Anda di halaman 1dari 54

SOAL BIOMEDIK 1 prophylaX1s ANATOMI 1.Bidang yang membagi tubuh menjadi bagian ventral dan dorsal adalah a.

bidang mediana b. bidang sagital c. bidang frontal d. bidang transversal e. bidang horizontal

2.Termasuk skeleton appendiculare... a. Os scapula b. Os sacrum c. Os sternum d. Os coccygeus e. Os costae

3. Jaringan ikat yang berbentuk tali yang melekatkan otot pada tulang disebut a.Tendon b.Aponeurosis c.Bursa mucosa d.Ligamentum e.Fascia

4. Membentuk os coxae kecuali A.Os illium b.Os ischium c.Os pubis d.Os sacrum

5.Pelvis dibentuk oleh kecuali.. a. Os coxae b. Os sacrum c. Os coccygeus d. Os femur

6.merupakan costa vera: a. Costa VII b. Costa VIII c. Costa IX d. Costa X e. Costa XI

7.Pemberian nama otot berdasarkan fungsinya a. M. Deltoideus b. M. Tibialis anterior c. M. trapezius d. M. levatorscapulae e. M. Biceps brachii

8. Membentuk art. Genu adalah a. Os Coxae b. Os Tibia c. Os Fibula d. Os Sacrum e. Os coccygeus

9. Membentuk art humeri a.Os ulna b.Os radius c Os scapula. d. Os clavicula e. Os sternum

10. Berhubungan dengan sternum: a. vertebrae cervicalis b. vertebrae toracalis c. Os clavucula d. Os scapula e. Os Humerus

11. Merupakan articulatio exkremitas atas kecuali a. art. Sternoclavicularis b. art. Acromioclavicularis c. art. Humeri d. art. Cubiti e. art metatarsalphalangeus

12. Tulang yang membentuk basis cranii a. Os ethmoidale b. Os mandibulae c. Os femur d. Os Maxilla e. Os lacrimale

13. Yang termasuk Os brevis a. Os Phalangs b. Os patella c. Os metacarpal d. Os Talus e. Os vertebrae

14. otot anthebrachium bagian dorsal adalah a. M. pronator teres b. M. supinator c. M. anconeus d. M. brachioradialis e. M. Palmaris longus

15.Otot flexor pada brachium adalah a. M. Triceps brachialis b. M brachialis c. M. Teres major d. M. coracobrachialis e. M. deltoideus

16. Otot region femoris yg terletak pd bagian lateral adalah a. M. tensorfascialatae b. M. gracilis c. M. Semitendinosus d. M. Semimembranosus e. M. Biceps femoralis caput brevis

17. Otot cruris yg melekat pd tubercalcanei adalah a. M. Soleus b. M. tibialis anterior c. M. d. M. e. M. brevis longus

18. articulatio humeri secara morfologi termasuk type... a. art. troclearis b. art. throcoedea c. art. globoidea d art. ciondyloidea e. art celaris

19. art cubiti dibentuk oleh a. art humroradialis dan art radioulnarisdistalis b. art. Humeroulnaris dan art radioulnaris distalis c. art humeroulnaris, art humeroradialis, dan radioulnaris proximalis d. art. Radioulnaris proximalis dan art. Radioulnaris distalis e. art radioulnaris distalis

20 N. musculocutaneus motorik untuk a. M. triceps brachii b. M. supinator c. M. Unconeus d. M. Extensor digitorum communis e. M. Biceps brachii

21. Vena superficial pada sisi ventrolateral ekxkremitas superior adalah a. V. Brachiallis b. V. Radialis c. V. Basilica d. V. Cepalica e, V. Ulnaris

22. Yang termasuk ligamen intrinsik adalah a. lig colateraletibiale b. lig. Teres capiti c. lig illiofemoralis d. lig glenohumerale e. lig. Colateralefibula

23. Otot antebrachium yang berlanjut sampai ke manus adalah a. M. Pronator teres b/ M. Supinator c. m. Anconeus

d. M. Brachioradialis e. M. Palmaris longus

24. Otot cruris yang ke dorsumpedis adalah a. M. Soleus b. M. Tibialis anterior c. M. Peroneuslongus d. M.popliteus e. m. Flexor hatucislongum

25. suatu sendi diarthrosis mempunyai cavum articularis, karenanya itu terdapat a. capsula articularis b. ligamentum c. discus articularis d. bursa sinovial e. sinovial sheet

26. pada mediastinum superior terdapat a. V. Subclavia sinister b. V. Hemiaszygos c. arteri subclavia desttra d. aorta decendens e. V. Anonyma dextra

27. Pada ventrikel dexter terdapat a. Valvula semilunaris aorta b. M. Pectinati c. M. Papillaris d. Valvula vena cava inferior e. Valvula mitralis

28.Ligamentum arteriosum botalli menghubungkan a. aorta ascendens dengan R. Sinistra arteri pulmonalis b. arcus aorta dan R. Dexter a. Pulmonalis c. arcus aorta dan R. Sinister a. Pulmonalis d. aorta decendens dengan R. Sinister a. Pulmonalis e. aorta ascendens dengan R. Dexter a. Pulmonalis

29. Vena azygos terkait dengan a. berasal dari vena lumbalis ascendens dexter b. melalui heatus esopagus c. Berjalan di dalam mediastinum anterior d. bermuara ke dalam vena cava inferior e. Menerima darah dari vena lumbalis ascendens sinistra

30. Vena cava superior dibentuk oleh persatuan a. V. Subclavia dgn V. Jugularis interna b. V. Cepalica dextra et sinistra c. V. Anonima dextra et sinistra

d. V. Azygos dan V. Azygoss e. V. Jugularis interna dan V. Jugularis eksterna

31. Hemiazygos bermuara ke dalam a. V. Cava superior b. V. Cava inferior c. V. Hemiazygos accesories d. V. Azygos e. V. Lumbalis ascendens sinister

32. Seorang pasien 54 tahun dibawah ke RS dgn nyeri dada hebat pd pemeriksaan fisis teraba pulsasi________________halus pd intercosta V kiri tepatnya pd linea medioclavicularis. Pulsasi ini berasal dari a. atrium sinistra b. atrium dextra c. valvula mitralis d. arcus aorta e. apex cordis

33. apertura toracalis superior dibatasi oleh a. Proc. Spinosus vertebrae toracalis X b. Angulus sternalis c. Costa X d. Spina scapulae e. arcus costarum

34.Pada atrium sinister terdapat a. M. Pectinati b. Fossa ovalis c. Valvula vena cava inferior d. valvula vena cava superior e. valvula sinus coronaries

35. seorang wanita 50 tahun masuk ke RS dgn edema pada kedua tungkainya. Pada pemeriksaan ultratopografi nampak kelainan pada valvula tricuspidalis. Area yg akan mengalami regorgitasi darah adalah a. Truncus pulmonalis b. Atrium sinistra c. aorta ascendens d. atrium deextra e. ventrikel dextra

36. apex cordis: a. merupakan bagian ventrikulus dexter b. arahnya cauda ventral dexter c. terletak pada intercostalis space V dextra d. letaknya 2 jari sebelah medial linea axillaris e. letaknya 2 jari sebelah medial linea medio clavicularis sinister

37. tulang yg membentuk dasar cavum nasi adalah a. Os nasal b. Os frontal

c. Os Sphenoydale d. Lamina cribriformis e. Proc. Palatina osis maxillaris

38. Tulang yg membentuk atap cavum nasi bagian posterior adalah a. Os nasal b. Os frontal c. Os ethmoydale d. Os sphenoidale e. Os maxilla

39. Plica vocalis berada pada a. cavum oris b. cavum nasi c. pharyngs d. laryngs e. bronkus

40. struktur yg terdapat pd meatus nasi medius: a. Heatus maxillaris b. Recessus spenopalatina c. Ductus naso lacrimalis d. septum nasi e. cellula ethmoidales

41. Vascularisasi cavum nasi diperoleh dari a. arteri lingualis b. arteri temporalis superficialis c. arteri spenopalatina d. arteri thyroidea superior e. arteri pharyngea ascendens

42. otot laryngs yg berperan untuk depresi adalah a. A. geniohioideus b. M. stylopharingeus c. M. salphingopharyngeus d. M. Palatopharungeus e. M. sternothyrohideus

43. otot intrinsic yg diinnervasi oleh Nervus Recurens laryngeus adalah a. M. cricotyroideus b. M. cricoarytenoideus c. M. tyroaritenoideus d. M. Vocalis e. M. Thyroepigglotis

44. vascularisasi bronchus diperoleh dari a. Pharyngea ascendens b. A. thyroidea superior c. A. thyroidea inferior

d. A. Mammaria interna e. A. Intercostalis

45. Trachea merupakan lanjutan dari A. oesopagus b. pharyngs c. laryng d, pulmo e. bronchus

46. vascularisasi pulmo diperoleh dari a. A. pharyngea asceendens b. A. Intercostalis c. A. Bronchialis d. A. Subclavia e. A. Axillaris

47. Heatus aorticus menembus diafraghma pd level a. vertebrae thoracalis IV b. vertebrae thoracalis VI c. vertebrae thoracalis VIII d. vertebrae thoracalis X e. vertebrae thoracalis XII

48. Innervasi pleura diperoleh dari

a. Nervus phrenicus b. Nervus intercostalis c. N. Subcostalis d. N. Laryngeus e. N. Suprascapularis

49. Struktur yg berhubungan dengan cavum nasi a. Pharyng b. Laryng c. oesopagus d. Broncus e. trachea

50. Membentuk laryngs kecuali a. cartilago thyroidea b. cartilage crycoidea c. cartilago arytenoidea d. cartilago articularis e. cartilago epigglotica

HISTOLOGI

1. lapisan epitel berlapis gepeng bertanduk yang paling tebal adalah a. stratum basale b. stratum spinosum c. stratum granulosum d. stratum lusidium e. stratum korneum

2. epitel selapis kubis dapat dijumpai pada : a. serviks uteri b. plexus koroideus c. ductus epididymis d. gaster e. usus

3. stratum spinosum pada epitel berlapis gepeng terdiri dari sel : a. sel kuboid b. sel gepeng c. sel torak d. sel silia e, sel goblet

4. berdasarkan pars terminalisnya kelenjar endokrin terbagi atas : a. simpleks

b. tubuler c. kompleks d. holokrin e. merokrin

5. epitel selapis silindris bersel goblet dapat ditemukan pada : a. saluran pencernaan b. saluran genitalis c. saluran napas atas d. saluran napas bawah e. saluran kemih

6. epitel yang merupakan gabungan dari sel silindris bersilia, sel goblet dan sel basal disebut dengan : a. epitel berlapis b. epitel gabungan c. epitel selapis d. epitel bertingkat e. epitel berlapis silindris

7. pernyataan yang benar mengenai kelenjar merokrin adalah : a. merupakan kelenjar eksokrin yang paling sedikit jumlahnya b. sekret banyak mengandung lemak yang disebut dengan sebum c. sekret dihasilkan dengan mengorbankan bagian apikal sel d. sebagai contohnya adalah kelenjar sebasea e. sekret dilepas melalui cara eksositosis

8. lapisan epitel berlapis gepeng yang peling tebal adalah : a. str. Basale b. str. Spinosum c. str. Granulosum d. str. Lusidium e. str. Korneum

9. hal dibawah ini dapat ditemui pada sekratory obsorptive simple collumnae epitelium kecuali : a. epitel selapis torak b. usus c. silia d. sel goblet e. mikrofili

10. yang tidak merupakan sifat dari lamina lusida membran basalis adalah : a. terletak di tengah b. glikoprotein c. di atas lamina densa d. serat kolagen tipe IV e. lamina rara eksterna

11. hal di bawah ini yang tidak berkaitan dengan struktur lien adalah : a. a. Sentralis b. sel T terkumpul di TALS

c. noduli limfatisi tersebar rata pada korteks/medula d. medula ricord pada medula e. pulpa alba ada sel T dan D

12. Sinus marginalis lien terdapat pada

1. 2. 3. 4. 5.

Di bwah kapsula b. Di samping trabekel Di dalam medula Di dalam pulpa alba Di dalam nodule limfhatikus

13. Tanda khas limfhonodus

1. 2. 3. 4. 5.

Hasals body Artei centralis Corpus malphigi d. Medullary cord Stigma malphigi

14. Tanda khas limpa

1. 2. 3. 4. 5.

Nodulus limfhatikus Pulpa alba Capsula fibrosa d. Artei centralis Crypte

15. Tanda khas thymus

1. 2. 3. 4. 5.

Trabekel Corpus malphigi Medullary cords d. Hasals body Pulpa Alba

16. Komponen krondoitin pada jaringan penyambung dijumpai pada

1. 2. 3. 4. 5.

a. Tulang Kulit Jantung Kornea Tali pusat

17. intermediate filamens yang terdapat pada sel fibroblast adalah

1. 2. 3. 4. 5.

Filamen glia Neurofilamen Filamen desmin Filamen vinetin Tonofilamen

18. pewarnaan khusus serat kolagen

1. 2. 3. 4. 5.

a. Mansson trikom OsO4 Weigert Pas (+) Biru toludin

19. sering menjadi tempat berlangsungnya peradangan pada

1. 2. 3. 4. 5.

a. Jar. Ikat longgar Jar. Ikat gelatinosa Jar. Ikat kolagen Jar. Ikat retikuler Jaringan lemak

20. struktur yang terletak diantara pemburuh darah plasenta

1. 2. 3. 4. 5.

Jar. Ikat longgar b. Jar. Ikat gelatinosa Jar. Ikat kolagen Jar. Ikat retikuler Jar ikat elastis

21. osteon primitif adalah

1. 2. 3. 4. 5.

Sistim haver pada tulang pipih Sistim haver pada tulang panjang Lamel-lamel bentuk triangular Lamel pada periosteum Lamel tulang spongiosa

22. serat kolagen yang paling dominan pada tulang rawan adalah

1. 2. 3. 4. 5.

Serat kolagen tipe I b. Serat kolagen tipe II Serat kolagen tipe III Serat kolagen tipe IV Semua salah

23. yang tidak berkaitan dengan osifikasi enkondral adalah

1. 2. 3. 4. 5.

Terjadi dalam suatu model tulang rawan Hipertrofi dan destruksi kondrosit c. Pada tulang pipih Mulai dengan tulang immature Terbentuk tunas osteogenik

24. Yang menghasilkan sel-sel kondroblas muda pada tulang rawan hyaline adalah

1. 2. 3. 4. 5.

Lakuna Serat kolagen Serat elastis d. Perikondrium Sel isogen

25. Yang membedakan tulang rawan hyaline dan elastis adalah pada elastis di temukan lebih banyak

1. 2. 3. 4. 5.

Lakuna Serat kolagen c. Serat elastis Perikondrium Sel isogen

26. otot polos ditemui pada

1. 2. 3. 4. 5.

Telinga Hidung Telapak tangan d. Kelenjar prostat Lutut

27. yang membentuk sarcoplasma pada jaringan otot adalah

1. 2. 3. 4. 5.

Apparatus golgi Mitokondria c. RE Mikrotubulus Lisosom

28. yang tidak sesuai dengan otot jantung

1. 2. 3. 4. 5.

Diskus interkalaris b. Tubulus T Inti ditengah Pigmen fichosianin Sarkomer sama otot polos

29. Otot skelet pada potongan memanjang terlihat inti

1. 2. 3. 4. 5.

a. Bawah sarkolemma Pada sarkolemma Samping sarkolemma Atas sarkolemma Dalam sarkolemma

30. yang tidak termasuk makromolekul serat otot rangka terdiri di bawah ini

1. 2. 3. 4. 5.

Aktin Myosin Troponin d. Desmin Tropomiosin

31 proses kromatolisis pada trauma saraf menyebabkan hilangnya

1. 2. 3. 4. 5.

Neurofilamen b. Ribosom Apparatus golgi Mikrotubuli Lisosom

32. sel ependym termasuk epitel

1. 2. 3. 4. 5.

Epitel selapis torak Epitel berlapis torak c. Epitel berlapis kubis (hrsnya selapis) Epitel bertingkat Epitel peralihan

33. sel saraf yang termasuk tipe Golgi I adalah

1. 2. 3. 4. 5.

Sel purkinye Mikroglia c. Sel motorik Astrosit Sel renshaw

34. yang termasuk dengan giant piramidal cell dari cortex cerebri

1. 2. 3. 4. 5.

Sel purkinye Sel betz Sel Sel martinotti Sel ependym

35. Neuroglia yang tersebar luas pada substansia alba dan glisea yang ada hubungannya dengan monosit adalah: a. Astrosit b. mikroglia c. sel piramidal d. sel ependym oligodendroglia

36. Tempat kontak antara akson dan perikaryon disebut: a. aksoplasma b. aksolema c. kolateral d. akson hillok e. sinapsis

37. Trauma akson menyebabkan menghilangnya substansi nissl disebut: a. regenerasi nissl b. regenerasi c. denegerasi nissl d. chromatolysis e. chromatogenesis

38. Neuron pseudounipoler terdapat pada: a. korteks serebri b. ganglion autonom c. cornu anterior medula spinalis

d. ganglion spinalis e. ganglion vestibularis

39. sinapsis yang terbanyak terdapat dalam tubuh adalah: a. akso-somatis b. akso-dendrit c. akso-aksonik d. dendro-dendritik e. akso-spinous

40. reseptor untuk rasa panas, dingin dan sakit adalah: a. badan meissner b. vater paccini c. ujung saraf bebas d. badan krause e. badan merkel

41. yang tidak termasuk mikroskop cahaya adalah: a. mikroskop lapangan terang b. mikroskop kontras interferensi diferensial c. mikroskop polarisasi d. mikroskop fluoresensi e. mikroskop fase kontras

42. Sel dapat berkontraksi oleh karena adanya: a. lisosom b. tonofilamen c. mikrotubulus d. mikrofilamen e. sentriol

43. Hal di bawah ini adalah yang bukan prinsip dasar histokimia adalah: a. zat yang dianalisa tidak boleh berdifusi keluar b. metode harus spesifik c. harus terjadi penghamburan elektron d. reaksi harus berwarna e. hasil tidak boleh larut

44. Sintesa membran sel terjadi pada: a. mitokondria b. lisosom c. apparatus golgi d. ribosom e. Ret. Endoplasma

45. Yang tidak termasuk fungsi mitokondria: a. mekanisme detoksifikasi b. sintesa ATP dari asam sitrat c. membantu biosnitesa steroid

d. membantu oksidasi asam lemak e. membantu sintesa asam nukleat

46. Yang tidak berkaitan dengan RE kasar adalah: a. riboforin b. basofil c. melepaskan ion Ca2+ d. ribosom e.

47. Yang tidak termasuk struktur apparatus golgi: a. bentuk lamel b. hanya punya permukaan c. permukaan matur d. hasilkan prohormon e. transpor sekresi sel

48. Organel di bawah ini yang merupakan sumber energi untuk sel adalah: A. RE kasar b. RE halus c. lisosom d. apparatus golgi e. mitokondria

49. Perubahan yang pertama terjadi pada sel yang hendak bermitosis adalah:

a. Hilangnya membran inti b. kromosom berpasangan c. nukleolus hilang d. sentriol membelah e. mikrotubulus membelah

50. Yang tidak sesuai untuk membrana basalis: a. tempat epitel melekat b. serat kolagen tipe IV c. desmosom d. fibronektin e. barrier selektif

BIOKIMIA

1. yang tidak termasuk unsure kimia yang penting bagi kehidupan manusia dan dapat membentuk ikatan yang stabil adalah a. nitrogen b. oksigen c. magnesium d. hidrogen e. sulfur

2. gugus fungsional yang aktif dalam berbagai reaksi kimia adalah a. thiol b. aldehid c. keton d. hidroksil e. alkohol

3. asam amino dibedakan satu sama lain berdasarkan a. rantai sampingnya b. rantai H nya c. gugus karboksil d. gugus amina e. gugus karboksil dan aminanya

4. pembentukan glikogen tergantung dari salah satu ikatannya antara lain a. ikatan hidrogen

b. ikatan glikosidik c. ikatan hidroksil d. ikatan fosfodiester e. ikatan sulfhidril

5. dipeptida terbentuk oleh ikatan di bawah ini a. ikatan hidrogen b. ikatan glikosidik c. ikatan hidroksil d. ikatan fosfodiester e. ikatan peptida

6. yang termasuk penyusun tulang punggung atau back bone RNA adalah a. urasil dan adenin b. purin dan pirimidin c. ribosa dan fosfat d. deoksiribosa dan fosfat e. nukleosida dan fosfat

7. gugus fungsi yang dapat ditemukan pada biomolekul karbohidrat adalah a. aldehid, amin, karboksilat b. aldehid, keton, ester c. hidroksil, aldehid, keton d. hidroksil, keton, karboksilat e. karboksilat, eter, ester

8. pasangan biomolekul dan jenis ikatan kovalen pembentuk ikatan antar monomernya adalah a. polisakarida-ikatan ester b. polisakarida-ikatan peptida c. lipid-ikatan glikosida d. protein-ikata disulfida e. polinukleotida-ikatan fosfodiester

9. protein dalam bentuk folding (native) dapat terdenaturasi oleh a. tekanan atmosfir normal b. suhu tinggi c. suhu rendah d. pelarut air e. pelarut alkohol

10. berikut ini adalah asam amino pembentuk inti protein (tidak terekspose dengan pelarut) yang berasosiasi melalui interaksi hidrofobik kecuali a. phenilalanin b. aspartat c. tyrosine d. alanine e. valina

11. karbohidrat diserap di darah dalam bentuk a. galaktosa b. fruktosa

c. glukosa d. maltosa e. mannosa

12. laktosa dihidrolisis menghasilkan a. glukosa dan fruktosa b. glukosa dan ribosa c. glukosa dan ribosa d. glukosa dan glukosa e. glukosa dan galaktosa

13. polisakarida yang merupakan simpanan energi jangka pendek adalah a. kitin b. selulosa c. pati d. glikogen e. inulin

14. karbohidrat yang tidak biasa ditemukan pada suatu glikoprotein adalah a. mannosa b. galaktosa c. arabinosa d. fruktosa e. silosa

15. penyakit yang tidak berhubungan dengan metabolisme karbohidrat adalah a. DM b. galaktosemia c. PJK d. glikogen storage disease e. intoleransi laktosa

16. yang merupakan salah satu fungsi lipid dalam tubuh adalah a. sumber energi utama b. insulator termal c. sumber vitamin B kompleks dan C d. pembawa sifat e. simpanan energi jangka pendek

17. yang termasuk asam lemak eikosanoid antara lain a. lipoprotein b. fosfolipid c. prostaglandin d. kolesterol e. glikolipid

18. vitamin larut lemak yang berfungsi sebagai antioksidan adalah a. vit. C b. vit. D c. vit. K

d. vit. B e. vit. E

19. gugus gula dalam suatu nukleotida terhubung dengan suatu basa purin atau pirimidin melalui ikatan a. ikatan N-glikosidik b. jembatan disulfida c. ikatan sulfhidril d. ikatan hidrogen e. ikatan hidroksil

20. jika kandungan komponen GC dalam suatu molekul DNA adalah 56%, maka persentase kandungan basa timin adalah a. 56% b. 28% c. 44% d. 22% e. tidak dapat dihitung

21. protein replikasi DNA diawali dengan pemisahan rantai ganda DNA menjadi 2 rantai tunggal oleh enzim : a. ligase b. DNA polimerasi 1 c. DNA polimerasi III d. RNA polimerase e. helicase

22. berikut ini adalah suatu segmen rantai DNA Segmen atas 5 ... ATTCGTACGATTAGATCCTAGGATACGATA ... 3 Segman bawah 3 ... TAAGCATGCTAATCTAGGATCCTATGCTAT ... 5 Jika proses replikasi berjalan dari kiri ke kanan, maka pernyataan berikut manakah yang paling tepat menggambarkan proses replikasi segmen di atas a.yang merupakan template untuk reading strand adalah pada rantai segmen bawah b. yang merupakan template untuk logging strand adalah pada rantai segmen atas c. fargmen okazaki akan terdapat pada segmen bawah d. DNA polimerase I akan bekerja mengisi kekurangan e. hanya akan pada segmen bawah

23. dATP adalah suatu nukleotida trifosfat yg mengandung a. Guanin b. adenin c. ribosa d. sulfat e. dua posfat 24. Molekul pembawa signal (hormon) di bawah ini yg diturunkan dari asam amino tirosin adalah a. histamine b. epinefrin c. insulin d. glukagon e. tirotrofin

25. Protein brikut in yg germasuk dalam klompok protein struktural adalah a. aktin b. mioglobin c. keratin d. lipoprotein e. protrombin

26. Pernyataan yg benar mengenai protein globular brkut ini adalah a. elastin b. terutama merupakan protein struktural c, strukturnya menyerupai benang (THREADLICE) d. Kebanyakan bersifat larut air e. Protein utama matriks ekstraseluler 27. Seorang laki-laki 27 tahun di bawa ke Rs dalam keadaan mengalami perdarahan hebat di daerah kepala akibat kecelakaan lalu lintas 30 sevelumnya. Setelah mendapat penanganan kegawatdaruratan dilakukan pemeriksaan laboratorium yg menunjukkan kadar hemoglobin 5 gr/di. Hasil ini menunjukkan pasien harus memperoleh transfusi darah segera. Secara fungsional termasuk ke dalam klompok manakah protein yg disebutkan pd kasus di atas? a. katalis b. transpor c. kontraktif d. struktural e. pembawa sinyal

28. Seorang anak 7 tahun di bawah oleh ibunya ke puskesmas dengan keluhan utama perut membesar dan pembengkakan pada wajah dan punggung kaki. Sementara badan anak scra keseluruhan tampak kurus. Setelah melakukan dan menanyakan scr rinci ttg terjadinya keadaan tsbt di atas. Kpd ibu pasien dan mlakukan pemeriksaan fisis yg teliti. Dokter berkesimpulan anak ini menderita busung lapar (kwarsiorkor) Protein apa yg paling mungkin, menyebabkan terjadinya pembengkakan pd aksus di atas? a. miosin b. kolagen c. albumin d. fibrinogen e. imunoglobulin

29. contoh sindroon errors of metabolisme akibat mutasi adalah pd sintesis enzim A. GALAKTOSEMIA b. infark myocard c. Hepatitis d. Pankreatitis e. karsinoma metastatis

30. enzim yg termasuk kls 2 sistem R;B adalah kelas a. isomerase b. Oksidoreduktase c. transferase d. ligase e. liase

31. faktor molekul kecil tambahan yg diperlukan oleh enzim untuk aktifitas katalitisnya disebut

a. aponzim b. koenzim c. hoenzim d. proenzim e. holoenzim

32. Vitamin yg merupakan bagian penting dari enzim untuk oksidasi biologis: a. niasin b. tiamin c. peridoksin d. ribofanin e. asam pantotenat

33. contoh enzim intraselular sejati: a. SGOT b. amylase c. pseoudokolin esterase d. proenzim penjendelan darah e. lipase

34. pernyataan yg benar mengenai gambar di bawah ini adalah: a delesi b. insersi c. transisi d. missense mutation pada kodon ke 37

e. termasuk ke dlm large scale mutation

35. Pernyataan yg benar mengenai mutasi yg terjadi pada Sickle Cell anemia: a. Mutasi terjadi pada gen yg mengkode rantai a-globin dari molekul Hb b. Pada kelainan genetic ini eritrosit tetap memiliki morfologi yg normal c. terjadi perubahan dari asam amino proiin menjadi valin d. merupakan poin mutation e. terjadinya nonsense mutation

36. perhhatikan gambar di atas ! mekanisme perbaikan urutan DNA yang ditunjukkan gambar di atas adalah a. miss macth repair b. repurination repair c. base exicion repair d. nucleotide exicion repair e. double strand break repair

37. siklus PCR terdiri dari 3 tahapan pertama. Urutannya adalah a. estensi-annealing (denaturasi) b. denaturasi-ekstensi-annealing c. denaturasi-annealing-ekstensi d. annealing-ekstensi-denaturasi e. ekstensi-denaturasi-annealing

38. seorang laki-laki tanpa identitas ditemukan meninggal dunia.

Dari 3 org yang mengaku sebagai keluarga korban (a,b,c,dan f adalah korban). Manakah diantaranya yang paling mungkin adalah adik korban a.A b. B c. C d. A dan C e. B dan C

39. lipid utama pembentuk jaringan ganda model mosaik cair membran adalah a. glikolipid b. sulfolipid c. fosfolipid d. lipoprotein e. sfingolipid

40. transpor molekul yang melawan gradien konsentrasi yang memerlukan energi disebut a. transpor pasif b. transpor aktif c. eksositosis d. endositosis e. simpor

41. matriks ekstraseluler yang terganggu pada keadaan osteoporosis maupun scurvy adalah a. elastis b. fibrilin c. entaktin

d. kolagen e. fibronektin

42. matriks ekstraseluler yang bertanggung jawab terhadap fleksibilitas pembuluh darah maupun turgor kulit adalah a. elastis b. fibrilin c. entaktin d. kolagen e. fibronektin

43. proteoglikan yang berfungsi sebagai antikoagulen adalah a. keratan sulfat b. dermatan sulfat c. kondroitin sulfat d. heparin e. asam

44. bagian sel yang berfungsi dalam komunikasi antar sel adalah a. mitokondria b. membran sel c. ribosom d. aparatus golgi e. nukleus

45. molekul sinyal terdiri dari, kecuali

a. autokrin b. parakrin c. endokrin d. endokrin e. vitamin

46. mediator sinyal pada hormon adalah a. darah b. membran c. celah sinagis d. ekstraseluler e.

47. transmisi listrik yang dibawa oleh neurotransmitter melalui neuron merangsang terjadinya gelombang dalam a. kalium b. natrium c. magnesium

d. kalsium e. Uranium

48. senyawa biologis yang tidak penting yang diklasifikasikan sebagai senyawa berenergi tinggi : a. UDP-glue b. Pi

c. S-adenosin metionin d. acyl carrier metionin e. KoA

49. yang memainkan peran sentral di dalam penangkapan dan transfer energi adalah a. sulfat b. fosfat c. Pi d. ~ p e. kalsium

50. yang bukan merupakan sumber ~ p dalam konservasi energi a. fosforilasi oksidatif b. glikolisis c. siklus asam sitrat d. AMP Shunt e. siklus Krebs

FAAL 1. Apa yang membedakan gelombang mekanik dengan gelombang elektromagnetik? a. Bentuk gelombang b. Arah penyebaran gelombang c. Zat medium perantara d. Amplitudo e. Frekuensi 1. Jika membran timpani telinga kiri dan kanan seseorang robek apakah tulang pendengaran nya msih dapat bergetar?? a. dapat bergetar b. tidak dapat bergetar c. tidak dapat ditentukan d. tergantung besar robekan e. tidak mungkin bergetar 1. Apakah fungsi organ corti?? a. Meningkatkan energi bunyi yg msuk ke liang telinga b. menyalurkan bunyi dri telinga tengah ke telinag dalam c. menyeimbangkan frekuensi telinga kanan dan kiri d. mengubah bunyi yg diterima menjadi sinyal listrik e. mengartikan bunyi yg diterima sbg persepsi 1. apakah bagian tubuh yg menfokuskan bunyi ke dalam telibga?? a. saculus b. c. tuba eustachius d. auricula e. stapes

1. Manakah di antara alat-alat berikut ini yg memanfaatkan prinsip gelombang mekanik?? a. b. stetoskop c. d. histeroskop e. esofagoskop 1. Apa tujuan menaikkan tungkai pada orang yg tidak sadar?? a.Agar tungkai nya dapat beristirahat shg cepat sadar b. agar darah mengalirlbh cepat ke tungkai nya c.agar otot punggung dapat berelaksasi dan tidak nyeri d. agar darah lbh banya mengalir ke kepala e. agar tekanan darah di sepanjang lengan berkurang 1. G- suit adalah sebuah alat yang digunakan pada pesawat tempur agar a. lebih mudah menentukan titik gravitasi b. tidak pingsan saat melakukan manuver tajam c. gaya gesekan antara udara dan pesawat berkurang d. dapat mengetahui arah gaya gravitasi pesawat e. dapat mengetahui titik gravitasi pilot dan pesawat 1. posisi terbaik saat mengangkat benda berat adalah a. sambil merentangkan lengan jau2 dari badan b. sambil merapatkan benda yang diangkat ke badan c. sambil meluruskan punggung seperti huruf . d. sambil merapatkan tungkai sedekat mungkin e. sambil menahan benda di atas sebelah bahu

1. pada sistem rangka yang menjadi titik kuasa pada saat menggerakkan anggota badan tertentu adalah a. origo otot b. tendo otot c. fascia otot d. serabut otot e. insersio otot 1. pasien yang karena penyakitnya terpaksa berbaring diam tidak bergerak dala jangka waktu yang lama beresiko terkena penyakit ulkus de kubitus. Ulkus de kubitus terjadi karena gaya berat pasien yang berlaku sebagai aksi mendapat reaksi berupa a. gaya tekan berkepanjangan dari ranjang b. gaya gravitasi yang statis pada ranjang c. gaya otot yang diam tidak bergerak d. gaya gesek roda ranjang pada lantai e. gaya gesek lantai pada roda ranjang 1. potensial membran sel istirahat nilainya adalah a. positif b. nol c. negatif d. variatif e. mutlak 1. listrik yang mengalir dalam tubuh manusia melalui a. konduksi jaringan saraf b. kontraksi jaringan otot c. relaksasi jaringan otot d. insersi jaringan otot e. kontraksi jaringan saraf

1. timbulnya potensial aksi pada satu sel mengikuti hukum 1. kekekalan massa 2. kekekalan energy 3. pascal 4. laplace 5. e. all or none 2. energy listrik yang timbul dalam tubuh manusia salah satunya disebabkan masuknya ion tertentu dalam sel. Ion yang paling berperan dalam menimbulkan listrik dalam jaringan saraf adalah 1. Mg2+ 2. Ca2+ 3. N+ 4. d. Na+ 5. So423. metode yang dapat mengukur aktifitas listrik jantung disebut 1. ekokardiografi 2. elektro 3. c. elektrokardiografi 4. elektrosevalografi 5. elektronistagmografi 4. jika seseorang menderita penyakit yang meyebabakan radius arteri poplitea menjadi 1/3 radius normal maka aliran darah di sebelah distal arteri polplitea menjadi 1. 9x lebih besar 2. 9x lebih kecil 3. 27x lebih kecil 4. 81x lebih besar 5. e. 81x lebih kecil 5. Alveolus2 manusia normal pada radius terkecilnya membentuk 1. Bola 2. Lingkaran 3. Irregular 4. Segi enam 5. Kubah 6. Rumus laplace yang menyatakan P=2T/r menyatakn bahwa semakin kecil radius maka tekanan ke dalam semakin besar. Alveolus normal yang peling kecil radiusnya tidak kolaps karena adanya cairan 1. Saliva 2. Pleura 3. Mucus 4. d. Surfactant 5. Pericardium 7. Policitermia adalah kedaan abnormal (tidak jelas) 1. Naik 2. b. Turun 3. Fluktuatif 4. Tidak tentu 5. berhenti 8. edema intertisiel adalah keadaan abnormal yang menyebabkan jarak antra dinding kapiler dengan sel2 dalam jaringan makin melebar. Jika dikaitkan dengan rumus yang

menghubungkan kecepatan difusi gas dgn ketebalan membrane, maka edema intertisiel menyebabkan kecepatan difusi oksigen dari kapiler ke jaringan menjadi 1. tidak tentu 2. fluktuatif 3. berhenti 4. d. turun 5. naik hari, seorang pria berumur 21 tahun adalah salah seorang korban selamat dari keclakaan kapal motor. Ia akhirnya berhasil dievakuasi setelah sekitar 2 hari mengapung2 di laut cina selatan. Ia mengaku banyak meminum air laut selama mengapung tersebut. Pemeriksaan laboratorium menunjukkan kadar ion natrium dalam darahnya meningkat hingga di atas noramal. 1. Di manakah di bawah ini merupakan kondisi cairan tubuh sekarang 1. Hipotonis 2. Mikrotonis 3. c. Hipertonis 4. Isotonis 5. Retrotonis 2. Apakah aktifitas listrik yang terjadi di dalam sel ketika ion tersebut masuk ked ala sel 1. Repolarisasi 2. b. Depolarisasi 3. Hiperpolarisasi 4. Isopolarisasi 5. Makropolarisasi 3. Bagaimana cara ion tersebut masuk jke dala sel 1. Difusi sederhana 2. Difusi terfasilitasi 3. Difusi symport 4. Difusi uniport 5. Difusi antiport 4. Agus, seorang anak laki2 berumur 8 tahun, berat badan 15 kg, tinggi 107cm. dia ditemukan pada suatu skrining gizi buruk yang dilakukan oleh sakah satu puskesmas di kota Makassar. Di perutnya terlihat adanya akumulasi cairan. Apakah hal yang paling mungkin menyebabkan kasu d atas? 1. Peningkatan tekanan hidrostatik plasma 2. Penurunan tekanan onkotik intertisiel 3. Penigkatan tekanan hidrostatik intertisiel 4. d. Penurunan tekanan onkotik plasma 5. Peningkatan tekanan aliran limfatik 5. Seorang laki2 berusia 25 tahun berat badan 70kg, tinggi bada 181cm. berapakah jumlah cairan plasma yang ia miliki 1. 2,5 kg 2. 3,5 kg 3. 4,5 kg 4. 5,5 kg 5. 6,5 kg

26. apakah usaha yang dilakukan oleh tubuh Anggi untuk mengatasi rendahnya tekanan udara tersebut? 1. Hipoventilasi d. reventilasi 2. Isopentilasi e. Hiperventilasi 3. Retro ventilasi 27. system buffer kimiawi apakah yang paling berperan dalam kasus ini? 1. Bikarbonat d. Fospat 2. Protein e. Hemoglobin 3. Amonia 28. adapun system buffer yang paling berperan di ginjal pada keadaan ini adalah: 1. Bikarbonat d. fosfat 2. Protein e.hemoglobin 3. Ammonia Seorg pasien wanita usia diperkirakan 21 thn dibawa ke instalansi gwat darurat oleh teman kosnya. Menururt pngakuan tmannya itu pasien d temukan dlm keadaan tidak sdarkan diri d kamarnya . pasien d knal sbg pecandu obat obat terlarang. Dlm pemeriksaan fisik d temuakan bahwa smua tanda vital msih dalam batas normal kecuali laju prnapasan 29. organ tubuh manakah yang mengkompensasi kasus di atas? a. otak d. paru2 b. hati e. ginjal c. jantung 30. apakah kompensasi tubuh untuk menganggulangi kasus di atas a. absorbs H+ d. eksresi ion bikarbonat b. ekskresi NH4 e. eksresi CO2 c. absorbs NaH2PO4 31. seorang wanita usia 50 tahun dating dgn keluhan benjolan di leher yang sejak 3 tahun yg lalu yang semakin lama smakin membsar. Dokter menganjurkan dilakukan serangkaian pemeriksaan termasuk dlm uji fungsi tiroid dengan mengunakan radio isotop Radioisotope yang digunakan adalah 1. Iodine 131 d. fosfor 32 2. Ferrum 59 e. kromium 51 3. Mangan 56

Slh 1 teknik pncitraan yang digunakan skrg ini adlh dgn menggunakan glmbang elektromagnerik sinar x. sinar x yg mrupakan radiasi pengion akan mnghitamkan plat film sesuai dgn intensitas radiasi yang diterimanya 32. hal apakah yang dimiliki oleh gelmbg ini untuk bagian tsbt? a. kecepatan tinggi d. frekuensi tinggi b. intensitas tinggi e. dosis tinggi c. paparan tinggi 33. apakah peralatan radiologi yang juga mnggunakan gelmbang ini? a. USG d. MRI b. CT scan e. PET c. endoskopi 34. (soal tdak jelas) bayi bilirubin yang kena pnyakit kuning digunakan gelmbang apa? 1. Gelombang mikro d. gel ultraviolet 2. Gel inframerah e. gel sinar x 3. Gel sinar tampak 35. salah satu modalitas radio diagnostik adalah penggunaan papan gel elektromagnetik pada bagian tubuh tertentu. Bagian tubuh tersebut kemudian akan memancarkan panas sesuai dengan karakteristik bagian tubuh tsb a.gel. mikro d. gel ultraviolet b.gel inframerah e. gel. Sinar x c. gelombang sinar tampak 36.sifat cahaya a. merupakan gelombang longitudinal d.lebih cepat merambat daripada bunyi b.mempunyai kecepatan 3x10 pangkat 8 e.terdiri dari sejumlah partikel c. salah satu spectrum elektromagnetik 37.ketika cahaya melewati dua medium yang berbeda disebut sebagai a.refleksi c. b. refraksi d e.retraksi

38. jika lensa mata normal titik fokus tepat berada di 1. 2. 3. 4. 5. corpus vitreious b. retina sklera coroid makula

39.pituitary anterior dihambat mensekresi hormone oleh a. hipotalamus c. tiroksin b. TRH d> TSH e.kel. tiroid 40. hipotalamus dihambat aktivitas nya ialah?? a. CRH b. ACTH c. kortisol d. hipotalamus e. hipofisis 41. Seorang pria 51 tahun datang ke poliklinik penyakit dalam dgn keluhan sering kencing dan mudah haus. Ia kemudian menjalani pemeriksaan ndaerah di lab dan didapatkan bahwa gula darahnya 320mg/dl di atas normal. Dalam keadaan normal mekanisme umpan balik apa yg seharus nya terjadi pada kasus di atas?? a. Peningkatan sekresi hormon insulin b Peningkatan sekresi hormon glukagon c Peningkatan sekresi hormon d Peningkatan sekresi hormon adrenalin e Peningkatan sekresi hormon aldosteron 42.Manakah yg merupakan efektor bagi stimulus berdasarkan bagan di atas?? a.medulla oblongata b. arteriola c.baroreseptor d. saraf simpatis

e.perubahan posisi 43.Umpan balik positif terjadi antara A. ion kalsium dan trombin B. fosfolipid platelet dan trombin C. protrombin aktivator dan trombin D. faktor v dan trombin e. aktivasi x dan trombin adasdasd sedang tur di negara 4 musim yang sedang musim panas. Tubuh asdasdasd melakukan melakukan serangkaian mekanisme 44 Pada keadaan tsb perpindahan kalor lingkungan dan tubuh asdasd paling banyak dalam bentuk A konduksi B konveksi c radiasi d eksresi e evaporasi 45komponen yang berperan sebagai termostat pada tubuh adasd adalah A hipotalamus B C medula oblongata D mesoensefalon E cerebrum 46 kompensasi yang dilakukan oleh tubuh adasd adalah A vasokontraksi arteriole perifer B kurangi produksi kel keringat C kontraksi otot rangka D turunkan laju metabolisme E tingakatkan ketebalan lemak Pada musim hujan tubuh kita melakukan serangkaian mekanisme untuk mjaga suhu tubuh dalam kondisi konstan 47usaha yang dilakukan oleh tubuh pada keadaan ini

A vasokontriksi pbuluh perifer B tingkatkan produksi kelenjar keringat C kontraksi otot rangka D menurunkan laju metabolisme E tururnkan ketebalan lemak di bawah kulit 48 pada keadaan tsb ppindahan kalor lingkungan dan tubuh paling banyak dalamn bentuk A konduksi B konveksi C radiasi D eksresi (urin feses) E evaporasi 49menggigil mrupakan salah satu upaya untuk A turunkan laju metabolisme B tekan evaporasi C kontraksi otot rangka D kurangi aliran darah perifer E cegah akumulasi lipid subkutan 50 pbuluh darah perifer yang dimaksud adalah A arteri kecil B arteriole C kapiler D venula E vena kecil