Anda di halaman 1dari 123

1

UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA


PROGRAMA DE PS-GRADUAO EM BIOTECNOLOGIA

RODRIGO DE QUEIROZ OLIVEIRA

Bioprospeco de microrganismos leveduriformes produtores de pectinases extracelulares isolados do Semi-rido baiano

Feira de Santana, BA 2007

RODRIGO DE QUEIROZ OLIVEIRA

Bioprospeco de microrganismos leveduriformes produtores de pectinases extracelulares isolados do Semi-rido baiano

Dissertao apresentada ao Programa de Ps-Graduao em Biotecnologia, da Universidade Estadual de Feira de Santana como requisito parcial para obteno do ttulo de Mestre em Biotecnologia. Orientador: Profa. Dra. Sandra Aparecida de Assis (UEFS) Co-orientadores: Prof. Dr. Carlos Augusto Rosa (UFMG) Profa. Dra. Ana Paula Trovatti Uetanabaro (UEFS)

Feira de Santana, BA 2007

minha orientadora Profa. Dra. Sandra Aparecida de Assis e aos meus Co-orientadores Prof. Dr. Carlos Augusto Rosa e Profa. Dra. Ana Paula Trovatti Uetanabaro pelos valiosos ensinamentos.

AGRADECIMENTOS

A Deus o guia fundamental de toda minha vida espiritual. Universidade Estadual de Feira de Santana (UEFS), em especial ao Departamento de Cincias Biolgicas, pela oportunidade concedida para realizao do Mestrado em Biotecnologia com nfase em Recursos Naturais da Regio Nordeste. Profa. Dra. Sandra Aparecida de Assis pelo acolhimento e orientao. Agradeo ainda pelas condies de trabalho que me proporcionou, pela contnua disponibilidade, pela pacincia e, sobretudo, pela amizade em todos os momentos. Profa. Dra. Ana Paula Trovatti Uetanabaro do Departamento de Sade da UEFS, pelo incentivo, pela coleta, pelas crticas e sugestes, e pela amizade. Ao Prof. Dr. Carlos Augusto Rosa do Departamento de Microbiologia do Instituto de Cincias Biolgicas da Universidade Federal de Minas Gerais (UFMG), pela valiosa cooperao tanto na coleta dos microrganismos, quanto nas anlises dos dados obtidos. Coordenao do Programa de Ps-Graduao em Biotecnologia, tendo a frente o Prof. Dr. Aristteles Ges-Neto que se mostrou sempre atencioso e pronto a ajudar. aluna de iniciao cientfica Rita e aos colegas de Ps-Graduao Catiane e Paulo pela colaborao nas tcnicas de biologia molecular e anlise filogentica. Aos alunos de iniciao cientfica Fabiana, Danyo e Gildomar do Laboratrio de Enzimologia e Tecnologia das Fermentaes (LAEN) do Departamento de Sade da UEFS, pelo auxlio nos ensaios enzimticos. Aos colegas do Laboratrio de Pesquisa em Microbiologia (LAPEM) do Departamento de Cincias Biolgicas da UEFS: Thiago, Clber, Alice, Carla, Isabela, Suzana, Suikinai e Luciana pela convivncia e apoio. Helton, pelo apoio na secretaria da Ps-Graduao.

Aos professores e colegas do Curso de Ps-Graduao em Biotecnologia, pela contribuio no meu desenvolvimento pessoal e profissional. Profa. Dra. Rosane Freitas Schwan do Laboratrio de Fisiologia de Microrganismos do Departamento de Biologia da Universidade Federal de Lavras (UFLA), pela gentil cesso da levedura Kluyveromyces marxianus CCT 3172. Ao Laboratrio de Micologia (LAMIC) do Departamento de Cincias Biolgicas da UEFS, coordenado pelo Prof. Dr. Lus Fernando Pascholati Gusmo, pelos registros fotogrficos dos microrganismos. Ao Laboratrio de Sistemtica Molecular de Plantas (LAMOL) do Departamento de Cincias Biolgicas da UEFS, coordenado pelo Prof. Dr. Cassio van den Berg, pelo suporte nos experimentos envolvendo biologia molecular. A Sra. Valentina de Ftima De Martin do Laboratrio de Biologia Molecular do Departamento de Cincias Biolgicas da Escola Superior de Agricultura "Luiz de Queiroz" (ESALQ) da Universidade de So Paulo (USP), pelo seqenciamento do material gentico. Ao Prof. Dr. Antonio Azeredo pela colaborao na anlise estatstica dos resultados. Ao bilogo Domingos pela identificao botnica. Aos meus pais Gilson e Maria Eneusa, e a meu irmo Ronaldo, que me ofereceram condies para o vivenciamento puramente acadmico. minha querida noiva Charlene pelo companheirismo e pacincia que teve comigo. minha famlia Queirozes, Oliveiras e Jesuses, representada por meu primo Paulo Marcelo, meu sogro Csar e minha sogra Ana, pela torcida. FAPESB pela concesso da bolsa de mestrado (Pedido N 3509/2006). Aos membros da banca examinadora, Dra. Olga Maria Mascarenhas de Faria Oliveira e Dr. Hlio Mitoshi Kamida, pelas sugestes e correes.

O meu bom senso no me diz o que , mas deixa claro que h algo que precisa ser sabido. Esta a tarefa da cincia que, sem o bom senso do cientista, pode se desviar e se perder. No tenho dvida do insucesso do cientista a quem falte capacidade de adivinhar, o sentido da desconfiana, a abertura dvida, a inquietao de quem no se acha demasiado certo das certezas. Tenho pena e, s vezes, medo do cientista demasiado seguro da segurana, senhor da verdade e que no suspeita da historicidade do prprio saber. (Paulo Freire Pedagogia da Autonomia)

RESUMO

As enzimas pcticas de origem microbiana correspondem a 25% do total de enzimas utilizadas na indstria alimentcia, sendo empregadas tradicionalmente na extrao e clarificao de suco de frutas. As leveduras despertam grande interesse para a produo em larga escala destas enzimas, em virtude do seu crescimento rpido e meio de crescimento geralmente sem indutor. Assim, selees de microrganismos do ambiente so promissores para prospeco de produtos de interesse industrial e biotecnolgico. Desse modo, os objetivos desse trabalho foram isolar, selecionar, identificar e verificar a atividade pectinoltica de microrganismos leveduriformes (leveduras e fungos semelhantes a leveduras), provenientes do Semi-rido baiano; alm de deposit-los na Coleo de Culturas de Microrganismos da Bahia (CCMB) da Universidade Estadual de Feira de Santana (UEFS). Os microrganismos foram isolados de flores, frutos, tecido vegetal necrosado, insetos e solos da regio Semi-rida baiana em meio YM, acrescido de cloranfenicol 0,01%; selecionados em meio diferencial contendo cido poligalacturnico (MP-5) para determinao da poligalacturonase (PG) e de pectina (MP-7) para pectina liase (PL); sendo eles identificados pela amplificao da seqncia do domnio D1/D2 do 26S rDNA. Os resultados obtidos foram avaliados mediante anlise de varincia (ANOVA) e Teste de Tukey com o pacote estatstico SPSS (Statistical Package for Social Sciences). Dos 250 isolados testados, 33 foram selecionados como pectinolticos. Estes 33 microrganismos pectinolticos foram: Aureobasidium pullulans (18), Candida boidinii (1), Trichosporonoides sp. (3), Pseudozyma sp. (4), Cryptococcus liquefaciens (1), Fungal endophyte (5) e o Kluyveromyces marxianus (1), o qual tem aceitabilidade na indstria de processamento de alimentos. A atividade pectinoltica diferiu significantemente entre os isolados (Tukey p<0,05). A atividade da poligalacturonase foi verificada somente em nove deles, sendo o isolado Pseudozyma sp.

CCMB 300 e o Trichosporonoides sp. CCMB 304 os produtores mais ativos, apresentando respectivamente 14,17 e 12,47 mol de cido galacturnico liberado por min/mg de protenas. Por outro lado, a atividade da pectina liase foi verificada em todos os 33 isolados, sendo os produtores mais ativos o Fungal endophyte CCMB 327 e o Fungal endophyte CCMB 328, que apresentaram, respectivamente, 130,48 e 117,26 mol de grupos urondeos insaturados formados por min/mg de protenas. Este estudo demonstrou que microrganismos leveduriformes isolados do Semi-rido baiano representam uma fonte de enzimas extracelulares de interesse industrial e biotecnolgico.

Palavras-chave: levedura, poligalacturonase, pectina liase, biotecnologia

ABSTRACT

The microbial pectic enzymes produced constitute 25% of the enzyme used in food market and are used in extraction and clarification of juice fruits. Yeasts are an alternative source for the large-scale production of commercial enzymes because have growth relatively simple and in the general the growth medium does not require an inducer. In addition, screenings of microorganisms from the environmental are promissory at prospection of products with industrial and biotechnological interest. Our objective were isolate, select, identify and study the enzymatic activity of yeast and like-yeast strains producers of pectinases extracelulars. Other objective of this work was deposited the isolated microorganism in the Culture Collections of Microorganisms of Bahia (CCMB) of the University of Feira de Santana (UEFS). The microorganisms were isolated from flowers, fruits, necrotic plant tissue, insects and soil from Semi-arid region of the State of Bahia, Brazil, using YM medium, in presence of 0.01% of chloramphenicol. The yeasts isolated were grown in plates with mineral medium containing polygalacturonic acid (MP-5) for polygalacturonase (PG) activity and mineral medium containing pectin (MP-7) for pectin lyase activity (PL). Pectinolytic-secreting yeast isolates were identified by amplification of the sequence of dominium D1/D2 of 26S rDNA. Data were analyzed by analysis of variance (ANOVA) and Test of Tukey using SPSS (Statistical Package for Social Sciences). From 250 strains 33 strains showed pectic activity. These microorganisms are: Aureobasidium pullulans (18), Candida boidinii (1), Trichosporonoides sp. (3), Pseudozyma sp. (4), Cryptococcus liquefaciens (1), Fungal endophyte (5) e o Kluyveromyces marxianus (1). With K. marxianus additionally achieving the status of being designated GRAS (Generally Regarded As Safe). The pectinolytic activity differed in the strains (Tukey p<0,05). Nine strains showed pectinolytic activity of polygalacturonase and the highest activity were verified in Pseudozyma sp. CCMB 300 and

10

Trichosporonoides sp. CCMB 304 that showed 14,17 e 12,47 mol of galacturonic acid/min/mg de protein. In relation to pectin lyase activity, these are verified in all 33 strains and the highest activities occurred in Fungal endophyte CCMB 327 and in the Fungal endophyte CCMB 328, that showed, respectively, 130,48 e 117,26 mol of unsaturated uronides/min/mg protein. Our study clearly revealed the potential of yeasts isolated from Semi-arid environments to produce a wide range of pectinolytic enzymes.

Key words: yeast, polygalacturonase, pectin lyase, biotechnology

11

LISTA DE FIGURAS

Figura 01

Estrutura

da

parede

celular

vegetal.

Fonte:

IPPA, 21

http://www.ippa.info/what_is_pectin.htm.................................................... Figura 02 Estrutura da pectina. Fonte: Cook e Stoddart (1973) apud Sakai et al. (1993)........................................................................................................ Figura 03 Unidade de cido galacturnico. Fonte: IPPA,

22

http://www.ippa.info/what_is_pectin.htm.................................................... Figura 04 Figura 05 Modo de ao das enzimas pectinolticas. Fonte: Sakai et al. (1993).......... Estrutura da unidade de DNA ribossomal (rDNA), o qual consiste de seqncias altamente conservadas codificadoras dos RNAs ribossomais (rRNAs) 18S, 5,8S e 28S, intercaladas com regies no codificadoras menos conservadas (ITS e IGS). Fonte: adaptado de VILGALYS LAB, http://www.biology.duke.edu/fungi/mycolab/primers.htm.......................... Figura 06 Diversidade de reas que envolvem a biotecnologia das leveduras. Fonte: Walker (1998) apud Pinheiro (2004)............................................................ Figura 07 Halo de hidrlise do cido poligalacturnico originado por

22 24

29

31

Saccharomyces cerevisiae CECT 1389, proveniente da Spanish Type Culture Collection, Espanha. Fonte: Blanco et al. (1994) apud Blanco, Sieiro e Villa (1999)..................................................................................... Figura 08 Mapa da Regio Nordeste mostrando as ecorregies do Bioma das Caatingas e as 57 reas prioritrias para conservao; as seis reas de Extrema Importncia Biolgica em vermelho esto sendo inventariadas pelo PPBio. Fonte: PPBio, http://www.uefs.br/ppbio/index.html................ 50 36

12

Figura 09

(a) Halo de hidrlise do cido poligalacturnico, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por microrganismos leveduriformes isolado do Semi-rido baiano, crescidos a 28C por 48 h em meio MP-5. (b) Halo de degradao da pectina, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por microrganismo leveduriforme isolado do Semi-rido baiano, crescido a 28C por 48 h em meio MP-7......................................... 66

Figura 10

Halo de degradao da pectina, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por Kluyveromyces marxianus CCT 3172, crescido a 28C por 48 h em meio MP-7................. 67

Figura 11

Produtos da PCR purificado de 33 isolados leveduriformes produtores de pectinases, submetido eletroforese em gel de agarose 1% em tampo TAE 1X, 5V/cm, 1,5 hrs, corado com SYBR Safe (Invitrogen) e fotografados pelo sistema de fotodocumentao Edas 290 (Kodak). Nas amostras (canaletas) ocorre amplificao do domnio D1/D2 do 26S rDNA com os primers LR0R e LR5, e obteno de um fragmento de aproximadamente 900 pb, que o tamanho prximo ao esperado para estes domnios. O marcador (M) utilizado foi o Gene Ruler 100 bp DNA Ladder (Fermentas)..................................................................................... 70

Figura 12

rvore filogentica dos microrganismos leveduriformes produtores de pectinases extracelulares isolado Semi-rido baiano, obtida por anlise de neighbour-joining (modelo de Kimura dois parmetros) do domnio D1/D2 do 26S rDNA. Schizosaccharomyces pombe foi includo para enraizar a rvore. Os valores em porcentagem do bootstrap de 1000 replicaes so dados a cada ramo (valores abaixo de 50% no so mostrados). A designao do isolado (CCMB) so indicados aps o nmero do acesso no GenBank, exceto no grupo externo............................ 73

13

LISTA DE GRFICOS

Grfico 01

Mercados globais de Enzima baseados nos setores da aplicao, 20022009 (milhes de dlares). Fonte: BCC Inc, 2004..................................... 39

Grfico 02

Atividade especfica (AE) da poligalacturonase (PG) em mol de cido galacturnico liberado por min/mg de protenas, obtida com 78 microrganismos leveduriformes isolado do Semi-rido baiano, crescidos em agitador rotatrio a 28C por 48 h em caldo de fermentao...............

Grfico 03

Atividade especfica (AE) da pectina liase (PL) em mol de grupos urondeos insaturados formados por min/mg de protenas, obtida com microrganismos leveduriformes isolado do Semi-rido baiano, crescidos em agitador rotatrio a 28C por 48 h em caldo de fermentao............... 82

14

LISTA DE TABELAS

Tabela 01

Classificao das enzimas pcticas segundo a Comisso de Enzimas (E.C.) adaptado de Jayani, Saxena e Gupta (2005).................................... 27

Tabela 02

Microrganismos leveduriformes isolados do Semi-rido baiano, substratos do qual foram isolados e seus respectivos 65 georeferenciamentos...................................................................................

Tabela 03

Atividade semiquantitativa da poligalacturonase e pectina liase extracelulares dos microrganismos leveduriformes isolados do Semirido baiano crescidos a 28C por 48 h em meios diferencial, estimada mediante o ndice enzimtico..................................................................... 69

Tabela 04

Caracterizao

molecular

dos

microrganismos

leveduriformes 72

pectinolticos isolados do Semi-rido baiano, a partir da anlise da sequncia do domnio D1/D2 da subunidade (26S) de rDNA................... Tabela 05 Biomassa seca, unidade de atividade da poligalacturonase, protena total e atividade especfica da poligalacturonase produzidas por microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, crescidos em caldo de fermentao em agitador rotatrio a 150 rpm, a 28C por 48 h................................................................................... Tabela 06 Biomassa seca, unidade de atividade da pectina liase, protena total e atividade especfica da pectina liase produzidas por microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, crescidos em caldo de fermentao em agitador rotatrio a 150 rpm, a 28C por 48 h.................................................................................................................. 84 81

15

LISTA DE ABREVIATURAS

AE: atividade especfica CCMB: Coleo de Culturas de Microrganismos da Bahia cm: centmetro EC: Comisso de Enzimas h: hora M: molaridade mg: miligramas min: minuto mL: mililitro MM: massa molar mM: milimolar nm: nanmetro p/v: relao em porcentagem entre o peso do soluto e o volume da soluo pb: pares de bases PG: poligalacturonase pH: potencial hidrogeninico PL: pectina liase PPBio: Programa de Pesquisa em Biodiversidade do Semi-rido rpm: rotaes por minuto seg: segundo UA: unidade de atividade v/v: relao em porcentagem entre o volume do soluto e o volume da soluo g: micrograma L: microlitro

16

SUMRIO

RESUMO........................................................................................................................... ABSTRACT...................................................................................................................... LISTA DE FIGURAS....................................................................................................... LISTA DE GRFICOS..................................................................................................... LISTA DE TABELAS....................................................................................................... LISTA DE ABREVIATURAS.......................................................................................... 1 INTRODUO.............................................................................................................. 2 OBJETIVOS................................................................................................................... 2.1 Objetivo Geral............................................................................................................. 2.2 Objetivos especficos................................................................................................... 3 Pectinases de interesse industrial e biotecnolgico produzidas por leveduras: UMA REVISO.......................................................................................................................... 3.1 As substncias pcticas................................................................................................ 3.2 As pectinases............................................................................................................... 3.2.1 Pectinesterases.......................................................................................................... 3.2.2 Enzimas despolimerizantes....................................................................................... 3.2.3 Protopectinases......................................................................................................... 3.3 Produo de pectinases por leveduras......................................................................... 3.3.1 Viso geral das leveduras......................................................................................... 3.3.2 Ocorrncia de pectinase em leveduras...................................................................... 3.3.3 Generalidades sobre os fatores que afetam a produo de pectinases em leveduras 3.4 Produo e aplicao industrial das pectinases........................................................... 3.4.1Processamento de frutas e vegetais........................................................................... 3.4.2 Produo de vinho.................................................................................................... 3.4.3 Indstria txtil........................................................................................................... 3.4.4 Extrao de leo....................................................................................................... 3.4.5 Fermentao do caf, ch e cacau............................................................................. 3.4.6 Rao animal............................................................................................................ 3.4.7 Purificao de vrus de plantas................................................................................. 3.4.8 Tratamento de guas residurias da indstria...........................................................

vi viii x xii xiii xiv 18 20 20 20 21 21 24 25 25 26 28 28 31 36 38 41 43 44 45 46 47 47 48

17

3.4.9 Indstria de papel e celulose..................................................................................... 3.5 O Semi-rido brasileiro como local potencial na obteno de enzimas...................... 4 MATERIAL E MTODOS............................................................................................ 4.1 Isolamento e purificao dos microrganismos leveduriformes do Semi-rido baiano 4.2 Preservao dos microrganismos isolados.................................................................. 4.3 Seleo dos microrganismos leveduriformes produtores de enzimas pectinolticas: a poligalacturonase (PG) e a pectina liase (PL)................................................................. 4.4 Identificao molecular dos microrganismos leveduriformes pectinolticos.............. 4.4.1 Extrao de DNA genmico..................................................................................... 4.4.2 Amplificao do domnio D1/D2 do 26S rDNA...................................................... 4.4.3 Sequenciamento dos produtos da PCR purificado................................................... 4.4.4 Anlise das seqncias............................................................................................. 4.5 Determinao da poligalacturonase (PG) e da pectina liase (PL) extracelulares produzidas por microrganismos leveduriformes em fermentao submersa..................... 4.5.1 Preparao das amostras para os ensaios enzimticos.............................................. 4.5.2 Determinao da unidade de atividade (UA) da poligalacturonase (PG)................. 4.5.3 Determinao da unidade de atividade (UA) da pectina liase (PL).......................... 4.5.4 Doseamento da protena total................................................................................... 4.5.5 Determinao da atividade especfica (AE) da poligalacturonase (PG)................... 4.5.6 Determinao da atividade especfica (AE) da pectina liase (PL)........................... 4.5.7 Determinao da biomassa....................................................................................... 4.5.8 Anlise estatstica..................................................................................................... 5 RESULTADOS E DISCUSSO.................................................................................... 5.1 Isolamento e purificao dos microrganismos leveduriformes do Semi-rido baiano 5.2 Seleo dos microrganismos leveduriformes produtores de pectinases extracelulares: a poligalacturonase (PG) e a pectina liase (PL)........................................ 5.3 Filogenia molecular e biodiversidade dos microrganismos leveduriformes pectinolticos...................................................................................................................... 5.4 Poligalacturonase (PG) e pectina liase (PL) extracelulares produzidas por microrganismos leveduriformes por meio de fermentao submersa............................... 5.4.1 Atividade da poligalacturonase (PG)........................................................................ 5.4.2 Atividade da pectina liase (PL)................................................................................ 5.5 Resumo dos resultados...............................................................................................

48 49 52 52 53 54 55 55 57 58 58 59 59 60 60 61 62 62 62 63 64 64 64 70 77 77 82 85

18

6 CONCLUSO................................................................................................................ REFERNCIAS................................................................................................................ APNDICE A Fotografias dos substratos do Semi-rido baiano, dos quais microrganismos leveduriformes produtores de pectinases extracelulares foram isolados.............................................................................................................................. APNDICE B Fotografias da microscopia de contraste de fase dos microrganismos leveduriformes produtores de enzimas pectinolticas extracelulares, isolados do Semirido baiano, crescidos em gar YM a 28C por 48 h, corados com azul de metileno 1% (p/v) e ampliao de 1.000x (imerso em leo).......................................................... APNDICE C - Seqncias amplificadas do domnio D1/D2 do 26S rDNA dos microrganismos leveduriformes produtores de enzimas pectinolticas extracelulares, isolados do Semi-rido baiano........................................................................................... APNDICE D - Curvas de calibrao............................................................................... ANEXO(S)........................................................................................................................ ANEXO A - Meios de cultura........................................................................................... ANEXO B - Solues, tampes e reagentes......................................................................

88 89

APNDICE(S)................................................................................................................... 102

102

104

107 116 118 118 120

18

1 INTRODUO

Desde a dcada de 30 que as pectinases so utilizadas em aplicaes comerciais na produo de vinhos e sucos de frutas (KASHYAP et al., 2001). Por outro lado, seu uso tem aumentado consideravelmente, especialmente nas indstrias de alimentos, bebidas e vinhos, txtil e de papel e celulose. Segundo Uenojo e Pastore (2006) estas enzimas correspondem cerca de 20% do mercado mundial de enzimas e so produzidas naturalmente por plantas, fungos, leveduras e bactrias. Apesar de clulas vegetais e animais serem tambm fontes de enzimas, do ponto de vista econmico e industrial, as enzimas extracelulares de microrganismos so preferveis devido ao custo de sua extrao, isolamento e purificao (SAID; PIETRO, 2002). As pectinases de origem microbiana correspondem a 25% do total de enzimas utilizadas na indstria alimentcia, sendo empregadas tradicionalmente na extrao e clarificao de suco de frutas em razo de sua especificidade e do seu potencial cataltico, melhorando o processo e qualidade do produto (JAYANI; SAXENA; GUPTA, 2005). No existem outros aditivos ou processos alternativos que se possam constituir em bons substitutos das enzimas pectinolticas nas indstrias alimentcias. Alm disso, a tendncia de aumento do consumo dessas enzimas pela incorporao ao mercado tanto de novos produtos quanto de pequenos produtores, os quais esto pouco a pouco se tecnificando (CANTO; MENEZES, 1995). Preparaes comerciais de pectinases so normalmente de origem fngica, especialmente do fungo filamentoso Aspergillus niger (BLANCO; SIEIRO; VILLA, 1999). Outros microrganismos tambm so capazes de produzir estas enzimas, tais como as leveduras dos gneros Kluyveromyces, Saccharomyces, Stephanoascus, Pichia,

19

Zygosacchoromyces, Candida, Debaryomyces, Pseudozyma, Cryptococcus, Leucosporidium, Metschnikowia, Rhodotorula, Torulaspora, Trichosporon, Kloeckera, Ambrosiozyma, Bullera, Geotrichum, Rhodosporidium, Saccharomycopsis e Ustilago, alm do fungo semelhante levedura Aureobasidium e de leveduras pretas (BIELY; SLVIKOV, 1994; STRAUSS et al., 2001; TRINDADE et al., 2002; BUZZINI; MARTINI, 2002; SILVA et al., 2005; OLIVEIRA et al., 2006). Assim sendo, as leveduras despertam grande interesse para a produo em larga escala, quando comparadas aos fungos filamentosos, em virtude de inmeras vantagens, destacandose, dentre outras, as seguintes: so unicelulares, o crescimento rpido e o meio do crescimento no requer um indutor (SILVA et al., 2005). O artigo de reviso de Steele e Stowers (1991) e o de Bull, Goodfellow e Slater (1992), enfatizam que, embora as modernas tcnicas de biologia molecular permitam manipular os microrganismos para gerar enzimas com propriedades desejveis, programas de seleo e triagem de microrganismos do ambiente so clssicos para prospeco de produtos de interesse industrial e biotecnolgico, pois microrganismos de uma mesma espcie em ambientes diferentes podem apresentar diversidade gentica. Desse modo, o Semi-rido baiano representa um grande campo prospeco biotecnolgica, pois leveduras adaptadas a esse ambiente fsico significativamente heterogneo, incluindo diferentes climas, sistemas de chuvas, relevos, solos e hidrografias, podem ser dotadas de caractersticas prprias, com peculiaridades de interesse industrial. Alm disso, pesquisas com estes microrganismos contribuem para o conhecimento da biodiversidade nativa da regio.

20

2 OBJETIVOS

2.1 Objetivo Geral

Selecionar microrganismos leveduriformes (leveduras e fungos semelhantes a leveduras) produtores de pectinases extracelulares do Semi-rido baiano.

2.2 Objetivos especficos

Isolar microrganismos leveduriformes de substratos do Semi-rido baiano; Selecionar microrganismos leveduriformes produtores de pectinases extracelulares; Identificar os microrganismos pectinolticos por meio da seqncia do domnio D1/D2 do 26S rDNA;

Verificar a atividade enzimtica das enzimas poligalacturonase (PG) e pectina liase (PL) produzidas pelos microrganismos pectinolticos;

Depositar os isolados pectinolticos na Coleo de Culturas de Microrganismos da Bahia (CCMB) da Universidade Estadual de Feira de Santana (UEFS).

21

3 Pectinases de interesse industrial e biotecnolgico produzidas por leveduras: UMA REVISO

3.1 As substncias pcticas

Substncia pctica o nome genrico usado para um grupo complexo de polissacardeos coloidais de elevado massa molecular, acidificado e carregado negativamente, que ocorre principalmente na lamela mdia e nas paredes celulares de vegetais superiores associadas celulose e hemicelulose, contribuindo na firmeza e estrutura dos seus tecidos (Figura 01) (GUMMADI; PANDA, 2003; JAYANI; SAXENA; GUPTA, 2005).

Figura 01. Estrutura da parede celular vegetal. Fonte: IPPA, http://www.ippa.info/what_is_pectin.htm

A cadeia principal dos polissacardeos pcticos constituda de resduos de cido Dgalacturnico unidos por ligaes - (1 4), intercalados ou no por resduos de ramnose, e cadeias laterais contendo principalmente arabinose, galactose e xilose (ALKORTA et al.,

22

1997; KASHYAP et al., 2001). Os grupos carboxlicos do cido galacturnico podem estar parcialmente esterificados por grupos metil e parcial ou completamente neutralizados por ons sdio, potssio ou amnio (KASHYAP et al., 2001). Detalhes da molcula pctica so ilustrados nas Figuras 02 e 03.

Figura 02. Estrutura da pectina. Fonte: Cook e Stoddart (1973) apud Sakai et al. (1993).

Figura 03. Unidade de cido galacturnico. Fonte: IPPA, http://www.ippa.info/what_is_pectin.htm

23

A Sociedade Americana de Qumica classificou as substncias pcticas conforme descrito a seguir (SAKAI et al., 1993; HOONDAL et al., 2002):

Protopectina designao atribuda s substncias precursoras das substncias pcticas, que apresentam como caracterstica a insolubilidade na gua; alm disto, quando hidrolisada transforma-se em cidos pectnicos ou pectina.

cido pctico - nome dado s substncias pcticas compostas na maior parte de cidos poligalacturnicos coloidais, essencialmente livres de grupos metil steres. Os sais destes cidos so chamados de pectatos.

cidos pectnicos - termo usado para designar o cido poligalacturnico coloidal que contm uma quantidade significativa de grupos metil steres (maior que zero e menor que 75%), que, sob condies adequadas, podem formar gis com acar em meio cido ou na presena de certos ons metlicos. Os sais destes cidos denominam-se pectinatos.

Pectina(s) denominao dada ao material polimrico solvel em gua no qual, aproximadamente 75% dos grupos carboxilas das unidades do cido galacturnico esto esterificados com metanol. Assim como os cidos pectnicos, a pectina tambm capaz de formar gis com acar em meio cido sob condies adequadas. Genericamente, as pectinas com mais da metade dos grupos carboxila esterificados com metanol, so chamadas de pectinas com alto grau de metoxilao e com menos da metade, de pectinas com baixo grau de metoxilao, que pode tambm possuir grupos amida. A pectina pode ser usada em um grande nmero de alimentos como agente

24

gelificante, espessante, texturizante, emulsificante e estabilizador (THAKUR et al., 1997, ASSIS, 2004).

3.2 As pectinases

Enzimas pcticas, pectinases ou enzimas pectinolticas so um grupo heterogneo de enzimas relacionadas que catalisam a degradao das substncias pcticas nos vegetais (BLANCO; SIEIRO; VILLA, 1999; JAYANI; SAXENA; GUPTA, 2005), sendo ilustrados seus modos de ao na Figura 04.

Figura 04. Modo de ao das enzimas pectinolticas. Fonte: Sakai et al. (1993).

As enzimas pectinolticas so produzidas pelos vegetais, tendo importncia na maturao dos frutos, crescimento, absciso e desenvolvimento do plen (BLANCO; SIEIRO; VILLA,

25

1999). Por outro lado, tambm so produzidas por bactrias, fungos filamentosos, leveduras, insetos, nematides e protozorios (HOONDAL et al, 2002). As pectinases podem ser classificadas em trs grupos (SAKAI et al., 1993; ALKORTA et al., 1997; KASHYAP et al., 2001; JAYANI; SAXENA; GUPTA, 2005):

3.2.1 Pectinesterases

As pectinesterases so enzimas que catalisam a desesterificao do grupo metoxlico da pectina produzindo lcool metlico e cido pctico, sendo produzidas por fungos filamentosos, leveduras e plantas superiores, estando presentes em praticamente todos preparados comerciais de enzimas pectinolticas.

3.2.2 Enzimas despolimerizantes

As enzimas despolimerizantes rompem as ligaes glicosdicas -(1-4) entre os monmeros galacturnicos das substncias pcticas, podendo atuar por hidrlise (hidrolases) ou por transeliminao (liases). As hidrolases so classificadas em dois grupos. Desse modo, aquelas que preferem o pectato como substrato, so chamadas de poligalacturonases (endo ou exo) e, aquelas que tm preferncia pela pectina so chamadas de polimetilgalacturonases (endo ou exo). Os prefixos endo e exo denotam uma clivagem randmica ou terminal pelas enzimas sob os monmeros galacturnico dos substratos, respectivamente. As endopoligalacturonases so enzimas produzidas por uma variedade de

microrganismos, como muitos fungos filamentosos, bactrias e leveduras. Elas tambm so encontradas em plantas superiores e em alguns nematides parasitas de planta. Por outro lado,

26

as exopoligalacturonases ocorrem menos freqentemente, sendo produzidas por fungos filamentosos e algumas bactrias. As poligalacturonases so, dentre as enzimas pectinolticas, as mais estudadas, tanto pelo seu papel biolgico na interao planta-fungo quanto pela sua utilizao industrial, sendo a atividade enzimtica determinada com base no aumento do nmero dos grupos redutores formados e diminuio da viscosidade dos substratos da soluo, durante a reao enzimtica (MILLER, 1959). As liases tambm so classificadas em dois grupos: poligalacturonato liases (endo e exo), tambm chamadas de pectato liases, as quais tm preferncia pelo pectato como substrato, e as polimetilgalacturonato liases (endo e exo), que preferem a pectina como substrato, tambm conhecidas como pectina liases. As poligalacturonato liases so enzimas produzidas por muitas bactrias e alguns fungos patognicos, sendo a endopoligalacturonato liase mais abundante. Poucos trabalhos tm relatado a produo de polimetilgalacturonato liases. O mtodo mais empregado na deteco da atividade da liase medir o aumento da absorbncia a 235 nanmetros, devido formao de dupla ligao entre os carbonos envolvidos na reao, gerando produtos insaturados (ALBERSHEIM, 1966).

3.2.3 Protopectinases

As protopectinases so enzimas que solubilizam protopectina, formando pectina solvel altamente polimerizada. Alm do mais, podem ser divididas em tipo A, que atuam na regio do cido poligalacturnico da protopectina, e tipo B, que atuam nas cadeias de polissacardeos que conectam as cadeias do cido poligalacturnico aos constituintes da parede celular

27

vegetal. Deve-se mencionar ainda que, o tipo A encontrado em leveduras e fungos semelhantes a leveduras (yeast-like), enquanto que o tipo B em bactrias. A Comisso de Enzimas (E.C.) da Unio Internacional de Bioqumica e Biologia Molecular definiram critrios para a classificao e denominao das enzimas. A mais recente e elaborada classificao para as pectinases so encontradas na Tabela 01.

Tabela 01. Classificao das enzimas pcticas segundo a Comisso de Enzimas (E.C.), adaptado de Jayani, Saxena e Gupta (2005).

28

3.3 Produo de pectinases por leveduras

Segundo artigo de reviso de Blanco, Sieiro e Villa (1999), a produo de enzimas pectinolticas por bactrias e fungos filamentosos foi extensamente estudada e relatada, devido ao seu papel na fitopatognese; enquanto que, a produo destas enzimas por leveduras recebeu menos ateno. Na citada reviso, os pesquisadores atriburam mais que um papel ecolgico para as pectinases secretadas por leveduras, elas poderiam estar envolvidas ainda na colonizao dos frutos, pois a sua produo causaria a degradao do tecido da fruta e concomitantemente liberao dos acares das clulas, que, por sua vez, podem ser assimilados para o crescimento da levedura, o que causaria o apodrecimento do fruto.

3.3.1 Viso geral das leveduras

Os fungos so seres eucariontes, de nutrio quimio-heterotrfico absorvitiva, predominantemente aerbios, com temperatura tima de crescimento entre 25 a 30 C e pH de 4 a 7, podendo apresentar-se sob a forma leveduriforme ou filamentosa (ALEXOPOULOS; MIMS; BLACKWELL, 1996). As leveduras so formadas por clulas nicas, caracteristicamente esfricas ou ovais, que se reproduzem assexuadamente por brotamento ou fisso. No entanto, algumas leveduras produzem brotos que no separam uns dos outros, formando pseudomiclio. Alm disso, alguns fungos exibem dimorfismo, ou seja, podem crescer tanto na forma de fungo filamentoso quanto na forma de levedura (ALEXOPOULOS; MIMS; BLACKWELL, 1996; LOGUERCIO-LEITE; ESPOSITO, 2004).

29

Na natureza as leveduras podem ocupar diversos nichos ecolgicos, j que so capazes de utilizar diversos substratos para sua nutrio absortiva. Essa caracterstica permite que as leveduras secretem ao meio, enzimas extracelulares que degradam macromolculas a molculas pequenas, que sero incorporadas e utilizadas nutricionalmente. Contudo, esses microrganismos no so tipicamente degradadores de polmeros, preferindo habitats onde abundam os acares solveis, tais como nectrio das flores e a superfcie de frutas (ALEXOPOULOS; MIMS; BLACKWELL, 1996; SANTOS et al., 1996; GALVAGNO; FORCHIASSIN, 2004). As leveduras so tradicionalmente identificadas atravs de tcnicas convencionais, baseadas em caractersticas morfolgicas (macro e micro) e fisiolgicas, entre as quais: fermentao de diferentes fontes de carbono, assimilao de diferentes fontes de carbono e nitrognio, crescimento em diferentes temperaturas, crescimento em diferentes concentraes de glicose e cloreto de sdio, tolerncia ao cido actico, produo extracelular de compostos amilides, colorao com diaznio azul B e resistncia a ciclohexamida (YARROW, 1998). Segundo Alexopoulos, Mims e Blackwell (1996), as leveduras podem ser classificadas como pertencente aos ascomicetos, basidiomicetos ou fungos mitospricos. Nos ltimos anos, com a introduo de novas tcnicas biotecnolgicas grandes progressos na taxonomia de leveduras vm ocorrendo (ORBERA-RATON, 2004). Para Valente, Ramos e Leoncini (1999), o DNA ribossmico (rDNA) muito empregado em estudos taxonmicos devido presena de regies que evoluem em diferentes taxas, servindo como base para anlise das relaes evolucionrias (Figura 05).
ITS-1 5 18S 5.8S 25-28S 5S ITS-2 IGS-1 IGS-2 3

Figura 05. Estrutura da unidade de DNA ribossomal (rDNA), o qual consiste de seqncias altamente conservadas codificadoras dos RNAs ribossomais (rRNAs) 18S, 5,8S e 28S, intercaladas com regies no codificadoras menos conservadas (ITS e IGS). Fonte: adaptado de VILGALYS LAB, http://www.biology.duke.edu/fungi/mycolab/primers.htm

30

As seqncias do domnio D1/D2 da subunidade maior (26S) do rDNA, que so entre as regies as mais variveis dentro do gene inteiro, esto disponveis para todas as espcies conhecidas de leveduras ascomicticas (KURTZMAN; ROBNETT, 1995, 1997, 1998). Estes dados esto disponveis tambm para leveduras basidiomicticas, embora em alguns casos seja necessrio seqnciar mais de uma regio do DNA para se obter uma identificao precisa (FELL et al. 2000). Neste caso, tem-se escolhido as regies internas no codificadoras (ITS1 e ITS2) e as regies no codificadoras intergnicas (IGS1 e IGS2) (FELL; BLATT, 1999; SCORZETTI et al., 2002). De outra parte, a abordagem baseada em uma combinao de mtodos clssicos (fenotpicas) e moleculares (genotpicas), tem resultado na descoberta de novas espcies e rearranjos taxonmicos das j conhecidas (MANFIO, 2000; JESPERSEN et al., 2005; LOPANDIC et al., 2006; LEAW et al., 2006). Sem as leveduras no existiriam bebidas fermentadas como cervejas e vinhos, e outros alimentos nos quais esses microrganismos tm papel de destaque em sua produo, como tambm na produo de po e queijo. Deve-se mencionar ainda que as leveduras so responsveis pela produo de enzimas de interesse industrial e de valor econmico, destacando-se as pectinases (ALEXOPOULOS; MIMS; BLACKWELL, 1996; ESPOSITO; AZEVEDO, 2004). A Figura 06 descreve, de um modo geral, a aplicao biotecnolgica das leveduras em diversas reas cientficas. Atualmente, h um grande interesse industrial e biotecnolgico e, na verdade, um sentido de urgncia sobre a documentao da biodiversidade das leveduras no Brasil, onde, invariavelmente, uma porcentagem das espcies encontradas ainda desconhecida para a cincia (SANTOS et al., 1996; MANFIO, 2000; BUZZINI; MARTINI, 2002; FUENTEFRIA, 2004; MORAES; ROSA; SENE, 2005; RUIVO et al. 2006; ROSA et al., 2007). Hawksworth

31

(2001) estima a existncia de 1,5 milhes de espcies de fungos no planeta, e menciona que apenas 5% da diversidade conhecida.

Tecnologia das fermentaes


Fermento de padeiro, etanol, produtos resultantes da fermentao.

Tecnologia Ambiental
Biossoro de metais, utilizao de efluentes.

Indstria alimentar / qumica


Aromas, enzimas, pigmentos, aditivos alimentares, redutores qumicos.

Investigao biomdica
Cancro, SIDA, gentica Humana, metabolismo de drogas.

Sade pblica
Vacinas, hormnios, factores sanguneos, probiticos, produtos farmacuticos.

Investigao biolgica
Biologia celular, gentica, bioqumica, biologia molecular.

Figura 06. Diversidade de reas que envolvem a biotecnologia das leveduras. Fonte: Walker (1998) apud Pinheiro (2004).

3.3.2 Ocorrncia de pectinase em leveduras

A partir da observao de que os trabalhos discordavam sobre a produo de pectinase por leveduras, os pesquisadores Luh e Phaff (1951), realizaram um estudo qualitativo com vista a evidenciar a produo de poligalacturonase por estes microrganismos. Os referidos autores testaram um grande nmero de espcies e linhagens de leveduras em meio lquido contendo pectina ctrica como substrato, todas oriundas da Division of Food Technology, University of

32

Califrnia, Estados Unidos. No entanto, somente seis culturas foram capazes de degradar a pectina do meio, clarificando-o, sendo identificadas como Saccharomyces fragilis e sua forma anamrfica Candida pseudotropicalis. Aps a pesquisa de Luh e Phaff (1951), outros pesquisadores passaram a investigar a produo de pectinase extracelular por leveduras. Sanchez, Guiraud e Galzy (1984), estudaram a atividade pectinoltica de leveduras isoladas na Costa do Marfim durante a fermentao do cacau, alm de outras linhagens obtidas na Ecole Nationale Superieure de Agronomie, Frana. Conforme foi verificado por estudos viscosimtrico, as leveduras Torulopsis candida, Candida norvegenesis,

Kluyveromyces fragilis e Saccharomyces chevalieri degradaram a pectina do meio de cultura, sendo as quatro positivas para poligalacturonase. No entanto, leveduras positivas para a pectina liase no foram encontradas nesse estudo. Outro mtodo para deteco de levedura produtora de poligalacturonase foi descrito por McKay (1988). Segundo esse mtodo, aps o crescimento da cultura em placa de agarose com cido poligalacturnico como substrato, se recobre a superfcie da placa com soluo de vermelho de rutnio. Sem a degradao da poligalacturonase, o vermelho de rutnio no penetra no meio, sendo facilmente lavado. Nesse caso, a degradao do cido poligalacturnico detectada pela formao de halo vermelho intenso ao redor da colnia. Ainda, segundo esse trabalho, as leveduras produtoras de poligalacturonase foram: Cryptococcus macerans NCYC 578, Candida toressi NCYC 786, Kluyveromyces marxianus NCYC 587 e C. pseudotropicalis NCYC 744, todas elas obtidas da National Collection of Yeast Culturres, Inglaterra. Em 1994, Biely e Slvikov, propuseram um mtodo similar para seleo de leveduras pectinolticas em meio slido. Entretanto, este mtodo consiste na precipitao da pectina ctrica no degradada em meio slido, aps a adio de brometo de cetil trimetil de amnio;

33

onde as linhagens positivas mostram reas transparentes em torno das colnias. Dentre os gneros de leveduras que exibiram halo de degradao nesse trabalho, tm-se: Ambrosiozyma, Aureobasidium, Bullera, Candida, Cryptococcus, Georrichum, Klyuveromyces,

Leucosporidium, Rhodosporidium, Saccharomycopsis, Strephanoascus, Trichosporon e Ustilago, todas elas provenientes da Culture Collection of Yeasts (CCY), Eslovquia. No Brasil, em 1997, Schwan, Cooper e Wheals, isolaram, identificaram e depositaram na Coleo de Culturas Tropicais da Fundao Tropical "Andr Tosello" (CCT), Brasil, as linhagens de leveduras oriundas da fermentao do cacau. No mesmo trabalho, as linhagens Kluyveromyces marxianus CCT 3172, K. thermotolerans CCT 1701, Saccharomyces cervisiae var. chevalieri CCT 1698 e Candida rugopelliculose CCT 1702 foram hbeis na secreo de poligalacturonase em meio lquido contendo pectina. Strauss et al. (2001), pesquisaram a produo de enzimas extracelulares de 245 leveduras no Saccharomyces, isoladas de vinhedos da frica do Sul, tendo em vista o seu uso como catalisadores durante a fermentao do vinho. Dentre outras enzimas, a pectinase foi estudada por esses pesquisadores, sendo utilizado o meio slido contendo cido poligalacturnico para deteco da produo da enzima. Entre as leveduras pectinolticas, foram encontradas duas linhagens de Candida stellata, uma de C. oleophila, uma de C. pulcherrima, uma de C. valida e quatro de Kloeckera apiculata. Por sua vez, Trindade et al. (2002), investigaram tanto a biodiversidade de leveduras em frutas maduras e em polpa de fruta congelada coletadas no Brasil, quanto produo de enzimas por estas, incluindo pectinase, tendo em vista sua aplicao industrial. Assim, entre as 381 linhagens pesquisadas nesse trabalho, somente 16 produziram pectinases extracelulares, em meio slido contendo cido poligalacturnico, conforme listadas a seguir: levedura preta, Candida azyma, levedura semelhante a C. bombicola, C. krusei, Leucosporidium scotii, Metschnikowia spp., Pichia membranifaciens, P. antarctica, levedura

34

semelhante a P. fusiformata, Rhodotorula graminis, R. marina, levedura semelhante a Torulaspora delbrueckii, Trichosporon spp., fungo semelhante a levedura e duas linhagens de Cryptococcus spp. Buzzini e Martini (2002) pesquisaram a produo de pectinase extracelular por leveduras e fungos semelhantes a leveduras. Neste trabalho, os 394 microrganismos testados para diferentes enzimas, foram isolados de solo, gua, inseto e plantas coletadas em florestas do Brasil. Os citados autores relataram produo de pectinase, em meio slido com pectina, pelas linhagens Candida sake, Pichia guilliermondii, P. spartinae, correspondendo 1,5% do total de linhagens positivas dos ascomicetos; Pseudozymas antarctica, correspondendo a 18,7% do total de linhagens positivas dos basidiomiceto; Aureobasidium pullulans, correspondendo a 21,7% do total de linhagens positivas dos fungo semelhante a levedura. Este estudo demonstrou o potencial de microrganismos isolados de ambiente tropical, como fontes de enzimas de interesse industrial e biotecnolgicas. No trabalho de Nakagawa et al. (2004), leveduras psicrfilas foram isoladas do solo em Abashiri no Japo, e testadas quanto a produo de enzimas pectinolticas em baixas temperaturas, usando meio slido contendo pectina. Nesse trabalho, foram encontradas trs espcies de leveduras psicrfilas pectinolticas, que podem ser utilizadas na indstria de alimentos, so elas: Cryptococcus cylindricus, Mrakia frigida e Cystofilobasidium capitatum. J no trabalho de Silva et al. (2005), de um total de 300 leveduras isoladas de frutas frescas e polpas de frutas tropicais do Brasil e da Colmbia, 21 foram positivas para poligalacturonase, usando como substrato em meio slido o cido poligalacturnico. Essas 21 foram: Kluyveromyces wickerhamii (3), Stephanoascus smithiae (5), Debaryomyces hansenii (2), D. polymorphus (1), Candida intermedia (1), C. pseudoglaebosa (1), C. krusei (1), Zygosacchoromyces fermentati (1), Z. cidri (1), Pichia guilliermondii (2), P. angusta (1), P. anomala (1), Pichia sp. (1). As leveduras S. smithiae (isolados FT-01, 168, 36 e 147), Pichia

35

sp. (FT-28), P. anomala (SL-125) e K. wickerhamii (185), tambm foram capazes de secretar pectina liase, no entanto, em meio contendo pectina como substrato. Mais recentemente, Oliveira et al. (2006) analisaram 201 isolados da levedura Saccharomyces cerevisiae quanto atividade pectinoltica de poligalactuonase e pectinase em meio slido, utilizando cido poligalacturnico e pectina como substrato, respectivamente. Todos esses isolados foram provenientes de amostras do leite de leveduras coletadas em uma fbrica de etanol ctrico no Brasil. Neste trabalho os autores encontraram 107 isolados que apresentaram secreo da poligalacturonase e 97 da pectinase. Deve-se ainda mencionar o trabalho de Uenojo e Pastore (2006). Por sua vez, esses pesquisadores isolaram 104 leveduras, de resduos de agroindstrias, e as testaram quanto produo de pectinase em meio slido contendo pectina ctrica, as quais 18 foram consideradas positivas. A aparente contradio entre os resultados encontrados por Luh e Phaff (1951), e dos pesquisadores mais recentes, podem ser devido ao mtodo empregado em cada caso (BLANCO; SIEIRO; VILLA, 1999). Nos trabalhos recentes, os pesquisadores passaram a aferir a produo de pectinase extracelular pelas leveduras atravs da formao de halo de degradao do substrato em meio slido (Figura 07). O uso de meio slido, ao contrrio do meio lquido, permite a triagem de uma grande quantidade de microorganismos, possibilitando uma rpida deteco de enzimas especficas, alm da determinao de variantes fisiolgicos (BIELY; SLVIKOV, 1994; STRAUSS et al., 2001; TRINDADE et al., 2002; BUZZINI; MARTINI, 2002; FUENTEFRIA, 2004; SILVA et al., 2005; OLIVEIRA et al., 2006; UENOJO; PASTORE, 2006). Cabe comentar que Kluyveromyces marxianus uma levedura anteriormente designada K. fragilis ou Saccharomyces fragilis (ROSE; HARRISON, 1969 apud PEREIRA, 2005).

36

3.3.3 Generalidades sobre os fatores que afetam a produo de pectinases em leveduras

O estudo regulatrio de sntese e excreo de enzimas por microrganismos um aspecto do metabolismo celular de grande interesse para a indstria produtora de enzimas, sendo dependente da linhagem selecionada, da forma de conduo do processo fermentativo e das caractersticas do meio de cultivo (SCHMIDELL, 2001).

Figura 07. Halo de hidrlise do cido poligalacturnico originado por Saccharomyces cerevisiae CECT 1389, proveniente da Spanish Type Culture Collection, Espanha. Fonte: Blanco et al. (1994) apud Blanco, Sieiro e Villa (1999).

Segundo Said e Pietro (2002), as enzimas produzidas pelos microrganismos podem estar localizadas dentro da clula (enzimas intracelulares), ou podem ser sintetizadas e posteriormente excretadas no meio (enzimas extracelulares); sendo esta produo influenciada pela fonte de carbono, tenso de oxignio, pH do meio de cultivo, tempo de incubao e tamanho do inoculo. Conforme Galvagno e Forchiassin (2004), muitas vezes, as enzimas necessrias para viabilizar o metabolismo bsico de um fungo esto sempre presentes e so enzimas constitutivas; em outros casos, necessria a presena do substrato para induzir a sntese ou a atividade da enzima para sua degradao, so as enzimas induzveis. Alm do mais, para os

37

citados autores, os fungos podem produzir enzimas adaptativas na presena de um substrato que, normalmente no utilizam. No trabalho de McKay (1988), as leveduras Kluyveromyces marxianus NCYC 587 e a Candida pseudotropicalis NCYC 744, produziram a poligalacturonase em meio contendo glicose como substrato, nesse caso a enzima foi constitutiva. Por outro lado, no mesmo trabalho, as leveduras Cryptococcus macerans NCYC 578 e a Candida toressi NCYC 786, produziram poligalacturonase quando utilizou o cido poligalacturnico como nica fonte de carbono e de energia, indicando que a secreo da enzima foi induzida. Entretanto, o trabalho de Schwan e Rose (1994) demonstrou que a produo de poligalacturonase sob condies anaerbicas acontece somente durante a fase de crescimento da levedura Kluyveromyces marxianus CCT 3172, isolada da fermentao do cacau, sendo uma capacidade constitutiva, porque pectina, cido poligalacturnico e cido galacturnico, no foram requeridos para induzir a sntese desta enzima. Alm do mais, uma fonte de carbono e de energia facilmente metabolizvel, como a glicose 1% (p/v), foi requerida para regular a atividade pectinoltica, no ocorrendo o processo de represso catablica nesta concentrao de acar. Said e Pietro (2002) chamam de represso catablica o processo pelo qual a sntese de determinadas enzimas, em uma seqncia metablica, suprimida quando uma fonte de carbono facilmente metabolizvel est presente. J o trabalho de Moyo et al. (2003), que apresenta a otimizao das condies de crescimento e da atividade pectinoltica da levedura Kluyveromyces wickerhamii pela metodologia de superfcie de resposta, aponta que a produo de poligalacturonase extracelular por essa linhagem foi parcialmente constitutiva; pois, a presena de pectina [1%(p/v)] no meio contendo glicose [1%(p/v)] aumentou em aproximadamente 50% a atividade pectinoltica. Alm disso, as melhores condies estimadas para a atividade foram

38

na combinao das seguintes variveis independentes: pH 5,0, temperatura 32 C e 91 horas de incubao. Esse trabalho indicou ainda que o extrato cru com a enzima foi termoestvel em vrias temperaturas quando na presena de ons Ca2+, sendo inibido pelos ons Mg2+, Zn2+, Co2+, Mn2+ e Na+. Em sentido amplo, Said e Pietro (2002) consideram que a produo de pectinases extracelulares pelos microrganismos requer muitas vezes um indutor, por exemplo, a pectina. Devendo-se ainda destacar que em alguns casos, a principal fonte de carbono pode tambm servir como indutor. Da mesma forma, Hoondal et al. (2002) em artigo de reviso relatam que as enzimas pectinolticas microbianas so induzidas. Com base nas consideraes de Blanco, Sieiro e Villa (1999), dois tipos de leveduras podem ser discernidos quanto produo de enzimas. Um grupo compreende aquelas incapazes de usar a pectina, o pectato ou seus produtos da hidrlise (cido galacturnico) como fonte de carbono. O outro grupo abrange as leveduras que, assim como fungos semelhantes a leveduras, tm habilidade de crescer usando substncias pcticas com a nica fonte de carbono, sugerindo um sistema enzimtico mais complexo.

3.4 Produo e aplicao industrial das pectinases

A utilizao de enzimas de forma geral e, em particular o uso industrial, tender a aumentar no futuro, porque grande parte dos produtos manufaturados, em pases desenvolvidos, de origem biolgica e tambm porque os custos das enzimas utilizadas tm declinado (ABRAHO NETO, 2001). Atualmente, apenas 5% das enzimas comercialmente importantes so produzidas por fermentao, em estado slido (SAID; PIETRO, 2002). A produo de enzimas em escala industrial se faz majoritariamente por fermentao submersa (SANTANNA JR., 2001). Os

39

processos de fermentao submersa dominam a produo da maioria das enzimas comerciais, principalmente, porque o controle do processo mais fcil neste sistema, predominando os reatores agitados mecanicamente (SANTANNA JR., 2001; SAID; PIETRO, 2002). O mercado industrial total de enzima em 2009 espera alcanar quase 2,4 bilhes de dlares (Grfico 01). Em artigo de reviso, Jayani, Saxena e Gupta (2005), relatam que as pectinases microbianas correspondem a 25% das vendas globais de enzimas para indstria de alimentos. As primeiras aplicaes comerciais das pectinases foram realizadas em 1930 na produo de vinhos e sucos de frutas (KASHYAP et al., 2001). Atualmente, a maioria das preparaes comerciais deste grupo de enzimas produzida por fungos filamentosos, sendo o Aspergillus niger a principal fonte (BLANCO; SIEIRO; VILLA, 1999).

Milhes de dlares

Enzimas para a transformao de matrias primas

Enzimas para a indstria de alimentos

Enzimas para a indstria de rao animal

Grfico 01. Mercados globais de Enzima baseados nos setores da aplicao, 2002-2009 (milhes de dlares). Fonte: BCC Inc, 2004.

40

Alm do mais, o A. niger tm o status de microrganismo GRAS (Generally Regarding As Safe), produzindo vrias pectinases, incluindo poligalacturonase, pectina liase e a indesejvel pectinesterase (BLANCO; SIEIRO; VILLA, 1999). Alm destas enzimas so produzidas outras (amilase, por exemplo), assim como metablitos (metanol, por exemplo) que conferem uma grande complexidade soluo, conduzindo a maiores dificuldades tcnicas e financeiras no processo de separao (BLANCO; SIEIRO; VILLA, 1999; SILVA et al., 2005; PEREIRA, 2005). Para Solis, Flores e Huitron (1990), em fungo filamentoso a produo das enzimas pcticas regulada por um indutor e mecanismos de represso catablica. As leveduras representam uma alternativa produo das pectinases, pois algumas linhagens produzem somente um tipo de enzima pectinoltica (poligalacturonase ou pectina liase) e geralmente no apresentam atividade para pectinesterase, dando origem a misturas menos complexas (BLANCO; SIEIRO; VILLA, 1999; SILVA et al., 2005; PEREIRA, 2005). No caso da levedura Kluyveromyces marxianus, cerca de 90% do total de protena secretada so poligalacturonase (BARNBY, 1987 apud PEREIRA, 2005); alm disso, K. marxianus tambm considerado microrganismo GRAS (BLANCO; SIEIRO; VILLA, 1999; PEREIRA, 2005). Alm disso, com a manipulao gentica de microrganismos pectinolticos, como linhagens das leveduras Saccharomyces cerevisiae e Kluyveromyces marxianus, possvel aumentar a produo da enzima desejada de modo a tornar o processo rentvel industrialmente (JIA; WHEALS, 2000). Gene para poligalacturonase da levedura Saccharomyces cerevisiae envolvido na degradao da pectina tem sido clonado e seqenciado, resultando em hiperexpresso em linhagem no pectinoltica (GOGNIES et al., 1999). O trabalho de Blanco et al. (1998), por sua vez, mostrou que a expresso do gene

41

pectinoltico de diversas linhagens de Saccharomyces cerevisiae dependeu do plasmdio usado e da base gentica de cada linhagem. Os seguintes tpicos discorrem sobre algumas das convencionais e novas aplicaes das enzimas pectinolticas.

3.4.1 Processamento de frutas e vegetais

O consumo de sucos, nctares e polpas a base de frutas e vegetais tem registrado um expressivo crescimento no mundo, tanto por seus sabores quanto por suas propriedades nutritivas. De outra parte, o uso de enzimas nas etapas de produo tem aumentado o rendimento e a qualidade destes produtos (BHAT, 2000). As enzimas pectinolticas so componentes importantes em toda a tecnologia empregada no processamento de frutas e vegetais, sendo usadas geralmente para extrao, clarificao e estabilizao da turbidez (BHAT, 2000; JAYANI; SAXENA; GUPTA, 2005). Assim sendo, a pectinase empregada no processo de extrao para reduzir a viscosidade e aumentar o rendimento do processo. Tambm usada na clarificao a fim de remover partculas responsveis pela turbidez, conferindo melhor aparncia aos produtos finais, visando alcanar melhor aceitao dos mesmos, por parte dos consumidores (CANTO; MENEZES, 1995). Muitas vezes, as pectinases esto disponveis na forma de misturas com outras enzimas, ou seja, como complexos enzimticos, contendo tambm celulase, hemicelulase e xilanase (BHAT, 2000; KASHYAP et al., 2001). Segundo Canto e Menezes (1995), no suco de ma o uso de complexos enzimticos muito importante para hidrolisar a pectina que ocorre em grande quantidade nessa fruta, mesmo nas mas mais maduras. J na produo de suco clarificado de limo, emprega-se um

42

complexo contendo pectinase e celulase para atuar tanto na hidrlise da pectina, quanto na membrana externa da clula contendo o suco da fruta. No caso do suco de uva, no so empregados complexos enzimticos por estes conterem celulases, as quais levariam extrao de muita polpa, o que no desejvel quando o objetivo obter suco clarificado. Cardoso et al. (1998), utilizaram complexos pectinolticos e enzimticos para aumentar o rendimento e reduzir a viscosidade do suco de banana. Assim, o suco obtido com pectinase comercial (Clarex) apresentou rendimento 9% maior que aquele obtido com pectinase e celulase (Sigma), sugerindo que a concentrao de pectinase na Clarex teria sido maior do que a encontrada no Sigma. Em artigo de reviso, Bhat (2000) menciona que a macerao enzimtica na produo de nctares e polpas de frutas possui grande valor industrial e comercial, particularmente no aproveitamento de frutas tropicais facilmente perecveis, como manga, goiaba e mamo. J na reviso de Lang e Drnenburg (2000), considera-se que as poligalacturonases fngicas so utilizadas no processamento de sucos para aumentar o seu rendimento, pois facilita a macerao e filtrao. Granada, Vendruscolo e Treptow (2001), utilizaram enzimas pectinolticas na extrao do suco de amora-preta, incrementando o rendimento em 52% na prensagem da polpa. Alm disso, a utilizao do preparado enzimtico resultou em um suco mais encorpado, com mais cor e sabor, sendo preferido pelos consumidores. Por sua vez, Bastos et al. (2002) com o objetivo de aumentar o rendimento durante o processo de extrao da polpa de cupuau, adicionaram polpa bruta dois tipos de preparaes enzimticas de ao pectoltica (Citrozym-L e Rohament-PL). A utilizao destas preparaes enzimticas comerciais apresentou efeitos relevantes no aumento do rendimento da extrao da polpa, onde a Citrozym-L mostrou maior eficincia durante o processo de extrao, devido a sua constituio com pectinases, celulases e arabinases.

43

No trabalho de Santini (2004), a hidrlise enzimtica utilizando Pectinex AFP L-3 (Novozymes) apresentou-se muito eficiente no processo de clarificao do suco de pssego, devido reduo da viscosidade e dos slidos suspensos. Semenova et al. (2006) utilizaram pectina liase de fungo para a produo do suco de cranberry e na clarificao do suco de ma, sendo esta pectinase mais eficientemente na remoo da pectina altamente esterificada.

3.4.2 Produo de vinho

Outra grande rea importante de utilizao de pectinase a indstria de vinhos. Na indstria de vinho, frequentemente, so usadas formulaes prontas contendo um complexo constitudo de pectinases, celulases e proteases. No caso dos vinhos brancos empregada pectinase durante o processamento, para obter um maior rendimento de extrao e para facilitar a prensagem. Entretanto doses excessivas da enzima, empregadas para aumentar a extrao tambm pode extrair os polifenis da casca da uva, os quais oxidam o vinho branco, tornando-o amarelo. No caso dos vinhos tintos, as enzimas nem sempre so empregadas logo aps o esmagamento, porque a casca fica em contato com o mosto por um tempo muito mais prolongado. Assim, na produo de vinhos tintos de alta qualidade, as enzimas so empregadas apenas na fase de acabamento do produto, aps a fermentao, para, to somente, clarificar o vinho (CANTO; MENEZES, 1995). Fertonani et al. (2006) obtiveram em condies semelhantes s observadas no setor industrial, vinhos de ma utilizando o mosto despectinizado com uma pectinase de nome comercial Pectinex 3XL (Novozymes).

44

3.4.3 Indstria txtil

O retting microbiano um processo antigo, muito utilizado pela indstria txtil, no qual populaes de microrganismos fermentadores, principalmente bactrias e fungos

filamentosos, degradam a pectina da casca do vegetal, tradicionalmente da juta e do linho, liberando as fibras (HOONDAL et al., 2002). Evans, Akin e Foulk (2002), estudaram o efeito da poligalacturonase fngica no retting do linho. Como resultado do tratamento, houve um eficiente aumento na liberao das fibras. Na indstria txtil, os fios obtidos do algodo cru so engomados para proteg-los da abraso durante a sua transformao em tecido. Entretanto, antes do tingimento, essa goma deve ser removida, assim com as substncias no celulsicas. O tratamento qumico utilizado na desengomagem emprega, entre outros, a soda custica, porm seu emprego tem sido reduzido, sobretudo pelos problemas ambientais decorrentes do efluente (HOONDAL et al., 2002). Ainda segundo Hoondal et al. (2002), o uso de enzimas especficas tais como pectinases (degradao das substncias pcticas) e amilase (degradao da goma), tem diminudo o uso dos produtos qumicos no processamento do algodo, melhorando tanto a qualidade dos efluentes, quanto do produto final, alm de reduzir o consumo de energia. No trabalho de Agrawal et al. (2007), as pectinases alcalinas foram 75% mais eficientes do que as pectinases cidas na degradao das substncias pcticas associadas s fibras do algodo. Na degomagem de fibras de caule, por exemplo, do linho, rami, juta e o cnhamo, tambm tem sido empregado complexos enzimticos contendo pectinase e xilanase, porm livres de celulase, pois essa pode danificar a fibra, comprometendo a qualidade do produto (HOONDAL et al., 2002).

45

3.4.4 Extrao de leo

Os processos industriais para a produo de leos vegetais geralmente envolvem extrao por solventes orgnicos, precedidos ou no de processos mecnicos (ROSENTHAL; PYLE; NIRANJAN, 1996). O hexano o solvente comumente utilizado, porm potencialmente carcinognico e tm propriedades txicas (ROSENTHAL; KASHYAP et al., 2001). Com isso, uma alternativa ao uso deste solvente a utilizao de solues aquosas enzimticas (ROSENTHAL; PYLE; NIRANJAN, 1996). Por sua vez, a seleo do extrato enzimtico depende da composio da parede da oleaginosa em questo (SANTOS; FERRARI, 2005). Geralmente, o extrato contm uma mistura de celulases, hemicelulases, pectinases, amilases e proteases, pois so mais eficientes que isoladamente (ABDULKARIM et al., 2006). Estas enzimas hidrolizam principalmente os polissacardeos estruturais da parede celular, ocorrendo tambm o rompimento das protenas e lipdeos que do forma membrana celular, liberando leo que por outro mtodo dificilmente seria extrado (ROSENTHAL; PYLE; NIRANJAN, 1996). A aplicao industrial da comercial enzima Olivex, um preparado de pectinase com baixa concentrao de celulase e hemicelulase produzida por Aspergillus aculeatus, melhorou a extrao do leo de oliva (KASHYAP et al., 2001). Hadj-Taieb et al. (2006), compararam o rendimento obtido na extrao do leo de oliva com e sem enzimas pectinolticas, concluindo que a aplicao enzimtica melhorou a extrao em aproximadamente 10%. O Centro Nacional de Pesquisa de Tecnologia Agroindustrial de Alimentos (CTAA) da Unidade da Empresa Brasileira de Pesquisa Agropecuria (EMBRAPA) vm desenvolvendo pesquisa que visam produzir enzimas especficas (celulase, hemicelulase, poligalacturonase e PYLE; NIRANJAN, 1996;

46

xilanase) para a extrao de leos vegetais, em especial dos leos de abacate, soja e palma (FREITAS et al., 1998).

3.4.5 Fermentao do caf, ch e cacau

A diversidade de microrganismos associados com o processamento dos gros do caf foi estudada por Silva et al. (2000). Geralmente, em todos os estgios do processo, as bactrias foram o grupo mais abundante, seguido por fungos filamentosos e finalmente leveduras, as quais mostraram um aumento durante a fermentao. Os gneros mais comuns de leveduras foram Pichia, Candida, Arxula e Saccharomycopsis, sendo que, dentre as espcies identificadas encontram linhagens produtoras de pectinase, as quais contriburam na degradao da mucilagem aderente aos gros, colaborando na qualidade final do produto. Por sua vez, Masoud e Jespersen (2006), concluram que linhagens de Pichia anomala e P. kluyveri poderiam estar envolvidas na degradao da pectina durante a fermentao do caf por produzirem poligalacturonase. O crescente interesse pelo consumo de ch deve-se grandemente a estudos que mostram a relao inversa entre seu consumo e o risco de doenas degenerativas, como cncer e doenas do corao (MATSUBARA; RODRIGUEZ-AMAYA, 2006). H, portanto, um interesse na utilizao de preparaes enzimticas para melhorar a produo de chs. Assim, as pectinases so requisitadas porque aceleram a fermentao dessa bebida ao degradar as substncias pcticas das folhas (ANGAYARKANNI et al., 2002). Segundo Schwan e Wheals (2004), a fermentao microbiana uma etapa essencial para a produo de chocolate, sendo a sucesso de microrganismos (bactrias, fungos filamentosos e leveduras) propiciada pela polpa mucilaginosa que envolve as amndoas do cacau. Contudo, a reduo da quantidade de pectina pode conduzir para uma degradao da mucilagem,

47

contribuindo na melhora no processamento. Assim, um inculo iniciador com leveduras pectinolticas pode render um chocolate de boa qualidade. No trabalho de Ardhana e Fleet (2003), a poligalacturonase provavelmente contribuiu para degradao da mucilagem das amndoas do cacau.

3.4.6 Rao animal

Os animais monogstricos (aves e sunos, por exemplo) apresentam limitaes no aproveitamento de certos nutrientes presentes nos vegetais. Entretanto, as pectinases fazem parte de uma mistura enzimtica utilizada atualmente na alimentao desses animais. Como conseqncia, ocorre uma melhora no desempenho do animal, os quais apresentam fezes mais secas e sem resduos de alimento (LECZNIESKI, 2006). Saleh et al. (2005) concluram que o rendimento da carcaa de frangos de corte foi influenciado pela combinao de celulase, hemicelulose e pectinases adicionadas na dieta.

3.4.7 Purificao de vrus de plantas

O desenvolvimento das tcnicas de purificao de vrus tem simplificado o isolamento das partculas virais dos constituintes da planta, contribuindo para estudos morfolgicos e fisiolgicos. Entretanto, para liberar os vrus dos tecidos vegetais, determinadas enzimas so requeridas, como por exemplo, as pectinases (HOONDAL et al., 2002). Assim sendo, para deteco do vrus da hepatite A em framboesa e morango, foram utilizadas pectinases para remoo da pectina dessas frutas, facilitando a liberao dos vrus, os quais foram identificados via amplificao do DNA in vitro (RZEZUTKA; D'AGOSTINO; COOK, 2006).

48

J na deteco de vrus entricos (vrus da hepatite A, norovirus e rotavirus) em amostras de bagas frescas, a adio de um tratamento com pectinase melhorou a sensibilidade do mtodo, pois as substncias pcticas do fruto atuavam como inibidores (BUTOT; PUTALLAZ; SANCHEZ, 2007).

3.4.8 Tratamento de guas residurias da indstria

Compondo os resduos gerados pelas indstrias de processamento de alimentos vegetais, encontramos as substncias pcticas. Entretanto, segundo Hoondal et al. (2002), o prtratamento deste resduo industrial com enzimas pectinolticas provavelmente remover o material pectinoso, facilitando a decomposio da matria orgnica pelo sistema de lodo ativado. Segundo estudo de Margesin, Fauster e Fonteyne (2005), leveduras psicrfilas produtoras de pectato liase, isoladas e identificadas como Mrakia frigida, poderiam ser utilizadas em escala industrial no pr-tratamento, a baixas temperaturas, de guas residuarias que contenham substncias pcticas.

3.4.9 Indstria de papel e celulose

A indstria de papel e celulose representa um dos mais expressivos setores industriais do mundo e espera-se intensificar seus processos com o uso de enzimas microbianas (BAJPAI, 1999). Durante a fabricao de papel, as pectinases podem despolimerizar o cido poligalacturnico em unidades de cido galacturnico e subsequentemente baixar a demanda catinica da polpa celulsica, descorada com perxido alcalino. A variao na reteno entre

49

substncias pcticas e polmeros catinicos atinge diretamente a qualidade final do produto. Logo, o controle deste processo de grande importncia para a indstria de papel e polpa de celulose (REID; RICARD, 2000).

Convem ainda mencionar que se empregam as pectinases para obteno de outros produtos e processos, como apresentados, a seguir: Menezes, Sarmento e Daiuto (1998) verificaram a influncia da adio de preparados comerciais de celulase e pectinase na pubagem. Segundo estes pesquisadores, a adio desses preparados enzimticos acelerou a fermentao das razes da mandioca, antecipando a estabilizao do pH e da acidez. Leonel e Cereda (2000) avaliaram a menor concentrao de pectinase (Pectinex Ultra SPL) necessria no processo de hidrlise e sacarificao do farelo de mandioca para produo de etanol e gerao de um resduo fibroso, com caractersticas para o aproveitamento como fibra diettica.

3.5 O Semi-rido brasileiro como local potencial na obteno de enzimas

No relatrio final sobre a Diversidade Microbiana no Brasil, onde as fontes de consulta incluram questionrios enviados para pesquisadores atuantes em Microbiologia, bem como consultas s bases de dados on-line e publicaes cientficas em revistas indexadas nos ltimos 10 anos (1989-1999), Manfio (2000) pde concluir preliminarmente que a atividade de pesquisa em diversidade microbiana, e, consequentemente, a explorao tecnolgica dos recursos microbianos, so ainda bastante limitados no Brasil. O Semi-rido brasileiro ocupa uma rea de aproximadamente 900.000 km, cobrindo quase 8% do territrio nacional e o Bioma Caatinga ocupa a maior parte dessa regio, sendo

50

estimada a sua biodiversidade na ordem de mais de 20.000 espcies, entre animais, fungos e plantas (Figura 08). Entretanto, dois dos maiores problemas associados ao Semi-rido so o elevado grau de degradao ambiental e o baixo conhecimento da sua biodiversidade (PPBio, http://www.uefs.br/ppbio/index.html).

Figura 08. Mapa da Regio Nordeste mostrando as ecorregies do Bioma das Caatingas e as 57 reas prioritrias para conservao; as seis reas de Extrema Importncia Biolgica em vermelho esto sendo inventariadas pelo PPBio. Fonte: PPBio, http://www.uefs.br/ppbio/index.html

51

Mais recentemente, a pesquisa em biodiversidade microbiana no Brasil ganhou fora, com a criao do Programa de Pesquisa em Biodiversidade (PPBio). Um dos projetos temticos do PPBio no Semi-rido est relacionado com prospeco de compostos bioativos produzidos por microorganismos. Neste projeto, esto sendo isolados e identificados microorganismos de diversos grupos (bactrias, leveduras e fungos filamentosos) do Semi-rido brasileiro para que suas atividades microbianas e enzimticas possam ser analisadas (PPBio,

http://www.uefs.br/ppbio/index.html). Em sentido amplo, a biodiversidade de microrganismos no Semi-rido brasileiro mais amplamente conhecida e melhor documentada para os fungos filamentosos (GUSMO, 2004). Os resultados de projetos relacionados ao estudo da diversidade de fungos na regio Semi-rida do Estado da Bahia tm revelado um nmero surpreendente de novos registros para o Brasil e para o Semi-rido; cerca de 30% do material coletado e identificado representam novos registros ou espcies novas (GUSMO; MARQUES, 2006). Entretanto, somente dois trabalhos voltados para leveduras no Semi-rido foram encontrados, os quais determinaram espcies associadas a flores e frutos (SANTOS et al., 1996) e a solo (COSTA, 2006). Assim, a diversidade de leveduras do Semi-rido e seu potencial biotecnolgico so ainda muito pouco conhecidos, porm altamente interessante dentro de um programa de desenvolvimento cientfico, tecnolgico, econmico e ambiental.

52

4 MATERIAL E MTODOS

4.1 Isolamento e purificao dos microrganismos leveduriformes do Semi-rido baiano

Os substratos foram coletados em abril de 2006, ao longo das rodovias baianas, sendo fotografados e georreferenciados os pontos das coletas. Amostras de solos e flores foram coletadas e acondicionadas em sacos plsticos individuais. Por outro lado, parte de frutos e necroses vegetais foram retiradas e transferidas individualmente para tubo de ensaio com 1,0 mL de soluo de extrato de levedura 1% (p/v), para estimular o crescimento dos microrganismos leveduriformes, acrescido de cloranfenicol 0,01% (p/v), para inibir o crescimento de contaminantes bacterianos. Os insetos associados as diferentes espcies de flores foram capturados individualmente. Para o isolamento dos microrganismos leveduriformes a partir das amostras de solo foi empregado o mtodo de diluio seriada (SILVA; JUNQUEIRA; SIVEIRA, 2001), sendo realizadas diluies de 10-1 a 10-3, preparadas em soluo salina estril 0,45% (p/v), pH 7,0. De cada diluio, uma alquota de 0,1 mL foi retirada e espalhada, em triplicadas, com auxlio de uma ala de Drigalski, em placa de Petri contendo gar YM (WICKERHAM, 1951 apud MAZUR, 1961), acrescido de cloranfenicol 0,01%. Para obteno dos microrganismos leveduriformes das flores, o nectrio floral foi perfurado e raspado com uma ala de inoculao e esta estriada em gar YM, acrescido de cloranfenicol 0,01%. Para o isolamento dos microrganismos leveduriformes de frutos e necrose, aps crescimento por 12 h a temperatura ambiente, a ala de inoculao foi mergulhada nos tubos

53

contendo a amostra, sendo em seguida semeada em gar YM, acrescido de cloranfenicol 0,01%. Para isolar os microrganismos leveduriformes associados aos insetos, esses foram colocados a caminhar por alguns minutos sobre o gar YM, acrescido de cloranfenicol 0,01%, sendo posteriormente preservados em lcool a 70%. Todas as placas inoculadas foram incubadas a 28C, sendo observadas diariamente, num perodo de 2 a 5 dias. Colnias morfologicamente distintas de cada placa foram semeadas por esgotamento em gar YM e incubadas a 28C por 24 horas, para obteno de culturas puras. A triagem foi realizada no Laboratrio de Pesquisa em Microbiologia (LAPEM) do Departamento de Cincias Biolgicas da Universidade Estadual de Feira de Santana (UEFS).

4.2 Preservao dos microrganismos leveduriformes

Das colnias puras foram preparadas lminas para exame microscpico para a verificao da morfologia e pureza dos microrganismos, para isso foi utilizando o corante azul de metileno 1% (p/v). Os isolados leveduriformes foram repicados em tubos de ensaio contendo o gar YM inclinado. Aps incubao a 28C por 24 h, foram adicionados sobre as colnias obtidas, 4,0 mL do crioprotetor glicerol 15% (v/v) estril, sendo o contedo do tubo homogeneizado em um agitador rotatrio at o desprendimento das colnias do gar. Imediatamente foi transferidos, em triplicadas, 1,0 mL da suspenso obtida para tubos de polipropileno com capacidade para 1,5 mL, sendo estes incubados por 10 min em gelo. Em seguida, os tubos foram transferidos para um ultrafreezer a -86C e a mantidos at sua utilizao. Sempre que necessrio procedia-se a recuperao das clulas, semeando a soluo descongelada em uma placa com o gar YM, seguindo de incubao a 28C por 24 a 48 h e a

54

verificao da pureza do material macroscpicamente e microscpicamente, quando necessrio.

4.3 Seleo dos microrganismos leveduriformes produtores de pectinases extracelulares: a poligalacturonase (PG) e a pectina liase (PL)

Os microrganismos leveduriformes preservados foram crescidos em gar YM a 28C por pelo menos 18 h, mas no mais do que 48 h, para verificao da pureza e obteno de clulas metabolicamente ativas. A seguir, foram preparados os inculos em soluo salina estril, equivalentes a escala 3 de McFarland (Colormetro VITEK, bioMrieux), que contm aproximadamente 108 UFC/mL. As suspenses obtidas foram homogeneizadas em agitador rotatrio de tubo, e uma alquota de 0,3 L foi inoculada na superfcie do meio diferencial (meio MP-5) para verificar a produo da enzima poligalacturonase (PG); e igual alquota no meio diferencial (meio MP7) para verificar a produo de pectina liase (PL) (HANKIN; LACY, 1984 apud SILVA, 2003). As placas contendo o inculo foram incubadas a 28C e, aps 48 h, sobre a superfcie do meio, foram cuidadosamente adicionados 3 mL da soluo aquosa de hexadecil trimetil amnio brometo 1% (p/v). Neste caso, o reagente precipita as substncias pcticas intactas no meio, tornando-o opaco; por outro lado, um halo claro ao redor das colnias pectinolticas formado, indicando degradao do cido poligalacturnico ou da pectina, substratos presentes nos meios MP-5 e MP-7, respectivamente. Tanto o dimetro do halo, quanto o da colnia foram mensurados com uma rgua milimetrada.

55

A atividade enzimtica em meio slido foi determinada semiquantitativamente, atravs da relao entre dimetro mdio do halo de degradao do substrato e o dimetro mdio de crescimento da colnia, expresso como ndice Enzimtico, conforme Hankin e Anagnostakis (1975). Desse modo, quanto maior o halo de degradao, maior o ndice e, conseqentemente, maior a atividade enzimtica no meio. O experimento foi conduzido em triplicadas e a levedura Kluyveromyces marxianus CCT 3172, cedida gentilmente pela Professora Dra. Rosane Freitas Schwan (Laboratrio de Fisiologia de Microrganismos, Departamento de Biologia da Universidade Federal de Lavras), foi utilizada como controle positivo para poligalacturonase.

4.4 Identificao molecular dos microrganismos leveduriformes pectinolticos

4.4.1 Extrao de DNA genmico

Para obteno do DNA, os isolados foram incubadas a 28C em 15 mL de caldo YM, sob agitao orbital mecnica a 250 rpm por 12 h, seguido de centrifugao de 1,5 mL de cada amostra a 13.000 rpm por 10 minutos em microtubos de 2 mL. O sobrenadante foi descartado e a massa celular obtida submetida macerao com nitrognio lquido com auxlio de bastes de vidro. Imediatamente aps a macerao, adicionou-se em cada tubo 1 mL de tampo de extrao de DNA [2% CTAB; 1,4 M NaCl; 20 mM EDTA (pH 8,0); 100 mM Tris HCl (pH 8,0); 2% PVP-40] previamente aquecido a 65C e 4 L de -mercaptoetanol, protocolo modificado de Doyle e Doyle (1987). Os tubos foram invertidos por algumas vezes e colocados em banhomaria a 65C por 30 min. Em seguida a incubao no banho-maria, adicionou-se aos tubos,

56

em temperatura ambiente, 800 L de Clorofrmio: lcool Isoamlico (24:1), sendo submetidos agitao constante por 60 min, at formar uma emulso. Posteriormente, a emulso foi centrifugada a 13.000 rpm por 10 min, seguindo da transferncia da fase aquosa superior para novos tubos, tomando cuidado para no contaminla com a interfase. Adicionou-se a soluo dos novos tubos, um volume igual de isopropanol gelado, invertendo gentilmente o tubo por algumas vezes e deixando-os a -20C por 12 h. Aps esse tempo, realizou-se uma nova centrifugao a 13.000 rpm por 10 min para obteno do precipitado, o qual foi lavado trs vezes com 1 mL de etanol 70%, tomando cuidado para no perder o precipitado (centrifugao a 13.000 rpm por 5 min), e colocado a secar em temperatura ambiente. Depois de seco, acrescentou-se ao precipitado de 50 - 100 L (dependendo do tamanho do precipitado) de tampo Tris-EDTA (TE). As amostras foram submetidas anlise ou estocadas a -20C. Para estimativa da qualidade e quantidade do DNA extrado, 3 L de cada amostra, acrescida de 4 L do corante azul de bromofenol, foram submetidos ao processo de eletroforese em gel de agarose 1% (p/v) em tampo TAE 1X, corado com 2 L SYBR Safe (Invitrogen), submersos na cuba com tampo TAE 1X. Como parmetro das estimativas, utilizou-se o marcador Lambda DNA/HindIII Markers (Promega). O gel foi submetido a uma voltagem de 60 volts (V) e corrente de 50 miliamperes (mA) por 1 h e 30 min. Ao final da eletroforese, o gel foi visualizado em transiluminador de UV. As imagens foram fotodocumentadas pelo sistema EDAS 290 (Kodak). Em seguida, as amostras foram diludas em TE na concentrao de 50 ng/mL e estocadas a 4C para posterior utilizao nas reaes de amplificao.

57

4.4.2 Amplificao do domnio D1/D2 do 26S rDNA

Para amplificao da seqncia do domnio D1/D2 do 26S rDNA, foram utilizados o primer direto LR0R (5-ACCCGCTGAACTTAAGC-3) e o primer reverso LR5 (5TCCTGAGGGAAACTTCG-3), os quais se alinham respectivamente, com as seqncias homlogas nas posies 26-42 e 964-948, da subunidade maior do RNA ribossomal (rRNA) da levedura Saccharomyces cerevisae disponvel no GenBank. As reaes da PCR (Polymerase Chain Reaction) foram realizadas em tubo de 0,2 mL, para um volume final de 25 L. A concentrao final dos componentes foi: tampo da Taq DNA polimerase 1X, 2,5 mM de MgCl2, 200 M de cada dNTP, 1 pmol/L de cada primer, 0,02 L de Taq DNA polimerase, 1 ng/L de DNA genmico e gua mili-Q. Estas reaes foram feitas com um controle negativo em paralelo para verificar contaminaes. As amplificaes foram realizadas em termociclador (Mastercycler, Eppendorf), programado para um ciclo de desnaturao inicial de 94C por 1 min e 25 segundos, seguido de 35 ciclos de desnaturao a 95C por 35 seg, anelamento a 55C por 55 seg e extenso a 72C por 2 min. Ao final dos 35 ciclos, as amostras foram submetidas a mais um ciclo de extenso a 72 C por 10 min; protocolo modificado de Gardes e Bruns (1993). Aps a amplificao, cada amostra foi submetida eletroforese em gel de agarose como descrito anteriormente no item 3.4.1. Entretanto, a qualidade e quantidade do DNA amplificado foram estimadas atravs de comparao com o marcador de peso molecular Gene Ruler 100 bp DNA Ladder (Fermentas). Para a purificao dos produtos da PCR utilizou-se o PureLink PCR Purification Kit (Invitrogen), seguindo as orientaes do fabricante. Para a quantificao do produto da PCR purificado comparou-se a intensidade da banda do material purificado com a do marcador Gene Ruler 100 bp DNA Ladder (Fermentas), conforme anteriormente descrito.

58

4.4.3 Seqenciamento dos produtos da PCR purificado

Os produtos da PCR purificado foram seqenciados no Laboratrio de Biologia Molecular do Departamento de Cincias Biolgicas da Escola Superior de Agricultura "Luiz de Queiroz" (ESALQ) da Universidade de So Paulo (USP). As reaes de seqenciamento foram realizadas utilizando-se o DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences), conforme manual do fabricante; e, o processamento das mesmas foi realizado em um seqenciador ABI 3100 Genetic Analyzer (Applied Biosystems).

4.4.4 Anlise das seqncias

Os seqenciamentos obtidos foram editados e analisados utilizando-se o Pregap4 version 1.4b1, Gap v4.8b1 e o Trev 1.8b1 do pacote de programas Staden Package (STADEN PACKAGE, http://staden.sourceforge.net/). As seqncias resultantes foram submetidas ao BLASTn (Basic Local Alignment Search Tool) do NCBI (National Center for Biotechnology Information) (NCBI, http://www.ncbi.nlm.nih.gov), comparando-as com as seqncias depositadas no GenBank. Aps a identificao, os microrganismos leveduriformes (leveduras e fungos semelhantes a leveduras) foram depositados na Coleo de Culturas de Microrganismos da Bahia (CCMB) da UEFS. A rvore filogentica foi gerada com o pacote PAUP* (SWOFFORD, 2001), usando o mtodo neighbour-joining (SAITOU; NEI 1987). A distncia entre as seqncias foi calculada baseada no modelo Kimura de dois parmetros (KIMURA 1980). A anlise do bootstrap (FELSENSTEIN, 1985) foi baseada em 1000 replicaes.

59

4.5 Determinao da poligalacturonase (PG) e da pectina liase (PL) extracelulares produzidas por microrganismos leveduriformes em fermentao submersa

4.5.1 Preparao das amostras para os ensaios enzimticos

O processo de fermentao submersa foi realizado no Laboratrio de Enzimologia (LAEN) do Departamento de Sade da UEFS. Para se efetuar as fermentaes, 5mL contendo clulas metabolicamente ativas, padronizado conforme descrito anteriormente no item 4.3, foram transferidos para frasco de vidro transparente de 250 mL contendo 50 mL de caldo de fermentao (PATCHING; ROSE, 1969 apud PEREIRA, 2005). Aps receberem os inculos, os frascos foram incubados em agitador rotatrio a 150 rpm, a 28C, durante 48 h. Logo aps a fermentao, as amostras foram transferidas assepticamente para tubos de polipropileno com capacidade para 50 mL. Em seguida, estes tubos foram centrifugados a 10.000 rpm por 10 min a 4C. O sobrenadante decorrente, livre de clulas, considerado a soluo bruta de protenas extracelulares, foi ento homogeneizado e transferido para frascos de vidro de 20 mL com tampa de borracha e mantidos a 4C em tampo acetato 0,05 M (pH 5,0), para poligalacturonase e tampo fosfato 0,05 M (pH 7,5), para pectina liase, at o momento da anlise, no ultrapassando o perodo de um ms. Todos os ensaios enzimticos e o doseamento da protena total foram realizados em triplicadas, sendo usado os resultados cuja diferena entre eles tenha sido de at 5%.

60

4.5.2 Determinao da unidade de atividade (UA) da poligalacturonase (PG)

A determinao da unidade de atividade da poligalacturonase foi adaptada de Pereira (2005), usando o cido 3,5-dinitrosalicclico (DNS) proposto por Miller (1959), baseando-se na quantificao de acares redutores liberados, pelo cido poligalacturnico, para o meio. A mistura da reao consistiu-se de 350 L do sobrenadante da fermentao e 250 L de cido poligalacturnico (Sigma) a 1% (p/v) em tampo acetato 0,05 M (pH 5,0). Todos os tubos foram incubados a 45C, em banho-maria durante 1 h. Em seguida, em cada tubo adicionou-se 600 L de DNS. Esta mistura foi fervida, a 100C por 15 min. Parou-se a reao mergulhando os tubos num banho de gelo e aps arrefecimento foram adicionados 6,0 mL de gua destilada. Usou-se 3,0 mL da soluo obtida para leitura da absorbncia. Esta foi mensurada em espectrofotmetro UV/VIS (Varian, Cary 50) a 540 nm, contra um branco. A curva de calibrao foi realizada em duplicada utilizando como padro o cido D-galacturnico (Fluka) (0,2162 1,19 mg/mL), para determinao do coeficiente angular da reta tangente. Uma unidade de atividade da poligalacturonase (UAPG) foi definida como a quantidade de enzima necessria para catalisar a formao de um mol de cido galacturnico por minuto.

4.5.3 Determinao da unidade de atividade (UA) da pectina liase (PL)

A determinao da unidade de atividade da pectina liase foi adaptada de Piccoli-Valle et al (2003), com base na taxa de produtos urnicos insaturados formados, os quais absorvem a 235 nm (ALBERSHEIM, 1966).

61

A mistura da reao constou de 200 L de tampo fosfato 0,1 M (pH 7,5), contendo pectina ctrica (Sigma) a 2,5% (p/v) e 300 L do sobrenadante da fermentao. Esta mistura foi incubada a 40C por 15 min. A reao foi paralisada pela adio de 4,5 mL de H2SO4 0,01 M. Em seguida, a absorbncia foi mensurada em espectrofotmetro a 235 nm, contra um branco, sendo utilizados 3,0 mL da soluo obtida para as leituras. Uma unidade de atividade da pectina liase (UAPL) foi definida como um moles de grupos urondeos insaturados produzidos por minuto. A unidade de atividade da pectina liase foi calculada atravs da subseqente frmula (UENOJO; PASTORE, 2006):

UAPL = A / v / 235nm x 106 / T Onde: A = aumento da absorbncia a 235 nm; v = volume da amostra enzimtica utilizado na anlise em mililitro; 235nm = coeficiente de extino molar dos produtos insaturados (5550 M-1cm-1); T = tempo da reao enzimtica em minutos; UAPL = unidade de atividade da pectina liase (mol/mL/min).

4.5.4 Doseamento da protena total

O doseamento da protena total do sobrenadante advindo da fermentao foi efetuado pelo mtodo de Bradford (1976), utilizando como padro albumina de soro bovino (BSA). Em tubos de ensaio foram colocados 50 L da soluo bruta de protenas extracelulares e adicionados 2,5 mL do reagente de Bradford. Misturou-se o contedo e aps 2 min, procedeu-se a leitura da absorbncia 595 nm, contra um branco.

62

A curva de calibrao foi realizada em duplicada utilizando como padro albumina de soro bovina (10 100 g/mL).

4.5.5 Determinao da atividade especfica (AE) da poligalacturonase (PG)

A atividade especfica da poligalacturonase foi calculada pela seguinte razo:

AEPG = UAPG / mg de protena Onde: AEPG = mol de cido galacturnico liberado por min/mg de protenas;

4.5.6 Determinao da atividade especfica (AE) da pectina liase (PL)

A atividade especfica da pectina liase foi calculada pela subseqente razo:

AE PL = UAPL / mg de protena Onde: AEPL = mol de grupos urondeos insaturados formados por min/mg de protenas.

4.5.7 Determinao da biomassa

O pellet resultante da centrifugao das amostras fermentadas foram ressuspensos em gua destilada. Em seguida, a soluo obtida foi transferida para placa de Petri previamente preparada (60C por 24h), e levadas estufa a 60C para secagem e pesados diariamente at

63

atingir massa constante. Posteriormente, a biomassa seca foi determinada pela diferena entre a massa inicial e a final das placas, aferida em balana analtica.

4.5.8 Anlise estatstica

Os dados obtidos foram submetidos anlise de varincia (ANOVA) e as mdias comparadas pelo teste Tukey (p<0,05), atravs do pacote estatstico SPSS (Statistical Package for the Social Sciences) verso 10.1 (SPSS, 1995).

64

5 RESULTADOS E DISCUSSO

5.1 Isolamento,

purificao

preservao

dos

microrganismos

leveduriformes

proveniente do Semi-rido baiano

Foram utilizados um total de 138 exemplares de flores, 74 de frutos, 10 de insetos, 19 amostras de tecido vegetal necrosado e nove de solo, coletados ao longo das rodovias baianas, como substratos do Semi-rido para o isolamento dos microrganismos leveduriformes, sendo esses substratos identificados pela fotografia e os pontos de coleta pelo georreferenciamento (Tabela 02). A partir desses substratos, colnias foram obtidas em meio YM, sendo que diferentes tipos morfolgicos macroscopicamente distintos, foram selecionados de cada placa e purificados. Todos os 250 microrganismos leveduriformes obtidos foram preservados em glicerol 15% (v/v) a -86C.

5.2 Seleo dos microrganismos leveduriformes produtores de pectinases extracelulares: a poligalacturonase (PG) e a pectina liase (PL)

No presente estudo, a deteco dos microrganismos pectinolticos deu-se atravs da visualizao de halos claros ao redor da colnia em meio de cultura slido especfico: meio MP-5 para identificao dos secretores da poligalacturonase (PG) e meio MP-7 para identificao dos secretores da pectina liase (PL).

65

Tabela 02. Microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, substratos do qual foram isolados e seus respectivos georeferenciamentos. Cdigo do isolado 23.1 26d1 27b3 27c2 27h4 27.4.3 28g2 29d1 30a2.1 31a1 33b1 33b2 72.2 76.1 90a1 103.2 131 133.1 133.2 134.2 134.3 135 136 137 137.2 138 144.1 147i1 147j1 149.1 175a1 202 203 Substrato do isolamento Flor (Solanum sp.) Flor (Pavonia sp.) Flor (Passiflora sp.) Flor (Passiflora sp.) Flor (Passiflora sp.) Flor (Passiflora sp.) Flor (Ipomoea sp.) Fruto (Clusia sp.) Flor (Pavonia sp.) Flor (Piptadenia sp.) Flor (Pavonia sp.) Flor (Pavonia sp.) Flor (Melocactus sp.) Flor (Melocactus sp.) Flor (Camptosema sp.) Flor (Stachytarpheta sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Fruto (Melocactus sp.) Tecido vegetal necrosado (Agave sp.) Flor (Agave sp.) Flor (Agave sp.) Flor (Jacaranda sp.) Fruto (Opuntia sp.) Solo (Arenoso) Solo (Arenoso) Georeferenciamento da coleta S 113843,4 - W 0405509,6 S 113120,8 - W 0411310,1 S 113120,8 - W 0411310,1 S 113120,8 - W 0411310,1 S 113120,8 - W 0411310,1 S 113120,8 - W 0411310,1 S 113121,7 - W 0411309,3 S 113121,7 - W 0411311,2 S 113121,7 - W 0411311,2 S 113121,7 - W 0411311,2 S 113120,9 - W 0411311,7 S 113120,9 - W 0411311,7 S 112908,2 - W 0412010,8 S 112908,2 - W 0412010,8 S 113416,4 - W 0410651,4 S 113723,7 - W 0405958,3 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 113719,0 - W 0405956,7 S 111800,3 - W 0410111,7 S 111800,3 - W 0410111,7 S 111800,3 - W 0410111,7 S 111015,1 - W 0405358,2 S 120307,9 - W 0395895,2 S 93437.3 - W 0384356.9 S 93437.3 - W 0384356.9

66

Dentre os 250 microrganismos avaliados, somente em 33 (13,2%) foi determinda a produo de pelo menos uma das pectinases extracelulares. Desses 33, 18 (54,54%) foram isolados de flores, os demais foram provenientes de frutos (36,36%), amostras de solo (6,06%) e tecido vegetal necrosado (3,03%). No sendo encontrado microrganismos leveduriformes pectinolticos nos insetos (Figura 09).

131

27b3

27h4

(b)

134.3

(a)

27c2

Figura 09. (a) Halo de hidrlise do cido poligalacturnico, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por microrganismos leveduriformes isolado do Semi-rido baiano, crescidos a 28C por 48 h em meio MP-5. (b) Halo de degradao da pectina, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por microrganismo leveduriforme isolado do Semi-rido baiano, crescido a 28C por 48 h em meio MP-7

Ainda em relao produo de pectinases extracelular, em trs dos 33 isolados positivos, no foi detectada produo da pectina liase, esses foram os isolados 27.4.3, 147i1 e 147j1. J a produo da poligalacturonase foi observada em todos os 33 isolados. A levedura Kluyveromyces marxianus CCT 3172, utilizada como controle positivo para poligalacturonase, nas condies experimentais estudadas, tambm secretou a pectina liase (Figura 10). Verifica-se que a percentagem de microrganismos leveduriformes pectinolticos aqui encontrada corroborada pelo trabalho de investigao de atividade enzimtica extracelular

67

realizada por Buzzini e Martini (2002), no qual foram encontrados 10,66% de pectinolticos, sendo estes isolados de solo, gua, inseto e materiais vegetais coletadas em florestas do Brasil.

Figura 10. Halo de degradao da pectina, visualizado aps adio de hexadecil trimetil amnio brometo 1% (p/v), originado por Kluyveromyces marxianus CCT 3172, crescido a 28C por 48 h em meio MP-7.

Convm salientar que uma percentagem mais baixa desses microrganismos foi encontrada nos trabalhos de Trindade et al. (2002) e Silva el al. (2005), 4,2% e 7%, respectivamente. Entretanto, nesses trabalhos estavam os microrganismos associados apenas a frutas tropicais. Flores que possuem glndulas nectarferas e frutas so tradicionalmente consideradas excelentes hbitat para leveduras, por oferecerem acares simples em sucessivos microhbitat durante seus diferentes estgios de desenvolvimento e deteriorao (SANTOS et al., 1996; LACHANCE; STARMER, 1998). Ainda, segundo os citados pesquisadores, insetos polinizadores so os vetores mais importantes na disperso das leveduras e sua especializao para certos nichos ecolgicos promove uma desigual distribuio e barreiras troca gentica entre as espcies de leveduras de diferentes substratos e microhbitat, englobando leveduras ainda no descritas na literatura. Silva (2003) inferiu que leveduras isoladas de frutas tropicais produzem pectinases para despolimerizar a pectina presente nessas frutas, permitindo a assimilao dos acares da

68

cadeia lateral desse polissacardeo pctico, tais como arabinose, galactose e xilose. Assim, Trindade et al (2002), sugereriram que a atividade pectinoltica das leveduras uma vantagem competitiva para otimizar seu crescimento, quando se esgotam fontes de carbono mais simples. De fato, a assimilao de acares por leveduras constatada em testes fisiolgicos quando se deseja identificar em nvel de espcie (YARROW, 1998). Alm disto, Schwan, Cooper e Wheals (1997) verificaram que a pectina e o cido poligalacturnico no so utilizados como fonte de carbono pela levedura Kluyveromyces marxianus CCT 3172, no estando sujeito a represso catablica a secreo das pectinases. O maior ndice enzimtico para poligalacturonase foi determinado no isolado 144.1, cujo valor foi de 5,667; sendo este inferior ao encontrado na levedura controle, o qual foi de 6,8. Por outro lado, entre os secretores de pectina liase, o isolado 33b1 apresentou o maior ndice (2,333), valor prximo ao do controle que foi de 2,5 (Tabela 03). Lealem e Gashe (1994) sugereriram um ndice enzimtico 2,0 para considerar um microrganismo como produtor potencial da enzima extracelular em meio slido especfico. Entretanto, estudos voltados para seleo de microrganismos leveduriformes produtores de enzimas extracelulares no fizeram uso desse ndice, sendo as leveduras classificadas apenas em secretoras ou no, das respectivas enzimas avaliadas (BIELY; SLVIKOV, 1994; STRAUSS et al., 2001; TRINDADE et al., 2002; BUZZINI; MARTINI, 2002; FUENTEFRIA, 2004; SILVA et al., 2005; OLIVEIRA et al., 2006). Uma vez que a microbiologia industrial explora condies adequadas de crescimento e sntese de produtos teis, o presente estudo, ao contrrio destes citados, envolveu o clculo do ndice enzimtico pelo fato de consider-lo til na comparao de isolados taxonomicamente relacionados, pois estes podem apresentar diversidade fisiolgica e fenotpica diferenciada.

69

Tabela 03. Atividade semiquantitativa da poligalacturonase e pectina liase extracelulares dos microrganismos leveduriformes isolados do Semi-rido baiano crescidos a 28C por 48 h em meios diferencial, estimada mediante o ndice enzimtico. Designao MP-5 MP-7 do isolado 23.1 26d1 27b3 27c2 27h4 27.4.3 28g2 29d1 30a2.1 31a1 33b1 33b2 72.2 76.1 90a1 103.2 131 133.1 133.2 134.2 134.3 135 136 137 137.2 138 144.1 147i1 147j1 149.1 175a1 202 203 MC* DMC 0,5 2,1 0,5 0,6 0,6 0,5 0,6 0,6 0,9 0,5 0,5 0,4 0,4 1,4 1,4 0,5 0,7 1,4 1,6 1,6 1,7 1 0,9 1,4 1,6 1,5 0,6 0,5 0,3 0,5 1,4 0,6 0,6 0,5 DMH 1 0,2 1,2 1,8 1,8 0,8 0,6 1,6 0,2 1,6 1,4 0,4 0,8 1,2 1,2 1,4 1,2 1,4 1,4 1,4 1,2 1,4 1,2 1,2 1 1,4 3,4 1 0,6 1,2 1,6 0,4 0,4 3,4 IE 2 0,095 2,4 3 3 1,6 1 2,667 0,222 3,2 2,8 1 2 0,857 0,857 2,8 1,714 1 0,875 0,875 0,706 1,4 1,333 0,857 0,625 0,933 5,667 2 2 2,4 1,143 0,667 0,667 6,8 DMC 0,6 1,6 0,9 0,7 0,7 0,7 1,1 0,6 0,7 0,5 0,6 0,6 0,6 0,9 0,9 0,7 0,8 1 0,9 1 1 0,7 0,7 0,9 0,9 0,7 0,9 0,8 0,7 0,6 0,7 0,8 0,7 0,8 DMH 0,6 1,2 0,6 0,5 0,6 ND 0,6 1,2 0,6 0,5 1,4 0,8 0,6 0,8 0,2 0,6 1,4 0,6 0,6 1 0,8 1,4 1,4 0,6 0,4 0,6 1,2 ND ND 0,8 0,6 0,4 0,4 2 IE 1 0,75 0,667 0,714 0,857 ND 0,545 2 0,857 1 2,333 1,333 1 0,889 0,222 0,857 1,75 0,6 0,667 1 0,8 2 2 0,667 0,444 0,857 1,333 ND ND 1,333 0,857 0,5 0,571 2,5

MP-5 = Meio diferencial para leveduras que produzem poligalacturonase; MP-7 = Meio diferencial para leveduras que produzem pectina liase; DMC = Dimetro mdio da colnia em centmetro; DMH = Dimetro mdio do halo de hidrlise do substrato em cm; IE = ndice enzimtico, relao entre DMH e o DMC; ND = No determinado. *MC = microrganismo controle positivo para poligalacturonase (Kluyveromyces marxianus CCT 3172).

70

5.3 Filogenia

molecular

biodiversidade

dos

microrganismos

leveduriformes

pectinolticos

O DNA genmico extrado dos 33 microrganismos leveduriformes pectinolticos apresentou-se ntegro e sem contaminao. Atravs da PCR do domnio D1/D2 do 26S rDNA com os primer LR0R e LR5, foi possvel amplificar um fragmento de aproximadamente 900 pares de bases, fato este condizente com a literatura cientfica (VILGALYS LAB, http://www.biology.duke.edu/fungi/mycolab/primers.htm) (Figura 11).

147j1 203 27b3 135 28g2 202 31a1 133.1 29d1 72.2 144.1 147j1 33b1 27c2 27h4 33b2 131

134.3 90a1 137.2 137 76.1

23.1 136

133.2 138 149.1 175a1 134.2 103.2 30a2.1 27.4.3 26d1 M

Figura 11. Produtos da PCR purificado de 33 isolados leveduriformes produtores de pectinases, submetido eletroforese em gel de agarose 1% em tampo TAE 1X, 5V/cm, 1,5 hrs, corado com SYBR Safe" (Invitrogen) e fotografados pelo sistema de fotodocumentao Edas 290 (Kodak). Nas amostras (canaletas) ocorre amplificao do domnio D1/D2 do 26S rDNA com os primers LR0R e LR5, e obteno de um fragmento de aproximadamente 900 pb, que o tamanho prximo ao esperado para estes domnios. O marcador (M) utilizado foi o Gene Ruler 100 bp DNA Ladder (Fermentas).

71

Entretanto, o tamanho do fragmento seqenciado com os primers LR0R e LR5, variou entre 324 e 810 pares de bases. Com a obteno das seqncias, estas foram comparadas com as disponveis no GenBank para identificao dos microrganismos (Tabela 04). Alm disto, as seqncias obtidas foram utilizadas para gerar uma rvore filogentica (Figura 12). Aps a identificao molecular, os microrganismos leveduriformes (leveduras e fungos semelhantes a leveduras) foram depositados na Coleo de Culturas de Microrganismos da Bahia (CCMB) da UEFS, recebendo cdigos da coleo. Foram identificados seis gneros (Pseudozyma, Trichosporonoides, Candida, Aureobasidium, Cryptococcus e Kluyveromyces), havendo entre eles 23 isolados ascomicetos [Aureobasidium pullulans (18), Candida boidinii (1), Trichosporonoides sp. (3) e Kluyveromyces marxianus (1)] e cinco basidiomicetos [Cryptococcus liquefaciens (1) e Pseudozyma sp. (4)]. Entretanto cinco dos 33 microrganismos leveduriformes pectinolticos, foram identificados apenas como Fungal endophyte no GenBank. Na anlise da rvore filogentica observou-se que com exceo dos isolados Fungal endophyte CCMB 328 e Fungal endophyte CCMB 327, oriundos de solo, os demais (Fungal endophyte CCMB 305, Fungal endophyte CCMB 311 e Fungal endophyte CCMB 308), proveniente de flores, apresentaram suporte estatstico de 82% na anlise de bootstrap na formao de subgrupos por meio de reamostragem dos dados, incluindo os subgrupos do gnero Aureobasidium. Alm disto, o isolado Fungal endophyte CCMB 308 obtido de Melocactus sp. apresentou valor de bootstrap de 80% com os subgrupos onde foram includos os Aureobasidium, tambm procedente do citado substrato, apontando uma pequena distncia gentica entre eles. Partindo destas observaes pode-se sugerir que estes isolados possuem uma percentagem de complementariedade de DNA muito prximas.

72

Tabela 04. Caracterizao molecular dos microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, a partir da anlise da sequncia do domnio D1/D2 da subunidade (26S) de rDNA.
Cdigo do 23.1 26d1 27b3 27c2 27h4 27.4.3 28g2 29d1 30a2.1 31a1 33b1 33b2 72.2 76.1 90a1 103.2 131 133.1 133.2 134.2 134.3 135 136 137 137.2 138 144.1 147i1 147j1 149.1 175a1 202 203 Pares de bases 716 324 735 716 797 810 440 620 662 729 775 761 635 733 708 581 556 728 504 526 591 692 527 733 740 705 685 784 525 408 708 715 715 Cdigo de acesso no GenBank AB217520 AY791700 DQ400366 DQ178644 DQ178644 DQ178644 AB217512 DQ400366 DQ400366 EF420058 DQ178644 AB217520 EF420058 AB217520 AB217520 EF420058 AB217520 AB217520 AB304735 AB304735 AB217520 AB217520 AB217520 AB217520 AB217520 AB217520 AF543841 AB217520 EF375702 AB304735 AB217520 EF420074 EF420074 Organismo relativo Aureobasidium pullulans Candida boidinii Trichosporonoides sp. Pseudozyma sp. Pseudozyma sp. Pseudozyma sp. Cryptococcus liquefaciens Trichosporonoides sp. Trichosporonoides sp. Fungal endophyte Pseudozyma sp. Aureobasidium pullulans Fungal endophyte Aureobasidium pullulans Aureobasidium pullulans Fungal endophyte Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Kluyveromyces marxianus Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Aureobasidium pullulans Fungal endophyte Fungal endophyte Valor de expectitiva Identidade (E-value) 0.0 2e -93 0.0 0.0 0.0 0.0 0.0 0.0 4e -144 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 (%) 99 87 99 98 98 98 96 99 89 98 98 100 99 100 99 97 99 100 100 100 100 100 99 99 100 100 100 99 99 99 99 99 99 Grupo taxonmico Ascomycota Ascomycota Ascomycota Basidiomycota Basidiomycota Basidiomycota Basidiomycota Ascomycota Ascomycota Fungi Basidiomycota Ascomycota Fungi Ascomycota Ascomycota Fungi Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Fungi Fungi Nmero depsito na CCMB 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328

Isolado seqenciadas

CCMB = Coleo de Culturas de Microrganismos da Bahia

73

Schizosaccharomyces pombe DQ442711


94

Fungal endophyte EF420074 CCMB 328 Fungal endophyte EF420074 CCMB 327 Kluyveromyces marxianus AF543841 CCMB 322 Candida boidinii AY791700 CCMB 297 Cryptococcus liquefaciens AB217512 CCMB 302 Trichosporonoides sp. DQ400366 CCMB 304
100

60 76

100

Trichosporonoides sp. DQ400366 CCMB 298 Trichosporonoides sp. DQ400366 CCMB 303

100 100 76

Pseudozyma sp. DQ178644 CCMB 299 Pseudozyma sp. DQ178644 CCMB 301 Pseudozyma sp. DQ178644 CCMB 300 Pseudozyma sp. DQ178644 CCMB 306

Fungal endophyte EF420058 CCMB 305


57 82 80 87 51

Fungal endophyte EF420058 CCMB 311 Fungal endophyte EF420058 CCMB 308 Aureobasidium pullulans AB217520 CCMB 296
75

Aureobasidium pullulans EF375702 CCMB 324 Aureobasidium pullulans AB217520 CCMB 323 Aureobasidium pullulans AB217520 CCMB 317 Aureobasidium pullulans AB217520 CCMB 326 Aureobasidium pullulans AB217520 CCMB 310 Aureobasidium pullulans AB217520 CCMB 321 Aureobasidium pullulans AB217520 CCMB 307 Aureobasidium pullulans AB217520 CCMB 318 Aureobasidium pullulans AB217520 CCMB 309 Aureobasidium pullulans AB304735 CCMB 314 Aureobasidium pullulans AB217520 CCMB 312 Aureobasidium pullulans AB217520 CCMB 316 Aureobasidium pullulans AB304735 CCMB 315 Aureobasidium pullulans AB217520 CCMB 313 Aureobasidium pullulans AB217520 CCMB 320 Aureobasidium pullulans AB304735 CCMB 325 Aureobasidium pullulans AB217520 CCMB 319

0.05 substitutions/site

Figura 12. rvore filogentica dos microrganismos leveduriformes produtores de pectinases extracelulares isolado Semi-rido baiano, obtida por anlise de neighbour-joining (modelo de Kimura dois parmetros) do domnio D1/D2 do 26S rDNA. Schizosaccharomyces pombe foi includo para enraizar a rvore. Os valores em porcentagem do bootstrap de 1000 replicaes so dados a cada ramo (valores abaixo de 50% no so mostrados). A designao do isolado (Coleo de Culturas de Microrganismos da Bahia, CCMB) so indicados aps o nmero do acesso no GenBank, exceto no grupo externo.

74

Os basidiomicetos pectinolticos foram isolados apenas de flores, enquanto que os ascomicetos de frutos e flores. Segundo Santos et al. (1996), comunidades de leveduras basidiomicticas so dominantes em flores, enquanto que leveduras ascomicticas predominam em frutos. Quando comparadas, a maioria das espcies de leveduras basidiomicticas possui um perfil assimilativo amplo de fontes de carbono quando comparadas com as leveduras ascomicticas, que se restringe a pouca fontes de carbono (KURTZMAN; FELL, 1998). Deve-se ainda salientar que, entre os cinco isolados identificados como Fungal endophyte, dois foram isolados de solo. J o isolado Kluyveromyces marxianus CCMB 322, foi proveniente do tecido vegetal necrosado de Agave sp. A grande maioria dos estudos publicados tem mostrado que a levedura K. marxianus muito verstil, tendo interesse cientfico, industrial e biotecnolgico, j que tem o status de GRAS. Alm da produo de enzimas como as pectinases e inulinase (BENDER et al., 2006), outras aplicaes incluem a produo de aromas (ETSCHMANN; SELL; SCHRADER, 2004). A espcie Aureobasidium pullulans, muitas vezes referida na literatura cientfica como fungo semelhante levedura (yeast-like) ou levedura preta (black-yeast) (BUZZINI; MARTINI, 2002; LAITILA et al., 2006), foi dentre os microrganismos pectinolticos, isolados no presente trabalho, o mais freqente, apresentando uma forte associao com Melocactus sp. Em estudos anteriores a espcie Aureobasidium pullulans tambm foi freqentemente encontrada fazendo parte da microbiota natural de flores e frutos (HAGLER et al., 1993; ROSA et al, 1995; BUZZINI; MARTINI, 2002). Espcies do gnero Trichosporonoides tambm so mencionadas como fungo semelhante levedura (HOCKING; PITT, 1981; RAMIREZ, 1989). Entretanto, na literatura

75

existem poucos relatos do isolamento e identificao destes microrganismos (HOCKING; PITT, 1981; RAMIREZ, 1989). No presente estudo o Trichosporonoides sp. CCMB 304, isolado de flor (Pavonia sp.), apresentou na anlise molecular valor de expectativa (E-value) de 4e-144, e identidade de apenas 89% com a seqncia com maior escore, que um valor de identidade considerado pouco significativo estatisticamente para indicar uma possvel homologia com as seqncias disponveis no banco de dados do GenBank para o segmento de DNA em estudo. Alm disto, na rvore filogentica observa-se que esse microrganismo est como subgrupo do grupo que inclui os Trichosporonoides, apresentando valor de bootstrap de 100%, subsidiando a diferenciao dentre os isolados do gnero. Outro valor de expectativa diferente de 0 (zero) foi encontrado com o isolado Candida boidinii CCMB 297, proveniente de flor (Pavonia sp.), indicando que no existe boa similaridade com as seqncias disponveis no banco de dados do GenBank. Nesta abordagem, inferimos que Trichosporonoides sp. CCMB 304 e Candida boidinii CCMB 297 so possivelmente dois novos txons, ainda no descritos na literatura. Entretanto, apesar das informaes obtidas com o seqenciamento dos domnios D1/D2, para confirmar que os ambos representam duas espcies novas, so necessrios dados complementares provenientes do seqenciamento da regio ITS, alm de caractersticas morfolgicas e fisiolgicas, pois pode ter sido utilizado uma seqncia parcial, como no caso do isolado Candida boidinii (324 pares de bases) ou ainda com um gene ainda no descrito. Recentes pesquisas tm identificado novas espcies de leveduras isoladas de flores (HONG, 2001), frutos (RUIVO, 2005), insetos associados a flores (LACHANCE; BOWLES, 2002), solo (MIDDELHOEVEN; SCORZETTI; FELL, 2001), gua de tanque (RUIVO, 2005), exudatos de plantas (MORAIS et al, 2004) e polpa de fruta (TRINDADE et al, 2004),

76

corroborando a possibilidade de termos encontrado novas espcies ainda no descritas na literatura. Alm disso, quatro dos microrganismos leveduriformes pectinolticos foram identificados apenas em nvel de gnero como Pseudozyma, sendo que linhagens desse gnero tambm so mencionadas na literatura como fungo semelhante levedura (AVIS et al., 2005). Leveduras pertencentes a este gnero possuem algumas caractersticas peculiares de interesse biotecnolgico, como por exemplo, produo de protenas heterolgas (AVIS et al., 2005) e glicolipdios biosurfactantes (KONISHI et al., 2007). Analisando a rvore filogentica verifica-se que os quatros isolados do gnero Pseudozyma correspondem a um grupo com valor de bootstrap de 100%, sendo este grupo, prximo filogeneticamente do grupo dos isolados do gnero Trichosporonoides, com um suporte estatstico de 76%. Da flor de Ipomoea sp. foi isolada a levedura Cryptococcus liquefaciens CCMB 302. Esta espcie considerada como um microrganismo capaz de habitar ambientes extremos, como geleiras (BUTINAR; SPENCER-MARTINS; GUNDE-CIMERMAN, 2007) e mar profundo (KANAMASA et al., 2007). Microrganismos de ambientes extremos j foram estudados e representam comercialmente uma fonte potencial de enzimas termoestveis (HAKI; RAKSHIT, 2003). Verifica-se que o nmero de pesquisa em estudos de sistemtica e diversidade de leveduras no Semi-rido brasileiro bastante limitado, no sendo detectado publicaes ligadas ao potencial biotecnolgico destes microrganismos. Assim, os nicos registros encontrados nos ltimos anos, foram os trabalhos de Santos et al. (1996) e mais recentemente, o de Costa (2006). Santos et al. (1996) determinaram espcies de leveduras associadas a flores e frutos de cajueiro (Anacardium occidentale), cajazeiro (Spondia lutea), umbuzeiro (Spondia sp.) e

77

mangueira (Mangifera indica) da regio Semi-rida do Brasil. Neste trabalho as leveduras encontradas foram: Candida spp., C. albicans, semelhante a C. entomaea, C. guilliermondii, C. krusei, C. parapsilosis, C. shehate, C. sorbosa, semelhante a C. torresii, C. tropicalis, Cryptococus spp., C. laurentii, Debaryomyces sp., Geotrichum sp., Haltermannia corniformus, Hanseniaspora occidentalis, Issatchenkia orientalis, I. terricola, Kloeckera sp. K. apiculata, K. javanica, levedura preta (black-yeast), Metschnikowia sp., M. pulcherrima, Pichia etchellsii, P. membranaefaciens, Rhodotorula spp., R. aurantiaca, R. glutinis, R. graminis, R. minuta, R. rubra, Sporobolomyces roseus, Torulaspora delbruckii, Tremella spp. Por outro lado, o trabalho de Costa (2006) constitui num levantamento taxonmico de leveduras associadas ao solo de trs localidades do Semi-rido da Bahia (Mucug, Ipir e Paulo Afonso), em perodo seco e chuvoso, registrando os seguintes txons: Aureobasidium pullulans, Brettanomyces bruxellensis, Brettanomyces sp., Bullera alba, Candida sp., C. catenulata, C. colliculosa, C. famata, C. glabrata, C.guilliermondii, C. parapsilosis, C. zeylanoides, C. insectorum, C. robusta, C. sake, Cryptococcus sp., C. albidus, C. humicola, C. laurentii, C. luteolus, C. terreus, Hormonema schizolunatum, levedura preta (black-yeast), Pichia ohmeri, Rhodotorula sp., R. glutinis, R. minuta, R. mucilaginosa, Sporobolomyces salmonicolor, S. roseus, Schizosaccharomyces sp., Trichosporon pullulans e T.dulcitum.

5.4 Poligalacturonase (PG) e pectina liase (PL) extracelulares produzidas por microrganismos leveduriformes por meio de fermentao submersa

5.4.1 Atividade da poligalacturonase (PG)

A atividade da poligalacturonase extracelular foi verificada apenas em nove dos 33 isolados leveduriformes (Grfico 02), sendo que as mdias dessa atividade no diferiram

78

significativamente apenas entre dois dos nove isolados pelo teste post-hoc de Tukey, para p<0,05 (Tabela 05). Esta tabela traz ainda as biomassas das culturas obtidas na fermentao submersa. Dentre aqueles nove isolados, o Pseudozyma sp. CCMB 300 foi quem apresentou o maior valor de atividade (14,18 mol de cido galacturnico liberado por min/mg de protenas). Em contrapartida, ela apresentou o menor valor de biomassa seca (67 mg). Segundo Malavolta (2000) o sistema de regulao do crescimento, parece ser independente do sistema de regulao da expresso de atividades pectinolticas em leveduras.

Grfico 02. Atividade especfica (AE) da poligalacturonase (PG) em mol de cido galacturnico liberado por min/mg de protenas, obtida com microrganismos leveduriformes* isolado do Semi-rido baiano, crescidos em agitador rotatrio a 28C por 48 h em caldo de fermentao.
*No grfico os microrganismos so em ordem crescente: 1-Aureobasidium pullulans CCMB 296; 2-Candida boidinii CCMB 297; 3-Trichosporonoides sp. CCMB 298; 4-Pseudozyma sp. CCMB 299; 5-Pseudozyma sp. CCMB 300; 6-Pseudozyma sp. CCMB 301; 7-Cryptococcus liquefaciens CCMB 302; 8-Trichosporonoides sp. CCMB 303; 9-Trichosporonoides sp. CCMB 304; 10-Fungal endophyte CCMB 305; 11-Pseudozyma sp. CCMB 306; 12-Aureobasidium pullulans CCMB 307; 13-Fungal endophyte CCMB 308; 14-Aureobasidium pullulans CCMB 309; 15-Aureobasidium pullulans CCMB 310; 16-Fungal endophyte CCMB 311; 17-Aureobasidium pullulans CCMB 312; 18-Aureobasidium pullulans CCMB 313; 19Aureobasidium pullulans CCMB 314; 20-Aureobasidium pullulans CCMB 315; 21-Aureobasidium pullulans CCMB 316; 22-Aureobasidium pullulans CCMB 317; 23-Aureobasidium pullulans CCMB 318; 24-Aureobasidium pullulans CCMB 319; 25-Aureobasidium pullulans CCMB 320; 26-Aureobasidium pullulans CCMB 321; 27-Kluyveromyces marxianus CCMB 322; 28-Aureobasidium pullulans CCMB 323; 29-Aureobasidium pullulans CCMB 324; 30-Aureobasidium pullulans CCMB 325; 31-Aureobasidium pullulans CCMB 326; 32-Fungal endophyte CCMB 327; 33-Fungal endophyte CCMB 328; 34Kluyveromyces marxianus CCT 3172. O microrganismo 34 corresponde ao controle positivo Kluyveromyces marxianus CCT 3172. As cores das colunas no possuem significado estatstico.

79

Alm do mais, entre os quatro isolados do gnero Pseudozyma avaliados, apenas no isolado Pseudozyma sp. CCMB 301, no foi determinada a atividade da poligalacturonase. O isolado Kluyveromyces marxianus CCMB 322 apresentou valores de atividade (1,041 mol de cido galacturnico liberado por min/mg de protenas) e biomassa seca (183,1 mg), prximos ao encontrado na levedura controle Kluyveromyces marxianus CCT 3172 (1,274 mol de cido galacturnico liberado por min/mg de protenas e 179 mg). Dos trs isolados do gnero Trichosporonoides, apenas no Trichosporonoides sp. CCMB 304, o qual corresponde possivelmente a uma nova espcie, foi determinada a atividade da poligalacturonase (12,43 mol de cido galacturnico liberado por min/mg de protenas), sendo que este isolado apresenta uma variao gentica, pois na rvore filogentica ele aparece como subgrupo dentro do grupo formado pelo gnero Trichosporonoides. O terceiro maior valor encontrado na atividade da poligalacturonase foi proveniente do isolado Cryptococcus liquefaciens CCMB 302, equivalente a 10,58 mol de cido galacturnico liberado por min/mg de protenas. Abe et al. (2006), tambm produziram poligalacturonase, utilizando Cryptococcus liquefaciens linhagem N6, porm em condies extremas, utilizando baixa temperatura e alta presso. Entre os trs Fungal endophyte isolados de flor, apenas no proveniente de Melocactus sp., (Fungal endophyte CCMB 308), foi determinada a atividade da poligalacturonase (0,493 mol de cido galacturnico liberado por min/mg de protenas), sendo esta o menor valor dentre os nove determinados. Pela anlise da rvore filogentica, verifica-se que este isolado est como subgrupo dentro do grupo que inclui os demais Fungal endophyte isolados de flor e o gnero Aureobasidium. Por outro lado, as mdias da atividade da poligalacturonase de um grupo a parte, formado pelos isolados Fungal endophyte CCMB 327 e Fungal endophyte CCMB 328 proveniente de solo arenoso, no diferiram significativamente pelo teste post-hoc de

80

Tukey, para p<0,05 (2,656 e 2,965 mol de cido galacturnico liberado por min/mg de protenas, respectivamente). Em Candida boidinii CCMB 297, assim como em todos os isolados do gnero Aureobasidium no foi no determinada atividade da poligalacturonase nas condies experimentais. Blanco, Sieiro e Villa (1999), em artigo de reviso, sugerem que este comportamento deve-se a um sistema enzimtico mais complexo presente nestes microrganismos. Vrios fatores podem ter influenciado para que a atividade da poligalacturonase nesses isolados no fosse determinada. Desta forma, comparando-se a fermentao submersa com a fermentao em estado slido, onde todos os 33 foram secretores da poligalacturonase, temos que no caldo de cultivo no estava presente o cido poligalacturnico; enquanto que, no meio slido, ele estava presente como substrato, podendo ter induzido a sntese da enzima. Alm disto, a quantidade de glicose utilizada no caldo de fermentao [10% (p/v)] foi duas vezes maior que a do meio slido, o que pode ter causado a represso catablica, visto que a fonte de carbono facilmente metabolizavel estava abundante naquele meio. Verifica-se, pela anlise dos resultados que nove isolados do presente estudo, produziram a poligalacturonase na ausncia de um indutor (cido poligalacturnico), demonstrando a natureza constitutiva dessa enzima nestes isolados. Por outro lado, estes nove isolados no foram suscetveis represso catablica por glicose na concentrao de 10% (p/v). Este fato difere do encontrado por Blanco et al. (1998) apud Blanco, Sieiro e Villa (1999), no qual a atividade pectinoltica foi completamente inibida quando a concentrao de glicose ultrapassou 2%. Por outro lado, no estudo de Malavolta (2000), os efeitos regulatrios da glicose quanto secreo de enzimas pectinolticas foram dependentes do isolado.

81

Tabela 05. Biomassa seca, unidade de atividade da poligalacturonase, protena total e atividade especfica da poligalacturonase produzidas por microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, crescidos em caldo de fermentao em agitador rotatrio a 150 rpm, a 28C por 48 h. Microrganismo Aureobasidium pullulans CCMB 296 Candida boidinii CCMB 297 Trichosporonoides sp. CCMB 298 Pseudozyma sp. CCMB 299 Pseudozyma sp. CCMB 300 Pseudozyma sp. CCMB 301 Cryptococcus liquefaciens CCMB 302 Trichosporonoides sp. CCMB 303 Trichosporonoides sp. CCMB 304 Fungal endophyte CCMB 305 Pseudozyma sp. CCMB 306 Aureobasidium pullulans CCMB 307 Fungal endophyte CCMB 308 Aureobasidium pullulans CCMB 309 Aureobasidium pullulans CCMB 310 Fungal endophyte CCMB 311 Aureobasidium pullulans CCMB 312 Aureobasidium pullulans CCMB 313 Aureobasidium pullulans CCMB 314 Aureobasidium pullulans CCMB 315 Aureobasidium pullulans CCMB 316 Aureobasidium pullulans CCMB 317 Aureobasidium pullulans CCMB 318 Aureobasidium pullulans CCMB 319 Aureobasidium pullulans CCMB 320 Aureobasidium pullulans CCMB 321 Kluyveromyces marxianus CCMB 322 Aureobasidium pullulans CCMB 323 Aureobasidium pullulans CCMB 324 Aureobasidium pullulans CCMB 325 Aureobasidium pullulans CCMB 326 Fungal endophyte CCMB 327 Fungal endophyte CCMB 328 Kluyveromyces marxianus CCT 3172** BS 172 329,2 212,9 162,9 67 213 351,3 301,6 163,3 222,3 141,8 152,8 133 201,1 161,1 106,5 117,5 118 97 147,4 237,2 227,3 108,8 110 236,9 147,1 183,1 250 250,5 218,8 179,5 166 214 179 UAPG ND ND ND 0,584 0,879 ND 1,206 ND 1,255 ND 0,725 ND 0,101 ND ND ND ND ND ND ND ND ND ND ND ND ND 0,201 ND ND ND ND 0,17 0,169 0,237 PT 0,084 0,127 0,059 0,089 0,062 0,088 0,114 0,1 0,101 0,075 0,086 0,07 0,205 0,12 0,074 0,063 0,06 0,096 0,06 0,091 0,076 0,076 0,078 0,058 0,06 0,088 0,193 0,053 0,055 0,086 0,086 0,064 0,057 0,186 AEPG* ND ND ND 6,562 14,18 ND 10,58 ND 12,43 ND 8,43 ND 0,493 ND ND ND ND ND ND ND ND ND ND ND ND ND 1,041 ND ND ND ND 2,656 2,965 1,274 c c b ab a e g f d h

CCMB = Coleo de Culturas de Microrganismos da Bahia; BS = biomassa seca (mg); UAPG = unidade de atividade da poligalacturonase (mol/mL/min); PT = Protena total (mg/mL); AEPG = atividade especfica da poligalacturonase (mol de cido galacturnico liberado por min/mg de protenas); ND = no determinada. * Mdias com letras minsculas desiguais correspondem a grupos significativamente diferentes para p<0,05, de acordo com o teste post-hoc de Tukey; ** Microrganismo controle positivo para poligalacturonase.

82

5.4.2 Atividade da pectina liase (PL)

A atividade da pectina liase extracelular foi verificada em todos os 33 isolados leveduriformes (Grfico 03).

Grfico 03. Atividade especfica (AE) da pectina liase (PL) em mol de grupos urondeos insaturados formados por min/mg de protenas, obtida com microrganismos leveduriformes* isolado do Semi-rido baiano, crescidos em agitador rotatrio a 28C por 48 h em caldo de fermentao.
*No grfico os microrganismos so em ordem crescente: 1-Aureobasidium pullulans CCMB 296; 2-Candida boidinii CCMB 297; 3-Trichosporonoides sp. CCMB 298; 4-Pseudozyma sp. CCMB 299; 5-Pseudozyma sp. CCMB 300; 6-Pseudozyma sp. CCMB 301; 7-Cryptococcus liquefaciens CCMB 302; 8-Trichosporonoides sp. CCMB 303; 9-Trichosporonoides sp. CCMB 304; 10-Fungal endophyte CCMB 305; 11-Pseudozyma sp. CCMB 306; 12-Aureobasidium pullulans CCMB 307; 13-Fungal endophyte CCMB 308; 14-Aureobasidium pullulans CCMB 309; 15-Aureobasidium pullulans CCMB 310; 16-Fungal endophyte CCMB 311; 17-Aureobasidium pullulans CCMB 312; 18-Aureobasidium pullulans CCMB 313; 19Aureobasidium pullulans CCMB 314; 20-Aureobasidium pullulans CCMB 315; 21-Aureobasidium pullulans CCMB 316; 22-Aureobasidium pullulans CCMB 317; 23-Aureobasidium pullulans CCMB 318; 24-Aureobasidium pullulans CCMB 319; 25-Aureobasidium pullulans CCMB 320; 26-Aureobasidium pullulans CCMB 321; 27-Kluyveromyces marxianus CCMB 322; 28-Aureobasidium pullulans CCMB 323; 29-Aureobasidium pullulans CCMB 324; 30-Aureobasidium pullulans CCMB 325; 31-Aureobasidium pullulans CCMB 326; 32-Fungal endophyte CCMB 327; 33-Fungal endophyte CCMB 328; 34Kluyveromyces marxianus CCT 3172. As cores das colunas no possuem significado estatstico.

83

As mdias da atividade da pectina liase no diferiram significativamente pelo teste posthoc de Tukey, para p<0,05 (Tabela 06), dentro dos seguintes grupos de isolados: Aureobasidium pullulans CCMB 296, Pseudozyma sp. CCMB 299 e Pseudozyma sp. CCMB 301; Candida boidinii CCMB 297, Trichosporonoides sp. CCMB 304, Aureobasidium pullulans CCMB 309 e Aureobasidium pullulans CCMB 313; Trichosporonoides sp. CCMB 298, Pseudozyma sp. CCMB 306 e Aureobasidium pullulans CCMB 320; Pseudozyma sp. CCMB 300 e Aureobasidium pullulans CCMB 317; Cryptococcus liquefaciens CCMB 302 e Kluyveromyces marxianus CCMB 322; Fungal endophyte CCMB 305, Aureobasidium pullulans CCMB 310 e Aureobasidium pullulans CCMB 321; Aureobasidium pullulans CCMB 314 e Aureobasidium pullulans CCMB 319; Aureobasidium pullulans CCMB 318 e Aureobasidium pullulans CCMB 326. A Tabela 06 traz ainda as biomassas obtidas na fermentao submersa de todas as 33 culturas. O isolado Fungal endophyte CCMB 328 apresentou atividade de 130,48 mol de grupos urondeos insaturados formados por min/mg de protenas, sendo este o maior valor encontrado no presente trabalho. Os resultados para as leveduras Kluyveromyces foram contrrios aos encontados em outros estudos (SCHWAN; ROSE, 1994; MOYO et al., 2003). Nestes estudos, no foram encontrado atividade para leveduras do gnero Kluyveromyces, enquanto que no presente estudo esta atividade foi determinada, sendo 22,624 mol de grupos urondeos insaturados formados por min/mg de protenas para a Kluyveromyces marxianus CCT 3172 e 17,425 mol de grupos urondeos insaturados formados por min/mg de protenas para a Kluyveromyces marxianus CCMB 322.

84

Tabela 06. Biomassa seca, unidade de atividade da pectina liase, protena total e atividade especfica da pectina liase produzidas por microrganismos leveduriformes pectinolticos isolados do Semi-rido baiano, crescidos em caldo de fermentao em agitador rotatrio a 150 rpm, a 28C por 48 h. Microrganismo Aureobasidium pullulans CCMB 296 Candida boidinii CCMB 297 Trichosporonoides sp. CCMB 298 Pseudozyma sp. CCMB 299 Pseudozyma sp. CCMB 300 Pseudozyma sp. CCMB 301 Cryptococcus liquefaciens CCMB 302 Trichosporonoides sp. CCMB 303 Trichosporonoides sp. CCMB 304 Fungal endophyte CCMB 305 Pseudozyma sp. CCMB 306 Aureobasidium pullulans CCMB 307 Fungal endophyte CCMB 308 Aureobasidium pullulans CCMB 309 Aureobasidium pullulans CCMB 310 Fungal endophyte CCMB 311 Aureobasidium pullulans CCMB 312 Aureobasidium pullulans CCMB 313 Aureobasidium pullulans CCMB 314 Aureobasidium pullulans CCMB 315 Aureobasidium pullulans CCMB 316 Aureobasidium pullulans CCMB 317 Aureobasidium pullulans CCMB 318 Aureobasidium pullulans CCMB 319 Aureobasidium pullulans CCMB 320 Aureobasidium pullulans CCMB 321 Kluyveromyces marxianus CCMB 322 Aureobasidium pullulans CCMB 323 Aureobasidium pullulans CCMB 324 Aureobasidium pullulans CCMB 325 Aureobasidium pullulans CCMB 326 Fungal endophyte CCMB 327 Fungal endophyte CCMB 328 Kluyveromyces marxianus CCT 3172** BS 172 329,2 212,9 162,9 67 213 351,3 301,6 163,3 222,3 141,8 152,8 133 201,1 161,1 106,5 117,5 118 97 147,4 237,2 227,3 108,8 110 236,9 147,1 183,1 250 250,5 218,8 179,5 166 214 179 UAPL 2,472 3,881 2,964 2,553 3,343 2,564 1,887 4,12 3,026 4,665 4,517 4,614 3,963 3,746 4,529 3,055 3,804 2,994 3,389 3,066 3,08 4,103 3,534 3,289 3,072 5,341 3,363 2,984 2,607 2,141 3,889 8,351 6,684 4,208 PT 0,084 0,127 0,059 0,089 0,062 0,088 0,114 0,1 0,101 0,075 0,086 0,07 0,205 0,12 0,074 0,063 0,06 0,096 0,06 0,091 0,076 0,076 0,078 0,058 0,06 0,088 0,193 0,053 0,055 0,086 0,086 0,064 0,057 0,186 AEPL* 29,429 30,559 50,237 28,685 53,919 29,136 16,553 41,2 29,96 62,2 52,523 65,914 19,332 31,217 61,203 48,492 63,4 31,188 56,483 33,692 40,526 53,987 45,308 56,707 51,2 60,693 17,425 56,302 47,4 24,895 45,221 130,48 117,26 22,624 cde de ijl cde jl cde a gh de mno ijl o ab de mno ij no de lmn ef fg jl ghi lmn ijl mno a lm hij bcd ghi q p abc

CCMB = Coleo de Culturas de Microrganismos da Bahia; BS = biomassa seca (mg); UAPL = unidade de atividade da pectina liase (mol/mL/min); PT = Protena total (mg/mL); AEPL = atividade especfica da pectina liase (mol de grupos urondeos insaturados formados por min/mg de protenas). * Mdias com letras minsculas desiguais correspondem a grupos significativamente diferentes para p<0,05, de acordo com o teste post-hoc de Tukey; ** Microrganismo controle positivo para poligalacturonase.

85

Alm disso, pectina liase no tem sido frequentemente detectada em leveduras, sendo bastante relatada como secretada por fungos filamentosos (SCHWAN; COOPER; WHEALS, 1997). No trabalho de Silva (2003), no foi determinada a atividade da pectina liase em nenhuma cultura das leveduras submetidas fermentao submersa. Segundo ela, uma possvel causa para a no deteco desta enzima pode ter sido devido baixa sensibilidade do mtodo empregado, um mtodo espectrofotomtrico (ALBERSHEIM, 1966). De fato, Nedjma, Hoffmann e Belarbi (2001) determinaram atividade da pectina liase na levedura Saccharomyces cerevisiae SCPP, empregando um teste colorimtrico usando cido tiobarbitrico na sua deteco. Entretanto, no presente trabalho assim como em outros (PICCOLI-VALLE et al., 2003; GUMMADI; KUMAR, 2006), a determinao da atividade da pectina liase deu-se pelo mtodo de Albersheim (1966). Deste modo, estudos com outros parmetros (fsicos e qumicos) fazem-se necessrios. A concentrao de acar [10% (p/v)] no meio de cultivo no causou a represso catablica da pectina liase no presente estudo. Alm disto, no foi necessria a presena do substrato (pectina) para induzir a sntese da pectina liase, sendo essa enzima constitutiva para os 33 isolados avaliados, nas condies estudadas.

5.5 Resumo dos resultados

Dentre os 250 microrganismos leveduriformes avaliados, 33 foram selecionados por produzirem enzimas pectinolticas em meio slido especifco. Em todos eles foi possvel determinar a produo da poligalacturonase e em trs destes, no foi possvel determinar a pectina liase;

86

O ndice enzimtico mostrou-se til na comparao de isolados taxonomicamente relacionados, sendo que nenhum isolado pectinoltico apresentou ndice maior que o encontrado no controle Kluyveromyces marxianus CCT 3172;

Os 33 isolados pectinolticos foram identificados molecularmente em seis gneros (Pseudozyma, Trichosporonoides, Candida, Aureobasidium, Cryptococcus e

Kluyveromyces), havendo entre eles 23 isolados ascomicetos [Aureobasidium pullulans (18), Candida boidinii (1), Trichosporonoides sp. (3) e Kluyveromyces marxianus (1)] e cinco basidiomicetos [Cryptococcus liquefaciens (1) e Pseudozyma sp. (4)]; Cinco dos 33 microrganismos leveduriformes pectinolticos, foram identificados apenas como Fungal endophyte; Os 33 microrganismos leveduriformes pectinolticos isolados de substratos do Semirido baiano foram depositados na Coleo de Culturas de Microrganismos da Bahia (CCMB) da UEFS; O isolado Trichosporonoides sp. CCMB 304 e o Candida boidinii CCMB 297 so possivelmente dois novos txons, ainda no descritos na literatura, embasando-se nos seus valores de expectativa (E-value) e de identidade (%); As mdias da atividade da poligalacturonase no diferiram significativamente apenas entre dois dos nove isolados produtores desta enzima (Tukey p<0,05); A atividade da poligalacturonase foi verificada somente em nove dos isolados pectinoltios, sendo o isolado Pseudozyma sp. CCMB 300 e o Trichosporonoides sp. CCMB 304 os secretores mais ativos, apresentando respectivamente 14,17 e 12,47 mol de cido galacturnico liberado por min/mg de protenas;

87

A poligalacturonase secretada por estes nove isolados, caracterizou-se como uma enzima constitutiva, no sendo reprimida catabolicamente em caldo com glicose a 10% (p/v);

A atividade da pectina liase foi verificada em todos os 33 isolados, sendo uma enzima constitutiva, no tendo represso catablica em caldo com glicose a 10% (p/v);

As mdias da atividade da pectina liase diferiram significativamente entre grupos de isolados produtores desta enzima (Tukey p<0,05);

Os secretores mais ativos da pectina liase foram o Fungal endophyte CCMB 327 e o Fungal endophyte CCMB 328, que apresentaram, respectivamente, 130,48 e 117,26 mol de grupos urondeos insaturados formados por min/mg de protenas;

possvel

que

proteases

extracelulares

produzidas

pelos

micorganismos

leveduriformes pectinolticos durante a fermentao submersa tenham degradado protenas da soluo bruta de protenas extracelulares, justificando os baixos valores encontrados no doseamento da protena total.

88

6 CONCLUSO

Esse estudo demonstrou que microrganismos leveduriformes isolados do Semi-rido baiano representam uma fonte de pectinases extracelulares de interesse industrial e biotecnolgico, com propriedades peculiares, tais como: tempo de fermentao curto em caldo no dispendioso economicamente, secreo da enzima na ausncia de um indutor e no represso catablica quando presente uma fonte de carbono facilmente metabolizvel. Alm disso, pesquisas com estes microrganismos contribuiro para o conhecimento da biodiversidade de microrganismos do Semi-rido, pois at o atual, existe uma relativa escassez de trabalhos. interessante que se d continuidade ao trabalho otimizando a produo destas enzimas, alm de aplic-las tendo em vista fins comerciais. Espera-se tambm, com mtodos complementares, diferenciar as espcies de microrganismos leveduriformes pectinolticos encontrados no presente estudo.

89

REFERNCIAS

ABDULKARIM, S.M.; LAI, O.M.; MUHAMMAD, S.K.S.; LONG, K.; GHAZALI, H.M. Use of enzymes to enhance oil recovery during aqueous extraction of Moringa oleifera seed oil. J Food Lipids, v.13, n.2, p.113130, 2006. ABE, F.; MINEGISHI, H.; MIURA, T.; NAGAHAMA, T.; USAMI, R.; HORIKOSHI, K. Characterization of cold- and high-pressure-active polygalacturonases from a deep-sea yeast, Cryptococcus liquefaciens strain N6. Biosci Biotech Bioch., v.70, n.1, p.296-9, 2006. ABRAHO NETO, J. Algumas Aplicaes de Enzimas. In: Urgel de Almeida Lima; Eugnio Aquarone; Walter Borzani; Willibaldo Schidel. (Org.). Biotecnologia Industrial. So Paulo: Edgard Blucher Ltda, 2001, v. 3, p. 405-412. AGRAWAL, P.B.; NIERSTRASZ, V.A.; KLUG-SANTNER, B.G.; GUBITZ, G.M.; LENTING, H.B.; WARMOESKERKEN, M.M. Wax removal for accelerated cotton scouring with alkaline pectinase. J Biotechnol., v. 12, 2007. ALBERSHEIM, P. Pectin lyase from fungi. In Methods in Enzymology vol. 8, ed. Neufeld, E.F. and Ginsburg, V. New York: Academic Press, 1966. p. 628-635. ALEXOPOULOS, C. J.; MIMS, C.; BLACKWELL, M. Introductory Mycology. 4 ed. New York: John Wiley & Sons, 1996. 869 p. ALKORTA, I.; GARBISU, C.; LLAMA, M. J.; SERRA, J. L. Industrial applications of pectic enzymes: a review. Process Biochem., v.33, n.1, p.21-28, 1997. ANGAYARKANNI, J.; PALANISWAMY, M.; MURUGESAN, S.; SWAMINATHAN, K. Improvement of tea leaves fermentation with Aspergillus spp. pectinase. J Biosci Bioeng. v.94, n.4, p.299-303, 2002. ARDHANA, M.M.; FLEET, G.H. The microbial ecology of cocoa bean fermentations in Indonesia. Int J Food Microbiol. v.86, n.1-2, p.87-99, 2003.

90

ASSIS, S. A. Enzima pectinametilesterase de acerola (Malpighia emarginata DC): purificao e produo de pectina de baixa metoxilao usando bioreatores contendo PME. 120 folhas. 2004. Tese (Doutorado em Biotecnologia) - Instituto de Qumica, Universidade Estadual Paulista, Araraquara, 2004. AVIS, T.J.; CHENG,Y.L.; ZHAO, Y.Y.; BOLDUC, S.; NEVEU, B.; ANGUENOT, R.; LABB, C.; BELZILE, F.; BLANGER, R.R. The potential of Pseudozyma yeast-like epiphytes for the production of heterologous recombinant proteins. Appl Microbiol Biote., v. 69, p.304311, 2005. BAJPAI, P. Application of enzymes in the pulp and paper industry. Biotechnol Prog. v.15, n.2, p.147-57, 1999. BASTOS, M. S. R.; GURGEL, T. E. P.; SOUSA FILHO, M. S. M.; LIMA, I. F. B.; SOUZA, A. C. R.; SILVA, J. B. Efeito da Aplicao de Enzimas Pectinolticas no Rendimento da Extrao de Polpa de Cupuau. Rev Bras Fruti., v.24, p.240-242, 2002. BCC. RC-147U Enzymes for Industrial Applications. Disponvel em: < http://www.bccresearch.com/editors/RC-147U.html>. Acesso em: 22 fev. 2006. BENDER, J.P.; MAZUTTI, M.A.; DE OLIVEIRA, D.; DI LUCCIO, M,; TREICHEL, H. Inulinase production by Kluyveromyces marxianus NRRL Y-7571 using solid state fermentation. Appl Biochem Biotech., Spring; 129-132:951-8, 2006. BHAT, M.K. Cellulases and related enzymes in biotechnology. Biotechnol Adv. v.18, n.5, p.355-83, 2000. BIELY, P.; SLVIKOV, E. New Search for Pectolytic Yeasts. Folia Microbiol. v.39, n.6, p.485-488, 1994. BLANCO, P.; SIEIRO, C.; REBOREDO, N.M.; VILLA, T.G. Cloning, molecular characterization, and expression of an endo-polygalacturonase-encoding gene from Saccharomyces cerevisiae IM1-8b. FEMS Microbiol Lett., v.164, n.2, p.249-55, 1998. BLANCO, P.; SIEIRO, C.; VILLA, T.G. Production of pectic enzymes in yeasts: MiniReview. FEMS Microbiol Lett., v.175, p.1-9, 1999. BRADFORD, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem., n.72, p.248254, 1976.

91

BULL, A.T.; GOODFELLOW, M.; SLATER, J.H. Biodiversity as a source of innovation in biotechnology. Annu Rev Microbiol. v.46, n.219-52, 1992. BUTINAR, L.; SPENCER-MARTINS, I.; GUNDE-CIMERMAN, N. Yeasts in high Arctic glaciers: the discovery of a new habitat for eukaryotic microorganisms. Antonie Van Leeuwenhoek, v.91, n.3, p.277-89, 2007. BUTOT, S.; PUTALLAZ, T.; SANCHEZ, G. Procedure for rapid concentration and detection of enteric viruses from berries and vegetables. Appl Environ Microbiol. v.73, n.1, p.186-92, 2007. BUZZINI, P.; MARTINI, A. Extracellular enzymatic activity profiles in yeast and yeast-like strains isolated from tropical environments. J Appl Microbiol., v.93, p.10201025, 2002. CANTO, W.L.; MENEZES, T.J.B. Produo, Usos e Mercado de Enzimas. Estudos Econmicsos-alimentos Processados n. 29. ITAL Campinas 74p, 1995. CARDOSO, M.H.; JACKIX, M.N.H.; MENEZES, H.C.; GONALVES, E.B.; MARQUES, S.V.B. Efeito da associao de pectinase, invertase e glicose isomerase na qualidade do suco de banana. Cin Tecnol Aliment., v.18, n.3, 1998. COSTA, M.S.F. Diversidade de leveduras do solo do Semi-rido da Bahia. 2006. Tese. (Doutorado em Biologia de Fungos), Departamento de Micologia do Centro de Cincias Biolgicas, Universidade Federal de Pernambuco, Departamento de Botnica. Recife, 2006. DOYLE, J.J.; DOYLE, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin v.19, p.11-15, 1987. ESPOSITO, E.; AZEVEDO, J.L. (Org.). Fungos: uma introduo biologia, bioqumica e biotecnologia. Caxias do Sul, RS: EDUCS, 2004, 510p. ETSCHMANN, M.M.W.; SELL, D.; SCHRADER, J. Medium optimization for the production of the aroma compound 2-phenylethanol using a genetic algorithm. J Mol Catal B Enzym., v.29, p.187193, 2004. EVANS. J.D.; AKIN, D.E.; FOULK, J.A. Flax-retting by polygalacturonase-containing enzyme mixtures and effects on fiber properties. J Biotechnol. v.97, n.3, p.223-31, 2002.

92

FELL, J. W.; BLATT, G. M. Separation of strains of the yeasts Xanthophyllomyces dendrorhousand and Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J Ind Microbiol And Biot., v.23, n.1, p.677-681, 1999. FELL, J. W.; BOEKHOUT, T.; FONSECA, A.; SCORZETTI, G.; STATZELLTALLMAN, A. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int J Syst Evol Micr., v.50, p.1351-71, 2000. FELSENSTEIN J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, v.39, p.783791, 1985. FERTONANI, H.C.R.; SIMES, D.R.S.; NOGUEIRA, A.; WOSIACKI, G. Potencial da variedade joaquina para o processamento de suco clarificado e vinho seco de ma. Cinc Tecnol Aliment., v.26, n.2, p.434-440, 2006 FREITAS, S.P.; SILVA, F.C.; LAGO, R.C.A.; COURI, S. Efeito de enzimas hidrolticas no comportamento reolgico do leo de palma cru. Cinc. Tecnol. Aliment. v.18, n.1, 1998. FUENTEFRIA, A.M. Identificao e avaliao do potencial biotecnolgico de leveduras e fungos semelhantes a leveduras isolados de filoplano do Hibiscus rosa-sinensis. 2004, 119p. Dissertao (Mestrado em Microbiologia Agrcola e do Ambiente), Faculdade de Agronomia, Universidade Federal do Rio Grande do Sul, Porto Alegre, 2004. GALVAGNO, M.A.; FORCHIASSIN, F. Fisiologia dos fungos: nutrio e metabolismo. In: ESPOSITO, E.; AZEVEDO, J.L. (Org.). Fungos: uma introduo biologia, bioqumica e biotecnologia. Caxias do Sul, RS: EDUCS, 2004, p.125-169. GOGNIES, S.; GAINVORS, A.; AIGLE, M.; BELARBI, A. Cloning, sequence analysis and overexpression of a Saccharomyces cerevisiae endopolygalacturonase-encoding gene (PGL1). Yeast. v.15, n.1, p.11-22, 1999. GARDES, M.; BRUNS, T. D. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Mol Ecol., v.2, p.113-118, 1993. GRANADA,, G.L.; VENDRUSCOLO, J.L.; TREPTOW, R.O.Caracterizao qumica e sensorial de sucos clarificados de amora-preta (Rubus spp.). Rev Bras Agrocincia, v.7, n.2, p.143-147, 2001.

93

GUMMADI, S.N.; KUMAR, D.S. Optimization of chemical and physical parameters affecting the activity of pectin lyase and pectate lyase from Debaryomyces nepalensis: A statistical approach. Biochem Eng J., n.30, p.130137, 2006. GUMMADI, S.N.; PANDA, T. Purification and biochemical properties of microbial pectinases: a review. Process Biochem., v.38, p.987-996, 2003. GUSMO, L.F.P. Microfungos associados a folhas em decomposio de plantas nativas de Campos Rupestres no estado da Bahia, Brasil. 2004, 187p. Tese (Doutorado em Cincias Biolgicas), Instituto de Biocincias da Universidade de So Paulo, Departamento de Botnica. So Paulo, 2004. GUSMO, L.F.P.; MARQUES, M.F.O. Diversity of Fungi in the Brazilian Semi-arid. In: QUEIROZ, L.P.; RAPINI, A.; GIULIETTI, A.M. (Editors). Towards Greater Knowledge of the Brazilian Semi-arid Biodiversity. Braslia-DF: Ministrio da Cincia e Tecnologia, 2006, p.83-86. HADJ-TAIEB, N.; AYADI, M.; KHLIF, M.; MRADA, K.; HASSAIRI, I.; GARGOURI, A. Fermentor production of pectinases on gruel, a local by-product and their use in olive oil extraction. Enzyme Microb Tech., v.39, p.10721076, 2006. HAKI, G.D.; RAKSHIT, S.K. Developments in industrially important thermostable enzymes: a review. Bioresource Technol., v.89, p. 17-34, 2003. HAGLER, A. N.; ROSA, C. A.; MORAIS, P. B.; MENDONA-HAGLER, L. C. Yeasts and coliform bacteria of water accumulated in bromeliads of mangrove and sand dune ecosystems of southeast Brazil. Can J Microbiol., v.39. p. 973-977, 1993. HANKIN, L.; ANAGNOSTAKIS, S. L. The use of solid media for detection of enzyme production by fungi. Mycologia. v.67, p.597-607, 1975. HAWKSWORTH, D.L. The magnitude of fungal iversity: the 1,5 million species estimate revisited. Mycol Res., v.105, n.12, p.1422-1432, 2001. HOCKING, A.D.; PITT, J.I. Trichosporonoides nigrescens sp. nov., a new xerophilic yeastlike fungus. Antonie Van Leeuwenhoek, v.47, n.5, p.411-21, 1981. HONG, S.G.; CHUN, J.; OH, W.H.; BAE, K.S. Metschnikowia koreensis sp. nov, a novel yeast species isolated from flowers in Korea. Int J Syst Evol Micr., n.51, p.127-1931, 2001.

94

HOONDAL, G.S.; TIWARI, R. P.; TEWARI, R.; DAHIYA, N.; BEG, Q. K. Microbial alkaline pectinases and their industrial applications: a review. Appl Microbiol Biot., v.59, p.409418, 2002. IPPA (International Pectin Producers Association). Disponvel em: <http://www.ippa.info/what_is_pectin.htm>. Acesso em: 22 fev. 2006. JAYANI, R.S.; SAXENA, S.; GUPTA, R. Microbial pectinolytic enzymes: A review. Process Biochem., v.40, p.29312944, 2005. JESPERSEN, L.; NIELSEN, D.S.; HONHOLT, S.; JAKOBSEN, M. Occurrence and diversity of yeasts involved in fermentation of West African cocoa beans. FEMS Yeast Res. v.5(4-5), p.441-53, 2005. JIA, J.; WHEALS, A. Endopolygalacturonase genes and enzymes from Saccharomyces cerevisiae and Kluyveromyces marxianus. Curr Genet. v.38, n.5, p.264-70, 2000. KANAMASA, S.; SUMI, K.; YAMUKI, N.; KUMASAKA, T.; MIURA, T.; ABE, F.; KAJIWARA, S. Cloning and functional characterization of the copper/zinc superoxide dismutase gene from the heavy-metal-tolerant yeast Cryptococcus liquefaciens strain N6. Mol Genet Genomics, v.277, n.4, p.403-12, 2007. KASHYAP, D.R.; VOHRA, P.K.; CHOPRA, S.; TEWARI, R. Applications of pectinases in the commercial sector: a review. Bioresource Technol., v.77, p.215-227, 2001. KIMURA, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol., v.16, p.111120, 1980 KONISHI, M.; IMURA, T.; FUKUOKA, T.; MORITA, T.; KITAMOTO, D. A yeast glycolipid biosurfactant, mannosylerythritol lipid, shows high binding affinity towards lectins on a self-assembled monolayer system. Biotechnol Lett., v.29, n.3, p.473-80, 2007. KURTZMAN, C.P.; FELL, J.W. The Yeasts A Taxonomy Study. 4 ed. Amsterdam: Elsevier Science B.V., 1998. 1055 p. KURTZMAN, C.P.; ROBNETT, C.J. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie Van Leeuwenhoek. v.73, n.4, p.331-71, 1998.

95

KURTZMAN, C. P.; ROBNETT, C. J. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol., v.35, n.5, p.1216-1223, 1997. KURTZMAN, C. P.; ROBNETT, C. J. Molecular relationships among hyphal ascomycetous yeasts and yeastlike taxa. Can J Botany, v. 73, suppl. 1, p.S824-S830, 1995. LACHANCE, M.A.; BOWLES, J.M. Metschnikowia arizonensis and Metschnikowia dekortorum, two new large-spored yeast species associated with floricolous beetles. FEMS Yeast Res., v.2, p.81-86, 2002. LACHANCE, M.A.; STARMER, W. T.: Ecology and yeasts. In: The yeasts a taxonomic study (Kurtzman, C. P., Fell, J. W. eds.) 4rd ed., Elsevier Science Publ. B.V. Amsterdam, the Netherlands, p. 2130, 1998. LAITILA, A.; WILHELMSON, A.; KOTAVIITA, E.; OLKKU, J.; HOME, S.; JUVONEN, R. Yeasts in an industrial malting ecosystem. J Ind Microbiol Biotechnol., v.33, n.11, p.95366, 2006. LANG, C.; DRNENBURG, H. Perspectives in the biological function and the technological application of polygalacturonases. Appl Microbiol Biotechnol., v.53, p.366-375, 2000. LEALEM, F.; GASHE, B. A. Amylase production by a gram-positive bacterium isolated from fermenting tef (Eraglostis tef). J Appl Bacteriol, v.77, n.1, p. 348-352, 1994. LEAW, S.N.; CHANG, H.C.; SUN, H.F.; BARTON, R.; BOUCHARA, J.P.; CHANG, T.C. Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. v.44, n.3, p.693-9, 2006. LECZNIESKI, J.L. Consideraes prticas do uso de enzimas. In: Seminrio Internacional de Aves e Sunos, 2006, Florianpolis. Anais do V Seminrio Internacional de Aves e Sunos, 2006. p 34-46. LEONEL, M.; CEREDA M.P. Avaliao da concentrao de pectinase no processo de hidrlise-sacarificao do farelo de mandioca para obteno de etanol. Cinc Tecnol Aliment., v.20, n.2, 2000. LOGUERCIO-LEITE, C.; ESPOSITO, E. Fungos: estrutura e ultra-estrutura. In: ESPOSITO, E.; AZEVEDO, J.L. (Org.). Fungos: uma introduo biologia, bioqumica e biotecnologia. Caxias do Sul, RS: EDUCS, 2004, p. 15-44.

96

LOPANDIC, K.; ZELGER, S.; BANSZKY, L.K.; ELISKASES-LECHNER, F.; PRILLINGER, H. Identification of yeasts associated with milk products using traditional and molecular techniques. Food Microbiol., v.23, n.4, p.341-50, 2006. LUH, B.S.; PHAFF, H.J. Studies on polygalacturonase of certain yeasts. Arch Biochem. v.33, n.2, p.212-27, 1951. MALAVOLTA, L. Isolamento de leveduras para a produo e enzimas pcticas. 2000, 89p. Dissertao (Mestrado em Biotecnologia), Instituto Butantan. Universidade de So Paulo, So Paulo, 2000. MANFIO, G.P. Avaliao do Estado Atual do Conhecimento Sobre a Diversidade Microbiana no Brasil - Relatrio Final. Campinas, 2000. 128p. MARGESIN, R.; FAUSTER, V.; FONTEYNE, P.A. Characterization of cold-active pectate lyases from psychrophilic Mrakia frigida. Appl Microbiol. v.40, n.6, p.453-9, 2005. MASOUD, W.; JESPERSEN, L. Pectin degrading enzymes in yeasts involved in fermentation of Coffea arabica in East Africa. Int J Food Microbiol. v.110, n.3, p.291-6, 2006. MATSUBARA, S.; RODRIGUEZ-AMAYA, D.B. Teores de catequinas e teaflavinas em chs comercializados no Brasil. Cinc. Tecnol. Aliment. v.26, n.2, p.401-407, 2006. MAZUR, P. Physical and temporal factors involved in the death of yeast at subzero temperatures. Biophysi J., v.1, p.247-264, 1961. McKAY, A.M. A plate assay method for the detection of fungal polygalacturonase secretion. FEMS Microbiol Lett., v.56, n.3, p.355-358, 1988. MENEZES, T.J.B.; SARMENTO, S.B.S.; DAIUTO, E.R. Influncia de enzimas de macerao na produo de puba. Cinc Tecno Aliment., v.18, n.4, 1998. MIDDELHOEVEN,W.J.; SCORZETTI, G.; FELL, J.W. Trichosporon porosum comb. nov., an anamorphic basidiomycetous yeast inhabiting soil, related to the loubieri/laibachii group of species that assimilate hemicelluloses and phenolic compounds. FEMS Yeast Res., v.1, p.15-22, 2001.

97

MILLER, G.L. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem., v.31, n.3, p.426428, 1959. MORAES, E. M.; ROSA, C. A.; SENE, F. M.. Preliminary notes on yeasts associated with necrotic cactus stems from different localities in Brazil. Braz J Biology, v.65, n.2, p.299-304, 2005. MORAIS, P.B.; TEIXEIRA, L.C.R.S.; BOWLES, J.M.; LACHANCE, M.A.; ROSA, C.A. Ogataea falcaomoraisii sp. nov., a sporogenous methylotrophic yeast from tree exudates. FEMS Yeast Res., v.5, n.1, p.81-85, 2004. MOYO, S.; GASHE, B.A.; COLLISON, E.K.; MPUCHANE, S. Optimising growth conditions for the pectinolytic activity of Kluyveromyces wickerhamii by using response surface methodology. Int J Food Microbiol., v.85(1-2), p.87-100, 2003. NAKAGAWA, T.; NAGAOKA, T.; TANIGUCHI, S.; MIYAJI, T.; TOMIZUKA, N. Isolation and characterization of psychrophilic yeasts producing cold-adapted pectinolytic enzymes. Lett Appl Microbiol., v.38, p.383387, 2004. NCBI. Disponvel em: <http://www.ncbi.nlm.nih.gov >. Acesso em: 20 jul. 2007. NEDJMA, M.; HOFFMANN, N.; BELARBI, A. Selective and Sensitive Detection of Pectin Lyase Activity Using a Colorimetric Test: Application to the Screening of Microorganisms Possessing Pectin Lyase Activity. Anal Biochem., v.291, p.290296, 2001. OLIVEIRA, K.F.; MALAVOLTA, L.; SOUZA, C.S.; VICENTE, E.J.; LALUCE, C. Pectinolytic activity secreted by yeasts isolated from fermented citrus molasses. J Appl Microbiol., v.100, n.4, p.633-640(8), 2006. ORBERA-RATON, T. Molecular identification methods of yeasts of biotechnological interest. Rev Iberoam Micol. v.21, n.1, p.15-9, 2004. PEREIRA, M.S.A. Purificao de uma endo-poligalacturonase, produzida por Kluyveromyces marxianus, utilizando sistema de duas fases aquosa. 2005, 219p. Tese (Doutorado em Engenharia Qumica e Biolgica), Departamento de Engenharia Biolgica, Universidade de Minho, Braga, 2005. PICCOLI-VALLE, R.H.; PASSOS, F.J.V.; BRANDI, I.V.; PETERNELLI, L.A.; SILVA, D.O. Influence of different mixing and aeration regimens on pectin lyase production by Penicillium griseoroseum. Process Biochem., v.38, p.849-854, 2003.

98

PINHEIRO, R.I.C. Estudo do efeito da presso na fisiologia de leveduras. 2004, 292p. Tese (Doutoramento em Engenharia Qumica e Biolgica), Departamento de Engenharia Biolgica, Universidade de Minho, Braga, 2004. PPBio (Programa de Pesquisa em Biodiversidade do Semi-rido). Disponvel em: <http://www.uefs.br/ppbio/home.htm>. Acesso em: 22 fev. 2006. RAMIREZ, C. A new species of Trichosporonoides isolated from sweetened orange/mango drink in Australia. Mycopathologia, v.108, n.1, p.25-30, 1989. REID, I.I.; RICARD, M. Pectinase in papermaking: solving retention problems in mechanical pulps bleached with hydrogen peroxide. Enzyme Microb Technol. v.26(2-4), p.115-123, 2000. ROSA, C. A.; LACHANCE, M.; TEIXEIRA, L. C. R. S.; PIMENTA, R. S.; MORAIS, P. B. Metschnikowia cerradonensis sp. nov., a yeast species isolated from ephemeral flowers and their nitidulid beetles in Brazil. Int J Syst Evol Micr., v.57, p.161-165, 2007. ROSA, C.A; MORAIS, P.B.; SANTOS, S.R.; PERES NETO, P.R.; MENDONA-HAGLER, L.C.; HAGLER, A.N. Yeast communities associated with different plant resourses in sandy coastal plains of southeastern Brazil. Mycol Res., v. 99, n.9, p.1047-1054, 1995. ROSENTHAL, A.; PYLE, D.L.; NIRANJAN, K. Aqueous and Enzymatic Processes for Edible Oil Extraction. Enzyme Microb Tech., v.19, n.6, p.402-420, 1996 RUIVO, C.C.C. Ocorrncia de leveduras em espcies vegetais nativas da Mata Atlntica, Parque Estadual da Serra do Mar Ncleo Picinguaba. Rio Claro. 2005, 91p. Tese (Doutorado em Cincias Biolgicas), Instituto de Biocincias, Universidade Estadual Paulista Julio de Mesquita Filho, Rio Claro, 2005. RUIVO, C. C. C.; LACHANCE, Marc-Andre; ROSA, C. A.; BACCI JR, M.; PAGNOCCA, F. C.. Candida heliconiae sp. nov., Candida picinguabensis sp. nov. and Candida saopaulonensis sp. nov., three ascomycetous yeasts from Heliconia velloziana (Heliconiaceae). Int J Syst Evol Micr., v.56, n.5, p.1147-1151, 2006. RZEZUTKA, A.; D'AGOSTINO, M.; COOK, N. An ultracentrifugation-based approach to the detection of hepatitis A virus in soft fruits. Int J Food Microbiol. v.108, v.3, p.315-20, 2006. SAID, S.; PIETRO, R.C.L.R. Enzimas de Interesse Industrial e Biotecnolgico. 1. ed. Rio de Janeiro: Eventos, 2002. 121 p.

99

SAITOU, N; NEI, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Bio Evol., v. 4, p.406425, 1987. SANTANNA JR., G.L. Produo de enzimas micorbianas. In: Urgel de Almeida Lima; Eugnio Aquarone; Walter Borzani; Willibaldo Schidel. (Org.). Biotecnologia Industrial. So Paulo: Edgard Blucher Ltda, 2001, v. 3, p. 351-362 SAKAI, T.; SAKAMOTO, T.; HALLAERT, J.; VANDAMME, E.J. Pectin, pectinase and protopectinase: production, properties, and applications. Adv Appl Microbiol. v.39, p.213-94, 1993. SALEH, F.; TAHIR, M.; OHTSUKA, A.; HAYASHI, K. A mixture of pure cellulase, hemicellulase and pectinase improves broiler performance. Br Poult Sci. v.46, n.5, p.602-6, 2005. SANCHEZ, J.; GUIRAUD, J.P.; GALZY, P. A study of the polygalacturonase activity of several yeast strains isolated from cocoa. Appl Microbiol Biot., v.20, p.262 267,1984. SANTINI, M.M. Aplicao de tratamento enzimtico combinado a microfiltrao na clarificao de suco de pssego. Dissertao (Mestrado em Engenharia de Alimentos) Universidade Regional Integrada do Alto Uruguai e das Misses. Erechim, RS: 2004. 79p. SANTOS, E.A.; OLIVEIRA, R.B.; MENDONA-HAGLER, L.C.; HAGLER, A.N. Yeasts associated with flowers and fruits from a Semi-arid Region of Northeastern Brazil. Rev Microbiol., v.27, n.1, p.33-40, 1996. SANTOS, R.D.; FERRARI, R.A. Extrao aquosa enzimtica de leo de soja. Cinc Tecnol Aliment., v.25, n.1, p.132-138, 2005. SCHMIDELL, W. Microrganismos e meios de cultura para utilizao industrial. In: Willibaldo Schmidell; Urgel de Almeida Lima; Eugnio Aquarone; Walter Borzani. (Org.). Biotecnologia Industrial. 1 ed. So Paulo - SP: Editora Edgard Blcher Ltda., 2001, v. 2, p. 518. SCHWAN, R. F.; ROSE, A. H. Polygalacturonase production by Kluyveromyces marxianus: effect of medium composition. J Appl Bacteriology, v.76, p.62-67, 1994. SCHWAN, R.F.; COOPER, R.M.; WHEALS, A.E. Endopolygalacturonase secretion by Kluyveromyces marxianus and other cocoa pulp-degrading yeasts. Enzyme Microb Tech., v.21, p.234-244, 1997.

100

SCHWAN, R.F.; WHEALS, A.E. The microbiology of cocoa fermentation and its role in chocolate quality. Crit Rev Food Sci Nutr. v.44, n.4, p.205-21, 2004. SCORZETTI, G.; FELL, J. W.; FONSECA, A.; STATZELL-TALLMAN, A. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res., v.2, n.4, p.495-517, 2002. SEMENOVA, M.V.; SINITSYNA, O.A.; MOROZOVA, V.V.; FEDOROVA, E.A.; GUSAKOV, A.V.; OKUNEV, O.N.; SOKOLOVA, L.M.; KOSHELEV, A.V.; BUBNOVA, I.U.P.; SINITSYN, A.P. Use of a preparation from fungal pectin lyase in the food industry. Prikl Biokhim Mikrobiol. v.42, n.6, p.681-5, 2006. SILVA, C.F.; SCHWAN, R.F.; SOUSA DIAS, E.S.; WHEALS, A.E. Microbial diversity during maturation and natural processing of coffee cherries of Coffea arabica in Brazil. Int J Food Microbiol. v.60(2-3), p.251-60, 2000. SILVA, E.G. Seleo de leveduras pectinolticas isoladas de frutas tropicais. 2003, 79p. Dissertao (Mestrado em Microbiologia Agrcola), Universidade Federal de Lavras. Minas Gerais, 2003. SILVA, E.G.; BORGES, M.F.; MEDINA, C.; PICCOLI, R.H.; SCHWAN, R.F. Pectinolytic enzymes secreted by yeasts from tropical fruits. FEMS Yeast Res., v.5, p.859865, 2005. SILVA, N.; JUNQUEIRA, V.C.A.; SIVEIRA, N.F.A. Manual de mtodos de anlise microbiolgica de alimentos - Segunda Edio. 2. ed. So Paulo: Editora Varela, 2001. v. 1. 317 p. SOLIS, S.; FLORES, M.E.; HUITRON, C. Isolation of endopolygalacturonase hyperproducing mutants of Aspergillus sp. CH-Y-1043. Biotechnol Lett., v.12, p.751-756, 1990. SPSS INCORPORATION. SPSS for Windows. Statistical Package for the Social Sciences. Release 10.1. Chicago: SPSS Inc., 1995. STADEN PACKAGE. Disponvel em: <http://staden.sourceforge.net/ >. Acesso em: 22 jul. 2007. STEELE, D.B, STOWERS, M.D. Techniques for selection of industrially important microorganisms. Annu Rev Microbiol. v.45, p.89-106, 1991.

101

STRAUSS, M.L.A.; JOLLY, N.P.; LAMBRECHTS, M.G.; van RENSBURG, P. Screening for the production of extracellular hydrolytic enzymes by non-Saccharomyces wine yeasts. J Appl Microbiol., v.91, p.182-190, 2001. SWOFFORD, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates, Sunderland, MA, 2001. THAKUR, B R; SINGH, R.K. HANDA, A. K. Chemistry and uses of pectin: a review. Crit Rev Food Sci Nutrition, v. 37, n.1 p.47-73, 1997. TRINDADE, R. C.; RESENDE, M. A.; PIMENTA, R. S.; LACHANCE, M. A.; ROSA C. A. Candida sergipensis, a new asexual yeast species isolated from frozen pulps of tropical fruits. Antonie Van Leeuwenhoek, v.86, n.1, p.27-32, 2004. TRINDADE, R.C.; RESENDE, M.A.; SILVA, C.M.; ROSA, C.A. Yeasts Associated with Fresh and Frozen Pulps of Brazilian Tropical Fruits. System Appl Microbiol., v.25, p.294 300, 2002. UENOJO, M.; PASTORE, G.M. Isolamento e seleo de microrganismos pectinolticos a partir de resduos provenientes de agroindstrias para produo de aromas frutais. Cin Tecnol Aliment., v.26, n.3, p.509-515, 2006. VALENTE, P.; RAMOS, J. P.; LEONCINI, O. Sequencing as a tool in yeast molecular taxonomy. Can J Microbiol., v.45, p.949-958, 1999. VILGALYS LAB. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA. Disponvel em: <http://www.biology.duke.edu/fungi/mycolab/primers.htm>. Acesso em: 22 fev. 2006. YARROW, D. Methods for the isolation, maintenance, and identification of yeasts. In The Yeasts. A Taxonomic Study ed. Kurtzman, C.P. and Fell, J.W. pp. 77100. Amsterdam: Elsevier Science. 1998

102

APNDICE(S)

APNDICE A Fotografias dos substratos do Semi-rido baiano, dos quais microrganismos leveduriformes produtores de pectinases extracelulares foram isolados.

Solanum sp.

Pavonia sp.

Melocactus sp.

Stachytarpheta sp.

Clusia sp.

Piptadenia sp.

103

Jacaranda sp.

Camptosema sp.

Opuntia sp.

Agave sp.

Passiflora sp.

Ipomoea sp.

104

APNDICE B Fotografias da microscopia de contraste de fase dos microrganismos leveduriformes produtores de enzimas pectinolticas extracelulares, isolados do Semirido baiano, crescidos em gar YM a 28C por 48 h, corados com azul de metileno 1% (p/v) e ampliao de 1.000x (imerso em leo).

Aureobasidium pullulans CCMB 296

Candida boidinii CCMB 297

Trichosporonoides sp. CCMB 298

Pseudozyma sp. CCMB 299

Pseudozyma sp. CCMB 300

Pseudozyma sp. CCMB 301

Cryptococcus liquefaciens CCMB 302

Trichosporonoides sp. CCMB 303

Trichosporonoides sp. CCMB 304

Fungal endophyte CCMB 305

Pseudozyma sp. CCMB 306

Aureobasidium pullulans CCMB 307

105

Fungal endophyte CCMB 308

Aureobasidium pullulans CCMB 309

Aureobasidium pullulans CCMB 310

Fungal endophyte CCMB 311

Aureobasidium pullulans CCMB 312

Aureobasidium pullulans CCMB 313

Aureobasidium pullulans CCMB 314

Aureobasidium pullulans CCMB 315

Aureobasidium pullulans CCMB 316

Aureobasidium pullulans CCMB 317

Aureobasidium pullulans CCMB 318

Aureobasidium pullulans CCMB 319

Aureobasidium pullulans CCMB 320

Aureobasidium pullulans CCMB 321

Kluyveromyces marxianus CCMB 322

106

Aureobasidium pullulans CCMB 323

Aureobasidium pullulans CCMB 324

Aureobasidium pullulans CCMB 325

Aureobasidium pullulans CCMB 326

Fungal endophyte CCMB 327

Fungal endophyte CCMB 328

107

APNDICE C - Seqncias amplificadas do domnio D1/D2 do 26S rDNA dos microrganismos leveduriformes produtores de enzimas pectinolticas extracelulares, isolados do Semi-rido baiano.

1. Seqncia do isolado Aureobasidium pullulans CCMB 296 5gcctccaccagagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccat ccgaagacatcaggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacact cgcatagatgttagactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagt cccggctggccgtattacacactgggctataacacctccaccgaagtgaaggccacattcccaatgcctttatccggccgccgaaactg atgctggcctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaat ttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaaga aatttacctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggatt ctcaccctctatgacgtcctgttccaaggaacttagactggcgttttacccaaagcatcctctacaaattacaatg3 2. Seqncia do isolado Candida boidinii CCMB 297 5gcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatctgaaaacatcaggatcggtc gataatgcacctaaaaggctcttatcttcgttcactttcattacgcgtaagagtttgacaccctaacactcgcatagacgttagactccttgg tccatgtttcaagacgggcggtactgtatcattacgccaaaatcctagccgaagcgcagtcctgagacaagttaggagtcattacttaag actataacactctaaaagagccacatttcaaaagctttttcactccaacaa3 3. Seqncia do isolado Trichosporonoides sp. CCMB 298 5tacccaggtcagacgatcgatttgcacgtcagaaccgcggcggccctccaccagagtttcctctggctttagcctacccaggcatag ttcaccatctttcgggtcccaacatatctgctcttgctcagaccagtattgcccgcaggcgcatggccggccggtgctgctcttacgatcg cacctacattactttcattgcgccctccgggtttgccacccaaagactcgcaaacatgttagactccttggtccgtgtttcaagacgggtcg ctgacggccattaagcctgcaccagtcggtcgcgaagcatccactgcgaggctataacactcccgaaagagccacattcctcacagc cttctcctacacaacccaccaacgcagaccccacacaaaacgcatagcccagcagaaactaggtgtacgccaagtgctacggtactg acagccagcgcttcccttttggcaatttcacgtactctttcactctctttccaaagttcttttcatctttccctcacgggtacttgttcgctatcgg tctctccccgttatttagccttagatggcgtttaccacccattttgcgctgcattcccaaacaacgcgactcgtcgagcgcaccccacaaa gcaacagcaaccacaccaagcacgggattctcaccctctctgatgctgctttccagcagacttgggcatggtaccattacaggaggtac gtctccagcttaca3

108

4. Seqncia do isolado Pseudozyma sp. CCMB 299 5agagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacaggtatgctcttactcaaatccacgacataaat gacgtgaggatcggtcgatggtgcaccttgcggatcccacctgaattcactttcattgcgcctatgggtttgccacccaaagactcgcat acatgttagactccttggtccgtgtttcaagacgggtggtagagggccattatgccaacgccctaagcgtaaaggtgcccgaaggccc gctcttgcgagtacgctgctgtcctcggtctcggtcgctgtatccagtagaaggctataacacaccccgagaggtgccacgttccttcca cccttctccagtgcccaaaaccgacgttggcctgcaatctaggaaaaacaccaagcaaaagcaaggctgaatcctaggccgcatctct gacctcctacccttcccttttggcaatttcacgtactgtttaactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtc tctccccaatatttagccttagatggcatttaccacccattttgagctgcattcccaaacaactcgactcttagaaagtgtatcacaaagcta cgggcgctccaagccatgtacgggattatcaccctctatgatgcccctttccaggggacttaggcttggtccgaagc3 5. Seqncia do isolado Pseudozyma sp. CCMB 230 5agagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacaggtatgctcttactcaaatccacgacataaat gacgtgaggatcggtcgatggtgcaccttgcggatcccacctgaattcactttcattgcgcctatgggtttgccacccaaagactcgcat acatgttagactccttggtccgtgtttcaagacgggtggtagagggccattatgccaacgccctaagcgtaaaggtgcccgaaggccc gctcttgcgagtacgctgctgtcctcggtctcggtcgctgtatccagtagaaggctataacacaccccgagaggtgccacgttccttcca cccttctccagtgcccaaaaccgacgttggcctgcaatctaggaaaaacaccaagcaaaagcaaggctgaatcctaggccgcatctct gacctcctacccttcccttttggcaatttcacgtactgtttaactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtc tctccccaatatttagccttagatggcatttaccacccattttgagctgcattcccaaacaactcgactcttagaaagtgtatcacaaagcta cgggcgctccaagccatgtacgggattatcaccctctatgatgcccctttccaggggacttaggcttggtccgaagcggaaaacacttct tgagattacaatgcggacgccgaagacgccagctttcaatcttgggctcttccctcttcactcgccgt3 6. Seqncia do isolado Pseudozyma sp. CCMB 301 5tatacccaaatttgacgatcgatttgcacgtcagaaccgctacgagcctccaccagagtttcctctggcttcaccctattcaggcatagt tcaccatctttcgggtcccaacaggtatgctcttactcaaatccacgacataaatgacgtgaggatcggtcgatggtgcaccttgcggatc ccacctgaattcactttcattgcgcctatgggtttgccacccaaagactcgcatacatgttagactccttgggtccgtgtttcaagacgggt ggtagagggccattatgccaacgccctaagcgtaaaggtgcccgaaggcccgctcttgcgagtacgctgctgtcctcggtctcggtcg ctgtatccagtagaaggctataacacaccccgagaggtgccacgttccttccacccttctccagtgcccaaaaccgacgttggcctgca atctaggaaaaacaccaagcaaaagcaaggctgaatcctaggccgcatctctgacctcctacccttcccttttggcaatttcacgtactgt ttaactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctccccaatatttagccttagatggcatttaccaccc attttgagctgcattcccaaacaactcgactcttagaaagtgtatcacaaagctacgggcgctccaagccatgtacgggattatcaccctc tatgatgcccctttccaggggacttaggcttggtccgaagcggaaaacacttcttgagattacaatgcggacgccgaaga3 7. Seqncia do isolado Cryptococcus liquefaciens CCMB 302 5tttcctctggcttcgccctattcaggcatagttcaccatctttcgggtcccaacatatatgctcttactcaaatccatcactaaagatccag atcggtcgaagctgcaccttgcggatcgctcctacgttcactttcattgcgcactcgggtttgacacccaaatactcgcagatatgttaga ctccttggtccgtgtttcaagacgggtcgtttaaagccattatgtcaacatcctaagcatgtacgtggacgaatcccggccaaaaggcat gctgcgttcctcagtcccaatcaatgtatatgacgcgaggctataagttcacccgagagtgctaccttccccgtgcctttatccatcgatca aaactgatgttgaccccactcaagggaggtaagtcccaagagcatgactgacttcaatcgtttccctttcaacaa3

109

8. Seqncia do isolado Trichosporonoides sp. CCMB 303 5ctcagaccagtattgcccgcaggcgcatggccggccggtgctgctcttacgatcgcacctacattactttcattgcgccctccgggttt gccacccaaagactcgcaaacatgttagactccttggtccgtgtttcaagacgggtcgctgacggccattaagcctgcaccagtcggtc gcgaagcatccactgcgaggctataacactcccgaaagagccacattcctcacagccttctcctacacaacccaccaacgcagaccc cacacaaaacgcatagcccagcagaaactaggtgtacgccaagtgctacggtactgacagccagcgcttcccttttggcaatttcacgt actctttcactctctttccaaagttcttttcatctttccctcacggtacttgttcgctatcggtctctccccgttatttagccttagatggcgtttac cacccattttgcgctgcattcccaaacaacgcgactcgtcgagcgcaccccacaaagcaacagaaaccacaccaagcacgggattct caccctctctgatgctgctttccagcagacttgggcatggtaccattacaggaggtacgtctccagcttacaatgcgctac3 9. Seqncia do isolado Trichosporonoides sp. CCMB 304 5tatacccaagtcagacgatcgatttgcacgtcagaaccgcgacggtcctccaccagagtttcctctggcttcaacctactcaggcata gttcaccatctttcgggtcccaacatatctgctcttgctcaaaccattcttgcccgcaggcgcatggtcggccggtgctgctccgaagatc gcacccacatcactttcattgcgccccccgggtttgccacccaaagactcgcaaacatgttagactccttggtccgtgtttcaagacggg ccgctgacggccattaagcaccagcccgtcggcagcgaggcatccacgtgcgggctataacactcccgagggagccacattcccac acgccttctcccccaccagccaacgggccggggccccacacgcagcgagtagcccggcagaaaccaggtgtacaccacgtgcttc ggtactgacagccagcgcttcccttttggcaatttcacgtactctttcactctctttccaaagtgcttttcatctttccctcacggtacttgttcg ctatcggtctctccccaatatttagccgtagatggcgtttaccacccattttgcgctgcattcccaaacaacgcgactcgtcgagcgcacc ccacaacgcagcagacaccacaccaagcacgggat3 10. Seqncia do isolado Fungal endophyte CCMB 305 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcag gatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttag actccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgt attacacccagggctataacactcccaccgaagtgagagccacattccctgagcctttatccggccgccaaaactgatgctggcctgtc cagactgagtaaaccggtcagaagaccggccgaacagtcaaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgcttttt aactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccggtatttagctttagaagaaatttacctccc atttagagctgcattcccaaacaactcgactcgtcgaaggagctttacatagggtgccatgtcctgtcacatacgggattctcaccctctat gacgtcctgttccaaggaacttagacaggcggctgccccaaagcatcctctacaaattacaatgcggacccgaaggccagctttcaaat t3 11. Seqncia do isolado Pseudozyma sp. CCMB 306 5gagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacaggtatgctcttactcaaatccacgacataaatg acgtgaggatcggtcgatggtgcaccttgcggatcccacctgaattcactttcattgcgcctatgggtttgccacccaaagactcgcata catgttagactccttggtccgtgtttcaagacgggtggtagagggccattatgccaacgccctaagcgtaaaggtgcccgaaggcccg ctcttgcgagtacgctgctgtcctcggtctcggtcgctgtatccagtagaaggctataacacaccccgagaggtgccacgttccttccac ccttctccagtgcccaaaaccgacgttggcctgcaatctaggaaaaacaccaagcaaaagcaaggctgaatcctaggccgcatctctg acctcctacccttcccttttggcaatttcacgtactgtttaactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtct ctccccaatatttagccttagatggcatttaccacccattttgagctgcattcccaaacaactcgactcttagaaagtgtatcacaaagctac gggcgctccaagccatgtacgggattatcaccctctatgatgcccctttccaggggacttaggcttggtccgaagcggaaaacacttctt gagattacaatgcggacgccgaagacgccagctttcaatcttgggc3

110

12. Seqncia do isolado Aureobasidium pullulans CCMB 307 5tatacccaaatttgacgatcgatttgcacgtcagaaccgctgcgagcctccaccagagtttcctctggcttcaccctattcaggcatagt tcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcaggatcggtcgatggtgcaccttgcggttcccac ctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttcaagacgggtcgctt acaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggctataacaccttcaccgaa gtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggc cgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatca ctctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgt cgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaacttagactggcgttt cacccaaagcatcctctacaaattacaatg3 13. Seqncia do isolado Fungal endophyte CCMB 308 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcag gatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttag actccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgt attacaccctgggctataacacctccaccgaagtggaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtc caaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgcttttt aactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctccca tttagagctgcattcccaaacaactcgactcgtcgaaggagctttacatagggtgccatgtcctgtcacatacgggattctcaccct3 14. Seqncia do isolado Aureobasidium pullulans CCMB 309 5agagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagaca tcaggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagat gttagactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctg gccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggc ctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtg ctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacc tcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccct ctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatgcggacccgaaggccagctttca aatt3 15. Seqncia do isolado Aureobasidium pullulans CCMB 310 5agagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagaca tcaggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagat gttagactccttgggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggct ggccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctgg cctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgt gctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttac ctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccc tctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatg3

111

16. Seqncia do isolado Fungal endophyte CCMB 311 5gggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcct agccgaagcgcggacctcagtcccggctggccgtattacacccagggctataacactcccaccgaagtgagagccacattccctggg cctttatccggccgccaaaactgatgctggcctgtccagactgagtaaaccggtcagaagaccggccgaacagtcaaaacaagtctga ttgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtct ctcgccggtatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacatagggt gccatgtcctgtcacatacgggattctcaccctctatgacgtcctgttccaaggaacttagacaggcggctgccccaaagcatcctctac aaattacaatgcggacccgaaggccagctttcaaatt3 17. Seqncia do isolado Aureobasidium pullulans CCMB 312 5ggggtttgacacccgaacactcgcatagatgttagactccttgggtccgtgtttcaagacgggtcgcttacaaccattacgccagcat cctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccag agcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtct gattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcgg tctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacatagg ttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctaca aattacaat3 18. Seqncia do isolado Aureobasidium pullulans CCMB 313 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcag gatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttag actccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgt attacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtc caaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgcttttt aactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctccca tttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatg acgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatgcggacccgaaggccagctttcaaat3 19. Seqncia do isolado Aureobasidium pullulans CCMB 314 5caagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggct ataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaacc ggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagt gcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcc caaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaag gaacttagactggcgtttcacccaaagcatcctctacaaattacaatgc3

112

20. Seqncia do isolado Aureobasidium pullulans CCMB 315 5gacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggctata acaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccgg tcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgct tttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaa acaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaa cttagactggcgtttcacccaaagcatcctctacaaattacaatgcggacccgaaggccagctttcaaatt3 21. Seqncia do isolado Aureobasidium pullulans CCMB 316 5gcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttca agacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggctataa caccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggt cagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgctt ttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaa caactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaact tagactggcgtttcacccaaagcatcctctacaaattacaatg3 22. Seqncia do isolado Aureobasidium pullulans CCMB 317 5acccaaatttgacgatcgatttgcacgtcagaaccgctgcgagcctccaccagagtttcctctggcttcaccctattcaggcatagttc accatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcaggatcggtcgatggtgcaccttgcggttcccacct ccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttcaagacgggtcgcttac aaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctgggctataacaccttcaccgaagt gaaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggccg aacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcact ctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcg aaggagctttacataggttaacatttccagtcacatacgggattctcaccctct3 23. Seqncia do isolado Aureobasidium pullulans CCMB 318 5cactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttcaagacgggtcgcttacaa ccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacaccctggggctataacaccttcaccgaagtg aaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggccga acagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactc tacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcga aggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaagg3

113

24. Seqncia do isolado Aureobasidium pullulans CCMB 319 5gagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacat caggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatg ttagactccttgggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctg gccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggc ctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtg ctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacc tcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccct ctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatgcggacccgaaggccagctttca aatt3 25. Seqncia do isolado Aureobasidium pullulans CCMB 320 5cctccaccagagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatc cgaagacatcaggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactc gcatagatgttagactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtc ccggctggccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactg atgctggcctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaat ttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaaga aatttacctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggatt ctcaccctctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatgcggacccgaaggcc agctttcaaat3 26. Seqncia do isolado Aureobasidium pullulans CCMB 321 5agtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatc aggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgtt agactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggc cgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggcct gtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctt tttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcc catttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctcta tgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatg3 27. Seqncia do isolado Kluyveromyces marxianus CCMB 322 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcag gatcggtcgatgatgcacccttgcgggccctcacctacgttcactttcattacgcgtacgggttttacacccaaacactcgcatagacgtt agactccttggtccgtgtttcaagacgggcggcatttaaccattacgccagcatccttgacaaaagtcgcaatcctcagtcccagctggc tgtattcccacgggctataacactctaccgaagcagagccacattcccgaggatttatccaaccgctaaaactgatgctggcccagcga aagccgaagcaaacgccatgtctgatcaaatgcccttccctttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttcca tcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatttaccacccacttagagctgcattcccaaacaactcgact cgtcgaaagcactttacaaataactgggatcctcgccacacgggattctcaccctctatgacgtcctgttccaaggaacatagacaagg accagctacaaagtcgccttcttcaaattacaactcggacgtcg3

114

28. Seqncia do isolado Aureobasidium pullulans CCMB 323 5acccaaatttgacgatcgatttgcacgtcagaaccgctgcgagcctccaccagagtttcctctggcttcaccctattcaggcatagttc accatctttcgggtcccaacagctatgctcttactcaaatccatccgaagacatcaggatcggtcgatggtgcaccttgcggttcccacct ccgttcactttcattacgcgcaggggtttgacacccgaacactcgcatagatgttagactccttggtccgtgtttcaagacgggtcgcttac aaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattacacactgggctataacacctccaccgaagt ggaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggccg aacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcact ctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcg aaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaacttagactggcgttttac ccaaagcatcctctacaaattacaatgcgaacccgaaggctagctttcaaatt3 29. Seqncia do isolado Aureobasidium pullulans CCMB 324 5gtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctggccgtattaca cactgggctataacacctccaccgaagtggaggccacattcccagagcctttatccggccgccgaaactgatgctggcctgtccaaac tgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactct ctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacctcccatttaga gctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccctctatgacgtcc tgttccaaggaacttagactggcgttttacccaaagcatcctctacaaattacaatgcgaacccgaagg3 30. Seqncia do isolado Aureobasidium pullulans CCMB 325 5gggcctttatccggccgccgaaactgatgctggcctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaa gtctgattgcaagcgcttccctttcaacaatttcacgtgctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctat cggtctctcgccaatatttagctttagaagaaatttacctcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacat aggttaacgtttccagtcacatacgggattctcaccctctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctc tacaaattacaatgcggacccgaaggccagctttcaaatt3 31. Seqncia do isolado Aureobasidium pullulans CCMB 326 5agagtttcctctgggcttcaccctattcaggcatagttcaccatctttcgggtcccaacagctatgctcttactcaaatccatccgaagac atcaggatcggtcgatggtgcaccttgcggttcccacctccgttcactttcattacgcgcaggggtttgacacccgaacactcgcataga tgttagactccttggtccgtgtttcaagacgggtcgcttacaaccattacgccagcatcctagccgaagcgcggacctcagtcccggctg gccgtattacaccctgggctataacaccttcaccgaagtgaaggccacattcccagagcctttatccggccgccgaaactgatgctggc ctgtccaaactgagtaaaccggtcagaagaccggccgaacagtttaaacaagtctgattgcaagcgcttccctttcaacaatttcacgtg ctttttaactctctttccaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctcgccaatatttagctttagaagaaatttacc tcccatttagagctgcattcccaaacaactcgactcgtcgaaggagctttacataggttaacatttccagtcacatacgggattctcaccct ctatgacgtcctgttccaaggaacttagactggcgtttcacccaaagcatcctctacaaattacaatg3

115

32. Seqncia do isolado Fungal endophyte CCMB 327 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtccgaggctttacgctcttactcaaatccatccgaatacatcagg atcggtcgatgatgcgccgaagctctcacctacgttcactttcattacgcgtgcgggttttacacccaaacactcgcgcaaaacctcgact ccttggtccgtgtttcaagacgggtcgctgatgaccattatgccagcgtccttgcagagcgcgaacctcggtccccgcgagggtattaa acgacgggctataacactcccggaggagccacgttcccgacgcttttatccccccgcgagaaccgacgctggcctgagccgggtcg agtgcaccagtgagaacactggatgatcagcccggcgcaagtctggtcacaagcgcttccctttcaacaatttcacgtgctatttaaccc tcttttcaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctggcctatatttagctttagaagagatatacctcccattttga gcagcattcccaaactactcgactcgtcgaaggagctttacagaggctaggtgtccgactatacggggctctcaccctctctggcgtcc cgttccagggaactcagaaggcacctcgccaaaagcatcctctacaaattacaactcgggccgaagccagatttcaaatt3 33. Seqncia do isolado Fungal endophyte CCMB 328 5tttcctctggcttcaccctattcaggcatagttcaccatctttcgggtccgaggctttacgctcttactcaaatccatccgaatacatcagg atcggtcgatgatgcgccgaagctctcacctacgttcactttcattacgcgtgcgggttttacacccaaacactcgcgcaaaacctcgact ccttggtccgtgtttcaagacgggtcgctgatgaccattatgccagcgtccttgcagagcgcgaacctcggtccccgcgagggtattaa acgacgggctataacactcccggaggagccacgttcccgacgcttttatccccccgcgagaaccgacgctggcctgagccgggtcg agtgcaccagtgagaacactggatgatcagcccggcgcaagtctggtcacaagcgcttccctttcaacaatttcacgtgctatttaaccc tcttttcaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctctggcctatatttagctttagaagagatatacctcccattttga gcagcattcccaaactactcgactcgtcgaaggagctttacagaggctaggtgtccgactatacggggctctcaccctctctggcgtcc cgttccagggaactcagaaggcacctcgccaaaagcatcctctacaaattacaactcgggccgaagccagatttcaaatt3

116

APNDICE D - Curvas de calibrao

1. Curva padro obtida com o cido D-galacturnico pelo mtodo do DNS (MILLER, 1959), para determinao da atividade da poligalacturonase (PG).

Curva padro do cido galacturnico


1.2 Absorbncia (540nm) 1 0.8 0.6 0.4 0.2 0 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Concentrao (mg/mL) y = 0,8055x - 0,0069 R2 = 0,9976

Concentrao (mg/mL) 0,2162 0,324 0,4324 0,5405 0,6486 0,7567 0,8648 0,9729 1,08 1,19

Absorbncia1 0,1761 0,2689 0,351 0,4155 0,5001 0,5814 0,7082 0,7536 0,8858 0,9585

Absorbncia2 0,171 0,2596 0,3436 0,4188 0,5032 0,5926 0,7 0,7634 0,8634 0,9653

Mdia da Absorbncia (540nm) 0,17355 0,29645 0,3917 0,478 0,57435 0,66905 0,7865 0,86325 0,9829 1,07425

117

2. Curva padro obtida com albumina de soro bovino (BSA) usando o mtodo de Bradford (1976), para determinao da protena total.

Curva padro da albumina de soro bovino (BSA)


1 Absorbncia (595nm) 0.8 0.6 0.4 0.2 0 0 20 40 60 80 100 120 Concentrao (g/mL) y = 0,0089x - 0,0069 R2 = 0,9931

Concentrao (g/mL) 10 20 30 40 50 60 70 90 100

Absorbncia1 0,0802 0,1711 0,2423 0,3502 0,4428 0,5389 0,6687 0,7851 0,851

Absorbncia2 0,0808 0,1507 0,2539 0,3524 0,421 0,5133 0,6685 0,7867 0,8514

Mdia da Absorbncia (595nm) 0,0805 0,1609 0,2481 0,3513 0,4319 0,5261 0,6686 0,7859 0,8512

118

ANEXO(S)

Todo material de laboratrio, meios de cultura, solues e tampes utilizados foram esterilizado em autoclave, a 121 C por 15 minutos.

ANEXO A - Meios de cultura

1. Agar YM (WICKERHAM, 1951 apud MAZUR, 1961)

Composto de extrato de levedura 3% (p/v), extrato de malte 3% (p/v), peptona 5% (p/v), glicose 10% (p/v) e agar 20% (p/v) dissolvidos em gua destilada; pH 6,2.

2. Agar MP-5 (HANKIN; LACY, 1984 apud SILVA, 2003)

Composto de cido poligalacturnico 5% (p/v), glicose 5% (p/v), KH2PO4 4% (p/v), NaHPO4 6% (p/v), (NH4)2SO4 2% (p/v), extrato de levedura 1% (p/v), FeSO4 0,001% (p/v), MgSO4 0,20% (p/v), CaCl2 0,001% (p/v), H3BO3 0,00001% (p/v), MnSO4 0,00001% (p/v), ZnSO4 0,00007% (p/v), CuSO4 0,00005% (p/v), MoO3 0,00001% (p/v) e gar 15% (p/v) dissolvidos em gua destilada; pH 5,5.

119

3. Agar MP-7 (HANKIN; LACY, 1984 apud SILVA, 2003)

Composto de pectina 5% (p/v), glicose 5% (p/v), KH2PO4 4% (p/v), NaHPO4 6% (p/v), (NH4)2SO4 2% (p/v), extrato de levedura 1% (p/v), FeSO4 0,001% (p/v), MgSO4 0,20% (p/v), CaCl2 0,001% (p/v), H3BO3 0,00001% (p/v), MnSO4 0,00001% (p/v), ZnSO4 0,00007% (p/v), CuSO4 0,00005% (p/v), MoO3 0,00001% (p/v) e gar 15% (p/v) dissolvidos em gua destilada; pH 7,2.

4. Caldo de fermentao (PATCHING; ROSE, 1969 apud PEREIRA, 2005)

Composto de extrato de levedura 1% (p/v), glicose 10% (p/v), (NH4)2SO4 3% (p/v), KH2PO4 4,5% (p/v), MgSO4 0,25% (p/v), CaCl2 0,25% (p/v) dissolvidos em gua destilada; pH 5,0.

120

ANEXO B - Solues, tampes e reagentes

1. Soluo de Tris-HCl 1 M (pH 8,0)

Dissolveu-se 121,1 g de Trizma base em 800 mL de gua milli-Q, ajustando o pH para 8,0 com HCl e completando-se o volume para 1000 mL com gua milli-Q.

2. Soluo de cido etileno diamino tetra actico (EDTA) 0,5 M (pH 8,0)

Dissolveu-se 37,22 g de EDTA em 160 mL de gua milli-Q, ajustando o pH para 8,0 com pastilhas de NaOH e completando-se o volume para 200 mL com gua milli-Q.

3. Tampo de extrao de DNA, modificado de Doyle e Doyle (1987)

Dissolveu-se (em banho-maria 65C) 2 g de CTAB em 28 mL de NaCl 5 M, 10 mL de Tris-HCl 1 M (pH 8,0) e 4 mL de EDTA 0,5 M. Em seguida, acrescentou-se 2 g de PVP-40 e ps no agitador por 10 h, sendo o volume completado para 100 mL com gua milli-Q.

4. Tampo Tris-EDTA (TE)

Misturou-se 1 mL de Tris-HCl 1 M (pH 8,0) com 0,2 mL de EDTA 0,5 M (pH 8,0), completando o volume com gua milli-Q para 100 mL.

121

5. Tampo Tris-Acetato/EDTA (TAE) 50X

Dissolveu-se 242 g de Trizma base em 57,1 mL de cido actico glacial e 100 mL de EDTA 0,5 M (pH 8,0), sendo o volume completado para 1000 mL com gua milli-Q.

6. Soluo de cido actico 0,05 M

Misturou-se 0,29 mL de cido actico em 100 mL de gua milli-Q.

7. Soluo de acetato de sdio 0,05 M

Dissolveu-se 0,41 g de acetato de sdio em 100 mL de gua milli-Q.

8. Tampo acetato 0,05 M (pH 5,0)

Misturou-se 14,8 mL da soluo de cido actico com 35,2 da soluo de acetato de sdio, sendo o volume completado para 100 mL com gua milli-Q.

9. Soluo de Fosfato de sdio monobsico 0,05 M

Dissolveu-se 0,695 g de fosfato de sdio monobsico em 100 mL de gua milli-Q.

9.1 Soluo de Fosfato de sdio dibsico 0,05 M

Dissolveu-se 1,34 g de fosfato de sdio dibsico (heptahidratado) em 100 mL de gua milli-Q.

122

9.2 Tampo fosfato 0,05 M (pH 7,5)

Misturou-se 16,0 mL da soluo de fosfato de sdio monobsico com 84,0 mL da soluo de fosfato de sdio dibsico (heptahidratado), sendo o volume completado para 100 mL com gua milli-Q.

9.3 Reagente cido 3,5-dinitrosaliclico (DNS) (MILLER, 1959)

Dissolveu-se 10 g de cido 3,5-dinitrosaliclico em 500 mL de gua destilada a 85C. Em seguida, adicionou-se 200 mL de soluo de NaOH 2 N e 300 g de tartarato duplo de sdio e potssio, completando o volume com gua destilada para 1000 mL

9.4 Reagente de Bradford (BRADFORD, 1976)

Dissolveu-se 50 mg de Azul Brilhante de Coomassie G-250 em 25 mL de etanol 95%. Em seguida, adicionou-se 50 mL de cido fosfrico 85%, sendo o volume completado para 500 mL com gua destilada.