang lain. Oleh sebab itu. Perbedaan ukuran kromosom lengan pendek nomor 5 antara Papasan I dan II 140 dapat menjadi karakter pembeda antara kedua tanaman. Variasi ukuran kromosom Papasan I lebih tinggi daripada Papasan II. lama fase mitosis secara khusus diatur oleh gen dan bervariasi antara spesies satu dengan yang lain. antara organ yang satu dengan yang lain dalam satu spesies.5 2 1. perbedaan lama fase mitosis antara Papasan I dan II diduga disebabkan oleh perbedaan tempat tumbuh yang mempengaruhi pengaturan gen kedua Papasan.Rindyastuti &Daryono Perbandingan Nilai R 2. 1 2 3 4 Jenis Tanaman Papasan I Papasan II Melon PI 371795 American muskmelon Papasan I 0. Ukuran pasangan kromosom antara Papasan I dan II tidak berbeda nyata baik autosom maupun kromosom kelaminnya. 4 = American muskmelon Gambar 4.

1984.25 mengindikasikan bahwa kedua Papasan tergolong dalam satu spesies C. Dr. Si. serta karakter genotip yang meliputi waktu mitosis. gracillis berdasarkan selisih nilai R lebih dari 0. grandis L. Karyotype of Coccinia indica. sedangkan American muskmelon memiliki variasi ukuran kromosom paling rendah (Gambar 4). ukuran.) Voigt. Qi-Xing et al. yaitu karakter morfologi daun. M. atas bantuannya secara teknis. KESIMPULAN Berdasarkan perbandingan karakter fenotip. Raka Swastika.25. S. Senada dengan hal tersebut. American muskmelon memiliki hubungan kekerabatan yang jauh dengan Papasan I dan II. Selisih nilai R Papasan I dan II yang lebih kecil dari 0. buah. Selisih nilai R antara Papasan I dan II dengan American muskmelon yang tinggi. Namun melon tidak tergolong dalam genus Coccinia. Meastika Dianeta. Selisih nilai R antara Papasan I dan II dengan Melon PI 371795. M. Purnomo. Disamping itu. tetapi Cucumis. Perbedaan ukuran lengan pendek kromosom pasangan nomor 5 antara Papasan I dan II mengindikasikan perbedaan kategori takson infraspesifik yaitu varietas. 141 . bentuk.Gen. Indian J. Penelitian sebelumnya menyatakan bahwa selisih nilai R lebih besar dari 0. & Plant Breeding 44(1): 117-120. Nogueira et al. 2000). yunnanensis dengan rasio 2. khususnya atas konsultasi di bidang taksonomi tumbuhan. Terima kasih kami ucapkan kepada Bapak Kisworo atas kontribusinya dalam pengadaan sampel. S.25. maka Papasan I dan II diduga masih tergolong dalam satu spesies Coccinia grandis (L.Identifikasi Papasan (Coccinia grandis (L.. perbedaan karakter fenetik antara Papasan I dan II diduga hanya merupakan adaptasi yang bersifat fisiologis. mengindikasikan bahwa Papasan I dan II memiliki hubungan kekerabatan yang dekat dengan Melon PI 371795. mengindikasikan bahwa berdasarkan karakter kromosom.25 dapat digunakan sebagai dasar pemisahan dua tanaman ke dalam spesies yang berbeda (Ferruci 2000. Qi-Xing et al. DAFTAR PUSTAKA Agarwal. & RP. Herlianti Anissa. Roy. UCAPAN TERIMA KASIH Ucapan terima kasih disampaikan kepada segenap rekan-rekan dan Dosen Laboratorium Genetika Fakultas Biologi UGM. atas bantuan konsultasinya. (2000) menyatakan bahwa Amentotaxis argotaenia dengan rasio 2. dalam Ferruci (2000) memisahkan Serjania communis dengan S. bunga dan biji.. karyotype kromosom dan selisih nilai R yang lebih kecil dari 0. dan Drs.Si. Tuty Arisuryanti. Sc. PK. jumlah. Hal ini mungkin disebabkan karena American muskmelon telah banyak dikultivasi melalui program pemuliaan.59.) Voigt) di Tiga Populasi tinggi di antara ketiga tanaman yang lain. AAG. S.71 memiliki kedudukan taksonomi yang sama dengan A.

1998. 2003. 2000. Zhi-Jiang & Y. 38 (6) : 525532. George Allens and UNWIN LTD. K. JM. Jones. SB. Effect of Coccinia indica on Blood Glucose Levels Aloxan-induced Diabetic Mice. & AP.id/files/cdk/files/ 10Pemanfaatan Tumbuhan Obat Diare109. RK. Niedzielski. 2007..http:// www. 2002. Cytochemical and Electrophoretic Distinction of a Dioecious Cucurbit. 1-77. Bot. Sinha. http://www. Darlington.go. Evolutionary Genetics.pdf/10Pemanfaatan TumbuhanObatDiare109. Principles of Genetics. Eber. Winarsih. Jstage. F. CA. & AE. Winarno. Inc. serta Isolasi dan Identifikasi Senyawanya”. PJ. Tangui. Cytological. 1979.. Ferruci. Science Publisher. Genetics. McGraw HillBook Company. Fakultas Biologi UGM. 51-57. London.go. Karyomorphology and Relationships of Amentotaxus Pilg. Karakterisasi Kromosom Melon (Cucumis melo L. Sundari. Coccinia indica. 98-101. Bakhuizen van den Brink. Yogyakarta. G. Cytotaxonomy of Sapindaceae with special reference to the tribe Paullinieae. 176182. 37 (4) : 380-383. Inc. 1955.jp/article/ cytologia/70/1/70_53/article. McGraw Hill-Book. Plant Systematics. Luchsinger. Subramaniam. Econ. Sinha & S. 234-325. Scarlet Gourd.jp/ article/cytologia/70/1/70_53/article. Diakses tanggal 5 November 2007. A. CD. Wylie. USA. Russel. H. Memasukkan Agustus 2009 Diterima: September 2009 142 . e d u / P re b u i l t / BiolJBR3_www.) PI 371795. Tjitrosoepomo. MW. w w. Ramachandran. Pemanfaatan Tumbuhan sebagai Obat Diare di Indonesia. JM. Act Phytotaxo. Flora of Java Vol. The Netherlands.V Groningen. New York. Inc. & D. Smith. Morfologi Tumbuhan. ZhongShu. Sin.pdf+coccinia&hl=id&ct= nk&cd=54&gl=id. G. Comp. Little-knownTropical Drug Plant. 1. The Benjamin/Cummings Publishing Company. 1998.ac.edu/ Prebuilt/BiolJBR3_ Niedziels- ki. hartwick. www. 3-5. 1999.lemlit. 1996. Singh. Inc. 1983. Uji Bioaktivitas Antibakteri Tumbuhan Obat dari Lontar Usadha “Taru Premana.id/ind/ detailPenelitian.Rindyastuti &Daryono Backer. www. Jahier. 2006. USA. Sixth edition. Plant Systematics. New York.unud. Cheure. California. Yogyakarta. Chromosome Atlas of Flowering Plants. Techniques of Plant Cytogenetics. h a r t w i c k . Z.html?id=4138.co. R. Fifth edition. RH. 217-222.jst. Walter Noordh off N. Ciawi. 1965. Coccinia grandis. K & B. MS. & RC.html. Tamarin.kalbe. Guha. Qi-Xing. 1999. 2000. Gadjah Mada University Press. Delourne & AM. Y. 305.jst. 2004. 1996. stage. Oxford University Press. Science Publisher.

Jl. Raya Cibinong KM 47 Cibinong Bogor ABSTRACT Biodiversity of Phenanthrene by Alcanivorak borkumensis M5 Isolated from Teluk Jakarta. perlu dilakukan proses pembersihan terhadap tumpahan minyak bumi dengan teknik bioremediasi yaitu.bacteria Kata kunci: Phenantren. Banyak penelitian ditujukan untuk mengetahui kemampuan mikroba untuk memecah senyawa PAH menjadi senyawa yang tidak berbahaya. yang 143 . produksi. Phenantrene is one of the most persistent organic substances in environment. degradasi. Keywords: Phenanthrene.. Cycloclasticus pugetti.8 with a doubling time of 14.Salah satu komponen tumpahan minyak bumi yang berbahaya bagi ekosistem lingkungan laut adalah senyawa-senyawa Polycyclic Aromatic Hydrocarbon (PAH) . This isolate grew optimum at 300C.Jurnal Biologi Indonesia 6 (1):143-151 (2009) Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati Pusat Penelitian Biologi-LIPI. distribusi. dietil.5 hours and specific growth rate of 0. The relation between PHB synthesis and phenantrene degradation is due required further investigation. Pseudomonas spp. bakteri PENDAHULUAN Pencemaran lingkungan laut oleh minyak bumi. frase phenanthrene merupakan gabungan dari senyawa alkil phenanthrene dan antrasen yang memiliki empat gugus karbon (tetrametil. Alcanivorax Borkumensis M5 was isolated from sea water. yang merupakan salah satu senyawa karsenogenik (Cerniglia.. Salah satunya adalah phenanthrene. yang tersusun dari gabungan tiga cincin benzena. Phenanthrene adalah senyawa Polycyclic Aromatics Hydrocarbons (PAH. antara lain bisa disebabkan oleh tercecernya minyak bumi pada proses pengolahan. About 75 % of phenantrene was degraded after 12 hours. 1992. maka. but the synthesis was inversely correlated with the cell growth. Menurut Brodkorb et al. 1984) yang sangat berbahaya bagi kesehatan manusia. maupun penggunaannya sehingga komponen-komponen minyak bumi terlepas ke dalam lingkungan. and able to degrade phenantrene after 5 hours. pH 7. metilpropil). Semua Phenanthrene C4n+2 memiliki tiga cincin benzena dan 1 gugus metil. Polyhydroxybutirate (PHB) was produced during culture growth. Peran bakteri indigenous akan sangat penting dalam proses biostimulasi. biostimulasi dan bioaugmentasi.0476/hour. telah dilaporkan mampu memecah PAH terutama phenantrene menjadi senyawa karbon dioksida melalui alur degradasi yang sangat komplek. degradation .

2. oleh karenanya mikroba laut banyak dieksplor kemampuannya dalam biokonversi senyawa berbahaya.79 gr NaCl. . Noble Agar (Difco) (15. H 3BO 3 . BAHAN DAN CARA KERJA Sampel penelitian ini diambil dari Teluk Jakarta. Untuk mencegah presipitasi selama proses sterilisasi dibuat 3 macam larutan yang terpisah dan dicampurkan setelah proses sterilisasi selesai (larutan mencapai temperatur 50ÚC). Untuk memadatkan media. larutan kedua mengandung MgCl2. 11. Na 2 HPO 4 dan TAPSO (sesuaikan pH hingga 7. NaF. 2006 ). dan 2. Lo´pez et al. 1.98 gr Na2SO 4. sehingga aktivitas mikroba yang mampu mendegradasi phenantrene juga tergantung dari parameter lingkungan tersebut (Mulder et al. Karakteristik ekologi dan fisiologi (terutama penggunaan sumber C yang berbeda dan aktivitas enzimatik) dari mikroba yang mampu mendegradasi PAH perlu diintensifkan untuk mendapatkan informasi yang dapat digunakan untuk memprediksi distribusi ekologi dari jasad renik yang berpeluang dimanfaatkan sebagai agen bioaugmentasi untuk limbah yang mengandung PAH. KCl. Mikroba laut juga dilaporkan berperan dalam hidrolisis senyawa PAH.850 LS. 144 Tujuan penelitian ini untuk mengetahui karakteristik mikroba laut yang mempunyai potensi sebagai agen bioaugmentasi untuk limbah yang mengandung phenantrene di dalam minyak bumi. 31 mg NaHCO 3 . NH 4 Cl.3 gr TAPSO {3-[N-tris(hydroxymethyl) methylamino]-2-hydroxypropanesulfonic acid}. karena memiliki metabolisma yang berbeda dengan mikroba teresterial.46 gr CaCl2·2H2O. 83 mg NaBr. termasuk pestisida. dan SrCl2 (divalent cation salts). NaBr. Mikroba laut dari marga Spingomonas umumnya memiliki distribusi ekologi yang sangat luas dari salinitas rendah (0%) sampai dengan salinitas tinggi (10%). 2002). Distribusi ekologi mikroba laut tergantung dari rentang toleransi pH. Uyttebroek et al. salinitas temperatur dan status nutrisi. Parameter lingkungan tersebut menentukan fisiologi dan aktivitas sel di lingkungan. NaHCO 4 . PAH memiliki sifat mudah berikatan dengan jaringan lipolytic sehingga mudah terakumulasi di dalam tubuh. 1.0 mg FeCl2·4H2O. Larutan pertama mengandung NaCl. Letak astronomisnya adalah 106. Penambahan phenantrene di dalam media dilakukan menggunakan teknik sublimasi yaitu temperatur sublimasi 1000C dan waktu sublimasi 10 menit.Dyah Supriyati dikontrol oleh novel gen (Johnson & Karlson 2004. Namun marga Salipiger kemungkinan mempunyai rentang distribusi ekologi yang lebih sempit dibandingkan dengan marga Spingomonas karena beberapa anggota dari marga Salipiger tidak dapat tumbuh pada salinitas 0%. CaCl2. 0.60 BT dan 5.6 dengan NaOH). Bakteri potensial pendegradasi PAH diisolasi pada medium minimum ONR7a : per liter akuades) 22.72 gr KCl. 27 mg H 3 BO 3 .6 mg NaF. 24 mg SrCl2·6H2O. 0. 3.0 gr/L) ditambahkan pada larutan pertama. 2001. 89 mg Na2HPO4·7H2O. Na2SO 4. dan larutan ketiga mengandung FeCl2.18 gr MgCl2·6H2O.27 gr NH4Cl.

Biodegradasi Phenantrene oleh Mikroba Laut M5

Mikroba yang tumbuh pada media ONR7a dan membentuk zona bening disekitar koloni adalah mikroba pengguna phenantrene. Mikroba yang memiliki zona bening selanjutnya di sub kultur pada media marine broth sebanyak 3 kali untuk mendapatkan biakan murni. Setelah menemukan zona bening di sekitar biakan potensial yang telah terisolasi, secara aseptik inokulasikan biakan-biakan potensial tersebut kembali ke medium ONR7a. Inkubasi pada suhu normal selama 24-72 jam. Kemudian pindahkan bakteri potensial tersebut ke media minimum ONR7a kembali. Uji kemurnian biakan dengan menanamnya di medium kaya (contohnya: medium marine agar). Isolat yang sudah murni, disubkultur ke 5 ml medium cair ONR7 yang mengandung 5 mg kristal senyawa Phenanthrene. Uji pertumbuhan biakan murni terseleksi pendegradasi phenantrene yang dilakukan dengan variasi tiga parameter fisik yaitu salinitas, temperatur dan pH. Biakan murni bakteri ditumbuhkan pada media air laut, dengan sumber karbon glukosa 5 gr/l dan yeast extract 0.5 gr/l .Salinitas + 3,3% dan Salinitas 5% , suhu 30oC dan suhu 40oC, dan pH 7.8 dan 5.17. Kecepatan pertumbuhan diikuti dengan menggunakan Spektrofotometer pada panjang gelombang 600 nm, yang diukur setiap 4 jam. Uji biodegradasi PAH Phenantrene dilakukan dengan mengamati perubahan konsentrasi total karbon phenanthrene selama selang waktu tertentu. Karena pengukuran total karbon dilakukan dalam fase cair, maka Phenanthrene harus

dapat dilarutkan ke dalam medium uji air laut. Phenanthrene dilarutkan dengan menggunakan DMSO sebanyak 10 % (V/V). Kecepatan degradasi diukur setiap 4 jam, dengan menggunakan GCMS (Harayama et al. 1999). 1 ml sampel di dalam appendorf, disentrifuge dengan kecepatan 6000 rpm selama 15 menit pada suhu 40C. Buang supernatan, timbang berat kering selnya. Campurkan 1 ml sampel kultur dengan 1 ml pewarna Suddan Black B dengan menggunakan Vortex. Inkubasi selama 1 jam di suhu kamar. Amati dengan spektrofotometer dengan panjang gelombang 595 nm. Campuran tersebut kemudian disentrifuge kembali 5000 rpm selama 10 menit, kemudian ukur kembali supernatannya dengan spektrofotometer pada panjang gel 595nm. PHB yang terbentuk akan terikat di dalam sel, sehingga warna campuran berubah menjadi lebih bening. Selisih absorbansi pada panjang gelombang 595 nm sebelum dan sesudah disentrifuge itu adalah PHB yang terbentuk. Dengan membandingkan selisih absorbansi dengan standar PHB dengan OD 595 nm dapat diketahui besarnya mg PHB/ gr sel. HASIL Diversitas mikroba pendegradasi PAHs dari air laut Panantrene merupakan senyawa PAHs yang persisten di lingkungan. Deteksi mikroba yang mampu mendegrdasi PAHs dilakukan menggunakan metoda sublimasi. 145

Dyah Supriyati

Terbentuknya zona bening pada koloni bakteri yang sedang tumbuh merupakan indikasi mikroba mampu menghidrolisis phenantrene. Diversitas mikroba pendegradasi phenantrene diperlihatkan pada Tabel 1. Tabel 1 memperlihatkan bahwa isolat M5 mampu menghidrolisis phenantrene dengan cepat. Biak tersebut setelah dilakukan uji konfirmasi, ternyata tetap mampu menghidrolisis PAHs dengan cepat, yaitu zona bening terbentuk setelah 6 jam waktu inkubasi. Karena kemampuannya menghidrolisis phenantrene maka isolat tersebut dipilih untuk dipelajari karakter fisiologinya. Kecepatan hidrolisis phenantrene Kemampuan degradasi PAHs diuji pada medium ONR7a. Medium ini mengandung kebutuhan nitrogen dan posfat yang memadai untuk degradasi phenantrene. Isolat M5 mampu menghidrolisis phenantrene setelah 4 jam waktu inkubasi, sekitar 75 % dari Phenantrene terdegradasi dalam waktu 12 jam. Selanjutnya kecepatan degradasi lambat (Gambar 1). Untuk mengetahui kemampuan adaptasi biak M5, selanjutnya dilakukan uji pertumbuhan

pada tingkat salinitas sekitar 3.3% dan-5 %. Identifikasi Tahapan dan hasil identifikasi biak terseleksi potensial pendegradasi PAH phenanthrene M5 dengan 16rDNA menyebutkan bahwa bakteri tersebut adalah : Alcanivorax borkumensis strain PTG49 (98%). Uji pertumbuhan pada rentang salinitas Variasi Salinitas Bakteri M5 mempunyai pola pertumbuhan yang sama ,pada salinitas 3.3% maupun 5 %. Bakteri baru tumbuh setelah 24 jam inkubasi. Pada salinitas 5% fase kematian sudah mulai terlihat setelah 36 jam inkubasi, sedsang pada salinitas 3.3% bakteri masih masih hidup stabil ( Gambar 2) Variasi suhu Bakteri M5 (Alcanivorak berkumensis) yang tumbuh pada media dengan suhu 400C lebih cepat tumbuh (8 jam inkubasi) tetapi pertumbuhannya kurang bagus bila dibandingkan dengan yang tumbuh pada media dengan suhu

Tabel 1. Pengujian degradasi phenantrene terhadap mikroba laut
No. 1 2 3 4 5 Kode Isolat M5 M1 M2 M3 M4 Kemampuan mendegrdasi +++ + Radius zona bening 2 mm 1 mm Karakter koloni Warna kuning, Warna kuning kecoklatan Warna Putih, tumbuh cembung Warna kuning, Warna putih kekuningan

146

Biodegradasi Phenantrene oleh Mikroba Laut M5

300C. Pada suhu 300C, bakteri terlihat tumbuh pada 24 inkubasi, dan pertumbuhannya relative lebih subur (Gambar 2) Variasi pH Pola pertumbuhan bakteri M5 (Alcanivorak berkumensis) pada media dengan pH 7.8 dan 5.17 hampir sama, mulai terlihat tumbuh 24 jam setelah inkubasi, tetapi tumbuh lebih subur pada media dengan pH 7.8 (Gambar 2) Berat sel. Produksi sel diukur pada biak yang tumbuh pada media dengan salinitas 3.3%, 5% dan pH 5.17. Dari ketiga sampel yang diukur berat selnya, produksi sel tertinggi dicapai biak M5 (Alcanivorak berkumensis) yang tumbuh pada media air laut dengan salinitas 3.3%, diikuti pada salinitas 5% dan pH 5.17 (Gambar 3). Produksi PHB Produksi PHB terlihat berbanding terbalik dengan pertumbuhan bakteri.

Pada media dengan salinitas 3.3 % yang terlihat optimal untuk pertumbuhannya, sel membentuk PHB paling sedikit, begitu juga berikutnya produksi PHB oleh biak yang tumbuh pada salinitas 5 % dan yang tertinggi adalah produksi PHB oleh biak yang tumbuh pada pH 5.17 (Gambar 3). PEMBAHASAN Isolasi, Purifikasi, Uji Konfirmasi Biak Pendegradasi PAH dan Identifikasi Zona bening yang kemudian diamati di sekeliling koloni bakteri adalah kondisi dimana telah menghilangnya kandungan PAHs phenantrene dari medium ONR7a, karena telah dihidrolisis oleh bakteri dalam metabolismenya. Pembentukan zona bening di sekeliling koloni bakteri yang tumbuh telah menunjukkan bahwa koloni bakteri tersebut dapat tumbuh dan mampu memanfaatkan senyawa PAHs Phenantrene sebagai sumber karbon dalam metabolismenya.

P5Sand A 120 Phenantren (mg/ 100 80 60 40 20 0 0 5 10 15 20 25 30 35 Waktu inkubasi (jam)

Gambar 1. Degradasi phenantrene oleh biak M5

147

0369 x +0.8 0.3887 Y= 0.7 38.3% Salinitas 5% 0 Td (jam) 15.018 0.8869 R2 = 0.25 18.7 0.6 0.1 0 0 24 48 72 Waktu (jam) OD 600 nm 40 0 C 30 0 C 96 1.17 pada Alcanivorak borkumensis pH/Suhu/Salinitas Persamaan Linear R2 Persamaan μ (jam -1) Linear penentuan μ pH 7.2 1 0.0266 1.2273 R2 = 0.9 0.3344 Y= 0.8 Y= 0.8 0.9977 2 0.9459 R 2 = 0.3958 Y=0.9701 R = 0.4 OD 600 nm 1 0.9685 R2 = 0.302 Y=0.2 0.17 Gambar 2.0266x + 0.6 0.0437 pH 5.3 0.5 25.6 1.0476 0.4 0. Pertumbuhan bakteri Alcanivorak berkumensis M5 pada media dengan salinitas suhu dan pH yang berbeda 148 .018 x +0.2 0 0 24 48 Waktu (Jam) 72 96 pH 7.2 1 0.0476 x + 0.8 pH 5.0369 0.3% Salin 5% 1.33 14.8 0.0143x + 0.2 0 0 24 48 Waktu (jam) 72 96 Salin3.79 48.Dyah Supriyati Tabel 2.9704 0.4 0.5 0.94 Y= 0.0437 x + 0.17 30 C 40 0C Salinitas 3.501 R2 = 0.6 0.4 0. Persamaan linear waktu dengan Ln N untuk penentuan nilai μ dan td dari pH 7.4 OD 600 nm 1.0143 0.8 dan pH 5.6 1.

bakteri M5 adalah salah satu mikroba yang dapat berperan penting dalam proses biostimulasi pada biodegradasi kasus tumpahan minyak di lingkungan laut tropis.3% terbentuk dua sel baru hasil pembelahan biner dari sel induk bakteri M5. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Salinitas 5% (25. Nilai waktu generasi M5 ini lebih cepat.bakteri mempunyai waktu generasi 18.17).79 jam Nilai waktu generasi M5 ini lebih cepat. 2. Sedangkan.17 Media Media Gambar 3.5 Berat sel (gr/l) 1..3 % lebih baik dibandingkan dengan 5.3% Salin 5% pH 5. dengan td 14.05 0 Salin3.94 jam) Pertumbuhan biak M5 (Alcanivorak berkumensis) pada media dengan suhu 30 oC lebih baik dibandingkan dengan 40oC.4 0. Di salinitas 5%.15 0. Produksi sel (kiri) dan PHB (kanan) bakteri Alcanivorak borkumensis M5 pada media air laut 149 .25 0. secara umum bakteri dapat tumbuh dengan baik pada kisaran salinitas 1%-5%.5 jam di salinitas 3. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada pH 5. Dengan td 18. salinitas maupun pH yang serupa dengan asalnya.3%. dan produksi sel).5 jam berarti bakteri mempunyai waktu generasi 14. Pada media dengan salinitas 3. Pada media dengan pH 7.33 jam) Biak M5 tidak dapat tumbuh baik pada media dengan pH rendah (5.3 %.17 PHB mg/g sel 2 0.5 0 Salin3. Artinya setiap 14.1 0. pH dan Temperatur Bagi biak M5 (Alcanivorax berkumensis) pertumbuhan pada media dengan salinitas 3. Dilihat dari 3 parameter di atas (waktu generasi.5 1 0.25jam) Produksi sel terbanyak dicapai oleh biak M5 yang tumbuh pada media air laut dengan salinitas 3.Biodegradasi Phenantrene oleh Mikroba Laut M5 Uji Pertumbuhan dengan Variasi Salinitas.35 0. dapat ditarik kesimpulan bahwa bakteri M5 tumbuh baik pada kondisi temperatur.3% Salin 5% pH 5. pertumbuhan bakteri M5 mulai lemah. jika dibandingkan dengan waktu generasi bakteri M5 yang tumbuh pada Suhu 40oC (38. Nilai waktu generasi M5 pada suhu 30oC ini lebih cepat. Dilihat dari sifatnya terhadap berbagai salinitas lingkungan perairan ini.5 jam. seperti misalnya di perairan laut Indonesia. laju pertumbuhan.2 0.8 bakteri M5 mempunyai td 15.3 0. Hal ini menunjukkan bahwa.17 (45.7 jam.3 %. bakteri ini bisa dikategorikan sebagai bakteri laut tropis.7 jam . Hal ini menunjukkan bahwa bakteri ini tumbuh paling optimal pada salinitas 3.

58:3117–3121. 1990) pada proses anaerobik-aerobik.. Brodkorb. 2006 recovery bakteri laut pada penanaman menggunakan medium seawater ini adalah berkisar 2 – 60%. dimana lebih tinggi dari yang didapat dengan medium konvensional (kurang dari 0.atas bantuan yang diberikan hingga selesainya tulisan ini.J. UCAPAN TERIMA KASIH Ucapan terima kasih penulis sampaikan kepada Dr. &R L. yang berperan pada proses degradasi phenantrene. 1990. Microbiol. perlu diteliti lebih lanjut. Environ. 30:31–71. bakteri M5 justru sel membentuk PHB paling sedikit. Pada media yang relatif optimum untuk pertumbuhannya.8) Kemungkinan isolat M5 mampu membentuk PHB.3 % . CE. metabolism. pada media air laut mengandung phenantrene. Produksi PHB PHB (polyhydrxybutirate) merupakan salah satu senyawa penting yang berperan sebagai elektron aseptor (Anderson & dawes. Microbial degradation of polycyclic aromatic hydrocarbons. 1984.Pada media dimana pertumbuhan bakteri M5 terlihat terhambat. suhu 30oC dan pH mendekati netral (7. Rev. metabolic role. Kemungkinan peran PHB pada degradasi phenantrene perlu penelitian lebih lanjut. dan nampaknya senyawa ini juga berperan pada proses degradasi phenenantrene. A. & E A. Enhanced biodegradation of phenanthrene in oil tar-contaminated soils supplemented with Phanerochaete chrysosporium. 54:450–472. Dengan tumbuhnya bakteri M5 tersebut. sel jusru membentuk PHB lebih banyak.1%). Made Sudiana. TS. 1992. DAFTAR PUSTAKA Anderson. Media seawater ini dipilih karena menurut Springael.Dyah Supriyati Degradasi Phenanthrene Pada uji degradasi Phenanthrene ini. KESIMPULAN Alkanivorax borkumensis M5 merupakan mikroba laut yang berperan dalam degrdasi phenantrene. karena menggunakan rangkaian botol L yang berisi medium air laut steril terfiltrasi dan dilarutkan senyawa phenanthrene sebagai satu-satunya sumber karbon (tidak dilakukan penambahan sumber karbon lain) dengan konsentrasi 100 mg/L. Microbiol. menunjukkan bahwa bakteri tersebut dapat memanfaatkan sumber karbon hanya dari phenantrene. Legge. Microbiol. Cerniglia. Appl. tumbuh optimum pada salinitas 3. Dawes. 150 .Adv. Occurrence. Appl. and industrial uses of bacterial polyhydroxyalkanoates.

Karlson. Vila. H. S. Kasai & K. strain AP1. Janssen. Wattiau. Microbiol. Lo´pez. 8:836–847. AR. Detection of microbial growth on polycyclic aromatic hydrocarbons in microtiter plates using the respiration indicator WST-1. MP. J. Karlson. Appl.. AM. M. Ortega-Calvo. Hausner. Rulkens. Grifoll. Uyttebroek. Environ. B. Evaluation of bacterial strategies to promote the bioavailability of polycyclic aromatic hydrocarbons (PAHs). Prediction of complete bioremediation periods for PAH soil pollutants in different physical states by mechanistic models. & U. Chemosphere 43:1085– 1094. U. Biotechnol. Shutsubo. L. Johnsen. 68:2683–2689. Breure & WH. M. 63:452–459. Distribution of the Mycobacterium community and polycyclic aromatic hydrocarbons (PAHs) among different size fractions of a longterm PAHcontaminated soil. 2002. C. 1999. Breugelmans. A. Bastiaens. Biotechnol. D. J. 1:63–70 Johnsen. ARK. Ryngaert. Microbiol. 70:747–756. Bendixen. Mulder. Microbiol. Springael. Environ. Joffe. Karlson. 2006.&U. 2001.. Microbiol. Memasukkan: Agustus 2009 Diterima: September 2009 151 . H. Appl. Kishira. Mol. 2006.Biodegradasi Phenantrene oleh Mikroba Laut M5 Harayama. P. Metabolism of fluoranthene by Mycobacterium sp. Y. Appl. 2004. JJ. Petroleum biodegradation in marine environments. Microbiol. Minguillo´n & M. Z. Biotechnol.

Wood. 1983. JR. Bogor : Institut Pertanian Bogor. tanpa mengubah jenis huruf. Pola Pertanian. & MT. 151-158. A. Informasi dari Internet : Schulze. Daftar pustaka ditulis secara abjad menggunakan sistem nama-tahun. β. R.. Tesis. NAMA PENULIS (yang disertai dengan alamat Lembaga/ Instansi). H.R. Buku : Chaplin. Gambar dalam bentuk grafik/diagram harus asli (bukan fotokopi) dan foto (dicetak di kertas licin atau di scan). W. Gambar dan Tabel di tulis dan ditempatkan di halam terpisah di akhir naskah.5 cm dengan program pengolah kata Microsoft Word dan tipe huruf Times New Roman berukuran 12 point. 1999. 2000. Detection and Identification of Lories and Pottos in The Wild. 15 –18 Oktober 1982. foto. MF. 1982. Abstrak : Suryajaya. Identification of plasmids linked with polyglutamate production in B. & SW. Suhartono. Contoh penulisan pustaka acuan sebagai berikut : Jurnal : Hara. Enzyme Technology. Abstrak Pertemuan Ilmiah Mikrobiologi. . maksimal 250 kata). Penggunaan nama suatu tumbuhan atau hewan dalam bahasa Indonesia/Daerah harus diikuti nama ilmiahnya (cetak miring) beserta Authornya pada pengungkapan pertama kali. No. BAHAN DAN CARA KERJA. & C. 248-277. KATA KUNCI (maksimal 6 kata). χ.. ASM. Setiap halaman diberi nomor halaman secara berurutan. 1 (2009) PANDUAN PENULIS Naskah dapat ditulis dalam bahasa Indonesia atau bahasa Inggris. Disertasi : Kemala. T..html.). Vol 6. 15-16 Februari 2000. Prosiding Seminar nasional Industri Enzim dan Bioteknologi II. 1987. PENDAHULUAN. P. Naskah disusun dengan urutan: JUDUL (bahasa Indonesia dan Inggris).E. Kata dalam bahasa asing dicetak miring. Information for surveys/Estimated of population density. Ueda. & N. Suwanto. Dalam : Gerhart. Jakarta. & S. kanan. http//www.G. Apll.A. Prosiding : Mubarik. ABSTRAK (bahasa Inggris. Gen. 1994. P. J. Zhang. Batas dari tepi kiri 3 cm. dan bawah masingmasing 2.[Disertasi]. Perkembangan tanaman polong-polongan utama di Indonesia. HASIL. Industri Perdagangan Kelapa dan Kelapa Sawit di Indonesia. D. Skripsi.J. NR. PEMBAHASAN. Isolasi dan karakterisasi protease ekstrasellular dari bakteri isolat termofilik ekstrim. Methods for General and Molecular Bacteriology. Naskah dikirimkan ke alamat Redaksi sebanyak 3 eksemplar (2 eksemplar tanpa nama dan lembaga penulis). Krieg (eds. 42. 1990.1. atas. Drew. subtilis. Microbiol. Washington. dan lain-lain dimasukkan melalui fasilitas insert.. Penulisan simbol α. Jakarta . S. 29: 345-354.species. Cambridge University Press. Biol. Murray. dan tabel disertai CD. Bab dalam Buku : Gerhart. Cambridge. Bucke. Indon. Liquid culture.net/primates/loris/ lorCp. Naskah diketik dengan spasi ganda pada kertas HVS A4 maksimum 15 halaman termasuk gambar. UCAPAN TERIMA KASIH (jika diperlukan) dan DAFTAR PUSTAKA.

Heryanto MSc. Fredinan Yulianda Fakultas Perikanan dan Ilmu Kelautan-IPB Dr. Puslit Biologi-LIPI Ir. Hari Sutrisno. Rugayah. Majariana Krisanti MSi.1 (2009) UCAPAN TERIMA KASIH Jurnal Biologi Indonesia mengucapkan terima kasih dan penghargaan kepada para pakar yang telah turut sebagai penelaah dalam Volume 6. Vol 6. No. Indon. Puslit Biologi-LIPI Edisi ini dibiayai oleh DIPA Puslit Biologi-LIPI 2009 . No 1. Biol. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr.J. Puslit Biologi-LIPI Ir. Desember 2009: Dr. Niken Tunjung Murti Pratiwi. Fakultas Perikanan dan Ilmu Kelautan-IPB Dr.

Habib Rizjaani. Indon. Agustina K. Kartono Identifikasi Papasan (Coccinia grandis (L.) Sri Widawati & Maman Rahmansyah Karakteristik Tipe Pakan Kelelawar Pemakan Buah dan Nektar di Daerah Perkotaan: Studi Kasus di Kebun Raya Bogor Sri Soegiharto & Agus P.J. Sibuea Pengaruh Inokulasi Bakteri Terhadap Pertumbuhan Awal Jarak Pagar (Jatropha curcas L. Biol. Vol 6. 1 (2009) Toksisitas Isolat-Isolat Bacillus thuringiensis yang Mengandung Gen cry 1A Terhadap Hama Penggerek Batang Jagung. No.) Voigt) Di Tiga Populasi di Yogyakarta Ridesti Rindyastuti & Budi Setiadi Daryono Biodegradasi Phenantrene oleh Mikroba Laut M5 (Alcanivorax Borkumensis) yang Diisolasi dari Teluk Jakarta Dyah Supriyati 97 107 119 131 143 . Ostrinia furnacalis Guenee Bahagiawati.

Sign up to vote on this title
UsefulNot useful