Anda di halaman 1dari 5

REVIEW TEKNIK KOMUNIKASI ILMIAH

Metode-metode dalam Diagnosis Virus Ebola melalui Rute Konvensional, Immunologi, dan Metode Berbasis Asam Nukleat

Virus Ebola (EBOV) yang menginfeksi manusia dapat dideteksi dengan beberapa macam metode yang sebelumnya telah diujicobakan pada sampel dari hewan. Digunakan tiga macam metode yaitu Plaque Assay yang menggunakan beberapa medium sel hidup untuk mendeteksi adanya plaque yang mengindikasikan adanya EBOV, Enzyme Immunosorbent Assay yang menggunakan prinsip sandwich yaitu adanya antibodi monoklonal untuk menangkap antigen disertai dengan serum anti-EBOV untuk mendeteksi antigen, dan Real-Time Reverse Transcriptation PCR yang menggunakan campuran enzim Superscript reverse transcriptase-Platinum Taq polymerase ditambah primer khusus yang didesain berdasarkan database DNA terbaru sehingga hasilnya dapat dilihat melalui interkalasi pewarnaan SybrGreen dye. Pada Plaque Assay, EBOV pada sampel serum hamster dapat dideteksi pada medium sel paru-paru janin rhesus dan sel ginjal monyet hijau Afrika. Pada Enzyme Immunosorbent Assay, pendeteksian dapat dikatagorikan sensitif dan spesifik : 44 dari 45 (97,7%) homogenat hati dan 38 dari 41 (92,7%) homogenat limpa yang dikultur bersifat positif dan setelah dites dengan metode ini juga menghasilkan hasil yang positif, sementara 85 dari 87 (97,7%) homogenat hati kultur negatif dan 66 dari 66 (100%) homogenat limpa kultur negatif menghasilkan hasil uji negatif pula. Pada Real-Time Reverse Transcriptation PCR, batas deteksi > 95% yang ditentukan oleh analisis regresi probit berkisar dari 1545 ke 2835 setara genom virus / ml serum (8,6-16 RNA eksemplar per assay). Kesesuaian alat tes telah dicontohkan oleh deteksi dan kuantifikasi RNA virus dalam sampel

serum pasien. Dari metode-metode di atas ada kelebihan dan kekurangan dari masing-masing metode. Deteksi yang memenuhi kualifikasi berdasarkan nilai ekonomi dan keakuratan hasil diberikan kepada Enzyme Immunosorbent Assay dengan nilai akurasi tinggi, waktu cepat, dan kemudahan relatif terhadap ketersediaan alat dan bahan. Virus Ebola Virus Ebola (Ebola virus/EBOV) adalah virus yang memiliki materi genetik RNA yang dikenal sebagai penyebab utama penyakit Demam Berdarah Ebola (Ebola Haemmorhagic Fever) yang mematikan. Menurut taksonominya, virus Ebola termasuk dalam ordo Mononegavirales, keluarga Filoviridae, genus Ebolavirus. Selanjutnya genus ini terdiri dari empat spesies yaitu Sudan Ebolavirus (SEBOV), Zaire Ebolavirus (ZEBOV), Reston Ebolavirus (REBOV), dan Ivory Coast Ebolavirus (ICEBOV). [1] SEBOV dan ZEBOV pernah mewabah di Sudan dan Zaire pada tahun 1976. Tingkat fatalitas SEBOV ada di bawah ZEBOV yaitu 50% untuk SEBOV dan 90% pada ZEBOV. Dilaporkan wabah berlangsung hingga tiga tahun kemudian yaitu pada tahun 1979 ketika terakhir dilaporkan adanya seseorang yang didiagnosis terinfeksi virus ini. [2] Virus ini disebarkan melalui gigitan hewan terutama macaque dan kelelawar. REBOV diketahui keberadaannya ketika terjadi infeksi pada koloni macaque yang diimpor dari Filipina di Reston, Virginia, Amerika Serikat. Diktahui bahwa virus jenis ini tidak menimbulkan kelethalan pada manusia dan hanya berbahaya bagi primata bukan manusia. [3]

KU3082_Tugas2_10408040_RMR

REVIEW TEKNIK KOMUNIKASI ILMIAH Karena tingkat patogenitasnya yang tinggi dan belum ditemukan cara menanganinya , virus Ebola digolongkan dalam mikroorganisme dangan katagori Biosafety Level 4. Penganan dan diagnosis yang tepat mungkin dapat membantu menurunkan tingkat kematian yang disebabkan oleh virus ini. Diagnosis Virus Ebola Diagnosis digunakan untuk mengetahui apakah seseorang terserang virus ebola atau tidak. Berdasarkan materi apa yang dijadikan objek diagnosis, diagnosis dibagi menjadi tiga jalur utama yaitu diagnosis secara konvensional, diagnosis secara immunologi, dan diagnosis berbasis asam nukleat. Pada diagnosis secara konvensional, digunakan suatu media pengaya untuk menumbuhkan virus ini untuk kemudian diidentifikasi. Diagnosis secara immunologi mendeteksi adanya antigen pada virus atau antibodi spesifik terhadap antigen virus pada manusia yang mengindikasikan adanya infeksi virus pada manusia tersebut. Diagnosis berbasis asam nukleat mendeteksi adanya materi genetik virus pada tubuh manusia. Berikut akan dibahas mengenai contohcontoh metode diagnosis berdasarkan ketiga jalur di atas. Diagnosis Konvensional Plaque Assay Metode ini digunakan untuk melihat adanya plaque pada media sel hidup yang diinfeksikan oleh virus ebola. Digunakan dua jenis virus ebola yaitu ZEBOV E718 dan SEBOV Boniface. Virus pertama diinfeksikan pada babi guinea untuk kemudian diambil dari bagian peritoneumnya. Digunakan delapan macam kultur sel untuk menumbuhkan virus ebola. Kultur sel tersebut adalah A549 (karsinoma adrenal manusia), BHK-21 (ginjal hamster), fibroblas embrio ayam, fibroblas embrio bebek, FRhL (paru-paru janin Rhesus), LLC-MK2 (ginjal monyet), SW-13 (adenokarsinoma manusia), dan Vero (ginjal monyet hijau Afrika). Sebelumnya dilakukan inokulasi dilakukan dalam labu 75cc secara monolayer pada sel Vero dengan penambahan 100U penicillin dan 100g streptomycin. Selanjutnya inokulum diinkubasi selama 10 hari pada suhu 37oC. Lalu dilakukan sentrifugasi untuk memisahkan debris sel sehingga supernatan berisi virus siap untuk digunakan. Sebanyak 0,2 ml supernatan kemudian diinokulasikan ke dalam masing-masing kultur sel dengan masing-masing kultur sel memiliki empat perlakuan berbeda. Inkubasi dilakukan pada suhu 37oC dengan waktu bervariasi dari 3, 5, 7, dan 9 hari. Setelah inkubasi, plat sel diberi agarosa overlay 1:6000 merah netral. Pembentukan plaque dapat diamati setelah 24 hingga 48 jam setelah penambahan overlay. Hasil dari pengamatan plaque ada pada tabel berikut.

Dari tabel di atas dapat diketahui bahwa plaque baik dari ZEBOV E718 maupun SEBOV Boniface dapat teramati hanya pada sel Vero sedangkan pada kultur sel lainnya tidak dapat teramati. Hasil yang berbeda terdapat pada kultur sel FRhL yaitu munculnya plaque yang tidak jelas teramati. Itupun hanya pada inokulum ZEBOV E718. Karakteristik dari plaque ZEBOV berupa bolongan pada media sel sedangkan pada SEBOV teramati sel viabel dan membentuk struktur mata sapi. Waktu inkubasi yang tepat adalah 7 hari karena menghasilkan plaque yang dapat dilihat dengan jelas. Percobaan menghasilkan hasil

KU3082_Tugas2_10408040_RMR

REVIEW TEKNIK KOMUNIKASI ILMIAH bahwa bila inkubasi dilakukan kurang dari 7 hari (3 dan 5 hari) plaque tidak jelas penampakannya sedangkan bila inkubasi mencapai 9 hari maka plaque akan bersatu sehingga sulit dikuantifikasi. Untuk mengonfirmasi bahwa plaque adalah virus ebola maka plaque diambil dan dilarutkan dalam medium. Selanjutnya medium ini disuntikan pada tikus. Hasil pengamatan menyebutkan bahwa tikus mati dalam waktu 7-14 hari setelah disuntik oleh medium berisi larutan plaque. Lalu ginjal tikus diambil dan virus diisolasi dari ginjal tikus dengan prosedur IFA menggunakan sera dari virus Ebola. Titrasi dilakukan untuk kuantifikasi hasil plaque assay dan menghasilkan jumlah sebagai berikut. Digunakan dua spesies virus Ebola yaitu ZEBOV dan SEBOV yang diisolasi dari macaque. Antisera yang digunakan disiapkan dari antibodi monoklonal tikus (MAb) yang telah dipersiapkan agar dapat berikatan dengan ZEBOV maupun SEBOV dalam mikrotiter. Selain itu diberikan antibodi poliklonal hiperimun dari kelinci yang sebelumnya telah dipastikan dapat berikatan dengan antigen yang tertangkap oleh MAb. Dengan perbandingan 1:1000, MAb dilarutkan dalam 0,01 M buffer garam fosfat (PBS) dengan pH 7,4. Sebanyak 0,1 ml larutan dimasukan dalam mikrotiter dan diperlakukan overnight pada suhu 4oC. 33l Suspensi jaringan dilarutkan dalam campuran susu skim-PBS-Tween sebanyak 0,1ml dan secara serial dipindahkan sebanyak 33l ke media baru sehingga pengenceran menjadi 1:4; 1:16; 1:64; dan 1:256. Mikrotiter kemudian diinkubasi selama 1 jam pada suhu 37oC. Kemudian mikrotiter dicuci dengan PBS-Tween sebanyak tiga kali. Lalu ditambahkan antibodi poliklonal kelinci yang sebelumnnya telah dilarutkan dengan perbandingan 1:1500. Antibodi poliklonal kelinci ini telah dikonjugasikan dengan peroksidase lobak. Campuran diikubasi selama 1 jam berikutnya pada suhu yang sama untuk kemudian dicuci dengan PBS-Tween sebanyak tiga kali. Setelah itu ditambahkan substrat 2 2 ' azino di - [ 3 - ethyl [benzthiazolin sulfonat]sebagai indikator. Hasil didapatkan setelah inkubasi selama 30 menit melalui pembacaan nilai OD pada spektrofotometer Dynatech MR600. Nilai OD dibaca pada panjang gelombang =410 nm. Nilai OD kemudian dibandingkan dengan hasil pembacaan spektrofotometer untuk kontrol negatif dan positif. Perkiraan hasil berdasarkan penambahan dan pengurangan dari nilai standar deviasi. Hasil pengamatan dapat dilihat berdasarkan grafik di halaman berikutnya.

Dengan demikian tingkat sensitifitas plaque assay memang masih rendah namun potensial untuk dikembangakan di tahun-tahun mendatang. Dilihat dari segi keamanannya pun metode plaque assay ini lebih baik karena menggunakan materi non gelas dan jarum. [4] Diagnosis Berbasis Immunologi Sandwich EIA Diagnosis EIA (Enzyme Immunosorbent Assay) menggunakan antibodi monoklonal dari tikus sebagai penangkap antigen dan antibodi poliklonal dari kelinci sehingga akan membentuk struktur sandwich yang akan dapat diamati berdasarkan reaksi enzimatis.

KU3082_Tugas2_10408040_RMR

REVIEW TEKNIK KOMUNIKASI ILMIAH

Sensitifitas dihitung berdasarkan pendeteksian antigen. Antigen terdeteksi sebanyak 44 dari 45 sampel (98%) pada kultur hati dan 38 dari 41 sampel (93%) pada kultur limpa. Sedangkan spesitifitas dilihat dari kenegatifan spesimen negatif. Pada kultur hati, dari 87 kultur negatif dinyatakan 85 kultur negatif (98%). Sedangkan pada kultur limpa , dari 66 kultur negatif dinyatakan semuanya negatif (100%). Metode ini diujicobakan pada Macaque fascicularis dan menghasilkan hasil yang baik. Diharapkan bila digunakan untuk deteksi pada manusia pun akan memberikan hasil yang tak kalah baik pula. Assay dengan metode ini memiliki peluang yang sangat besar untuk digunakan dan dikembangkan karena hasil dan kemudahan prosedurnya sehingga dapat dilakukan dalam wilayah yang luas misalnya seperti di Afrika. [5] Diagnosis Berbasis Asam Nukleat Real-Time Reverse-Trancriptase PCR PCR merupakan metode amplifikasi materi genetik yang juga dapat digunakan untuk mendiagnosis virus Ebola. Virus Ebola seperti yang diketahui memiliki materi genetik berupa PCR. Digunakan ReverseTranscriptase PCR karena materi genetik yang digunakan adalah RNA sehingga digunakan enzim reverse transcriptase untuk membuat salinan RNA yaitu berupa cDNA.

Pada prakteknya digunakan Real-Time PCR karena metode PCR yang lama masih menghabiskan banyak waktu karena perlu dialkukan elektroforesis dan perlu mengisolasi cDNA yang terbentuk. Dengan adanya RealTime PCR maka waktu yang dibutuhkan akan semakin singkat karena hasil dapat langsung terbaca saat proses PCR berlangsung. Sebagai kontrol positif digunakan virus Ebola yang telah dipropagasi dalam sel Vero dan diinkubasi selama 3 5 hari. Sampel diambil dari darah penderita yang berasal dari Gulu, Uganda pada tahun 2000. Gen yang menjadi target amplifikasi adalah gen L sepanjang 419 pasang basa pada genom virus ebola. Digunakan sepasang primer yaitu Filo A dan Filo B yang memiliki urutan sebagai berikut. FiloA ATCGGAATTTTTCTTTCTCATT [1321313234] FiloB ATGTGGTGGGTTATAATAATCACT GACATG [13631-13601] Profil PCR yang digunakan merujuk pada metode universal dengan 40 siklus. Profil PCR adalah sebagai berikut. Reverse transkripsi pada 50oC selama 20 menit Denaturasi awal pada 95oC selama 5 menit 10 presiklus pada 95oC selama 5 detik, 60oC selama 5 detik dengan penurunan 1oC per siklus, dan 72oC selama 25 detik

KU3082_Tugas2_10408040_RMR

REVIEW TEKNIK KOMUNIKASI ILMIAH 40 siklus pada 95oC selama 5 detik, 56oC selama 10 detik, 72oC selama 25 detik Pembacaan fluorescence pada 79oC selama 15 detik Probe deteksi yang berlabel pewarna fluorescence berhibdisasi dengan produk PCR secara spesifik dan membelah selama PCR karena aktivitas 5-eksonuklease Taq polimerase yang mengaktifkan pewarna fluorescence. Karena probe belum dapat didesain untuk virus Ebola, maka dugunakan metode SybrGreen. Larutan SybrGreen yang akan mewarnai produk PCR secara spesifik dimasukan dalam campuran dan hasilnya akan terbaca dalam pipa kapiler Light Cycler. Dari perhitungan analisis statistik diketahui bahwa dengan metode ini virus Ebola dapat dideteksi dengan jumlah (genome equivalent) 2647 geq/ml (1887 hingga 4964). Dengan demikian metode ini begitu sensitif dalam mendeteksi virus. Namun perlu pengembangan lebih lanjut mengenai metode ini karena masih dibutuhkan penelitian mengenai desain probe dan oligonukleotida yang akan dideteksi. [6] Tambahan Metode diagnosis memang bervariasi namun perlu diperhatikan juga penggunaannya. Metode yang canggih memang menghasilkan data yang akurat namun perlu dibayar dengan harga yang tinggi. Untuk deteksi masal atau yang dapat digunakan pada wabah sebaiknya digunakan deteksi yang tidak mahal dan dapat digunakan di mana saja tanpa perlu adanya dukungan laboratorium dan fasilitas lainnya. Namun demikian pengembangan metode diagnosis ini perlu diapresiasi karena sudah mampu menghasilkan data yang akurat dan dalam waktu yang singkat. Akan lebih baik bilametode akurat ini bisa digunakan dengan mudah di berbagai tempat dan murah untuk dijalankan sehingga deteksi dini dalam hal ini virus Ebola akan lebih baik karena kebanyakan penderita atau orang yang terinfeksi virus ini jauh dari fasilitas canggih yang memungkinkan untuk dilakukannya diagnosis yang cepat. Referensi 1. Feldmann, H., et al..2004. Filoviridae. Dalam In Virus Taxonomy, Eight Report of The International Commitee on Taxonomy of Viruses. San Diego : Elsevier Academic Press 2. Baron, R.C., J.B. McCormick, dan O.A. Zubeir. 1983. Ebola Virus Disease in Southern Sudan : Hospital Dissemination and Intrafamilial Spread. Bull WHO. 62:997-1003 3. World Health Organization. 1992. Viral haemorrhagic fever in Imported Monkeys. Wkly Epidemiol Rec. 67:142-143 4. Moe, James B., Rhonda D. Lambert, dan Harold W. Lupton. 1981. Plaque Assay for Ebola Virus. J. Of Clinical Microbiology. 13:791-793 5. Ksiazek, T.G., P.E. Rollin, dan P.B. Jahrling. 1992. Enzyme Immunosorbent Assay for Ebola Virus Antigens in Tissues of Infected Primates. J. Of Clinical Microbiol. 30:947-950 6. Drosten, Christian, Stephan Gttig, Stefan Schilling, Marcel Asper, Marcus Panning, Herbert Schmitz, dan Stephan Gnther. 2002. Rapid Detection and Quantification of RNA of Ebola and Marburg Viruses, Lassa Virus, Crimean-Congo Hemorrhagic Fever Virus, Rift Valley Fever Virus, Dengue Virus, and Yellow Fever Virus by Real-Time Reverse Transcription-PCR. J. of Clinical Microbiology. 40:2323-2330

KU3082_Tugas2_10408040_RMR