Anda di halaman 1dari 2

Exerccio Biologia Celular Agronomia 1) O que diferencia um ser vivo de algo no vivo? = 2) O que uma clula?

? =pequena unidade morfoziologica capaz de se auto multiplicar. 3) Quais as caractersticas de uma clula procarionte e de uma clula eucarionte? 4) Quais as caractersticas de uma clula animal e uma clula vegetal? Elas so pro cariontes ou eucariontes? 5) Os seres multicelulares so procariontes ou eucariontes? 6) Os seres unicelulares so procariontes ou eucariontes? 7) Os protozorios so eucariontes ou procariontes? So unicelulares ou pluricelu lares? 8) Quais os postulados da biologia celular? 9) O vrus um ser vivo? Porque? 10) O que a membrana plasmtica? O que constitui a membrana plasmtica? Todas as clulas possuem membrana plasmtica? 11) O que uma membrana nuclear? Todas as clulas possuem membrana nuclear (car ioteca)? 12) Diga se as organelas relacionadas a baixo esto presentes em clulas procar iontes e eucariontes e informe a sua funo.

Ribossomo =sim e sua funo produo de protenas utilizadas pelas clulas ,atuando sempr m grupo[polissomo]. Mitocndria =sim responsvel pela gerao de energia na clula. Cloroplasto = Complexo de Golgi Retculo endoplasmtico liso Retculo endoplasmtico rugoso Lisossomos =responsvel pela digesto intracelular. 13) O que est presente no ncleo de uma clula eucariontes? 14) Qual a origem evolutiva das mitocndrias e dos cloroplastos nas clulas euca riontes? 15) O que osmose? 16) O que fagocitose e o que pinocitose? 17) A osmose ocorre em clulas animais e vegetais? Qual a diferena da ao da pared e celular das clulas vegetais nesse processo? 18) O transporte ativo ocorre contra ou a favor do gradiente de concentrao? 19) O transporte passivo ocorre contra ou a favor do gradiente de concentrao? 20) O que uma soluo hipertnica e uma soluo hipotnica? 21) Descreva o processo de transporte da bomba de sdio e potssio. 22) O que o DNA? O que o RNA? Quais as diferenas entre o DNA e o RNA? 23) Quais so os tipos de RNA quais as suas funes? 24) O que um nucleotdeo? 25) O que um gene? 26) O que um organismo transgnico? 27) Quais as vantagens e desvantagens do uso de transgnicos na agricultura? 28) O que uma mutao gnica? 29) O que um cromossomo? 30) Descreva como ocorre a duplicao do DNA. 31) Descreva como ocorre a transcrio do DNA. 32) Descreva como ocorre a traduo dos cdon do RNAm mensageiro para a sntese de p rotena. 33) O ponto de vista gentico, o que um cdon? 34) O que uma protena? 35) Qual a sequencia de aminocidos formada pela informao gentica da seguinte fit a de DNA:

A) B)

5 AAATACTGGGTATGTTTAAATTAG 3 3 AGCTTTTGCTCAGGTGAACATAAG5

36) Qual a sequencia de aminocidos formada pela informao gentica da seguinte fit a de RNAm: C) D) 5 AAAUACUGGGUAUGUUUAAAUUAG 3 3 AGCAUUUGCUCAGGUGAACAUAAG5