Vaccine 24 (2006) 23872394

F4 (K88) mbrial adhesin FaeG expressed in alfalfa reduces F4+ enterotoxigenic Escherichia coli excretion in weaned piglets
J.J. Joensuu a, , F. Verdonck b , A. Ehrstr m c , M. Peltola a , H. Siljander-Rasi e , o d , K.-M. Oksman-Caldentey d , T.H. Teeri a , E. Cox b , A.M. Nuutila B.M. Goddeeris b , V. Niklander-Teeri a
b

Department of Applied Biology, P.O. Box 27, FIN-00014 University of Helsinki, Finland Laboratory of Veterinary Immunology, Faculty of Veterinary Medicine, Gent University, BE-9820 Merelbeke, Belgium c Department of Animal Science, P.O. Box 28, FIN-00014 University of Helsinki, Finland d VTT Biotechnology, P.O. Box 1500, FIN-02044 VTT, Finland e MTT Agrifood Research Finland, Swine Research, Tervam entie 179, FIN-05840 Hyvink a, Finland a a Received 19 May 2005; received in revised form 21 November 2005; accepted 24 November 2005 Available online 9 December 2005

Abstract Transgenic plants are attractive bioreactors to large-scale production of recombinant proteins because of their relatively low cost. This study reports for the rst time the use of transgenic plants to reduce enterotoxigenic Escherichia coli (ETEC) excretion in its natural host species. The DNA sequence encoding the major subunit and adhesin FaeG of F4+ ETEC was transformed into edible alfalfa plants. Targeting of FaeG production to chloroplasts led to FaeG levels of up to 1% of the total soluble protein fraction of the transgenic alfalfa. Recombinant plant-produced FaeG (pFaeG) remained stable for 2 years when the plant material was dried and stored at room temperature. Intragastric immunization of piglets with pFaeG induced a weak F4-specic humoral response. Co-administration of pFaeG and the mucosal adjuvant cholera toxin (CT) enhanced the immune response against FaeG, reected a better induction of an F4-specic immune response. In addition, the intragastric co-administration of CT with pFaeG signicantly reduced F4+ E. coli excretion following F4+ ETEC challenge as compared with pigs that had received nontransgenic plant material. In conclusion, transgenic plants producing the FaeG subunit protein could be used for production and delivery of oral vaccines against F4+ ETEC infections. 2005 Elsevier Ltd. All rights reserved.
Keywords: F4 (K88) mbriae; Enterotoxigenic Escherichia coli; Plant-made vaccine; Alfalfa; Chloroplast targeting; Piglet

1. Introduction Diarrhea caused by F4+ enterotoxigenic Escherichia coli (ETEC) is a common problem among neonatal and newly weaned piglets. ETEC infections result in severe economic losses due to mortality and reduced growth rates. F4 mbriae are long proteinaceous appendages radiating from the surface of F4+ ETEC, with a length of 0.11 m and a diameter of 2.1 nm. They are composed of hundreds of identical repeating protein subunits, called FaeG, as well as some minor subunits

Corresponding author. Tel.: +358 9 191 58 451; fax: +358 9 191 58 434. E-mail address: jussi.joensuu@helsinki. (J.J. Joensuu).

[1,2]. The major F4 mbrial subunit, FaeG, is also the adhesive subunit, allowing these bacteria to adhere to F4-specic receptors (F4R) on small intestinal enterocytes [3], which results in colonization, toxin production and subsequent diarrhea. To prevent ETEC infections in suckling piglets, sows can be vaccinated parenterally with F4 mbriae, with the protective IgA antibodies then being transmitted via colostrum and milk to suckling piglets [4]. Parenteral vaccination is not efcient in preventing post-weaning diarrhea in piglets no longer protected by passive lactogenic immunity since it stimulates a systemic rather than intestinal F4-specic immune response [57]. Oral vaccination of piglets with puried F4 mbriae or the recombinantly produced F4 mbrial adhesin

0264-410X/$ see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2005.11.056

2388

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

FaeG, by contrast, has been reported to induce an F4-specic mucosal immune response [810]. Vaccines are typically composed of killed or attenuated disease-causing organisms. Recombinant subunit vaccines offer a desirable alternative, with potentially fewer sideeffects than delivering the whole organism. Recombinant subunit vaccines do not contain an infectious agent, thus being safer to administer and prepare. Subunit vaccines are mostly produced in genetically engineered bacteria, yeast, or mammalian cells. However, plant-produced subunit vaccines would be safer than the classically used recombinant production systems since contamination risk with mammalian pathogens is signicantly reduced. Transgenic plants would also function as low-cost, efcient, and practical oral vaccine delivery vehicles to stimulate mucosal immunity (for review, see [11]). Expression of recombinant FaeG has recently been reported in tobacco chloroplasts [12] and tobacco cytosol [13]. Moreover, recombinant FaeG produced in chloroplasts of tobacco was able to bind the F4 receptor present on porcine villous enterocytes [12], which is necessary to induce an F4-specic immune response following oral immunization [9,14]. Tobacco has many advantages as a laboratory model plant, including high transformation efciency and easy cell culture protocols. However, unlike crop plants, tobacco cannot be used as a delivery vehicle for oral vaccines since it contains high amounts of toxic secondary metabolites. Alfalfa is a good candidate species for edible plant vaccine production. It can be cultivated in variety of different climates and is commonly used as an additive to improve the quality of feed. Furthermore it can be easily processed with techniques that do not disturb the properties of foreign proteins. In this study, the F4 mbrial adhesin FaeG was transformed into the crop plant alfalfa and used to immunize weaned piglets intragastrically. We then determined whether an F4-specic immune response was induced that could reduce the excretion of F4+ E. coli following an F4+ ETEC challenge.

2. Materials and methods 2.1.1. Plant material To express FaeG adhesin in the chloroplast of alfalfa (Medicago sativa L.), the PCR product (the primers: CAAGGATCCTGGATGACTGGTGATTTC, CCATCTAGATCAGTAATAAGTTATTGCTAC) of FaeG-encoding DNA sequence from the ETEC 5/95 strain (serotype O149:F4ac, LT+ , ST-B+ ) was cloned under the Cauliower Mosaic Virus 35S RNA promoter and linked to the chloroplast transit peptide (TP)-encoding sequence of the pea rubisco small subunit gene ss3.6 [15]. The resulting gene construct [12] was conjugated into Agrobacterium tumefaciens strain C58C1RifR [16] that contained the modied

Ti-plasmid pGV2260 [17], using triparental mating [18]. Alfalfa hybrid Regen-SY [19] leaf explants were dipped for 5 min in 18 h grown Agrobacterium culture. For formation of callus the explants were cultivated in dim light at 23 C on a SH based callus induction medium [20,21]. For induction of somatic embryogenesis, the callus was further cultivated on SH media [22] supplemented with 10 mM NH4 NO3 and 30 mM proline. Root formation was induced on SH media supplemented with 0.29 mM GA3 . Rooted seedlings were transplanted into pots containing a mixture of peat and vermiculite. The transformation and the transgene copy number of alfalfa T0 -plantlets from ve separate transgenic lines (60.1, 60.2, 60.3, 60.4, and 60.5) were conrmed by DNA hybridization analysis. Total DNA was prepared from the leaves as described by [23]. Ten micrograms of HindIIIdigested DNA were separated on a 1% agarose gel and transferred to a nylon membrane (Hybond-N+, Amersham Biosciences, Espoo, Finland) according to [24]. The probe was prepared from the faeG-PCR fragment by labeling the fragment with a RediprimeTM II random prime labeling system kit (Amersham Biosciences, Espoo, Finland) and [32 P]dCTP. The probe was puried from unincorporated nucleotides with a NickTM Column (Amersham Biosciences, Espoo, Finland). Hybridization was performed overnight at 42 C using the ULTRAhybTM hybridization buffer (Ambion, Cambridgeshire, UK). The membrane was washed twice for 20 min at 65 C with 2 SSC (0.3 M NaCl, 0.3 M Nacitrate, pH 7.0) supplemented with 0.1% SDS, three times with 0.2 SSC-0.1% SDS, and once with 0.1 SSC-0.1% SDS. Membranes were incubated with the phosphoimager plate (Imaging plate BAS-MP 2040S, Fujilm) for 23 h, and scanned with a phosphoimager (BAS-1500, Fujilm, Japan). The level of FaeG accumulation in the transgenic plant lines was analyzed by densitometry on immunoblots as described by [12]. T0 -plants from two high-yield transgenic lines (60.1 and 60.3) with a single copy of transgene were vegetatively propagated by cuttings in mixture of peat and vermiculite and grown in a greenhouse (18 C, 16/8 h light period, 60% relative humidity), with the green tissues being harvested at 2-week intervals. The plant material obtained was dried in an oven at 37 C to 10% humidity, wrapped in plastic, and stored at room temperature. To perform the immunization experiment, the dried transgenic alfalfa (1:1 mixture of lines 60.1 and 60.3), as well as control alfalfa was pulverized by using an experimental mill (KT-30, Koneteollisuus Oy, Helsinki, Finland) with a 0.8-mm sieve. Soluble proteins from dry transgenic plant powder were extracted by adding 15 volume (w/v) extraction buffer containing 0.2 M HEPES-KOH (pH 7.0), 20 mM DTT, and a Complete Mini protease inhibitor cocktail mix (Roche, Espoo, Finland), and homogenized with a mortar and pestle on ice. The homogenate was centrifuged for 10 min at 4 C at 14,000 g, the recovered supernatant represented the total soluble proteins (TSP). The total soluble protein

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

2389

concentration of the supernatant was determined by Bradford dye binding with a Bio-Rad protein assay kit (Bio-Rad Laboratories, Espoo, Finland) using bovine serum albumin (BSA) as a standard. The amount of FaeG in the TSP was analyzed on immunoblots with densitometry analysis as described in [12]. 2.2. Purication of F4 mbriae F4 mbriae were puried as described by Van den Broeck et al. [14]. The purity of the puried F4 mbriae was assessed using a Coomassie-stained 10% SDS-PAGE and a Bio-Rad ChemiDocTM station equipped with Quantity One software (Bio-Rad Laboratories, Espoo, Finland). The protein concentration of puried F4 mbriae was determined using bicinchoninic acid reaction, with BSA as a standard (SigmaAldrich, Helsinki, Finland), taking into account the purity of the puried F4 mbriae. 2.3. Bacterial inoculum Bacteria of F4+ ETEC strain 5/95 (serotype O149:F4ac, LT+ , ST-B+ ) were collected from an overnight culture in Tryptone Soya Broth (Scharlau Chemie, Barcelona, Spain), as described elsewhere [9]. The concentration of the bacteria was determined by measuring the optical density (OD) of 10-fold dilutions of the bacterial suspension at 660 nm. Bacterial suspension at 660 nm with an OD660 of 1 equalling 109 viable bacteria/ml, as determined by counting colonyforming units. 2.4. Animal trial 2.4.1. Animals Nineteen F4R+ and F4-seronegative conventionally bred pigs (Finnish Landrace Yorkshire) from three different litters were used. Pigs were managed according to legislation documented within the Finnish Animal Welfare Act (247/96), the Order of using vertebrate animals for scientic purposes (1076/85), and the European convention for the protection of vertebrate animals used for experimental and scientic purposes. The piglets were weaned at the age of 4 weeks, randomized into four groups and housed in an isolation unit where they received water and standard piglet food ad libitum. The piglets were treated orally with OriprimTM (125 mg/kg of body weight, Orion Pharma, Espoo, Finland) from 2 days before till 3 days after the weaning to prevent E. coli infections due to transport and handling. 2.4.2. Immunizations At 1 week post-weaning, the piglets were intragastrically immunized. The rst group (C, n = 4) received 30 g of dried and pulverized nontransgenic plant material and served as a negative control. The second group (C + F4, n = 5) received 2 mg of puried F4 mbriae mixed with a similar amount of nontransgenic plant material. This group served

as positive control since oral administration of 2 mg of puried F4 has been shown to protect F4R+ piglets against a subsequent challenge with F4+ ETEC [9]. The third and fourth groups were immunized with transgenic alfalfa. The FaeG subunits produced in transgenic alfalfa plants appear as monomers, whereas puried F4 mbriae are multimers (data not shown). Since polymeric antigens tend to stimulate a higher immune response than monomeric forms [9], a 10-times higher amount of monomeric pFaeG (20 mg) than F4 mbriae (2 mg) was used to immunize the piglets. The third group (pFaeG group, n = 5) was immunized with 30 g of pulverized transgenic plant material containing 20 mg of FaeG. The fourth group (pFaeG + CT, n = 5) received the same amount of transgenic plant material supplemented with 50 g of cholera toxin (CT) (List Biological Laboratories, Campbell, USA). The puried F4 mbriae, CT, and the plant material were dissolved in a nal volume of 300 ml water containing 0.28% (w/v) NaHCO3 for gastric pH neutralization and administered intragastrically at 0, 1, 2, and 14 days post-primary immunization (dppi). Animals were deprived of food and water 3 h before till 2 h after the immunizations. One week after the booster immunization (21 dppi), the animals were orally challenged with virulent F4+ ETEC strain 5/95, as previously described by [25], with minor modications. Briey, pigs were orally pre-treated at 1518 dppi with OriprimTM (125 mg/kg of body weight, Orion Pharma, Espoo, Finland) to decrease colonization resistance. At 21 dppi, pigs were sedated with azaperon (StresnilTM , Janssen-Cilag, Espoo, Finland, 1 mg/kg body weight), after which gastric pH was neutralized with intragastric administration of 60 ml of 0.17 M NaHCO3 . Fifteen to thirty minutes later, 1010 F4+ ETEC in 20 ml of PBS were given intragastrically. 2.4.3. Sample collection Blood was collected from the jugular vein on 0, 7, 14, 21, 25, 28, and 35 dppi to analyze F4- and CTspecic serum antibodies. To determine the excretion of F4+ ETEC, faecal samples were taken daily from challenge until 8 days post-challenge (29 dppi) and kept on ice until the subsequent analysis. Two weeks after the challenge (35 dppi), the pigs were euthanized, and jejunal villi were isolated as described elsewhere [14] to conrm the presence of F4R. 2.4.4. Assays The presence of F4-specic IgA, IgG, and IgM in serum was determined with ELISA as described by [8], with one minor modication. Microtiter plates were directly coated with puried F4 mbriae derived from strain 5/95 (10 g/ml in PBS). To detect CT-specic serum antibodies, 96-well microtiter plates (NUNC Maxisorb, Roskilde, Denmark) were coated with CT (5 g/ml in PBS) and incubated overnight at 4 C. The plates were blocked with dilution buffer (1% BSA in PBS). Series of 2-fold dilutions of

2390

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

serum samples (in dilution buffer) starting from 1/10 were added. Alkaline phosphatase-conjugated goat anti-pig antiserum (Bethyl laboratories, Montgomery, USA) was used as a secondary antibody (1/3000 in dilution buffer). Plates were incubated for 1 h at room temperature between the steps described above. Three washings with PBS were done between every step, except after the blocking. p-Nitrophenyl phosphate was used as a substrate, and OD455 was spectrophotometrically determined. The cut-off value was calculated as mean OD455 value of all sera at day 0, increased by three-times the standard deviation. The antibody titer was the inverse of the highest dilution that still had an OD455 higher that the cut-off value (0.603). To analyze excretion following F4+ ETEC challenge, F4 E. coli were enumerated in faecal samples by dot blotting using the F4-specic MAb (CVI-F4ac-5, CIDC-Lelystad, Lelystad, the Netherlands), as previously described by [8], with minor modications. The bacterial colonies were blotted on nitrocellulose membrane and detected with anti-mouse IgG AP conjugate (Promega, Madison, USA) using chromogenic detection with NBT/BCIP (Promega). The resulting dots were counted and the average for each group was calculated. The presence of F4R was analyzed by an in vitro villous adhesion assay as described by [14]. 2.5. Statistical analysis Statistical analysis (SPSS 12.0 for Windows) of serum antibody titers and F4 E. coli excretion was performed using a General Linear Model (repeated measures analysis of variance), adjusting for multiple comparisons by Bonferoni. Differences in fecal scores between groups were analyzed for statistical signicance using the MannWhitney U-test.

Fig. 1. Analysis of ve alfalfa T0 -plants transformed with gene encoding FaeG protein. (A) DNA hybridization analysis showing the copy number of transgene. 60.1, 60.2, 60.3, 60.4, and 60.5 are the transgenic alfalfa plants and C is the nontransgenic alfalfa. Ten micrograms of DNA was loaded for lanes 16. DNA size in kb. (B) Immunoblot analysis of FaeG expression. Total of 20 g of TSP was loaded for lanes 16. Molecular mass in kDa.

conrm that alfalfa can be used as a high-yield expression and storage vehicle for foreign proteins. 3.2. Intragastric immunization of newly weaned piglets with pFaeG induces a slight systemic F4-specic immune response To analyze whether pFaeG could be used as a subunit vaccine, transgenic plant material (60.1 and 60.3) was vegetatively multiplied under greenhouse conditions and used to immunize weaned piglets. Following the rst intragastric immunization of newly weaned piglets (0, 1, and 2 dppi), only a very low F4-specic IgM titer was observed in the positive control group immunized with puried F4 mbriae (C + F4 group; mean titer 17) at 7 dppi (Fig. 3). The booster immunization induced a weak secondary F4-specic systemic immune response in the C + F4 group, with the F4-specic IgM antibody titer decreasing and the IgA and IgG titers increasing 1 week following the boost. Intragastric immunization with pFaeG also induced an F4-specic immune response; low F4-specic IgG titers were detected in the pFaeG at 21 dppi. Induction was improved when pFaeG was co-administered with CT as a mucosal adjuvant (pFaeG + CT group). These data indicate that intragastric immunization of newly weaned piglets with pFaeG does activate a weak systemic F4-specic immune response.

3. Results 3.1. Alfalfa plants expressing FaeG To examine whether orally delivered FaeG expressed in plants is able to provide protection against F4 ETEC diarrhea in weaned piglets, the crop plant alfalfa was transformed with a FaeG-encoding construct. In ve T0 -transgenic alfalfa lines, DNA hybridization experiments of genomic DNA revealed unique integration patterns with 13 copies of the faeG transgene (Fig. 1A). Accumulation of plant-produced FaeG (pFaeG) in these T0 -plants was conrmed by immunoblotting and was not signicantly affected by the copy number of the transgene (Fig. 1B). Lines 60.1 and 60.3 with a single copy of the transgene were subjected for further analysis and the proportion of pFaeG in the fresh plant tissue was up to 1% of TSP (Fig. 2). No degradation of pFaeG was observed when the transgenic plant material was dried, or after a 2-year storage period at room temperature (Fig. 2). By self pollination of T0 -plants, the transgene was inherited to T1 -generation with the similar expression level (data not shown). These results

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

2391

Fig. 2. Immunoblot analysis of FaeG expression in transgenic alfalfa. Lanes 12, 0.1 and 0.5 g of puried F4 mbriae; lanes 3 and 4, total soluble protein (TSP) from fresh tissue of T0 transgenic plants 60.1 and 60.3; lane 5, TSP from fresh nontransgenic plant; lane 6, TSP from dried transgenic plant material (1:1 mixture of 60.1 and 60.3 plants) after 2 years of storage. A total of 20 g of TSP was loaded for lanes 36. Molecular mass in kDa.

3.3. Intragastric immunization of weaned piglets with pFaeG reduces F4+ E. coli excretion following F4+ ETEC challenge To determine whether intragastric immunization of newly weaned piglets with pFaeG also induces a mucosal F4specic immune response, the piglets were challenged with pathogenic F4+ ETEC strain 5/95, and fecal excretion of F4+ E. coli was analyzed daily (Fig. 4). Animals in the negative control group (C), which received nontransgenic plant material, excreted F4+ E. coli till 7 days post-challenge (dpc), with maximal numbers being around 106 F4+ E. coli per gram feces. Oral immunization with pFaeG reduced the excretion of F4+ E. coli slightly following challenge but did not shorten excretion time. Co-administration of pFaeG and CT did, however, signicantly reduce the number of excreted F4+ E. coli (2 and 4 dpc; p = 0.041 and 0.062) as well as the excretion time, as compared with the negative control group (6 dpc; p = 0.002). Indeed, F4+ E. coli excretion in the pFaeG + CT group is identical to that in the positive control group (C + F4). These results indicate that intragastric immunization of piglets with pFaeG induces a mucosal F4-specic immune response. The induction of a mucosal F4-specic

Fig. 3. Mean F4-specic IgM, IgA, and IgG serum antibody titers (S.E.M.) at 0, 7, 14, 21, 25, 28, and 35 days post-primary immunization (dppi) of piglets intragastrically immunized with F4 mbriae mixed with nontransgenic alfalfa (C + F4, n = 5), nontransgenic alfalfa (C, n = 4), transgenic alfalfa expressing the F4 mbrial adhesin FaeG (pFaeG, n = 5), or transgenic alfalfa supplemented with cholera toxin (pFaeG + CT, n = 5). A signicant (* p < 0.1 or ** p < 0.05) difference was found between C + F4 and C (a), C + F4 and pFaeG (b), C and pFaeG (d), C and pFaeG + CT (e), and pFaeG and pFaeG + CT (f). Black arrow represents immunization and white arrow the F4+ ETEC challenge.

immune response is improved by co-administration of pFaeG and CT, which results in a signicant reduction of F4+ E. coli excretion following F4+ ETEC challenge. While CT supplementation also results in the induction of CT-specic antibodies, at the moment of challenge (21 dppi), the CTspecic antibody titer in serum of the supplemented group (mean titer of 14) was not signicantly higher than in the C and pFaeG groups (mean titer of 10). CT-specic antibodies may affect LT-induced diarrhea but will not reduce F4+ ETEC colonization [10,26]. However, no signicant differences in diarrhea scores were observed between the groups (Table 1). The F4-specic serum antibody titers following F4+ ETEC challenge are in agreement with the results of F4+ E. coli excretion (Figs. 3 and 4). Infection of the negative control group (C) induced a primary F4-specic antibody response characterized by high F4-specic IgM titers during

2392

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

reduced stimulation of the immune system. Indeed, the lowest F4-specic serum antibody titers following challenge were observed in the pFaeG + CT group. These results conrm the ability of plant-produced FaeG to induce a protective F4specic immune response.

4. Discussion ETEC are an important cause of intestinal infections in animals and humans [26]. Induction of a protective mucosal immune response against at least one of ETEC virulence factors (mbriae and toxins) would be the rst step towards the development of an effective vaccine. Oral vaccination of piglets with puried F4 mbriae or its adhesin FaeG has been reported to induce a protective F4-specic mucosal immune response against subsequent F4+ ETEC infection [8,9]. An effective delivery system is, however, needed to produce a vaccine. Since the introduction of the concept of transgenic plants as an alternative production and delivery system for subunit vaccines [27], several E. coli mbrial antigens have been expressed in transgenic plants including BfpA [28], F4 (K88) [12,13] CFA/I [29] and F5 (K99) [30]. In these studies mbriae-specic antibodies were induced in mice after oral [28,29] or parenteral [13,30] administration. However, to our knowledge, this is the rst study reporting the use of transgenic plants to reduce ETEC excretion in its natural host species. In this study, the F4 mbrial adhesin FaeG was produced in the edible plant alfalfa (pFaeG). The high-level expression of pFaeG (1% of TSP) obtained in the chloroplasts of alfalfa is identical to the pFaeG amount obtained in the chloroplasts of tobacco [12]. Targeting of pFaeG to the cytosol of tobacco is less efcient since the pFaeG level has only reached 0.15% of TSP [13]. Taken together, these results conrm that chloroplasts, by offering a compartment where large amounts of foreign protein can accumulate without disturbing the growth and metabolism of the cell, are excellent candidates for high-level expression of foreign proteins in plant cells, [31]. Chloroplasts also offer a suitable environment for correct protein folding of eukaryotic proteins [31,32]. Indeed, chloroplast-produced pFaeG is able to bind to the F4 receptor [12]. Binding of FaeG to the F4R on small intestinal enterocytes is a prerequisite for induction of an F4-specic mucosal immune response following oral immunization [8]. The results of this study show that oral immunization of piglets with pFaeG was able to induce an F4-specic mucosal immune response. This induction was rather weak since no clear F4-specic antibodies were detected in serum 1 week following the booster immunisation, but nevertheless able to result in a limited reduction of F4+ E. coli excretion following F4+ ETEC challenge. However, the efcacy of pFaeG is lower than the bacterial produced recombinant FaeG (rFaeG) described by Verdonck et al. [9,10]. This may perhaps be explained by differences in FaeG sequence between the 5/95

Fig. 4. Mean F4+ Escherichia coli excretion per gram feces (S.E.M.) after oral ETEC challenge. Piglets were intragastrically immunized with F4 mbriae mixed with nontransgenic alfalfa (C + F4, n = 5), nontransgenic alfalfa (C, n = 4), transgenic alfalfa expressing the F4 mbrial adhesin FaeG (pFaeG, n = 5), or transgenic alfalfa supplemented with cholera toxin (pFaeG + CT, n = 5). A signicant (* p < 0.1 or ** p < 0.05) difference was present between C + F4 and C (a), C + F4 and pFaeG (b), C and pFaeG + CT (e), and pFaeG and pFaeG + CT (f).

the rst week following challenge (signicantly higher in the C group than in the pFaeG + CT group, p = 0.057) and the subsequent appearance of F4-specic IgA and IgG antibodies. A similar F4-specic IgM response was observed in the pFaeG group. This is not surprisingly since the F4+ E. coli excretion was only a bit lower in this group than in the negative control group. However, the faster appearance and higher amounts of F4-specic IgA antibodies in the pFaeG group suggest a priming of the immune system following pFaeG immunization. On the other hand, the presence of protective F4-specic mucosal antibodies at the moment of challenge will reduce bacterial proliferation and result in
Table 1 Daily fecal score for each animal in the different treatment groups Group Fecal scorea Pig C + F4 1 2 3 4 5 1 2 3 4 1 2 3 4 5 1 2 3 4 5 2dpcb 1 1 1 1 1 1 1 1 2 1 0 1 3 1 1 1 1 1 0 3dpc 1 1 1 1 2 2 0 1 2 1 1 0 2 0 1 1 1 0 0 4dpc 0 0 1 1 1 3 0 1 2 1 1 1 3 0 1 0 1 1 0 5dpc 0 1 0 0 1 1 0 1 1 0 0 0 2 0 1 1 1 0 0 6dpc 1 0 0 1 0 0 0 1 1 0 0 0 1 0 0 0 1 0 0 7dpc 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 8dpc 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

pFaeG

pFaeG + CT

a b

Fecal score: 0, normal; 1, pasty; 2, semi-liquid; 3, watery. Days post-challenge with F4+ ETEC.

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

2393

F4+ ETEC strain (used in pFaeG) and that of the GIS26 F4+ ETEC strain (used in rFaeG) [33]. Indeed, a higher F4specic immune response has been observed following oral immunization with GIS26 F4 puried mbriae [8] than with 5/95 puried mbriae (this study), which is likely related to a difference in FaeG polymerization and subunit folding between these strains [33]. Furthermore, the resident plant material may have a protective effect and even prevent some antigen degradation in the digestive tract [34,35]. Whether the plant material has a stimulating or a reducing effect on the induction of an F4-specic mucosal immune response following oral pFaeG immunization is unknown. Oral co-administration of pFaeG and the mucosal adjuvant CT resulted in a signicant reduction of F4+ E. coli excretion, similar to that obtained with puried 5/95 F4 immunization. The adjuvant effect of CT in pigs is reported to be better towards antigens targeted to the mucosal epithelium than towards nonmucosa-binding antigens [36,37]. This suggests that further improvement of pFaeG targeting to the F4R on enterocytes would lead to a better induction of F4specic mucosal immune response. The polymeric appearance of FaeG subunits in puried F4 mbriae may enable a higher avidity of binding to the F4R, as compared with FaeG monomers. On the other hand, multimeric structures are known to be more immunogenic than monomers [38]. Further research is needed to determine whether FaeG polymers could be efciently produced by plants. Plant-produced vaccines do show promise in future vaccine development. In the United States, six clinical human trials with vaccine antigen-producing plants have been tested so far [35,39,40]. In the European Union, the development of vaccine plants is receiving considerable funding: the Sixth Framework Program (20022006) has awarded a 12 million euro research grant to the Pharma-Planta research consortium to aid in the investigation and development of vaccine antigen-producing plants for medical purposes. The ability of alfalfa-produced pFaeG to reduce F4+ E. coli excretion following oral immunization of weaned piglets is encouraging for future vaccine development since large amounts of pFaeG, which remain stable over prolonged storage, can be produced. This study is an important proof of principle demonstrating the potential of plant-based vaccines against animal ETEC infections. Acknowledgments This research was supported by the Academy of Finland (62958), TEKES (40127/99, 40876/00 and 40268/03), the University of Helsinki (974/62/98), Raisio Feed Ltd., and FWO (grant, F. Verdonck). J. Joensuu is a PhD student at a Viikki Graduate School in Biosciences. Dr. E.T. Bingham from the University of Wisconsin-Madison is acknowledged for providing Regen-SY seeds. Mrs. Lilia Sarelainen and Mr. Tapio Helenius are thanked for excellent technical assistance.

References
[1] Bakker D, Willemsen PTJ, Simons LH, van Zijderveld FG, de Graaf FK. Characterization of the antigenic and adhesive properties of FaeG, the major subunit of K88 mbriae. Mol Microbiol 1992;6(2):24755. [2] Van den Broeck W, Cox E, Oudega B, Goddeeris BM. The F4 mbrial antigen of Escherichia coli and its receptors. Vet Microbiol 2000;71(34):22344. [3] Jones GW, Rutter JM. Role of the K88 antigen in the pathogenesis of neonatal diarrhea daused by Escherichia coli in piglets. Infect Immun 1972;6:91827. [4] Rutter JM, Jones GW. Protection against enteric disease caused by Escherichia coli-a model for vaccination with a virulence determinant. Nature 1973;242(5399):5312. [5] Moon HW, Bunn TO. Vaccines for preventing enterotoxigenic Escherichia coli infections in farm animals. Vaccine 1993;11(2):21320. [6] Bianchi ATJ, Scholten J, Van Zijderveld AM, Van Zijderveld FG, Bokhout BA. Parenteral vaccination of mice and piglets with F4 super(+) Escherichia coli suppresses the enteric anti-F4 response upon oral infection. Vaccine 1996;14(3):199206. [7] Van der Stede Y, Cox E, Verdonck F, Vancaeneghem S, Goddeeris BM. Reduced faecal excretion of F4 super(+)-E. coli by the intramuscular immunisation of suckling piglets by the addition of 1 alpha, 2,5-dihydroxyvitamin D sub(3) or CpG-oligodeoxynucleotides. Vaccine 2003;21(910):102332. [8] Van den Broeck W, Cox E, Goddeeris BM. Receptor-dependent immune responses in pigs after oral immunization with F4 mbriae. Infect Immun 1999;67(2):5206. [9] Verdonck F, Cox E, Van der Stede Y, Goddeeris BM. Oral immunization of piglets with recombinant F4 mbrial adhesin FaeG monomers induces a mucosal and systemic F4-specic immune response. Vaccine 2004;22(3132):42919. [10] Verdonck F, Snoeck V, Goddeeris BM, Cox E. Cholera toxin improves the F4(K88)-specic immune response following oral immunization of pigs with recombinant FaeG. Vet Immunol Immunopathol 2005;103(12):219. [11] Sala F, Rigano MM, Barbante A, Basso B, Walmsley AM, Castiglione S. Vaccine antigen production in transgenic plants: strategies, gene constructs and perspectives. Vaccine 2003;21(78): 8038. [12] Joensuu JJ, Kotiaho M, Riipi T, Snoeck V, Palva ET, Teeri TH, et al. Fimbrial subunit protein FaeG expressed in transgenic tobacco inhibits the binding of F4ac enterotoxigenic Escherichia coli to porcine enterocytes. Transgenic Res 2004;13(3):2958. [13] Huang Y, Liang W, Pan A, Zhou Z, Huang C, Chen J, et al. Production of FaeG, the major subunit of K88 mbriae, in transgenic tobacco plants and its immunogenicity in mice. Infect Immun 2003;71(9):54369. [14] Van den Broeck W, Cox E, Goddeeris BM. Receptor-specic binding of puried F4 to isolated villi. Vet Microbiol 1999;68(34):255 63. [15] Cashmore AR. Nuclear genes encoding the small subunit of ribulose 1,5 bisphosphate carboxylase stromal protein in chloroplasts. In: Kosuge T, Meredith CP, Wilson CM, editors. Genetic engineering of plants: an agricultural perspective. New York: Plenum Press; 1983. p. 2938. [16] van Larebeke N, Engler G, Holsters M, van den Elsacker S, Zaenen I, Schilperoort RA, et al. Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability. Nature 1974;252:169 70. [17] Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, et al. Efcient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants. Nucl Acids Res 1985;13(13):477788.

2394

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394 [29] Lee JY, Yu J, Henderson D, Langridge WH. Plant-synthesized E. coli CFA/I mbrial protein protects Caco-2 cells from bacterial attachment. Vaccine 2004;23(2):22231. [30] Piller KJ, Clemente TE, Mu Jun S, Petty CC, Sato S, Pascual DW, et al. Expression and immunogenicity of an Escherichia coli K99 mbriae subunit antigen in soybean. Planta 2005;222(1):618. [31] Daniell H, Chebolu S, Kumar S, Singleton M, Falconer R. Chloroplast-derived vaccine antigens and other therapeutic proteins. Vaccine 2005;23(15):177983. [32] Daniell H, Lee S, Panchal T, Wiebe PO. Expression of native cholera toxin B subunit gene and assembly as functional oligomers in transgenic tobacco chloroplansts. J Mol Biol 2001;311(5):10019. [33] Verdonck F, Cox E, Schepers E, Imberechts H, Joensuu J, Goddeeris BM. Conserved regions in the sequence of the F4 (K88) mbrial adhesin FaeG suggest a donor strand mechanism in F4 assembly. Vet Microbiol 2004;102(34):21525. [34] Tacket CO, Mason HS. A review of oral vaccination with transgenic vegetables. Microbes Infect 1999;1(10):77783. [35] Tacket CO. Plant-derived vaccines against diarrheal diseases. Vaccine 2005;23(15):18669. [36] Foss DL, Murtaugh MP. Mucosal immunogenicity and adjuvanticity of cholera toxin in swine. Vaccine 1999;17(78):788801. [37] Verdonck F, De Hauwere V, Bouckaert J, Goddeeris BM, Cox E. Fimbriae of enterotoxigenic Escherichia coli function as a mucosal carrier for a coupled heterologous antigen. J Control Release 2005;104(2):24358. [38] Miller J, Williamson ED, Lakey JH, Pearce MJ, Jones SM, Titball RW. Macromolecular organisation of recombinant Yersinia pestis F1 antigen and the effect of structure on immunogenicity. FEMS Immunol Med Microbiol 1998;21(3):21321. [39] Twyman RM, Schillberg S, Fischer R. Transgenic plants in the biopharmaceutical market. Expert Opin Emerging Drugs 2005;10(1):185218. [40] Ma JK-C, Barros E, Bock R, Christou P, Dale PJ, Dix PJ, et al. Molecular farming for new drugs and vaccines. EMBO reports 2005;6(7):5939.

[18] Van Haute E, Joos H, Maes M, Warren G, Van Montagu M, Schell J. Intergeneric transfer and exchange recombination of restriction fragments cloned in pBR322: a novel strategy for the reversed genetics of the Ti plasmids of Agrobacterium tumefaciens. EMBO J 1983;2(3):4117. [19] Bingham ET. Registration of alfalfa hybrid regen-SY germplasm for tissue culture and transformation research. Crop Sci 1991;31: 1098. [20] Shetty K, McKersie BD. Proline, thioproline and potassium mediated stimulation of somatic embryogenesis in alfalfa (Medicago sativa L.). Plant Sci 1993;88(88):18593. [21] McKersie BD, Bowley SR, Jones KS. Winter survival of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiol 1999;119(3):83948. [22] Schenk RU, Hildebrandt AC. Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can J Bot 1972;50:199204. [23] Stewart Jr CN, Via LE. A rapid CTAB DNA isolation technique useful for RAPD ngerprinting and other PCR applications. BioTechniques 1993;14(5):74850. [24] Sambrook J, Russel DW. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 2001. [25] Cox E, Schrauwen E, Cools V, Houvenaghel A. Experimental induction of diarrhoea in newly-weaned piglets. J Vet Med A 1991;38(6):41826. [26] Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998;11(1):142201. [27] Mason HS, Lam DMK, Arntzen CJ. Expression of hepatitis B surface antigen in transgenic plants. Proc Natl Acad Sci USA 1992;89(24):117459. [28] Vieira da Silva J, Garcia AB, Vieira Flores VM, Sousa de Macedo Z, Medina-Acosta E. Phytosecretion of enteropathogenic Escherichia coli pilin subunit A in transgenic tobacco and its suitability for early life vaccinology. Vaccine 2002;20(16):2091 101.