Anda di halaman 1dari 65

Cermin 1996

Dunia Kedokteran
International Standard Serial Number: 0125 – 913X

110. Penyakit Hati


Juli 1996

Daftar Isi :
2. Editorial
4. English Summary
Artikel
5. Biologi Molekuler Hepatitis C dan Aplikasi Diagnostiknya –
Suwarso
9. Upaya Pengembangan Vaksin Hepatitis C – Djoko Yuwono,
Retno Iswari
15. Evaluasi Faal Hati pada Penderita Tuberkulosis Paru yang Men-
dapat Terapi Obat Anti Tuberkulosis – Zulkarnain Arsyad
19. Program Imunisasi Masal Hepatitis B di Indonesia – Nuchsan
Umar Lubis
21. Penyakit Hati pada Kehamilan – AB Wardoyo
26. Diagnostik. Thalassemia dengan Polymerase Chain Reaction –
Sunarto
32. Pengembangan Uji Diagnostik melalui Teknik Molekuler –
Roch man Na ‘im
35. Tanaman Obat Bersifat Antibakteri di Indonesia – B.
Dzulkarnain, Dian Sundari, Ali Chozin
49. Obat-obat Anti Epilepsi Baru – Budi Riyanto W.
56. Berbagai Determinan yang Mempengaruhi Penilaian Pasien ter-
hadap Pelayanan Medis – Benyamin Lumenta, Reflinar
61. Pengalaman Praktek
62. Abstrak
64. RPPIK
Para peneliti di Indonesia tidak mau ketinggalan dalam penelitian/pe-
ngembangan biologi molekuler; beberapa di antaranya ditujukan untuk pengem-
bangan vaksin dan diagnostik beberapa penyakit, antara lain hepatitis dan tha-
lassemia. Hasil-hasilnya dapat Sejawat pelajari dalam Cermin Dunia Ke-
dokteran edisi ini Masih men genai faal hati, artikel Zulkarnain Arsyad seyogya-
nya meningkatkan kewaspadaan kita terhadap kemungkinan efek samping peng-
obatan.
Artikel B. Dzulkarnain dkk. mengenai tanaman obat layak dipelajari ka-
rena mungkin dapat dimanfaatkan dan dilanjutkan dengan penelitian-penelitian
klinis.
Sedangkan bagi para Sejawat yang berminat terhadap masalah pelayanan
kesehatan, artikel Benyamin Lumenta dkk. memberikan data penting yang dapat
dimanfaatkan untuk meningkatkan pelayanan.
Selamat membaca,

Redaksi

2 Cermin Dunia Kedokteran No. 110, 1996


Cermin
Dunia Kedokteran
International Standard Serial Number: 0125 – 913X

KETUA PENGARAH REDAKSI KEHORMATAN


Prof. Dr Oen L.H. MSc
– Prof. DR. Kusumanto Setyonegoro – Prof. DR. Sumarmo Poorwo Soe-
KETUA PENYUNTING Guru Besar Ilmu Kedokteran Jiwa darmo
Dr Budi Riyanto W Fakultas Kedokteran Universitas Indonesia, Staf Ahli Menteri Kesehatan,
Jakarta. Departemen Kesehatan RI,
PEMIMPIN USAHA Jakarta.
Rohalbani Robi – Prof. Dr. Sudarto Pringgoutomo
Guru Besar Ilmu Patologi Anatomi – Prof. DR. B. Chandra
PELAKSANA Fakultas Kedokteran Universitas Indonesia, Guru Besar Ilmu Penyakit Saraf
Sriwidodo WS Jakarta. Fakultas Kedokteran Universitas Airlangga,
Surabaya.
TATA USAHA – Prof. Drg. Siti Wuryan A. Prayitno
Sigit Hardiantoro SKM, MScD, PhD. – Prof. Dr. R. Budhi Darmojo
Bagian Periodontologi Guru Besar Ilmu Penyakit Dalam
ALAMAT REDAKSI Fakultas Kedokteran Universitas Diponegoro,
Fakultas Kedokteran Gigi
Majalah Cermin Dunia Kedokteran Universitas Indonesia, Jakarta Semarang.
Gedung Enseval
Jl. Letjen Suprapto Kav. 4, Cempaka Putih – Prof. DR. Hendro Kusnoto Drg.,Sp.Ort – DR. Arini Setiawati
Jakarta 10510, P.O. Box 3117 Jkt. Laboratorium Ortodonti Bagian Farmakologi
Fakultas Kedokteran Gigi Fakultas Kedokteran Universitas Indonesia,
NOMOR IJIN Universitas Trisakti, Jakarta Jakarta,
151/SK/DITJEN PPG/STT/1976
Tanggal 3 Juli 1976
DEWAN REDAKSI
PENERBIT
Grup PT Kalbe Farma
– Dr. B. Setiawan Ph.D - Prof. Dr. Sjahbanar Soebianto
PENCETAK Zahir MSc.
PT Temprint – DR. Ranti Atmodjo
PETUNJUK UNTUK PENULIS
Cermin Dunia Kedokteran menerima naskah yang membahas berbagai sesuai dengan urutan pemunculannya dalam naskah dan disertai keterangan
aspek kesehatan, kedokteran dan farmasi, juga hasil penelitian di bidang- yang jelas. Bila terpisah dalam lembar lain, hendaknya ditandai untuk meng-
bidang tersebut. hindari kemungkinan tertukar. Kepustakaan diberi nomor urut sesuai dengan
Naskah yang dikirimkan kepada Redaksi adalah naskah yang khusus untuk pemunculannya dalam naskah; disusun menurut ketentuan dalam Cummulated
diterbitkan oleh Cermin Dunia Kedokteran; bila telah pernah dibahas atau di- Index Medicus dan/atau Uniform Requirements for Manuscripts Submitted
bacakan dalam suatu pertemuan ilmiah, hendaknya diberi keterangan mengenai to Biomedical Journals (Ann Intern Med 1979; 90 : 95-9). Contoh:
nama, tempat dan saat berlangsungnya pertemuan tersebut. Basmajian JV, Kirby RL. Medical Rehabilitation. 1st ed. Baltimore. London:
Naskah ditulis dalam bahasa Indonesia atau Inggris; bila menggunakan William and Wilkins, 1984; Hal 174-9.
bahasa Indonesia, hendaknya mengikuti kaidah-kaidah bahasa Indonesia yang Weinstein L, Swartz MN. Pathogenetic properties of invading microorganisms.
berlaku. Istilah media sedapat mungkin menggunakan istilah bahasa Indonesia Dalam: Sodeman WA Jr. Sodeman WA, eds. Pathologic physiology: Mecha-
yang baku, atau diberi padanannya dalam bahasa Indonesia. Redaksi berhak nisms of diseases. Philadelphia: WB Saunders, 1974; 457-72.
mengubah susunan bahasa tanpa mengubah isinya. Setiap naskah harus di- Sri Oemijati. Masalah dalam pemberantasan filariasis di Indonesia. Cermin
sertai dengan abstrak dalam bahasa Indonesia. Untuk memudahkan para pem- Dunia Kedokt. l990 64 : 7-10.
baca yang tidak berbahasa Indonesia lebih baik bila disertai juga dengan abstrak Bila pengarang enam orang atau kurang, sebutkan semua; bila tujuh atau lebih,
dalam bahasa Inggris. Bila tidak ada, Redaksi berhak membuat sendiri abstrak sebutkan hanya tiga yang pertama dan tambahkan dkk.
berbahasa Inggris untuk karangan tersebut. Naskah dikirimkan ke alamat : Redaksi Cermin Dunia Kedokteran,
Naskah diketik dengan spasi ganda di atas kertas putih berukuran kuarto/ Gedung Enseval, JI. Letjen Suprapto Kav. 4, Cempaka Putih, Jakarta 10510
folio, satu muka, dengan menyisakan cukup ruangan di kanan-kirinya, lebih P.O. Box 3117 Jakarta.
disukai bila panjangnya kira-kira 6 - 10 halaman kuarto. Nama (para) penga- Pengarang yang naskahnya telah disetujui untuk diterbitkan, akan diberitahu
rang ditulis lengkap, disertai keterangan lembaga/fakultas/institut tempat secara tertulis.
bekerjanya. Tabel/skema/grafik/ilustrasi yang melengkapi naskah dibuat sejelas- Naskah yang tidak dapat diterbitkan hanya dikembalikan bila disertai
jelasnya dengan tinta hitam agar dapat langsung direproduksi, diberi nomor dengan amplop beralamat (pengarang) lengkap dengan perangko yang cukup.

Tulisan dalam majalah ini merupakan pandangan/pendapat masing-masing penulis


dan tidak selalu merupakan pandangan atau kebijakan instansi/lembaga/bagian tempat
kerja si penulis.
Cermin Dunia Kedokteran No. 110, 1996 3
English Summary
EVALUATION OF LIVER FUNCTION LIVER DISEASES IN PREGNANCY investigations, but molecular
AMO PATIENTS TREATED WITH study is needed to determine the
OAT AB Wardoyo genotype and for the prenatal
Internist, Semarang, Indonesia diagnosis. In the molecular study,
Zulkarnain Arsyad the DNA should be first amplified
Dept. of Internal Medicine, Faculty of and among the amplification
Medicine, Padjadjaran University, Ban- Various liver diseases during techniques polymerase chain
dung, Indonesia. pregnancy have been discussed. reaction is the simplest and the
The jaundice in pregnant most rapid one. The procedure
woman may be peculiar to preg- can in vitro amplify a DNA seg-
The administration of anti nancy, such as acute fatty liver, ment million times. It has been
tuberculosis drugs may cause toxaemias, intrahepatic chole- used extensively in the molecular
various side effects including stasis and hyperemesis gravi- studies.
liver function disorders. darum; or as intercurrent jaun- While amplifying a DNA seg-
The study on the tuberculosis dice during pregnancy, such as ment, polymerase chain reaction
out patients had been carried viral hepatitis, gallstones, hepa- can detect gene deletion di-
out to evaluate liver function totoxic drugs and underlying rectly. A procedure based on
disorders caused by anti tuber- cirrhosis. polymerase chain reaction prin-
culosis drugs from September The most common cause of ciples using allele specific oligo-
1993 to December 1993. Thisstudy jaundice in pregnancy is viral nucleotide primer(s), called
found 28% elevation of SGOT, hepatilis, then followed conse- amplification refractory mu-
SGPT and Alkali Phosphatase cutively by intrahepatic chole- tation system (ARMS), can de-
value among 1 & 2 months- stas and gallstones. tect mutant(s) directly. Reverse
treated patients, 27% among 3 & Several changes in liver func- dot blot hybridization on poly-
4 months-treated patients, and tion during pregnancy have to merase chain reaction product
57% among 5 & 6 months-treated be detected, especially in third using allele specific oligonucleo-
patients. The elevation of SGOT, trimester, such as increased alka- tide probe(s) has many advan-
SGPT and Alkali Phosphatase line phosphatase, globulin and tages. Either ARMS or RDB proce-
were not more than twice of cholesterol; and decreased al- dure, both have very high sensi-
normal value. The liver function bumin level. tivity and specificity, need only a
disorders was also influenced by
short time, and are relatively
anemia and old age. Regular liver Abw
inexpensive. Using appropriate
functions monitoring was re- Cermin Dunia Kedokt. 1996; 110:21-5
allele specific oligonucleotide(s),
commended for tuberculosis pa-
either as probe(s) or primer(s),
tients which were treated by anti
THALASSEMIA DIAGNOSIS WITH commonly occured mutants in a
tuberculosis drugs, especially
POLYMERASE CHAIN REACTION certain population can be de-
when accompanied by anemia
tected easily.
and old age.
Sunarto
S
Za Dept of Child Health. Dr. Sardjito General
Cermin Dunia Kedokt. 1996;110: 26-31
Cermin Dunia Kedokt. 1996; 170: 15-8 Hospital/Gajah Mada University, Yogya-
karta. Indonesia.

The clinical diagnosis of tha-


lassemia syndrome is not difficult
to establish with relatively simple

4 Cermin Dunia Kedokteran No. 110, 1996


Artikel
TINJAUAN KEPUSTAKAAN

Biologi Molekuler Hepatitis C


dan Aplikasi Diagnostiknya
Dr. Suwarso PhD
Laboratorium Patologi Klinik, Seksi Virologi-immunologi,
Fakultas Kedokteran Universitas Gadjah Mada, Yogyakarta

PENDAHULUAN menternya (ss-cDNA). Seterusnya olekenzim DNA-Polimerase


Sejak tersedianya test diagnostik (1975) untuk hepatitis akan diproduksi banyak ss-cDNA yang secara spontan akan
virus A (HVA) dan hepatitis virus B (HVB), maka menjadi jelas membentuk double-heliksnya (ds-cDNA). Kode-kode genetik
bahwa mayoritas kasus hepatitis post-transfusi (HPT) tidak di- pengsintesaan antigen VHC yang sekarang ada di ds-cDNA,
sebabkan oleh virus hepatitis A (VHA) ataupun B (VHB), juga selanjutnya direkonstruksi atau direkombinasi dengan fragmen
tidak disebabkan oleh virus-virus hepatotropik lain seperti virus DNA yang dapat bereplikasi dengan cepat yakni DNA dari
Cytomegalo (CMV) dan Epstein-Barr (EBV)(1). Meskipun waktu vektor plasmid atau bakteriofage (? 1). Akhirnya dengan
itu nama virus hepatitis C (VHC) telah diusulkan untuk meng- memasukkan vektor-vektor ini ke dalam jamur (Saccharomyces
gantikan nama HPT (HNANB = Hepatitis Non-A, Non-B)(2,3,4), cerevisiae) atau bakteri inangnya (E. coli) akan dihasilkan klon-
namun karena metode serologi konvensional yang digunakan klon yang memproduksi protein antigen VHC dalam jumlah
(pada waktu itu merupakan satu-satunya metode yang diandal- yang berlebihan (Gambar 1).
kan) tidak mampu mendeteksi adanya antigen atau antibodi virus Gambar 1. Isolasi mRNA Virus Hepatitis C dan Pemproduksian KIT EIA/
penyebab, maka nama VHC usulan Choo et al. yang dapat di- RIBA-Anti-VHC secara Rekombinan
terima setelah mereka pada tahun 1989 secara rekombinan pada
Bakteriofage λgt 11 berhasil mengisolasi sebagian genom virus
penyebab HPT dan regio NS4 yang mengkode pengsintesaan
protein antigen 5.1.1 dan plasma penderita HNANB kronik(5).
Kini seluruh genom dan protein antigen yang dikodenya
telah berhasil diisolasi dan disintesis secara rekombinan pada
vektor Bakteriofage atau Plasmid. Analisis serologik memper-
lihatkan bahwa antigen-antigen tersebut bereaksi dengan serum
penderita HNANB dan sejak itu pula diketahui bahwa VHC me-
rupakan penyebab pokok Karsinoma Hepatoseluler (KHS) di
negara-negara maju seperti Amerika, Eropa, Jepang dan meru-
pakan penyebab pokok untuk kasus-kasus Hepatitis Kriptogenik
di Itali(5).
Teknik rekombinan ini diawali dengan pengisolasian mRNA
(sumber gen yang mengkode protein antigen VHC) yang ada
dalam pelet dan plasma Chimpanzee yang bertiter infeksius
tinggi (≥ 108 CID/ml). Oleh enzim Reverse Transcriptase,
dari setiap isolat mRNA niaterial infeksius akan dibentuk atau
dikopi satu single strand DNA homolog atau DNA komple-

Dipresentasikan pada simposium sehari tentang "Deteksi Awal & Penanggu-


langan Hepatitis B dan C dalam Peningkatan Sumber Daya Manusia". Solo
(PAPDI). 18 Juni 1994.

Cermin Dunia Kedokteran No. 110, 1996 5


Protein Antigen hasil rekayasa genetik (rekombinan) ini 5-UTR merupakan bagian, genom VHC tempat proses pem-
akhirnya digunakan sebagai alat untuk mendeteksi antibodi bacaan (translasi) kode-kode genetik dimulai. Dia memiliki
yang ada dalam sirkulasi darah penderita HVC, dapat secara panjang 341 nt dan merupakan rantai yang sangat conserved,
ELISA (Enzynze linked immunoassay) atau RIBA (Recombinant artinya berbagai jenis genom VHC di berbagai negara (USA,
immunoblotassay) (Gambar 1). Australia, Italia, Jepang, Argentina, Afrika Selatan dan Taiwan)
Mengingat bahwa VHC merupakan virus hepatitis yang memiliki rantai 5-UTR yang identik(11). Lokasi 5-UTR tepat
pertama yang dapat dideteksi dengan cara molekuler biologi, upstream (di depan) ORF, dan memiliki peranan yang sangat
maka dalam artikel ini akan diterangkan molekuler biologi VHC penting dalam proses replikasi atau pengsintesaan protein anti-
dan aplikasi diagnosisnya. gen virus. Di dalam replikasi atau pengsintesaan protein virus, 5-
UTR berperan sebagai regulator (pengatur replikasi virus), hal
STRUKTUR VIRION DAN SIFAT-SIFATNYA ini didukung dengan sifat-sifatnya sangat conserved, letaknya
VHC merupakan virus yang berenvelope, yang menginfeksi yang direk upstream dan ORF, memiliki kodon-kodon initiator
sel hati dengan perubahan-perubahan tubuler sitoplasma. Dari AUG (kode-kode genetik untuk mengawali atau menginisiasi
studi filtrasi diketahui bahwa virion atau virus utuh yang meng- replikasi atau pengsintesaan protein antigen virus) dan memiliki
induksi perubahan tubuler sitoplasma memiliki diameter < 80 kode-kode genetik untuk IRES (internal ribosome entry site)
nm(6) atau antara 30–60 nm(7), dan dengan elektron mikroskop yakni kode-kode genetik yang memungkinkan mRNA virus
36–62 nm(8). Buoyant density virion yang diukur dengan gradien berikatan dengan ribosom pembuat protein-protein (polipeptida)
densitas sukrosa adalah 1,14–1,18 g/cm3(8), dan 1,30–1,36 g/cm3 antigen virus di sel hati.
dengan CsCl(6). Dari dan hasil analisis sedimentasi disimpulkan Letak IRES pada 5’ UTR ini membentang dari nt 101–332,
bahwa koefisien sedimentasi VHC <200S(8). sedang codon initiatornya (AUG) pada posisi nt 76 (AUG-76), 87
VHC merupakan virus yang berenvelope karenanya infek- (AUG-87), 206 (AUG-206), 333 (AUG-333). Dari empat kodon
tivitasnya dapat ditiadakan dengan pelarut-pelarut lemak seperti initiator yang dimiliki oleh VHC, ternyata kodon yang ke-IV,
kloroform dan beta-Propiolakton atau dengan pemanasan 60°C yang digunakan oleh VHC untuk mengawali replikasi atau
selama 30 menit(6). pengintesaan proteinnya. Hal ini dimungkinkan, sebab rantai
5’- dan 3’-UTR yang mengapit ORF mengandung berturut-turut
STRUKTUR DAN FUNGSI GENOM VIRUS struktur ‘Cap” dan ‘Poly-A”, yang merupakan petunjuk bagi
Seperti terlihat pada gambar 2, VHC merupakan virus-virus ribosom untuk memilih kodon AUG yang dapat digunakan se-
single strand RNA (ss-RNA). Genomnya bertipe positive- bagai start-codon, agar diperoleh pengsintesaan protein antigen
strand RNA dengan panjang kurang lebih 9400 nukleotida (nt). virus yang efisien(12).
Genom terbagi dalam tiga bagian: dua bagian berupa regio Selanjutnya atas dasar kemiripan susunan regio struktural
yang tidak ditranslasi (UTR = untranslation regio) yakni 5’-UTR (C, El) dan non-struktural (NS2-NSS), memperlihatkan bahwa
di ujung 5, 3-UTR di ujung 3, dan satu bagian merupakan regio genom VHC mirip dengan genom virus dan famili Plavi- atau
yang ditranslasi yang disebut open reading frame (ORF). Regio- Pesti-virus (Gambar 3). Hanya saja gp48 pada Pestivirus dan
regio yang tidak ditranslasi terletak pada kec ujung genom Protein M (Matriks) pada Plavivirus menghilangkan pada VHC.
VHC, dengan demikian kedua UTR tersebut mengapit regio Dengan demikian masuk akal bahwa genom regmo struktural
yang ditranslasi (ORF). VHC adalah lebih pendek daripada genom regio struktural Pesti-
ORF memiliki panjang 9030–9099 nt (membentang mulai dan Plavivirus. Sedang regio NS2-NS5 dari ketiga virus relatif
dan nt 342). Di dalam ORF inilah disimpan kode-kode genetik memiliki panjang yang identik.
untuk pengsintesaan 7–9 protein antigen virus, berturut-turut
adalah protein antigen struktural core dan struktural envelope-I, Gambar 3. Struktur genom VHC dibanding dengan Plavi- dan Pestivirus.
gp = Glikoprotein, P = Protein, C = Core, M = Matriks, E =
masing-masing disimpan di ORF di regio C dan El; protein
Envelope,NS=Non-struktural, aa= Asam amino, nt =Nukletida,
antigen non-struktural-1 atau envelope-2 (NS1/E2), non-struk- 5’ & 3’ = untranslasi regio (UTR) (Modifikasi dari Choo. et.al.
tural-2, -3, -4 (4a, 4b) dan -5 (5a, 5b), masing-masing disimpan 1990).
di regio NS1/E2, NS2, NS3, NS4 (NS4a, NS4b) dan NS5 (NS5a,
NS5b)(9,10).Keseluruhan protein antigen yang dikode oleh ORF
ini tersusun dan 3010–3011 aa.
Gambar 2. Susunan Genom Virus Hepatitis C dan Produk Antigennya

PROTEIN ANTIGEN VIRUS DAN ANTIBODINYA


Protein (polipeptid) antigen virus yang dikode oleh ORF
genom VHC kini secara rekombinan telah dapat dipurifikasi dan

6 Cermin Dunia Kedokteran No. 110, 1996


ditentukan masing-masing arti klinisnya. Protein antigen core sebagian regio NS3, tapi sudah dengan protein Ag yang dikode
yang berhasil dipurifikasi adalah GOR, CP9, JCC, Po dan C22- oleh seluruh regio NS3 dan akhirnya pada EIA generasi terbaru/
3. Aspek klinis antibodi yang ditujukan pada antigen-antigen ini generasi-III (mendeteksi adanya anti-HCV-C825) protein Ag
merupakan petanda (marker) infeksius. Kecuali antibodi ter- yang dikode oleh regio NS5 ditambahkan (Gambar 4).
hadap antigen GOR, antibodi-antibodi terhadap antigen-antigen
core lainnya hampir 90% dapat terdeteksi dalam sirkulasi darah Gambar 4. Susunan Genom Virus Hepatitis C dan Produk Antigen Ko-
mersialnya
penderita HVC kronis, dan dengan metode Polymerase Chain
Reaction (PCR) umumnya dapat diketahui bahwa serum-serum
mereka memiliki RNA-VHC (Gambar 4). Peran antibodi ter-
hadap antigen-antigen core ini adalah membantu diagnosis VHC
pada kasus-kasus anti-C 100-3 (Ab terhadap antigen NS3-NS4)
negatip, yang pendeteksian RNA-VHC belum dikerjakan. Ke-
cuali antigen GOR, pengsintesaan antigen CP9, JCC, Po dan
C22-3 ada di bawah pengaruh kode-kode genetik yang ada di
dalam regio C dan ORF genom VHC. Antigen GOR merupakan
auto-antigen sintetik yang dikode oleh rantai genom sel hospes
dan tampaknya dia merupakan antigen nuklear sel hospes.
Protein Envelope-i merupakan protein yang terglikosilasi
(Glikoprotein =gp)dengan beratmolekul 33 Kilo Dalton (gp33),
dikode oleh regio El. Protein ini merupakan selubung terluar
VHC dan dinominasikan merupakan antigen yang dapat meng-
induksi antibodi yang dapat menetralkan virus. Dengan demi
kian merupakan novel antigen untuk mengembangkan vaksin. Antibodi-antibodi terhadap protein-protein antigen ini
Protein E2/NSI juga merupakan protein yang terglikosilasi merupakan marker infeksius, sebab banyak terdapat pada pende-
dengan berat molekul 72 Kilo Dalton (gp72), dikode oleh regio rita-penderita HVC kronik (Gambar 5).
E2/NS 1 dan genom VHC. Protein ini merupakan selubung kedua
Gambar 5. Positive rate epitope HCV dengan test konfirmasi Polymerase
seperti pestivirus, atau protein npn-struktural- 1 terluar seperti Chain Reaction (PCR). Modifikasi dari Yatsuhashi et .al.(1993).
Plavivirus. Adanya regio yang hypervariable pada regio E2/NS1,
ini menandakan bahwa protein atau antigen yang dikodenya
merupakan protein atau antigen yang dapat menginduksi anti-
bodi yang dapat menetralkan virus. Tapi nyatanya antibodi
terhadap antigen-E2 (Anti-E2) ini, lebih dan 50% terdeteksi pada
penderita-penderita HVC kronik, dan menghilang pada pende-
rita-penderita HVC yang berespon terhadap terapi interferon
(Yokosuka et al. 1993). Dengan demikian antibodi-E2 me-
rupakan marker replikasi VHC.
Protein NS2, NS3, NS4 dan NS5 merupakan protein non-
struktural dengan berat molekul berturut-turut 23kd (p23), 60kd
(p60), 52kd (p52) dan 1 l6kd (p116), dikode berturut-turut oleh
regio NS2, NS3, NS4 dan NS5 genom VHC. p23 dan p52 me-
miliki fungsi membran binding, p60 merupakan enzim protease/
helikase yang digunakan untuk sintesa protein virus, sedang
p116 merupakan enzim polimerase/reflikase yang berfungsi di
dalam reflikasi genom VHC (Gambar 2). Sebagai alat diagnos-
tik, produk antigen-antigen yang dikode oleh regio ini telah
tersedia secara komersial, dan dan Kit-diagnostik generasi lama
ke generasi yang lebih baru sensitivitas dan spesifisitasnya selalu
ditingkatkan dengan cara mengkombi nasikan antigen-antigen
ini. Pada EIA-Anti-HCV generasi-I, yakni EIA untuk mendeteksi TIPE, SUB-TIPE DAN DISTRIBUSI VIRUS
adanyaanti-HCV-Cl00-3 digunakan kombinasi protein antigen Sejak genom VHC berhasil dianalisis(5). Kini minimal di
yang berhasil diisolasi oleh Choo et al. yakni Ag 5.1.1 (Ag yang dunia secara genotipeada 7 tipe pokok VHC, yakni VHC I-VII
dikode oleh regio NS4) dengan protein antigen yang dikode oleh (Tabel 1). Masing-masing tipe berdasarkan pada persamaan
sebagian regio NS3; Pada EIA generasi-II yakni EIA untuk (homolog) nukleotida yang menyusun regio genomnya (ho-
mendeteksi antibodi-HCV-C200, protein antigen yang dikom- molog nt <72% signifikan berbeda) kemudian dapat dibagi lagi
binasikan pada Ag 5.1.1 tidak hanya protein Ag yang dikode oleh ke dalam 2–3 subtipe (a–c). Prevalensi sub-tipe tampak ber-

Cermin Dunia Kedokteran No. 110, 1996 7


variasi antara daerah geografik yang berbeda. VHC-I (subtipe Aspek klinis lain dengan adanya subtipe adalah timbulnya
1a) yang berhasil diisolasi dan chimpanzee yang diinfeksi oleh infeksi multipel, yakni satu individu mengalami infeksi berulang
faktor VIII konsentrat yang menyebabkan HNANB pada resi- oleh VHC. Jadi adanya infeksi multipel pada seseorang perlu
piennya (penderita hemofilia) banyak terdapat di USA, Australia mendapat perhatian yang serius, sebab mayoritas (>50%) indi-
dan negara-negara Eropa Barat. VHC-I (Ia) ini umumnya me- vidu yang terinfeksi oleh VHC dengan beda tipe, penyakitnya
rupakan VHC yang ditemukan pada penderita-penderita hemo- akan berjalan kronis dan umumnya di dalam tubuh penderita ini
dialisis. VHC- 1a tidak diketemukan pada 52 penderita hepatitis akan terdeteksi lebih dari satu tipe VHC.
kronik dan sirosis hati, tapi sebaliknya umum pada penderita- Mengingat bahwa awal timbulnya kasus dan terdeteksinya
penderita yang dihemodialisis(9). Di Yogyakarta kami menemu- VHC adalah dan pemakaian darah dan produk-produknya se-
kan bahwa VHC-subtipe-1a merupakan VHC yang mayoritas ter- perti faktor-faktor pembekuan yang biasa digunakan pada kasus-
dapat pada pasien-pasien hemodiaIisis(10). VHC-II (1b) banyak kasus hemophilia, immunoglobulin yang diberikan untuk kasus-
terdapat di Jepang, Korea, Taiwan, China, dan di Indonesia kasus immunisasi pasif, dan bahkan vaksin-vaksin yang berasal
merupakan subtipe yang paling umum ditemukan (48%) pada dari donor plasma, pemakaian bahan-bahan ini perlu lebih se-
penderita-penderita penyakit hati kronis dan umumnya meru- lektif.
pakan subtipe yang berespon jelek terhadap terapi interferon.
Sub-tipe Ic (HC-G9, Td-6?), sejauh ini merupakan subtipe yang
spesifik ada di Indonesia; Subtipe ini lebih banyak ditemukan
pada penderita-penderita sirosis hati dan pada hepatitis kronis KEPUSTAKAAN
(34% vs 20%). VHC-III (2a) dan IV (2b) merupakan VHC yang
1. Feinstone SM, Kapikian AZ, Purcell RH, AlterHJ, Holand PV. Transfusion
berespon baik terhadap Interferon. Tipe 2a banyak terdapat di associated hepatitis not due to viral hepatitis type A or B. N. Engl. J. Med.
Jepang dan di Indonesia tercatat >20% sebaliknya tipe 2b ter- 1975; 292: 767–70.
dapat di Jepang dan tidak ditemukan di Indonesia. VHC-V (3a) 2. Prince AM, Brotman B, Grady GF et al. Long incubation posttransfusion
di Thailand, Inggris, Brazil dan sejauh ini tidak ada di Indonesia, without serological evidence of exposure to hepatitis B virus. Lancet 1974;
2: 241–246.
VHC-VI (3b) di Thailand dan Jepang, VHC-VII (4a) di Afrika 3. Shirachi R, Tateda A, Shiraishi H, Kikuchi K, Ishida N. “Hepatitis C”
Selatan(9). antigen in NANB-postransfusion hepatitis. Lancet 1978; 2: 853–856.
4. Villarejos VM, Provos PJ, Ittensohn OL, McLean AA, Hilleman MR.
Tabel 1. Tipe dan Subtipe VHC Seroepidemiologic investigations of human hepatitis caused by A, B and a
Tipe Subtipe Genotipe Isolat Keterangan posible third virus. Proc. Soc. Exp. Biol. Med. 1976; 152: 524–528.
5. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M.
1 A I USA Hemodialisis Isolation of a cDNA clone derived from a blood-borne NANB-viral
Eropa hepatitis genome. Science. 1989; 244: 359–62.
Australia 6. BradleyDW, McCaustland KA, Cook EH, SchableCA, EbertiW, Maynard
Indonesia JE. Posttransfusion NANBH in Chimpanzees: Physicochemical evidence
B II Jepang Hepatitis kronis that the tubule-forming agent is small, enveloped virus. Gastroenterol.
Korea Kebal interferon 1985; 88: 773–79.
Taiwan 7. He LF, Ailing D, Popkin T, Shapiro M, Alter HJ, Purcel RH. Determining
China the size of non-A, non-B hepatitis virus by filtration. J. Infect. Dis. 1978;
Indonesia 156: 636–40.
C Indonesia Sirosis hati 8. Hollinger FB. Non-A, non-B hepatitis viruses. In: Field BN, Knipe DM.
2 A III Jepang Peka interferon Eds. Virology, second ed. Vol. 2. New York: Raven Press 1990; 2:
Indonesia 2239–2273.
B IV Jepang Peka interferon 9. Hotta H., Handajani R, Lusida MI, Widawati, Doi H, Miyajima H, Homma
3 A V Thailand M. Subtype analysis of hepatitis C virus in Indonesia on the basis of NS5b
Inggris region sequences. 2nd Nat Congr Indonesian Society for Clinical Patho-
Brazil logy (PDS PATKLIN), Surabayn Januari, 29–3 12, 1994.
B VI Thailand 10. Hotta H, Doi H, Hayashi T, Mariyam, Lusida INI, Widawati, Homma M.
Jepang Sequence analysis of hepatitis C virus obtained from Indonesia patients
4 VII Afrika Selatan and identification of novel sequence variants. Viral Hepatitis and Liver
Disease. 1994 (in press).
11. Hari JH, Shyamala V, Richman KH et al. Characterization of the terminal
regions of hepatitis C virus RNA: identification of conserved sequences in
Telah diketahui bahwa virus-virus RNA mudah sekali untuk the 5’ untranslated region and poly (A) tails at the 3’ end. Proc. Natl. Acad.
mutasi secara spontan(13). Karenanya masuk akal jika perbedaan Sci. USA 1991; 88: 1711–15.
tipe dan virulensi ini muncul pada VHC. Adanya perbedaan tipe 12. Kohara KT, lizuka N, Kohara M, Nomoto A. Internal ribosome entry site
ini karena di antara VHC yang berhasil diisolasi memiliki per- within hepatitis C virus RNA. J. Virol. 1992; 66: 1476–1483.
13. Domingo E, Martinez-Salas E et al. The Quasispecies (extremely hetero-
bedaan panjang atau adanya substitusi pada jumlah nukleotida gene) nature of viral RNA genome populations: Biological relevance-a
yang menyusun rantai genomnya (tapi dan kebanyakan isolat review. Gene 1985; 40: 1–8.
yang ada, hanya regio Core dan NS3 yang konservasi). Selan- 14. Yatsuhashi H, Inokuchi K, lnoue 0 et al. The clinical significance of
jutnya perbedaan subtipe ini memegang peran pula dalam berat reactivity to individual epitopes of the hepatitis C viral genome. Gastro-
enterol. Jpn. 1993; 28. (Suppl. 5): 6–1l.
ringannya hepatitis dan respon terhadap terapi interferon.

8 Cermin Dunia Kedokteran No. 110, 1996


TINJAUAN KEPUSTAKAAN

Upaya Pengembangan
Vaksin Hepatitis C
Ojoko Yuwono*, Retno Iswari S.**
Jakarta - Indonesia
* Peserta Program Pendidikan Pasca Sarfana Bidang Studi Ilmu Biomedik Universitas Indonesia, Jakarta
** Bag. Mikrobiologi, FKUJ Jakarta, selaku Pembimbing

RINGKASAN
Virus hepatitis C, merupakan penyebab Hepatitis Pasca Transfusi; Sirosis Hepatis
Aktif dan Karsinoma Hepatoselular. Prevalensi HCV sangat bervariasi tergantung letak
geografi. Sampai saat ini telah diketahui paling tidak terdapat 6 genotipe HCV. Peng-
obatan infeksi HCV dilakukan dengan pemberian interferon, masalahnya adalah tim
bulnya genotipe HCV yang non responsif interferon. Pencegahan infeksi HCV dapat
dilakukan dengan uji tapis anti HCV pada donor darah. Akan tetapi pencegahan bentuk
sporadik HCV hanya dapat dilakukan dengan imunisasi HCV.
Telah dikembangkan suatu vaksin rekombinan untuk pencegahan infeksi HCV,
dengan merekayasa suatu virus vaksinia yang berisi genom struktural HCV. Ekspresi
virus pada sd mamalia menghasilkan glikoprotein kompleks E1-E2/NS1, besarnya 33 kD
dan 72 kD, yang bersifat imunogenik dan menghasilkan titer antibodi yang tinggi pada
chimpanse.
Dikemukakan pula adanya kontroversi kekebalan humoral yang tidak dapat mem
benkan proteksi terhadap reinfeksi HCV tipe homolog ataupun tipe heterolog, dalam uji
coba infeksi HCV pada chimpanse. Di lain fihak dikemukakan pula vaksinasi yang meng
gunakan teknologi transfer gen dengan cara menginjeksikan plasmid yang berisi genom
nukleoprotein (NP-DNA) virus influenza strain A/PR/8/38 (H1N1) secara intramuskular
ke dalam mencit BALB/c. Pengujian daya proteksi dilakukan dengan infeksi vitus dosis
letal galur virus influenza A/HK/68 (H3N2) yang merupakan virus virulen pada mencit.
Hasilnya menunjukkan bahwa mencit yang diberi NP-DNA dapat terlindung dan ke
matian akibat infeksi virus dosis letal. Selanjutnya diusulkan agar model teknologi
transfer gen dipakai dalam pengembangan vaksin terhadap infeksi HCV.

PENDAHULUAN hadap khloroform. Virus ini sangat berbahaya karena dapat


Virus hepatitis C pertama kali disebut sebagai virus hepatitis menyebabkan sirosis hepatis aktif yang berkembang menjadi
NonA Non B, ialah suatu virus ssRNA positif, yang mempunyai hepatokarsinoma; selain itu menjadi terkenal sejak ditemukan-
diameter 30–60 nm, mempunyai envelop, bersifat sensitif ter- nya sebagai penyebab hepatitis pasca transfusi(1,2,3).

Dipresentasikan pada Seminar Program Pendidikan Pasca Sarjana Bidang Studi


Ilmu Biomedik Universitas Indonesia, Jakarta 26 November 1994

Cermin Dunia Kedokteran No. 110, 1996 9


Penelitian seroepidemiologi infeksi HCV pada donor darah akan dipakai untuk pencegahan infeksi HCV.
menunjukkan bahwa di Eropa Barat prevalensinya antara 0,01 –
0,7% yang didominasi HCV tipe-1, tipe-2 dan tipe-3, di Australia STRUKTUR DAN ORGANISASI GENOM VIRUS HEPA-
HCV tipe- I dan tipe-2. Begitu pula di Jepang dan Taiwan yang TITIS C
dominan HCV tipe-1 dan tipe-2, prevalensinya pada donor darah Genom virus Hepatitis C diketahui pertama kali oleh Choo
antara 1,0–1,7%. Telah ditemukan tipe baru di Hong Kong, yang QL, dkk. (1989) dan Takamizawa A, dkk. (1991) yang merupa-
dikenal dengan HCV tipe-6. Di Eropa Timur yang dominan kan suatu ORF (Kerangka Baca Terbuka-open reading frame)
adalah HCV tipe-2 dan tipe-3 dan prevalensi pada donor darah yang panjang, sekitar 9.416 bp (pasangan basa). Terdiri dari
sebesar 1,0%. Di Mesir yang dominan adalah HCV tipe-4, terminal 5 NCR (Daerah Bukan Sandi-non coding region) yang
dengan prevalensi pada donor darah 8,6%(3,4). Sedangkan di merupakan daerah yang sangat konserv pada berbagai genotipe
Indonesia diduga tipe yang dominan adalah HCV tipe-1 dan tipe- HCV. Diduga mempunyai peran penting dalam replikasi virus
2. Prevalensi HCV pada donor darah di beberapa kota besar di yaitu pada tahap translasi, dan panjangnya 5’ NCR sekitar 341 nt.
Indonesia sekitar 3,4%(5). Selanjutnya diteruskan dengan daerah struktural yang terdiri dari
Selama ini pengobatan infeksi HCV ditakukan dengan daerah inti (C: Core), panjangnya sampai nukleotida no. 700 dan
pemberian interferon (INF) akan tetapi cara ini menimbulkan mengekspresi 191/192 asam amino. Kemudian region envelop
beberapa masalah yaitu terjadinya infeksi persisten HCV dan (El), panjangnya sampai nukleotida no: 1400 dan mengekspresi-
mutasi genetik HCV sehingga bersifat non responsif INF. Ter- kan asam amino sampai ke no. 383/384. Berikutnya adalah
jadinya infeksi persisten ini diduga disebabkan oleh beberapa region E2 (NSI), panjangnya sampai nukleotida no. 2400 dan
faktor antara lain: 1. Bloking ekspresi MHC I pada permukaan sel mengekspresikan asam amino sampai no.750. Dilanjutkan dengan
yang terinfeksi, 2. Supresi respon imun pada sel yang terinfeksi daerah non struktural (NS) yang terdiri dan NS2, NS3, NS4a,
disebabkan oleh kerusakan sel atau terjadinya imunotoleran yang NS4b dan NS5 yang mengekspresikan asam amino sampai no.
terjadi karena bloking produksi interferon, dan 3. Kerusakan 1000; 1500; 1960 dan 3011. Diitkhiri dengan terminal 3’ UTR
sistem transkripsi atau translasi protein, sehingga terjadi mutasi (daerah yang tidak ditranslasi-) yang diidentifikasi sebagai arus-
spontan pada virus(1,6,7). turun (downstream) dan ORF tersebut, yang diketahui terdiri
Pencegahan infeksi HCV dapat dilakukan dengan uji tapis dari 27–55 nt, tergantung dan tipe virusnya. Pada daerah ini juga
anti HCV pada donor darah, sehingga transfusi darah dipastikan ditemukan adanyapoly A yang hanya ditemukan pada HCV yang
bebas HCV. Namun bagi bentuk sporadik HCV pencegahan mempunyai terminal 3’ UTR 27 nt, sedangkan pada HCV dengan
dengan imunisasi merupakan suatu keharusan. Sampai saat ini 3’ UTR 55 nt tidak ditemukan adanya poly A(2,10,11) (Gambar 1).
berbagai penelitian telah dilakukan untuk mencari protein yang
paling mungkin untuk dipakai sebagai antigen yang immuno- Gambar 1. Skema struktur da fungsi genom DCV(1)
genik dan menghasilkan antibodi netralisasi yang bersifat pro-
tektif. Ternyata yang memungkinkan adalah protein yang
diekspresikan oleh region E (envelop), walaupun sebetulnya
tinggi titer antibodi HCV dan kaitannya terhadap antibodi pro-
tektif pada infeksi HCV sampai saat ini masih belum jelas.
Penelitian menggunakan protein kompleks E1-E2 yang telah
dipurifikasi menunjukkan bahwa imunisasi pada chimpanse
menghasilkan antibodi dengan titer tinggi yang diduga merupa-
kan antibodi netralisasi. Namun belum diketahui dengan pasti
apakah antibodi yang dihasilkan tadi bersifat protektif(8). Teori
mengenai kekebalan protektif pada infeksi HCV sebetulnya
masih kontroversial. Di satu fihak ada peneliti yang berpendapat
bahwa penggunaan vaksin konvensional dengan melibatkan
sistem kekebalan humoral sudah dapat memberikan daya pro-
teksi terhadap infeksi HCV(8), tetapi penelitian lain membuktikan
bahwa kekebalan yang dihasilkan vaksin konvensional (protein
envelop E-E2) hanya bersifat homotipik(20). Sehingga, ada kelom- Homologi sekuens asam amino terhadap berbagai virus lain
pok peneliti yang berpendapat perlunyadirekayasa suatu vaksin ternyata menunjukkan bahwa HCV merupakan suatu virus barn.
yang cara kerjanya melibatkan baik kekebalan humoral yang Daerah 5’ NCR mirip dengan keluarga Picornaviridae, daerah
memproduksi antibodi spesifik ataupun kekebalan selular de- struktural dan non struktural mirip dengan Flaviviridae. Sekuens
ngan sasaran terjadinya sitolisis sel yang terinfeksi HCV(9,10). asam amino pada daerah NS3 menunjukkan adanya hubungan
Tujuan penulisan artikel ini adalah ingin memberikan dengan Flavivirus (virus Dengue, Japanese Encephalitis, Yellow
gambaran tentang berbagai upaya yang telah dilakukan dalam fever), namun hubungannya lebih dekat dengan Pestivirus (Bovine
pengembangan vaksin serta adanya kontroversi mengenai anti- viral diarrhea dan Hog cholera virus) yang semuanya termasuk
bodi yang protektif dan kaitannva dengan bentuk vaksin yang dalam kelompok Flaviviridae(10,11). Tabel 1 menunjukkan hu-

10 Cermin Dunia Kedokteran No. 110, 1996


bungan HCV dengan berbagai jenis virus dalam Flaviviridae Gambar 2. Perbandingan prevalensi antigen c-100-3,cp-9 dan cp-10 pada
serum penderita HCV menurut lamanya sakit(16)
berdasarkan homologi sekuens asam amino.

Tabel 1. Hubungan philogenetik antara virus Hepatitis C dengan ber-


bagai virus dalam keluarga Flaviviridae

HCV HOG BVD TBE JEV YFV DEN WNF KUN TVM
HCV – 51 52 41 41 40 38 37 33 47
HOG – – 169 38 34 33 35 37 33 47
BVD – – – 39 34 34 38 36 37 48
TBE – – – – 91 87 90 90 93 35
JEV – – – – – 88 118 159 163 35
YFV – – – – – – 94 95 90 39
DEN – – – – – – – 117 121 36
WNF – – – – – – – – 177 34
KUN – – – – – – – – – 35
TVM – – – – – – – – – –

Keterangan
HCV : Virus Hepatitis C YFV : Virus Yellow Fever
HOG : Virus Hog Cholera DEN : Virus Dengue
BVD : Virus Bovine Diarrhea WNF : Virus West Nile Fever
TBE : Virus Tick Borne Encephalitis KUN : Virus Kunjin
JVE : Virus Japanese Encephalitis TVM : Virus Tobacco Mozaic

BEBERAPA JENIS ANTIGEN SINTETIK UNTUK IMU- Penggunaan identifikasi serologi ini mungkin berguna bagi
NODIAGNOSIS daerah yang tidak memiliki fasilitas untuk penyimpanan RNA-
Untuk kepentingan imunodiagnosis telah dihasilkan antigen HCV pada teknik RT-PCR(17).
yang diperoleh dengan melakukan klon dan genom HCV dari Seperti dikemukakan terdahulu, telah diisolasi berbagai
region struktural (Core, Envelope dan NS 1), yang kemudian protein HCV dengan cara mengekspresi genom HCV, kapsid
dibuat suatu rekombinan menggunakan vektor virus. Rekom- (C), non struktural (NS) dan envelop (E) pada berbagai sistem
binan virus ini dapat menghasilkan protein rekombinan pada ekspresi, antara lain : sistem ekspresi baculovirus pada sel
berbagai teknik sistem ekspresi, antara lain: sistem ekspresi sd serangga, sistem ekspresi pada sel mamalia dengan virus vaksinia
mamalia atau menggunakan sistem ekspresi baculovirus pada sel rekombinan. Hasilnya menunjukkan bahwa protein yang
serangga. Telah dihasilkan protein yang besarnya 18 kD, 33 kD, diekspresi oleh gen El dan E2INSI merupakan protein yang
72 kD yang diduga merupakan protein yang diekspresikan oleh bersifat imunogenik pada chimpanzee dan menghasilkan titer
gen Core (C), envelop (El) dan gen E2/NS1(8,14,15,16). Dengan antibodi tinggi. Namun ujicoba untuk mengetahui apakah anti-
menggunakan antigen tersebut berhasil dilakukan imunodiagno- bodi tersebut dapat meinberikan proteksi terhadap infeksi HCV
sis HCV, sehingga dengan menggunakan antigen tersebut anti masih belum jelas hasilnya. Grakoui dkk. (1993) mencoba me-
HCV dapat dideteksi; yaitu: kit diagnostik ELISA generasi I, lakukan karakterisasi protein yang diekspresi oleh gen El dan
menggunakan antigen c-100-3 (Chiron Corp.), suatu polipeptida E2; diketahui bahwa dengan melarutkan dalam larutan SDS
berasal dari region NS4. Kit diagnostik ELISA Generasi II, (Sodium Dodecyl Sulfat), protein El dan E2 merupakan protein
menggunakan antigen c-22-c dan c-33 (RIBA Corp.), poli- yang terpisah dan dihubungkan oleh ikatan disulfida(16). Sedang-
peptida yang berasal dari region Core dan envelop. Okamoto, kan menurut Ralston dkk. (1993) dengan menggunakan Triton
dkk. (1992) menganjurkan penggunaan polipeptida cp-9 dan X-100, diketahui bahwa tidak terdapat ikatan disulfida antara
cp-10 yang berasal dari region Core (C) di samping hanya protein El dan E2 (Gambar 4). Protein El -E2 merupakan suatu
menggunakan antigen c-100-3 saja, tujuannya untuk me- kompleks protein yang dapat menstimulasi terjadinya antibodi
ningkatkan sensitivitas pemeriksaan(4,16). Pada Gambar 2 dapat dengan titer tinggi pada chimpanzee(8). Antibodi ini diduga
diketahui perbedaan prevalensi penggunaan antigen c-l00-3, merupakan antibodi netralisasi, yang terbentuk oleh adanya
cp-9 dan cp- 10 pada serum penderita HCV menurut lamanya glikoprotein multimerik kompleks El-E2. Berbeda dengan yang
sakit(16). ditemukan Grakoui, dkk. serokonversi tidak terbentuk karena
Machida dkk. (1992) berhasil membuat suatu peptida sintetik protein El dan E2 merupakan protein monomerik yang ter-
identik dengan protein kapsid, yaitu peptida IPKARRPEGRT- pisah(8,15).
WAQPGY yang konserv pada HCV genotipe-1 dan genotipe-2
serta IPKADRRSTGKSWGKPGY yang konserv pada geno- TEKNOLOGI TRANSFER GEN SEBAGAI MODEL
tipe-3 dan genotipe-4. Dengan menggunakan antigen sintetik ini PENGEMBANGAN VAKSIN VIRUS
ternyata dapat dibedakan dua serotipe HCV, HCV serotipe-1 Imunisasi chimpanzee dengan kompleks glikoprotein murni E1-
identik dengan HCV genotipe- 1 dan genotipe-2, sedangkan E2 yang diekspresi oleh vaksinia virus rekombinan menun-
HCV serotipe-2 identik dengan HCV genotipe-3 dan genotipe-4. jukkan bahwa sebagian terkena infeksi HCV sebagian lagi tidak,

Cermin Dunia Kedokteran No. 110, 1996 11


Gambar 3. Glikoprotein envelop HCV yang diekspresi oleh virus vaksinia lebih dahulu diinfeksi oleh virus influenza A/PR/8/34 (H1N1)
rekombinan pada sel mamalia
secara in vitro. Lebih lanjut dapat dibuktikan juga bahwa sel
limfa mencit yang diinjeksi NP-DNA dan kemudian diaktivasi
dengan Concanavalin A (Con A) dan IL-2, ternyata dapat me-
lisiskan sel target yang diinfeksi oleh virus influenza strain
virulen mencit A/HK/68 (H3Ns) secara in vitro.
3) Bahwa pada injeksi i.m. plasmid yang berisi gen NP tersebut
juga menghasilkan antibodi yang tinggi, anti NP IgG. Hal ini
membuktikan bahwa penyuntikan NP-DNA tidak saja meng-
hasilkan CU spesifik, tapijuga menghasilkan antibodi spesifik.
Pemberian kekebalan pasif pada mencit dengan antiNP tidak
dapat menetralisasi virus A/HK/68. Penyuntikan NP yang di-
purifikasi pada mencit juga tidak menetralisasi virus A/HK/58.
Ternyata antibodi yang dihasilkan NP-DNA berbeda dengan
vaksinasi oleh virus utuh.
4) Membuktikan kekebalan protektif secara in vivo, tujuannya
untuk mengetahui apakah reaksi CU mempunyai daya proteksi
yang efektif; Mencit yang diimunisasi dengan NP-DNA (A/PR/
8/34 (H1N1) dichallenge dengan dosis letal virus virulen pada
mencit A/HK/68 (H3N2). Titer virus pada paru-paru mencit yang
divaksin ternyata 3 kali lebih rendah pada hari ke 7 setelah
challenge dibanding titer virus pada mencit yang tidak divaksi-
nasi dan yang divaksinasi dengan plasmid tanpa NP-DNA. Hal
Keterangan: ini membuktikan bahwa DNA (plasmid) tidak berperan dalam
M : Marker reaksi CU tersebut, selain itu kekebalan yang terbentuk mem-
1, 6, 11 : Virus Vaccinia berikan daya proteksi heterotipik.
2, 7, 12 : Virus Rekombinan Vaccinia/HCV
3, 8, 13 : Virus Rekombinan Vaccinia/C-E1
Kelompok peneliti lain(18), menyarankan untuk meman-
4, 9, 14 : Virus Rekombinan Vaccinia 59/C-El faatkan keberhasilan teknologi transfer gen tersebut sebagai
5, 10, 15 : Virus Rekombinan Vaccinia/E2-NS2 metoda yang tampaknya menjanjikan bagi vaksinasi Hepatitis C
yang diketahui mempunyai keanekaragaman genetik(4). Tekno-
namun masing-masing memiliki titer anti HCV yang cukup logi transfer gen ini merupakan suatu terobosan baru dalam
tinggi(8). Teori mengenai kekebalan protektif pada infeksi HCV teknologi vaksin dan tampaknya memang merupakan teknologi
memang masih kontroversial. Penelitian Farci, dkk. (1992) me- yang menjanjikan di masa depan.
nunjukkan bahwa pada imunisasi chimpanse dengan HCV yang Gambar 4. Survival mencit yang diimunisasi dengan NP-DNA setelah di-
berbeda strain, ternyata 3 tahun kemudian tidak dapat menetrali- challenge dengan virus Influenza vlrulen mencit galur /HK/68
sasi infeksi challenge doses HCV; masih ditemukan adanya (H3N2)(9)
viremia challenge virus HCV. Hal ini membuktikan adanya
kekebalan protektif pada chimpanse(19).
Ulmer et al (1993) berhasil mengembangkan teknologi
transfer gen, yaitu melakukan injeksi plasmid yang berisi suatu
gen yang mengkode nukleoprotein (NP) virus influenza strain
A/PR/8/34, secara intramuskuler pada sd otot bisep mencit
BALB/c.Teknologi ini merupakan suatu pengembangan teknik
transfer gen yang menggunakan naked-DNA yang mengkode
nukleoprotein virus influenza, yang dipakai dalam pengembang-
an teknologi vaksin influenza(9).
Dalam penelitian tersebut telah dibuktikan beberapa hal
antara lain:
1) Membuktikan bahwa plasmid yang berisi gen NP yang
diinjeksikan dapat masuk ke dalam sd otot mencit. Hal ini
dibuktikan dengan menggunakan teknik PCR, sebagai target
sekuensnya adalah 5’ nukleoprotein dan 3’ sekuens nukleotida
virus promotornya (Rous Sarcoma Virus).
2) Membuktikan bahwa telah terjadi reaksi CTL spesifik. Sel
limfa mencit yang diinfeksi NP-DNA ternyata dengan bantuan
IL,-2 rekombinan, dapat melisiskan sd limfa autolog yang ter-

12 Cermin Dunia Kedokteran No. 110, 1996


DISKUSI maka bukan tidak mungkin NP-DNA juga akan keluar masuk
Imunisasi dengan gabungan protein E1-E2 yang dihasilkan dalam berbagai jenis sel di dalam tubuh. Apakah hal tersebut juga
oleh virus vaksinia rekombinan pada sel mamalia telah mem- tidak akan menimbulkan efek samping lain?
buktikan bahwa kompleks protein tersebut dapat menimbulkan Berdasarkan argumentasi yang dikemukakan, maka dapat
titer antibodi yang tinggi pada chimpanse, walaupun pengujian disimpulkan adanya beberapa kemungkinan bentuk vaksin HCV
daya protektifnya masih dalam taraf penelitian. Namun, hasil yang kiranya dapat dikembangkan, yaitu:
penelitian ini terbentur pada fakta yang menunjukkan bahwa 1) Bentuk vaksin subunit yang berisi epitop protein envelop
dalam suatu studi prospektif in vivo pada chimpanse, ternyata HCV, yang dapat menstimulasi kekebalan humoral. Sudah tentu
kekebalan humoral yang terbentuk tidak dapat memberikan vaksin ini harus bersifat multimerik atau multiepitop bila ingin
proteksi terhadap reinfeksi heterolog HCV. Apabilajenis vaksin menghasilkan kekebalan yang bersifat heterotipik.
ini masih tetap akan dipakai untuk imunisasi Hepatitis C, maka 2) Bentuk vaksin polinukleotida atau naked DNA yang berisi
beberapa upaya harus dilakukan agar vaksin yang dihasilkan sekuens nukleotida yang sangat konserv dart virus yang ber-
cukup efektif. Perbaikan itu antara lain membuat suatu vaksin sangkutan sehingga dapat menstimulasi baik kekebalan selular
yang berisi epitop heterolog dan berbagai tipe HCV, sehingga maupun kekebalan humoral dan memberikan kekebalan hetero-
vaksin tersebut dapat memberikan kekebalan yang heterotipik(4,16). tipik.
Di lain pihak, kelompok peneliti lain mengusulkan agar
memanfaatkan keberhasilan teknologi transfer gen pada pe- PENUTUP
ngembangan vaksin influenza. Telah berhasil dibuktikan bahwa Infeksi HCV merupakan infeksi hepatitis yang berbahaya
imunisasi mencit dengan vaksin NP-DNA yang berisi nukleo- karena pada sekitar 50%–70% orang yang terinfeksi HCV akut
kapsid virus influenza strain AIPRJ8/34 (N1H1), selain meng- akan berkembang menjadi hepatokarsinoma; infeksi HCV
hasilkan reaksi CTL spesifik secara in vitro, juga menghasilkan menjadi lebih berbahaya oleh karena menyebabkan hepatitis
antibodi spesifik yang memberikan kekebalan heterotipik. Vaksi- pada penderita pasca transfusi darah. Pencegahan infeksi HCV
nasi NP-DNA ternyata dapat menetralisasi paparan virus dosis dapat dilakukan dengan uji tapis anti HCV, akan tetapi pada
letal strain virulen mencit A/HK/68 (H3N2) secara in vivo(9). bentuk sporadik Hepatitis C pencegahan hanya dapat dilakukan
Beberapa kelebihan dalam penggunaan dan produksi vaksin dengan imunisasi terhadap HCV. Untuk pencegahan infeksi
NP-DNA ini antara lain: HCV, dewasa ini telah dikembangkan suatu vaksin yang di-
• Cara imunisasinya yang mudah, dengan injeksi intra- lakukan dengan mengisolasi dan memurnikan kompleks protein
muskular. E1-E2 yang melibatkan sistem kekebalan humoral (kerjasama
• Cara produksinya yang mudah dengan mengkultur plasmid antara sel CD4+ dan sd limfosit B). Hasilnya ternyata protein ini
pada bakteri E. coli. dapat menstimulasi terbentuknya titer antibodi yang tinggi pada
• Cara purifikasinya yang lebih mudah, jika dibandingkan chimpanse, namun hasil ujicoba in vivo membuktikan bahwa
dengan purifikasi protein pada umumnya. kekebalan yang terbentuk bersifat homotipik.
• Vaksin jenis ini hanya menghasilkan polipeptida yang Keberhasilan pengembangan vaksin influenza yang
dikehendaki, jika dibandingkan dengan vaksin rekombinan menggunakan teknologi transfer gen (NP- pada plasmid) yang
menggunakan vektor virus. Oleh karena plasmid bersifat non diinjeksikan intramuskular ke dalam sel otot mencit BALB/c,
replikatif di dalam sd otot, sedangkan virus rekombinan juga merupakan suatu terobosan barn dalam teknologi vaksin di masa
menghasilkan protein yang diekspresi oleh genom vektornya. depan. Hasil penelitian menunjukkan bahwa secara in vitro
Sampai saat ini pertanyaan yang belum terjawab dan teori reaksi CTL spesifik dan antibodi spesifik dapat terbentuk. Hal ini
vaksin NP-DNA adalah mengapa sel Tc (CD8+) yang hanya membuktikan bahwa baik presentasi antigen ke pada sel Tc
distimulasi oleh suatu antigen tertentu, ternyata dapat memiliki (CD8+) oleh MHC-I ataupun presentasi antigen ke pada sd Th
sifat heterotipik. Kemungkinannya adalah bahwa sekuens nukleo- (CD4+) oleh MHC-ll dapat terjadi bersama. Secara in vivo,
tida yang dipakai untuk menghasilkan antigen tersebut bersifat imunisasi mencit dengan NP-DNA menunjukkan bahwa ke-
sangat konserv, sehingga oligopeptida yang dihasilkan, yang kebalan CTL yang dihasilkan bersifat heterotipik. Yaitu dapat
akan dipresentasikan ke sd Tc (CD8+) dapat menimbulkan efek menetralisasi dosis letal virus influenza strain virulen. mencit
yang bersifat heterotipik. Pada virus influenza telah terbukti A/HK/68 (H3N2). Keberhasilan inilah yang menggugah se-
bahwa sekuens nukleotida yang konserv dapat menghasilkan kelompok peneliti untuk mengembangkan suatu vaksin nukleo-
antibodi yang protektif terhadap paparan virus yang heterotipik. peptida terhadap HCV.
Namun, bagaimana halnya dengan virus-virus lainnya? Selain
KEPUSTAKAAN
itu telah diketahui bahwa virus Hepatitis C tidak sama dengan
virus influenza, terutama dalam hal sebagai penyebab hepato- 1. Houghton Met al. Molecular Biology of The Hepatitis C Viruses: implica-
karsinoma. Stimulasi terhadap aktivitas kekebalan selular pada tions for diagnosis, development and control of viral disease. Hepatology
respon imun yang disebabkan oleh infeksi virus onkogenik 1991; 14(2): 381–8.
diduga akan mempunyai efek samping yang lebih berat. Per- 2. Choo QL et al. Genetic organization and diversity of the hepatitis C virus.
Proc. Natl. Acad. Sci. 1991; 88: 2451–55.
tanyaan lain yang masih belum terjawab adalah mengingat sifat 3. Kiyosawa K et al. Review of Hepatitis C in Japan. J. Gastroenterol Hepatol
plasmid yang dengan bebas dapat keluar masuk dalam sel bakteri, 1991; 383–91.

Cermin Dunia Kedokteran No. 110, 1996 13


4. Meomish FM Ct al. Geographical distribution of Hepatitis C Virus geno- 12. Miller RH et al. Hepatitis C virus shares amino acid sequence similarity
types in blood donors: an International Collaboiration Survey. J Clin. with Pestivirus and Flavivirus as well as members of two plant virus
Mierohiol. 1994; 32: 884–92. supergroups. Proc. Natl. Acad. Sci. 1991; 87: 2057–61.
5. Sulaiman A et al. Epidemiologi Hepatitis C di Indonesia 1993. Makalah 13. Suzich JA et al. Hepatitis C virus NS3 protein Polynucleotide-Stimulated
pathi KONAS Vl PGI-PEGI dan Pertemuan llmiah PPHI Bandung, 30 Nucleoside Triphosphatese and comparison with related Pestivirius and
Nov.–4 Des. 1993. flavivirus Enzymes. J Virol. 1993; 67(10): 6152–58.
6. Yamaguchi K et al. Adaptation of Hepatitis C virus for persistent infection 14. Hsu HH et al. Characterization of Hepatitis C Virus Structural Proteins with
in patients with acute hepatitis. Gastroenterology 1994; 106: 1344–48. Recombinant Baculovirus Expression System. Hepatology 1993; 17:
7. Okuda M. HCV-RNA assay in peripheral blood mononuclear cells in 763–71.
relation to INF therapy. Gastroenterologia Japonica 1993; 28(4): 535–40. 15. Grakoui A et al. Expression and identification of Hepatitis C virus Poly-
8. Ralston Ret al. Characterization of Hepatitis C Virus Envelop Glycoprotein protein cleavage products. J Virol. 1993; 67(3): 1385–95.
Complexes expressed by Recombinant Vaccinia Viruses. J Virol 1993; 16. Okamoto H et al. Antibodies against synthetic oligopeptides deduced from
67(11): 6753–61. the putative Core gene for the diagnosis of Hepatitis C virus infection.
9. Ulmer BJ et al. Heterologous protection against Influenza by injection Hepatológy 1992; 15: 180–86.
DNA encoding a viral protein. Science 1993; 259: 1745-49. 17. Machida A et al. Two distinct subtypes of Hepatitis C virus defined by
10. Hari JH et al. Characterization of the terminal region of hepatitis C viral antibodies directed to the putative Core protein. Hepatology 1992; 16:
RNA: Identification of conserved sequences in the 5’ untranslated region 886–91.
and poly (A) tails at the 3 end. Proc. Nati. Acad. Sci. 1991; 88: 1711–15. 18. Gumucio J et al. Gene transfer as a new mode of vaccination: implication
11. Takamizawa A. Structure and organization ofthe Hepatitis C virus Genome for HCV. Hepatology 1993; 18: 696–702.
isolated from human carriers. J Virol. 1991; 65: 1105–13. 19. Farci Petal. Lack of protective immunity against reinfection with Hepatitis
C virus. Science 1992; 258: 135–40.

14 Cermin Dunia Kedokteran No. 110, 1996


HASIL PENELITIAN

Evaluasi FaaI Hati pada Penderita


Tuberkulosis Paru yang Mendapat
Terapi Obat Anti Tuberkulosis
Zulkarnain Arsyad
Laboratorium Ilmu Penyakit Dalam Fakultas Kedokteran Universitas A ndalas,
Rumah Sakit Umum Pusat Dr. M. Jamil, Padang

ABSTRAK
Pemakaian obat anti tuberkulosis (OAT) dapat menimbulkan berbagai macam efek
samping. Salah satu efek samping yang cukup serius adalah efek hepatotoksik.
Telah dilakukan penelitian pada penderita Tb Paru rawat jalan, untuk melihat
gangguan faal hati yang terjadi akibat pemakaian kombinasi obat anti tuberkulosis ini.
Dari 58 penderita yang mendapat OAT didapatkan gangguan faal hati untuk kelom-
pok yang mendapatkan obat 1 & 2 bulan sebanyak 28%, untuk kelompok 3 & 4 bulan
sebanyak 27% dan untuk kelompok 5 & 6 bulan 57%. Peningkatan nilai dan komponen
faal hati ini (SGOT, SGPT, Alkali Fosfatase dan Bilirubin) tidak melebihi dua kali nilai
normal. Peningkatan faal hati juga dipengaruhi oleh faktor umur tua dan faktor anemia.
Didapat kesan supaya dilakukan monitoring faal hati yang reguler pada penderita Tb Paru
yang mendapat OAT terutama pada umur tua dan yang disertai anemia.

PENDAHULUAN didahului oleh gejala prodromal(4). Secara histopatologi me-


Penyakit tuberkulosis, terutama tuberkulosis paru masih nyerupai kelainan oleh virus hepatitis akut; terlihat sarang-
merupakan masalah kesehatan di negara yang sedang mem- sarang nekrosis sel hati, pigmentasi sel Kupfer dan peningkatan
bangun seperti di Indonesia. Diperkirakan 10–20 juta penderita sel radang. Pada kasus berat dapat dijumpai bridging necrosis
tersebar di seluruh dunia(1). Di RSUP Dr. M. Jamil Padang selama atau nekrosis multilobuler(5).
periode 1990 sampai dengan 1992, 78% dan kelainan paru yang Rifampisin dianggap jarang mempunyai etek toksis pada
dirawat disebabkan oleh tuberkulosis(2). fungsi hati yang normal, beberapa penulis menyangka sebagai
Untuk pengobatan Tb paru biasanya dipakai obat-obat se- reaksi hipersensitif(6). Insiden tertinggi terjadi pada orang yang
perti Isoniazid atau INH, Rifampisin, Pirazinamid, Streptomi- mempunyai kelainan hati atau saluran empedu, pecandu alkohol
sin, Ethambotol, dan lain-lain. Salah satu efek samping yang dan pada usia tua(7). Pirazinamid efek hepatotoksiknya berkisar
dapat ditimbulkan akibat pemberian OAT ini adalah gangguan antara 1–2% dan gejala ikterus antara 3–4%. Dapat terjadi efek
fungsi hati, dan yang ringan sampai yang berat berupa nekrosis nekrosis yang fatal. Pemberian pirazinamid pada penyakit hati
dan jaringan hati(3). Obat-obat anti tuberkulosis yang sering tidak dianjurkan(5).
hepatotoksik adalah INH, Rifampicin dan Pirazinamid. Untuk mengetahui terjadinya gangguan faal/fungsi hati
Kejadian hepatitis oleh INH antara 0,5–3%. Penderita tua, penderita Tb Paru akibat pemberian obat anti tuberkulosis, di-
.pecandu alkohol, penderita dengan riwayat penyakit hati sebe- lakukan penelitian pada penderita berobat jalán di Poliklinik
lumnya, mempunyai .risiko tinggi untuk hepatitis, dan dapat Paru RSUP Dr. M. Jamil Padang.

Cermin Dunia Kedokteran No. 110, 1996 15


BAHAN DAN CARA Tabel 4. Faal Hati Penderita Th Paru dengan OAT (1–2 bulan) berdasar-
kan Faktor Umur
Sebagai bahan peñelitian adalah penderita Tb paru yang
berobat jalan ke Poliklinik Paru RSUP Dr. M. Jamil Padang. < 55 tahun > 55 tahun
Faal Hati p
Penderita yang dimasukkan dalam penelitian adalah yang hanya (n = 14) (n = 7)
menderita Tb paru, yang sedang menjalani pengobatan dengan SGOT (u/1) 29,4 ± 12 30,1 ± 48 > 0,05
obat anti tuberkulosis (OAT). Tidak dimasukkan penderita- SGPT (u/1) 29,4± 12 42,1 ±41 < 0,05
penderita yang dicurigai menderita kelainan hati primer seperti Fosfatase Alkali (u/1) 151,4± 41,6 167 ± 62,4 > 0,05
Bilirubin (mg%) 0,47 ± 0,20 0,61 ± 0,5 > 0,05
hepatitis dan sirosis hepatis. Penderita yang memenuhi syarat
diperiksa kadar bilirubin darah, enzim SGOT, SGPT dan fosfa- Tabel 5. Faal Hati Penderita Tb Pam dengan OAT (1-2 bulan) berdasar-
tase alkali. Di samping itu juga dilakukan pencatatan jenis kan Faktor Anemia
kelamin, umur, berat badan, kadar Hb waktu pertama kali di-
Hb < 12g% Hb > 12g%
berikan pengobatan, lamanya mendapat OAT dan jenis kom- Faal Had
(n = 6) (n = 15)
p
binasi obat anti Tb yang sedang dimakan (RHE).
SGOT (u/1) 27 ± 21,8 30 ±11,3 > 0,05
Dilakukan analisis pengaruh faktor umur, keadaan gizi, SGPT (u/1) 44,8 ± 45,2 29,1 ± 11,5 < 0,05
lamanya makan OAT, kadar Hb, terhadap faal hati penderita Fosfatase Alkali (u/I) 180,7 ± 70,4 149,5 ± 40,7 > 0,05
penderita yang mendapat OAT ini. Sebagai pembanding di- Bilirubin (mg%) - 0,68.± 49,1 0,46 ± 0,2 >0,05
lakukan pemeriksaan faal hati orang normal.
Dari Tabel 5 di atas terlihat peningkatan dan SGPT, fosfa-
HASIL tase alkali dan bilirubin pada penderita Tb paru yang mendapat
Telah dilakukan pemeriksaan faal hati 58 orang penderita Tb OAT (1–2 bulan) yang disertai faktor anemia. Peningkatan yang
paru dan 30 orang normal sebagai pembanding (Tabel 1 dan 2). bermakna hanya pada SGPT (p < 0,05).
Tabel 1. Data Dasar Penderita Tb dan Orang Normal Tabel 6. Faal Hati Penderita Tb Paru dengan OAT (1–2 bulan) berdasar -
kan Faktor Berat Badan
Th paru + OAT Orang Normal
Jumlah 58 30 Berat badan Berat badan
Faal Had P
Kelamin kurang normal/lebih
Pria 43 21 SGOT (u/1) 30,1 ± 14,9 29,2 ± 13,5 > 0,05
Wanita 15 9 SGPT(u/1) 39,4 ± 35,4 28,4 ± 11,3 >0,05
Umur (th) 14-70 20-67 Fosfatase Alkali (u/1) 180,4 ± 41,1 136 ± 46,9 > 0,05
Kombinasi OAT RHE Bilirubin (mg%) 0,54 ± 0,4 0,50 ± 0,2 > 0,05

Tabel 2. Jumlah Kasus Tb yang Diteliti


Dari Tabel 6 terlihat peningkatan SGPT, SGOT, fosfatase
Lama Pengobatan Jumlah alkali dan bilirubin pada penderita dengan OAT (1–2 bulan) yang
(bulan) (n)
mempunyai berat badan kurang, tetapi tidak bermakna.
1-2 21
3-4 11 Tabel 7. Faal Hati Penderita Tb Paru dengan OAT (5–6 bulan) berdasar-
5-6 26 kan Faktor Umur

Tabel 3. Faal Hati Penderita Tb Paru dan Orang Normal Umur < 55 Umur > 55
Faal Hati p
n = 14 n=12
Lama Pengobatan
SGOT (u/1) 34,9 ± 33,8 63,3 ± 63,5 < 0,05
Faal Hati SGPT (u/1) 31,1 ± 21,5 44 ± 34 < 0,05
1-2 bulan 3-4 bulan 5-6 bulan Orang Normal Fosfatase Alkali (u/1) 224,9 ± 248,5 176,2 ± 118,6 > 0,05
n=21 n=11 n=26 n=30 Bilirubin (mg%) 0,78 ± 0,56 0,50± 0,2 > 0,05

SGOT 29,6 ± 13,8 36 ± 21,9 48 ± 50,8* 23,5 ± 7


SGPT 33,6 ± 25,6 38 ± 39,5 37,6 ± 27,4 26,4 ± 9 Dari Tabel 7 terlihat peningkatan bermakna SOOT dan
Fosfatase alkali 151 ± 59,6 186,2 ± 67,2 199,4± 188,31 98,7 ± 38 SGPT pada kelompok umur > 55 tahun.
Bilirubin 0,52 ± 0,30 0,52 ± 0,21 0,69 ± 0,43 0,64 ± 24
Tabel 8. Faal Hati Penderita Tb Paru dengan OAT (5–6 bulan) berdasar-
Keterangan : * P < 0,05 kan Faktor Anemia
Hb < 12 g% Hb > 12 g%
Terlihat peningkatan SOOT, SGPT dan fosfatase alkali pada Faal Had P
n=7 n = 19
semua kelompok yang mendapatkan pengobatan OAT. Pening- SGOT (u/1) 58,3 ± 63,5 35 ± 34,8 < 0,05
katan SOOT yang bermakna didapatkan dan penderita yang SGPT (u/1) 4,3,7 ± 35,5 33,3 ± 18,9 < 0,05
Fosfatase Alkali (u/1) 216,9 ± 180,4 180,4 ± 205,2 > 0,05
mendapat pengobatan OAT 5–6 bulan (p < 0,05) (Tabel 3). Bilirubin (mg%) 0,54 ± 0,3 0,60± 0,4 > 0,05
Pada fase inisial (1 dan 2 bulan), pada penderita mendapat
OAT yang berumur > 55 tahun terjadi peningkatan semua Dari Tabel 8 terlihat peningkatan SGOT, SGPT yang ber-
komponen faal hati yang diperiksa. Pada SGPT terjadi pen- makna dan fosfatase alkali pada penderita Tb paru dengan OAT
ingkatan yang bermakna (p <0,05). (Tabel 4) (5–6 bulan) yang mempunyai kadar Hb < 12%.

16 Cermin Dunia Kedokteran No. 110, 1996


Tabel 9. Persentase Gangguan Faal Hati pada masing-masing Grup penelitiannya dengan kombinasi INH dan rifampisin tidak
Pengobatan
menemukan pengaruh umur tersebut pada usia di atas dan di
Grup Pengobatan Persentase (%) bawah 35 tahun tenhadap faal hati penderita Tb yang mendapat
OAT(18).
1 – 2 bulan 6 / 21 (28)
3 – 4 bulan 3 / 11 (27) Mengenai peranan anemi, penulis mendapatkan peningkatan
5 – 6 bulan 15 / 26 (57) SGPT yang bermakna pada kelompok penderita Tb paru plus
anemi yang mendapat OAT 1 dan 2 bulan. Sedangkan pening-
Dari Tabel 9 terlihat persentase gangguan faal hati ter- katan enzim lainnya pada kelompok tersebut, tidak bermakna.
banyak terjadi pada kelompok pengobatan 5 –6 bulan. Dan hasil ini didapat kesan SGPT lebih sensitif dibanding faal
hati yang lain. Pada kelompok penderita Tb plus anemi yang
PEMBAHASAN mendapat OAT 5 dan 6 bulan, terjadi peningkatan bermakna
Obat-obatan anti tuberkulosis seperti INH, rifampisin, pi- enzim SGOT dan SGPT tapi peningkatan ini tidak sampai 2 kali
razinamid dan ethambutol mempunyai beberapa efek samping, lipat nilai normal.
dan yang ringan sampai yang berat. Efek samping yang patut Pada penderita Th paru dengan berat badan kurang yang
diwaspadai adalah efek hepatotoksik. Hampir semua OAT mendapat OAT terjadi peningkatan semua komponen faal hati
mempunyai efek hepatotoksik kecuali streptomisin(8). yang diperiksa, tetapi tidak bermakna. Telah ada laporan bahwa
Kerusakan sel hati bervariasi dan yang ringan asimptomatik tidak ada pengaruh malnutnisi dan anemia pada pasien-pasien
sampai menimbulkan gejala serius akibat nekrosis sel hati. Pi- yang mendapatkan kombinasi OAT(19).
razinamid yang sering dipakai untuk pengobatan jangka pendek Pada penelitian ini persentase peningkatan faal hati pada
Tb paru telah dilaporkan menyebabkan hepatitis(9). Peninggian kelompok Tb paru dengan OAT 5 dan 6 bulan relatif lebih tinggi
SGOT dan SGPT merupakan gejala dini dari kelainan hati(10). yaitu sekitar 57% tapi peningkatan ini tidak melebihi dua kali
Isoniazid atau INH merupakan obat yang hampir selalu nilai normal. Tidak ada hepatitis toksik yang manifes.
digunakan dengan kombinasi obat anti tuberkulosis yang lain.
Efek samping INH adalah neuropati perifer dan hepatotoksik. RINGKASAN
Efek hepatotoksik INH akan bertambah besar pada usia tua dan Telah dilakukan evaluasi faal paru pada penderita Th paru
pada individu yang mempunyai asetilisasi cepat(11). Kerusakan yang mendapat OAT, yang berobat jalan pada Poliklinik Paru
hati diduga karena hasil metabolit INH berupa asetilhidrazin. RSUP Dr. M. Jamil Padang. Dan 58 orang penderita yang men-
Pada orang normal metabolit yang toksik lebih sedikit dari dapat pengobatan kombinasi INH, nifampisin dan ethambutol,
metabolit yang nontoksik. Kombinasi INH dengan rifampisin terjadi peningkatan komponen faal hati pada kelompok peng-
ternyata lebih toksik dan kombinasi INH dengan streptomisin(12) obatan I dan 2 bulan, 3 dan 4 bulan, 5 dan 6 bulan. Insiden pe-
karena pada kombinasi tersebut dihasilkan lebih banyak meta- ningkatan yang tertinggi terjadi pada kelompok 5 dan 6 bulan
bout toksik. (57%). Tapi peningkatan ini tidak melebihi dua kali nilai normal.
Rifampisin 85% sampai 90% dimetabolisme di hati. Se- Di samping itu juga didapat kesan adanya peranan faktor umur
bagian besar dikeluarkan melalui saluran empedu, sekitar 10% yang lanjut dan anemia untuk terjadi peningkatan faal hati ini.
penderita yang diberi rifampisin memperlihatkan peninggian Pemberian OAT pada penderita Tb paru disanankan tetap
serum transaminase, bilirubin dan retensi BSP(13). Rifampisin diwaspadai dan faal hati diperiksa secara reguler, terutama pada
juga dapat menyebabkan peningkatan asimptomatik serum yang lanjut usia dan penderita anemia.
transaminase pada sebagian penderita di sampingjuga memper-
lihatkan efek khoIestatik(14). Rifampisin bekerja sinergis dengan
INH pada hati, dapat menimbulkan ikterus dan peningkatan
KEPUSTAKAAN
asimptomatik kadar enzim aspartat dan amino transaminase(15).
Ethambutol yang digunakan sebagai pengganti PAS, me- 1. Home N. Tuberculosis. Medicine International 1986; 2: 1490–98.
nyebabkan efek samping minimal. Biasanya menimbulkan 2. Zulkarnain Arsyad. Tuberculosis manifestations in Dr. M. Jamil Hospital
neuropati optik dengan keluhan kurang tajamnya penglihatan, Andalas University Padang Indonesia. In: Abstr 17th Eastern Regional
jarang menimbulkan hepatitis(16,17). Conference on Tuberculosis and Respiratory Diseasis. Bangkok, 1993.
3. Angel JH, Sommer AR, Citron MK. Toxicity of antituberculosis drug with
Studi ini mendapatkan peningkatan enzim transaminase dan special reference to hepatotoxicity. Bull IUAT 1979; 54(47).
fosfatase alkali asimptomatik, ini sesuai dengan hasil studi para 4. Sherlock S. Diseases of the Liver and Billiary System. 6th ed. London:
peneliti lain. Peningkatan enzim faal hati tersebut dibanding Blackwell Scient PubI. 1981; 295.
dengan orang normal ternyata tidak bermakna, kecuali pada 5. Stead WW, Dutt AK. Chemotherapy of tuberculosis today. Am. Rev. Res.
Dis. 1982; 125: 94–101.
kelompok yang meridapat OAT 5 dan 6 bulan, peningkatan ini 6. Van Arsdel. Adverse drug reaction, in: Medleton’s Allergy principles and
bermakna untuk enzim SGOT. practice 1st ed. St Louis: The Mosby Co. 1978; 1133.
Mengenai peranan umur, penulis mendapatkan pada umur 7. Riscaetal. Predisposing factors in hepatitis induced by isoniazid rifampicin
lebih dan 55 tahun, terdapat peningkatan SGPT yang bermakna treatment of tuberculosis. Am. Rev. Resp. Dis. 1978; 118: 146–466.
8. Mitchison DA. Treatment of tuberculosis. The Mitchell Lecture. London
pada OAT I dan 2 bulan dan SGOT dan SGPT pada kelompok 1980; 14:91.
OAT 5 dan 6 bulan. Sehaliknya Zulkifli Amin (1993) pada 9. Pilheu JA et al. Liver alterations in antituberculosis regiments containing

Cermin Dunia Kedokteran No. 110, 1996 17


pyrazinamid. Chest 1981; 80: 720. 1981; 80: 727.
10. Citron K, Sommer A, Angel J. Short. duration chemotherapy in pulmonary 15. Snider D et al. Prelimenary result of six months regimens studied in United
tuberculosis; the occurence of hepatitis in six month regimens containing States and in Poland. Chest 1980; 80: 727.
pyrazinamid as well as nfampicin.Am Rev Respir. Dis. 1980; 121: 452. 16. Postlewaite AE et al. Hyperuricemia due to ethambutol N. Engl. J. Med.
11. Fox W. Current status of short course chemotherapy. Bull IUAT 1978; 53: 1972; 286: 761.
268. 17. Narang RKet al. Hyperuricemiainducedby ethambutol. Br. J. Chest 1985;
12. Zimmerman HJ, Maddrey WC. Toxic and drug induced hepatitis. In: 77: 403.
Diseases of the liver, (Eds). Schiff. C, Schiff ER. 5th ed. Philadelphia 18. Zulkifli Amin. The Influence of Isoniazid and Rifampicin toward liver
Toronto: JB. Lippincott Co. 1982. function. In: Abstr 17th Eastern Regional Conference on Tuberculosis and
13. StrickerCH, SpealstraP. Drug induced hepatic injury. Amsterdam, Elsevier Respiratory Diseases. Bangkok, 1993.
Science PubI. 1985. 19. Aziz S. et al. Hepatotoxicity to different antituberculosis drug combina-
14. Dutt AK. Short course chemotherapy. The Arkansas experience. Chest tions. JPMA 1990; 40: 290.

18 Cermin Dunia Kedokteran No. 110, 1996


ULASAN

Program Imunisasi Masal Hepatitis B


di Indonesia
Dr. H. Nuchsan Umar Lubis, DSA
Bagian Ilmu Kesehatan Anak Rumah Sakit Umum Langsa, Aceh Timur

PENDAHULUAN POLA PENULARAN VIRUS HEPATITIS B(3,4,5)


Dikembangkannya program Imunisasi Hepatitis B didasar- 1) Secara vertikal:
kan pada kenyataan bahwa program Imunisasi Dasar (BCG, Penularan dan ibu ke anak terjadi: a) di dalam rahim (intra-
DPT, Polio dan Campak) telah mencapai Universal Child Immu- uterin), b) pada saat persalinan (intrapartum), dan c) pasca per-
nization (UCI), yang berarti secara nasional telah dicakup lebih salman (postpartum).
dari 80% sasaran 5 juta bayi untuk imunisasi dasar lengkap ter- Bayi yang dilahirkan dan ibu yang HBsAg + HBs AgE +
sebut, hal ini didasarkan tingginya kesadaran masyarakat ter- akan menderita hepatitis B. Infeksi hepatitis B pada bayi ini tanpa
hadap program Imunisasi serta mantapnya program Imunisasi. gejala klinis yang menonjol; keadaan ini menyebabkan ibu men-
Dengan demikian adopsi hepatitis B ke dalam program Imunisasi jadi lengah dan lupa untuk membuat upaya pencegahan.
rutin yang ada tidak akan menjadi masalah. 2) Secara horizontal
WHO mentargetkan bahwa pada tahun 2000, masalah he- Transmisi yang paling sering terjadi akibat transfusi darah,
patitis B di dunia sudah dapat diatasi. Program Imunisasi Dasar jarum suntik, hubungan intim dengan carrier, dan lain-lain.
hepatitis, adalah untuk proteksi, membentuk anti HBs untuk Faktor-faktor yang mempengaruhi pembentukan respon anti
mencegah penularan infeksi hepatitis B(1,2). HBs(2,4) :
a) Umur
TUJUAN PROGRAM Respon pembentukan anti HBs pada anak dan dewasa muda
Secara umum program imunisasi hepatitis B bertujuan me- jauh lebih baik dibandingkan dengan orang dewasa yang berumur
nurunkan angka kematian yang disebabkan oleh infeksi hepati- di atas 40 tahun.
tis B dan akibat lanjut darinya, dengan memberi kekebalan b) Jenis kelamin
kepada bayi sedini mungkin. Respon wanita lebih baik dan laki-laki (Warmer dkk, 1983).
Secara khusus program imunisasi hepatitis B bertujuan(1) : c) Faktor immunologis
a) mencegah infeksi hepatitis pada bayi; penularan vertikal Penderita gangguan imunitas sekunder terbukti mempunyai
akan melahirkan bayi yang menjadi pengidap dan merupakan respon pembentukan anti HBs yang lemah, misalnya penderita
sumber penularan (Robinson dkk, 1984); bayi-bayi tersebut akan hemodialisa kronik.
menderita cirrhosis dan hepatoma di kemudian hari. d) Tempat dan cara pemberian
b) mencegah pengidap penyakit hepatitis B; apabila anak sudah Karena tebalnya lemak subkutan di bokong, maka cara pem-
tertular dan menjadi pengidap hepatitis B maka upaya pencegah- berian imunisasi di bokong memberikan respon pembentukan
an akan sia-sia belaka. Pencegahan harus diarahkan terhadap antibodi yang lebih rendah dibandingkan pemberian di deltoi-
bayi baru lahir. deus.

Cermin Dunia Kedokteran No. 110, 1996 19


Vaksin hepatitis terbuat dan plasma darah atau recombinant Beberapa faktor kunci yang menunjang keberhasilan pro-
DNA; bila disimpan pada. suhu 2°C – 8°C akan memberikan gram imunisasi hepatitis B
perlindungan 95%. Tidak boleh beku karena merusak potensi- 1) Kelancaran penyediaan dan distribusi vaksin.
nya. Stabil tahan 30 hari pada suhu 37°C – 45°C. 2) Pelatihan seluruh petugas Dinas Kesehatan Propinsi, Ka-
Efek samping vaksinasi boleh dikatakan tidak ada, kadang bupaten, Puskesmas dan Kader.
kadang nyeri pada tempat suntikan. 3) Penyuluhan tentang pencegahan penyakit hepatitis B ke
seluruh desa, petugas imunisasi, kader dan jajaran pemerintah
JADWAL IMMUNISASI(1,4) daerah.
Vaksin hepatitis B diberikan pada mereka yang belum
pernah terinfeksi dengan hepatitis. KESIMPULAN
Tabel 1. Dosis dan Jadwal Vaksinasi Hepatitis Program Imunisasi Hepatitis secara massal harus segera
dilakukan untuk mencegah timbulnya carrier, namun mengingat
Grup Initial 1 bulan 6 bulan keterbatasan dana, belum bisa serentak dilakukan di Indonesia.
Bayi dan anak ≤ 10 tahun 10 mg 10 mg 10 mg Mulai tahun 1996, semua bayi akan mendapatkan Imunisasi
(0,5 ml) (0,5 ml) (0,5 ml) Hepatitis B secara cuma-cuma.
Anak > 10 tahun dan 20 mg 20 mg 20 mg
orang dewasa (1,0 ml) (1,0 ml) (1,0 ml)

Tabel 2. Imunisasi bagi Bayi yang Dilahirkan di Rumah Sakit


Umur Antigen
0 bulan HB1, BCG
2 bulan HB2, DPT, Polio 1
3 bulan DPT2, Polio 2 KEPUSTAKAAN
4 bulan DPT, Polio 3
7 bulan HB, (atau bersama dengan campak pada usia 9 bulan)
1. Kadun N. Program vaksinasi massal hepatitis B di Indonesia, MDK 1992;
9 bulan Campak
11: 19–23.
Tabel 3. Jadwal Imunisasi bagi Bayi yang Datang ke Posyandu/Pus- 2. World Health Organization. Hepatitis B vaccination attacking pandemic.
kesmas Geneva: WHO 1989.
3. Angsar DM. Hepatitis Virus pada kehamilan. Cermin Dunia Kedokt. 1979;
Umur Antigen 15: 13–5.
2 bulan BCG, Polio 1, DPT, 4. Soeparman AK. Vaksinasi profilaksis terhadap hepatitis B. Cermin Dunia
3 bulan HB,, Polio 2, DPT2 Kedokt. 1985; 40: 37–40.
4 bulan HB2, Polio 2, DPT, 5. Tandra H. Hepatitis pada kehamilan. Cermin Dunia Kedokt. 1991; 68: 16–7.
9 bulan HB, Campak 6. Supadmi LP dkk. Daya lindung program Immunisasi dasar hepatitis B di
RSUP Sanglah Bali. Wahana Medik 1993; 21: 29–32.

He knows the water the best who has waded through it

20 Cermin Dunia Kedokteran No. 110, 1996


TINJAUAN KEPUSTAKAAN

Penyakit Hati pada Kehamilan


A.B. Wardoyo, DSPD
Semarang

PENDAHULUAN sedikit pada kulit berwarna. Kedua perubahan ini akan menghi-
Penyakit hati jarang terjadi pada wanita hamil. Ikterus pada lang dalam waktu 4–6 minggu setelah melahirkan(1-4).
kehamilan timbul pada kira-kira 1 dan 1.500 kehamilan atau Hati yang normal biasanya tidak teraba selama kehamilan.
0,067%(1-4). Hati yang teraba mungkin didasari karena penyakit hati atau
Ikterus pada kehamilan dapat disebabkan karena(1) : kegagalan jantung(2,4).
A) Ikterus yang terjadi karena kehamilan : Selama kehamilan kadar bilirubin serum biasanya normal,
1) Perlemakan hati akut. pada sebagian kecil wanita hamil terdapat peningkatan bilirubin
2) Toksemia. yang ringan, tetapi dengan kadar total kurang dan 2 mg%, hal ini
3) Kolestasis intrahepatik. mungkin karena peningkatan metabolisme hemoglobin(2,3).
4) Hiperemesis gravidarum. Enzim fosfatase alkali dalam serum kadarnya akan naik
B) Ikterus yang terjadi bersama kehamilan : secara lambat sampai bulan ke tujuh kehamilan dan akan naik
1) Hepatitis virus. lebih cepat serta mencapai puncaknya pada bulan ke sembilan,
2) Batu empedu. tetapi kadarnyajarang melebihi dua kali batas atas normal; pe-
3) Pemakaian obat-obatan hepatotoksik. ningkatan ini disebabkan karena produksi sinsisiotrofoblast di
4) Sirosis hati. plasenta. Kadar enzim ini akan kembali normal setelah 2–8
Kira-kira 41% ikterus pada kehamilan disebabkan karena minggu post partum(2,4).
hepatitis virus, 21% karena kolestasis intrahepatik dan 6% ka- Enzim-enzim lainnya, yaitu glutamic oxaloacetic transami-
rena batu empedu, sedangkan penyebab lainnya Ieb jarang nase (GOT), glutamic pyruvic transaminase (GPT), gamma
ditemukan(1,3). glutamyl transpeptidase (Gamma GT), serta 5-nucleotidase (5-
Adanya ikterus pada kehamilan dapat menyebabkan terjadi NT) kadarnya masih tetap normal selama masa kehamilan(1,3,4).
nya prematuritas, dan ini terjadi pada sekitar 20% dan ibu yang Kadar protein total dalam serum jarang turun sampai di
ikterus; meskipun demikian prematuritas tidak berhubungan bawah 6 g%, perubahan ini disebabkan karena penurunan relatif
dengan lamanya ikterus, kadar bilirubin serum, atau beratnya kadar albumin serum akibat peningkatan volume plasma (dilusi)
gejala klinis; sedangkan kematian bayi tergantung dan derajat selama kehamilan(2,4,5). Globulin dalam serum akan meningkat
prematuritasnya(1). demikian juga fibrinogen. Dengan pemeriksaan elektroforesis,
Selanjutnya akan dibahas beberapa penyakit hati pada wa- tampak globulin alfa dan beta meningkat, sedangkan globulin
nita hamil. gama sedikit menurun(1,3).
Kolesterol total serum kadarnya meningkat sejak bulan ke
FAAL HATI PADA KEHAMILAN NORMAL empat kehamilan, mencapai puncaknya sekitar 250 mg% pada
Faal hati selama kehamilan normal dapat dikatakan tidak bulan ke delapan, tetapi jarang melebihi 400 mg%(4).
berubah. Karena pengaruh kenaikan kadar estrogen, spider naevi Pada sebagian kecil wanita hamil ekskresi bromsulphalein
dan eritema palmaris dapat ditemukan pada kira-kira 60% wanita (BSP) dapat sedikit terganggu pada trimester ketiga, yang akan
hamil normal, kebanyakan pada wanita hamil berkulit putih dan cepat normal kembali pada awal masa nifas(1,3,4).

Cermin Dunia Kedokteran No. 110, 1996 21


Pemeriksaan biopsi hati pada wanita hamil yang normal Karenaetiologinya belumdiketahui, makapengobatan yang
tidak menunjukkan kelainan histologik, atau kadang-kadang diberikan bersifat suportif. Pengobatan ini secara umum sesuai
hanya tampak perubahan minimal yang tidak spesifik berupa dengan pengobatan gagal hati dan ginjal. Di samping itu tim-
perbedaan ukuran hepatosit, bertambah besarnya inti sd, infil- bulnya hipoglikemi dan gangguan pembekuan darah harus selalu
trasi limfosit yang sangat ringan pada daerah portal serta pe- diwaspadai sehingga dapat segera dikoreksi(1,2,7,8).
ningkatan retikulum endoplasmik. Aliran darah ke hati biasanya Penatalaksanaan obstetrik masih kontroversial(1). Beberapa
juga tidak mengalami perubahan yang berarti(1). penulis(3,6) menyatakan bahwa seksio sesar dini dengan anestesi
epidural adalah pilihan yang terbaik bagi harapan hidup ibu serta
PERLEMAKAN HATI AKUT janinnya, sedangkan penulis-penulis lain(4,7) menyatakan bahwa
Perlemakan hati akut pada kehamilan (acute fatty liver of tindakan pengakhiran kehamilan tersebut tidak berpengaruh
pregnancy) pertama kali dilaporkan oleh Sheehan pada tahun terhadap prognosis ibunya.
1940, disebut juga acute fatty metamorphosis of pregnancy atau Berdasarkan pengamatan lebih lanjut, ternyata penyakit ini
obstetric acute yellow atrophy(3,4). tidak terulang lagi pada kehamilan berikutnya(7).
Penyakit ini jarang dijumpai(3,4,6), dari laporan-laporan yang
ada, sampai tahun 1983 hanya baru ditemukan 100 kasus dengan TOKSEMIA GRAVIDARUM
angka kematian maternal dan janin masing-masing sebesar 75% Keadaan ini dapat disertai kelainan faal hati berupa kenaik-
dan 85%(2). an kadar fosfatase alkali dan transaminase dalam serum, sedang-
Meskipun dapat mengenai semua umur, penyakit ini se- kan ikterusjarang timbul, hanya terjadi pada keadaan berat, yaitu
bagian besar diderita oleh primigravida muda dan hampir selalu karena koagulasi intravaskuler (DIC) dengan hemolisis dan
dalam trimester akhir, terutama pada kehamilan antara 32 sam- nekrosis hati(1,8).
pai 40 minggu, tidak pernah timbul sebelum minggu ke tiga Gambaran histopatologis menampakkan adanya trombi fibrin
puluh(4,6,7). dalam sinusoid di periportal disertai tanda-tanda perdarahan
Penyebab penyakit m masih belum diketahui(6). Mungkin serta nekrosis, sedangkan tanda-tanda mnflamasi tidak ada(3,4).
disebabkan karena reaksi kepekaan berlebihan terhadap suatu zat Perdarahan intrahepatik dan subkapsuler menimbulkan
yang dihasilkan oleh kesatuan feto-p1asenta Malnutrisi diduga keluhan nyeri epigastrik atau nyeri perut kuadran kanan atas;
mempermudah terjadinya penyakit ini(1,3,8). meskipunjarang terjadi, ruptur spontan hati yang mengakibatkan
Kelainan morfologinya hampir mirip dengan kelainan pada perdarahan intra peritoneal dan syok memerlukan tindakan be-
keracunan tetrasiklin dan sindrom Reye. Secara makroskopis dah darurat(4,6,9).
tampak hati mengecil, lunak dan berwarna kuning. Sedangkan Umumnya tidak ada pengobatan khusus terhadap kelainan
kelainan histologisnya berupa infiltrasi lemak intraseluler faal hati yang terjadi pada toksemia gravidarum; terminasi keha-
(mikrovesikel) yang distribusinya sentrilobuler, kecuali hepato- milan akan memperbaiki keadaan klinis dan histopatologisnya(3).
sit di daerah periportal yang biasanya masih tampak normal,juga
tidak didapatkan adanya tanda-tanda nekrosis maupun reaksi KOLESTASIS INTRAHEPATIK
inflamasi yang luas; infiltrasi lemak mungkin juga terlihat di Kolestasis intrahepatik pada kehamilan (intrahepatic chole-
pankreas, ginjal, otak dan sumsum tulang(2,6,7). stasis of pregnancy) sering disebutjuga dengan istilah idiopathic
Penyakit ini onsetnya mendadak, gej ala klipis yang timbul cholestasis of pregnancy dan recurrent cholestasis of preg-
dapat berupa malaise, anoreksi, nausea, vomitus, nyeri epi- nancy(1,4,9).
gastrik, ikterus, hematemesis dan perdarahan lainnya, ensefalo- Insiden penyakit ini berkisar antara 1/100 sampai 1/10.000
pati hepatik dan gagal ginjal. Penyakit ini sering disertai dengan kehamilan, relatif lebih banyak terdapat di Scandinavia dan
pankreatitis akut dan kadang-kadang disertai juga dengan tok- Chile, mungkin karena adanya variasi geografik(3,6).
semia dan koagulasi intra vaskuler (DIC). Biasanya terjadi partus Penyakit ini biasanya terjadi pada trimester akhir, tetapi
prematur dan bayinya lahir mati, kematian ibu biasanya terjadi dapat juga terjadi pada awal kehamilan. Penyebabnya belum
pada hari ke tiga sampai empat minggu sejak onset, karena diketahui, mungkin disebabkan karena gangguan metabolisme
hipoglikemi, ensefalopati, perdarahan, infeksi dan gagal gin- estrogen; hal ini dihubungkan dengan kejadian ikterus pada
jal(1,2,4,6,7). wanita pemakai obat kontrasepsi oral, penderita yang pada waktu
Pada pemeriksaan laboratorium didapatkan kenaikan kadar hamil menderita kolestasis akan menderita gejala yang sama bila
bilirubin serum (biasanya di bawah 10 mg%), SGOT (biasanya minum pil kontrasepsi. Faktorgenetik tampaknya juga berperan,
kurang dan 500 IU), fosfatase alkali, asam urat, amonia dan 50% penderita mempunyai keluarga dekat dengan riwayat pe-
ureum. Sedangkan kadar gula darah, albumin, kolesterol dan nyakit yang sama(1,2,4).
protrombin akan menurun. Pada pemeriksaan darah tepi akan Pruritus yang kadang-kadang sangat berat adalah keluhan
didapatkan leukositosis dan trombositopenia(1,2,6,7). utama dan gejala klinis yang sering timbul paling awal, akibat
Diagnosis pasti berdasarkan hasil biopsi hati, tetapi hal ini kenaikan kadar asam empedu dalam serum. Pruritus dirasakan di
sering tidak dapat dilaksanakan karena adanya gangguan pem- seluruh tubuh dan biasanya bertambah berat pada malam dan dini
bekuan darah(2). Diagnosis bandingnya adalah hepatitis fulmi- hari(2,4,6).
nan, pankreatitis dan kolesistitis(8). Pada keadaan ringan, pruritus mungkin tidak disertai dengan

22 Cermin Dunia Kedokteran No. 110, 1996


ikterus(1,3). Bila keadaan terus berkembang, maka kira-kira 1 Dalam hal penyebabnya, Hieber dkk(11) di Dallas Amerika
minggu setelah timbulnya pruritus akan tampak adanya ikterus, Serikat tahun 1970–1974 mendapatkan virus hepatitis (VH) B
urine berwarna seperti air teh dan tinja kadang-kadang berwarna sebesar 40% dan VH non B sebesar 60% sebagai penyebab HV
agak pucak(2,6). Ikterus biasanya ringan, menetap sampai pada wanita hamil. Sedangkan Pratiknyo(12) menemukan bahwa
melahirkan dan menghilang 1–2 minggu setelah melahirkan(1,4). HV pada wanita hamil 45,4% karena infeksi VHB dan 54,6%
Gejala klinis Iainnya adalah malaise, nausea, vomitus dan karena VH non B.
nyeri epigastrik. Hati serta limpa biasanya tidak teraba(3,6). Semula disangka bahwa infeksi VH selama kehamilan lebih
Kadar bilirubin direk biasanya naik, tapi umumnya kurang berat dibanding wanita yang tidak hamil. Namun bukti-bukti se-
dari 5–6 mg%, demikian pula halnya dengan kadar transaminase lanjutnya membantah pendapat tersebut. Tampaknya keadaan
(3–4 kali normal), fosfatase alkali (2 kali normal), gamma GT nutnisi yang mempengaruhi prognosis ibu hamil tersebut(1,3,4,13).
dan asam empedu (10–100 kali normal) dalam serum, sedangkan HV yang terjadi pada trimester ke tiga gejalanya relatif lebih
waktu protrombin akan memanjang(2,3,4,6). berat dan gejala yang timbul pada trimester sebelumnya maupun
Pada pemeriksaan histopatologis hati, tampak gambaran pada wanita yang tidak hamil. Pada trimester inilah nekrosis hati
kolestasis sentrilobuler ringan di sekitar vena sentralis tanpa akut dengan gejala hepatitis fulminan sering terjadi sehingga
tanda-tanda reaksi inflamasi dan nekrosis sel hati; kanalikuli menimbulkan mortalitas ibu yang sangat tinggi. Gizi yang buruk,
empedu mengandung banyak pigmen empedu dan sedikit me- khususnya defisiensi faktor lipotropik, disertai dengan pening-
lebar(3,4,9). katan kebutuhan protein untuk pertumbuhan janin, menyebab-
Tidak ada pengobatan dan perawatan khusus untuk penyakit kan gejala infeksi VH pada kehamilan lebih berat(1,3,4,13).
ini. Antihistamin atau kolestiramin (12–24 g/hari) untuk meng- Dari beberapa laporan yang ada, Douvas dkk(2) tidak me-
ikat garam empedu dapat mengurangi pruritus; vitamin K (10 nemukan adanya kenaikan yang bermakna dalam hal terjadinya
mg/hari) dapat diberikan bila terjadi perpanjangan waktu pro- abortus, kelahiran mati, retardasi pertumbuhan intrauterin dan
trombin, dan untuk mencegah perdarahan post partum(1,6). malformasi kongenital akibat infeksi VH. Sedangkan kelahiran
Menurut beberapa peneliti, seperti yang dikutip oleh Douvas prematur naik antara 15–35% lebih tinggi daripada wanita hamil
dkk(2) dan Miller(3), induksi persalinan perlu dipertimbangkan yang tidak terkena HV. Prematunitas ini mungkin disebabkan
setelah kehamilan 37 minggu, mengingat makin tingginya ke- karena keadaan penyakitnya yang berat atau karena pengaruh
mungkinan fetal distress dan kematian perinatal. virus pada janin atau plasenta, atau mungkin juga karena ikterus.
Penyakit ini akan timbul lagi pada kehamilan yang berikut Ada suatu pendapat yang menyatakan bahwa kenaikan kadar
nya(9). asam empedu dan asam lemak bebas bersama dengan timbulnya
ikterus, dapat menaikkan tonus uterus dan memulai persalinan.
HIPEREMESIS GRAVIDARUM Persoalan yang banyak dibicarakan saat ini adalah penu-
Nausea dan vomitus adalah gejala klinis hiperemesis gravi laran VHB dan ibu terhadap bayinya. Penularan infeksi VHB
darum, biasanya terjadi pada kehamilan bulan ke dua sampai ke dan ibu dengan HBsAg (+) kepada bayi yang dilahirkannya
empat, muntah-muntah yang hebat akan menyebabkan disebut sebagai cara penularan ventikal. Sebagian besar penu-
dehidrasi, asidosis karena kelaparan, alkalosis karena laran vertikal terjadi pada saat kelahinan karena banyaknya lesi
kehilangan asam hidroklorik dan hipoka1emia(9). kulit bayi akan merupakan tempat masuknya pàrtikel VHB yang
Penyakit ini dapat menyebabkan peningkatan kadar berasal dari darah ibu ke dalam tubuh bayi; cara penularan ini
transaminase, retensi BSP, infiltrasi lemak pada hati, ikterus disebut sebagai cara penularan perinatal atau penularan mater-
jarang terjadi dan biasanya ringan(6,8,9). nal-neonatal. Sebagian kecil penularan vertikal terjadi dalam
Semua kelainan pada hati tersebut akan normal kembali kandungan atau penularan in utero, atau penulanan transplasen-
dengan memperbaiki keseimbangan cairan, elektrolit dan asam tal(14).
basa tubuh(9). Pada penularan perinatal dari ibu yang menderita HVB akut
agaknya periode umur kehamilan memegang penanan yang
HEPATITIS VIRUS penting; jika infeksi terjadi pada 2 trimester pertama, maka pe-
Hepatitis virus (HV) adalah penyebab ikterus yang ter- nularan jarang terjadi, hanya kurang dari 10%, sedangkan jika
banyak pada wanita hamil, kira-kira 41%(1,3,4,6). Pada wanita terjadi pada trimester ke tiga, maka penularannya menjadi lebih
hamil kemungkinan untuk terkena HV sama dengan wanita tidak sering, sampai mencapai 76%(15).
hamil pada usia yang samadan dapat terjadi pada semua trimester Penularan perinatal ini merupakan masalah yang besar di
kehamilan(1,10,11). negara-negara dengan prevalensi HBeAg yang tinggi. Jika pada
Di Kashmir India (1978) insidens HV pada wanita hamil ibu hamil dengan HBsAg (+) dan HBeAg (+), maka kemungkin-
sebesar 16,82%, timbulnya pada trimester pertama, ke dua dan an bayinya akan kejangkitan infeksi sebesar 90%, tetapi jika
ke tiga masing-masing sebesar 8,3%; 4 1,7% dan 50%(10). Di RS HBeAg-nya (–) atau anti HBe-nya (+), maka daya penularannya
Dr. Kariadi Semarang tahun 1982–1986, insidens HV pada menjadi hanya 4%. Adanya HBeAg pada ibu memegang peranan
wanita hamil sebesar 6,85%, ditemukan 10,5% pada trimester penting untuk penularan terhadap bayinya(14,15). Kekerapan pe-
pertama; 23,7% pada trimester ke dua dan 65,8% pada trimester nularan yang selalu tinggi pada bayi-bayi yang dilahirkan oleh
ke tiga(12). ibu-ibu yang menderita HVB akut mungkin karena semua kasus

Cermin Dunia Kedokteran No. 110, 1996 23


mengandung HBeAg pada permulaan perjalanan penyakitnya(15). PEMAKAIAN OBAT-OBATAN HEPATOTOKSIK
Gejala klinis, gambaran laboratoris dan histopatologis serta Sama seperti wanita yang tidak hamil, pada wanita hamil
penatalaksanaan HV pada.wanita hamil tidak berbeda dengan dapat terjadi hepatitis toksik karena pemakaian obat-obatan yang
HV pada umumnya(1,4,10), berupa anoreksia, nausea, vomitus, dapat mengakibatkan kolestasis (Tabel 1).
malaise, kadang-kadang nyeri otot, demam ringan, ikterus, nyeri Tabel 1. Obat-obatan yang Dapat Menyebabkan Kolestasis Intrahepa-
perut kanan atas dan hepotomegali(2). tik(5)
Pada pemeriksaan laboratorium didapatkan kenaikan kadar
Chlorpromazine Methimazole
bilirubin serta transaminase serum. Gambaran histopatologisnya Methyltestosterone Chlorpropamide
berupa nekrosis sel hati sentrilobuler dengan infiltrasi sel radang Oral contraceptives Tolbutamide
di daerah portal, sedangkan kerangka retikulum masih baik(1). Arsphenamines Chlordiazepoxide
Terjadinya hepatitis fulminan hans dipikirkan pada setiap Sulfanilamide Imipramine, desipramine
Thiouracil Meprobamate
kasus HV akut dengan timbulnya tanda-tanda ensefalopati he- Neocinchophen Carbamazepine
patik pada fase akut. Kadar bilirubin serum akan naik secara Indomethacin Chlorothiazide
progresif, dengan kadar transaminase serum yang sangat tinggi Griseofulvin Phenindione
dan perpanj angan waktu protrombin(14). Nitrofurantoin Pyribenzamine
Penatalaksanaan secara konservatif merupakan terapi pilih- Pemakaian obat-obat tersebut dapat menambah ikterus pada
an untuk penderita HV dengan kehamilan. Penderita hams tirah bayi baru lahir, demikian juga pada pemakaian fenasetin, dapat
baring di rumah sakit sampai gejala ikterusnya hilang dan kadar menyebabkan ikterus pada bayi yang menderita defisiensi enzim
bilirubin serum menjadi normal, makanan yang diberikan me- G-6-PD(1).
ngandung kaya kalori dan protein. Obat-obatan yang hepatoksik Ikterus pada hepatitis karena obat ini biasanya akan meng-
harus dihindari. Bila diduga akan terjadi perdarahan postpartum hilang setelah 3–6 minggu penghentian obatnya(5).
karena defisiensi faktor pembekuan darah, maka perlu diberikan
vitamin K dan transfusi plasma. Keseimbangan cairan dan elek- SIROSIS HATI
trolit juga harus diperhastikan(2,3,4). Pengaruh hepatitis kronik aktif pada kehamilan tergantung
Apabila terdapat tanda-tanda yang menjurus ke arah hepati- pada intensitas proses penyakitnya(9). Peningkatan insidens in-
tis fulminan, diet penderita harus diganti dengan rendah atau fertilitas dan komplikasi obstetrik selama kehamilan selaras
tanpa protein, juga dilakukan tindakan sterilisasi usus serta dengan berat penyakitnya(2,9). Sedangkan kehamilannya sendiri
tindakan suportif lainnya. Penggunaan kortikosteroid tidak ber- tidak memperburuk fungsi hati(1).
manfaat. Prognosisnya buruk dengan angka kematian lebih dari Suatu pengamatan terhadap 37 penderita hepatitis kronik,
85%(2,14). menemukan 17 di antaranya amenore dan 21 danpadanya tidak
dapat hamif; agaknya karena anovulasi. Dalam beberapa pene-
BATU EMPEDU litian lainnya ditemukan mortalitas janin sebesar 17–50%.
Batu empedu 2–3 kali lebih banyak terdapat pada wanita Sedangkan komplikasi obstetrik yang sering dijimpai adalah
dibanding pria, khususnya pada usia di bawah 50 tahun(1,9). toksemia dan yang lebih berat lagi adalab kegagalan faal hati
Dalam penelitian tentang kinetika kandung empedu selama serta perdarahan post partum(2).
kehamilan, Braverman dkk, seperti yang dikutip oleh Pritchard Adanya hepatitis kronik aktif bukan merupakan indikasi
dkk(9), menjumpai bahwa setelah trimester pertama volume untuk tindakan abortus(9). Pengobatan kortikosteroid dengan atau
kandung empedu selama puasa dan volume residual setelah tanpa azatioprin pada penderita hepatitis kronis selama keha-
kontraksi sebagai respons terhadap test makan, dua kali lebih milan dapat diteruskan. Dalam pengamatan Whelton dan Sher-
besar daripada wanita tidak hamil; pengosongan yang tidak lock(16) pada 5 penderita hepatitis kronik aktif autoimun yang
sempurna dapat menyebabkan retensi kristal-kristal kolesterol; mendapat kortikosteroid selama kehamilan, ternyata 3 orang
hal ini menyokong pendapat bahwa kehamilan meningkatkan melahirkan secara normal, seorang dengan seksio sesar dan se-
risiko batu empedu; diduga bahwa kadar progesteron yang orang lainnya mengalami abortus, sedangkan 4 bayi yang di-
sangat tinggi pada trimester ke dua dan ke tiga bertanggung lahirkan semuanya sehat.
jawab terhadap berkurangnya aktivitas kandung empedu. Kehamilan pada penderita sirosis hati jarang terjadi karena
Meskipun demikian ikterus karena batu empedu jarang ter- usia penderita yang biasa sudah lanjut dan karena sirosis hati
jadi selama kehamilan, hanya kira-kira 6% dan penyebab ikterus mengurangi kesuburan, yaitu sering menyebabkan amenore dan
pada kehamilan(1,2,3). siklus haid tanpa ovulasi(1,4,9,16).
Gejala klinis dan penatalaksanaan kolesistitis akut karena Menurut Cheng dan Schreyer, seperti yang dikutip oleh
batu empedu pada wanita hamil tidak berbeda dengan pada Pritchard dkk(9), kehamilan pada penderita sirosis hati akan
waktu tidak hamil. Jika diperlukan, kolesistektomi dapat di- meninggikan angka kematian perinatal dan maternal; sedangkan
lakukan pada waktu yang optimal yaitu dalam trimester ke dua, menurut Whelton serta Sherlock(16), dari beberapa jenis sirosis
untuk mengurangi risiko abortus atau partus imatur, di samping hati pada kehamilan, maka sirosis bilier mempunyai prognosis
itu ukuran uterus belum terlalu besar, sehingga kurang meng- yang tampaknya lebih baik di lainnya.
ganggu teknik operasi(2,3,9). Pengelolaan penderita sirosis hati yang hamil tidak berbeda

24 Cermin Dunia Kedokteran No. 110, 1996


dengan penderita yang tidak hamil. Persalinan spontan sebaik- diketahui, terutama pada trimester yang ke tiga, seperti pening-
nya dipercepat dengan bantuan cunam untuk mengurangi ke- katan fosfatase alkali, globulin dan kolesterol; serta penurunan
naikan tekanan pada varises esofagus. Penggunaan anestesi albumin.
umum sedapat mungkin dihindari(3).
KEPUSTAKAAN
LAIN-LAIN
1. Sherlock S. Diseases of the liver and biliary system. 6th ed. Oxford:
Hanya sedikit diketahui tentang pengaruh kehamilan pada Blackwell Scientific Publications, 1981; 400–5.
penderita hiperbilirubinemia non-hemolitik familial. Pada 2. Dotivas SG, Meeks GR, Phillips O, Momson JC, Walker LA. Liver disease
sindrom Dubin-Johnson dan Rotor, kehamilan cenderung in pregnancy. Obstetrical and Gynecological Survey 1983; 38: 831–6.
memperberat penyakitnya, sehingga dapat timbul ikterus yang 3. Miller JP. Diseases of the liver and alimentary tract. Clin Obstet Gynecol
1977; 4: 297–304.
ringan. Sedangkan pada sindrom Gilbert, ikterusnya dapat ber- 4. Geall MG, Webb MJ. Liver disease in pregnancy. Med Clin North Am
kurang karena peningkatan enzim glukuronil transferase selama 1974; 58: 8 17–22.
kehamilan(1,3). 5. Bynum TE. Hepatic and gastrointestinal disorders in pregnancy. Med Clin
Ada beberapa laporan tentang sindrom Budd-Chiari yang North Am 1977; 61: 129–33.
6. Wright R. Liver disease in pregnancy. Medicine International 1986; 2:
terjadi pada kehamilan, dan seperti pada beberapa wanita pemakai 1210–1.
obat kontrasepsi oral, hiperkoagulasi karena pengaruh estrogen 7. MacKenna J, Pupkin M, Crenshaw C, McLeod M, Parker RT. Acute fatty
mungkin sebagai penyebab penyakit ini. Prognosis terhadap ibu metamorphosis of the liver. Am J Obstet Gynecol 1977; 127: 400–4.
dan bayinya kurang baik, meskipun pada sebagian besar kasus 8. MalikT.Jauadice in pregnancy. In: Hamdani SAR, ed. Symposium Liver
Disease. Bahawalpur: Hamdard Foundation Press, 1984; 12–5.
biasanya timbul waktu post partum, sehingga tidak mempenga- 9. Pritchard JA, MacDonald PC, Gant NF. Williams Obstetrics. 7th ed.
ruhi bayinya(6). Connecticut: Appleton-Century-Crofts, 1986; 611–5.
10. Khuroo MS, Teli MR, Skidmore S. Sofi MA, Khuroo MI. Incidence and
RINGKASAN severity of viral hepatitis in pregnancy. Am J Med 1981; 70: 252–5.
11. Hieber JP, Dalton D, Shorey J, Combes B. Hepatitis and pregnancy. J
Telah dibahas beberapa penyakit hati yang dapat timbul Pediatr 1977; 91: 545–9.
pada wanita hamil. 12. Pratiknyo P. Hepatitis virus pada kehamilan dan persalinan. Semarang:
Terjadinya ikterus pada wanita hamil dapat disebabkan ka- Lab/UPF Obstetri dan Ginekologi FK UNDIP/RS Dr. Kariadi, 1988;
rena proses kehamilan, seperti perlemakan hati akut, toksemia, 81–92.
13. Cristie AB, Aref MK, Allam AA, El Muntasser IH, El Nageh M. Pregnancy
kolestasis intrahepatik dan hiperemesis gravidarum; dapat juga hepatitis in Libya. Lancet 1976; 16: 827–9.
terjadi bersama dengan suatu kehamilan, seperti hepatitis virus, 14. Suwignyo, Akbar N. Hepatitis virus B. Dalam: Soeparman, Sukaton U,
barn empedu, pemakaian obat-obatan hepatotoksik serta sirosis Daldiyono, Nelwan RHH, Ranakusuma ABS, Djoerban Z, dkk. eds. Ilmu
hati. Penyakit Dalam jilid I edisi kedua. Jakarta: Balai Penerbit FK UI, 1987;
593–601.
Penyebab ikterus pada kehamilan yang terbanyak adalah 15. Sulaiman A. Virus hepatitis B sirosis hati dan karsinoma hepatoseluler.
hepatitis virus, kemudian disusul berturut-turut dengan kolesta- Jakarta: Infomedika 1990; 115–21.
sis intrahepatik dan batu empedu. 16. Whelton Ini. Sherlock S. Pregnancy in patients with hepatic cirrhosis.
Beberapa perubahan faal hati selama kehamilan perlu Lancet 1986; 9: 995–8.

Happiness grows at our fireside,


it is not to be picked up in strangers galleries

Cermin Dunia Kedokteran No. 110, 1996 25


TINJAUAN KEPUSTAKAAN

Diagnostik Thalassemia
dengan Polymerase Chain Reaction
Sunarto
Laboratorium Ilmu Kesehatan AnakIUPF Kesehatan Anak Fakultas Kedokteran Universitas Gadjah Macla
Rumah Sakit Umum Pusat Dr. Sardjito, Yogyakarta

Keywords : – thalassemia – gene mutation and deletion – polymerase chain reaction –


amplification refractory mutation system – covalent reverse dot-blot

PENGANTAR PEMBAHASAN
Thalassemia adalah sindrom klinik yang disebabkan oleh
defek gena yang menyandi sintesis globin dengan akibat sintesis Dasar molekular thalassemia
globin mengurang atau tak ada sama sekali. Kekurangan sintesis Hemoglobin terdiri atas haem dan globin. Globin pada orang
globin pada penderita thalassemia telah dibuktikan secara in normal terdiri atas sepasang rantai polipeptid-α dan sepasang
vitro pada retikulosit darah tepi penderita(1,2,3). rantai non-α (β, δ, γ atau ε) . Sintesis globin disandi oleh gena
Manifestasi klinik thalassemia sangat beraneka ragam dan yang unik; gena yang menyandi sintesis polipetid α bersama ξ
keaneka ragaman tadi hanya dapat dijelaskan dengan studi terletak pada lengan pendek kromosom 16, menempati regio
molekular. Berbagai cara telah dikembangkan untuk kepenting- 16-25 kb (kilo base pair). Gena yang menyandi sintesis rantai β,
an penelitian maupun untuk kepentingan praktis di lapangan, di δ, γ atau ε terletak pada lengan pendek kromosom 11 menempati
antarahya adalah sequencing atau pengurutan DNA (desoxyribo- regio 55-60 kb. Rantai- ε dan rantai- ξ hanya disintesis pada awal
nucleic acid sequencing)(4-8), dengan probe oligonukleotid radio- kehidupan janin. Analisis urutan nukleotid semua gena globin
aktif atau nonradioaktif(9-12), linkage analysis dan deteksi lang- telah sangat luas dilakukan dan struktur gena itu telah didoku-
sung dengan allele specific oligonucleotide primer (primer mentasikan sepenuhnya(19). Gena globin terdiri atas 3 exon, yaitu
ARMS)(13,14,15). bagian yang diekspresikan atau menyandi sintesis polipeptid
Pada teknik diagnosis di atas, kecuali yang terakhir, DNA globin, dan di antara ketiga exon tadi terdapat intron atau inter-
hams digandakan lebih dulu untuk memperoleh sejumlah DNA vening sequence (IVS) yang tak diekspresikan. Di samping itu di
yang cukup untuk dianalisis. Sebelum teknik polymerase chain sebelah hulu ujung 5’ dan hulu ujung 3’ terdapat non-coding DNA
reaction (PCR) ditemukan, penggandaan DNA dilakukan de- atau flanking DNA(20) (Gambar 1).
ngan kloning(6,8,16,17). Penggandaan DNA dengan kloning, rumit Thalassemia terjadi bila gena globin mengalami delesi
dan memerlukan waktu sampai 10 hari. PCR merupakan suatu (terutama pada thalassemia-α) atau mutasi noktah (point muta-
prosedur penggandaan DNA secara in vitro yang praktis dan tion) (terutama thalassemia-β). Delesi genaglobin dapat mengenai
memerlukan waktu hanya kira-kira 3 jam. PCR baik sebagai cara hanya sebagian dari gena atau satu gena seutuhnya, bahkan dapat
penggandaan maupun untuk diagnostik amat praktis dan mem- mengenai beberapa gena bersama-sama(21) (Gambar 2).
punyai akurasi tinggi(15,18). Pada prosedur PCR berbagai masalah Mutasi yang berakibat thalassemia dapat terjadi pada exon,
timbul, demikian pula pada pengembangannya sebagai uji pada IVS, pada flanking DNA ujung 5’ maupun 3'(9,21,22). Kelain-
diagnostik di lapangan. an-kelainan tensebut akan menyebabkan mRNA globin tidak
Dalam makalah ini akan dibahas prinsip dan masalah PCR atau sedikit sekali terbentuk atau terbentuk mRNA abnormal
secara teknis, dasar kelainan genetik thalassemia, masalah dan yang tidak berfungsi, tidak stabil dan akan dihancurkan; akibatnya
kepentingan diagnostik thalassemia dengan menggunakan PCR. terjadi defisiensi sintesis globin(23,24). Poladelesi maupun mutasi

26 Cermin Dunia Kedokteran No. 110, 1996


triphosphate, dan dTTP = deoxythymidine triphosphate), enzim
polimerase, garam, bufer dan sepasang primer dicampur dalam
tabung reaksi. Campuran itu diberi suhu yang berselang-seling,
mula-mula 95°C selama 15 detik, kemudian suhu diturunkan
menjadi 54°C selama 15 detik dan kemudian dinaikkan lagi men-
jadi 72°C selama 30 detik(15). Pada suhu 95°C DNA untai ganda
akan terurai menjadi DNA untai tunggal (proses denaturasi);
pada suhu 54°C primer akan menempel pada segmen DNA yang
komplementer (annealing) dan selanjutnya pada suhu 72°C di
bawah pengaruh enzim polimerase primer akan mengalami pe-
manjangan (extension). Ketiga langkah ini merupakan satu siklus
dan akan menghasilkan untai DNA tunggal yang komplementer
dengan segmen DNA target (copy DNA target). Dalam satu
siklus, satu untai DNA tunggal akan tergandakan menjadi 2
untai. Dengan n siklus, dari satu untai DNA teoretis akan dihasil-
kan 2 untai. Dengan 25 siklus dan satu untai DNA tunggai akan
Gambar 1. Bagan gena globin dihasilkan lebih dari 30 juta copy untai DNA tunggal, cukup
banyak untuk proses analisis selanjutnya.
Pada awal pengembangan PCR timbul masalah yang sangat
menghambat pelaksanaan, yaitu rusaknya enzim polimerase
(fragmen Kienow) akibat suhu yang tinggi, sehingga sejumlah
enzim baru harus selalu ditambahkan seteiah setiap satu siklus.
Hal ini amat merepotkan. Dengan ditemukannya enzim Taq
(berasal dari bakteri Thermoaquatus) yang tahan panas sampai
100°C, maka permasalahan tersebut teratasi. Enzim Taq yang
dicampurkan pada awal pengerjaan dapat bertahan sampai se-
lesai, sehingga otomatisasi pengerjaan dapat diterapkan. Dengan
enzim yang tahan panas segmen DNA berukuran sampai be-
Gambar 2. Beberapa tipe delesi pada gena-α berapa kilo base pair (kb) dapat digandakan(26).
Prosedur PCR dapat dilakukan terhadap setiap sel berinti
(yang mengandung DNA) seperti sel mukosa pipi, leukosit, sel
dalam cairan amnion, viii korialis, bahkan dari bahan fosil yang
bervariasi untuk berbagai populasi/ras dan wilayah geografi dan masih mengandung DNA. Hal ini sangat memudahkan dalam
variasi ini menyebabkan manifestasi thalassemia yang beraneka memperoleh cuplikan. Metode ini sangat sensitif sehingga mem-
ragam pu1a(20). butuhkan hanya sejumlah kecil cuplikan saja; DNA sejumlah
1 ug telah cukup. Dari single copy genes dapat diperoleh se-
jumlah copy DNA cukup untuk dianalisis(8). Setetes darah kering
PRINSIP PCR pada kentas saring cukup untuk mendeteksi genotip penderita
PCR diperlukan pada diagnosis molekular, termasuk tha- tha1assemia(10). DNA produk PCR dapat disimpan dan dapat di-
lassemia. Cara ini diperkenalkan pertama kali oleh Saiki et al., gunakan sebagai cuplikan untuk digandakan lagi.
dari kelompok Cetus, tahun 1984_1985(25). Pada awalnya PCR Sensitivitas yang amat tinggi dan PCR menyebabkan ber-
dikembangkan sebagai cara untuk menggandakan DNA secara bagai masalah(15,25,26). DNA kontaminan yang amat sedikitpun
in vitro, sebagai alternatif dan cara in vivo yang rumit dan me- akan ikut tergandakan sehingga terbentuk sejumiah copy dari
merlukan waktu lama. DNA kontaminan. DNA kontaminan dapat berasal dari sel dalam
Prinsip PCR dapat dijelaskan sebagai berikut(25) : bila DNA ludah, serpih kulit dari pemeriksa, dan sebagainya. Karena itu
dicampur dengan oligonukleotid yang komplementer dan diberi pengerjaan PCR harus benar-benar teliti. Penempelan primer
kondisi yang sesuai, maka oligonukleotid tadi akan berperan secara nonspesifik pada segmen DNA non target akan meng-
sebagai titik awal (primer) sintesis copy DNA target dengan hasilkan sejumiah copy DNA non target; hal ini dapat dihindari
DNA target sebagai cetakan (template). Dengan menggunakan dengan membuat primer sespesifik mungkin, antara lain dengan
dua primer, satu di sebeiah hulu (5’) dan satu di sebelah hilir (3’), menggunakan oligonukieotid yang tidak terlalu panjang maupun
segmen DNA yang terietak di antara kedua primer tadi akan terlalu pendek dan dengan memasukkan mismatched nucleotide,
tergandakan. misalnya nukieotid –4 dari ujung 3'(15). Pada percobaan dengan
Dalam pelaksanaannya DNA bersama deoxynucleosid siklus yang amat banyak, misalnya kalau cuplikan DNA terlalu
triphosphate (dATP = deoxyadenosine triphosphate, dCTP = sedikit, dapat terbentuk dimer dan primer; dimer akan terlihat
deoxycytidine triphosphate, dGTP = deoxyguanosine sebagai DNA dengan ukuran kira-kira 40 bp, dan biasanya

Cermin Dunia Kedokteran No. 110, 1996 27


mudah dikenali sehingga tidak terlalu mengganggu. Selain mutasi digandakan dan kemudian dianalisis dengan probe, de-
masalah di atas kekurangan aktivitas polimerase dari Taq akan ngan endonuklease restriksi atau sekuensing. Prosedur yang
menyebabkan terjadinya salah baca dan penggabungan basa praktis untuk mendeteksi mutan secara langsung dari produk
yang salah (misincorporation); karena itu polimerase harus di- PCR telah dikembangkan, yaitu amplification refractory muta-
tangani dengan amat cermat, misalnya dalam hal penyimpanan tion system (ARMS)(13,15). Pada sistem ini digunakan primer
bahan-bahan yang digunakan. ARMS, yaitu oligonukleotid – terdiri atas 20–30 bp – yang kom-
plementer dengan DNA mutan (allele specific oligonucleotide =
PCR PADA THALASSEMIA ASO); nukleotid ujung 3’ dan primer ARMS komplementer
Sebelum cara PCR ditemukan analisis DNA dilakukan dengan nukleotid yang mengalami mutasi. Primer ARMS untuk
dengan prosedur yang panjang dan rumit, yaitu pertama-tama mutan tertentu akan merupakan primer atau amplimer bagi
membentuk perpustakaan (library construction) melalui digesti mutan itu saja, dan tidak bagi DNA normal maupun mutan lain,
dengan endonuklease restriktif dan kloning, kemudian skrining, karena ujung 3’ primer ARMS mutan tidak komplementer de-
mapping, subkloning dan terakhir sekuensing. PCR dapat me- ngan DNA normal maupun mutan lain. Satu primer ARMS yang
nyingkat proses tersebut: dengan PCR, yang masih mengguna- komplementer dengan segmen hilir DNA mutan tertentu ber-
kan fragmen Klenow, dapat diperoleh fragmen DNA yang lang- sama dengan satu common primer (yang punya urutan nukleotid
sung dapat disubklon(27). Pada prosedur PCR sekarang, dengan sama dengan segmen DNA target di hulu) akan menggandakan
menggunakan enzim Taq, subkloning tidak diperlukan lagi. segmen DNA mutan yang terletak di antara kedua primer ter-
Tipe delesi pada thalassemia-α yang terbanyak di Asia sebut.
Tenggara adalah –α3,4 dan –α4,2. Dengan menggunakan dua Untuk mendeteksi mutasi IVS-1 nt5 (G –> C) pada
primer – satu di hulu dan satu di hilir dan delesi – akan dihasil- gena-β misalnya, digunakan primer ARMS, 5'
kan segmen DNA yang sekian bp lebih pendek daripada normal. CTCCTTAAACCTGTCTTGTAACCTTGTTAG 3’ dan
Pada hidrop fetalis Hb Bart tidak terbentuk copy dan gena-α common primer 5’ ACCTCACCCTGTGGAGCCAC 3’(15).
sebagai produk PCR(18). karena penderita sama sekali tidak mem- Proses PCR digambarkan sebagai berikut (Gambar 3).
punyai gena-α. Winichagoon et al. (1989) membuktikan bahwa Dengan primer di atas akan diperoleh sejumlah besar copy
PCR mampu mendeteksi delesi hanya sepanjang 4bp pada kodon dari segmen DNA target denganukuran 285 bp, hanya kalau pada
41/42 (–CTTT) dan gena-β(28). DNA target terdapat mutasi IVS1 ntl (G–>C); DNA normal
Untuk mendeteksi mutan, yang merupakan dasar utama tidak akan digandakan. Sebaliknya d tabung yang mengan-
kelainan genetik pada thalassemia- β mula-mula segmen tempat dung primer normal yang ujung 3’-nya C (komplementer dengan

Gambar 3. Bagan deteksi mutan dengan prosedur ARMS: a/ penempelan primer ARMS pada DNA target
[gena-b dengan mutasi pada IVS-1 nt-5 (G–>C)] dan seterusnya ekstensi primer ARMS –> ter-
bentuk DNA yang komplementer dengan DNA target; b/ common primer menempel pada DNA hasil
ekstensi primer ARMS dan seterusnya ekstensi common primer menghasilkan DNA dengan panjang
285 bp. (c/)

28 Cermin Dunia Kedokteran No. 110, 1996


ujung 3’ DNA normal G), akan terjadi penggandaan DNA nor- tidak diperlukan bahan radioaktif maupun elektroforesis, se-
mal, sedangkan penggandaan DNA mutan tidak terjadi. Segmen hingga mudah dilaksanakan dan relatif murah. Di samping itu
DNA yang diperoleh kemudian dideteksi secara elektroforesis terdapat keunggulan lain, yaitu beberapa primer ASO dapat
dengan pengecatan etidium bromid. digunakan sekaligus, sehingga mutan langsung dapat dibaca
Gambar 4 memperlihatkan hasil elektroforesis dari produk (Gambar 5); canik-carik lempeng yang berisi bermacam-macam
PCR dan mutasi IVS1 nt5(G–>C)(15). probe ASO yang diperlukan mudah disuplai untuk keperluan
lapangan(11).

Gambar 5. Hasil reverse dot blot beberapa jenis mutasi

Pada prosedur ARMS maupun hibridisasi RDB, primer


ASO maupun probe ASO mudah disintesis jika pola mutasi dari
populasi yang diteliti sudah diketahui. Primer atau probe ASO
Gambar 4. Hasil elektroforesis DNA produk dan ARMS. bagi mutan yang sering terdapat merupakan prioritas untuk
0x174\Hae111 dipakai sebagai marker untuk menunjukkan disediakan.
ukuran fragmen-fragmen. Adanya fragmen dengan ukuran
861 bp pada semua jalur menunjukkan efikasi PCR. Jalur 3,4 MANFAAT PCR
dari kontrol positif menunjukkan produk dengan ukuran 285
bp; ini berarti ada mutasi IVS1nt5(G–>C). Pada jalur 1, 2, 5 Penggandaan DNA dengan kloning tidak praktis terutama
dan kontrol negatif tidak ada mutasi tersebut. untuk keperluan diagnosis prenatal yang berlomba dengan
waktu(18), sedangkan PCR hanya memerlukan waktu 3 atau 4
Meskipun prosedur ARMS cukup praktis, tetapi untuk meng- jam, prosedur pengerjaannya seperti melakukan reaksi kimia biasa
identifikasi suatu mutan setiap primer ASO harus dicoba sendiri- dan telah digunakan dalam berbagai penelitian thalassemia(5,16,29).
sendiri. Untuk mengatasi masalah tersebut Maggio et al. (1993) Dengan PCR dalam waktu 24 jam sejak pencuplikan vili korialis
menerapkan teknik hibridisasi covalent reverse dot blot (RDB) (chorionic villous sampling) diagnosis prenatal sudah dapat di-
dengan hasil sangat akurat(11). Pada teknik ini ASO digunakan tegakkan(18).
sebagai probe (probe ASO) untuk alel mutan dan probe untuk alel Pada studi pola mutasi diperlukan cara yang praktis dan
normal. Bermacam-macam probe ASO bersama dengan probe murah, dalam hal ini PCR dapat memenuhi tuntutan tersebut.
normal difiksasikan terpisah-pisah pada lempeng nilon (Biodyne Varawalla et al. (1991) dengan 19 macam primer ARMS dan 5
Cnylon membrane). Pada carik lempeng sebelah atas difiksasikan macam common primer meneliti 702 carrier, yaitu ibu dari bayi
sederet probe untuk alel normal dan di sebelah bawahnya sederet thalassemia-β di Subbenua India(15). Dengan primer yang amat
probe ASO untuk bermacam-macam alel mutan. DNA hasil bervariasi tersebut berhasil diidentifikasi 98% genotip dan kasus
amplifikasi PCR yang mencakup segmen tempat mutasi yang yang diteliti. Lima macam mutasi yaitu IVS-1 nt5 (G–>C), delesi
dicurigai dipaparkan pada canik lempeng tadi setelah didenatu- 619 bp dan ujung 3’ gena-β, kodon 8/9 (+C), NS-l ntl (G–>T),
rasi dengan pemanasan, maka akan terjadi hibridisasi DNA tadi dan kodon 41/42 (–CTTT) merupakan 93,6% dari keseluruhan.
dengan probe yang ada pada lempeng. Alel normal hasil ampli- Jenis mutasi tersebut sama dengan yang ditemukan pada imigran
fikasi akan mengalami hibridisasi pada deret atas dan lempeng, India di Inggris(13). Ini berarti 5 macam primer ARMS untuk
sedangkan alel mutasi akan mengalami hibridisasi dengan probe mutan tersebut merupakan primer utama yang perlu disediakan
ASO yang sesuai di deret bawah. Setelah pengerjaan dengan untuk wilayah Subbenua India atau untuk ras India.
konyugat streptavidin horseradish peroxidase (HRP) atau avidin Dengan menggunakan primer ARMS untuk IVS-1 ntl (G–
alkaline phosphatase (AP) deteksi warna dilakukan dengan >A), IVS-1 nt5 (G–>C) dan kodon 15(G–>A) Sofro et al.
substrat nitroblue tetrazolium (NBT) untuk AP atau tetrame- (1992) melaporkan jenis mutasi dan penderita thalassemia dan
thylbenzidine (TMB) untuk HRP. Pada prosedur RDB di atas trait thalassemia dari Yogyakarta dan sekitannya(14). Dari 81

Cermin Dunia Kedokteran No. 110, 1996 29


subyek yang diteliti dapat diidentifikasi jenis mutasi dari 67 1970; 19: 469–75.
2. Friedman SH, Schwartz E, Ahern V, Ahern E. Globin synthesis in the
subyek dengan frekuensi mutan sesuai dengan hasil penelitian Jamaican Negro with l-thalassemia, Br J Haematol. 1974; 28: 505–13.
Lie-Injo et al(29) dengan teknik PCR dan probe oligonukleotid 3. Todd D, Chan V, Schneider RG, Dozy AM, Kan YW, Chan TK. Globin
menemukan tipe mutasi berturut-turut dari yang tersering synthesis in hemoglobin New York (β113valin–>glutamic acid, Br J Hematol.
IVS1ntl (G–>C), Kodon 26(HAH–>AAG), IVS2nt654(C–>T), 1980; 46: 557–64.
4. Cheng TC, Orkin SH, Antonarakis SE. Potter MJ, Sexton JP, Markham AF,
IVS1ntl (G–>T), Kodon 1 5(TGG–>TAG), Kodon 17(AAG–> Giardina PJV, Li A, Kazazian Jr HH. β-thalassemia in Chinese use of in
TAG), Kodon30(AGG–>ACG),IVS1ntl(G–>A),Kodon 35(–C), vivo mRNA analysis and oligonucleotide hybridization in systemic cha-
Kodon4l/42(–CTTT). Berdasarkan penelitian itu, jika teknik racterization of molecular defects. USA: Proc NatI Acad Sci 1984; 81:
ARMS diterapkan di Indonesia primer yang terutama perlu 2821–25.
5. Chan V, Chan TK, Kan YW, Todd. A novel β-thalassemia frameshift
disediakan adalah: mutation (codon 14/15), detectable by direct visualization of abnormal
5’ TTAAACCTGTCTTGTAACCTFGATACGAAG 3’ untuk restriction fragment in amplified genome DNA. Blood 198; 72: 1420–23.
mutan IVS1 ntl(G–>C), 6. Fucharoen 5, Kobayashi Y, Fucharoen G, Ohta Y, Miyazono K, Fukimaki
5’ GAATAACAGTGATAATTTCTGGGTTATGGT 3’ untuk F, Takaku. A single nucleotide deletion in codon 123 of -g1obin gene
causes an inclusion bodies 3-thalassemia trait: A novel elongated globin
mutan IVS2 nt654(C–>T), chain Makabe. Br J Haematol. 1990; 75: 393–99.
5’ TTAAACCTGTCTTGTAACCTFGATACGAAA 3’ untuk 7. Romeo L, Almeido L, Higgs DR, Levinha J, Liebhaber SA. α-thalassemia
mutan IVS1 ntl(G–>T), resulting from deletion of regulatory sequences far upstream of the α-
5’ CCACCAACTTCATCCACGTTCACTTGGCCT 3’ untuk globin structural gene Blood 1991; 7: 1589–95.
8. Wong C, Antonarakis SE, Goff SC, Orkin SH, Forget BG, Nathan DG,
mutan kodon 15(G–>A), dan Giardina PJV, Kazazian Jr HH. β-thalassemia due to two novel nucleotide
5’ TAACCTTGATACCAACCTGCCCAGGGGCTT 3’ untuk substitutions in consensus acceptor splice sequences of the -globin gene
mutan kodon 26(GAG–>AAG) atau HbE. Blood 1989; 73: 914–18.
Dengan menggunakan teknik hibridisasi RDB Maggio et al. 9. Cal SP, Zhang JZ, Doherty M, Yuet WK. A new TATA box mutation
detected at prenatal diagnosis for -tha1assemia. Hum Genet 1989; 45:
(1993) dapat mengidentifikasi sembilan mutasi pada gena-β 112–14.
yang sering terdapat pada populasi Sicilia, berturut-turut dari 10. Huang SZ, Zhou XD, Thu H, RenZR, Zeng YT. Detection ofβ-thalassemia
yang terbanyak mutasi kodon 39, IVS1nt110, IVS1nt6, IVS1nt1, mutations in Chinese using amplified DNA from dried blood specimens,
mutasi IVS2nt745 dan mutasi nt-87. Persentase dari masing- Hum Genet 1989; 84: 129–3 1.
11. Maggio A, Giambona A, Cal SP, Wall J, Kan YW, Chebab FF. Rapid and
masing mutan ternyata sesuai dengan penelitian sebelumnya. simultaneous typing of hemoglobin S, hemoglobin C, and seven Me-
Hal ini menunjukkan keakuratan dari cara tersebut(11). diterranian -thalassemia mutations by covalent reverse dot-blot analysis:
Karena prosedur PCR amat praktis maka besar harapan akan Application to prenatal diagnosis to Sicily, Blood 1993; 81: 239–42.
dapat diimplementasikan sebagai prosedur rutin di Indonesia 12. Saiki RK, Gelfand DH, Stoffel 5, Scharf Si, Higuchi R, Ham GT, Mullis
KB, Erlich HA. Primer directed enzymatic amplification of DNA with a
khususnya untuk diagnosis prenatal bila alternatif pengendalian thermostable DNA polymerase. Science 1988b; 239: 487–91.
thalassemia melibatkan diagnosis tersebut. Apabila polimerase 13. Old JM, Varawalla NY, Weatherall DJ. Rapid detection and prenatal
Taq dan primer/probe dapat ditekan harganya maka biaya tiap diagnosis ofll-thalassemia: studies in Indian and Cypriot populations in the
satuan analisis akan tidak mahal(18). UK. Lancet 1990; II: 834–37.
14. Sofro ASM, Lanni F, Ismadi. Globin gene mutations ofbeta-thalassemiaat
Dr. Sardjito General Hospital Yogyakarta-Indonesia Hum Genet 1992;
KESIMPULAN 51(Y) Supl A: 343.
PCR merupakan cara enzimatik yang sangat sensitif dan 15. Varawalla NY, Old JM, Sarkar R, Venkatesan R, Weatherall DJ. The
spesifik untuk menggandakan DNA. Dengan ditemukannya spectrum of 1-thalassemia mutations on the Indian subcontinent: the basis
for prenatal diagnosis. Br J Haematol. 1991; 78: 242–7.
polimerase Taq prosedur ini makin praktis, sehingga kini cara 16. Nantomi Y, Nakashima H, Kagimoto M, Naito Y, Yokota E, Imamura T.
tersebut telah luas digunakan dan merupakan alternatif yang A common chinese β-thalassemia mutation found in a Japanese family.
praktis untuk memperoleh DNA dalam jumlah yang cukup guna Hum Genet 1990; 86: 480–83.
kepentingan studi molekular, termasuk thalassemia. Berdasar- 17. Wang C, Antonarakis SE, Goff SC, Orkin SH, Forget BG, Boehm CD,
Kazazian Jr HH. On the origin of the spread of 1-thalassemia : Recurrent
kan prinsip PCR telah dikembangkan cara diagnostik molekular observation on mutations in different ethnic groups, USA:Pro Natl Acd Sci
yang terbukti sangat akurat. Dengan prosedur ARMS yang 1986; 83: 6529–32.
menggunakan allele specific oligonucleotide sebagai primer 18. Fucharoen 5, Winichagoon P. Thonglairoam V. Siriboon W, Siritanarakul
mutan dapat dideteksi secara langsung. Teknik hibridisasi RDB N, Kanokpongsakdi S. Vantanasiri V. Prenatal diagnosis of thalassemia
and hemoglobinopathies in Thailand : Experiences from 100 pregnancies
terhadap DNA produk PCR dengan menggunakan allele specific Southeast Asian, J Trop Med Pubi Health 1991; 22: 16–29.
oligonucleotide sebagai probe merupakan cara diagnostik 19. Vogel F, Motulsky AG. Human Genetics Problem and Approaches 2nd ed.
molekular yang relatif mudah. Untuk penyediaan primer maupun Berlin: Springer-Verlag, 1986.
probe yang sesuai bagi populasi atau ras tertentu, macam dan 20. Fucharoen-Winichagoon P. Fucharoen S. Molecular mechanism of tha-
lassemiain Thailand. Thailand: J Sc Soc 1986; 12: 9–21.
frekuensi mutasi gena pada populasi yang bersangkutan harus 21. Bunn HF, Forget BG. Hemoglobin : genetic and clinical aspects 1st ed.
telah diketahui lebih dahulu. Philadelphia: WB. Saunders Co 1986; pp 225–305.
22. Rosatelli MC, Oggiano L, Leoni GB, Tuveri T, Di Tucci A, Scalas MT.
KEPUSTAKAAN Dore E, PistiddaP, Massa A, Longinotti M, Cao A. Thalassemiaintermedia
resulting from a mild -thalassemia mutation Blood 1989; 73: 601–05.
1. Conconni F, Bargellesi A, Del Senno L, Menegatti E, Pontremoli S. Russo 23. Kazazian HH, Ginder GD, Snyder PG. Van Beneden Ri, Wodhead AP.
G. Globin chain synthesis in Sicilian thalassemic subjects, Br J Haematol. Furtherevidence of quantitative deficiency of chain-specific globin mRNA

30 Cermin Dunia Kedokteran No. 110, 1996


in thalassemia syndromes, USA: Proc Nat Acad Sci 1975; 72: 567–71. enzymatically amplified genomic sequences. Science 1986; 233: 1076–78.
24. Nienhuis AW, Turner P, Benz Jr. EL Relative stability of c and 3-globin 28. Winichagoon P. Kownkon J, Yetchinsomanus P. Thonglairoam V, Sirita-
messenger RNAs in homozygous 3+-thalassemia. USA: Proc Natl Acad naratkul N, Fucharoen S. Detection of 13-thalassemia and hemoglobin E
Sci 1977; 74: 3960–64. gene in Thai by a DNA amplification technique Hum Geret 1989; 82:
25. Arnheim N, Levenson CH. Polymerase chain reaction CAEN – Special 389–90.
Report, October 1990. 29. Lie-Injo LE, Cai SP, Iskandar Wahidiyat, Moeslichan S. Lim ML, Evange-
26. Saiki RK, Chang CA, Levenson CH, Waren IC. Boehm CD. Haig MS, lista I, Doherty M. Kan YM. 3-thalassemia mutations in Indonesia and
Kazazian H, Ehrlich HA. Diagnosis of sickle anemia and 3-thalassemia their linkage to 3-haplotype, Am J Hum Genet 1989; 45: 97 1–5.
with enzymatically amplified DNA and nonradioactive allele-specific 30. Wong C, Dowling CE, Saiki RK, Higuchi RG, Erlich HA, Kazazian Jr HH.
oligonucleotide probes. N Engl J Med 1988a; 319: 537–41. Characterization of 3-thalassemia mutations using direct genomic sequenc-
27. Scarf SJ, Horn GT, Ehrlich HA. Direct cloning and sequence analysis of ing of amplified single copy DNA. Nature 1987; 330: 384–6.

Cermin Dunia Kedokteran No. 110, 1996 31


TEKNIK

Pengembangan Uji Diagnostik melalui


Teknik Molekuler

Rochman Na'im
Jurusan Penyakit Hewan dan Kesehatan Masyarakat Veteriner, Fakultas Kedokteran Hewan
Institut Pertanian Bogor, Bogor

PENDAHULUAN gunakan probe asam nukleat adalah hibridisasi. Teknik ini di-
Dalam bidang kedokteran (manusia maupun hewan), uji-uji dasarkan pada perpaduan dua basa nukleotida dan rantai asam
diagnostik merupakan salah satu metode untuk menangani kasus nukleat yang komplementer (DNA dengan DNA atau RNA; dan
penyakit. Berbagai uji diagnostiktelahdikembangkan, baik yang RNA dengan RNA).
didasarkan pada teknik kultur agen penyakit, reraksi kimia/ Teknik hibridisasi meliputi dua proses, yaitu proses denatu-
biokimia maupun reaksi imunologik. Dengan berkembangnya rasi atau pemisahan dua rantai asam nukleat yang komplementer
teknologi dalam bidang biologi molekuler, maka pengembangan dari proses renaturasi atau perpaduan kembali dua rantai asam
uji-uji diagnostik mulai diarahkan kepada teknologi tersebut nukleat. Proses denaturasi biasanya dilakukan dengan cara pe-
yang menggunakan materi genetik sebagai dasar pengujiannya. manasan DNA untuk memecah ikatan hidrogen yang terdapat
Materi genetik yang berupa asam nukleat baik DNA (Deoxy- di antara pasangan basa sehingga rantai asam nukleat akan
ribose Nucleic Acid) maupun RNA (Ribo Nucleic Acid) mengan- terpisah. Proses ini kemudian diikuti dengan proses renaturasi
dung tiga komponen, yaitu: 1) basa (purin dan pirimidin); 2) gula dengan cara pendinginan.
(deoksiribosa untuk DNA dan ribosa untuk RNA); dan 3) fosfat. Uji-uji yang menggunakan hibridisasi membutuhkan proses
Basa purin yang terdapat pada DNA maupun RNA adalah sama, denaturasi dan fragmen asam nukleat yang tidak diketahui dan
yaitu Adenine [A] dan Guanine [G] sedangkan basa pirimidin memfiksasi fragmen tersebut pada bahan solid seperti filter
berbeda, untuk DNA adalah Cytocine [C] dan Thymine [T] dan nitroselulosa. Kemudian suatu probe asam nukleat yang kom-
untuk RNA kedudukan Thymine digantikan oleh Uracil [U] plementer dicampurkan dengan fragmen asam nukleat yang
Kedua unsur basa tersebut (purin dan pirimidin) akan berpa- terdapatpada bahan solid tersebut pada kondisi yang mendukung
sangan membentuk kode-kode genetik pada DNA maupun RNA terjadinya hibridisasi. Proses hibridisasi dapat juga dilakukan
melalui ikatan hidrogen (A akan berpasangan dengan T [pada dalam larutan (bukan bahan solid). Baik DNA yang hendak
DNA] atau A dengan U [pada RNA]; dan G dengan C). Unsur didiagnosis (target) maupun probe dimasukkan dalam larutan
gula dan fosfat akan membentuk struktur DNA dan RNA. DNA buffer. Kedua DNA tersebut bebas bergerak dan proses hibridi-
memiliki struktur rantai ganda sedangkan RNA memiliki rantai sasinya berlangsung 5–10 kali lebih cepat danipada di bahan
tunggal. Struktur DNA lebih stabil bila dibandingkan dengan solid. Keadaan tersebut sangat penting dalam aplikasi kebanyak-
RNA. an diagnostik mikrobiologi yang memiliki konsentrasi DNA
Berdasarkan materi genetik tersebut, uji-uji diagnostik di- target sangat sedikit dan membutuhkan waktu diagnosis lebih
kembangkan melalui teknik-teknik molekuler seperti hibridisasi cepat.
dengan probe asam nukleat; polymerase chain reaction (PCR), Kondisi yang dapat mempengaruhi apakah dua rantai
restriction fragment length polymorphism (RFLP) dan sekuensing asam nukleat akan berhibridisasi disebut stringency. Kondisi
asam nukleat. stringency yang kuat akan mendukung perpaduan dua basa dari
dua rantai yang komplementer dengan tepat. Sedangkan kondisi
HIBRIDISASI stringency yang lemah akan menyebabkan banyaknya perpadu-
Mekanisme dasar di balik uji-uji diagnostik yang meng- an dua basa yang tidak sesuai di antara dua rantai asam nukleat.

32 Cermin Dunia Kedokteran No. 110, 1996


Salah satu kondisi yang mempengaruhi hibridisasi adalah buat PCR dapat digunakan untuk uji-uji diagnostik secara
tipe asam nukleat yang akan dihibndisasi. Perpaduan dua basa praktis.
antara dua rantai DNA tidak sekuat pasangan basa antara DNA DNA polymerase adalah enzim yang dapat mensintesis
dan RNA. Rantai asam nukleat yang lebih panjang dengan rantai DNA yang baru dan DNA yang sudah ada. Penemuan
jumlah pasàngan basa yang komplementer lebih banyak akan enzim yang tahan panas sangat membantu untuk mensintesis
berhibridisasi lebih kuat daripada rantai yang pendek. Kompo- DNA barn, karena tahap awal proses PCR dilakukan dengan
sisi basa asam nukleat juga akan mempengaruhi hibridisasi, cara pemanasan rantai DNA yang sudah ada pada temperatur
karena pasangan basa G-C lebih kuat daripada pasangan A-T. 90°C.
Selain itu temperatur dan kekuatan ionik buffer yang digunakan Untuk mengamplifikasi DNA dilakukan 30-40 kali siklus
juga akan mempengaruhi reaksi hibridisasi. proses PCR. Satu siklus terdiri dari 3 tahap, yaitu tahap denatu-
Probe asam nukleat adalah suatu fragmen rantai tunggal rasi pada temperatur 95°C, tahap hibridisasi primer pada tem-
dari DNA atau RNA yang komplementer yang telah dilabel. peratur 37° sampai 56°C dan tahap polimerisasi pada temperatur
Probe ini dapat dibuat sesuai dengan komposisi basa yang ter- 72°C.
dapat pada gen dan suatu agen penyakit sehingga probe tersebut Secara umum, DNA yang akan diamplifikasi diapit oleh se-
hanya dapat berhibridisasi dengan gen dan agen penyakit ter- pasang primer sintetik yang merupakan potongan pendek dari
sebut dan secara spesifik akan mendeteksi adanya agen penyakit. DNA yang spesifik/komplementer yang berfungsi sebagai
Ada berbagai cara untuk memperoleh dari melabel probe template dari DNA yang akan diamplifikasi. DNA target yang
asam nukleat. Sebuah gen dan agen penyakit yang akan dideteksi akan diamplifikasi didenaturasi terlebih dahulu dengan pema-
hams dimurnikan terlebih dahulu, kemudian dilabel apakah nasan, kemudian primer ditambahkan pada DNA target dan
dengan radioisotop seperti 32P atau dengan substansi non-radio- temperatur diturunkan agan terjadi proses hibridisasi. Bila tahap
isotop. Walaupun substansi non-radioisotop dan dapat disimpan polimerisasi dimulai, maka rantai DNA target yang terdapat di
dalam waktu yang lebih lama. Sensitifitas uji diagnostik meng- antara primer akan diperbanyak menjadi dua rantai dengan pan-
gunakan probe yang dilabel dengan non-radioisotop dapat di jang yang sama seperti DNA target. Dengan adanya pengulang-
,tingkatkan dengan penggunaan PCR. Substansi non-radioisotop an tahap-tahap denaturasi, hibridisasi dan polimerisasi beberapa
yang paling sering digunakan sebagai label adalah biotin dan kali, maka DNA target akan diperbanyak secana efektif.
digoxigenin. Bila enzim reverse transcriptase yang mensintesis DNA
Probe yang dilabel dengan biotin akan dideteksi dengan dan template RNA, digunakan pada tahap awal proses PCR,
menggunakan konjugat streptavidin-alkaline phosphatase (atau maka RNA ribosom dan genomik dan virus RNAjuga dapat di-
enzim lain) dan pewarna yang sesuai untuk menghasilkan reaksi amplifikasi.
yang berwarna seperti pada reaksi ELISA (Enzyme Linked PCR dapat digunakan dalam uji-uji diagnostik untuk
Immunosorbent Assay). Untuk probe yang dilabel dengan mengamplifikasi asam nukleat dan agen-agen penyakit yang
digoxigenin, konjugat antibodi terhadap digoxigenin dengan ada dalam jumlah sedikit sehingga sensitifitas uji dapat diting-
berbagai enzim dapat digunakan dengan substrat yang sesuai katkan. DNA yang telah diamplifikasi selanjutnya diidentifikasi
untuk menghasilkan reaksi berwarna. Bila antibodi terhadap dengan teknikhibridisasi yang rnenggunakan probe asam nukleat
digoxigenin dikonjugasikan dengan alkaline phosphatase, substrat yang spesifik, atau dengan analisis restriction fragment length
chemiluminescent dapat digunakan untuk menghasilkan reaksi polymorphism (RFLP) dan elektroforesis pada gel aganose atau
bercahaya, yang bila diekspos ke film sinar X akan memberikan dengan cara sekuensing.
metode deteksi yang sensitif.
Probe dapat juga dibuat dari oligonukleotida (biasanya
terdiri dari 30-40 nukleotida) yang dibuat secara sintetik. RESTRICTION FRAGMENT LENGTH POLYMOR-
Oligonukleotida tersebut dapat berupa fragmen DNA rantai PHISM (RFLP)
tunggal atau fragmen RNA yang dilabel. Teknik ini menggunakan enzim-enzim restriksi yang ber-
Probe asam nukleat dapat digunakan pada hampir seluruh fungsi sebagai pemotong DNA rantai ganda pada sekuens yang
agen patogen, baik untuk digunakan dalam laboratonium riset spesifik, untuk menentukan apakah dua fragmen DNA memiliki
sebagai alat eksperimental atau untuk uji-uji diagnostik yang kesamaan. Dalam teknik ini, DNA didigesti atau dipotong de-
sifatnya komersial. ngan enzim restriksi tertentu, kemudian dielektroforesis pada gel
aganose yang akan memisahkan fragmen DNA yang dipotong
POLYMERASE CHAIN REACTION (PCR) sesuai dengan ukurannya. Kalau DNA tidak identik ukurannya,
Salah satu perkembangan teknik biologi molekuler yang maka pola fragmen DNA pada gel tidak akan sepadan. Bila pola
sangat membantu dalam pengembangan uji-uji diagnostik ada- fragmen DNA sarna, maka enzirn restriksi tersebut akan diguna-
lah PCR. PCR dapat mengamplifikasi DNA dan jumlah yang kan untuk menentukan apakah dua rantai DNA merniliki ke-
sedikit menjadi jumlah yang dapat dideteksi/banyak. samaan.
Adanya penemuan DNA polymerase (Taq polymerase) yang Satu rantai DNA yang tidak diketahui dapat diidentifikasi
stabil pada temperatur tinggi dan pengembangan alat yang apakah berasal dari agen penyakit tertentu atau tidak dengan cara
mengatur temperatur proses PCR secara otornatis, telah mem- pembar pola RFLP dengan referensi standar.

Cermin Dunia Kedokteran No. 110, 1996 33


SEKUENSING ASAM NUKLEAT teknik molekuler hanya akan berfungsi sebagai pelengkap uji-
Sekuensing asam nukleat merupakan suatu metode untuk uji diagnostik yang telah ada.
menentukan urutan-urutan basa nukleotida (A, C, G dan T) Teknik-teknik molekuler yang telah diuraikan tersebut se-
dalam suatu gen dan asam nukleat. Saat m sekuensing asam baiknya digunakan untuk memahami atau mempelajari agen
nukleat dapat dilakukan secara otomatis dengan suatu alat yang penyakit pada tingkat molekuler dan interaksinya dengan induk
disebut nucleic acid sequencer. Peralatan tersebut dapat meng- semang.
identifikasi secara cepat suatu mikroorganisme berdasarkan
sekuens dan genomiknya. Bila alat tersebut aplikasinya di- KEPUSTAKAAN
kombinasikan dengan PCR, maka dapat dijadikan suatu alat uji
1. Brock TD, Madigan MT. Biology of Microorganisms. 5th ed. Prentice Hall.
diagnostik yang sensitif dan spesifik. New Jersey. 1988.
Bagaimanapun uji-uji diagnostik yang didasarkan pada 2. Innis MA, Gelfand DH, Sninsky JJ, White TJ. PCR Protocols: A Guide to
teknik molekuler bukanlah sesuatu yang mudah, melainkan Methods and Applications. Academic Press, Inc. San Diego. California.
membutuhkan keterampilan khusus. Teknik molekuler tersebut 1990.
3. Murray RK, Granner DK, Mayes PA, Rodwell VW. Harpers Biochemistry.
seharusnya digunakan untuk mengembangkan uji-uji diagnostik 23rd ed. Prentice Hall International Inc. USA. 1993.
yang Iebih sensitif dan lebih spesifik dengan biaya yang relatif 4. Old RW, Primrose SB. Principles of Gene Manipulation: An Introduction to
tidak mahal. Genetic Engineering. Blackwell Scientific Publications. London. 1989.
Untuk agen-agen penyakit tertentu metode diagnosis seperti 5. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory
Manual. 2nd ed. Cold Spring Harbor Laboratory Press. New York. 1989.
antibodi monokional, ELISA, mikroskop elektron, immuno- 6. Swaminathan B, PrakashG. Nucleic Acid and Monoclonal Antibody Probes:
fluoresensi ataupun uj i-ui i diagnostik konvensional lainnya Application in Diagnostic Microbiology. Marcel Dekker, Inc. New York.
masih memberikan hasil yang cukup baik. Dengan demikian 1989.

Half the ease of life oozes away through the leaks of unpunctuality

34 Cermin Dunia Kedokteran No. 110, 1996


TINJAUAN KEPUSTAKAAN

Tanaman Obat Bersifat Antibakteri


di Indonesia

B. Dzulkarnain, Dian Sundari, Au Chozin


Pusat Penelitian dan Pengembangan Farmasi, Badan Penelitian dan Pengembangan Kesehatan
Departemen Kesehatan RI, Jakarta

PENDAHULUAN tanggungjawab atas khasiat ini.


Penyakit infeksi mungkin merupakan penyakit yang banyak Penyakit infeksi yang banyak diderita masyarakat di an-
diderita masyarakat Indonesia sejak dulu. Pada waktu sekarang taranya(10,11,18). infeksi usus, antara lain karena Staph. aureus, E.
penyakit infeksi dapat ditanggulangi menggunakan obat modern coli, Salmonella typhi, Vibrio cholerae, infeksi lambung seperti
di antaranya antibiotika. Zaman dahuh bahan modern ini tidak Staph. aureus, infeksi kulit karena Staph. aureus, Pseudomonas
dikenal dan masyarakat pada waktu itu tergantung pada berbagai aeruginosa dan sebagainya.
bahan yang diperoleh di sekitar rumah termasuk pekarangan Penentuan daya antibakteri(9) dapat dilakukan dengan me-
atau hutan sekitarnya. nentukan adanya daya hambat pertumbuhan bakteri atau di-
Dari berbagai catatan diketahui berbagai tanaman yang di- lanjutkan dengan menentukan potensi daya hambat dengan
gunakan untuk mengatasi keluhan yang mungkin sekali di- membandingkan dengan antibiotika atau dengan menentukan
sebabkan kuman (infeksi). Dari berbagai survey, di antaranya koefisien fenol. Untuk ini dilakukan percobaan menggunakan
Survey Kesehatan Rumah Tangga(1,2). Survey Penggunaan Obat plat agar dengan cara sumur atau menggunakan cakram me-
Tradisional di masyarakat di Sulawesi dan Kalimantan Timur(3), ngandung sejumlah antibiotik, atau dengan menentukan peng-
di Aceh dan Madura(4). Survey Etnobotani di daerah oleh Pus- hambatan pertumbuhan dengan menentukan kekeruhan atau
litbang Biologi LIPI(5), dapat disimpulkan bahwa, masyarakat dengan turbidimetri, atau dengan menentukan konsentrasi
masih mengandalkan alam sekitarnya untuk menanggulangi terendah yang menghambat pertumbuhan (MIC = minimal
penyakit yang mungkin sekali disebabkan kuman(3,5-8). Terlihat inhibition concentration) atau konsentrasi terendah yang me-
cara ini kuno, tetapi selain obat modern belum dapat mencapai matikan kuman (MLC = minimal lethal concentration).
daerah jauh, apalagi penggunaan antibiotika yang harus dengan Bentuk bahan yang diuji dapat berupa bentuk sediaan yang
resep dan mahal, tidak bisa tidak masyarakat harus puas dengan digunakan secara empirik, seperti tumbukan, perasan, seduhan,
keadaan demikian. rebusan dan sebagainya. Percobaan pendahuluan ini dilanjutkan
Di balik itu, bila diingat bahwa bentuk zat aktif berbagai dengan bentuk sediaan yang diperoleh dengan penyarian meng-
obat modern berasal dari alam, contoh atropin, digitalis, anti- gunakan berbagai penyari seperti etanol, metanol, etil-asetat,
biotik penisilin juga merupakan hasil alam, maka dapat dire- eter minyak tanah, kioroform, dikiorometana atau campuran
nungkan bahwa obat dari alam yang digunakan secara tradisional bahan ini dengan berbagai perbandingan. Langkah lebih maju
mungkin saja mempunyai dasar kebenaran yang belum banyak adalah dengan mencoba zat-zat murni dari tanaman.
dibeberkan. Andaikata bahan-bahan di atas tidak menolong,
mungkin sudah lamaditinggalkan. Untuk inilah dicoba merekam PENELUSURAN PUSTAKA
pembuktian khasiat eksperimental, khususnya pembuktian daya Menggunakan dasar pemikiran di atas, maka ditelusuri
antibakteri, daya antimikroba, daya menghambat pertumbuhan berbagai informasi(1,5,6,7), dari berbagai instansi, swasta ataupun
kuman atau pembuktian dengan nama lain yang menjurus kepada pemerintah yang melakukan eksperimen antibakteri. Direkam
khasiat antibakteri. Akan diusahakan untuk menemukan tulisan simplisianya, bentuk sediaan percobaannya, dan hasilnya. Di-
tentang zat yang bertanggung jawab atau yang mungkin ber- usahakan untuk merekam juga kandungan dari tanaman dan

Cermin Dunia Kedokteran No. 110, 1996 35


dipadankan dengan zat yang terbukti mempunyai daya anti buah Citrus macimus Merr.(76), Citrus sinensis Osbeck.(76), buah
bakteri. Informasi yang diperoleh mungkin sudah sampai mene- Pyrus mallus L.(184,185) terbukti berdaya antibakteri. Minyak atsiri
mukan zat yang aktif antibakteri, tetapi mungkin hanya sampai dan 24 simplisia dari Indonesia terbukti berdaya antibakteri.
suatu taraf yang hanya memberi kesan adanya daya antibakteri. Berbagai ekstrak dari beberapa simplisia bersifat antibakteri.
Dengan merekam kandungan kimia dan memadankan dengan zat Sejumlah 11 simplisia mengandung flavonoid yang tidak diba-
berkhasiat antibakteri modern diramalkan zat yang mungkin rengi dengan pembuktian daya antibakteni, demikian pula 9
bertanggung jawab atas khasiat antibakteri. simplisia yang mengandung minyak atsiri dan 16 simplisia yang
Dengan pemilahan dapat diketahui bentuk sediaan empirik mengandung tanin.
yang terbukti berdaya antibakteri, bentuk sediaan hasil penyari- Simplisia yang terbanyak diteliti adalah daun Casia alata L.
an di antaranya sampai bentuk zat yang berdaya antibakteri, zat (tercatat 13 naskah).
yang diketahui berdaya antibakteri atau bahan yang diduga ber- Ada 42 simplisia digunakan secara empirik untuk infeksi
sifat antibakteri. Informasi tambahan adalah tentang pengguna- saluran pencernaan dan 39 di antaranya terbukti bersifat anti
an empiriknya. bakteri. Di antara simplisia ini 9 simplisia terbukti bersifat
Penelusuran ini jauh dari sempurna. Namun dengan hasil antibakteni dalam bentuk empiriknya. Selain itu 2 simplisia
penelusuran ini dapat diperoleh gambaran tentang status ta- mengandung pektin, 1 (satu) mengandung flavonoid; dan 12
naman obat antibakteri (dilihat dari segi pembuktian khasiat mengandung minyak atsini yang semuanya bersifat antibakteri.
secara ilmiah), oleh karena itu angka-angka di bawah ini bukan Berbagai jenis ekstrak dari 19 jenis simplisia bersifat antibakteri.
merupakan angka mutlak tetapi dapat memberikan gambaran Sebanyak 33 simplisia tercatat digunakan secara empirik
tentang hasil-hasil penelitian. sebagai obat penyakit kulit. Duapuluh empat di antaranya ter-
bukti bersifat antibakteri. Lima simplisia bentuk preparat siap
HASIL PENELUSURAN pakainya (bukan ekstrak atau sediaan empirik) bersifat anti-
Dari penelusuran dapat dijaring 106 simplisia (Daftar 1) bakteri. Satu simplisia rnengandung pektin, satu mengandung
yang diuji daya antibakterinya; di antaranya : 42 simplisia di- suatu flavonoid, 2 mengandung minyak atsiri yang terbukti
ketahui digunakan secara empinik untuk infeksi saluran pencer- bersifat antibakteri.
naan, 33 simplisia tercatat digunakan secara empinik sebagai obat Beberapa tanaman lain tidak jelas penggunaan empiriknya
penyakit kulit, Enam simplisia digunakan secara empirik untuk tetapi bersifat antibakteri.
infeksi kandung kemih, Satu simplisia digunakan secara empirik Coleus amboinicus Lour., Hemigraphis colorata Hall., Piper
sebagai obat infeksi tenggorokan. Beberapa simplisia lain tidak cubeba L. yang digunakan sebagai obat infeksi saluran kemih
jelas penggunaan empiriknya tetapi diteliti daya antibakterinya. secara empirik, ekstraknya (berbagai jenis ekstrak) bersifat anti-
Di antaranya 9 simplisia hanya diuji bentuk empiriknya bakteri. Michelia champaca L., Ocimum gratisimum L. dan
(irifus, rebusan atau perasan), 82 simplisia diuji dalam bentuk Orthosiphon stamineus Benth., yang secara empinik digunakan
isolatnya (disari menggunakan berbagai jenis pelarut), 15 sim- sebagai obat saluran kemih belum terbukti bersifat antibakteri.
plisia diuji dalam bentuk kedua jenis sediaan ialah bentuk em- Morinda citrifolia L., dan Syzygium cumini Skeels. yang diguna-
pirik dari isolatnya. kan secara empinik sebagai obat tenggorokan, ekstraknya ber-
Jumlah sediaan yang mempunyai daya antibakteri positif(+) sifat antibakteri.
sebvanyak 85 simplisia, baik dalam bentuk empinik, isolat atau
dalam kedua bentuk, dari beberapa simplisia belum diperoleh PEMBAHASAN
informasinya; 16 simplisia belum jelas dibuktikan berdaya anti- Penelitian daya antibakteri tanaman obat merupakan jenis
bakteri menggunakan cara, dosis atau konsentrasi, dan kuman penelitian terbanyak dilakukan di Indonesia(21b). Yang terjaring
yang digunakan. Lima simplisia dengan cara yang telah diguna- seperti dilihat di atas sebanyak 106 simplisia, tetapi diyakini
kan tidak terbukti mempunyai daya antibakteri. bahwa masih banyak yang belum dijamah. OIeh karena itu
Kayu Arcangelisiaflava Merr.(40), kulit kayu Cinnamomum angka-angka jumlah simplisia bukanlah angka mutlak, tetapi
burmanii Ness.(30), daun Colleus amboinicus Lour.(35), rimpang hanya memberikan bayangan tentang kegiatan penelitian ta-
Kaempferia galanga L.(36,37), daun Lawsonia inermis L.(38), kem- naman obatkhususnya yang bersifat antibakteri. Penelitian yang
bang Michelia champaka L.(146), dan daun Plantago mayor L.(170), terjaning merupakan naskah yang dikeluarkan sekitar tahun 1977
selain dibuktikan daya antibakterinya secara kualitatif, juga sampai 1995. Melihat instansi penghasit penelitian di atas sangat
ditentukan potensinya dengan cara membandingkan dengan bervariasi, mulai dari perguruan tinggi negeri maupun swasta
potensi antibiotik, dengan cara penentuan MIC (minimal inhi- dan instansi non pendidikan seperti Puslitbang Biologi LIPI.
bition concentration), atau dengan cara menentukan koefisien Memang penghasit naskah terbanyak adalah fakultas atau ju-
feno rusan Farmasi dari berbagai perguruan tinggi.
Berberin dan kayu Arcangelisia flava Merr.(36), herba Seperti dikatakan di atas dari 42 simplisia yang diketahui
Caseinum fenestratum Colebr.(53), berasal dari bumi Indonesia digunakan sebagai obat infeksi usus 39 simplisia bersifat anti-
dibuktikan berdaya anti bakteri. Flavonoid dan daun Elephanto- bakteri dan dari 33 simplisia yang digunakan sebagai obat infeksi
pus scaber L.(105), Phaseolus radiatus L.(162), daun Ricinus kulit 24 simplisia terbukti bersifat antibakteri dalam berbagai
communis L.(187),serta pektin dari buah Carica papaya L.(52), kulit bentuk sediaan, di antaranya dalam bentuk empinik, dalam ben-

36 Cermin Dunia Kedokteran No. 110, 1996


tuk flavonoid, minyak atsiri atau dalam bentuk zat aktifnya pada mencari mddel zat yang baru yang mempunyai daya anti-
seperti berberin dan pektin. Di sini belum dibuktikan jenis bakteri. Mungkin di sini tidak difikirkan tentang kemungkinan
minyak atsiri yang bersifat antibakteri, tetapi diketahui sesqui- simplisia menjadi komoditi penghasil obat, seperti kina dahulu.
terpen, fenol, eugenol merupakan jenis minyak atsiri bersifat Karena seperti kina akhirnya pengganti kina secara sintetik
antibakteri(29). banyak ditemukan dari perkebunan kina terlantar. Hal yang sama
Ekstrak beberapa simplisia bersifat antibakteri dan masih terjadi baru-baru ini dengan Artemisia anua. Tanaman ini harus
perlu diteliti zat aktif yang bertanggung jawab atas daya ini. diteliti selama sekitar 20–30 tahun untuk menemukan zat aktif-
Sebaliknya ada simplisia yang mengandung minyak atsiri, fla- nya (bahan ini antimalaria bukan alkaloid, jadi merupakan model
vonoid, pektin atau alkaloid (contoh berberine) yang berindikasi zat yang baru). Sekitar 2 tahun setelah ditemukan zat aktifnya
adanya daya antibakteri. Sehingga bentuk ekstrak (dengan ber- bahan ini dibuat secara sintetik di Boston University dari 2 tahun
bagai pelarut seperti etanol, eter minyak tanah, kioroform) yang kemudian sudah mendapatkan izin untuk diedarkan. Dimanakah
bersifat antibakteri, masih perlu dilanjutkan penelitian. harapan orang yang ingin menjadikan Artemisia anua sebagai
Khasiat suatu simplisia tergantung kandungannya,jenis dan obat antimalaria baru?
jumlahnya. Jumlah zat aktif saja sudah memberikan kesulitan Jadi untuk segi kedua ini perlu diwaspadai. Kita tidak perlu
dalam evaluasi. Karena bila jumlahnya dalam konsentrasi ren- berbangga mempunyai sumber alam yang kaya. Tetapi mungkin
dah khasiat tidak akan terlihat, dengan demikian yang belum setelah suatu bentuk (bila perlu yang sederhanapun) dimintakan
terbukti berdaya antibakteri belum tentu tidak mempunyai daya paten hingga penghasil simplisia tidak dirugikan dan masyarakat
antibakteri. Di sinilah pentingnya bahan baku yang standar. di daerah tetap masih dapat menggunakan tanaman obat yang
Standardisasi bahan baku perlu diadakan, dan untuk ini tidak diperoleh dari alam bebas, sebagai obat.
diperlukan bahan baku dengan daya yang tinggi. Sebagai per- Dengan lain perkataan, karena sudah banyak simplisia ter-
mulaan diperlukan suatu kesepakatan terlebih dahulu. Ialah me- bukti berdaya antibakteri, segera diteliti potensinya dengan tidak
nentukan asal bahan baku, bila dipanen (tgl bulan, keadaan melupakan standardisasi, da dimasyarakatkan meskipun hasi-
cuaca), cara penanaman (mungkin sudah dibudidayakan hingga lnya masih dalam bentuk empirik (infus, rebusan atau lainnya).
diperlukan informasi pembudidayaan), cara pengolahan bahan Tidak perlu menunggu menemukan zat aktifnya lengkap dengan
setelah dipanen. informasi farmakodinamika dari farmakokinetika.
Semua bahan baku lainnya kemudian menggunakan bahan Perlu juga difikirkan batasan-batasan yang menjadi per-
baku ini sebagai pembanding (reference), sehingga mungkin saja syaratan untuk sesuatu simplisia layak diteliti lebih lanjut. Con-
bahan baku dari daerah lain atau dipanen pada waktu lain dapat toh bagi satu persyaratan adalah toksisitas. Di antaranya LD50
berpotensi lebih atau kurang. Tidak berarti penelitian daya anti- (dapat diambil kreterion yang lain). Berapa LD50 bahan diteliti
bakteri yang sudah dilakukan sampai dengan membandingkan untuk manjadi batas bagi lanjutan penelitian. Dapatkah batasan
dengan antibiotika tidak ada gunanya tetapi bagi peneliti kemu- Gleason digunakan ialah bila besar LD50 lebih dari 15.000 mg/Kg
dian perlu diperhatikan bahwa pernah dilakukan penelitian ini berat badan tikus dalam bentuk sediaan apa saja? Bila ini dapat
hingga perlu ditelusuri segala informasinya termasuk sumber diterima, maka salah satu syarat sudah dipenuhi. Perlu diperhati-
dari bahan baku. kan bahwa batasan Gleason (1969) diperuntukkan zat industri.
Dalam ulasan di sini belum diangkatjenis bakteri uji. Hal ini Bila diasumsikan bahwa hasil toksisitas merupakan hasil secara
sangat penting karena tidak semua bakteri uji sama pekanya ter- total dari bahan maka, batasan Gleason sekiranya dapat diguna-
hadap suatu zat. Jadi perlu dieval uasi jenis bahan uji di antaranya kan.
sensitivitas, Gram positif atau Gram negatif, atau dilihat dari Contoh lain adalah tentang potensi daya antibakteri bagi
jenis bakteri uji berkaitan denganjenis penyakit yang ditimbul- bahan (yang sementara ini telah ditentukan pada sejumlah sim-
kan. plisia). Berapa sebaiknya MIC-nya untuk diputuskan bahan
Demikian belum diperhatikan kaitan suku tanaman dan daya tersebut akan diteruskan penelitiannya. Untuk ini perlu diper-
antibakteri berbagai simplisia. Karena diketahui kandungan bandingkan dengan MIC dan bahan antibakteri lain yang dikenal
kimia sangat erat hubungan suku dan kandungan sehingga ter- seperti suatu antibiotika. Contoh umpamanya : dalam suatu
lahir ilmu yang dinamakan chemo-taxonomi. bentuk jumlah bahan uji sama dengan pembanding, potensinya
Masalah falsafah tujuan penelitian mungkin meminta per- minimal harus sepertiga dari potensi pembanding. Atau untuk
hatian (untuk semua penelitian obat tradisional/tanaman obat). bahan lain dapat ditentukan koefisien fenolnya. Berapakah se-
Satu segi pengembangan dapat dilakukan untuk secepat baiknya koefisien fenol bahan uji ini supaya layak diteliti lebih
mungkin dapat dimanfaatkan, artinya digunakan oleh penderita. lanjut? Dengan demikian masih beberapa masalah masih perlu
ini berarti dimanfaatkan dalam bentuk sederhana dan bila sudah dijawab sebelum penelitian lanjutan dapat dilaksanakan, meski-
dapat dimanfaatkan, dapat dimasyarakatkan umpamanya se- pun sudah banyak dilakukan.
bagai informasi di Posyandu. Langkah pengembangan kemudi-
an adalah untuk dikembangkan menjadi obat berbentuk lebih KESIMPULAN DAN SARAN
modern, tanpa mencari zat aktifnya yang perlu memenuhi semua Sudah cukup banyak simplisia yang terbukti berdaya anti-
persyaratan sebagai obat modern. bakteri dalam berbagai bentuk sediaan.
Segi lain adalah bahwa tiap penelitian dapat diarahkan ke- Beberapa bahan yang berhasil disari, beberapa zat telah di-

Cermin Dunia Kedokteran No. 110, 1996 37


isolasi dari simplisia yang diperoleh di Indonesia terbukti ber- 1996
22. Tri Murti Andayani. tiji antibakteri dan identifika.si flavonoid daun tapak
daya antibakteri. liman (Elephanropus scaber L.) Fakultas Farmasi UGM. Penelitian Pen-
Berbagai simplisia telah disari dan memperoleh bahan dan dahuluan. 1992.
tdah diisolasi beberapa zat yang baru diperkirakan berdaya 23. Amalia Nur Utami. Isolasi dan daya antibakteri flavonoid daun kacang
antibakteri, tetapi belum dibuktikan daya antibakterinya. hijau (Phaseolus radiatus L.) terhadap Staph aureus. FF, UGM 1986.
24. Erna Prawita Setyowati. Uji antibakteri dan identifikasi flavonoid dari
Penlu dikembangkan penelitian untuk dapat dimanfaatkan daun jarak kepyar (Ricinus communis L.) FF, UGM. Penelitian Pen-
hasil secepatnya meskipun penelitian dilakukan dari bentuk dahuluan. 1992.
sederhana, dan tanpa menunggu hasil penelitian zat aktif yang 25. Anita Silvia Handayani. Isolasi glikosida flavonoida dan daun dari kulit
lebih banyak meminta waktu, dana, dan usaha. kayu Anacardium occicentale L. FF, Universitas Katolik Widya Mandala
(WIDMAN). Penejitian Pendahuluan. 1986.
Dalam penelitian selanjutnya perlu dikembangkan berbagai 26. Nancy Cherley Pelealu. Pemeriksaan kandungan kimia belimbing wuluh
persyaratan yang menjadi dasar keputusan kelayakan pene1itian (Averriwa bilimbi L.) asal Ujung Pandang. JF. FMIPA UNHAS. Penelitian
selanjutnya. Pendahuluan. 1984.
Khusus bagi penelitian lanjutan simplisia perlu diperhatikan 27. Siti Aisjah, Wahjo Djatmika, IGP Santa. Penelitian golongan kandungan
kimia Hibiscus murabilis L. Risalah Seminar Lokakanya Pembudidayaan
di antaranya bahan baku, supaya bahan berkualitas ajek (konsis- Tanaman Obat dan Pameran Obat Tradisional, Universitas Jendral Soedir-
ten). man Purwokerto, 1985: 100–
28. Aisyahfatmawati S. Identifikasi komponen utama flavonoid dari Alpinia
KEPUSTAKAAN galanga L. secara kromatografi lapis tipis asal desa Paria Kab. Wajo. JF,
FM UNHAS. 1981.
1. Departemen Kesehatan RI, Badan Litbang Kes. Survey Kesehatan Rumah 29. Tyler yE, Brady LR, Robbins JE. Pharmacognosy. 8th ed. Lea & Febiger.
Tangga 1980. Philadelphia USA. 1977; hal 107.
2. Departemen Kesehatan RI. Badan Litbang Kes. Survey Kesehatan Rumah 30. Harry Ongiriwan. Penentuan koefisien fenol minyak atsiri dari klika
Tangga 1985. tanaman Cinnamomum burmani BL. terhadap bakteri Staph. aureus dan
3. Pusat Penelitian dan Pengembangan Farmasi, Badan Litbang Kes. Dep Kes Salmonella typhosa. JB, FMIPA UNAND Penelitian Pendahuluan, 1980.
RI. Penelitian Penggunaan Obat-obatan Tradisional di Kalirnantan Timur 31. Trease GE, Evans WC. Pharmacognosy. 12th ed. Bailiere Tindall, London.
dan Sulawesi Selatan, 1989. 1983. Eucalyptus oil, Eugenol, Thymol adalah anti septic. di dalamnyajuga
4. Pusat Penelitian dan Pengembangan Farmasi, Badan Litbang Kes. Dep Sesquiterpen (salah satu jenis minyak atsiri) bersifat antimikrobial, ha-
Kes. RI. Penelitian Obat-obatan tradisional pada masyarakat di Acdeh dan laman 1452.
Madura. 32. Perry LM, Metzger J. Medical Plant of Asia and South-East Asia. MIT
5. Ervizal AM. Zuhud (editor). Pelestarian dan Pemanfaatan Tumbuhan Obat University Press Massachusetts. 1987.
dari Hutan Tropis Indonesia (Prosiding) Bogor 1991. 33. Hamon NW. Garlic and the genus allium. Reveu Pharmaceutique
6. Sudarman Mardisiswojo, Harsono Rajakmangunsudarsi. Cabe Puyang Candiene Aout 1987: 493–498.
Warisan Nenek Moyang. Balai Pustaka, 1987. 34. Lucky Hayati. Pemeriksaan pendahuluan terhadap daya antibakteni bebe-
7. Sumali Wiryowidagdo dkk. Risalah Simposium Penelitian Tumbuhan Obat rapa (13) minyak atsiri. Jurusan Kimia, FMIPA UI. Penelitian Pendahulu-
VII. Ujung Pandang, 4–5 Nopember 1993. an. 1990.
8. Chairul Saleh. Inventarisasi Obat Tradisional yang digunakan di Daerah 35. Ifiwati Wibowo. Uji daya antibakteri ekstrak daun jinten terhadap dua
Kab. Tapanuli Selatan untuk pengobatan ‘mencret-mencret’ serta peme- macam kuman gram negatif hasil isolasi urine penderita infeksi saluran
riksaan mikroskopik serbuknya. Skripsi JF M1PA USU. kemih dibandingkan amoksilin tnhidrat. FF. WIDMAN. Penelitian Pen-
9. Youmans PG, Paterson PY, Smmmers HM. The Biologic and Clinical dahuluan 1992.
Basis of Infectious Diseases. 2nd ed. WB. Saunders Company, Phila- 36. Udju Sughondho es. Takaran terrendah (MIC) sebagai antibiotik dan
delphia, London, Toronto, 1980. infusa Kaemferia galanga dibandingkan dengan ampicillin. FK. UNPAD.
10. Junaidi P. Kapita Selekta Kedokteran. Edisi II, Media Aesculapis Fakultas 1990.
Kedokteran Universitas Indonesia. 1982 37. Herri S. Sastroamihardja. Minimal inhibition concentration (MIC) dan
11. Dwidjoseputro D. Dasar-Dasar Mikrobiologi, Djambatan. Jakarta. 1985. infusum Kaemferia galanga L. Bagian Farmakologi FK, UNPAD.
12. Jawetz E, Melnick JL, Adelberg EA. Mikrobiologi Untuk Profesi Kese- 38. Eti Kusraeti. Pd daya antibakteri ekstrak etanol daun paean kuku
hatan. Edisi 14. terjemahan Bonang G. UKI Atmajaya, Jakarta 1982. (Lawsonia inermis L.) kesetaraannya dengan tetrasiklin .Serta usaha meng-
13. Pelczar MJ. Dasar-dasar Mikrobiologi, tenjemahan Hadi Oetomo R.S. UI isolasi zat aktifnya. JF, FMIPA UNPAD. 1985.
Jakarta 1988. 39. Wiljanto Tjahjana. Daya antibakteri alkaloid berberin hasil isolasi dari
14. Gillies RR, Doods IC. Bacteriology Illustrated, 3rd ed. Churchil Living- tanaman Caseinum fenestratum Colebr. terhadap Staph. aureus dan E. coli.
stone, London, 1973. Fakultas Farmasi Unika Widya Mandala. Penelitian Pendahuluan. 1983.
16. Bailey W, Robert, Scott, Evelyn G. Diagnostic Microbiology, a Textbook 40. Susana Endahwati Chandra. Perbandingan daya antibakteri berberin siolat
for lsolaiion and Identification of Pathogenic Microorganism, 4th ed. The Arcangelisia flava Merr. dengan penisilina G terhadap Staph. aureus.
CV. Mosby Company. Saint Louis 1974: 400–401. Fakultas Farmasi, Unika Widya Mandala. 1986.
17. Roche Diagnostica. Urotube (Roche), F. Hoffmann - La Roche & Co. 41. Departemen Kesehatan RI. Tanaman Obat Indonesia. Direktorat Jenderal
Limited Company, Basle, Switzerland, 1984: 1–15. Pengawasan Obat dan Makanan, 1985.
18. Hadi S. Gastroenterologi, edisi V. Bandung, Penerbit Alumni 1991: 36–45. 42. Meyliana. Pengaruh pektin hasil isolasi dari kulit buah Citrus sinensis
19. Cutting C. Cuttings Handbook of Pharmacology. The activities and uses of Osbeck., varietas pacitan, Citrus maxima Merr. varietas Nambangan dan
drugs. 5th ed. Appleton-Century-CroftslNew York. 1972. Citrus maxima Merr. varietas Bali, terhadap Salmonella typhosa NCTC
20. Yadava RN. In vitro antimicrobial studies on the saponin obtained from 786. Fakultas Farmasi Universitas Surabaya. Penelitian Pendahuluan.
Caesal pininea sappan L. Asian J Org Chemistry. 1989; V.1(t). 1992.
21. Harborne JB, Mobry LT. The flavonoid, Advances in research. Chapman 43. Aris Hidayat. Isolasi dan analisis pektin dari buah Carica papaja L. mentah
& Hall. London New York. 1982; 620. serta daya antibakterinya terhadap Salmonella typhi dan E. coli. Fakultas
21a. Puslitbang Farmasi, Badan Litbang Kesehatan, Depkes RI., Hasil Peneliti- Farmasi UGM. Penelitian Pendahuluan. 1991.
an Tanaman Obat di berbagai instansi di lokasi I s/d VIII. 44. Etty Sri Rejeki W cs. Isolasi pektin dan buah Pyrus mallus L. dan pe-
21b. Dzulkarnain B, Nurendah PS. Praswanto, Lucie Widowati. Penelitian ngaruhnya sebagai antibakteri terhadap Salmonella typhi dan Salmonella
Tanaman Obat di Indonesia 1965–1995. Cermin Dunia Kedokt in press, enteritidis secara in vitro. Risalah simposium penelitian tumbuhan obat III,

38 Cermin Dunia Kedokteran No. 110, 1996


Yogyakarta 1983 79–90. – ll berisi angka no literatur camber informasi dan terdaftar pada DAFTAR
45. Dwi Kori Andayani. Pemeriksaan pengaruh pektin dari buah apel (Pyrus RUJUKAN
mallus L.) terhadap pertumbuhan bakteri penyebab diare secara in Vitro. @ Kolom 5: berisi kependekan informasi ilmiah eksperimen khasiat dari isolat,
Jurusan farmasi FMIPA USU. Penelitian Pendahuluan. 1991. - (bb/ee/hh/ll);
– bb = berisi kependekatn bagian digunakan seperti pada kolom 4 ditambah
Daftar 1. Informasi tentang daya antibakteri berbagai simplisia dengan Bi + biji, A = akar, C cabang, Km = kembang, KuA = kulit akar,
Keterangan: Ra = ranting, ? = bila tidak jelas informasinya
@ Koloni 3 : berisi informasi penggunaan secara empirik u = penyakit saluran – ee = berisi kependekan bentuk sediaan digunakan, EM = ekstrak metanol, E =
pencernaan, k = penyakit kulit ekstrak, EAI = ekstrak etanol, MA = minyak atsiri, residu = residu, Sa = sari,
@ Kolom 4: berisi informasi ilmiah eksperimen khasiat antibakteri dan sediaan berberin = berberine, EKI = ekstrak kloroform, pektin = pektin, EDM = ekstrak
bentuk empirik; – (bb/ee/hh/ll); diklorometan, sediaan = sediaan, EMT = ekstrak minyak tanah, flavonoid =
– bb berisi kependekan bagian digunakan, D = daun, Ul = umbi lapis, Ku = kulit, flavonoid, EEA = ekstrak etil aserat, suspensi serbuk = suspensi serbuk, EA =
B = batang, KuB = kulit batang, Ka = kayu, KaB = kayu batang, R = rimpang, ekstrak air, minyak picung = minyak picung, PotPemb = potensi pembanding,
H = herba, Bu -buah, KuBu = kulit buah, ? = bila tidak jelas informasinya ?= bila tidak jelas informasinya
– ee berisi kependekan bentuk sediaan digunakan, I = infus, P = perasan, ge- – hh = lihat keterangan kolom 4
tah = getah, rendaman = rendaman, De = dekok, Re = rebusan, Sa = sari, EA – ll = lihat keterangan kolom 4
= ekstrak air, ? = bila tidak jelas informasinya @ Kolom 6 : berisi informasi tentang zat kimia yang dikandung; - (bb/zz/ll);
– hh berisi kependekan hasi/percobaan, + = ada aktivitas antibakteri, 0 = tidak – bb = lihat keterangan kolom 4
ada aktivitas antibakteri, ? = bila tidak jelas informasinya – zz = zat yang dikandung sesuai yang tercantum
– ll = No rujukan yang memberikan informasi kandungan

Daftar 1. Informasi tentang daya antibakteri berbagai simplisia

Nama Latin Penggunaan Eksp. sediaan Eksp. sediaan Kandungan


No.
(nama daerah) empirik k/u empirik isolat kimia
1 2 3 4 5 6
1 Abrus precatorius L. (saga) u (1) –(D/I+/13) – (D/E/+/9, 10) –(glyzerizin/
–(D/EM/+/1l) 211)
–Bi/EM/+/11) –
–(D/E/0/12) (D/flavonoid/
–(D/EAI/+/13) 14)
2 Achrasia elliptica L. –(D/I/?/16)
3 Acorus calamus L. (dringo) u (1) –(R/MA/+/17)
4 Aglia odorata Lour. (nilam) k (18) –(D/Sa/+/18)
5 Allium cepa L. (bawang –(I/L/E/0/19)
merah)
6 Allium.flstulosum L. –(D/MA/+/20)
(bawang daun)
7 Alliumsativum L. (bawang k+u (1, 8, 28) –(I/I/?/?/21) –I/L/?/?/21) –(atsiri/211)
putih) –(I/I/P/+23) –(I/I/E/?/22) –(alicin =
–(I/I/P/+/25) –(I/I/EI+/24) baktstati k/2 10)
–(I/I/E/+/26) –I/I/MA/27)
–I/I/E/+27) –I//alisin/28)
8 Aloe vera L. (lidah buaya) u (1) –(D/residu/+/ –(aloe emodin/
29) 211)
9 Alyzia stellata R.Br u (1, 30) –(KuB/1/0/30) –(KuB/E/0/30) –(tanin/211 )
(pulosari)
10 Anacardiam occidentale L. k (1) –(D/E/?/31) –(tanin/211 )
(jambu mete) –(D/flavonoid/
32)
–(KuB/
flavonoid/32)
11 Andrographis paniculata u & k (1) –(D/Sa/+/18)
Nees. (sambiloto) –(D/E/+/33)
12 Andropogon muricata Rtz. –(A/MA/+/35)
(akar wangi)
13 A rcangelisia flava Merr. –(KaB/berberin –(KaB/
(kayu kuning) +/36) PotPemb alkaloid/37)
14 ArdisiafnnsteniScheffer. –(C/EM/+/38)
(lingapus)
15 Areca catechu L. (pinang) k+u (1, 2, 8) –(Bi/El0/19) –(alkaloid/21 I)
–(alkaloid/210)
–(tanin
antibakt/212)
16 Averrhoa bilimbi L. u(39) –(D/E/+/39) –(Bu/flavonoid/
(belimbing wuluh) –(D/E/+/19) 40)
17 Averrhoa carambola L. –(D/E/?/4I )
(belimbing manis)

Cermin Dunia Kedokteran No. 110, 1996 39


18 Boesenbergia panduratu u (42) –(R/EK1 /+/42)
(kunci) –(R/EJ+/19)
19 Cuesalpinia sappan L. u (1, 44, 46) –(KaB/I/?/34) –(KaB/?/?/42) –(galat, asam
(kayu secang) –(KaB/I/?/36) –(KaB/FJ?/46) tanat, atsiri/21 1)
–(KaB/I/0/45) –(KaB/E/+/47) –(KaB/tanin/48)
–(KaB/Sa/+/48) –(KaB/tanin/49)
–(?/saponinl+l
45a)
20 Cananglum odorata Hook. k (1) –(Km/MA/+/35)
(kenanga) –(Km/MA/+/17)
21 Capsicum.jrutescens L. k (1, 50) –(Bu/E/?/50) –(atsiri/21 1)
(cabe rawit)
22 Carica papaya L. (papaya) u (1, 51) –(Bi/EA1/+/51) –(alkaloid/211)
–(carpain =
amebicide/210)
22 Carica papaya L. (papaya) u(52) –(Bu/pektin/+/
52)
23 Caseinum fenestratum –(H/berberin/+/
Colebr. (herba) 53)
24 Cassia alata L. k (54, 55) (D/I/?/54) –(D/EA1/+/55) –(aloe emodin/
(ketepeng kebo) 211)
–(D/Sa/?/56)
–(D/Sa/+157)
–(D/EDM/+159)
–(D/EDM/+/60)
–(D/EDM/+/61)
–(D/EA 1/+/62)
–(D/EA II+/63)

–(D/EAI/+/64)
–(D/EAI/+/65)
25 Cassia fistula (trengguli) –(D/I/?67) –(D/EAI/+/66
26 Cassia siamea Lamk. k(69) –(D/I/+/68)
(johar)
27 Centella asiatica I/rban. k+u (1, 69, –(D/P/+/71) –(H/triterpen/
(daun kaki kuda) 70,71) –(D/E/+/69) 72)
–(D/sediaan/+/ –(atsiri/211)
70) –(art tileprosyl
211)
28 Cinnamomum burmanii u (6, 73) –(KuB/minyak
Nees. (kayu manis) –(KuB/MA/+/ –(atsiri/73)
35) –(tanin/21 1)
–(KuB/MA/+/ –(tanin/210)
73) Koeffen
29 Citrus aurantifolia u (1, 6) –(KuB/Sa/+/74) – (atsiri/21 1)
Swingle. (jeruk tipis) – (DIMAI+/75) –(atsiri dan
flavonoid/212)
30 Citrus maxima Merr. k (1) –(KuBu/pektin/
(jeruk bali) –(KuBu/pektin/ 77)
31 Citrus sinensis Osbect. 76) –(KuBu/pektin/
–(KuBu/pektin/ 77)
32 Clausena harmandiana 76)
Pierre. –(D/EA 1/+/78)
33 Clerodendron siphoxanthes –(DIEA 1/+/79)
R.Br. (pituju)
34 Clidemia hirta –(I/L/E(0/19) –(tanin/21 1)
35 Coffea robusta Lind. –(Bu/EM/+/80)
(kopi) saluran –(Bu/EEA/+81) –(atsiri/211)
36 Colleus amboinicus Lour. kemih (82) –(D/E/+/82)
(daun jinten PotPemb
k (1) –(D/I/?/83) –(D/EJ+/19) –(D–flavonoid/
37 Coleus scutellarioides 84)
Benth.
38 Cosmos caudatus –(D/MA/+/85)
HBK. (kenikir)
39 Curcuma aeruginosa Roxb. k (86) –(R/E/+/86)
(temu hitam) –(R/I/?/87) –(atsiri, ses–
40 Curcuma domestica Val. u(1,6);k(1) –(R/I/?/90) –(R/MA/?/88) quiterp/211)
(kunyit) –(R/E/+/98)

40 Cermin Dunia Kedokteran No. 110, 1996


–(R/EMT/?/91) – (atsiri
–(R/EK1/?/9 1 ) di antaranya
–(R/EM/?/91) sequiterpen
dan curcumin
–(Antibakt
212)
–(R/MA/92)
–(R/curcumin/
93)
41 Curcuma heyneana Val. ° (R/MA/+/94) –(R/curcumin/
V. Zijp (temu giring) 95)
42 Curcuma mangga Val. ? –(R/MA/+/96) –(R/curcumin/
–(R/EMT/+/96) 95)
43 Curcumaxanthorrhiza k (1) –(R/E/+/89) –(R/MA/99)
Roxb. (temulawak) –(R/E/+/97) –(R/curcumin
(R/Sa/+/18) 95)
–(R/MA/?/98) – (R/sesquiter–
pen/100)
44 Cymbopogon nardus L. –(D/MA/+/35) –(D/MA/101)
(serai wangi) –D/MA/102)
45 Drymoglossum hetero– k (1) –(D/E/?/103)
phyllum C.Chr. (sisik naga)
46 Dysoxylum anwrroides –(D/E/?/104)
Miq. (kedoya)
47 Elephantopus scaber L. u(1) –(D/flavonoid/ – (flavonoid/2 1 1)
(daun urat) +/105)
48 Eleusine indica Hearth. –(A/EAI/+/106)
(rumput belulang)
49 Erythrina orientalis L. u (107) –(D/E/?/107)
(dadap ayam)
50 Eugenia caryophylata –(Km/MA/+/35) –(Km/MA/108)
Sprengel. (cengkeh) –(Km+D/
eugenol/109)
51 Eugenia polyantha Wight. u (1) –(D/E/?/110)
(daun salam) –(D/MA/+/111)
52 Euphorbia antiquorum L. k (112) –(D/getah/?/
(getah) 112)
53 Euphorbia hirta (patikan u (113) –(H/l/+/113) –(H/flavonoid/
kebo) 114)
54 Garcinia mangostana L. u (1, 115) –(KuBu/I/?/ –(KuBu/E/?/ –(tanin/2l 1)
manggis 115) 115)
–(KuBu/E/0/19)
55 Gardenia augusta Merr. –(D/EEA/+/1 17 –(atsiri/211)
(kacapiring)
56 Hemigraphis colorata Hall. saluran kemih –(D/EEA/+/118) –(D/flavonoid/
(kecibeling) (1) 119)
–(D/flavonoid/
120
57 Hibiscus mutabilis L. u (121) –(D/E/+/I21) –(D/flavonoid,
(daun) ? tanin,
polifenol/122)
58 Hibiscus similis (waru) ? TBC (123) –(D/rendaman/
+/123)
59 Ipomoea batata Poir. k (1, 2, 124) –(D/E/+/124) –(pektin/211)
(ubijalar)
60 Kaempferia galanga L. u (6) –(R/I/?/126) –(R/MA/+/125) –(atsiri/211)
(kencur) PotPemb PotPemb –R/etil
–(R/I/?/127) –R/E/+/128) p–metoksi
MIC sinamat/130)
– (R/?/?/ 129)
61 Lagestromia regina Roxb. k (1) u (132) –(KuB/E/_+/132
(bungur)
62 Languas galanga Stunz. I/ (134, 136) –(R/?/?/133) –(R/E/+/135) –(R/flavonoid/
laos) k (134) –(R/?/?/I34) –(R/MA/?/138) 137)
–(R/perasan/+/
136)
63 Lantana camara L. k (3, 139) –(A/EAI/+/139) –(D/triterpen/
(temblekan) 140)
64 Lawsonia inermis L. k (142) –(D/E/?/l41)
(pacar kuku) PotPemb

Cermin Dunia Kedokteran No. 110, 1996 41


–(D/EM/+1142)
65 Leucas lavandulifolia –(D/E/+/143)
J. Smith. (lenglengan)
66 Litsia cubeba L. –(Bu/MA/+/35) –(B/sesquiter–
(krangean) pen/144)
67 Melaleuca leucadendra L. –(Bu/MA/+/35) –(atsiri/21 I)
(merica bolong) –(Bu/MA/+/
145)
68 Melia azadarach L. k (212) erysi– –(D/I/?/16) –(tanin/212
(mindi) pelas, k (t) antibakteri)
69 Melia azadirachta L. k (1) –(D/I/?/16)
(mimba)
70 Michelia champaca L. saluran kemih –(?/E/?/146) Pot
(cempaka) (1) –(?/EK 1?/147)
71 Morinda citrifolia L. u (l) – (By/EEA/+/ –antrakinon/2I1
(mengkudu) tenggorokan 148) –(Bu/fenolik/
(149) –(Bu/EA/+/148) 151)
–(Bii/EA I/+/ –(A/fenolik/
149) 151)
–(Bu/EEA/+/
150)
72 Moringa oleifera Lamk. saluran kemih –(KuA/EMT/+/
(kelor) (1) 152)
(Bi/suspensi
serbuk/+/153)
–(Bu/E/+/19)
73 Musa brachicarpa ? –(Bu/E/+/19)
74 Myristicafragrans Hout. u (6) –(Bi/MA/+/35) –(fuli/MA/154)
(pala, biji, fuli)
75 Ocimum gratisimum L. saluran kemih –(D/MA/?/155)
(selasih) (1)
76 Orthosiphon stamineus urin (156) –(D/I/?/156)
Berith. (kumis kucing)
77 Paederia foetida L. (daun u (1) –(D/EEA/+/157) –(D/flavonoid
sembukan) –(D/EA/+/157) 0/157)

78 Pangium edule Reinw. –(Bi/minyak


(klewek) picung/+/158)
(Bi/minyak
picung/+/159)
79 Parkia biglobosa Benth. u (160) –(Bi/EAI/+/ –(tanin/211)
(kedawung) 160) –(Bi/tanin/ 161)
80 Phaseolus radiatus L. –(D/flavonoid/
(kacang hijau) +/162)
81 Phyllanthus niruri L. u (6, 164) –(H/I/+/164)
(meniran) –(H/De/+/163)
82 Piper betle L. (sirih) u (6) –(D/I/+/168) –(D/MA/+/166) –(atsiri, tanin/
kumur(168) –(D/minyak/?/ 211)
167)
–(D/Sa/+/168)
83 Piper cubeba L. (kemukus) saluran kemih –(Bu/I/+/169) –(Bu/MA/+/35) –(atsiri/211)
(6) –(Bu/MA/+/17)
84 Piper nigrum L. (lada) u (6) –(Bu/MA/+/35) – (atsiri/21 1)
85 Plantago mayor L. (daun k (1) –(D/EA1/+/170)
sendok) Pot Pemb.
86 Pleomaleangustifolia kumur (171) –(D/Sa/?/171)
M.E.Broun. (daun suji)
87 Pluchea indica Less. u (1) –(D/Sa/+_/18) –(D/MA/173)
(beluntas) –(D/MA/+/173) –(D/kamfer,
pinene/172)
88 Pogostemcm cablin Benth. –(D/MA/+/35)
(nilam)
89 Psidium guajava L. u (1, 2, 3, 5, –(D/I/?/44) –(D/E/?/176) –(D/flavonoid +
(jambu biji) 6, 36, 167) –(D/I/+/174) –(D/E/?/175) + tan in + saponi
–(D/I/+/45) –(D/Sa/+/18) n/179)
– (D/De/+/177) –(D/El?/19) –(D/tanin/I80)
–(D/I/+/170)
90 Punica granatum L. u (6, 44, 45, –(Bu/1/?/44) –(KuBu/E/?/ –(tanin/211)
(delima) 30) –(KuBu/I/?/44) 181)
k (183) –(Bu/I/0/45) –(KuBu/EM/+/

42 Cermin Dunia Kedokteran No. 110, 1996


–(KuBu/I/0/45 183)
–(KuBu/R/?/ –(KuBu/E/+/19)
182) –(KuBu/E/+/30)
91 Pyrus mallus L. (apel) u (35, 32, 184, –(Bu/pektin/+/ –(Bu/pektin/
185) 184) (184)
–(Bu/pektin/+/
185)
92 Rhinicantrhus nosutus k (186) –(D/E/+/186)
Kurz. (tereba
93 Ricinus communis L. k (1) –(D/flavonoid/ –(D/flavonoid/
(jarak kepyar) +/187) 187)
94 Santalum album L. k (1) –(KaB/MA/+/ –(KaB/MA/188)
(cendana) 35) – (atsiri, tanin/
211)
95 Sesbania grandiflora Pers. u (1, 190) –(KuB/E/+/190)
(turi)
96 Sida rhombifolia L. k (1, 191) –(D/EAI/+/191)
(sida guri)
97 Spilanthes acmella L. ? u(192) –(Km/MA/+/
192)
98 Symphytum gfficinale L. –(D/E/+/193)
(komfrei)
99 Syzygium cumini Skeels. amandel (1) –(D/E/+/194) –(atsiri, tanin/
(jamblang) 211)
100 Terminalia bellerina Roxb. –(KuBu/FJ+/
(jalawe) 195)
101 Tinospora crispa Miers. k+u (1, 196, –(B/I/+/199) –(B/E/?/196) –(berberin/211)
(brotowali) 197, 198) –(B/E/+/197)
–(B/E/+/198)
102 Tithonia diversifolium k (200, 201) –(B/E/?/200)
A. Gray. ? –(D/E/+/201)
103 Unicaria gambir Roxb. u (6, 202, 203) –(D/E/+/202)
(gambir) –Ra/E/+/202) – (tanin/21 1)
– (D/E/+/203) –(D/tanin/204)
–(Ra/E/+/203)
104 Usnea Sp.(kayu angin) u (1) –(H/E
cream/+/205)
–(D/E/+/10)
105 Woodfordia,floribunda k (1) –(Km/E/?/206) –(tanin/211)
Lamk.(sidawajah)
106 ZingibergfficinaleRoxbr u (1) kolera –(R/MA/+/35) – (atsiri/21 1)
(jahe) –(R/MA/+/207) –(R/MA/208)

RUJUKAN UNTUK DAFTAR 1 Seminar POKJANAS TOI IV Bogor, 13–14 Januari 1993.
10. Masniani Poelungan, Rita Dewi Rahayu, Windarti Haryono, Chaerul. Lebar
1. Sudarman Mardisiswojo, Harsono Rajakmangunsudarso. Cabe Puyang daerah hambatan yang dibentuk ekstrak daun saga (Abrus precatorius L.)
Warisan Nenek Moyang. Balai Pustaka. 1987. Kayu angin (Usnea Spp) pada bakteri E. coli dan Maraxella Sp. Puslitbang
2. Ervizal AM. Zuhud (ed). Pelestarian dan Pemanfaatan Tumbuhan Obat Biologi, LIPI. Seminar POKJANAS TOI IV Bogor 13–14 Januari 1993.
dari Hutan Tropis Indonesia (Prosiding) Bogor 1991. 11. Rita Dwi Rahayu, Mindiarti Harapini, Chaerul, Masniani Poelungan. Pe
3. Sumali Wiryowidagdo cs. Risalah Simposium Penelitian Tumbuhan Obat ngaruh penambahan ekstrak metanol daun dan biji saga manis terhadap
VII. Ujung Pandang, 4–5 Nopember 1993. beberapa jenis bakteri. Puslitbang Biologi LIPI. POKJANAS IV Bogor
4. Pusat Penelitian dan Pengembangan Farmasi. Badan Litbang Kes. Dep 13–l4Januari 1993.
Kes. RI. Penelitian penggunaan Obat-obatan Tradisional di Kalimantan 12. Bambang Prayogo, Wahjo Djatmika. IGP Santa, Sutarjadi. Aktivitas anti-
Timur dan Sulawesi Selatan. 1989. mikrobadaun Abrus precatorius. Puslitbang 01. Universitas Airlangga
5. Pusat Penelitian dan Pengembangan Farmasi, Badan Litbang Kes. Dep (UNAIR). 1993.
Kes. RI. Penelitian Obat-obatan tradisional pada masyarakat di Aceh dan 13. Riana Savitri. Uji daya antibakteri ekstrak etanol dan infus daun saga
Madura. Abrus precatorius L.) terhadap kuman Staph. aureus ATCC25933, Strep.
6. Departemen Kesehatan RI. Badan Litbang Kes. Survey Kesehatan Rumah beta hemolisycus standard strain WHO dan Strept. pneumonia standard.
Tangga 1980. JF., FMIPA Universitas Indonesia (UI). Penelitian pendahuluan. 1994.
7. Departemen Kesehatan RI, Badan Litbang Kes. Survey Kesehatan Rumah 14. Tri Windono. Identifikasi senyawa flavonoid daun saga (Abrus precatorius
Tangga 1985. L.) Lab. Fitokimia Fakultas Farmasi (FF), FMIPA Universita.s Surabaya
8. Chairul Saleh. Inventanisasi Obat Tradisional yang digunakan di Daerah (UBAYA). Seminar POKJANAS TOI IV Bogor, 13–I4ianuari 1993.
Kab. Tapanuli Selatan untuk pengobatan ‘mencret-mencret’ serta pe 15. Chaerul, Mindarti Harapini. Kandungan komponen kimia pada Saga (Abrus
meriksaan Mikroskopik serbuknya. Skripsi JF MIPA USU. Penelitian precatorius L.) Lab. Treub. LIPI Bogor. Seminar POKJANAS TOI IV
Pendahuluan. 1982. Bogor, 13–14ianuari 1993.
9. Muchsin Danise, M. Matsudjide, Suleman. Ekstraksi daun saga (Abri 16. Agus Djamludin A. Percobaan daya antibakteri dari infus daun Melia
folium) dengan beberapa metoda serta uji daya hainbat bakteri uji. Jurusan azadarachta L., Melia azadarach L.. Achrasia ellipticaL.. terhadap kuman
Farmasi (JF), FMIPA Universitas Hasanudin (UNHAS). Ujung Pandang. Staph. aureus ATCC25933 dan E. coli 25922. JF. FMIPA UI. Penelitian

Cermin Dunia Kedokteran No. 110, 1996 43


Pendahuluan. 1986. HAS. Pene1itit Pendahuluan. 1991.
17. M. Noerdin Arzani. Aktivitas antimikroba minyak atsiri dan rimpang 39. Linda. Uji efek antimiknoba ekstrak daun belimbing (Averrhoa bilimbi L.)
dringo (Acorus calamus L.). kembang kenanga (Canangium odarayta L.), terhadap beberapa bakteri penyebab tukak secara invitro. JF, FMIPA
dan buah kemukus (Piper cubeba L.) secara in vitro. Jurusan Kimia Universitas Andalas (UNAND). Penelitian Pendahuluan. 1993.
Farmasi, FF UGM, Yogyakarta. Abstrak Penelitian/Publikasi llmiah, 40. Nancy Cherley Pelealu. Pemeriksaan kandungan kimia belimbing wuluh
Fakultas Farmasi Universitas Gajah Mada, 1986–1990. (Averrhoa bilimbi L.) asal Ujung Pandang. JF, FMIPA UNHAS. Penelitian
18. Aneng Widjastuti. Penelitian mikrobiologi terhadap kandungan anti Pendahuluan. 1984.
mikroba dan limajenis tumbuhan. FF, Universitas Pancasila (UPANCA). 41. Suwarti Sjamsuddin. Uji antimikroba dari ekstrak daun segar Averrhoa
Penelitian Pendahuluan. 1990. carambola L. JF, FMIPA UI. Penelitian Pendahuluan. 1982.
19. Atiek Soemiati. Pemeriksaan pendahuluan daya antibakteri ekstrak be- 42. Yulvia. Uji efek antimiknoba ekstrak rimpang temu kunci (Boesenbergia
berapa tanaman. SPTO VII, Ujung Pandang 1993 : 99–103. pandurataRoxb.) terhadap beberapa bakteri penyebab tukak secara in vitro.
20. lndah Setyaningsih. Efek minyak atsiri bawang daun (Allium fistulosum L.) JF, FMIPA UNAND. Penelitian Fendahuluan. 1990.
terhadap bakteri Staph. aureus dan E. coli serta profit kromatografinya. FF. 43. Elm Yulina S. et aS. Isolasi komponen aktif dari Caesalpinia sappan L.
UGM. Penelitian Pendahuluan. 1992. (kayo secang) dari pengujian efek antibakteri serta uji toksisitasnya pada
21. Adiana Ayudi. Penelitian pendahuluan daya antibakteri Allium sativum L. hewan percobaan. JF, FMIPA Institut Teknologi Bandung 1982.
terhadap kuman Staph. aureus strain Oxford. JF FM1PA UI. Penelitian 44. Benny Hartanto. Uji efek Infus daun Psidium guajava K. (Myrtaceae), kayu
Pendahuluan. 1985. Caesalpinia sappan L. (Caesalpiniaceae), buah dan kulit buah Punica
22. Eka Irindadevi. Aktivitas antibakteri secara invitro ekstrak bawang putih. granatum L (Punicaceae) sebagai antidiare pada mencit putih Swiss Web.
Jurusan Farmasi, FMIPA Universitas Indonesia. Penelitian Pendahuluan. dan sebagai antibakteri. JF, FM1PA ITB. 1983.
1986. 45. Wattimena JR, Elm Yulinah, Benny Hartanto. Uji infus daun Psidium
23. Nelly D. Leswara, Atiek Sumiati, Sardjito, Rahim. Pemeriksaan daya anti guajava (Myrtaceae), kayu Caesalpinia sappan (Caesaipiniaceae), buah
bakteri perasan bawang putih terhadap Staph. aureus. Simposium Peneli- dari kulit buah Punica granatum sebagai antidiare pada mencit putih Swiss
tian Tumbuhan Obat VI, Mnktamar IV PERHIPBA, Expo 111 Obat Tra- Webster dan sebagai antibakteri. JF. FMIPA ITB. Maj. Farmakol. Terapi
disional, Lokakarya dan Penyuluhan Bahan Obat Alam. Depok 15–19 Indon. 1985; 11(4): 29–31.
Nopember 1988. hal 214. 45a. Yavada RN. In vitro antimicrobial studies on the saponin obtained from
24. Safriansyah. Analisis bioautografi langsung pada lempeng KLT senyawa Caesalpiniea sappan L. Asian J Org Chemistry 1989; V.1(1).
antibakteri dari Allium sativum L. FFUGM . Penelitian Pendahu1uan 46. Moh. Anis. Uji rnikrobiologi ekstrak kayu secang (sappan L.) terhadap
1988. beberapa bakteri penyebab tukak secara invitro. JF. FMIPA UNAND.
25. Anastasia Adriani. Daya antibakteri Allium sativum L. dari pasar Bering- Penelitian Pendahuluan. 1990.
harjo Yogyakarta terhadap Staph. aureus dan E. coli koleksi laboratorium 47. Nurhayati, Imam Hidayatullah, Siti Nurjanah, Radiah Wahyuningsih. Efek
mikrobiologi Fakultas Kedokteran. Fakultas Kedokteran (FK), UGM. anti mikroba ekstrak kayu secang (Caesalpinia sappan L.) terhadap bebe-
1992. rapa macam mikroba. Divisi Ristek, PT (Pesero) Kimia Fanma. Seminar
26. Slamet P, Slamet Santoso, Yusron Suwarso. Penggunaan ekstrak bawang Nasional Ke-IX POKJANAS TOI Yogyakarta 21–22 September 1995.
putih (Allium sativum L.) sebagai bahan antibakteni. Fakultas Biologi (FB), 48. Liliek S. Hermanu. Penentuan kadartanin dalam serbuk kayu secang. Puslit
Universitas Jendral Soedirman (UNSOED). 1992. OT WIDMAN. Surabaya. Seminar Nasional Ke-IX POKJANAS TOI
27. Christiana Lethe. Isolasi dan identifikasi minyak atsiri dari umbi tapis Yogyakarta 2 1–22 September 1995.
bawang putih (Allium sativum L.) JF. FMIPA UNHAS. Penelitian Pen- 49. Risfaheni, Sri Yuliani, Tjitjah Fatimah. Isolasi tanin dan kayo secang.
dahuluan. 1980. Balni Penelitian Tanaman Rempah dan Obat. Seminar Nasional Ke-IX
28. lta Ruchaniyati. Analisis kandungan kimiautamaberbagai sediaan bawang POKJANAS TOI Yogyakarta 21–22 September 1995.
putih di pasaran. FF. UGM. 1989. 50. Tyas Ekowati Prasetyoningsih. Daya hambat ekstrak buah Capsicum
29. Yoe Hok. Pengaruh residu daun lidah buaya (Aloe Vera L.) terhadap frutescens L. terhadap pertumbuhan Candida albicans. FF. UNAIR. Pene-
biakan bakteri Staph. aureus secatra invitro. JB, FMIPA, UNAIR. litian Pendahuluan. 1987.
Penelitian Pendahuluan. 1988. 51. Nuraini Gani. Daya antiseptik biji pepaya (Carica papaya L.) terhadap
30. Dian Sundani. Pengaruh infusdan ekstnakpulosani (AlyxiastehlataR.B.) dan bakteri penyebab diare invitro. JF, FMIPA UNHAS. Penelitian Penda-
delima (Punica grariatum L.) terhadap bakteri penyebab diare. Laporan. huluan. 1988.
Pusat Penelitian dan Pengembangan Farmasi. Badan Litbang Kes. 1995. 52. Anis Hidayat. Isolasi dan analisis pektin dari buah Caricu papaya L.
31. Wayan Supradiyani. Daya antibakteri daun dari ekstrak kulit buah mentab serta daya antibakteninya terhadap Salmonella typhi dan E. coli.
Anacardium occidentale L. JF, FMIPA UI. Penelitian Pendahuluan, 1986. FF, VGM. Penelitian Pendahuluan. 1991.
32. Anita Silvia Handayani. Isolasi glikosida flavonoida dan daun dari kulit 53. Wiljanto Tjahjana. Daya antibakteri alkaloida berberin hasil isolasi dari
kayu Anacardium occicentale L. FF, Universitas Katolik Widya Mandala tanaman Caseinumfenestratum Cobebr. terhadap Staph. aureus dan E. coli.
(WIDMAN). Penelitian Pendahuluan. 1986. FF, WIDMAN. Penelitian Pendahuluan. 1983.
33. Chairul, Masniari Poelungan, Wika Rachmawati. Uji efek antibakteri 54. Yayat Heryati. Penelitian laboratorium mengenai efek antibakteri dan
ekstrak sambiloto (Andrographis paniculata Nees.) terhadap beberapa antijamur dari daun Cassia alata L. (ketepeng) dalam bentuk infusa ter-
jenis bakteri. Seminar Nasional POKJANAS TOL VI Bandung 2–3 Fe- hadap beberapa jasad nenik patogen. JF. FMIPA UI. 1980.
bruari 1994. 55. Tahir Ahmad. Pengaruh ekstrak daun ketepeng (Cassia alata L.) terhadap
34. Rita Dwi Rahayu, Mindarti Harapini, Chairul. Pengaruh penambahan bakteri penyebab penyakit kutit. JF, FMIPA UNHAS. Penelitian Pen-
ekstrak sambiloto (Andrographispaniculata Nees.) dengan beberapa dahuluan. 1985.
pelarut dan dosis terhadap beberapa bakteri. Puslitbang Biologi. Seminar 56. Mindarwati. Uji daya antimikroba sediaan kriin mengandung sari daun
Nasional POKJANAS TOI VI, Bandung 2–3 Februan 1994. ketepang (Cassia alata L.) JF, FMIPA UNPAD. Penelitian Pendahuluan.
35. Lucky Hayati. Pemeriksaan pendahuluan terhadap daya antibakteri bebe- 1986.
rapa (tiga belas) minyak atsini. Jurusan Kimia (JK), FMIPA UI. Penelitian 57. Sri Harjati Setiodihardjo. Uji daya antimikroba sediaan salep yang me
Pendahuluan. 1990. ngandung sari daun ketepeng (Cassia alata L.). JF, FMIPA UNPAD. Pe-
36. Suasana Endahwati Chandra. Perbandingan daya antibakteri berberin isolat nelitian Pendahuluan. 1986.
Arcangelisiaflava Merr. dengan penisilina G terhadap Staph. aureus. FF, 58. Titik Wirahardja, Sri Soeryati HI, R. Usman. Uji daya antimikroba sediaan
WIDMAN. Penelitian Pendahutuan. 1986. salep yang mengandung sari daun ketepeng (Cassia alata L.). Simposium
37. Fatmawati AM. Isolasi dan identifikasi kandungan alkaloid kayu kuning Penelitian Tumbuhan Obat VI, Muktamar IV PERHIPBA, Expo III Obat
(Arcangehisiaflava Merr.) asal kabupaten Sorong Propinsi Irian Jaya. JF, Tradisional, Lokakarya dan Penyuluhan Bahan Obat Alam. Depok 15–19
FMIPA UNHAS. Penelitian Pendahuluan. 1989. Nopember 1988. hal 214.
38. Mob. Au Yusran, Uji daya hambat ekstrak cabang lingapus (Ardisia 59. Sri Mulyani. Daya antimikroba sari dikiormetana hasil sokhletasi daun
forstenii Sceffer.) terhadap bakteri uji yang digunakan. JF, FMIPA UN- Cassia alata L. yang dikeringkan. jurusan Biologi Farma.si, FF UGM

44 Cermin Dunia Kedokteran No. 110, 1996


Yogyakarta. Abstrak Penelitian/Publikasi Ilmiah Fakultas Farmasi, Uni- macam kuman gram negatif hasil isolasi urine penderita infeksi saluran
versitas Gajah Mada, 1986–1990. hal 166. kemih dibandingkan amoksilin trihidrat. FF, WIDMAN. Penelitian Pen-
60. Taroeno. Daya antimikroba sari diklorometana hasil penyarian cair-air dahuluan. 1992.
ekstrak daun Cassia alata L. yang dikeringkan dengan oven. Jurusan 83.. Liem So Tjien. Pemeriksaan beberapa isi kandungan daun Coleus
Biologi Farmasi (JBF). FF UGM Yogyakarta. Abstrak Penelitian/Publikasi scutellariodes dan daya antibakteri infusnya terhadap Pseudomonas
llmiah Fakultas Farmasi, Universitas Gajah Mada, 1986–1990. hal 166. aeruginosa. FF, WIDMAN. Penelitian Pendahuluan. 1981.
61. Soedarsono. Daya antimikroba sari diklormetana hasil penyarian cair-air 84. Tjendawati. Isolasi glikosida flavonoid dari daun Coleus scullarioides
ekstrak daun Cassia alata L. yang dikeringkan dengan matahari. JBF, FF BTH. FF, WIDMAN. Penelitian Pendahuluan. 1990.
UGM Yogyakarta. Abstrak Penelitian/Publikasi llmiah Fakultas Farmasi 85.. Fed Sovia Ersani. Isolasi dan uji daya antibakteri minyak atsiri daun
Universitas Gajah Mada, 1986–1990. hal 167. Cosmos caudatus H.B.K. (kenikir). FF, UGM. Penelitian Pendahuluan.
62. B. Sudarto. Daya antimikroba sari etanol hasil sokhletasi daun Cassia alata 1992.
L. yang dikeringkan dengan oven. JBF, FF UGM Yogyakarta. Abstrak 86.. Conny Pattipelohy. Pengaruh ekstrak temu hitam (Curcuma aeruginosa
Penelitian/Publikasi llmiah Fakultas Farmasi, Universitas Gajah Mada, Roxb.) terhadap jamur Epidermophyton floccosum penyebab penyakit
1986–1990. hal 168. kurap. JF, FMIPA UNHAS. Penelitian Pendahuluan. 1986.
63. Wahyono. Daya antimikroba sari hasil sokhletasi daun Cassia alata L. 87. Nana Suriana. Pemeriksaan beberapa sat kandungan serta daya antibakteri
yang dikeringkan dengan matahari. .IBF, FF UGM Yogyakarta. Abstrak terhadap Pseudomonas aeruginosa dan infus rimpang Curcuma domestica
Penelitian/Publikasi Ilmiah Fakultas Farmasi Universitas Gajah Mada, Val. FF, WIDMAN. 1981.
1986–1990. hal 168. 88. Muriyah. Hubungan antana kadar minytak atsiri rimpang kunyit dan efek
64. Koensoemardiyah. Daya antimikroba sari etanol hasil penyarian Cair-Cair antibakterinya terhadap Staph. aureus in vitro. FF, UGM. Penelitian Pen-
daun Cassia alata L. yang dikeringkan dengan oven. JBF, FF UGM dahuluan. 1985.
Yogyakarta. Abstrak Penelitian/Publikasi llmiah Fakultas Farmasi Uni- 89. E. Ratnasani, MS. Hastuti, Rozali Usman, Sidik. Daya antibakteri temu
versitas Gajah Mada, 1986–1990, hal 169. lawak (Curcuma xanthorrhiza Roxb. dan kunyit (Curcuma domestica Val.)
65. Suwijo Pramono. Daya antimikroha sari etanol hasil penyarian Cair-Cair dalam ekstrak hasil fraksinasi dengan pelarut berpolaritas meningkat.
daun Cassia alata L. yang dikeringkan dengan matahari. JBF, FF UGM Seminar, Lokakarya pembudidayaan tanaman obat dan Pameran Obat
Yogyakarta. Abstrak Penelitian/Publikasi llmiah Fakultas Farmasi Univer- Tradisional. Universitas Jendral Soedirman Purwokerto. 1985 210-
sitas Gajah Mada, 1986–1990. hal 169. 90. Susilowati. Penganuh daya antimiknoba dari rhizom Curcuma domestica
66. Kinteki Rarastri. Daya antibakteri sari diklormetana bebas klorofil daun Val. terhadap bakteri E. coli. FF, UNAIR. Penelitian Pendahuluan. 1985.
Cassia alata L. (ketepeng kebo) terhadap Staph. aureus. FF, UGM. Pene- 91. Lois Ratnasani. Uji daya antibakteri ekstnak kunyit hasil ekstraksi dengan
litian Pendahuluan. 1992. pelarut eter minyak tanah, khloroform dan metanol, terhadap beberapa
67. Yardo Hartanto. Pereobaaa pendahuluan efek antibakteri infus Cassia jenis bakteri gram + dan bakteri gram–. JF, FMIPA UNPAD. Penelitian
fistula L. terhadap Staph. aureus strain Oxford. JF, FMIPA UI. Penelitian Pendahuluan. 1986.
Pendahuluan. 1985. 92. Fitri Yunita. Penentuan komponen utama minyak atsiri kunyit (Curcuma
68. Aan Risna Uli. Uji pendahuluan efek antimikroba dari infus daun johar domestica Val.) dengan GS-MS. 1K, FMIPA ITB. Penelitian Pendahuluan.
terhadap beberapa bakteri dan jamur penyebab penyakit kulit. JF, FMIPA 1986.
UI. Penelitian Pendahuluan. 1994. 93. Eddy Yusuf. Penentuan kadan curcumin pada kunyit (Curcuma domestica
69. Endang Adriyani. Uji khasiat daun pegagan (Centella asiatica Urban.) Val.) secara kromatografi dan spektrofotometri. JK, FMIPA UI. 1989.
terhadap Staph. aureus, E. coli dan Candida albicans invitro. FF, UGM. 94. Sri Multani. Analisis GC-MS dan daya antimikroba minyak atsiri temu
Penelitian Pendahuluan. 1987. giring (Curcuma heyneana Val. V. Zijp. JBF, FF UGM. Abstrak
70. Ibid.. Penelitian/Publikasi Ilmiah Fakultas Farmasi Universitas Gajah Mada,
71. Syahnida. Daya hambat perasan daun Centella asiatica Urban. terhadap 1986–1990. hal 171.
beberapa kuman enterik. JB, FMIPA UNAN. Penelitian Pendahuluan. 95. Eddy Yusuf Analisis kandungan kurkumin pada rimpang beberapa (empat
72. Maria Theresia Susilowati. Isolasi triterpen dari Centella asiatica Urban. belas)jenis kurkuma dan Jawa (7. Curcuma heyneana Val.). FB UNHAS.
FF. WIDMAN. Penelitian Pendahuluan. 1991. 1980.
73. Harry Ongiriwan. Penentuan koefisien fenol minyak atsiri dari klika 96. Ita Yukimantati. Penbedaan aktivitas antimiknoba minyak atsiri dengan
tanaman Cinnamomum burmani BL. terhadap bakteri Staph. aureus dan ekstrak eter minyak bumi nimpang temu mangga (Curcuma mangga Val &
Salmonella typhosa. JB, FMIPA UNAND. Penelitian Pendahuluan. 1980. V. Zijp.). JF, FMIPA UNPAD. Penelitian Pendahuluan. 1991.
74. Ria Amelya. Pengaruh daya hambat kayu manis (Cinnamomum burmani 97. M Siti Hastuti. Uji daya antibakteni ekstrak temulawak (Curcuma
BI.) terhadap Staph. aureus Rosenbach. JB. FMIPA UNAND. Penelitian xanthorrhiza Roxb.) hasil fraksinasi dengan eter minyak tanah, kloroform
Pendahuluan. 1992. dan metanol terhadap Staph. aureus, E. coli, Salmonella typhy dan Bacillus
75. Ratih Dyah Pertiwi. Uji dayaantibakteri dan identifikasi minyak atsiri dari subtilis. JF, FMIPA UNPAD. Penelitian Pendahuluan. 1986.
daun jeruk nipis (Citrus aura ntithlia Swingle). FF. UGM. Penelitian Pen- 98. Ardiah Astusi S.S. Ilyas. Isolasi minyak atsiri rhizoma temulawak (Curcuma
dahuluan. 1992. xanthorrhiza Roxb.) dan perannya sebagai antibakteri terhadap suatu jenis
76. Meyliana. Pengaruh pektin hasil isolasi dari kulit buah Citrus sinensis Staph. aureus dan E. coli. FB, UGM. Penelitian Pendahuluan. 1993.
Osbeck. varietas Pacitan, Citrus maxima Merr. varietas Nambangan dan 99,. Taufik Rachman. Penetapan kadan minyak atsiri rimpang temulawak
Citrus maxima Merr. varietas Bali terhadap Salmonella typhosa NCTC (Curcumaxanthorrhiza Roxb.) dad beberapa daerah. JF. FMIPA UNPAD.
78. PP, UBAYA. Penelitian Pendahuluan. 1992. Penelitian Pendahuluan. Minyak atsiri tergantung daerah tumbuh. 1987.
77. Indrawati Tapuwidjaja. Isolasi dan uji kualitas pektin secara kimiawi dari 100. Semangat Katanen. Penentuan komponen utama minytak atsiri temulawak
kulit buah Citrus sinensis Osbeck. var Pacitan, Citrus maxima Merr. var Curcuma xanthorrhiza Roxb. JK, FMIPA ITB. 1988.
Nambangan dan Citrus maxima Merr. var Bali. FF, UBAYA. Penelitian 101.Elisviati. Analisis komponen-komponen utama minyak sereh dan daun
Pendahuluan. 1992. sereb wangi dan sereh sayur secara spektrofotometri infra merah dan
78. Uniati Triwahyuningsih. Pemeriksaan kandungan kimia dan aktivitas anti kromatografi cairan gas. JF, FMIPA USU. 1988.
mikroba dan daun Clausena harmandiana Pierre ex Guill. FF, UGM. 102.Guspanyanti. Penganuh pnoses pelayuan daun sereh dapur Cympoogon
Penelitiaa Pendahuluan. 1989. nardus Rendle terhadap kuantitas dan kualitas minyak atsirinya.
79. Khairul. Uji mikrobiologi ekstrak daun pituju (Clerodendron siphoxanthes FFUBAYA. 1992.
R.Br.). JF, FMIPA UNAND. Penelitian Pendahuluan. 1991. 103. L. Nuraini Susilowati. Daya antibakteri daun Drymoglossum heterophyllum
80. Ester Rositawati. Penelusuran komponen aktif antibakteri buah kopi hijau C. Chr. (pakis duwitan) terhadap E. coli dan Staph. aureus serta sknining
(Coffea robusta L.) FF, UGM. Penelitiaa Pendahuluan. 1992. fitokimianya. 1988.
81. Ulfah Hanum. Uji aktivitas antibakteri fraksi etil asetat buah kopi hijau 104. E Surtina. Penelitian daya antibakteni ekstrak daun kedoya (Dysoxylum
(Coffea robusta L.) FF, UGM. Penelitian Pendahuluan. 1991. amorroides Miq. dengan menggunakan pelarut heksana, kloroform dan
82. Ifiwati Wibowo. Uji daya antibakteri ekstrak daun jinten terhadap dua etanol. JF, FM UNPAD. 1985.

Cermin Dunia Kedokteran No. 110, 1996 45


105. Tri Murti Andayani. U antibakteri dan identifikasi flavonoid dari daun 129. Dien Amiani L, Haria T. Gunawan, Meylida. Skmining daya antimikroba
tapak linian (Elephantopus scaberL.). FF, UGM. Penelitian Pendahuluan. rimpang Kaempferia galanga L. Seminar nasional POKJANAS TOL VI
1992. Bandung 2–3 Februan 1994.
106. Aty Widya Warayanti. Uji antibakteri ekstrak akar rumput belulang 130. Ratnasari. Studi penentuan struktum komponen kimia rimpang kencum
(Eleusine indicu Gearttt), JF, FMIPA UNPAD. Penelitian Pendahuluan. (Kaempfèria galanga L.) asal Ujung Pandang. JF, FMIPA UNHAS. Pene-
1987. lilian Pendahulunn 1991.
107. DerizarDeniska. Uji efek antimikrobaekstrak daun dadap ayam (Erythrinu 131. Mindarti Harapini, Rita Dwi Rahayu, Chairul. Pemeriksaan Komponen
orientalis L.) terhadap beberapa bakteri penyebab tukak secara in vitro. JF, minyak atsiri rimpang kencur (Kaempteria galanga L.) Lab. Treub. Pus
FMIPA UNAND. Penelitian Pendahuluan. 1993. litbang Biologi LIPI Bandung. Seminar POKJANASA TOI VI Bandung,
108. M. Muchalal. Komposisi minyak esensial minyak cengkeh. Risalah Semi- 2–3 Februari 1994.
nar Lokakarya Pembudidayaan Tanaman Obat dan Pameran Obat Tra- 132. Heriyanto. Uji daya antibakteri ekstrak kulit batang bungur terhadap E.
disonal, Universitas Jendral Soedirman Purwokerto, 1985: 158 - coli dan Shigella sonnei dibandingkan dengan kloramfenikol base. FF,
109. Idha Wahyu Windarti. Isolasi eugenol dan kuncup bunga, tangkai hunga, WIDMAN. Penelitian Pendahuluan. 1992.
dan daun cengkeh (Eugenia caryophyllata Thunb.) tipe Zanzibar. FF, 133. Wahyu Noer. Penejitian bakteriologik-mikologik laos (Alpinia hgalanga
UGM. Penelitian Pendahuluan. 1991. L.) merajh dan putih segar terhadap bakteri Staph. aureus Str Oxford,
110. Beni Warman. Uji mikrobiologi ekstrak Eugenia polyantha Wight. folium Salmonella typhosa dan jamur microsporum. JF, FMIPA UNPAD. 1977.
terhadap bakteri penyebab diare secara in vitro. JF, FMIPA UNAND. Pe- 134.. Tjarkiah Apandi, Penelitian daya kenja laos (Alpinia galanga Swan.)
nelitian Pend 1990. yang dikerjakan terhadap bakteri Staph. aureus strain Oxford, Salmonella
111. Retno Sudewi. Isolasi dan uji daya antibakteri minyak atsiri daun salam typhosa dan jamur Microsporum gypseum. JF, FMJPA UNPAD. 1977.
(Eugenia polyantha Wight.). FF, UGM. Penelitian Pendahuluan. 1992. 135. Sri Ardani Soelarto. Formulasi salep dengan ekstrak langkuas dan penen-
112. Agusdini Banun Saptaningsih. Pemeriksaan pendahuluan daya antibakteri tuna daya hambatnya terhadap bakteri dan jamur. Penelitian Pendahuluan.
dan antijamur getah Euphorbia anti quorum L. terhadap kuman Pseudo JF, FMIPA UNPAD. 1979:
monas aeruginosa dan Staph. aureus serta Candida albicans. JF, FMIPA 136. Mohasnad Eksan Sjatiudin. Penelitian efek bakterologik dan mikologik
UI. Penelitian Pendahuluan. 1991. dari laos merah dan putih yang segar dan yang dikeringkan terhadap Staph.
113 Hana Tuti. Daya antibakteri infus herba Euphorbia hirtaL. terhadap Staph. aureus, Salmonella ryphosa dan jamur Microsporum gypseum. Penelitian
aureus dengan Shigella sonnel. FF, WIDMAN. Penelitian Pendahuluan. Pendahuluan. JF, FMIPA UNPAD. 1981.
1993. 137. Ny. Aisyahfatmawati S. Identifikasi komponen utama flavonoid dan Alpi
114. Wellim Hartono. Skriningdan isolasi flavonoid dan Euphorbia hirta L. FF, sin galanga L. secara kromatografi lapis tipis asal desa Pania Kab. Wajo.
WIDMAN. Penelitian Pendahuluan. 1991. JF, FMIPA UNHAS.
115.Novi EkoRini. Pengaruh infus dan ekstrak kulit buah Garciniamangostana 138. Paramita A. Hubungan antana kadardengan efek minyak atsiri hasil isolasi
L. pada bakteri E. coli dan Shigella flexneri. FF, UNAIR. Penelitian dari laos (galanga rhizome) ‘terhadasp Staph. aureus in vitro.
Pendahuluan. 1990. 139. Purwani Sulistyowati. Efek antimiknoba akar temblekan (Lantana camara
116. Hermansjah Amirt. Isolasi xanthone dan kulit buah Garcinia mangostana L) terhadap Candida albicans, E. coli dan Staph. aureus serta skrining
L. JK, FMIPA ITB. Penelitian Pendahuluan. 1990. fitokimianya. FF, UGM. Penelitian Pendahuluan. 1988.
117. Siti Badriyah. Uji daya antibakteri fraksi etil asetat dan fraksi air daun 140. Aida. Usaha isolasi dan identifikasi komponen kima daun temblekan
Gardenia augusta Merr. Fakultas Farmasi, UGM. Penelitian Pendahuluan. (Lantana camara L.) asal Tamalamea Ujung Pandang. JFi, FMIPA UN-
1991. HAS. Penelitian Pendahuluan. 1990.
118.Serly Sapulete. Uji aktivitas antibakteri fraksi etil asetat daun Hemigraphis 141. Eti Kusraeti. Penelitian daya antibakteri ekstnak etanol daun paean kuku
colorata Hall. FF, UGM. Penelitian Pendahuluan. 1992. (Lawsonia inermis L.) kesetaraannyadengan tetrasiklin serta usaha
119. Art Kristijono. Isolasi dan identifikasi flavonoid dan daun Hemigraphic mengiso lasi zat aktifnya. JF, FMIPA UNPAD. 1985.
colorata Hall. FF, UGM. Sknipsi. 1987. 142. Wiralaga. Uji daya hambat ekstrak daun paean kuku (Lawsonia mermis
120. Sarwoko. Isolasi flavonoid dan daun kejibeling (Hemigraphis colorata L.) terhadapbakteri penyebab infeksi kuku secarainvitro. JF, FMIPA
Hall.) secara kromatografi lapis tipis. FF, UOM. Penelitian Pendahuluan.. UNAND. Penelitian Pendahuluan. 1990.
1989. 143. Ni Nyoman Tamri. Pemeriksaan kandungan kimiadan aktivitas antibakteri
121. Masmariani. Daya antibakteni ekstrak daun Hibiscus mutabilis L. terhadap dari Leucas lavanduli folia J.E,Smith. FF, UGM. Penelitian Pendahuluan.
Staph. ureus, Bacillus subtilis, E. coli dan Shigella sonnei. FF, WIDMAN. 1986.
Penelitian Pendahuluan. 1992. 144. Asep Saiful Azhan. lsolasi minyak atsiri dari Litsea cubeba Pers. JK,
122. Siti Aisjah, Wahjo Djatmika, lOP Santa. Penelitian golongan kandungan FMIPA ITB. 1993.
kimia Hibiscus mutabilis L. Risalah Seminar Lokakasya Pembudidayaan 145. AnikDwiyanti. Isolasi dan ujidayaantibakteni minyakatsiri buah
Tanaman Obat dan Pameran Obat Tradisional, Universitas Jendral Soedir- Melaleuca leucadendra L. (merica bolong) serta pemeriksaan kandungan
man Purwokerto, 1985: 100- kimianya. FF, UGM. Penelitian Pendahuluan. 1990.
123. Misnadiarly, Nunik Siti Aminah. Studi pendahuluan pengaruh ekstrak daun 146. Titi Miranti. Pengukuran potensi ekstrak kasar Michelin champaca L. se-
Hibiscus similis (waru) terhadap kuman Mycobacterium tuberculosis 1- bagai antibakteri dengan metoda paper disc. JF FMIPA UNPAD. 1979.
136 Rv di Laboratorium. Cermin Dunia Kedokt 1993; 84: 39-40. 147. Richard S. Pengujian aktivitas antibakten senyawa alkaloida lanut kloro-
124. Meriyatmi. Uji mikrobiologi ekstrak daun ubi jalar (lpomoeabatatas Pair.) form dari Michelia champaca, famili Magnoliaceae. JF FMIPA UNPAD.
terhadap bakteri penyebab infeksi kulit secara in vitro. JF, FMIPA Univer- 1981.
sitas Andalas. Penelitian Pendahuluan. 1990. 148. Endang Pmasetyaningsih. Uji aktivitas antibakteri fraksietil asetatdan
125. Imarn Handoyo. Daya antibakten minyak atsiri dari kencur terhadap fraksi air buah pace (Morinda citrifolia L.). FF, UGM. Penelitian
Staph. aureus dibandingkan dengan Erythromisin stearat. FF, WIDMAN. Pendahuluan. 1990.
Penelitian Pendahuluan. 1989. 149. Zulkifli. Uji mikrobiologi ekstrak buah mengkudu (Morinda citrifolia L.)
126. Udju Sughondho cs Takaran terrendah (MIC) sebagai antibiotik dan terhadap beberapa bakteri penyebab infeksi tenggorokan secara in vitro.
infusa Kampferia galanga L. dibandingkan dengan ampicillin. FK, JF, FMIPA UNAND. Penelitian Pendahuluan. 1991.
UNPAD, 1990. 150.Ester. Efek fraksi etil asetat buah pace (Morinda citrifolia L.) terhadap
127. Herri S. Sastroamihardja. Minimal inhibition concentration (MIC) dan pertumbuhan Staph. aureus in vitro. FF, UGM. Penelitian Pendahuluan.
infusum Kampferia galanga L. Bagian Fanmakologi FK, UNPAD. 19 1992.
128. Masniari Poelungan, Rita Dwi Rahayu, Mindiarti Harapini, Chairul. 151.Supriyanto. Penelitian fitokimia terhadap buah dan akar tumbuhan pace
Diameter daerah hambat yang dibentuk ekstrak kencur (Kaempferiagalanga (Morinda citri L.). FF, UGM. Penelitian Pendahuluan. 1989.
L.) terhadap Pasteurella Multivida. Seminar nasional POKJANAS TOI VI 152.Sudarsini. Uji antibakteri zat larut dalam fmaksi eter minyak tanah kuliat
Bandung 2–3 Februari 1994. akar kelor (Moringa oleifera Lamk.). JF, FMIPA UNPAD. Penelitian Pen-

46 Cermin Dunia Kedokteran No. 110, 1996


dahuluan. 984. 176. Fathiyah. Uji daya antibakteri ekstrak kental dan ekstrak kering daun
153. Sumarno. Menguji sifat antiseptika larutan serbuk biji kelor yang diguna- jambu biji. JF, FMIPA UI. Penelitian Pendahuluan. 1987.
kan untuk menjernihkan air keruh. JKF, FF, UOM, Yogyakarta. Abstrak 177. Prima Yuniarti. Pengaruh anti bakteri dekok daun jambu biji (Psidium
Penelitian/Publikasi llmiah Fakultas Farmasi, Universitas Gajah Mada, guajava L.) terhadap Staph. aureus dan E. coli (koleksi laboratorium
1986–1990 hal 170. Mikrobiologi FK UGM). FF, UGM. Penelitian Pendahuluan. 1991.
154. Aryetti. Analisis komponen kimia minyak atsiri fuli pala (Myristica fra- 178. Maria Lucia Susi Haryati. Daya antibakteri daun jambu biji (Psidium
grans Haul.) dengan GS-MS. PPPS ITB. 1989. guajava L.) dan Selarong terhadap Staph. aureus danE. coli (Koleksi Lab
155. Siti Nur Rokhmah. Penelitian sifat fisikadan kimia sertakhasiat antibakteri mikrobiologi FK UGM) secarainvitro. FF. UGM. Penelitian Pendahuluan.
atsiri daun selasih mekah (Ocimum gratissimum L.). FF, UGM. Penelitian 1992.
Pendahuluan. 1987. 179.. Soetarto M, Asep Gun Suganda, Desmida. Pemeriksaan kandungan kimia
156. Zahidah Rasjid. Efek antibiotika daun kumis kucing (folia Orthosiphon) dan Psidiam guajava L. Risalah Seminar Lokakarya Pembudidayaan Ta-
dalam bentuk yang sudah disterilkan terhadap kuman-kuman yang mung- naman Obat dan Pameran Obat Tradisional, Universitas Jendral Soedirman
kin ditemukan di saluran kemih. JF, FMIPA UI. Penelitian Pendahuluan. Purwokerto; 1985 : 118-
1978. 180.. Meliati Soetanto. Pemeriksaan kadar tanin dan ciri-ciri morfologi daun
157. Kestri Harjanti. Uji daya antibakteri fraksi air dan fraksi etil asetat daun berbagai kultivarjambu biji (Psidium guajava L.). FF, WIDMAN.
sembukan (Paederia foetida L.). FF, UGM. Penelitian Pendahuluan. 1992. Penelitian Pendahuluan. 1992.
158. Ni Wayan Asri Indraningsih. Pemeriksaan antibakteri secara in vitro 181.. F. Rias Prasetya. Uji daya antibakteri invitro ekstrak kulit buah Punica
minyak picung (Pangium edule Reinw.) terhadap bakteri Staph. aureus dan granatum L. terhadap pelbagai kuman standar dari kuman liar yang di
Staph, epidermidis, Pseudomonas aeruginosa dan E. coli. JF, FMIPA UI. asingkan dari penderita. JF, FMIPA UI. Penelitian Pendahuluan. 1987.
Penelitian Pendahuluan. 1994. 182.. Rachmat Hatunggal Siregar. Pengaruh rebusan kulit buah
159. Effionara Anwar, Atiek Soemiati, R. Sarjito, NWA. Indraningsih. Peme- Punicagranatum L. terhadap beberapa bakteri penyebab diare secara in
riksaan daya antibakteri secara in vitro minyak picung (Pangium edule vitro. FF, UGM. Penelitian Pendahuluan. 1987.
Reinw.) terhadap bakteri Staph. aureus, Staph. epidermidis, Pseudomonas 183.. Sri Indrarini. Gambaran antimikroba dan kulit buah delima putih (Punica
aeruginosa dan Escherichia coli. JF, FMIPA-UI, Bagian Mikrobiologi granatumL. varalba L.) terhadap Gandida albicans, E. coli, Staph. aureus.
FKUI. Simposium Penelitian Bahan Obat Alam VIII dan Muktamar Bacillus cereus dan usaha pembuatan sediaannya. JF, FMIPA UNPAD.
PERHIPBA VI. Bogor, 24–25 Nopember 1994. Penelitian Pendahuluan. 1991.
160. Hanny Prasetyawati. Daya antibakteri ekstrak etanol dan infus biji kedaung 184. Etty Sri Rejeki W dkk. Isolasi pektin dan buah Pyrus mallus L. dan penga-
terhadap kuman Vibrio cholerae Balivet, E. co1i 25922, Salmonella typhosa ruhnya sebagai anti bakteri terhadap Salmonella typhi dan Salmonella
9012 dan Shigella dysentriae. JF, FMIPA UNPAD. 1994. entritidis secara in vitro. Risalah Simposium Penelitian Tumbuhan Obat III
161. S. Yuliani, Ma’mun, Trianingsih. Analisis kandungan tanin biji kedaung Yogyakarta 1983. 79–90.
(Parkiajavanica) dan berbagai daerah secara fotometri. Balai Penelitian 185. Dwi Kori Andayani. Pemeriksaan pengaruh pektin dan buah apel (Pyrus
tanaman rempah dan obat Bogor. POKJANAS TOI V, Surabaya, 13–14 mallus L.) terhadap pertumbuhan beberapa bakteri penyebab diare secara
Agustus 1993. invitro. JF, FMIPA USU. Penelitian Pendahuluan. 1991.
162. Amalia Nur Utami. Isolasi dan daya antibakteri flavonoid daun kacang 186. Debora Bumbungan. Penelitian daya hambat ekstrak daun tereba (Rhini
hijau (Phaseolus radiatus L.) terhadap Staph. aureus. FF, UGM. 1986. canthus nasutus Kurz.) terhadap kapang penyebab kurap. JF, FMIPA
163. Elva Annisa. Efek antibakteri dekok herba meniran (Phyllanthus niruri L.) UNHAS. Penelitian Pendahuluan. 1988.
terhadap Staph. aureus dan E. coli (Koleksi Lab Mikrobiologi FK UGM) 187., EmaPrawita Setyowati. Uji antibakteri dan identifikasi flavonoid dari
serta skrining fitokimia. FF, UGM. Penelitian Pendahuluan. 1991. daun jarak kepyan (Ricinus communis L.). FF, UGM. Penelitian
164. Nanik Isnaini. Skrining daya hambat dan infusa meniran (Phyllanthus Pendahuluan. 1992.
niruri L.) terhadap pertumbuhan bakteri E. coli ATCC 15221, Shigella 188.. Meike Wantah. Identifikasi minyak atsini dan kayu cendana (Santalum
dysenteriae dan Staph. aureus. FF, UBAYA. Penelitian Pendahuluan. album L.) secara kromatografi lapis tipis dan kromatografi gas. FF, UN
1991. PANCA. Penelitian Pendahuluan. 1990.
165. Anas Subamas, Sidik. Phyllanthus niruri L, Kimia, Farmakologi, peng- 189. AS. Winoto. Pengambilan minyak pada kayu cendana dengan metoda
gunaannya dalam obat tradisional. JF, FMIPA UNPAD. Seminar ekstrak.si pelarut. LP UNDIP. 1991.
POKJANAS TOI V, Surabaya 13–14 Agustus 1993. 190. Connie Hanytono. Perbandingan daya antibakten ekstrak kulit batang turi
166. Henny Kurniawati. Membandingkan daya antibakteri infus sirih dengan putih terhadap E. coli, Shigella sonnei, Staph. aureus dan Bacillus subtilis.
minyak sirih secara in vitro. FF. UGM. Penelitian Pendahuluan. 1983. FF, WIDMAN. Penelitian Pendahuluan. 1992.
167. Dhiah Santi Nuringsih. Daya antibakteri minyak sirih (Piper belle L.) ter- 191. Herni Hartati. Efek antimiknobaekstrak daun sidaguri (Sida rhombifolia
hadap Staph. aureus dan E. coli serta identifikasi secara kromatografi lapis L.) terhadap Staph. aureus dan Candida albicans serta skrining
tipis dan kromatografi gas. FF, UGM. Penelitian Pendahuluan. 1992. fitokimianya. FF, UGM. Penelitian Pendahuluan. 1992.
168. Suprihati dkk. Pengaruh penyimpanan daun sirih sebagai obat kumur ter- 192. Edwin. Efektifitas minyak atsiri bunga Spilanthes acmella L. terhadap
hadap akumulasi plak gigi dan pertumbuhan bakteri Streptococcus bakteri penyebab infeksi gigi. JF, FMIPA UNAND. Penelitian Pendahu-
sanguis. FKG. UGM. 1990. luan. 1992.
169. Susilowati. Membandingkan daya antibakteri infus kemukus secara in 193. M. Eksan, Rosali, Usman, Emma Nurdiamah. Penelitian sediaan dan
vitro. FF, UNAIR. 1983. ekstrak dan daun comfrey dalam kaitannya dengan daya antimikroba nya.
170. MarianaSugiarto. Uji daya antibakteri ekstrak daun sendok terhadap Risalah Simposium Penelitian Tumbuhan Obat III. Yogyakarta 1983:
Staph. aureus dan Shigella sonnei dibandingkan dengan kloramfenikol. 78–91.
FF, WIDMAN. Penelitian Pendahuluan. 1992. 194. Anindito Widyantoro. Efek daun jamblang (Syzygium cumini Skeéls.)
171. Neneng Mupidah. Pembuatan sari daun suji (Pleomele angustiftulia ME. terhadap Staph. aureus dan E. coli serta skrining fitokimia. FF, UGM.
Broun.) dan penggunaannya dalam obat kumur. JF. FMIPA UNPAD. Penelitian Pendahuluan. 1989.
172. Sri Dewi Astuti. Isolasi minyak atsiri dan daun beluntas. FF, UGM. 1985. 195. Sumarti. Sebaran senyawa bioaktif antibakteni kulit buah lalawe (Term-i
173. Atik Erawati. Uji aktivitas antibakteri dan identifikasi minyak atsiri daun nalia bellerinaRoxb.). JF, FMIPA UNPAD. Penelitian Pendahuluan. 1993.
Pluchea indica Less. FF, UGM. 1992. 196. Muhamad Iskandar. Uji mikrobiologis fnaksi ekstrak batang brotowali
174. Murni Siregar. Pengaruh infus daun Psidium guajava L. terhadap bakteri Tinospora crispa Miers ex Hook F. & Thems terhadap beberapa bakteri
E. coli secana in vitro. JF, FMIPA Universitas Sumatera Utara (USU). penyebab diare secara in vitro, JF, FMIPA UNAND. Penelitian Penda-
Pane litian Pendahuluan. 1984. huluan. 1990.
175. Enni Mulyawati. Pemeriksaan stabilitas mikrobiologi ekstrak daun jambu 197. Yunita Halim. Daya antimikroba ekstrak brotowali terhadap Staph.
biji dan daya antibakteri terhadap kuman Salmonella typhosa, Staph. aureus, E. coli, Candida albicans dan Trichophyton ejelloi. FF,
aureus, Vibrio cholerae dan E. coli. JF, FMIPA UI. Penelitian Penda- WIDMAN. Pene litian Pendahuluan. 1991.
huluan. 1986. 198. Dien Ariani Limyati, IGK Artawan, Yunita Halim. Daya antimikroba

Cermin Dunia Kedokteran No. 110, 1996 47


ekstrak brotowali terhadap Staph. aureus, E. coli, Gandida albicans dan 6538 dan Strep. pyogenes ATCC 12385. Divisi Ristek PT (Pesero) Kimia
Trichophiton. FF. WIDMAN. Surabaya. Seminar POKJANAS TOI ke Farma. Seminar POKJANAS TOI 111, Jakarta 9–lOJuli 1992.
VIII. Jakarta 16–17 Maret 206. Sumiati. Studi senyawa bioaktif antibakteri dan ekstrak sidowayah (Wood-
199. Atiek Soemiati, Katrin, Ema Rahmah. Uji daya antibakteri infus batang fordia floribunda Lamk.). JF, FMIPA UNPAD. Penelitian Pendahuluan.
browowali (Tinos crispa L. Miers) terhadap beberapa kuman standar. JF. 1993.
FMIPA UI. Seminar POKJANAS 101 ke-VIll. Jakarta 16–17 Maret 1995. 207. Elin Yulinah Sukandar, Asep Gana Suganda, Afrinda. Penapisan aktivitas
200. Sri Mulyani. Kandungan kimia dan aktivitas ekstrak batang Tithonia minyak atsiri dan Zingiber officinale terhadap bakteri dan jamur. JF,
diversifolia Gray. (kembang bulan) terhadap Gandida albicans. JBF, FF FMIPA ITB. Simposium Penelitian Bahan Obat Alami VIII dan Muktamar
UGM, Yogyakarta. Abstrak Penelitian/Publikasi Ilmiah Fakultas Farmasi, PERHIPBA VI. Bogor 24–25 Nopember 1994.
Universitas Gajah Mada, 1986–1990. hal 171. 208. Lily Damita. Pengaruh umur tanaman terhadap kadar minyak atsiri dan
201. Asri Susitijowati Suroso. Efek ekstrak daun kembang bulan (Tithonia jahe yang diambil dari Pematang Raya Kabupaten Simalungun. FF,
diversiftuia A. Gray) terhadap Candida albicans dan Staph aureus serta FMIPA USU. Penelitian Pendahuluan. 1982.
profil kromatogratinya. FF, UGM. Penelitian Pendahuluan. 1992. 209. Rachmaniar. Aktivitas antimikroba beberapa jenis soft coral yang berasal
202. Suheri. Uji mikrobiologi ekstrak daun dan ranting Uncaria dari perairan Lombok Banat. Laboratorium Produk Alam Laut. Simposium
gambir(hunter) Roxb. terhadap beberapabakteri penyebab tukak. JF, Penelitian Bahan Obat Alami VIII dan Muktamar PERHIPBA VI. Bogor
FMIPA UNAND. Penelitian Pendahuluan. 1988. 24–25 Nopember 1994.
203. Zulfadli. Uji mikrobiologi ekstrak daun dan ranting UncariagambirRoxb. 210. Perry LM, Metzgeri. Medicinal Plants of Asiaand Soutwast Asia. TheMIT
dibuat secara tradisional terhadap beberapa bakteri penyebab diare secara Press Cambridge London, England. 1980.
invitro. JF, FM1PA IJNAND. Penelitian Pendahuluan. 1989. 211. Departemen Kesehatan RI. Tanaman Obat Indonesia. Direktorat Jenderal
204. Imtihanah. Isolasi tanin dan Uncaria gambir Roxb. dan penentuan kadar Pengawasan Obat dan Makanan. 1985.
nya dalam ekstrak. JK, FMIPA ITB. Penelitian Pendahuluan. 1989. 212. Hson-Mou Chang, Paul Pui-Hay But. Pharmacology and Applications of
205. Yuljarti R. Merati, Enngis Rosnita, Fitrileni, Imazn Hidayatullah. Penentu- Chinese Materia Medica. World Scientific Publishing Co., Inc. Singapore.
an potensi asam usnat dalam scabicid cream terhadap Staph. aureus ATCC 1987.

48 Cermin Dunia Kedokteran No. 110, 1996


TINJAUAN KEPUSTAKAAN

Obat-obat Anti Epilepsi Baru

Dr. Budi Riyanto W.


Dokter Spesialis Saraf Bogor Indonesia

PENDAHULUAN Rumus kimia oxcarbazepine


Epilepsi merupakan kelainan neurologik yang sering di-
jumpai, beberapa jenis di antaranya merupakan penyakit serius
yang sulit ditangani. Diperkirakan 0,4–1% populasi mengidap
salah satu jenis epilepsi.
Penyakit ini masih tetap menjadi perhatian karena sifat
serangannya yang spontan dan tidak dapat diperkirakan,
sehingga menyebabkan pengidapnya merasa cemas, malu dan
takut bergaul dengan masyarakat umum. Oxcarbazepine Carbamazepine
Cara penanggulangan epilepsi yang utama sampai saat ini
ialah dengan penggunaan obat-obat anti epilepsi. Kendati saat
ini obat-obat anti epilepsi yang ada cukup efektif untuk sebagian Obat ini diserap dengan baik setetah pemberian per oral;
besar kasus diperkirakan sekitar 25% pasien epilepsi masih konsentrasi plasma maksimum (Cmax) 1 mg./l (4 mmol/1.)
mengalami serangan, meskipun telah menggunakan obat. Selain tercapai dalam 1 jam setelah dosis tunggal 600 mg. atau 900
itu obat-obat yang ada tidak bebas dari efek samping; dan yang mg. pada sukarelawan sehat. Metabolitnya – 10,11-dihidro 10-
ringan sampai yang cukup serius seperti gangguan kognitif, hidroksi karbamazepin – juga aktif, bahkan mungkin merupa-
gangguan fungsi hepar, leukopeni atau dismorfogenesis. Ada kan zat uta yang berkhasiat dalam klinik. Obat ini tersebar
juga yang menyebabkan reaksi hipersensitif berupa ruam kulit merata dalam tubuh, kira-kira 50% terikat dengan protein
sampai sindrom Steven-Johnson. plasma; waktu paruhnya sekitar 2,5 jam, tetapi metabolit aktif-
Oleh karena itu para peneliti masih terus mengembangkan nya mempunyai waktu paruh yang lebih panjang yaitu 8–14
berbagai zat baru untuk diselidiki kemungkinannya sebagai jam, bahkan ada yang melaporkan sampai 26,5 jam. Makin
obat anti epilepsi yang lebih efektif dan aman. Beberapa di lanjut usia penggunanya, Cmax dan AUC nya makin tinggi,
antaranya telah dipasarkan, tetapi masih banyak yang dalam sedangkan ekskresinya makin berkurang; pasien-pasien dengan
taraf uji klinis; obat-obat ini diharapkan dapat menjadi pilihan, creatinine clearance kurang dari 30 ini/menit mungkin me-
terutama bagi kasus-kasus yang selama ini refrakter terhadap merlukan penyesuaian dosis. Konsentrasi plasma berhubungan
obat-obat anti epilepsi yang ada. linear dengan dosis, sehingga memudahkan penyesuaian dosis
bila diperlukan.
Percobaan klinik umumnya membandingkan efektivitas
obat ini dengan pendahulunya – karbamazepin, termasuk juga
OXCARBAZEPINE penggunaannya untuk neuralgia trigeminal dan gangguan
Obat ini merupakan pengembangan lebih lanjut dari afektif. Suatu studi buta-ganda yang melibatkan 235 pasien
karbamazepin untuk mendapatkan profil terapeutik yang lebih epilepsi tonik-klonik dan epilepsi parsiil menunjukkan efekti-
baik dengan mengurangi efek samping dan efek induksi enzim- vitas yang sama antara karbamazepin dengan oxcarbazepine,
enzim hepar. yaitu sekitar 80% pasien mengalami pengurangan serangan

Cermin Dunia Kedokteran No. 110, 1996 49


lebih dari 50%; tetapi kelompok oxcarbazepine lebih sedikit saraf akan bertambah.
yang mengalami efek samping ataupun yang harus meng- Rumus kimia vigabatrin
hentikan pengobatan akibat efek samping. Keunggulan
oxcanbaLepine lainnya ialah dalam hal perbaikan kewaspada-
an dan fungsi kognisi.
Karena perbedaan metabolisme, penggantian karbamazepin
dengan oxcarbazepine pada poli-terapi dapat mempengaruhi
kadar obat anti epilepsi lainnya; kadar fenitoin serum naik rata-
rata 25% dan kadar asam vaiproat naik 20–30%. Keadaan ini
perlu diperhatikan karena memperbesar risiko toksisitas obat
bersangkutan. Fenitoin dan fenobarbital dapat menginduksi
metabolisme oxcarbazepine, tetapi secara klinis tidak bermakna. Obat ini diserap dengan baik pada pemberian oral, agaknya
Obat ini digunakan dengan dosis 600–1200 mg./hari; selain tidak dipengaruhi oleh makanan; konsentrasi puncak plasma
itu telah pula dicobakan pada kasus-kasus neuralgia trigeminal tercapai daiam 1–2 jam dan waktu paruhnya 5–8 jam. Vigabatrin
dengan dosis 900–2100 mg./hari yang ekivalen dengan sebagian besar tidak tenikat protein, tidak dimetabolisme dalam
karbamazepin 400–1200 mg./hari. Efektivitasnya serupa dalam tubuh dan diekskresi dalam bentuk utuh (70% dalam 24 jam)
periode evaluasi selama 1 bulan sampai 3 tahun. meialui urine. Secara teoretik vigabatrin tidak mernpengaruhi
Pada kasus-kasus mania oxcarbazepine 2400 mg/hari metabolisme obat lain, tetapi pada percobaan klinik, obat ini
dibandingkan dengan haloperidol 42 mg./hari, sedang menurunkan kadar plasma obat anti epilepsi lain; kadar plasma
oxcarbazepine 1400 mg./hari dibandingkan dengan lithium 1100 fenitoin turun 20%, sedangkan kadar fenobarbital dan primidon
mg./hari; setelah dua minggu, efeknya sama baiknya, tetapi juga tunun pada penggunaan bersama vigabatrin.
efek samping haloperidol 3½ kali lebih banyak, sedangkan Dalam klinik, vigabatrin digunakan oleh pasien kejang
lithium lebih baik ditoleransi daripada oxcarbazepine. parsial kompleks yang resisten terhadap obat anti epilepsi
Efek samping dapat berupa gangguan susunan saraf seperti sebelumnya; selain itu tampaknya juga bermanfaat untuk
rasa mengantuk, pusing, nyeri kepala, diplopi, nistagmus, gang- serangan umum dan pada sindrom Lennox-Gastaut dan spasme
guan koordinasi dan sulit berbicara; gangguan gastrointestinal infantil. Sebaliknya agaknya merugikan bila digunakan pada
seperti mual dan muntah, diare juga dilaporkan. Pada pasien- kasus-kasus absence dan miokionik karena dapat memperse-
pasien psikotik dapat dijumpai gejala mirip Parkinson, sulit ring serangan.
tidur, depresi, hipotensi, krisis okulogirik dan sialorea. Oxcar- Vigabatrin digunakan dengan dosis 1–3 g./hari; selama
bazepine sampai saat ini tidak diketahui menyebabkan sindrom masa follow-up 7–12 minggu menghasilkan penurunan
Steven-Johnson, peninggian kadar enzim-enzim hati ataupun frekuenisi serangan lebih dari 50% pada 33–67% pasien. Per-
diskrasia darah yang selama ini dikaitkan dengan penggunaan cobaan lain menggunakan vigabatrin 2–4 g./hari sebagai obat
karbamazepin; sebaliknya hipernatremi lebih sering dijumpai tambahan secara acak buta-ganda selama 7–12 minggu, umum-
pada penggunaan oxcarbazepine, tetapi makna klinisnya belum nya terhadap pasien-pasien epilepsi parsial kompleks dengan/
jelas. tanpa umum sekunder yang telah resisten terhadap pengobatan
Dosis yang dianjurkan pada dewasa sebagai monoterapi terdahulu; dari 98 pasien, 46% mengalami penurunan frekuensi
berkisar antara 600–1200 mg./hari dibagi tiga dosis, meskipun serangan lebih dari 50%. Percobaan lain menyimpulkan bahwa
kadang-kadang dapat diberikan dua kali sehari; dosis ini dapat dosis efektif vigabatrin ialah 3–6 g./hari.
dinaikkan sampai 3000–4000 mgihari. Bila digunakan untuk Penggunaan sebagai monoterapi belum banyak dipelajari;
menggantikan karbamazepin, tiap 200 mg. karbamazepin suatu percobaan yang membandingkannya dengan monoterapi
diganti dengan 300 mg. oxcarbazepine secara bertahap. Secara karbamazepin menghasilkan efektivitas yang sama.
umum dapat disimpulkan bahwa oxcarbazepine merupakan Di kalangan anak-anak, percobaan sebagai obat tambahan
alternatif bagi karbamazepin pada pasien-pasien yang sensitif pada berbagai jenis epilepsi tenmasuk spasme infantil dan
karena obat ini mempunyai profil keamanan yang lebih baik. sindrom Lennox-Gastaut menurunkan frekuensi serangan lebih
Obat ini telah beredar di beberapa negara dengan nama dari 50% pada 34% anak.
dagang Trileptal®. Pasien-pasien dengan kejang kompleks, EEG abnormal
multifokal, gangguan intelek dan yang senangannya berat dan
VIGABATRIN sering, cenderung resisten terhadap pengobatan vigabatrin,
Vigabatrin (gamma-vinyl GABA) merupakan hasil usaha seperti juga umumnya tenhadap obat anti epilepsi lain.
mencari zat yang dapat menghambat aktivitas enzim GABA-T Eksaserbasi dapat dijumpai, terutama pada epilepsi parsial;
(gamma-amino butyric acid alpha-oxoglutarate transaminase), di beberapa percobaan kilnis, rata-rata 6% pasien harus ber-
suatu enzim yang berperan dalam katabolisme GABA – suatu henti karena vigabatrin ternyata menambah frekuensi serangan.
neurotransmiter yang bersifat menghambat (inhibitor). Dengan Sebagai obat tambahan, vigabatrin relatif aman; dari kira-
terhambatnya aktivitas enzim GABA-T maka katabolisme kira 2000 pasien, efek samping yang sering dikeluhkan ialah
GABA berkurang, sehingga kapasitas hambatan GABA di sistim mengantuk (12,5%), dan rasa lelah (9,2%). Keluhan-keluhan

50 Cermin Dunia Kedokteran No. 110, 1996


lain seperti pusing, nyeri kepala, gangguan daya ingat, depresi, metabolit epoksid sehingga menurunkan kadar zat aktifnya.
agitasi terjadi pada kurang dari 4% pasien. Sampai saat ini tidak Felbamat juga menurunkan clearance asam valproat sehingga
dijumpai reaksi alergi. Reaksi psikiatrik juga dapat timbul, kadar asam vaiproat dalam plasma meningkat. Sebaliknya kadar
mungkin akibat efek vigabatrin yang menurunkan daya ikat plasma felbamat juga dipengaruhi oleh obat anti epilepsi lain,
reseptor D2. kadarnya meningkat bila digunakan bersama asam vaiproat,
Dosis yang dianjurkan mulai dari 2 g./hari pada dewasa, sebaliknya turun bila digunakan bersama fenitoin atau kar-
dapat diberikan 1–2 kali sehari; dosis di atas 4 gram tidak me- bamazepin. Hal-hal di atas perlu mendapat perhatian karena
nambah efektivitas. Pada anak-anak dosisnya berkisar antara saat ini felbamat digunakan terutama sebagai terapi tambahan
40–80 mg./kgbb/hari, pada spasme infantildapat dicoba sampai (add-on therapy).
50–100 mg./kgbb/hari pada anak dan 100–200 mg./kgbb/hari Obat ini sempat dipermasalahkan karena munculnya la-
pada bayi. poran kasus anemia aplastik dan hepatotoksisitas di kalangan
Obat ini telah dipasarkan di beberapa negara dengan nama penggunanya, di samping efek samping lain seperti gangguan
dagang Sabril®. saluran cerna, insomnia, penurunan berat badan, pusing, rasa
lelah, ataksia dan letargi. Sampai Agustus 1994 telah dilapor-
FELBAMAT kan 32 kasus anemia aplastik, 10 di antaranya fatal, meskipun
Struktur kimia: hanya 6 di antaranya yang menjalani monoterapi felbamat.
Kasus-kasus tersebut telah menggunakan felbamat rata-rata
selama 163 (72–539) hari dengan dosis rata-rata 3055 mg/hari
(600–5400 mg./hari). Bila dibandingkan dengan seluruh peng-
guna, angka kejadian anemia aplastik ini diperkirakan sekitar
1 : 4000–5000. Kasus-kasus hepatotoksisitas yang dilaporkan
ternyata tidak ada yang jelas terkait dengan penggunaan
felbamat; sampai saat ini dilaporkan 19 kasus gagal hati yang
fatal, hanya 8 kasus yang setelah diselidiki lebih lanjut mungkin
berkaitan dengan penggunaan felbamat; 5 di antaranya me-
ninggal dunia.
Saat ini felbamat masih beredar dengan indikasi terbatas –
yaitu untuk sindrom Lennox-Gastaut dan localisation-related
epilepsy; para penggunanya dianjurkan menjalani pemeriksaan
hematologik dan fungsi hati secara berkala – sebelum peng-
obatan dan tiap 2 minggu selama pengobatan.
Felbamat digunakan dengan dosis awal 1200 mg/hari atau
15 mg./kgbb/hari pada anak-anak dalam dosis terbagi, kemudian
dapat ditingkatkan sampai 45 mg./kgbb/hari atau maksimum
3600 mg./hari; umumnya diberikan 3–4 kali sehari.
Obat ini beredar di Amerika Serikat dan beberapa negara
Struktur kimianya mirip dengan meprobamat – suatu anxiolitik Eropa dengan nama dagang antara lain Felbatol® dan
yang telah lama beredar. Taloxa®.
Pada percobaan binatang, obat ini menghambat perluasan
kejang dan meningkatkan ambang rangsang terhadap kejang. CLOBAZAM
Pada penggunaan oral, penyerapannya bersifat linear, tidak Struktur kimia:
dipengaruhi oleh makanan dan profil farmakokinetiknya sama,
baik pada anak-anak maupun pada dewasa. Waktu paruhnya
berkisar antara 13,5–23,1 jam, sedangkan kadar puncak plasma
tercapai dalam 3–5 jam setelah pemberian dosis tunggal; pem-
berian berulang menghasilkan kadar plasma puncak 2,5–3 kali
lebih tinggi daripada pemberian dosis tunggal; meskipun de-
mikian tidak dijumpai tanda-tanda bahwa obat ini terakumulasi
dalam tubuh.
Felbamat menaikkan konsentrasi fenitoin bila digunakan
bersama, sehingga dianjurkan untuk menurunkan dosis fenitoin
sebesar 20%; diduga hal ini disebabkan karena metabolisme
fenitoin dihambat oleh felbamat. Bila digunakan bersama
arbamazepin, kadar karbamazepin turun sekitar 20–25%, Figure 1. The structure of the 1,S-benzodiazcpine, clobazam, contrasted
mungkin akibat induksi felbamat terhadap pembentukan with the 1,4-benzodiazepine, diazepam.

Cermin Dunia Kedokteran No. 110, 1996 51


Merupakan derivat benzodiazepin yang telah lama beredar TIAGABINE
sebagai anxiolitik; potensinya sebagai antikonvulsan mulai Tiagabine HCI, suatu derivat asam nipekotat yang te-
diketahui dari percobaan binatang. Dibandingkan dengan rangkai dengan senyawa hipofihik, mempunyai efek spesifik
benzodiazepin lain, clobazam rnempunyai efek antikonvulsan menghambat masuknya (uptake) GABA ke dalam astrosit dan
yang lebih spesifik dengan efek sedasi yang minimal. neuron; sebaliknya obat ini tidak mempengaruhi uptake
Clobazam diserap dengan baik pada pemberian oral; dalam neurotransmiter lain seperti dopamin, norepinefrin, serotonin,
tubuh dimetabolisme menjadi N-desmetil clobazam – metabolit glutamat ataupun asetilkhohin. Pada percobaan binatang,
yang lebih aktif berperan dalam pencegahan serangan epilepsi tiagabine terbukti meningkatkan konsentrasi GAJ3A ekstrasel;
daripada bentuk asalnya. Dalarn darah, bentuk N-desmetil dan berkhasiat mencegah kejang yang disebabkan oleh
konsentrasinya 10–20 kali Iebih tinggi danipada bentuk asli- pentilentetrazol, pikrotoksin atau kejutan listnik.
nya. Rumus kimia tiagabine:
Penggunaannya sebagai antikonvulsan dimulai oleh Gastaut
pada tahun 1978, dan sampai sekarang telah digunakan oleh
lebih dari 2000 pasien, di antaranya mehalui 8 uji klinis buta-
ganda. Laporan-laporan khinis tersebut rneminjukkan bahwa
10 mg. clobazam dosis tunggal efek’tif untuk jenis serangan
umum, sedangkan serangan fokal Iebih efektif diatasi dengan
dosis tunggal 20 mg. Suatu studi yang melib 1300 kasus di
Canada menunjukkan bahwa clobazam dapat menurunkan
frekuensi serangan lebih dari 50% pada sedikitnya 40% pasien
selama 4 tahun. Studi lain pada epilepsi katamenial menun-
jukkan bahwa clobazam yang diberikan selama 10 hari di sekitar Pada manusia, obat ini diserap dengan baik melalui sa-
saat menstruasi dapat menurunkan frekuensi serangan sampai luran cerna; makanan mempengaruhi kecepatan penyerapan
63%, bahkan 12 dari 16 pasien menjadi bebas serangan. tetapi tidak mengurangi jumlah obat yang diserap, bio-
Masalah yang mungkin timbul pada penggunaan jangka availabilitasnya mendekati 100%. Terikat sebagian besar (96%)
lama ialah adanya toleransi, seperti yang umum dijumpai pada dengan protein plasma, dimetabolisme terutama di hati. Kadar
penggunaan derivat benzodiazepin pada umumnya. Besarnya puncak plasma tercapai dalam I jam. Waktu paruhnya 5–8 jam
kemungkinan toleransi bervariasi pada beberapa uji klinik, dengan proses eliminasi melalui urine.
angkanya berkisar antara 0–86%; studi di Canada mendapat- Penggunaan bersama obat-obat enzyme-inducers seperti
kan 9% pasiennya menjadi toleran sehingga pengobatan di- fenobarbital dapat memperpendek waktu-paruh menjadi 2–3
hentikan, sedangkan pada studi di Australia, angka toleransi jam. Tiagabine sendiri tidak mempengaruhi kadar plasma obat
tersebut mencapai 19,6%. Toleransi timbul terutama pada 3 anti epilepsi lain, kecuali sedikit menurunkan kadar asam
bulan pertama pengobatan, mekanismenya belum diketahui valproat (sekitar 10–12%).
secara pasti, tetapi dapat dicegah/diperlambat dengan pemberian Saat ini obat ini sedang dicoba sebagai add-on therapy
dosis kecil, dosis tunggal atau secara intermiten. Masalah to- pada berbagai jenis epilepsi dengan dosis berkisar antara 8–
leransi timbul pada ± 18,8% pasien setelah pengobatan selama 80 mg./hari (median 45 mg./hari), dibagi 2–4 dosis.
8 bulan; masalah ini dapat dikurangi kemungkinannya bila Efek samping yang paling sering dijumpai ialah pusing
menggunakan dosis kecil 10–20 mg./hari. Bila timbul toleransi, (dizziness) pada 30% subjek yang menggunakan obat ini, astenia
sebaiknya berangsur-angsur diganti dengan obat lain. dirasakan oleh 24%, nasa gugup (nervousness) – 12%, tremor –
Efek samping yang dapat dijumpai kurang lebih sama 9%, diane – 9%, depresi – 5% dan labilitas emosi pada 4%,
dengan sediaan benzodiazepin lain, berupa sedasi, pusing (diz- kebanyakan efek samping ini dirasakan ringan. Sekitar 15,4%
ziness), rasa kering di mulut, konstipasi, mual dan kadang- pasien hams menghentikan pengobatan karena efek samping
kadang inenyebabkan tremor halus. Umumnya muncul pada yang mengganggu. Efek samping dapat dikurangi dengan pem-
awal pengobatan dan berangsur-angsur hilang bila terapi berian yang lebih sering karena pemberian 4 kali sehari lebih
dilanjutkan. Pada kasus-kasus tertentu dapat timbul rasa gelisah ditoleransi daripada pemberian 2 kali sehari.
dan kelemahan otot. Obat ini tidak menyebabkan reaksi Dibandingkan dengan plasebo, obat ini menunjukkan
idiosinkratik ataupun alergi, juga tidak mempengaruhi fungsi efektivitas yang bermakna; dalam 4 minggu, obat ini dapat
kognitif. Efek anxiolitiknya dapat memperbaiki kualitas hidup mengurangi frekuensi serangan hingga 25%; setelah 9–12 bu-
para pasien. lan, pengurangan frekuensm serangan lebih dari 50% dicapai
Clobazam digunakan sebagai obat tambahan, terutama pada 30–40% pasien.
pada epilepsi parsial kompleks dengan/tanpa serangan umum Obat ini baru akan dipasarkan di Denmark dengan nama
sekunder, dengan dosis antara 5–30 mg./hari (rata-rata 14 ± Gabitrol®.
5,7 mg./hari).
Obat ini beredar dengan indikasi utama anxiolitik, dengan TOPIRAMATE
nama Frisium®. Merupakan denivat monosakhanida yang unik karena

52 Cermin Dunia Kedokteran No. 110, 1996


struktur kimia yang sama sekali berbeda dari obat antiepilepsi obatannya karena efek samping yang timbul.
yang ada sebelumnya. Obat ini baru beredar di Inggris dengan nama dagang
Rumus kimia topiramate : Topamax®.

ZONISAMID
Merupakan obat antiepilepsi yang dikembangkan di
Jepang; berasal dari turunan 1,2 bensizoxazole.
Percobaan pada binatang menunjukkan bahwa obat ini
menunjukkan aktifitas yang serupa dengan fenitoin atau
karbamazepin; dapat menekan atau menghilangkan aktifitas
kejang sekaligus mencegah penyebarannya, diduga melalui
efek hambatannya terhadap saluran natrium dan/atau kalsium.
Obat ini diserap dengan baik setelah pemberian per oral;
konsentrasi puncak plasma dicapai dalam 2,4–3,6 jam, berkisar
Obat ini diserap dengan baik pada pemberian oral, farma- antara 2,3 mg/l setelah dosis 200 mg. sampai 12,5 mg/l setelah
kokinetiknya bersifat linear dengan waktu paruh sekitar 22 jam, dosis 800 mg. Penyerapannya tidak dipengaruhi oleh makan-
sedangkan kadar puncak plasma tercapai dalam 1,3 jam sampai an. Dalam tubuh, zonisamid terutama ditemukan di dalam
4,8 jam, tergantung pada besarnya dosis, atau apakah ditelan eritrosit – konsentrasinya dapat mencapai 4–9 kali lebih tinggi
bersama makanan. Meskipun demikian AUC (area under curve) danipada konsentrasinya dalam plasma; kurang dari 50% ter-
nya tidak berbeda bermakna, sehingga penggunaannya tidak ikat dengan protein plasma. Waktu paruh plasmanya berkisar
terlalu dipengaruhi oleh saat makan obat. Dalam darah, hanya antara 50–68 jam setelah pemberian dosis tunggal 200–800 mg.
9–17% terikat dengan protein plasma, tetapi banyak yang ter- Kadar plasma terapeutik berkisar antana 7–40 mg/l; kadar lebih
ikat pada eritrosit. Ekskresinya terutama melalui urine sebagi- dari 30 mg/l dikaitkan dengan timbulnya efek samping. Saat ini
an besar dalam bentuk utuh. kadar plasma yang dianjurkan berkisan antara 20 mg/l.
Penggunaannya bersama obat antiepilepsi lain harus di- Dalam tubuh zonisamid dimetabolisme melalui proses
perhatikan; fenitoin dan karbamazepin menurunkan kadar asetilasi dan konjugasi dengan asam glukuronat; hampir 50%
topiramate plasma sampai 50% bila digunakan bersama; se- dapat ditemukan dalam urine; pada percobaan binatang,
dangkan pengaruh asam vaiproat sangat kecil. Sebaliknya metabolitnya jugaditemukan dalam faeces dalam jumlah yang
penambahan topiramate tidak mempengaruhi kadar plasma dan cukup bermakna, sedangkan pada manusia belumjelas. Sampai
fenitoin, karbamazepin ataupun asam valproat secara berarti. saat ini ekskresi zonisamid dosis tunggal diketahui tidak di-
Saat ini topiramate digunakan pada pasien-pasien yang penganuhi oleh adanya gangguan fungsi ginjal.
refrakter terhadap obat antiepilepsi sebelumnya sebagian be- Sebagian besar percobaan klinis dilakukan di Jepang;
sar terdiri dari kasus kasus epilepsi umum sekunder tetapi di sampai saat ini telah mehbatkan sedikitnya 1008 pasien anak
kemudian hari mungkin juga dapat digunakan untuk jenis dan dewasa dengan berbagai jenis .epilepsi yang refrakter ter-
epilepsi lainnya Studi klinis menunjukkan bahwa dosis opti- hadap pengobatan sebelumnya. Dosis rata-rata yang digunakan
mal berkisar antara 2 dd 100–300 mg./hari. Dosis ini pada antara 5,9–8,8 mg/kgbb/hani yang menghasilkan kadar plasma
add-on therapy ialah 50 mg. dosis tunggal, dinaikkan sampai 2 sekitar 20mg/l. Zonisamid terutama efektif untuk kejang parsial,
dd 100 mg./hari. dengan keberhasilan antara 50–60% (pengurangan frekuensi
Sebagai obat tambahan, dosis 200 mg., 400 mg. dan 600 serangan lebih dari 50%); keberhasilan tersebut berkisar antara
mg. masing-masing menghasilkan penurunan frekuensi se- 59% di kalangan kejang tonik klonik umum, 41% di kalangan
rangan lebih dari 50% pada 27%, 47% dan 46% pasien, di- serangan kompleks, sampal 26% di kalangan kejang tonik
bandingkan dengan 18% di kalangan penerima plasebo. umum. Obat ini juga dilaporkan efektif untuk sindrom West
Efektivitasnya tidak bertambah pada dosis di atas 600 mg/ dan sindrom Lennox Gastaut.
hari meskipun pada beberapa percobaan beberapa pasien Zonisamid diketahui dapat meningkatkan kadar plasma
memerlukan dosis sampai 800–1000 mg/hari untuk mengen- obat lain, terutama karbamazepin; sebaliknya kadar plasma
dalikan serangannya zonisamid meningkat bila digunakan bersama fenobarbital atau
Data yang diperoleh dari 1244 pasien yang menggunakan kanbamazepin; asam valproat juga dilaporkan meningkatkan
topiramate, 336 di antaranya lebih dari 1 tahun dan 119 lain- kadan zonisamid bebas dalam plasma.
nya lebih dari 3 tahun, menunjukkan bahwa efek samping yang Efek samping yang terutama diamati ialah mengantuk
utama hampir sama dengan efek samping obat antiepilepsi lain
yaitu rasa lelah pusing nyen kepala mengantuk abnornal
thinking dan ataksia sebagian besar ringan dan bersifat se-
mentara. Selain itu terdapat peningkatan kejadian nefrolitiasis
pada 1,5% pasien yang menggunakan topiramate. Dalam per-
cobaan yang sama, 13% pasien harus menghentikan peng- Fig. 2. Chemical structure of zonisamide

Cermin Dunia Kedokteran No. 110, 1996 53


(24%), ataksia (13%), hilang nafsu rnakan (11%) dan gangguan peninggian konsentrasi plasma karbamazepin dan fenitoin,
gastrointestinal (7%), kehilangan spontanitas (6%) dan per- tetapi tidak mempengaruhi kadar asam vaiproat.
lambatan fungsi mental (5%). Leukopeni dan peningkatan kadar Efek samping yang dilaporkan berupa rasa pusing (dizzi-
enzim-enzim hati menyebabkan penghentian pengobatan pada ness) yang agaknya tergantung dosis; efek samping lain berupa
2% pasien. Dibandingkan dengan efek samping karbamazepin, dispepsia atau nyeri abdomen; dosis lebih dari 800 mg/hari di-
efek sainping zonisamid kira-kira seimbang; zonisamid lebih kaitkan dengan timbulnya perubahan suasana hati (mood). Rasa
sering menyebabkan anoreksia, sedangkan karbamazepin lebih lelah, ataksia dan diplopia dijumpai pada penggunaan kom-
sering menyebabkan ataksia. Batu ginjal juga ditemukan pada binasi dengan antiepilepsi lain. Sampai saat ini tidak diketahui
1,9–3,5% pasien pada beberapa percobaan klinis, tetapi per- mempengaruhi fungsi kognitif.
cobaan klinis di Jepang hanya menunjukkan insidens sekitar Dalam bentuk preparat parenterat, obat ini diberikan intra-
0,2%. vena pada kasus-kasus stroke iskemik akut dengan dosis sampai
Zonisamid sampai saat ini bani digunakan di Jepang dengan 2 dd 500 mglhani selama 3 hari.
dosis awal 100–200 mg/hari, dapat ditingkatkan sampai 600/
hari, diberikan dalam dosis tunggal atau terbagi. Dosis untuk
anak dimulai dari 2–4 mglkgbb/hari, dapat dinaikkan sampai RINGKASAN
maksimum 12 mg/kgbb/hari. Penyesuaian dosis dilakukan tiap Dalam tahun-tahun terakhir ini, banyak obat antiepilepsi
1–2 minggu sampai tercapai dosis optimal. banu diteliti; beberapa di antananya telah mulai dipasarkan di
beberapa negara sebagai obat tambahan (add-on therapy) untuk
REMACEMIDE meningkatkan efekt’ivitas pengobatan yang telah berlangsung.
Suatu obat antiepilepsi baru yang dikembangkan berda- Obat-obat baru ini masih tetap dipenlukan mengingat sekitar
sarkan konsep blokade reseptor NMDA (N-metil D-aspartat); 25% penyandang epilepsi masih mengalami serangan meskipun
reseptor NMDA bersifat eksitatorik, bereaksi terhadap glisin, telah menggunakan (kombinasi) obat-obat antiepilepsi yang ada..
glutamat dan beberapa poliamin. Dalam percobaan laboratorium Penelitian dan pengembangan obat baru dengan demikian
remacemide memblokade saluran Na+ dan saluran C++, mem- memperbesar harapan keberhasilan pengendalian serangan-
perkuat efek inhibisi GABA dan juga memperkuat inhibisi ter- serangan epilepsi, terutama pada kasus-kasus yang selama ini
hadap efek excitatory amino acids seperti glutamat. sulit ditangani.
Dalam laboratorium, remacemide dan metabolit aktif-
nya – API 12495 – terbukti efektif menghambat pelepasan KEPUSTAKAAN
listrik neuron yang berulang, mencegah kejang yang dibang-
1. Ben-Menachem E. Vigabatrin. Chemistry, absorption, distribution and
kitkan oleh kainat, 4-aminopiridin dan oleh NMDA. Selain itu elimination. Dalam: Levy RH, Mattson RH, Meldrum BS. Antiepileptic
zat ini juga dapat mencegah kerusakan neuron akibat iskemi. Drugs. 4th ed. New York: Raven Press Ltd., 1995. pp. 915-23.
Pada pemberian oral, kadar puncak plasma tercapai dalam 2. Bernus 1, Dickinson RG, Hooper WD. Franklin ME. Eadie Ini. Effect of
1–2 jam, sedangkan metabolit aktifnya – dalam bentuk desgli- felbamate on the plasma protein binding of vaiproate. Clin. Drug Invest.
1995; 10(5): 288-95.
sinil – mencapai kadar puncak plasma dalam 4–6 jam. Dalam 3. Brodie Ini, Pellock JM. Taming the brain storms: felbamate updated. Lan-
plasma, 77% remacemide dan 90% metabolit aktifnya terikat cet 1995; 346: 918-19.
dengan protein. Waktu paruhnya 3–.4 jam untuk remacemide 4. Clinical Controversies in Epilepsy. Satellite Symposium to the 21st Inter-
dari 12–15 jam untuk metabolit aktifnya. national Epilepsy Congress. Sydney, September 3, 1995.
5. Clobazam. The management of epilepsy with special reference to intract-
Dalam tubuh, remacemide HCI dimetabolisme melalui be- able seizure disorders. Medication Disease Monograph. 1995.
berapa cara; melalüi deaminasi di hepar menjadi desglisinil 6. Clobazam. A New Perspective. Satellite Symposium to the 2lth Inter-
remacemide yang juga aktif, melalui oksidasi dan glukuroni- national Epilepsy Congress. Sydney, September 2, 1995.
dasi juga di hepar. Ekskresinya terutama melalui ginjal; hanya 7. Drug News 1995; 4(36): 5.
8. FisherRS, Kerrigan Ill JF, Vigabatrin. Toxicity. Dalam: Levy RH. Mattson
kurang dari 1% yang masih ditemukan dalam bentuk utuh. RH, Meidrum BS. Antiepileptic Drugs. 4th ed. New York: Raven Press
Sampai April 1995, obat ini telah dicobakan pada kira- Ltd., 1995. pp.931–39.
kira 600 pasien dengan dosis antara 300–1200 mg/hari diberi- 9. Grant SM, Faulds D. Oxcarbazepine. A review of its pharmacology and
kan dalam dosis terbagi 2–4 kali sehari, terutama pada pasien therapeutic potential in epilepsy, trigeminal neuralgia and affective
disorders. Drugs 1992; 43(6): 873-88.
pasien epilepsi parsial kompleks yang refrakter terhadap peng- 10. Jung Ini, Paifreyman MG. Vigabatrin. Mechanism of action. Dalam: Levy
obatan sebelumnya; selain itu juga sebagai obat tambahan ter- RH, Mattson RH. Meldrum BS. Antiepileptic Drugs. 4th ed. New York:
hadap obat antiepilepsi yang telah digunakan. Percobaan atas Raven Press Ltd., 1995. pp.
25 pasien yang dibandingkan dengan 23 pasien lain yang men- 11. Oxcarbazepine – a first line drug. Abstracts. 21st International Epilepsy
Congress. Sydney, September 3, 1995.
dapat plasebo menghasilkan bebas serangan pada 16%, reduksi 12. Palmer Ki, McTavish DM. Felbamate. A review of its pharmacodynamic
serangan lebih dari 75% pada 29% dan reduksi serangan lebih and pharmacokinetic properties and therapeutic efficacy in epilepsy. Drugs
dari 50% pada 32% pasien; dibandingkan dengan hanya 9% 1993; 45(6): 1041–65.
yang mengalami reduksi lebih dari 50% di kalangan penerima 13. Pellock JM. l3oggs JG. Felbamate: A unique anticonvulsant. Drugs of
Today 1995; 31(1); 9–16.
plasebo. 14. Peters DH, Sorkin EM. Zonisamide, A review of its pharmacodynamic
Penggunaannya bersama antikonvulsan lain menyebabkan and pharmacokinetic properties, and therapeutic potential in epilepsy.

54 Cermin Dunia Kedokteran No. 110, 1996


Drugs 1993; 45(5): 760-87. 17. Taloxa. Product Monograph. Schering-Plough. 1995.
15. Remacemide hydmchloride – anticonvulsant and neuroprotectant ? Sa- 18. Tiagabine: the art of epilepsy care. Abstracts. 21st International Epilepsy
tellite Symposium to the 21st International Epilepsy Congress. Sydney, Congress. Sydney, September 2–8, 1995.
September 2, 1995. 19. Topiramate: a promising new agent for the treatment of epilepsy. Internat.
16. Scrip 1995; 2067: 20. Symposium Proc. Advances in AED Therapy 1995; 1(1).

Kalender Peristiwa

Juli 3–6, 1996 – KONGRES NASIONAL RADIOLOGI ke VIII


Hotel Papandayan, Bandung, Indonesia
Bandung, INDONESIA
Sekr.: Bagian Radiologi RS Hasan Sadikin/FK
Universitas Padjadjaran
Jl. Pasteur 38
Bandung, INDONESIA

8–l0 juli 1996 – KONGRES NASIONAL VIII


PERHIMPUNAN DOKTER SPESIALIS MATA INDONESIA
Hotel Savoy Homann
Bandung, INDONESIA
Sekr.: Bagian Ilmu Penyakit Mata FK Unpad
RS Mata Cicendo
JL. Cicendo 4
Bandung 40171
INDONESIA
TeIp.: 62-22 431281
Fax : 62-22 4201962

8–10 Juli 1996 – MUKTAMAR AHLI BEDAII INDONESL (MABI) XII


Surabaya, 8–l0 Juli 1996
Sekr.: Kantor IKABI Wilayah Jawa Timur
d/a Chef de Clinique
Lab./UPF Ilmu Bedah
FK Universitas Airlangga/RSUD Dr. Soetomo
JL. Mayjen. Prof Dr. Moestopo 6–8
Surabaya 60286
INDONESIA
Tel.: (031)550 1315/550 1305
Fax: (031)5353648/516364
Pendaftaran peserta:
PT Haryono Travel
Jl. Sulawesi 27–29
Surabaya 60271
INDONESIA
Tel.: (031)5465029
Fax: (031)5465030

Cermin Dunia Kedokteran No. 110, 1996 55


HASIL PENELITIAN

Berbagai Determinan
yang Mempengaruhi Penilaian Pasien
terhadap Pelayanan Medis
Benyamin Lumenta, Ref linar
Pusat Penelitian Penyakit Tidak Menular, Badan Penelitian dan Pengembangan Kesehatan
Departemen Kesehatan RI, Jakarta

ABSTRAK

Studi ini hendak mencari hubungan antara berbagai karakteristik pasien, karakteris-
tik pertemuan dokter-pasien, dan penilaian pasien terhadap pertemuan itu. Seluruhnya
1682 pertemuan dokter-pasien dipelajari dalam 12 fasilitas asuhan kesehatan. Dapat
diidentifikasi 3 variabel independen untuk studi ini, ialah: umur, kepuasan hidup dalam
masyarakat, dan derajat kesinambungan asuhan yang menandai kunjungan pasien pada
dokter. Jenis kelamin pasien, status perkawinan, agama dan jumlah dari jenis pelayanan
yang diberikan tidak berkorelasi dengan penilaian pasien. Perbedaan besar dalam ke-
puasan pasien atas asuhan yang didapat adalah antara berbagai jenis fasilitas pelayanan.
Perbedaan-perbedaan ini kemungkinan besar terletak padajenis atau karakteristik pasien
yang membutuhkan asuhan tersebut, yaitu usia, kepuasan dalam hidup kemasyarakatan.
Di samping itu berbagai kebijaksanaan mengenai prosedur pengadaan pelayanan berke-
sinambungan. Semua ini dibutuirkan untuk menetapkan kebijaksanaan puskesmas pe-
merintah dan pengadaan klinik spesialis swasta di tengah masyarakat.

PENGANTAR lapisan atas, yang mulai lebih banyak menuntut dari pertemuan
Banyak ahli sosiologi dan ahli kedokteran mempertanyakan dokter-pasien yang dibayarnya semakin mahal. Namun di negara
validitas dan kemaknaan evaluasi yang dibuat para pasien ter- kita penelitian ke arah itu belum dilaksanakan, dan banyak masih
hadap pengalaman medis mereka. Namun penelitian Alpert et al. berdasarkan dugaan para dokter atau para ahli sosiologi. Pene-
(1980) dan Francis et al (1979) menunjukkan bahwa terdapat litian ini di Jakarta baru merupakan suatu survai awal ke arah
kecenderungan perubahan sikap pasien terhadap dokternya dan mengenal sikap pasien dan perubahan ke arah peran yang lebih
ditemukan kepuasan yang cukup berarti dalam berbagai pertemu- besar dari pihak pasien.
an dokter-pasien. Kemudian Reedor (1982) mengkonstatasi
betapa konsumerisme medis semakin berkembang, juga di luar LATAR BELAKANG DAN KERANGKA TEORI
negara-negara maju, yang semakin memacu pertemuan dokter Dalam berbagai studi di negara-negara maju kepuasan pa-
pasien dan mulai merubah hubungan tradisional itu. Pasien se- sien dalam memperoleh pelayanan medis dapat dikategorikan
makin berperan dan semakin mengambil peran kuasa karena dalam 3 kelompok :
pengetahuannya tentang masalah kedokteran semakin dipa- 1) kepuasan pasien terhadap pemberian pelayanan berupa ke-
haminya. Karena itu peran mereka tak dapat begitu saja diabai- lompok pelayanan (termasuk asuransi).
kan oleh para dokter. Di Indonesia kitajuga temukan gejala yang 2) kepuasan saat kunjungan pada dokter.
sama, terutama di kota-kota besar dan di kalangan penduduk 3) kepuasan saat kunjungan pada nondokter (perawat, bidan,

56 Cermin Dunia Kedokteran No. 110, 1996


ahli gizi/diet, dan sebagainya). BAHAN DAN CARA
Kelompok ke- 1 menunjukkan adanya kepuasan terhadap Data diperoleh dari 12 buah fasilitas pelayanan kesehatan di
peralatan kedokteran modern yang serba canggih, namun kurang Jakarta Selatan, Jakarta Timur dan Depok. Ia meliputi 3 buah
puas dengan hubungannya dengan dokter. Weinerman meneliti praktek dokter pribadi, 2 pusat kesehatan dalam kampus univer-
klinik dengan asuransinya pada tahun 1974 dan menemukan hal sitas, 2 buah praktek dokter berkelompok dari 5 unit rawat jalan
ini. Anderson et al. (1969) dan Freidson (1971) menemukan pada hospital swasta, dan meliputi seluruhnya 1682 pertemuan
bahwa kepuasan pasien Iebih banyak diperoleh pada pertemuan dokter-pasien yang lengkap. Semua pertemuan ini ditelaah ka-
dokter-pasien di praktek pribadi dan pada dalam praktek ber- rena merupakan suatu program pendidikan dua buah pendidikan
sama atau dalam suatu ikatan dengan asuransi. Hampir semua tinggi keperawatan yang dilakukan 2 buah hospital umum swasta
peneliti menemukan banyak keluhan atas pertemuan dokter- yang cukup besar.
pasien, bila ini berlangsung dalam ikatan asuransi atau dalam Dalam setiap pertemuan, semua kunjurigan pasien diteliti
klinik praktek bersama. Kelompok ke-3 yaitu pertemuan pasien selama enam hari dalam seminggu. Peneliti dibantu oleh para
dengan nondokter (perawat atau asisten dokter) menunjukkan mahasiswa perawat yang kebetulan berdinas di tempat tersebut.
kepuasan yang tinggi. Di Amerika Serikat misalnya sedang Semua pasien disambut dengan ramah dan diberi suatu kuesioner
berkembang perawat pediatri, atau perawat kardiologi, perawat yang diminta diisi secara anonim. Di samping itu sebuah formulir
geriatri, yang semuanya cenderung dirasakan sangat memuas- petugas kesehatan disediakan bagi setiap dokter atau perawat
kan. Di negara kita memang belum banyak dilakukan spesialisasi yang bertugas, kecuali mahasiswa perawat yang merupakan para
perawat seperti itu. pelaksana pengumpul data. Setelah selesai pertemuan dokter-
Selain itu, dari berbagai penelitian yang dilakukan, banyak pasien atau perawat-pasien, ia diberi kesempatan menyelesaikan
hal mulai terpapar : pengisian kuesioner sebelum dikumpulkan oleh mahasiswa
1) dikenal berbagai teknik mengukur kepuasan dengan asuhan perawat petugas penelitian.
kesehatan (skala sikap, dan sebagainya). Dengan cara ini dapat diketahui siapa yang memberi pe-
2) bermacam-macam populasi dipelajari (populasi pasien, layanan, apa yang diberkan, dan bagaimana asuhan dinilai
populasi asuransi populasi praktek bersama populasi peng- pasien. Juga dapat diketahui jenis dan tipe pemberi asuhan
hasilan rendah dan sebagainya) kesehatan. Kadang-kadang pasien ditangani dokter dan perawat,
3) berbagai obyek kepuasan dapatdievaluasi (kunjungan dokter yang penilaiannya dilakukan terpisah dalam kuesioner. Tingkat
terakhir, dokter seumumnya, kelompok kesehatan, asuransi pengembalian dan ke- 12 fasilitas pelayanan kesehatan berkisar
kesehatan profesi kesehatan baru dan sebagainya) antara 89 dan 100%. Sangat sedikit pasien yang menolak mengisi.
Namun, di samping banyakobyekdan subyek studi ini, juga Yang butahuruf ingin dituntuni dan hanya beberapa tuarenta
dapat ditemukan banyak kesatuan baru seperti: yang kunang kooperatif atau menolak. Beberapa dokter juga
1) semua studi menemukan kepuasan pasien yang tinggi. telah menolak mengisiformnya, sehingga total pertemuan dokter-
2) tiadanya temuan yang menunjukkan kekhasan faktor-faktor pasien dan perawat-pasien yang lengkap berjumlah 1682 buah
sosial dan budaya dalam perolehan kepuasan pasien. yang dapat digunakan dalam penelitian ini.
3) karakteristik khusus dari pertemuan dokter-pasien tidak
dapat ditemukan yang berkaitan dengan tingkat kepuasan yang Berbagai ukuran
dinyatakan pasien. Yang diukur dalam penelitian ini ialah sesuai instrumen:
Berdasarkan semua kesamaan maupun perbedaan yang di- 1) formulir pertemuan pasi
temukan dalam banyak penelitian (di luar negeri), dan karena di 2) karaktenistik pasien
negara kita juga semakin tampak adanya peningkatan konsu- 3) penilaian pasien terhadap asuhan (kepuasan).
merisme di bidang kesehatan, sangat penting diketahui peng- ad. 1 formulir pertemuan dokter-pasien: setelah diisi se-
ukuran kepuasan pasien terhadap pelayanan dan asuhan kese- belum kunjungan dan dirampungkan setelah kunjungan se-
hatan, khususnya terhadap pertemuan dokter-pasien. Karenanya lesai, diperoleh data tentang a) sifat-sifat umum kunjungan;
studi ini mempunyai beberapa tujuan yaitu: b) pelayanan yang diberikan atau dilaksanakan, dan c) hasil
1) mengenal berbagai tingkat kepuasan pasien berdasarkan pertemuan berupa nasihat, anjuran tindak lanjut dan sebagainya.
banyak kriteria, yang penting bagi pelayanan kesehatan yang Dalam sifat-sifat umum dapat diketahui lama pertemuan, kun-
diberikan dokter. jungan pertama atau ke sekian, untuk masalah kesehatan yang
2) mengadakan analisis terhadap karakteristik pasien, karakte- sama atau yang lain. Pelayanan yang diberikan menyangkut
ristik pertemuan dokter-pasien dan tingkat kepuasan pasien ter- riwayat penyakit, pemeriksaai fisik, tes laboratonium, foto
hadap pertemuan itu. rontgen, pengobatan, nasihat, diit atau anmuran cara hidup. Se-
Dalam studi ini, kepuasan pasien didefinisikan sebagai suatu dangkan dengan hasil pertemuan dimaksudkan ada tidaknya
variabel keluaran yang merupakan hasil percampuran sifat sosial, pasien dinasihatkan atau dianjurkan kembali lagi, kapan, untuk
budaya dan psikologis pasien yang dikaitkan dengan aspek ter- apa, dan sebagainya.
tentu dan proses pemberian pelayanan kesehatan. Lebih jauh ad. 2 karakteristik pasien: dalam kuesioner dimintakan
definisi ini dapat diaplikasikan terhadap keluhan dan proses data gender, usia, suku bangsa, status nikah, pendidikan, agama,
penyembuhan pasien. dan terakhir tingkat kepuasan hidup dalam masyarakatnya se-

Cermin Dunia Kedokteran No. 110, 1996 57


karang. (skor 16–17) 31%. ini merupakan Indeks Penilaian Umum.
ad. 3 penilaian pasien terhadap asuhan: diperoleh beberapa Pengukuran kedua dilakukan dengan skor pertanyaan 7
ukuran penilaian pasien tentang pelayanan yang akan dianalisis, sampai 10 akan menghasilkan Indeks Kepuasan terhadap Asuhan
pertama-tama Indeks Penilaian Urnum, yang diperoleh dari Dokter. Di sini juga semua pasien dimasukkan dalam 4 kuartil.
jawaban atas 6 pertanyaan (1 sampai 6) dan yang kedua ialah Distribusinya ialah: Kuartil I (skor 6–14) 21%; Kuartil 2 (skor
Indeks Kepuasan dengan Asuhan Dokter yang juga diperoleh 15) 13%; Kuartil 3 (skor 16) 32%; dan Kuartil 4 (skor 17–19)
dari 4 pertanyaan berikutnya (7 sampai 10). 34%. Desain kuesioner adalah sedemikian sehingga Indeks
Ke- 10 pertanyaan itu yang semuanya diberi skor (angka) Penilaian Umum menunjuk kepada sikap yang berhubungan
sebagai dasar analisis adalah: dengan keseluruhan kunjungan hari itu. Sedangkan Indeks
1) Apakah anda merasa bahwa pelayanan dokter hari ini lebih Kepuasan terhadap Asuhan Dokter hanya menunjuk kepada
baik daripada yang diterima orang-orang lain? (3, 2, I) pertemuan dengan dokter. Betapapun, secara statistis ditemukan
2) Apakah semua pelayanan hari ini anda rasakan perlu? (1,2) suatu korelasi (r = 0,57) antara kedua indeks itu secara bermakna
3) Apakah anda merasa diperlukan lebih banyak pemeriksa- (p > 0,001). Karena itu, hasil penelitian ini hendaknya jangan
an? (1,2) dilihat sebagai dua dimensi kepuasan yang berlain-lainan.
4) Apakah anda rasakan pelayanan medis hari ini lebih baik Sengaja keduanya tidak dikombinasikan dalam 1 indeks karena
dari yang dulu, ataukah sama, ataukah lebih buruk? (3, 2, 1) mungkin dapat terjadi perbedaan dalam hubungannya dengan
5) Apakah anda mengerti keadaan medis anda sekarang ? variabel independen yang ditelaah.
(tandai satu)
saya sangat mengerti (4) HASIL PENELITIAN
saya merasa saya mengerti (3) Sesuai dengan penelitian di negara-negana lain, pada umum-
saya tak yakin saya mengerti (2) nya pasien menilai pelayanan yang merekaperoleh secara sangat
saya tak mengerti (1) positif. Misalnya, 97% merasa bahwa pelayanan yang mereka
6) Pernyataan manakah paling sesuai dengan perasaan anda peroleh adalah sama atau lebih baik dari pada yang lain, sedang-
tentang dokten/perawat yang melayani anda hari ini? kan 98% merasa bahwa pelayanan sekarang adalah sama atau
Saya ingin ketemu orang yang sama lagi (3) lebih baik dari pada pelayanan terdahulu. Begitu juga 98% tidak
Saya merasa masabodo siapa yang akan merasa bahwa mereka memperoleh pelayanan yang tak perlu,
melayani saya kali berikut (2) dan 86% tak merasa bahwa mereka memerlukan pemeriksaan
Saya ingin dilayani orang lain saja (1) Iebih banyak lagi.
7) Apakah dokter menggunakan cukup waktu bagi anda, se- Berkaitan dengan kepuasan tenhadap asuhan dokter, hanya
cukupnya atau kurang waktu? (3, 2, 1) 3–5% dan pasien merasakan ketidakpuasan atas pentanyaan 7
8) Merasakah anda bahwa dokter mengerti keluhan anda? sampai 10. Tentu penlu kita pertanyakan juga 6 tingkat jawaban
Sangat mengerti (4) yang diberikan dalam kuesioner untuk dipilih salah satu. Gra-
Cukup mengerti (3) dasinya kadang-kadang membingungkan atau dinasakan tak ber-
Kurang mengerti (2) beda. ini tampak dari penjelasan yang diminta dari mahasiswa
Sama sekali tak mengerti (1) perawat yang mendampingi mereka dalam mengisi kuesioner.
9) Seberapa banyakkah perhatian dokter bagi anda? Bila kedua indeks diperhatikan lebih mendalam pada ke- 12
Sangat peduli (6) fasilitas pelayanan kesehatan, ditemukan perbedaan yang ber-
Cukup peduli (5) makna di antara pasien-pasien itu. Misalnya saja, pasien yang
Sedikit peduli (4) sangat puas pada Indeks Penilaian Umum (kuantil 3 dan 4)
Sedikit tak peduli (3) persentasenya ada di antara 44 dan 87%. Pada Indeks Kepuasan
Tak peduli (2) dengan Dokter ada pada kurun 52 sampai 84%.
Sangat tak peduli (1)
10) Pada umumnya seberapa besarkah kepuasan anda hari ini Karakteristik Pasien dan Kepuasan
terhadap dokter? Ternyata, gender, agama dan status nikah tidak berkorelasi
Sangat puas (6) dengan kepuasan pasien. Pasien berusia lanjut tennyata paling
Cukup puas (5) puas, sedangkan usia muda 18–24 sangat tidak puas. Dalam
Sedikit puas (4) Tabel 1 juga tampak bahwa pasien yang puas dengan kehidupan
Sedikit tak puas (3) dalam masyarakatnya, secara bermaknajuga sangat puas dengan
Tak puas (2) pelayanan dokter. Sangat mengesankan ialah bahwa kepuasan
Sangat tak puas (1) yang ditunjukkan terhadap pelayanan dokten sebetulnya juga
Alas 6 pertanyaan pertama setiap pasien dimasukkan dalam menupakan petunjuk akan kepuasannya dalani kehidupan ke-
satu kuartil I sampai 4, yaitu penilaian yang paling positif ter- masyarakatannya. Sebaliknyajuga demikian, ialah mereka yang
hadap penilalan (kuartil 1 paling rendah). Karena distribusi skor, tak puas dalam kehidupan kemasyarakatannya juga men unjuk-
maka kiasifikasi dilakukan seperti: Kuartil 1 (skor 8–13) 16%; kan ketidakpuasan dengan pelayanan dokter. Mungkin predis-
Kuartil 2 (skor 14) 20%; Kuartil 3 (skor 15) 33%; dan Kuartil 4 posisi psikologis mereka yang kunang puas tentang sesuatu, juga

58 Cermin Dunia Kedokteran No. 110, 1996


akan tak puas dengan pelayanan dokter. kunjungan lebih lama (16 menit atau Iebih) dalam Indeks Ke-
Demikian juga variabel pendidikan dan latar belakang ke- puasan Umum.
sukuan tidak menunjukkan korelasi bermakna dengan Indeks
Penilaian Umum. Namun, mereka dengan sedikit pendidikan Tabel 2. Kepuasan Pasien dan Karakteristik Umum Kunjungan Pasien
ternyata puas berniakna dengan pelayanan dokter, daripada Kepuasan Umum Kepuasan dengan
mereka dengan pendidikan Iebih banyak (Tabel 1). Karakteristik umum Tinggi Dokter Tinggi
Kunjungan
% N Total % N Total
Tabel 1. Karakteristik Pasien dan Kepuasan dengan Asuhan Kedokteran
Kunjungan pertama
Kepuasan Umum Kepuasan dengan Ya 62 69 111 66 71 107
Karakteristik Pasien Tinggi Dokter Tinggi Tidak 63 652 1032 65 726 1117
% N Total % N Total
X2 TB X2 TB
Usia: < 17 tahun 66 160 243 63 175 278
Pertemuan pertama dengan
18-20 55 85 156 55 73 132
dokter :
21-24 50 97 193 67 121 182
Ya 57 192 338 60 193 321
25-29 68 95 139 61 76 124
30-39 64 88 138 64 101 159 Tidak 67 485 720 68 535 789
40-49 72 70 97 69 88 128 X2 p<0,01 X2 p<0,01
50-59 65 67 103 70 87 125 Pertemuan pertama dengan
dokter untuk masalah yang
2 2
X p < 0,001 X p < 0,01 sama
Suku Bangsa: Ya 67 145 218 60 149 248
Pulau Jawa 63 543 856 64 559 886 Tidak 68 360 520 71 397 560
Luar Pulau Jawa 68 67 98 75 80 106
X2 TB X2 p < 0,01
Cina dan WNA lain 65 120 185 7 160 228
Lama kunjungan
X2 NS X2 NS <- 5 menit 67 209 311 63 210 334
Latar Belakang Pendidikan 6-10 menit 63 259 414 63 289 462
SD tidak tamat 65 46 71 77 66 86 11-15 menit 63 131 209 69 160 231
SD tamat 74 46 62 79 66 84 16 menit 59 90 152 70 111 159
SNIP 60 120 201 71 153 218
SMA 6 156 256 59 169 286 X2 p < 0,05 X2 T13
SLTA lain 61 25 41 59 28 48
Akademi 70 26 37 63 29 49
Mengenai Kepuasan Pasien dikaitkan dengan Pelayanan
Mahasiswa 61 253 413 62 239 384
Sarjana 64 94 147 64 82 128
Berlanjut, pada Tabel 3 dapat dilihat korelasi bermakna antara
kedua ukuran, di samping adanya suatu pola kunjungan yang
X2 NS X2 p < 0,05
menarik perhatian. Misalnya saja, penilaian pasien lebih me-
Kepuasan dengan Masyarakat
mungkinkan bila ia melihat dokter yang sama, baik untuk masa
Sangat puas 71 152 315 77 176 229
Puas 64 307 478 68 337 494 lah yang sama maupun untuk masalah berlainan.
Sedikit puas 57 209 366 61 239 394
Sedikit tak puas, tak puas, Tabel 3. Kepuasan Pasien dan Pelayanan Berlanjut
sangat tak puas 61 119 194 54 112 206
Kepuasan Umum Kepuasan dengan
X2 p < 0,05 X2 p < 0,001 Tinggi Dokter Tinggi
Pelayanan Berlanjut
% N Total % N Total
Kepuasan Pasien dan Karakteristik Pertemuan Dokter sama, masalah sama
Dalam penelitian-penelitian terdahulu biasanya kepuasan kunjungan ulang 69 273 394 71 300 420
pasien selalu dikaitkan dengan penilaian pelayanan. Namun Dokter sama, masalah sama
bukan kunjungan ulang 69 87 126 69 97 140
karena kepuasan bukan hanya ditentukan oleh keadaan pasien
Dokter sama, masalah baru
tapi dapat dipengaruhi oleh pelayanan yang diberikan atau oleh kunjungan ulang 71 61 86 63 64 101
berbagai kebijaksanaan dalam pelayanan kesehatan, maka dalam Dokter sama, masalah baru
telaah ini juga diperhatikan hubungan antara kepuasan dan bukan kunjungan ulang 58 56 96 56 62 111
karakteristik pertemuan dokter-pasien. Dokter baru, kunjungan ulang 61 90 147 65 89 137
Dokter haru, bukan kunjungan
Karakteristik umum dan pertemuan dokter-pasien dapat ulang 52 98 187 56 101 180
dilihat pada Tabel 2, bahwa sebetulnya tidak ada perbedaan
p<0,01 p<0,01
bermakna dalarn tingkat kepuasan antara pasien baru dan lama.
Pasien lama cenderung lebih puas dengan pelayanan pada umum-
nya dan dengan dokter khususnya daripada pasien baru.
Juga tampak pada Tabel 2 bahwa menyangkut lama kun- BAHASAN DAN SIMPULAN
jungan, pasien dengan kunjungan yang lebih pendek (5 menit Setelah disajikan semua penemuan dan hasil pengolahan
atau kurang) secara bermakna lebih puas daripada pasien dengan data pada penelitian in dapat disimpulkan bahwa pada dasarnya

Cermin Dunia Kedokteran No. 110, 1996 59


banyak temuan sesuai dengan penelitian di Amerika menyangkut makna lebih puas daripada mereka yang dilayani dokter yang
penilaian pasien terhadap pelayanan dokter dan fasilitas kese- baru ditemuinya. Begitu juga kepuasan dengan dokter adalah
hatan. Menyangkut studi ini, terdapat perbedaan yang cukup lebih besar di antara pasien yang pernah dilayaninya sebelum-
besar di antara berbagai jenis fasilitas kesehatan. Karena perbe- nya.
daan-perbedaan ini. maka karakteristik pasien dan karakteristik 6) Dengan beberapa pengecualian, baik jumlah maupun jenis
pertemuan diamati secara saksama dengan simpulan sebagai pelayanan yang diberikan selama suatu pertemuan sedikit ber-
berikut: pengaruh pada penilaian pasien atas pelayanan atau dokternya.
1) Semua ukuran tentang kepuasan tidak berkorelasi secara 7) Kalau usia, kepuasan bermasyarakat dan sifat maupun ting-
bermakna dengan gender, status nikah atau agama yang dianut. kat kelanjutan kunjungan diperhatikan dalam hubungannya
2) Pasien dengan pendidikan kurang atau dari latar belakang dengan kepuasan, maka hasilnya akan menunjukkan bahwa ke-
pedesaan (umumnya dari Pulau Jawa) secara bermakna lebih tiga faktor ini secara relatif merupakan sumber kepuasan yang
suka menilai dokternya secara lebih positif danipada pasien tidak saling mempengaruhi.
dengan pendidikan lebih tinggi atau berasal dari kota (umumnya Akhirnya pertanyaan mengapa terdapat perbedaan kepuas-
dari luar Pulau Jawa). Namun demikian pendidikan dan suku an yang besar antara fasilitas pelayanan, maka bila ditinjau lebih
bangsa tidak berkorelasi secara bermakna dengan skor pasien mendalam, ternyata bahwa antara fasilitas terdapat perbedaan
dalam Indeks Penilaian Umum. pasien dengan karakteristik berlainan.
3) Pada umumnya, pasien di atas 60 tahun dan di bawah 18 UCAPAN TERIMA KASIH
(dalam hal ini lebih merupakan penilaian ibu tentang asuhan Penelitian ini dapat terlaksana dengan bantuan dana dan tenaga oleh
kepada anak atau bayinya) secara bermakna lebih puas dengan PT Bina Hospindo Sakti. Terima kasih penulis ucapkan kepada semua pimpin-
pertemuan dokter-pasien, danipada pasien dalam kelompok usia an klinik yang menjadi subyek penelitian ini. Juga kepada para rnahasiswa-
perawat Akademi Perawatan MH Thamrin dan para pimnpinan keperawatan
lainnya. Dewasa muda (18–21 atau 21–25) merupakan yang yang telah banyak membantu dalam studi ini.
paling kurang kepuasannya. Perbedaan ini mungkin mencer-
minkan perbedaan sosial dan psikologis kelompok usia ber-
sangkutan. KEPUSTAKAAN
4) Pasien yang lebih puas dengan kehidupan kemasyartakatan-
nya secara bermakna lebih puas dengan kunjungan dokter mereka, 1. Alpert JJ, Kosa J, Haggerty Li, Robertson LS, Mageret C. Attitudes and
di samping interaksi mereka dengan dokter, danipada pasien yang Satisfaction of Low-income Families Receiving Comprehensive Paediatric
Care. Am. i. Publ. HIth. 1980; 70: 3.
kurang puas dengan kehidupan kemasyarakatan mereka. Inter- 2. Francis V. Korsch BH, Morris MJ. Gaps in Doctor-Patient Communication
pretasi penemuan ini niungkin ialah karena orang cenderung patients’ response to Medical Advice. New Engl. I. Med. 1979; 290: 10.
menilai suatu pertemuan dokter memuaskan, kalau ia dalam 3. Reeder LG. The Patient-Client as a Consumer: Some Observations on the
keadaan puas dengan kehidupan sekelilingnya. ini merupakan Changing Professional-Client relationship, 1982.
4. Weinermann ER. Patients’ Perceptions of Group Medical Care. Am. J. Publ.
juga hasil penelitian Linn dan Reeder (1983). Karena itu juga, HIth. 1974; 64: 6.
orang yang memang dalam keadaan tak puas, akan menilai atau 5. Anderson DW, Sheatsley PB. Comprehensive Medical Insurance: A Study of
cenderung menilai pertemuan dokter-pasien juga kurang me- Costs, Use and Attitudes Under Two Plans. Research Series No. 9. Chicago:
muaskan. Health Information Foundation, 1969.
6. Freidson E. Patients’ View of Medical Practice. New York: Russell Sage
5) Tidak ditemukan perbedaan bermakna antara penilaian pe- Foundation, 1971.
layanan oleh pasien lama dan pasien baru. Namun, di antara 7. Linn LS, Reeder LG. Satisfaction with the L..ast Doctor Visit in a General
pasien usia lanjut, yang dilayani dokter yang lama secara ber- Population Sample, Health and Society, 1982; 12: 4.

great talents have some admirers, but few friends


(Niebuhr)

60 Cermin Dunia Kedokteran No. 110, 1996


Pengalaman Praktek

Masalah Adat
Suatu sore datang seorang ibu dengan menggendong anaknya yang berumur dua
tahun ke ruang praktek saya. Anaknya nampak sakit berat tetapi ekspresi wajah ibu itu
tidak menampakkan lazimnya seorang ibu yang anaknya sakit berat. Sambil menggen-
dong sang anak yang lemah, tangan ibu menggenggam dua bungkus oralit dan sebungkus
plastik yang tampak berisi obat puyer.
Kesan sekilas cukup membuat saya penasaran. Ibu itu saya persilahkan masuk dan
anaknya saya periksa. Anak tampak apatis, didapatkan tanda-tanda dehidrasi berat. Sang
ibu mengaku bahwa anaknya telah sakit mencret selama satu minggu dan telah beberapa
kali datang di rumah sakit Susteran dan puskesmas. Tetapi ternyata obat puyer masih utuh
10 bungkus dan oralit dua bungkus. "Obat dan rumah sakit tidak ibu minumkan ?" tanya
saya. "Tidak dokter" jawab ibu itu datar. "Kenapa" tanyaku lagi. Ibu itu menjawab dengan
enteng, "anak ini memang haus mati dokter. Dia harus mati karena bapaknya telah tasalah
adat (melanggar adat), bapaknya sampai sekarang belum membayan belis (mas kawin)
perkawinan kami dahulu, oleh karena itu bila anak ini mati itu tidak apa-apa".
Aku terkesima. Belum pernah kudengar jawaban seorang ibu seperti ini. "baik, kalau
begitu bawa saja anak ini ke rumah sakit, nanti saya yang merawat", bujukku. “Tidak usah
dokter, obat dari puskesmas dan rumah sakit tidak saya minumkan, saya hanya minta anak
ini disuntik saja. Sekarangpun saya minta suntik saja, kalau dokter berobat, tidak akan
saya minumkan juga. Memang anak ini harus mati”.
Saya tidak bisa membujuknya lagi. Ibu itu demikian yakin dengan peraturan adatnya.
Keesokan harinya saya mendapat kabar bahwa anak tersebut telah meninggal dunia.

Dr. Sutrisno
Pusk. Maubesi, insana, Timor Tengah Utara, NTT

Ralat
Artikel Penelitian Proses Pembuatan Tempe Kedelai. I. Pengaruh lama perendaman,
perebusan,dan pembungkusan terhadap kandungan asam fitat dalam tempe kedelai dalam
Cermin Dunia Kedokteran no. 107/1996 hal. 53–56,Proses Pembuatan Tempe Kedelai.
II. Penganuh lama fermentasi terhadap kandungan asam fitat dalam tempe kedelai dalam
Cermin Dunia Kedokteran no. 108/1996 hal. 54–57 dan artikel Proses Pembuatan
Tempe Kedelai. III. Analisis mikrobiologi dalam Cermin Dunia Kedokteran no. 109/
1996 hal. 54–57 seharusnya dikarang oleh : Sitoresmi Triwibowo dan Hestining Pupus
Pangastuti (bukan sebaliknya).
Redaksi

Cermin Dunia Kedokteran No. 110, 1996 61


ABSTRAK
USIA IBU DAN KEMATIAN JANIN ALPROSTADIL UNTUK IMPO- PEMBEDAHAN UNTUK KASUS
Data dari Royal Victoria Hospital di TENSI EPILEPSI
Montreal, Kanada digunakan untuk me- US FDA telah menyetujui peng- Pembedahan menupakan salah satu
nyelidiki pengaruh usia ibu terhadap gunaan alprostadil (Caverject®) untuk pilihan pengobatan epilepsi yang in-
risiko kematian janin; data tersebut dari mnengatasi masalah impotensi pria; obat tractable.
tahun 1961–1974 dan dari tahun 1978– tersebut rnerupakan hormon prostaglan- Selama tahun 1974–1990, sejumlah
1993 meliputi 94.346 persalinan. din E1, yang bila disuntikkan ke dalam 202 pasien epilepsi telah menjalani
Kematiañ janin turun dari 11,5 per- corpus cavernosum penis akan menye- pembedahan di UCLA, AS karena re-
1000 persalinan di tahun 1960an men- babkan ereksi dalam 5–20 menit. Obat frakter terhadap pengobatan medika-
jadi 3,2 per 1000 persalinan di tahun ini bekerja merelaksasi otot polos se- mentosa; hasilnya dibandingkan de-
1990–1993 (p <0,001); selama periode hingga memperbesar aliran darah me- ngan 46 pasien refrakter yang tidak
tersebut usia rata-rata ibu saat bersalin nuju penis yang akan menghasilkan menjalani pembedahan. Ternyata ke-
meningkat dari 27 tahun menjadi 30 ereksi. lompok yang dibedah mengalami rata-
tahun (p < 0,001) dan penyakit diabetes Dalam berbagai studi klinis, hasil rata serangan 6,9 perbulan dibanding-
melitus dan hipertensi selama kehamil- yang memuaskan tercapai pada 70–80% kan dengan 21,1 perbulan di kelompok
an meningkat lima kali lipat (p <0,001). pasien. Dosis yang dianjurkan 20 ug, yang tidak dibedah; lebih dari 80%
Setelah faktor-faktor lain diperhitung- disuntikkan oleh dokter atau yang telah pasien kelompok kontrol masih meng-
kan, usia di atas 35 tahun menyebabkan berpengalaman, tidak boleh diulang se- alami 1 kali atau lebih serangan tiap bu-
risiko keniatian janin yang lebih tinggi; belum 24 jam, dan/atau lebih dari tiga lan, dibandingkan dengan 25% di ka-
dibandingkan dengan usia ibu di bawah kali seminggu. langan pasien yang dibedah; selain itu
30 tahun, usia ibu 35–39 tahun mem- Efek samping berupa nyeri di tempat mereka (kelompok yang dibedah)
punyai odds ratio 1,9 (95%CI: 1,3–2,7), suntikan, terbentuknya jaringan ikat dan cenderung menggunakan lebih sedikit
sedangkan usia Iebih dan 40 tahun, ereksi yang berkepanjangan; nyeri ter- obat antiepilepsi [ rata-rata 1,4 vs. 2,0;
risikonya 2,4 (95%CI: 1,3–4,5). jadi pada 37% pasien, 3% di antaranya 95%CI: –0,67 (–0,94–0,40)].
Walaupun secara keseluruhan terda- harus menghentikan pengobatan; jarin- Tetapi meskipun kualitas hidup di
pat penurunan kematian janin sebesar gan ikat terbentuk pada 3% pasien kalangan pasien yang dibedah lebih baik
70%, usia ibu tetap merupakan faktor sedangkan ereksi yang terlalu lama – (p ≤ 0,05), tidak terdapat perbedaan yang
risiko yang perlu diperhatikan. sampai 4–6 jam–terjadi pada 4% pasien. bermakna dalam hal status bekerja dan
Seorang dokter mengingatkan bahaya dalam prospectively assisted quality of
N Engl. J. Med. 1995; 333: 953–7 terbentuknya bekuan darah di penis yang life.
Hk
dapat menyebabkan emboli di jaringan Lancet 1995; 346: 1445–49
lain seperti di paru dan otak. Hk
ANTIBIOTIK PROFILAKTIK Carapengobatan ini tidak dianjurkan PENVEBAB PENYAKIT HUN-
UNTUK LUKA pada orang-orang yang menderita anemi TINGTON
Suatu meta analisis atas 7 percobaan sel sabit (sickle cell), mieloma multipel, Para peneliti di AS telah menemukan
antibakterial sistemik pada kasus-kasus leukemia, kelainan bentuk penis atau protein yang dianggap berkaitan dengan
luka biasa menghasilkan kesimpulan menggunakan implan penis. Selain itu perkembangan penyakit Huntington –
bahwa penggunaan antibakterial sis- faktor-faktor yang dapat menyebabkan suatu penyakit degeneratif susunan sa-
temik justru meningkatkan risiko in- impotensi juga harus ditangani, seperti raf pusat.
feksi (odds ratio 1,16) bila dibanding- usia lanjut, arterioskierosis, hipertensi, Protein tersebut dinamai HAP-I,
kan dengan kontrol. diabetes melitus atau hiperkhofestero- berinteraksi dengan huntingtin–protein
Analisis ini juga menunjukkan lemi; faktor-faktor lain berupa diet yang hasil produksi gen Huntington–sehingga
bahwa jenis antibakterial, cara pem- buruk, kurang olahraga, alkoholisme dan mengubah fungsinya yang berakibat
berian, jenis luka tidak mempengaruhi merokok. kematian sel neuron.
kesimpulan di atas.
Pharm. Bus. News 995: 11(246/247): 9 Scrip 1995; 2083: 27
Am. J. Emerg. Med. 1995; 13: 396–400 Brw Brw
Hk

62 Cermin Dunia Kedokteran No. 110, 1996


ABSTRAK
VITAMIN A DOSIS TINGGI kasus gangguan muskuloskeletal yang indometasin, atau 2 dd 300 mg. asam
Vitamin A dosis tinggi masih diper- berkaitan dengan penggunaan omepra- tiaprofenat, atau plasebo selama sedi-
debatkan kegunaannya, apalagi karena zol: 8 orang menderita pembengkakan kitnya satu tahun.
adanya sifat teratogenik seperti ternyata sendi termasuk 2 kasus gout, 9 orang Ternyata studi foto Rö yang dilaku-
pada percobaan binatang. nyerilatrofi otot dan 2 orang menderita kan tiap 6 bulan menunjukkan bahwa
Selama Oktober 1984 sd. Juni 1987, keduanya sekaligus. Dari 16 pasien yang kelompok indometasin menunjukkan
terdapat 22.748 wanita hamil di daerah dapat ditelusuni, 14 orang mengguna- perburukan kartilago yang lebih berat
Boston, AS yang bisa dihubungi dan di- kan dosis 20 mg. dan 2 orang dosisnya (47,05%) dibandingkan dengan kelom-
wawancarai mengenai kebiasaan diet 40 mg. Gejala mulai dirasakan antara pok plasebo (22,35%); sedangkan di
dan obat/vitamin yang dimakan selama sehari sampai setahun setelah peng- kalangan asam tiaprofenat perbedaan
hamil. Dari 22.748 kehamilan tersebut, gunaan obat. tersebut tidak bermakna (43,45% vs.
339 bayi dengan cacad lahir, 121 di Selain itu omeprazol juga dikaitkan 34,25%). Akibatnya para peneliti me-
antaranya akibat gangguan cranial dengan timbulnya nefritis interstitial mutuskan untuk menghentikan peng-
neural crest. yang diderita oleh para pasien berusia obatan dengan indometasin.
Rasio prevalensi cacad lahir di ka- 58–86 tahun dan gejalanya timbul dalam
langan wanita yang mengkonsumsi beberapa minggu sampai 6 bulan sete- J. Rheumatol. 1995; 22: 1941-46
Brw
lebih dari 15000 IU vitamin A dan ma- lah penggunaan omeprazol.
kanan dan suplemen, dibandingkan de- Gejala/kemungkinan efek samping
ngan yang mengkonsumsi kurang dari tersebut harus diwaspadai terutama pada
5000 IU adalah sebesar 3,5 (95%CI: bulan pertama pengobatan. PIRACETAM UNTUK STROKE
1,7–7,3). Untuk kalangan yang meng- Scrip 1995; 2083: 27 Dalam kongres International Con-
konsumsi hanya dari suplemen vitamin Brw ference on Stroke: Heart and Brain di
A, konsumsi Iebih dari 10000 IU ri- Praha baru-baru ini, dibicarakan peng-
sikonya sebesar 4,8 (95%CI: 2,2–10,5) obatan pirasetam untuk stroke iskemik
bila dibandingkan dengan mereka yang CUKA APEL UNTUK ARTRITIS?
akut.
konsumsinya kurang dari 5000 IU per- Cuka apel dipercaya dapat meng-
Dalam percobaan yang melibatkan
hari. encerkan cairan tubuh sehingga da-
927 pasien stroke sedang/berat, pira-
Peningkatan frekuensi kelainan ter- pat mengurangi kekakuan sendi seperti
setam diberikan dengan dosis bolus 12
sebut terutama terkonsentrasi pada wa- pada pasien-pasien artritis. Meskipun
g. iv selama 20 menit dalam 12 jam
nita yang mengkonsumsi vitamin A dosis demikian, sampai saat ini tidak terdapat
pertama setelah serangan stroke, diikuti
tinggi sebelum usia gestasi 7 minggu. cukup bukti bahwa cuka apel memang
dengan 3 dd 4 g. iv perhari selama 4
Mereka menyimpulkan bahwa kon- bermanfaat untuk artritis.
minggu. Kemudian disusul dengan 4,8
sumsi vitamin A dosis tinggi bersifat Sampai saat ini pengobatan artritis
g. perhari selama 8 minggu.
teratogenik; di antara wanita yang yang dianjurkan ialah berolahraga/
Perbaikan dicapai oleh 25% pasien,
mengkonsumsi 10000 IU vitamin A bergerak (exercise), kompres panas dan
dan 2 dari 10 pasien (dibandingkan
atau lebih dalam bentuk suplemen, 1 dingin, istirahat dan relaksasi, obat-
dengan 1 dari 10 pasien yang mendapat
dari 57 kelainan yang diamati diper- obat antiinflamasi dan kadang-kadang
plasebo) pulih sempurna.
kirakan berkaitan dengan faktor suple- kortikosteroid dan tindakan bedah.
Scrip 1995; 2072: 30
mentasi tersebut. MCHL 1995; 13(12): 8 Brw
Hk
N. Engl. J. Med. 1995; 333: 1369–73
Hk
NSAID UNTUK OSTEOARTRITIS
LUTUT
EFEK SAMPING OMEPRAZOL Studi prospektif multisenter di UK
Majalah Australian Adverse Drug melibatkan 376 pasien ostreoartritis
Reactions Bulletin telah melaporkan 19 lutut yang diobati dengan 3 dd 25 mg.

Cermin Dunia Kedokteran No. 110, 1996 63


Ruang
Penyegar dan Penambah
Ilmu Kedokteran
Dapatkah saudara menjawab
pertanyaan-pertanyaan di bawah ini?
1. Hepatitis pasca transfusi disebut juga: e) Perlemakan hati
a) Hepatitis A 6. Obat antiepilepsi baru yang dilaporkan dapat menyebabkan
b) Hepatitis B anemi aplastik:
c) Hepatitis C a) Oxcarbazepin
d) Hepatitis D b) Felbamat
e) Hepatitis B c) Vigabatrin
2. Yang diakibatkan dengan karsinoma hepatoseluler: d) Tiagabin
a) Hepatitis A e) Remacemid
b) Hepatitis B 7. Selain sifat anti epilepsi, kiobazam digunakan untuk indi-
c) Hepatitis C kasi:
d) Hepatitis D a) Antipsikotik
e) Hepatitis E b) Antidepresi
3. Selain efek hepatotoksik, INH dapat menyebabkan: c) Anxiolitik
a) Neuropati d) Hipnotik sedatif
b) Anemi e) Anestetik
c) Vertigo 8. Pada penelitian kepuasan masyarakat terhadap pelayanan
d) Urtikaria kesehatan, kelompok usia yang paling kurang puas:
e) Semua salah a) Balita
4. Yang termasuk pola transmisi virus secara vertikal ialah b) Anak
melalui: c) Dewasa muda
a) Transfusi d) Wanita
b) Hubungan seksual e) Lanjut usia
c) Intrauterin 9. Faktor Iuar yang mempengaruhi kepuasan terhadap pela-
d) Jarum suntik yanan kesehatan:
e) Makanan/minuman a) Status pernikahan
5. Ikterus pada kehamilan dapat menyebabkan: b) Kehidupan di masyarakat
a) Hiperemesis gravidarum c) Status pekerjaan
b) Ekiamsi d) Tempat tinggal
c) Prematuritas e) Kemudahan dicapai
d) Batu empedu

5. C
9. B 4. C
8. C 3. A
7. C 2. C
6. B 1. C JAWABAN RPPIK :

64 Cermin Dunia Kedokteran No. 110, 1996