Anda di halaman 1dari 6

Pilihlah jawaban yang paling benar . a,b,c,d, atau e! 1.Aliran darah yang bergerak paling lambat terjadi pada.

a.arterio b.aorta c.kapiler d.vena e.venula 2. Kemungkinan untuk memperoleh keturunan dengan genotip AaBbCc x AaBbCc a.1/2 b.1/4 c.3/4 d.1/16 e.1/64 3.Sel saraf yang berfungsi untuk mengirimkan impuls dari system saraf pusat ke otot dan kelenjar adalah a.Neuron aferen b.neuron intermedier c.neuron eferen d.neuron sensori e.neuroglia 4.bagian sel yang dimiliki oleh eukariot maupun sel prokariot adalah a.mitokondria b.retikulum endoplasma c.badan golgi

d.ribosom e.membran nucleus 5.Fertilisasi pada tumbuhan dari golongan angiospermae terjadi didalam a.sigma b.stilus c.ovarium d.ovulum e.karpelum 6.Jaringan dasar tumbuhan yang berfungsi memperkuat jaringan lain dan dapat berubah menjadi meristematis adalah a.kambium b.mesenkim c.kolenkim d.parenkim e.sklerenkim Petunjuk nomor 10 Pilihan: a.jika pernyataan benar, alasan benar dan keduanya menunjukan hubungan sebab akibat b.jika pernyataan benar, alasan benar tetapi keduanya tidak menunjukan hubungan sebab-akibat c.jika pernyataan benar dan alasan salah d.jika pernyataan salah dan alasan benar e.jika pernyataan salah dan alasan salah B: dipergunakan dalam

menjawab soal nomor 7 sampai ke

Petunjuk 7.Melalui proses isolasi reproduksi darat terbentuk spesies baru SEBAB Isolasi reproduksi dapat mencegah pertukaran gen antar populasi yang mempunyai sifat genotip berbeda 8.Achatina fulica bersifat hermaprodit, tetapi melakukan perkawinan silang SEBAB Achatina fulica memiliki ovarium dan testis yang menghasilkan gamet pada waktu berbeda 9.Lisosom adalah salah satu organel sel yang berperan dalam pencernaan intra sel SEBAB Lisosom mengandung bermacam-macam enzim hidrolisis yang berfungsi dalam proses pencernaan 10.Pada siklus hidup tumbuhan Gymnospermae, sporofit akan menghasilkan megaspore dan mikrospora dalam satu konus tunggal SEBAB nomor 15 Pilihan:

C:

dipergunakan

dalam

menjawab soal nomor 11 sampai ke

a.Jika 1,2, dan 3 benar b.Jika 1 dan 3 benar c.Jika 2 dan 4 benar d.Jika hanya 4 yang benar e.Jika semua benar 11.Antigen yang masuk ke dalam tubuh manusia direspon secara spesifik oleh. 1) Selaput lender 2) Sel leukosit 3) Sel fagosit 4) Antibodi 12.Karakteristik berikut yang dimiliki tumbuhan paku adalah 1) Sporofit mempunyai akar,batang,dan daun sejati 2) Sporofit mempunyai pembuluh pengangkut dan klkorofil 3) Gametofitnya disebut protalus 4) Gametofitnya bersifat autrotof 13.Pengembangan rekayasa genetika dalam bidang kedokteran menyangkut hal berikut 1) Pembuatan antibody monoclonal 2) Terapi gen 3) Pembuatan 4) Vaksin

Pada tumbuhan Gymnospermae, pembentukan biji terjadi melalui proses pembuahan tunggal

A. otot 14.Pada system reproduksi manusia,peristiwa berikut yang terjadi pada fase ovulasi adalah 1) Kadar esterogen meningkat,produksi FSH dihambat 2) Kadar esterogen meningkat,LH dihasilkan 3) Folikel mengkerut berubah menjadi korpus loteum 4) Endometrium menjadi tipis 15.Pernyataan berikut yang benar dalam proses fermentasi adalah 1) Hasil akhir berupa bahan organic 2) Berlangsung di dalam sitoplasma 3) Berlangsung tanpa oksigen 4) Diproduksi ATP dan NADH2 19. Kelebihan glukosa pada sel hewan disimpan dalam bentuk A. glukosa Petunjuk A : dipergunakan nomor 23. dalam B. sukrosa C. glikogen D. laktosa E. peptidoglikan 20. Bagian akar tumbuhan dikotil dewasa berikut yang TIDAK jelas batasnya bila dilihat dengan menggunakan mikroskop cahaya adalah A. tudung akar B. rambut akar C. perisikel D. korteks E. empulur 18. Pertumbuhan dan perkembangan awal dari zigot tumbuhan lumut akan B. saraf C. epitelium D. ikat E. darah

membentuk A. protalium B. protonema C. sporogonium D. tumbuhan lumut E. arkegonium

menja-wab soal nomor 16 sampai ke

16. Organel sel berikut hanya dimiliki oleh tumbuhan, KECUALI A. vakuola B. plastida C. sentriol D. dinding sel E. kloroplas 17. Mukosa usus halus dihasilkan oleh selsel penyusun jaringan

21. Hal yang pertama kali terjadi ketika eritrosit manusia dimasukkan ke dalam medium akuades adalah A. air sel keluar B. hemoglobin keluar C. akuades masuk ke dalam sel D. membran sel mengkerut E. sel pecah

a.jika pernyataan benar, alasan benar dan keduanya menunjukan hubungan sebab akibat b.jika pernyataan benar, alasan benar tetapi keduanya tidak menunjukan hubungan sebab-akibat c.jika pernyataan benar dan alasan salah d.jika pernyataan salah dan alasan benar e.jika pernyataan salah dan alasan salah

22. Diketahui mRNA memiliki urutan basa N: AUGGCUAGGCUAUAAAUGCGAUCC GAUUGA. bila sintesis protein... dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 23. Hujan asam dapat terjadi apabila di atmosfer banyak mengandung gas A. CO2 B. CO C. N2 D. S02 E. CH4 Petunjuk nomor 26 B: dipergunakan dalam 26. Penyerbukan pada tumbuhan dioecious tidak dapat terjadi secara autogami. SEBAB umbuhan dioecious mempunyai bunga jantan dan betina yang terpisah dalam satu pohon. Petunjuk nomor 30 C: dipergunakan dalam 24. Kupu-kupu dan lebah digolongkan dalam ordo yang sama. SEBAB Penggolongan ordo pada insekta didasarkan pada tipe metamorfosisnya. 25. Sel yang mula-mula terbentuk di alam adalah sel autotrof. SEBAB Klorofil sel autotrof mampu menangkap energi sinar matahari.

menjawab soal nomor 24 sampai ke

menjawab soal nomor 27 sampai ke

Pilihan:

Pilihan:

a.Jika 1,2, dan 3 benar b.Jika 1 dan 3 benar c.Jika 2 dan 4 benar d.Jika hanya 4 yang benar e.Jika semua benar

30. Kerusakan hipofisis anterior mamalia betina dapat berakibat terganggunya fungsi 1. kelenjar tiroid 2. kelenjar susu 3. kelenjar anak ginjal 4. ovarium

27. Pernyataan

berikut

yang

berkaitan

dengan teori Lamarck adalah 1. lingkungan berpengaruhi terhadap proses evolusi organisme 2. makhluk hidup beradaptasi melalui organ tubuhnya 3. perubahan organ tubuh diwariskan kepada keturunannya 4. seleksi alam memacu kepunahan organisme 28. Pemecahan senyawa kompleks menjadi lebih sederhana dengan memanfaatkan aktivitas mikroorganisme dapat dilakukan dengan cara 1. biofermentasi 2. bioremediasi 3. biodegradasi 4. bioakumulasi

29. Lisosom dapat dihasilkan oleh 1. badan Golgi 2. membran inti 3. retikulum endoplasma 4. membran sel

Kunci jawaban 1.c 2.e 3.c 4.d 5.d 6.d 7.d 8.a 9.a 10.d 11.d 12.e 13.e 14.a 15.a 16. c 17. c 18. c 19. c 20. c 21. c 22. b 23. d 24. e 25. d 26. c 27. a 28. a 29. b 30. e