Anda di halaman 1dari 4

Flu Singapore pada Anak

PADA tahun 2003 lalu merebak suatu penyakit infeksi virus di Cina yang dikenal dengan Flu Singapore atau Hand Foot and Mouth Disease (HFMD). Saat ini penyakit tersebut mulai muncul di kalangan penduduk Indonesia termasuk Bali.

Penyakit ini kerap kali menimbulkan gejala yang lebih berat pada bayi dan anak-anak sehingga pengenalan jenis penyakit ini sangat diperlukan agar dapat dilakukan tindak lanjut. Adapun virus yang menyebabkan penyakit Flu Singapore atau HFMD ini termasuk golongan Picornaviridae jenis Coxsackie A16 dan Enterovirus 71. Ini merupakan salah satu penyakit yang mudah menular dari satu orang ke orang lainnya, misalnya melalui tangan yang tidak dicuci atau adanya kontak dari mucus, saliva, atau feses orang yang terinfeksi. HFMD juga bisa menyebar karena adanya percikan air ludah dari orang yang terinfeksi pada saat mereka batuk atau bersin. Virus ini akan menimbulkan gejala klinik kurang lebih 3-7 hari setelah waktu terinfeksinya. Awalnya anak akan mengalami demam yang ringan dan lemas lalu diikuti timbulnya kemerahan setelah satu atau dua hari kemudian. Selanjutnya akan muncul bintik-bintik merah yang akan berkembang menjadi vesikel/gelembung pada telapak tangan, telapak kaki, dan juga rongga mulut termasuk mulut, lidah, pipi bagian dalam. Adanya lesi pada mulut ini biasanya berkaitan dengan sakit radang tenggorokan dan penurunan nafsu makan. Terkadang anak juga akan mengalami sakit kepala dan juga diare. Berdasarkan gejala klinik tersebut diagnosis HFMD sudah dapat ditegakkan dan dapat ditunjang dengan pemeriksaan swab tenggorok dan spesimen feses. Umumnya penyakit ini akan sembuh dalam waktu 5 sampai 7 hari tanpa komplikasi. Namun bila timbul komplikasi biasanya anak akan mengalami dehidrasi atau kejang demam.

Terapi Sampai saat ini HFMD tidak memerlukan terapi yang spesifik. Terapi diberikan bersifat simptomatik yang artinya hanya mengobati gejala-gejala klinik yang muncul. Misalnya pemberian obat antipiretik untuk gejala klinik berupa demam ataupun pemberian obat analgetik untuk mengurangi gejala klinik berupa nyeri. Penggunaan antibiotik tidak diindikasikan pada penyakit ini. Selain itu anak dapat diberikan air garam untuk berkumur dan pastikan anak mendapat cairan lebih banyak misalnya dengan memberikan susu, namun hindari memberikan jus atau minuman bersoda karena mengandung asam dan dapat memperparah ulkus pada mulut. Beberapa cara untuk menghindari terkenanya penyakit ini di antaranya menerapkan kebiasaan cuci tangan yang bersih, disinfeksi lingkungan sekitar, mengajarkan anak bagaimana menjaga higienitas dan mengisolasi anak dari orang yang terinfeksi. *dr. Ratna Sari Dewi, S.Ked.

http://www.balipost.co.id/mediadetail.php?module=detailberitaminggu&kid=24&id=53022

flu singapura
TINJAUAN PUSTAKA A. Definisi "Flu Singapore" sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM) flu singapura adalah penyakit yang cukup sering ditemui pada anak dan bayi dengan masa inkubasi 3-7 hari. HFMD adalah moderately contagious, menular melalui kontak langsung cairan hidung dan tenggorok, saliva, cairan dari blister atau tinja pasien. Masa penularan terbesar adalah pada minggu pertama sakit. Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru. Istilah Flu Singapore muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah flu Singapore, walaupun ini bukan terminologi yang baku. B. Etiologi PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus. Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit. C. Manifestasi Klinik Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti flu pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus di mulut seperti sariawan (lidah, gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal di telapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada di bokong. Penyakit ini membaik sendiri dalam 7-10 hari. Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Waspadai gejala dan tanda yang berbahaya, diantaranya adalah : 1. Hiperpireksia (suhu lebih dari 39 der. C). 2. Demam tidak turun-turun (Prolonged Fever) 3. Tachicardia (denyut jantung cepat) 4. Tachypneu (sesak) 5. Tidak mau makan, muntah atau diare sehingga kekurangan cairan dehidrasi. 6. Lethargi atau lemah dan kesadaran menurun 7. Nyeri pada leher,lengan dan kaki. 8. kejang. D. pemeriksaan diagnostik Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak. Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihatpeningkatantiter. Diagnosa Laboratorium adalah sebagai berikut : 1. Deteksi Virus :

- Immuno histochemistry (in situ) - Imunofluoresensi antibodi (indirek) - Isolasi dan identifikasi virus. Pada sel Vero ; RD ; L20B Uji netralisasi terhadap intersekting pools Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum. 2. Deteksi RNA : RT-PCR Primer : 5? CTACTTTGGGTGTCCGTGTT 3? 5? GGGAACTTCGATTACCATCC 3? Partial DNA sekuensing (PCR Product) 3. Serodiagnosis : Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji ELISA sedang dikembangkan. Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71. E. Penatalaksanaan 1. penatalaksanaan medis a) Pengobatan spesifik tidak ada b) Pengobatan simptomatik atau mengobati gejalanya , tidak perlu pemberian antibiotika c) Antiseptik di daerah mulut d) Pemberian obat demam atau penghilang rasa sakit Analgesik misal parasetamol e) Pengobatan suportif lainnya f) Pada penderita dengan kekebalan tubuh yang rendah atau neonatus dapat diberikan : Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus 2. Penatalaksanaan keperawatan a) Istirahat yang cukup b) Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam c) Penyakit ini adalah dapat sembuh sendiri atau self limiting diseases. Biasanya akan membaik dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. d) Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas. F. Pencegahan dan pengendalian penyakit: 1. Penyakit ini diduga sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Tetapi tampaknya pada masyarakat menengah ke atas dengan sanitasi yang baikpun masih sering terjadi. 2. Sering terjadi penularan d tempat yang padat seperti sekolah. 3. Kebersihan Higiene dan Sanitasi dengan memperhatikan kesehatan 4. ingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi. 5. Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rasa sampai panas hilang. 6. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan. PENUTUP flu singapura adalah penyakit yang cukup sering ditemui pada anak dan bayi dengan masa inkubasi 3-7 hari. HFMD adalah moderately contagious, menular melalui kontak langsung cairan hidung dan tenggorok, saliva, cairan dari blister atau tinja pasien. Masa penularan terbesar adalah pada minggu

pertama sakit. Flu Singapura sudah masuk ke Indonesia sejak ditemukan 8 kasus di Jakarta tahun 2009. Banyak yang khawatir flu Singapura ini seperti flu burung atau flu babi yang mematikan. Meski penularannya mudah,flu Singapura tidaklah seganas flu burung ataupun flu babi. Flu Singapura dalam ilmu kedokteran dikenal denganHand Foot and Mouth Disease (HFMD). Penyakit ini menyerupai flu yang disertai dengan terbentuknya lesi vesikular (bintil berisi cairan) di sekitar tangan, kaki, dan mulut.

http://sa-habatcinta.blogspot.com/2010/12/flu-singapura.html