IDENTIFICATION OF HUMAN ENDONUCLEASE V

Aparna Sunder 103 Pages May 2010

This thesis describes the experiments performed to identify the human homolog of Endonuclease V (Endo V), a DNA repair enzyme highly conserved across all kingdoms of life.

APPROVED: Date Date Date Erik D. Larson, Chair Jon Friesen Laura A. Vogel

IDENTIFICATION OF HUMAN ENDONUCLEASE V

Aparna Sunder 103 Pages May 2010

DNA repair pathways in cells are responsible for faithful transmission of genetic information from one generation to the next, which is extremely important to life. One DNA repair enzyme, Endonuclease V (Endo V) has been characterized in bacteria and appears to be highly conserved because sequence homologs have been identified in all kingdoms of life. In E.coli, Endo V is the product of the nfi gene, and mutational analysis studies suggest that it is involved in the repair of nitrosative DNA damage. Repair mechanisms are not known but it is possible that Endo V functions in tandem with other base excision repair factors to correct base modifications in DNA. In mice, one of the two Endo V homologs may have a role in the removal of hypoxanthine from DNA. Biochemical characterization of Endo V from archea has shown metal-mediated DNA cleavage, and has

suggested a model for its mechanism of action on both single-stranded as well as double-stranded synthetic DNA substrates. Characteristically, Endo V nicks duplex DNA containing deoxyinosine, abasic sites, base mismatches, or uracil at the second phosphodiester bond 3 to the deaminated (or modified) base. Downstream repair processes are still unclear. The human homolog of Endo V has not been reported or characterized. From the NCBI database, I have identified a hypothetical protein FLJ35220 gene (GenBank ID BC064545) with a predicted nucleotide sequence of 795 bp and a translated amino acid sequence of 265aa, which shows significant homology to the Endo V of E.coli, Thermotoga maritima, Mus musculus and putative Endo V of Gallus gallus. The goal of my research is to identify the human homolog of Endo V. I have purified the recombinant human protein and have initiated genetic complementation experiments, aimed at defining the activity of FLJ35220, a potential functional and sequence homolog of bacterial Endo V.

APPROVED: Date Date Date Erik D. Larson, Chair Jon Friesen Laura A. Vogel

IDENTIFICATION OF HUMAN ENDONUCLEASE V

APARNA SUNDER

A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE School of Biological Sciences ILLINOIS STATE UNIVERSITY 2010

IDENTIFICATION OF HUMAN ENDONUCLEASE V

APARNA SUNDER

THESIS APPROVED: Date Date Date Erik D. Larson, Chair Jon Friesen Laura A. Vogel

ACKNOWLEDGEMENTS First and foremost, I want to thank my advisor, Dr. Erik D. Larson for his enthusiastic support and mentoring throughout my research. Interpreting results with an open mind, troubleshooting, and time management are the greatest lessons I learned from him. My Committee members, Dr. Jon Friesen and Dr. Laura Vogel have provided great inputs and criticisms on my research, for which I shall always remain grateful. Next, I want to thank Dr. Alan J. Katz and the School of Biological Sciences, ISU, for the Teaching Assistantship and tuition waiver provided to me. The opportunity to teach a variety of undergraduate Biology courses gave me a good primer in teaching Biology at the collegiate level, which I think is an extremely useful experience I gained in graduate school. I also want to thank all the Staff and Faculty members at ISU for the little lessons they taught me which added up together to make my graduate school experience worthwhile.

I wish to thank Nichols lab, Jayaswal lab, Otsuka lab and Wilkinson lab for lending equipment, enzymes and/or other resources for my experiments when needed. My sincere thanks to the Larson lab members - Glen Borchert, Ed Ehrat, Varun Kumar, Brad Johnson and Nate Holton for their constructive criticisms, suggestions for improvements, and for all the lighter moments weve shared together to ease out the stress of graduate school research. I also want to thank my friends and fellow graduate students from other labs for all the wonderful times weve had together. My parents and sister have always been my greatest sources of support and encouragement. I owe to them all that I am today. I wish to humbly thank my middle and high school Biology teacher, Mrs. Latha Balasubramanian and my graduate research advisor in India, Dr. Padma Raghunathan for being my role models by sharing with me to this day, their teaching and living philosophies. Last, but certainly not the least, I want to dedicate this thesis to my husband and daughter, without whose encouragement, support and understanding, graduate school and research in this country would have remained an unfulfilled dream. A.S.

ii

CONTENTS Page ACKNOWLEDGEMENTS CONTENTS TABLES FIGURES CHAPTER I. INTRODUCTION AND HYPOTHESIS Introduction Research Goal Definition of Hypothesis Testing of the Hypothesis II. REVIEW OF LITERATURE Characterization of Bacterial Endo V Deletion of nfi Revealed Base Modifications Repaired by Endo V Biochemical Characterization of Archeal Endo V Identification of Key Catalytic Residues for Archeal Endo V Crystal Structure of Tma Endo V Characterization of Murine Endo V III. MATERIALS AND METHODS Cloning of FLJ35220 Genetic Complementation iii 1 1 4 8 8 11 11 13 15 17 19 21 23 23 24 i iii vi vii

Cell Survival in Response to DNA Damage Statistical Analysis Purification of Recombinant FLJ35220 in the HISTagged and MBP-fusion Forms Circular Dichroism Site Directed Mutagenesis (SDM) Substrate Design and Controls for Cleavage Assays Cleavage Assay IV. RESULTS OF GENETIC ANALYSIS OF FLJ35220 ACTIVITY Genetic Complementation With FLJ35220 Recovers nfi Knock-out E.coli Cultures (AS01) from Damage Caused by Cisplatin FLJ35220 Expression Allows AS01 Cells to Survive Exposure to Nitrofurantoin V. PURIFICATION AND ANALYSIS OF FLJ35220 EXPRESSION PRODUCTS Construction of Expression System for FLJ35220 and its Point Mutants Cleavage Assays Circular Dichroism VI. DISCUSSION Genetic Complementation Analyses in E.coli Purification and Analysis of Recombinant FLJ35220 VII. SUMMARY, CONCLUSIONS AND RECOMMENDATIONS FOR FUTURE RESEARCH Genetic Analysis Purification and Analysis of Recombinant FLJ35220 Recommendations for Future Research REFERENCES APPENDIX A: LIST OF OLIGONUCLEOTIDES APPENDIX B: PLASMID MAPS iv

25 26 27 28 29 29 30 32

32 48 55 56 65 74 77 77 80 84 84 85 86 88 93 95

APPENDIX C: STATISTICAL ANALYSIS

101

TABLES Table 1. Genotypes of E.coli Strains Used for The Genetic Analysis of FLJ35220 Activity 2. Cell Survival of Cultures Grown With No DNA Damaging Agent 3. Cell Survival of Cultures Grown With 70M Cisplatin 4. Cell Survival of Cultures Grown With 70M Transplatin 5. Cell Survival of Cultures Grown With 10M Nitrofurantoin 6. Different Strategies of Purification Tried for Obtaining Active Recombinant FLJ35220 Page 34

41

43

46

53

70

vi

FIGURES Figure 1. Nucleotide coding sequence of FLJ35220 (795bp) and translated amino acid sequence (265 amino acids) 2. Protein multiple sequence alignment of Endo V homologs generated by ClustalW 3. Conserved motifs of amino acids in the Endo V Sequence 4. Structure of Cis-diamminedichloroplatinum (II) (Cisplatin) 5. Structure of trans-diamminedichloroplatinum (II) (Transplatin) 6. Determination of IC50 for Cisplatin on wild type NM232 E.coli 7. Cell survival of cultures grown with no damaging agent 8. Expression of FLJ35220 in AS01 recovers cells in response to damaged caused by 70M Cisplatin 9. Cell survival of cultures in response to 70M Transplatin 10. Structure of 1-[[[5-nitro-2-furanyl] methylene] amino]2, 4-imidazolidinedione (Nitrofurantoin) 11. Determination of IC50 of nitrofurantoin on wild type NM232 E.coli vii Page 6 7 21 36 37 39 42 44 47 49 51

12. Expression of FLJ35220 in AS01 recovers cells in response to damaged caused by 10M nitrofurantoin 13. Verification of cloning of wt FLJ35220 by DNA sequencing 14. Verification of the point mutation leading to the amino acid substitution D52A by DNA sequencing 15. Purification of FLJ35220 protein and verification of the HIS-tag 16. Purification of FLJ35220 D52A protein 17. Verification of cloning of MBP-FLJ35220 by DNA sequencing 18. Verification of the point mutation leading to the amino acid substitution D52A by DNA sequencing 19. SDS-PAGE showing purification of wt MBP-FLJ35220 20. SDS-PAGE showing purification of MBP-FLJ35220 D52A 21. Predicted cleavage of a synthetic substrate containing deoxyinosine by FLJ35220 22. Cleavage of single-stranded DNA containing deoxyinosine by FLJ35220 23. Recombinant FLJ35220 mediated cleavage of deoxyinosine containing substrate in the presence of a cold competitor 24. Cleavage assay to compare activities of wt and D52A mutant of FLJ35220 against E.coli Endo V 25. SDS-PAGE showing aggregation of FLJ35220 on the NiSepharose resin viii

54 57 58 59 60 61 62 63 64 66 67

68 72 74

26. Circular Dichroism comparing the spectra of wt, D52A and D52A VDGN-AAAA mutants of FLJ35220

76

ix

CHAPTER I INTRODUCTION AND HYPOTHESIS

Introduction DNA repair factors function to correct DNA damage, and maintain the genome for faithful transmission of genetic information to the next generation. Endonuclease V (Endo V) is a DNA repair enzyme that shares a high degree of sequence homology across all kingdoms of life, yet its cellular functions are not fully defined. In E.coli, Endo V is encoded by the nfi gene, and mutational studies in this organism have suggested that it is involved in correction of deaminated bases (particularly purines), which result primarily from nitrosative DNA damage (Budke & Kuzminov, 2006., Gates & Linn, 1977., Kanugula et al.,2005.,Yao & Kow, 1997., Weiss, 2001., Weiss, 2006). However, Endo V has broad substrate specificity (Guo & Weiss, 1998), suggesting repair roles beyond correction of purine deaminations. DNA damage can come from endogenous or exogenous sources. Endogenous sources of DNA base damage are generated by normal DNA metabolism, such as reactive oxygen or nitrogen species. This 1

results in DNA base modifications, most of which are recognized by Endo V. Oxidative DNA damage results in formation of 8-oxo-guanine, DNA breaks, and abasic sites (reviewed by Hansen & Kelley, 2000., Lindahl et al., 1997). Reactive nitrogen species typically deaminate adenosine to create inosine, which has the potential to mispair with guanine and create substitution mutations. Endo V is particularly active on inosines (Huang et al., 2002). Exogenous sources of DNA damage are usually environmental mutagens coming from processed and/or preserved food products and various chemical additives. They eventually lead to base modifications of different kinds, which could be potential substrates for Endo V. In human cells, apoptotic pathways protect against high levels of DNA damage by signaling programmed cell death. However, some types of damage may circumvent the avoidance of mutagenesis by apoptosis. It has been documented that chronic nitrosative stress could inhibit apoptosis by the post-translational nitrosation of thiol groups of caspases (Li et al., 1997), resulting in their inactivation, and consequently preventing initiation of apoptotic events. Thus, an understanding of repair responses to nitrosative agents in humans is important for clarifying mechanisms that protect against carcinogenesis. The evidence that E. coli Endo V recognizes abasic 2

sites, cytosine deaminations (uracils), base mismatches, and DNA structures (Yao & Kow, 1997) indicates that Endo V may participate in correcting a wide range of DNA lesions. The classical base excision repair pathway corrects uracil in DNA by first removing the uracil base, which is catalyzed by the enzyme DNA N-glycosylase (Cunningham et al., 1986). The resulting abasic sites are then cleaved by an endonuclease, and repair is completed by DNA resynthesis and gap filling activities by polymerase and ligase (reviewed by David et al., 2007). Specific glycosylases for inosine, xanthine and oxanosine in DNA have not been identified, although an oxanine DNA-glycosylase activity has been reported in a mammalian alkyl adenine glycosylase (Hitchcock et al., 2004). In E.coli, Endo V has been reported to cleave double-stranded and single-stranded DNA containing inosine and uracil in vitro (Demple & Linn, 1982., Yao & Kow, 1997). Endo V recognizes modified bases

and makes a nick at the second phosphodiester bond 3 from the lesion (Kanugula et al., 2005). However, the subsequent steps in the repair pathway are not known. It has been suggested in the archeal model that a 3-5 exonuclease (probably a function of Endo V) removes the lesion, followed by action of DNA polymerase and ligase to complete the repair (Feng et al., 2005). It is important to note that 3

this is only a hypothetical model, and downstream repair events have not been established. Endo V homologs have been characterized in Thermotoga maritima (archea), Archaeoglobus fulgidus (archea), and also in Mus musculus (eukaryote) (Feng et al., 2006, Lin et al., 2007, Liu et al., 2000, Moe et al., 2003, AK172181). Based on sequence homology, I have identified a hypothetical human protein FLJ35220 (Genbank accession BC064545) from the NCBI database that has a coding sequence of 795bp and 265 amino acids with homology to Endo V (http://www.ncbi.nlm.nih.gov/nucleotide/40555766, Accessed on 4-210). Based on this sequence homology, I hypothesize that FLJ35220 is a protein with Endo V activity, and as such it has functions that overlap with E. coli Endo V. My thesis tests this model using genetic and biochemical approaches.

Research Goal The goal of my research project is to identify the activity of the hypothetical human protein FLJ35220, a protein of unknown function with sequence homology to bacterial, archeal and murine Endo V, and to compare that activity to a known Endo V protein from E. coli. Figure 1 shows the nucleotide coding sequence of FLJ35220 (795bp) 4

and the translated amino acid sequence (265 aa), and Figure 2 shows the multiple alignment of the protein sequence of FLJ35220 with Endo V homologs of various representatives from other kingdoms. I have cloned the ORF of FLJ35220 and used this expression clone to assay the function of FLJ35220. My model is that human Endo V has activities that parallel the other characterized Endo V homologs. If this is true, human Endo V should be able to substitute for E. coli Endo V in response to DNA damage. Likewise, purified recombinant protein should have activities that reflect the characterized Endo V proteins. This is defined as the introduction of a single-stranded nick, or a duplex break near lesions containing deoxyinosine, abasic sites, base mismatches, or uracil. My thesis research takes both genetic and biochemical approaches, and I present here evidence that the protein encoded by FLJ35220 can complement the DNA repair defect imparted by loss of Endo V in E. coli. I have also identified DNA damage caused by exposure to the anticancer drug, cisplatin as a substrate for the human and E. coli Endo V protein. Biochemical experiments using purified FLJ35220 revealed that the human protein is unstable outside of the cell.

Figure 1. Nucleotide coding sequence of FLJ35220 (795bp) and translated amino acid sequence (265 amino acids). Open reading frame from the FLJ35220 expressed sequence tag was collected from the NCBI database (http://www.ncbi.nlm.nih.gov/nucleotide/40555766, Accessed on 4-210), and then translated using EnzymeX software (Mekentosj B.V., Amsterdam, The Netherlands).

Figure 2. Protein multiple sequence alignment of Endo V homologs generated by ClustalW. Amino acid sequences for Mouse (Mm CAM18891.1), humans (Hs - ABF47100.1), chicken (Gg XP_420082.1), Thermotoga maritima (Tma - NP_229661.1) and Escherichia coli (Ec - A8A798.1) were collected from the National Center for Biotechnology Information (NCBI) database and then aligned using the ClustalW program (Thompson, et al., 1994). Readout from the comparisons is shown, 100% identical amino acids are indicated by the symbol (*). A single different aa residue among the homologs compared is denoted by the symbol (.), and a difference of two aa residues among the homologs compared is represented by the symbol (:). 7

Definition of Hypothesis The hypothesis for my research project is as follows: FLJ35220 has activities that parallel the characterized Endonuclease V enzyme from E.coli.

Testing of the Hypothesis I have tested my proposed model using the following strategic approaches.

I. Complementation of nfi Deficiency in E.coli by Expression of FLJ35220 Transgene If FLJ35220 is a functional homolog of Endo V, I expect that it will be able to substitute for E. coli Endo V during a DNA damage response. Therefore, introduction of the FLJ35220 transgene into E. coli lacking the nfi gene should result in complementation of the defect caused by the lack of E. coli Endo V protein. I have monitored this by cell survival patterns, comparing wild type cells to nfi deficient cells, and nfi deficient cells complemented with the E. coli nfi gene after exposure to DNA damaging agents. I have selected two types of DNA damaging agents, one which makes a very specific base modification, and the other is associated 8

with a broad class of base damage. These two compounds are cisplatin and nitrofurantoin, and their toxicity to DNA has been documented. While nitrofurantoin creates damage known to be cleaved by Endo V, cisplatin is an anticancer drug that generates guanine crosslinks in DNA. It is not currently known if the base modifications induced after cisplatin exposure will be cleaved by E.coli Endo V. Therefore, these experiments will not only test the ability of E. coli Endo V to recognize platinated DNA, but also the ability of the human FLJ35220 protein to substitute for E. coli Endo V during the DNA damage response.

II. Purification and Analysis of Recombinant FLJ35220 Bacterial Endo V specifically recognizes and cleaves DNA containing deaminated purines, deaminated pyrimidines, abasic sites, and mismatches. Such a wide substrate recognition range is unprecedented in other repair pathways, and is a unique characteristic of Endo V. Furthermore, Endo V activity does not remove this damage directly, but introduces a downstream break that is presumably a site for further nucleolytic repair. In this thesis I present experiments performed to purify FLJ35220 and verify if the purified recombinant protein will recognize and/or cleave DNA that contains base 9

modifications known to be recognized by bacterial and archeal Endo V. If FLJ35220 encodes a homolog of Endo V, I predicted that substitution of conserved catalytic residues by site-directed mutagenesis will block this activity. Although cloning and purification of wild type and substitution mutants of FLJ35220 were accomplished, activity assays revealed the instability of the human protein outside of the cell. The observations of experiments that led to the above conclusions are presented in Chapter V of this thesis.

10

CHAPTER II REVIEW OF LITERATURE

Characterization of Bacterial Endo V Endo V of E.coli was first reported in the 1970s as an enzyme with high activity on single-stranded DNA containing uracil (Gates & Linn, 1977). This activity required magnesium, and it was suggested to be a key player in an alternative mechanism to uracil-DNA Nglycosidase initiated removal of uracil (Gates & Linn., 1977). Since that time, the substrate recognition properties of E.coli Endo V have been identified with a wide range of DNA base modifications. Currently, it appears that Endo V will recognize and cleave DNA containing deaminated DNA bases such as hypoxanthine (deoxyinosine), xanthine, oxanosine and uracil, (Demple & Linn, 1982). In addition to these substrates, Endo V cleaves DNA containing urea residues, AP sites, base mismatches, flaps and pseudo-Y structures, insertion and deletion mismatches (Yao & Kow, 1997). Deoxyinosine recognition in single-stranded as well as double-stranded substrates was reported to be highly dependent on magnesium or 11

manganese, while mismatch-specific endonucleolytic activity of Endo V was specifically manganese dependent (Yao & Kow, 1997). Endo V is encoded by the nfi gene in E.coli (Yao & Kow 1997; Guo et al., 1997). During E.coli micro-aerobic growth, and in saturated aerobic cultures, ablation of the nfi gene resulted in increased frequency of A/T: G/C and G/C: A/T transition mutations caused by nitrosating agents - nitrate and nitrite (Weiss, 2006). However, in well-aerated log phase cultures, these effects were not observed (Weiss, 2001). This suggests a protective effect of the nfi gene product in repairing nitrosative DNA damage under oxygen-depleted conditions. Additionally, when the nitrate reductase gene, narG was ablated, mutagenesis of the nfi mutant by nitrate was reduced, indicating that the nfi gene product responded to damage caused by reduced nitrates, which was prevented by the narG ablation (Weiss, 2001). During anaerobic respiration when nitrates/nitrites serve as alternative electron acceptors in the place of oxygen, the cells are subject to damage caused by reactive nitrogen species, which could be repaired by Endo V (Weiss, 2001). It is also reported that nitrate/nitrite metabolism results in generation of endogenous alkylating agents (Weiss, 2001). To rule out the possibility that the increased frequency of transition mutations caused by nfi ablation was 12

not simply due to a defect in alkylation repair, mutagenesis experiments with N-methyl N-nitrosourea, a potent alkylating agent, were performed (Weiss, 2001). Ablation of nfi did not enhance mutagenesis by this alkylating agent, thereby supporting the theory that Endo V repairs damage caused by nitrosating agents, independent of defects in alkylation repair (Weiss, 2001., Weiss, 2006).

Deletion of nfi Revealed Base Modifications Repaired by Endo V Disruption of the nfi gene in E.coli by insertion of a chloramphenicol acetyl transferase (cat) gene cassette resulted in increased mutagenesis after exposure to nitrofurantoin, bleomycin, nitrite and nitrate (Guo et al., 1997). Mutation of nfi also increased lethality resulting from a combined deficiency of exonuclease III and dUTPase, which are originally involved in repairing abasic sites in DNA, suggesting that Endo V responds to a wide variety of damage, and that it could be an alternative player in repair (Guo et al., 1997). Upon over-expression of plasmid-borne nfi, these strains exhibited a 46-fold increase in Endo V activity, as measured by the standard Endonuclease V assay (Guo et al., 1997). Furthermore, neither the deficiency nor over-production of nfi impacted the growth of single13

stranded DNA phages, or of uracil-containing bacteriophage within these E.coli strains. Together, the above experimental results support roles for Endo V in the repair of deaminated bases and abasic sites in DNA, but does not provide evidence for Endo V-mediated repair of uracil-containing DNA or single-stranded DNA in vivo (Guo & Weiss, 1998), suggesting that Endo V may not be part of a primary repair pathway involved in correcting deaminations in DNA bases; rather, it might have secondary roles in the cell. Experimental evidence suggests Endo V is a key player involved in the repair of deaminated purine bases in DNA; further genetic analysis reinforced these findings. Incorporation of deaminated purines in DNA through rdgB ablation (this gene normally encodes a protein that prevents incorporation of deoxyinosine and xanthine in DNA by intercepting dITP and dXTP, the respective non-canonical precursors of these deaminated purines; ablating this gene would not make this protein available, and thereby incorporate these deaminated bases in DNA) has been reported to be non-mutagenic in E.coli, as no changes were observed in the spontaneous mutagenesis spectra as well as nitrous-acid induced mutagenesis for these cultures (Budke & Kuzminov, 2006). Therefore, deaminated bases may somehow be repaired by some other gene product. To test if the nfi gene product 14

rendered protection from this type of damage, the same test was performed on nfi ablated cultures that also had an rdgB ablation. Increased mutagenesis was observed, as there was no repair taking place (Budke & Kuzminov, 2006), suggesting that Endo V had a role in repairing deaminated base lesions in DNA. However, nfi ablated cultures which had an intact rdgB gene could efficiently prevent incorporation of deaminated base lesions in DNA (Budke & Kuzminov, 2006), again showing that rdgB and nfi gene products respectively prevent and repair mutagenesis by incorporation of deaminated base lesions in DNA.

Biochemical Characterization of Archeal Endo V Substantial biochemical and structural characterization of Endo V homologs has unraveled the molecular mechanisms of substrate recognition and catalytic activity. Thermotoga maritima (Tma) Endo V (archeal homolog) incubated with damage-bearing oligonucleotide substrates has revealed dual activities, where upon damaged base recognition, Endo V nicks one nucleotide 3 from the lesion, and then switches its activity into a 3-5 exonuclease mode, which could be important in removing the deaminated base lesions during repair (Feng et al., 2005). Both double-stranded and single-stranded 15

synthetic oligonucleotide substrates containing deoxyinosine, abasic sites, uracil or mismatches were also recognized by Tma Endo V, and substrates containing deaminated purine bases appear to be preferred cleavage substrates while uracil-containing substrates are the least preferred (Huang et al., 2001). These findings were consistent with genetic analysis in E. coli (Yao & Kow, 1997). When the enzyme was added in excess to the cleavage reactions with double-stranded DNA substrates, a second nicking event was observed on the complementary strand, creating a double-strand break. Also, Endo V mediated cleavage of abasic sites suggests that contacts with lesions, as well as local distortions could be the mechanisms by which Endo V facilitates recognition and repair of a wide spectrum of lesions in DNA (Huang et al., 2001). A catalytic and regulatory two-metal model has been proposed for Endo V mediated catalysis in the archeal homolog (Feng et al., 2006). Addition of calcium supports manganese-mediated cleavage of deoxyinosine containing substrate by Endo V, while calcium by itself did not support catalysis. On the other hand, addition of manganese initially stimulated, but then subsequently inhibited magnesium mediated DNA cleavage by Endo V (Feng et al., 2006), suggesting that there are two metal-binding sites on Endo V, one being the catalytic 16

site and the other, regulatory. Single-molecule kinetics published on archeal Endo V by measurement of time-lapses during a catalytic event using the technique of Fluorescence Resonance Energy Transfer (FRET) further reinforce the finding that archeal Endo V has two metalbinding sites to regulate its activity. While calcium has been associated with protein-binding, magnesium has been reported to be involved in DNA cleavage (Lin et al., 2007).

Identification of Key Catalytic Residues for Archeal Endo V Site directed mutagenesis studies have identified the residues of Endo V important for catalysis, metal binding and substrate recognition. Alteration of the highly conserved amino acids D43, E89, D110 and H214 strongly suggest these amino acids play key roles in Endo V function. D43 has been identified as the most critical residue needed for catalysis, since it exhibited least tolerability to substitution by alanine (Feng et al., 2006). Substitution of D43, E89 and D110 with alanine has been reported to either completely render the protein catalytically inactive, or substantially reduce the nucleolytic cleavage of deoxyinosine containing DNA substrates. These substitution mutants retained their binding affinities to DNA even in the absence of 17

metals, which suggested roles in co-ordinating catalytic function rather than DNA binding (Huang et al., 2002). Y80, R88 and H116, when substituted by alanine, showed reduced affinities for single-stranded and double-stranded deoxyinosine containing substrates (Huang et al., 2002). Furthermore, they failed to cleave abasic sites, and bound weakly to uracil containing substrates (Huang et al., 2002). It has been suggested that these residues might have a role in substrate recognition (Huang et al., 2002). The K139A mutation failed to cleave abasic sites and uracil efficiently, but retained the recognition and cleavage of other substrates, suggesting that K139 may be an important residue in facilitating cleavage of substrates having lesions other than deoxyinosine (Huang et al., 2002). Several mutations on Y80 and H116 have established that these residues are not involved in DNA-protein interactions, but could have important roles in donating hydrogen bonds to facilitate recognition of deaminated bases, particularly purines in DNA. Substitution of R118 for alanine impaired binding to the nicked product, thereby suggesting its involvement in post-cleavage protein-DNA interaction. G113 and G136 have been shown to be important in metal co-ordination, along with the conserved aspartic acid residues owing to their substantially reduced DNA cleavage activities (Feng et al., 2005). Figure 3 shows an 18

alignment of Endo V sequences from several species, further indicating the importance of the aforesaid conserved residues for Endo V function.

Crystal Structure of Tma Endo V The structure of Tma Endo V has been solved by X-ray crystallography (Dalhus et al., 2009), and the data support mutational analysis experiments which have characterized the key amino acid residues involved in lesion recognition, metal-binding and catalysis. It was suggested that the tight binding of the lesion recognition pocket of Endo V to the DNA substrate through Mg2+ and hydrogen bonding interactions stabilizes the product complex and probably recruits downstream repair proteins to the site of damage (Lin et al., 2007). In addition to substrate recognition properties, the crystal structure of Tma Endo V has revealed other important sequence motifs (Dalhus et al., 2009). The PYIP wedge motif is conserved in the bacterial and archeal homologs (Figure 3) and was found to be important in damage sensing and separation of DNA strands at lesions (Dalhus et al., 2009). The Prolines and Isoleucine within this motif may push the conserved Tyrosine 80 residue which recognizes the lesion, particularly hypoxanthine using its aromatic ring (Dalhus et al., 19

2009). Outside of the PYIP motif, other key residues include D43, D110, K139, E89, Q218 and F46, whose involvement in metal coordination and lesion binding is in agreement with mutational analyses discussed in the previous section (Huang et al., 2002, Feng et al., 2005). The Leu142 side chain likely makes contact with the hypoxanthine ring and assists rotation by closely contacting the DNA backbone. There are four conserved glycine residues G83, G111, G113 and G121, which maintain the shape of the lesion recognition pocket (Feng et al., 2005). G111, 113 and 121 are unique to the Endo V family, and substituting either one of them reportedly reduced Endo V activity on hypoxanthine containing substrate by up to 50% (Dalhus et al., 2009, Feng et al., 2005). Another motif, VDGN has been reported to be important in maintaining the shape of the molecule, so it binds the lesion. The conserved residues D110, G111 and G113 (located just outside of this motif) determine the shape of this motif involved in lesion binding (Dalhus et al., 2009). The important active site residue D43 is part of the GVDV conserved motif. Substitution of D43 to alanine completely impairs catalysis (Feng et al., 2005, Huang et al., 2002), and these results were subsequently supported by structural analysis (Dalhus et al., 2009). Conserved motifs, and amino acids with established roles in catalysis are shown below in Figure 3. 20

Figure 3. Conserved motifs of amino acids in the Endo V sequence. Sequences for five Endo V homologs are shown, Mm mouse; Hs human; Gg chicken; Tma Thermotoga maritima (archeal); Ec Escherichia coli (bacterial). The Hs sequence corresponds to FLJ35220. Gray Conserved Glycine residues determining the shape of the active site; Yellow Conserved catalytic Aspartate residues involved in metal co-ordination; Magenta PYIP wedge motif; Blue Conserved Arginine involved in post-cleavage DNA protein interaction; Green Conserved Lysine, suggested to be involved in non-inosine substrate cleavage.

Characterization of Murine Endo V Based on sequence homology with E.coli Endo V, a murine homolog has been identified, cloned, over-expressed and purified in E.coli (Moe et al., 2003). Activity for this protein has been tested in vitro. Consistent with the bacterial homolog, a single-stranded DNA substrate containing hypoxanthine appeared to be a substrate (Moe et al., 2003). However, additional activites were also noted for murine Endo V. It has been reported in 1994 that the hypoxanthine lesion removal in E.coli is effected by the enzyme hypoxanthine DNA 21

glycosylase, and is associated with 3-methyladenine DNA glycosylase II, the product of alkA gene in E.coli. This finding was documented on the basis of experiments on a DNA repair deficient alkA- E.coli mutant, which failed to show any detectable hypoxanthine DNA glycosylase activity (Saparbaev & Laval., 1994). Following these results, genetic analyses on a DNA repair-deficient E.coli alkA- nfi- strain showed that over- expression of murine nfi transgene completely reversed the mutator phenotype of this repair deficient double mutant host (Moe et al., 2003), indicating that the murine Endo V homolog probably has a hypoxanthine DNA glycosylase activity comparable to alkA and nfi gene products in E.coli. However, activities seem to deviate from simple nitrosative damage repair, and may not be necessarily be reflective of the human Endo V homolog. Nevertheless, the identification of a murine Endo V homolog indicates Endo V is conserved in mammals and likely important for DNA repair and maintenance of genomic stability in mammalian cells.

22

CHAPTER III MATERIALS AND METHODS

Cloning of FLJ35220 The human cDNA clone of FLJ35220 in pCMV-SPORT6 was purchased from the Mammalian Gene Collection (MGC) of the ATCC clone bank. Gene specific primers (Eurofins MWG Operon, Huntsville, AL listed in Appendix A) were designed and then used to amplify the 795bp ORF of FLJ35220 using PCR. The PCR product was cloned directionally into pET100 D-TOPO vector using the Invitrogen Directional TOPO cloning kit procedure (Invitrogen, Carlsbad, CA). The resulting clone was maintained in TOP10 E.coli (Invitrogen) and stored as glycerol stocks in 25% glycerol-LB medium at -80C. Clones were sequenced in both the forward and reverse directions using T7 Forward and Reverse sequencing primers supplied in the kit. The vector pMAL-c5X was purchased from New England Biolabs (NEB, Ipswich, MA) to clone and express FLJ35220 as a recombinant N-terminal maltose binding protein fusion. The vector was digested with EcoRI and NdeI. The ORF of FLJ35220 was amplified by PCR 23

using gene specific forward and reverse primers designed with NdeI and EcoRI tails respectively (Eurofins MWG Operon). The vector and the amplified PCR product (795bp) digested with EcoRI and NdeI (NEB) were purified on PCR purification columns (Qiagen, Valencia, CA), and ligated using T4 DNA ligase (NEB) overnight at 16C. Clones were maintained in TOP10 E.coli (Invitrogen) and stored as glycerol stocks in 25% glycerol-LB medium at -80C. DNA sequencing of all clones was completed at the DNA sequencing facility at Illinois State University using the ABI PRISM 373 DNA sequencer, and chromatograms analyzed with the FinchTV program (Geospiza Inc., Seattle, WA). Maps of the electronic constructs of FLJ35220 in pET100 D-TOPO and pMAL-c5X are included in Appendix B.

Genetic Complementation AS01, a DNA repair deficient genomic nfi knock-out line of E.coli was made by the generalized P1 transduction procedure (Thomason et al., 2007). P1 lysate from the nfi deficient E.coli strain JW5547 (Yale E.coli Genetic Stock Center) was used to infect a recipient culture of wild type NM232 E.coli (Duquette et al., 2004) which is a DE3 type cell line based on AB1157. The objective of making an nfi deficient 24

DE3 cell line was to enable T7-promoter driven transcription of the transgene upon complementation with plasmid-borne nfi. AS01 acquired resistance to kanamycin upon Tn10 mediated interruption of genomic nfi, which enabled its selection on LB agar plates with kanamycin. Additionally, the nfi knock-out was verified by PCR using primers specific for nfi (Eurofin MWG Operon). Expression constructs of E.coli nfi, FLJ35220 and its catalytically inactive point mutant D52A were made in pET100-D-TOPO using the procedures described in the previous section, and were used for complementation of AS01. Electro competent AS01 cells were prepared, and complementation was carried out by transformation of AS01 with the appropriate transgenes by electroporation (Bio-Rad, Hercules, CA). AS01 complemented with the lacZ gene directionally cloned into pET100 (AS01-DlacZ) was used as an expression control in the survival response assays.

Cell Survival in Response to DNA Damage Wt, AS01, AS01-Ecnfi, AS01-FLJ35220, AS01-FLJ35220 D52A and AS01-DlacZ cultures were grown overnight to saturation. Saturated overnight cultures (200 L) were used to inoculate 2mL of fresh LB broth, and the tubes were grown at 37 C to an OD of 0.3 at 600nm. The cultures were diluted to 1/106 and were incubated with 25

cisplatin and transplatin (negative control for cisplatin cytotoxicity) at 70 M final concentration, and nitrofurantoin at 10 M final concentration. Cells were aerated at 37 C for 1h and plated in triplicates on LB agar plates. After incubation overnight at 37 C, colonies were counted manually. Each of the cultures had a control plate with no DNA damaging treatment. Mean colony counts were graphed using Microsoft Excel.

Statistical Analysis Mean colony counts of each group of cultures obtained with and without DNA damaging treatment were compared and tested for statistical significance using two-tailed T-test computed using an open access online application offered by Vassar College, Poughkeepsie, NY. (http://faculty.vassar.edu/lowry/VassarStats.html, Accessed on 3-3110). P-values at a confidence interval of 95% were calculated for each group of means compared, and tabulated (P-value tables included in Appendix C). Recovery effects of complementation in response to cisplatin and nitrofurantoin treatments were interpreted on the basis of statistically significant comparisons.

26

Purification of Recombinant FLJ35220 in the HIS-Tagged and MBP-Fusion Forms Arctic Express (DE3) RP E.coli (Stratagene, La Jolla, CA) was used as an expression host to express and purify recombinant FLJ35220 as an N-terminal 6-HIS tagged protein or as an MBP-fusion protein. One liter of sterile Luria Bertani broth was inoculated with 25mL of fresh overnight grown culture of Arctic Express (DE3) RP E.coli carrying the respective expression construct of FLJ35220. Cells were grown to an OD of 0.4 at 600 nm. Protein expression was induced with 0.2mM IPTG at 8 C overnight. Cells were lysed by sonication using the standard protocol for E.coli lysis (Sambrook & Russel, 2001). Twenty milliliters of clarified cell lysate was loaded on a pre-equilibrated column of sepharose resin coated with nickel (for purification of HIS-tagged protein) or coated with amylose (for purification of MBP-FLJ35220). The equilibration and wash buffers consisted of 20mM HEPES, pH7.6, 500mM NaCl, 1mM DTT and PMSF for purification of HIS-tagged protein, and 20mM Tris-Cl, pH 7.4, 200mM NaCl, 1mM DTT, and PMSF for purification of recombinant MBP-FLJ35220. The protein was eluted in a 2mL volume from the column using the elution buffer, which was prepared by adding 500mM imidazole to the wash buffer for the HIS-tagged protein, and by adding 27

10mM maltose to the column buffer for MBP-FLJ35220. Uninduced and induced cultures, clarified cell lysate, column flow-through, wash and elute fractions were all loaded on a 10% SDS-polyacrylamide gel and run at 200V for 1h (an 8% gel was made for resolving MBPFLJ35220). Protein separation was visualized by staining with Coomassie brilliant blue. The size of the HIS-tagged protein is ~33KDa, while the size of MBP-FLJ35220 is ~72KDa. Imidazole/maltose was removed from the eluted protein by dialysis into the same buffer, and glycerol was added to a final concentration of 20%. Fresh protein was used for cleavage assays. Aliquots of purified protein were frozen at -80 C for future experiments.

Circular Dichroism Purified proteins were assayed by circular dichroism (CD) to test for proper folding. A Model 215 AVIV CD Spectrometer in the Department of Chemistry, ISU, was used to measure the CD spectra of human recombinant wild type and mutant FLJ35220 protein. The instrument was blanked with the elution buffer in which the proteins were solubilized. All protein samples were read at 0.5 mg/mL concentration. The CD signals were graphed using MS Excel.

28

Site Directed Mutagenesis (SDM) Specific forward and reverse primers for FLJ35220 were designed with the targeted base changes (oligonucleotide table included in Appendix A) and were synthesized to include a 5 phosphate (Eurofin MWG Operon). SDM was performed using Phusion Site Directed Mutagenesis kit protocol (New England Biolabs). Mutated clones were verified by DNA sequencing, and recombinant mutant proteins were over-expressed by induction with IPTG, as described for the wild type (wt) protein expression. Purification of protein was completed by affinity chromatography on a nickel column for the HIStagged protein, and on an amylose column for the MBP-fusion protein, and all the fractions were resolved by SDS-PAGE as described for the purification of recombinant FLJ35220.

Substrate Design and Controls for Cleavage Assays A panel of synthetic oligonucleotide substrates were designed (oligonucleotide table, Appendix A) for biochemical analysis of purified FLJ35220 expressed protein. The substrates were 51-mers with adenine, deoxyinosine or uracil at the 25th position. Another 26-mer oligonucleotide (oligonucleotide table, Appendix A) was designed for use in cleavage assays as a marker for the size of the expected 29

cleavage product (all substrates were purchased from Eurofin MWG Operon). Commercially purified E.coli Endo V was bought from New England Biolabs and was used as a positive control for the cleavage assays on the synthetic substrates. The substrates with no protein added were negative controls for the assays.

Cleavage Assay The oligonucleotide substrates were radiolabeled at the 5 end with
32

P ATP (MP Biomedicals, Solon, OH), using T4 polynucleotide

kinase (NEB). One hundred femtomoles of radiolabeled substrate were used for each 20 L reaction. The assay buffer was 20mM HEPES, 5mM MgCl2/MnCl2, and/or 10mM CaCl2, 1mM DTT and 5% glycerol. Approximately 8 pmols of each protein - E.coli Endo V, wt or mutants of FLJ35220 were added in the reactions. Reactions were incubated at 37 C for 1 hour and stopped with 0.2% SDS, 25 g/mL proteinase-K and 10mM EDTA. Equal volumes of deionized formamide containing bromophenol blue were added to the reactions and the cleavage products were resolved on 15% polyacrylamide gels with 6M urea, pre-equilibrated with 0.5X TBE buffer, and run at 275V for 1h. Gels were exposed on a phosphor screen (GE Biosciences, Pittsburgh, PA)

30

within a cassette for 2-3h and then scanned on a STORM 840 phosphor imager. Bands were quantified using Image Quant software.

31

CHAPTER IV RESULTS OF GENETIC ANALYSIS OF FLJ35220 ACTIVITY

Genetic Complementation With FLJ35220 Recovers nfi Knock-Out E.coli Cultures (AS01) from Damage Caused by Cisplatin Genetic complementation experiments and cell survival response assays for my research project have been modeled on two previous publications - first, the characterization of the Endonuclease IV mutant of E.coli (Cunningham et al., 1986) and second, the survival response of E.coli and coliphages in response to sodium bisulfite treatment (Simmons & Friedberg, 1979). I tested the model that FLJ35220 encodes a protein that has functionality similar to E. coli Endo V. Sequence similarities between FLJ35220 and homologs of Endo V (Figure 2 and Figure 3) support similar activities; nevertheless, this has not been tested for FLJ35220, and a human homolog of Endo V has not been described. If FLJ35220 has Endo V activity, I expect that it will respond

32

in the same way as E. coli Endo V in the cell upon encountering DNA damage. I have used isogenic E. coli strains with a mutated version of nfi complemented with E.coli nfi (Ecnfi), wild type FLJ35220, FLJ35220 D52A and control DlacZ genes. My prediction was that the nfi knockout cultures will show decreased cell survival relative to wild type cultures upon exposure to DNA damaging agents, and that complementation with E.coli nfi and FLJ35220 will restore cell survival back to the wild type numbers. An alternative prediction was that the cells may die upon over-expression of Endo V due to excessive fragmentation of DNA by Endo V upon encountering damage by the experimental cytotoxic agent. I first generated an Endo V deficient strain of E. coli in the background of NM232. NM232 is based on the strain AB1157 (Bachmann et al., 1987), which has been used previously as a background strain for mutant analysis of DNA repair in E. coli. The genotypes for all E. coli strains I used in this study are shown in Table 1.

33

Table 1 Genotypes of E.coli Strains Used for The Genetic Analysis of FLJ35220 Activity
E.coli strains AB1157 Genotype thr-1, araC14, leuB6(Am), (gpt-proA)62, lacY1, tsx-33, qsr'-0, glnV44(AS), galK2(Oc), LAM-, Rac-0, hisG4(Oc), rfbC1, mgl-51, rpoS396(Am), rpsL31(strR), kdgK51, xylA5, mtl-1, argE3(Oc), thi-1 F-, (araD-araB)567, lacZ4787(::rrnB-3), -, rph1, (rhaD-rhaB)568,nfi-769::kan, hsdR514 thr-1, araC14, leuB6(Am), (gpt-proA)62, lacY1, tsx-33, qsr'-0, glnV44(AS), galK2(Oc), LAM-, Rac-0, hisG4(Oc), rfbC1, mgl-51, rpoS396(Am), rpsL31(strR), kdgK51, xylA5, mtl-1, argE3(Oc), thi-1, (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) thr-1, araC14, leuB6(Am), (gpt-proA)62, lacY1, tsx-33, qsr'-0, glnV44(AS), galK2(Oc), LAM-, Rac-0, hisG4(Oc), rfbC1, mgl-51, rpoS396(Am), rpsL31(strR), kdgK51, xylA5, mtl-1, argE3(Oc), thi-1, (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]), nfi-769::kan

JW5547

NM232

AS01

Note. AB1157 wt E.coli with no T7 polymerase gene; NM232 wt E.coli with the T7 polymerase gene; JW5547 genomic nfi interrupted donor cell line; AS01 Kanamycin resistant tool for genetic complementation analysis, created by infecting NM232 with P1 lysate from the donor strain, JW5547.

NM232 carries the DE3 lysogen to support expression of the transgene in pET100 by T7 polymerase (Duquette et al., 2004), which will allow me to induce expression using Isopropyl -thio galactoside (IPTG). I introduced a kanamycin interrupted version of nfi from JW5547 into NM232 by P1 transduction. This nfi knock-out strain was 34

re-named AS01, and contains a kanamycin interrupted nfi gene along with a DE3 lysogen for T7 polymerase driven expression of the transgene. Ablation of nfi was verified by selection on LB agar plates containing kanamycin and by PCR with primers specific for nfi. In order to test my model, I transformed AS01 cells with several different transgenes. I used a single expression system, a pET100 plasmid (Invitrogen) capable of inducible expression with IPTG. I directionally cloned wild-type E. coli nfi (Ecnfi), FLJ35220, FLJ35220 D52A, and lacZ (control vector supplied with pET100) into pET100. I then transformed nfi knock-out (AS01) cells with each of these transgenes and tested their respective survival after exposure to two different DNA damaging agents, cisplatin and nitrofurantoin. Prior to examining cell survival after DNA damage, I determined the concentration of cisplatin that is lethal to wild-type NM232 E. coli. Cis-diamminedichloroplatinum (II), (cisplatin) is a potent anti-cancer drug that exerts its cytoxicity through DNA damage. The molecular structure is shown in Figure 4. Primarily, it creates covalent crosslinks between adjacent guanine DNA bases, which then causes cell death through activation of the DNA damage response (Reviewed by Boulikas & Vougiouka., 2003). Cisplatin creates covalent crosslinks with DNA, particularly between adjacent guanine bases through the N7 nitrogen 35

of purines. This is a mutagenic lesion because platinum adducts in genomic DNA formed by cisplatin inhibit replication and transcription and causes cell death in proliferating cells (Cepeda et al., 2007).

Figure 4. Structure of Cis-diamminedichloroplatinum (II) (Cisplatin). Cisplatin causes platinum adducts in genomic DNA and inhibits transcription and replication, leading to cell death in proliferating cells (Cepeda et al., 2007).

36

Transplatin is a stereoisomer of cisplatin and identical except for the orientation of the reactive groups (Figure 5). This results in a much less cytotoxic molecule probably because it forms 1, 3 intrastrand crosslinks in DNA as against 1, 2 adducts formed by cisplatin (Cepeda et al., 2007), which is more cytotoxic. Therefore, transplatin was used as a control for the genomic cytotoxicity of cisplatin in the experiments I present here. However, it has been documented in literature that the two chloride ligands of transplatin, upon photo-activation with UVA light, makes transplatin as cytotoxic as cisplatin to both plasmid DNA as well as duplex genomic DNA by mediating formation of interstrand crosslinks and DNA-protein crosslinks (Heringova et al., 2006).

Figure 5. Structure of trans-diamminedichloroplatinum (II) (Transplatin). The placement of chlorides in this molecule makes it instantly go into solution when it finds water. Therefore, transplatin is inactivated even before it can access DNA in the nucleus. 37

NM232 cells were exposed to various concentrations of cisplatin or transplatin and the survival determined by colony counting. I then determined the quantity of cisplatin required for cell survival to reach 50% of no-damage controls (IC50). Colony counts were obtained in triplicates, and the means and standard deviations were calculated using MS Excel. I conclude that the IC50 for cisplatin in wild-type NM232 E. coli is 70M (Figure 6).

38

Figure 6. Determination of IC50 for Cisplatin on wild type NM232 E.coli. A saturated overnight culture of NM232 was diluted to 1/106 and incubated with the indicated concentrations of cisplatin, and then plated on LB agar plates in the absence of drug. Experiments were performed in triplicate and the average number of colonies counted for each treatment with standard deviations is shown.

I conclude that cisplatin is cytotoxic to E. coli, suggesting that the cytotoxic effects on proliferating human cells also influence E. coli survival. Based on the known function of cisplatin on killing human cancer cells, it is likely that the cell death I observed in NM232 is caused by damage to DNA in the form of base crosslinks. 39

Having established a concentration of cisplatin capable of reducing NM232 viability to 50%, I next tested the model that FLJ35220 encodes a protein with functions similar to Endo V. NM232, AS01, AS01-Ecnfi, AS01-FLJ35220, AS01-FLJ35220 D52A, and an expression control AS01-DlacZ were exposed to cisplatin and then plated to monitor relative survival. AS01-DlacZ, which expresses the beta-galactosidase protein (Invitrogen expression control for pET100 vector system), was used here as a control to ensure that protein over-expression alone does not alter survival. Beta-galactosidase is a sugar metabolizing protein, and does not function in DNA repair. The mean colony counts obtained for the six cultures grown in the absence of DNA damaging agents are shown in Table 2, and the graph is presented in Figure 7.

40

Table 2 Cell Survival of Cultures Grown With No DNA Damaging Agent

Mean colony counts (No Damage) 690 673 692 680 676 672 Standard Deviation 1.5 3.0 2.0 1.5 4.0 3.0 Cell Survival Relative to wild type 100% 97.5% 100% 98.5% 97.8% 97.3%

Cultures Wild type AS01 AS01-Ecnfi AS01-FLJ35220 AS01-FLJ35220 D52A AS01-DlacZ

Note: Cells were grown to an OD of 0.3, diluted to 1/106, and then plated on LB agar containing 0.2mM IPTG to induce T7 expression of the transgenes, all in pET100. Colonies were counted by hand and results from three different experiments averaged and standard deviation calculated. Strains tested for survival in the absence of damaging agents included NM232 (Wild type), NM232 with nfi gene disruption (AS01), AS01 expressing a wild type nfi gene (AS01-Ecnfi), AS01 expressing FLJ35220 ORF (AS01-FLJ35220), AS01 expressing D52A mutated version of FLJ35220 (AS01-FLJ35220 D52A), and the lacZ expression control (AS01-DlacZ).

41

Figure 7. Cell survival of cultures grown with no damaging agent. Graphical representation of data presented in Table 2.

42

The mean colony counts obtained for the six cultures grown with 70M cisplatin are tabulated in Table 3 and the graph is shown in Figure 8.

Table 3 Cell Survival of Cultures Grown With 70M Cisplatin

Mean colony counts (Cisplatin 70M) 347 171 339 323 200 166 Standard Deviation 1.2 2.0 3.0 5.2 3.0 2.6 Cell Survival Relative to wild type 100% 49.3% 97.6% 93.1% 57.6% 47.8%

Cultures Wild type AS01 AS01-Ecnfi AS01-FLJ35220 AS01-FLJ35220 D52A AS01-DlacZ

Note: Cells were grown to an OD of 0.3, diluted to 1/106, incubated with 70M cisplatin at 37C for 1h and then plated on LB agar containing 0.2mM IPTG to induce T7 expression of the transgenes, all in pET100. Colonies were counted by hand and results from three different experiments averaged and standard deviation calculated. Strains tested for survival in the presence/absence of damaging agents included NM232 (Wild type), NM232 with nfi gene disruption (AS01), AS01 expressing a wild type nfi gene (AS01-Ecnfi), AS01 expressing FLJ35220 ORF (AS01-FLJ35220), AS01 expressing D52A mutated version of FLJ35220 (AS01-FLJ35220 D52A), and the lacZ expression control (AS01-DlacZ).

43

Figure 8. Expression of FLJ35220 in AS01 recovers cells in response to damaged caused by 70M Cisplatin. Graphical representation of data shown in Table 3.

Even though results strongly indicate that expression of FLJ35220 in AS01 allows cells to survive cisplatin treatment to wildtype levels (Figure 8), I preformed statistical analysis of the data. I used a two-tailed T-test and pair-wise comparisons of mean colony counts between the six different cultures. P-values for each 44

comparison are tabulated in Appendix C. For AS01 compared to AS01FLJ35220 (P value = 0.03), AS01 compared to AS01-Ecnfi (P value = 0.03), and wt compared to AS01 (P value = 0.04), the difference in survival upon adding back nfi or FLJ35220 is significant. AS01 compared to AS01-FLJ35220 D52A (P value = 0.27) and AS01 compared to AS01-DlacZ (P value = 0.12) suggest a statistically insignificant difference between mean colony counts of these populations. The results fit with my predictions that the mutant version of FLJ35220 (AS01-FLJ35220 D52A) is catalytically impaired and is therefore unable to recover the AS01 cells. Furthermore, the AS01DlacZ control had no significant impact on response to cisplatinmediated DNA damage, indicating that merely over-expressing a transgene did not cause a variation in cell survival in response to cisplatin. Sensitivity to transplatin, a non-toxic stereoisomer of cisplatin, was assayed as a negative control to cisplatin cytotoxicity, and is shown in Table 4 and Figure 9.

45

Table 4 Cell Survival of Cultures Grown With 70M Transplatin

Mean colony counts (Transplatin 70M) 504 499 500 502 501 488

Cultures

Standard Deviation 1.2 1.7 2 2 1.2 1.5

Cell Survival Relative to wild type 100% 99% 99.2% 99.6% 99.4% 97%

Wild type AS01 AS01-Ecnfi AS01-FLJ35220 AS01-FLJ35220 D52A AS01-DlacZ

Note: Cells were grown to an OD of 0.3, diluted to 1/106, incubated with 70M transplatin at 37C for 1h, and then plated on LB agar containing 0.2mM IPTG to induce T7 expression of the transgenes, all in pET100. Colonies were counted by hand and results from three different experiments averaged and standard deviation calculated. Strains tested for survival in the presence/absence of damaging agents included NM232 (Wild type), NM232 with nfi gene disruption (AS01), AS01 expressing a wild type nfi gene (AS01-Ecnfi), AS01 expressing FLJ35220 ORF (AS01FLJ35220), AS01 expressing D52A mutated version of FLJ35220 (AS01-FLJ35220 D52A), and the lacZ expression control (AS01-DlacZ).

46

Figure 9. Cell survival of cultures in response to 70M Transplatin. Graphical representation of data shown in Table 4.

Statistical analysis was completed using two-tailed T-test for transplatin sensitivity for each strain and transgene-expressing AS01 cells. At 95% confidence level, the computed P-values (Appendix C) indicated that there is no significant difference in the colony counts obtained for the different cultures in response to transplatin treatment (P values >0.05). However, wild type cultures showed a greater 47

survival response than the other cultures. This suggests that transplatin may be weakly toxic to other molecular targets in the cell besides DNA, but much less cytotoxic than cisplatin, as predicted. This experiment further supports the model that cisplatin-mediated DNA damage generates a DNA lesion that is a substrate for FLJ35220 and E.coli Endo V, but transplatin does not. I conclude that the recovery effects imparted by FLJ35220 expression in AS01 cells to cisplatin exposure are due to the DNA repair response mediated by FLJ35220, replacing activities lost upon nfi ablation. The results also suggest that E.coli Endo V is needed for cell survival in the presence of cisplatin, but not transplatin (Table 4, Figure 9).

FLJ35220 Expression Allows AS01 Cells to Survive Exposure to Nitrofurantoin Endo V is well known as a repair protein specific to nitrosative DNA damage, and has been shown to prefer deaminated adenosine bases as repair substrates (Demple & Linn, 1987., Huang et al., 2001). If FLJ35220 encodes a protein that has similar properties, I expect it will behave similar to E. coli Endo V in response to DNA deamination. Therefore, I asked if expression of FLJ35220 in AS01 cells results in 48

survival to nitrosative DNA damaging agents at levels similar to AS01 cells expressing wt Endo V. Nitrofurantoin is an antibiotic that is specifically used to treat urinary infections, and is a chemical that causes nitrosative DNA damage (Guo & Weiss, 1998). The chemical name of nitrofurantoin is 1-[[[5-nitro-2-furanyl] methylene] amino]-2, 4-imidazolidinedione, and its structure is shown below in Figure 10.

Figure 10. Structure of 1-[[[5-nitro-2-furanyl] methylene] amino]-2, 4-imidazolidinedione (Nitrofurantoin). Nitrofurantoin is an antibiotic used in treating urinary infections, and is known to cause a wide variety of free radical mediated DNA damage like DNA breaks, transition mutations, and deaminated bases.

49

Previously, nitrofurantoin has been shown to kill E. coli cells (Guo & Weiss., 1998) and creates a broad range of free radicalmediated DNA damage such as DNA breaks, interstrand crosslinks, base modifications and transition mutations (Povirk, 1996). Nitrofurantoin has been reported to be toxic to DNA, RNA and proteins in E.coli (Povirk, 1996). Nitrosative damage is one of the types of damage caused by nitrofurantoin to DNA; however, there may be other damaging consequences to DNA mediated by nitrofurantoin which are not clear. Hence, I used cell survival as a measure of the recovery response to damage caused upon incubation of the experimental cultures with nitrofurantoin. I have tested wild type NM232 cultures to determine the IC50 for nitrofurantoin. The IC50 concentration of nitrofurantoin was determined for wt E.coli cultures to be 10M (Figure 11).

50

Figure 11. Determination of IC50 of nitrofurantoin on wild type NM232 E.coli. A saturated overnight culture of NM232 was diluted to 1/106 and incubated with the indicated concentrations of nitrofurantoin, and then plated on LB agar plates in the absence of drug. Experiments were performed in triplicate and the average number of colonies counted for each treatment with standard deviations is shown.

51

After determining concentrations of nitrofurantoin that are toxic to NM232, I examined the ability of nfi and FLJ35220 expression to influence survival of AS01 cells. Nitrofurantoin at its IC50 concentration was added to cultures of AS01 and derivatives, incubated at 37C, and changes in survival after plating on LB agar plates containing IPTG were recorded in terms of colony counts. Colony counts were obtained in triplicates, and the means and standard deviations were calculated using MS Excel. AS01-DlacZ was used as an expression control in the damage response assays to ensure that gene expression caused by induction with 0.1mM IPTG is not itself responsible for survival changes. Table 5 and Figure 12 show the results of survival after incubation in 10M nitrofurantoin. AS01 cells were two-fold more sensitive to 10M nitrofurantoin compared to NM232. Expression of nfi in AS01 recovered survival, mean colony count of 350 for AS01-Ecnfi compared to a mean of 356 for wild type (Table 5). AS01 expressing FLJ35220 survived at levels nearly identical to AS01-Ecnfi, with a mean colony count 335 after nitrofurantoin exposure. Expression of the D52A mutant form of FLJ35220 did not recover survival, and the mean colony count was statistically different from AS01 cells alone (P value= 0.065). I conclude that expression of FLJ35220 substitutes for

52

loss of the nfi gene in E. coli and allows cells to survive nitrofurantoin exposure.

Table 5 Cell Survival of Cultures Grown With 10M Nitrofurantoin

Mean colony counts (nitrofurantoin 10M) 356 180 350 335 209 172

Cultures

Standard Deviation 1.7 1.2 1.6 3.3 1.7 1.6

Cell Survival Relative to wild type 100% 50.5% 98.3% 94.1% 58.7% 48.3%

Wild type AS01 AS01-Ecnfi AS01-FLJ35220 AS01-FLJ35220 D52A AS01-DlacZ

Note: Cells were grown to an OD of 0.3, diluted to 1/106, incubated with 10M nitrofurantoin at 37C for 1h and then plated on LB agar containing 0.2mM IPTG to induce T7 expression of the transgenes, all in pET100. Colonies were counted by hand and results from three different experiments averaged and standard deviation calculated. Strains tested for survival in the presence/absence of damaging agents included NM232 (Wild type), NM232 with nfi gene disruption (AS01), AS01 expressing a wild type nfi gene (AS01-Ecnfi), AS01 expressing FLJ35220 ORF (AS01FLJ35220), AS01 expressing D52A mutated version of FLJ35220 (AS01-FLJ35220 D52A), and the lacZ expression control (AS01-DlacZ).

53

Figure 12. Expression of FLJ35220 in AS01 recovers cells in response to damage caused by 10M nitrofurantoin. Graphical representation of data in Table 5.

54

CHAPTER V PURIFICATION AND ANALYSIS OF FLJ35220 EXPRESSION PRODUCTS In order to test the activity of the expressed product from FLJ35220, I initiated purification and activity assays. I cloned the ORF of FLJ35220 in two different expression systems one with an Nterminal 6-HIS tag, and the other with an N-terminal maltose binding protein tag. After obtaining purified recombinant protein, I performed cleavage assays in vitro. I predicted that the hypothetical human protein, FLJ35220 would cleave a synthetic DNA substrate containing deoxyinosine, in a pattern identical to the characterized E.coli enzyme and the archeal homolog. I have used a synthetic oligonucleotide substrate containing deoxyinosine for my in vitro cleavage assays to compare the activity of FLJ35220 with the bacterial and archeal homologs. All oligonucleotides used in this study have been tabulated in Appendix A with their sequences and a brief description. I have used site directed mutagenesis to engineer the substitution mutations equivalent to the archeal and bacterial homologs, in the human protein FLJ35220. Identifying FLJ35220 as the human homolog of Endo V is 55

significant because it would pave the way for future experimentation on characterizing the mechanism by which human Endo V repairs deaminated bases.

Construction of Expression System for FLJ35220 and its Point Mutants The ORF for the human hypothetical protein FLJ35220 has been cloned in the pET100/D-TOPO cloning system (Invitrogen), placing the gene downstream of an inducible T7 promoter and in-frame with an Nterminal poly histidine tag. Successful cloning into the pET100 vector was verified by DNA sequencing as shown in Figure 13. Expression of the recombinant proteins were completed in E.coli Arctic Express (DE3) RP cell line (Stratagene). Purification of the recombinant human protein FLJ35220 on SDS-PAGE and verification of the N-terminal 6HIS-tag by Western Blot using a primary antibody to the HIS-tag are shown in Figure 15. Substitution of the highly conserved catalytic amino acid D52 with Alanine was done in order to impair metal coordination. The mutation was verified by DNA sequencing as shown in Figure 14. Purification of the D52A mutant of FLJ35220 by SDS-PAGE is shown in Figure 16. The plasmid maps are included in Appendix B.

56

Figure 13. Verification of cloning of wt FLJ35220 by DNA sequencing. Experimental sequence obtained using the T7F sequencing primer for pET100, was aligned with the 795bp ORF of FLJ35220 published in the NCBI database (Genbank accession BC064545). Pair-wise alignments were generated using ClustalW2. 100% identity is denoted by the symbol (*). 57

Figure 14. Verification of the point mutation leading to the amino acid substitution D52A by DNA sequencing. Experimental sequence obtained using the T7F sequencing primer for pET100, was aligned with the 795bp ORF of wt FLJ35220 published in the NCBI database (Genbank accession BC064545). Pair-wise alignments were generated using ClustalW2. The single base change leading to the D52A substitution is indicated by a gap (absence of a *). 100% identity is denoted by the symbol (*). 58

Figure 15. Purification of FLJ35220 protein and verification of the HIStag. SDS-PAGE and Coomassie brilliant blue staining of HIS-tagged FLJ35220 protein that eluted from Ni-sepharose column (top). Western Blot (bottom) using primary antibody to probe for the presence of the HIS tag on the FLJ35220 protein. The arrow points to the fusion protein, which migrates at approximately 33 KDa.

59

Figure 16. Purification of FLJ35220 D52A protein. SDS-PAGE and Coomassie brilliant blue staining of HIS-tagged FLJ35220 D52A protein that eluted from Ni-sepharose column. The arrow points to the fusion protein, which migrates at approximately 33 KDa.

Maltose Binding Protein (MBP) fusion tags have previously been reported as being helpful in solubilizing human proteins for purification (New England Biolabs). Therefore an MBP-FLJ35220 fusion construct was made in pMAL-c5X and verified by DNA sequencing, as shown in Figure 17. The D52A mutant was also cloned in pMAL-c5X. Verification of the point mutation by DNA sequencing is shown in Figure 18. Purification of this fusion protein - both the wt as well as the D52A mutant was completed as shown in Figures 19 and 20.

60

Figure 17. Verification of cloning of MBP-FLJ35220 by DNA sequencing. Experimental sequence obtained using the forward sequencing primer for pMAL-c5X, was aligned with the 795bp ORF of FLJ35220 published in the NCBI database (Genbank accession BC064545). Pair-wise alignments were generated using the ClustalW2. 100% identity is denoted by the symbol (*). 61

Figure 18. Verification of the point mutation leading to the amino acid substitution D52A by DNA sequencing. Experimental sequence obtained using the reverse sequencing primer for pMAL-c5X, was aligned with the 795bp ORF of wt FLJ35220 published in the NCBI database (Genbank accession BC064545). Pair-wise alignments were generated using ClustalW2. The single base change leading to the D52A substitution is indicated by a gap (absence of a *). 100% identity is denoted by the symbol (*). 62

Figure 19. SDS-PAGE showing purification of wt MBP-FLJ35220. SDSPAGE and Coomassie brilliant blue staining of MBP-FLJ35220 protein that eluted from the Amylose column. The arrow points to the fusion protein, which migrates at approximately 72 KDa.

63

Figure 20. SDS-PAGE showing purification of MBP-FLJ35220 D52A. SDS-PAGE and Coomassie brilliant blue staining of MBP-FLJ35220 D52A protein that eluted from Amylose column. The arrow points to the fusion protein, which migrates at approximately 72 KDa.

64

Cleavage Assays After cloning and purification of recombinant FLJ35220, cleavage assays were performed in vitro to ask the question if the human protein could cleave a synthetic deoxyinosine substrate identical to E.coli Endo V. Using the purified recombinant N-terminal HIS-tagged wild type protein FLJ35220 on a single-stranded oligonucleotide substrate EDL410 having deoxyinosine at the 25th position, a cleavage assay was performed. The predicted cleavage by Endo V is shown in Figure 21. E.coli Endo V was used as a positive control for cleavage in the assay. A recombinant HIS-tagged hypothetical protein from an archeal organism Pyrococcus furiosus (sequence homolog of E.coli Endo V), was also added in the assay to observe cleavage. This protein was purified in the lab beforehand. The results from the cleavage assays are shown in Figure 22. Recombinant human protein and Pfu protein both showed weak endonucleolytic cleavage of the substrate, resulting in a cleavage product that co-migrated with the E.coli Endo V cleavage product. However, there was also a stronger 35 exonucleolytic cleavage product in the human and Pfu protein added lanes, which required further investigation.

65

Figure 21. Predicted cleavage of a synthetic substrate containing deoxyinosine by FLJ35220. EDL410 is a synthetic oligonucleotide (51mer) containing deoxyinosine at the 25th position (top). Bacterial and archeal homologs of Endo V are known to make a nick at the second phosphodiester bond 3 from the lesion (bottom). Therefore, the prediction is that Endo V activity will yield a 26-mer cleavage product.

66

Figure 22. Cleavage of single-stranded DNA containing deoxyinosine by FLJ35220. The substrate EDL410 with no protein added (negative control Lane 1) did not show any cleavage. E.coli Endo V completely cleaved the substrate (positive control - Lane 2), yielding a cleavage product of the expected size, while recombinant Pfu Endo V (Lane 3) and FLJ35220 (Lane 4) resulted in a weak endonucleolytic cleavage product co-migrating with the E.coli Endo V cleavage product, accompanied by a stronger 3-5 exonucleolytic cleavage product. However, the exonuclease activity required further verification.

In order to retrieve Endo V activity by titrating the 3-5 exonuclease activity, another cleavage assay was performed with addition of excess amounts of unlabeled competitor (EDL 413) in different competitor/substrate ratios. The results are shown in Figure 23. At 20 times more competitor than substrate, the exonuclease 67

activity was titrated, and the cleavage band corresponding to Endo V activity was only seen, suggesting that the human recombinant protein FLJ35220 may be the active human homolog of Endo V.

Figure 23. Recombinant FLJ35220 mediated cleavage of deoxyinosinecontaining substrate in the presence of a cold competitor. The 3-5exonuclease activity was completely titratable at 20-fold excess competitor than substrate, and Endo V activity reappeared, suggesting that FLJ35220 could be the human homolog of Endo V because the cleavage product obtained co-migrated with the positive control cleavage band given by E.coli Endo V.

68

While recombinant HIS-tagged FLJ35220 initially showed promising activity on inosine-containing substrates, activity was not repeatable and recombinant protein with the D52A substitution could not be correlated with active human Endo V. This suggested to me that the human protein expressed in E. coli is unstable outside of the cell. Therefore, I next examined this model to better clarify the enzymology of human Endo V. I completed multiple repurification trials with different column buffers, different pH ranges, an imidazole elution gradient, a salt elution gradient, sequential ion-exchange columns, cobalt columns, and size exclusion column purification (not shown). The outcomes of the above-mentioned failed purification experiments are summarized in Table 6; the observations suggest that FLJ35220 probably needs a eukaryotic expression system. A denaturing prep with 6M urea in the buffers was also attempted, followed by refolding with buffer exchange on a Centricon column. However, the attempt was unsuccessful.

69

Table 6 Different Strategies of Purification Tried for Obtaining Active Recombinant FLJ35220
Experiments Ni column purification elution with an imidazole gradient of 20-200mM, 300mM, 500mM and 1M Ni column purification tried with 20mM Tris, pH 7.2 in the column buffers Ni resin loaded on SDS-PAGE Outcomes No protein eluted; Protein seen in the insoluble pellet A small quantity eluted; most of the protein seen in the pellet Most of the protein aggregated seen on the resin No appreciable elution; Protein seen in the insoluble pellet No appreciable elution; Protein seen in the insoluble pellet A small quantity eluted; most of the protein seen in the pellet A small quantity eluted; most of the protein seen in the pellet FLJ35220 did not elute FLJ35220 did not elute FLJ35220 was too dilute to be seen on the gel FLJ35220 did not elute Interpretation FLJ35220 probably lost stability, and went into inclusion bodies Unstable protein, inactive on synthetic substrate Unstable protein

Ni column purification tried with 20mM HEPES, pH 7.0 and pH 7.6 in the column buffers Ni column purification tried with 20mM MOPS, pH 5.6 in the column buffers Ni column purification tried with 20mM Sodium phosphate, pH 8.0 in the column buffers Cobalt column purification tried with all of the above variations SP Sepharose with a salt gradient elution Q- Sepharose salt gradient elution and pH gradient elution Size exclusion on a G500 column Hydroxyapatite column purification

Aggregation on resin; unstable protein Aggregation on resin; unstable protein Unstable protein; inactive on synthetic substrate Aggregation on resin; unstable protein, inactive on synthetic substrate FLJ35220 probably needs a different purification strategy FLJ35220 probably needs a different purification strategy FLJ35220 probably needs a different purification strategy FLJ35220 probably needs a different purification strategy

Note: FLJ35220 seems to be a highly unstable protein outside of the cell, and likely requires a eukaryotic expression system for stability.

70

As an alternative strategy, the MBP-fusion forms of FLJ35220 and its point mutant D52A were used for the cleavage assays to see if the MBP fusion tag increased their stability in vitro. EDL 472, a synthetic oligonucleotide substrate 51nt long with deoxyinosine at the 25th position was used for the cleavage assays. This substrate was synthesized with a 5 phosphorothioate modification, intending to resist any exonuclease activity. The cleavage assay results are shown in Figure 24. The substrate with no protein added (negative control) showed no cleavage, while addition of E.coli Endo V (positive control) gave a cleavage product of the expected size (26nt), suggesting that the reaction conditions were all appropriate. However, wt and D52A forms of FLJ35220 did not show an Endo V activity. The weak exonucleolytic activity persisted, and was stronger with the addition of wt FLJ35220 to the substrate, suggesting that this exonuclease activity might be a part of the human protein.

71

Figure 24. Cleavage assay to compare activities of wt and D52A mutant of FLJ35220 against E.coli Endo V. EDL472 with no protein added (lane 1) showed no cleavage. E.coli Endo V cleaved the substrate irrespective of the concentration of the second metal in the assay buffer (lanes 2,3 and 4). Addition of wt FLJ35220 to the substrate (lanes 5,6 and 7) seemed to show a 3-5 exonuclease activity, which was more pronounced with 10mM Ca++ added to the assay buffer (lane 7) that already contained 5mM Mn++. FLJ35220 D52A also showed a weak exonucleolytic activity (lanes 8,9 and 10), but was not as pronounced as the wild type human protein, suggesting that the exonuclease activity could be a part of the human protein.

To confirm whether the exonucleolytic cleavage was an activity of FLJ35220, another quadruple mutant was made, that had a VDGNAAAA substitution in the conserved motif identified as important for 72

maintaining the shape of the molecule for lesion binding in the archeal homolog (Dalhus, 2009). This substitution was made in addition to the already mutated D52A. The mutation was verified by DNA sequencing (not shown). The recombinant mutant human protein FLJ35220 D52A VDGN-AAAA was purified (data not shown). Having made the quadruple mutant VDGN-AAAA, cleavage assays were repeated, comparing the activities of wt FLJ35220 with the D52A and the D52A VDGN-AAAA mutants (data not shown). Neither the wild type nor mutants showed any Endo V activity, suggesting that the human protein was unstable outside of the cell. The quadruple mutation did not appear to have any impact on FLJ35220 activity, thereby reinforcing the consistent failures observed in the cleavage assays in vitro (data not shown). The exonuclease activity was probably from a host nuclease co-purified with the human protein. The inability of His-tagged and the MPB fusion FLJ35220 protein to function in biochemical assays, and the apparent aggregation during Ni++ chromatography (Figure 25) suggested to me that the recombinant proteins may not be properly folded.

73

Figure 25. SDS-PAGE showing aggregation of FLJ35220 on the NiSepharose resin. Repeated attempts of purification resulted in no elution even with 500mM imidazole, and aggregation of the protein on the resin, which is indicated by the arrow pointing at the corresponding band on the image.

Circular Dichroism To further investigate the inactivity of the purified wild type and mutant forms of FLJ35220, a circular dichroism experiment was performed. A protein concentration of O.5 mg/mL was used for the experiment. The CD signals recorded by the instrument were very weak, which indicated that the inactivity may be due to improper folding of the human protein in vitro or due to undetectable concentrations of protein in the sample (Figure 26). Parallelly, the 74

MutS protein of E.coli, run at the same concentration, recorded strong CD signals on the instrument (not shown), thereby ruling out the possibility that weak CD signals were due to undetectable amounts of protein in the sample. Poor CD signals, along with repeated inactivity seen in the cleavage assays suggest that the recombinant protein FLJ35220 and its point mutants are all unstable outside the cell. Within the cell it may oligomerize or depend on other proteins for its activity. However, biochemically, the activity of FLJ35220 could not be defined owing to its instability in vitro. It is also a possiblity that the human protein requires post-translational modifications, which would require a eukaryotic expression system to achieve.

75

Figure 26. Circular Dichroism comparing the spectra of wt, D52A and D52A VDGN-AAAA mutants of FLJ35220. The CD signals representing the ellipticities of the amino acids show no appreciable variations indicative of alpha helices or beta sheets or turns in the helices, suggesting that the proteins are all probably unfolded in vitro. These observations support the consistent failures observed in the cleavage assays for action of FLJ35220 on inosine substrates.

76

CHAPTER VI DISCUSSION

Genetic Complementation Analyses in E.coli The fact that cultures of wt NM232, AS01, AS01-Ecnfi, AS01FLJ35220, AS01-FLJ35220 D52A and AS01-DlacZ, all exhibited robust growth in the absence of any DNA damaging agent, and that addition of cisplatin and nitrofurantoin reduced the survival of nfi-deficient AS01 cells to about 50% of that of wt cultures, suggests that knocking out Endo V has a significant impact on the ability of the cultures to repair DNA damage. Furthermore, FLJ35220 recovers survival of nfi deficient E.coli cultures (AS01) upon response to damage induced by cisplatin and nitrofurantoin, suggesting that the recombinant protein is active inside the cell. Localization of Endo V within the cell, in the presence/absence of DNA damage could have been tracked using an antibody to Endo V. However, the unavailability of an antibody to Endo V limited this experiment. The response of E.coli Endo V and FLJ35220 to cisplatin and nitrofurantoin- induced damage implies that Endo V has a broader 77

substrate range, and that it could be a key participant in an alternative pathway for repair of a variety of damage caused by different agents. These results are in agreement with previous research that established a wide range of DNA base lesions as possible substrates for E.coli Endo V (Demple & Linn., 1982), but extends from these findings in a significant way because they identify platinum adducts as substrates for Endo V. Genetic complementation experiments have shown for the first time that E.coli Endo V recognizes DNA damage caused by cisplatin. Interestingly, the biological activity of cisplatin was first discovered in 1965 by accident during experiments designed to test the effect of electric current on E.coli cultures (Rosenberg at al., 1965). Inhibition of cell division in those experiments was apparently not due to electric current, but due to the production of cisplatin from the platinum electrodes used in the study (reviewed by Chu., 1994). This is probably the first evidence of cisplatin-induced cytotoxicity in E.coli. My results described here show that E.coli Endo V responds to platinated DNA, and cell survival in the presence of cisplatin depends in part on active Endo V. Cisplatin, being a chemotherapeutic drug, has been extensively studied with relevance to human DNA, and the possible biochemical 78

mechanisms of cisplatin cytotoxicity have been published (Cepeda et al., 2007). Even so, the clear molecular bases of tumor resistance to cisplatin in any particular cell type have not been established. Previous studies in the early 1990s discussing the mechanisms by which cisplatin-DNA adducts led to apoptosis and cell death have stated that DNA is heavily fragmented into 180bp multimers during these events, possibly caused by an internucleosomal cleavage of chromatin by an endonuclease in human cell lines (reviewed by Chu., 1994). If FLJ35220 protein recognizes platinated DNA adducts caused by cisplatin, it may be involved in mediating the cytotoxicity of this drug. Loss of the FLJ35220 protein may further lead to cancer drug resistance. Thus, further study of the role of human Endo V is warranted. The use of nitrofurantoin for treating urinary infections has been previously documented. The cytotoxicity of nitrofurantoin to E.coli has also been reported in the genetic experiments on nfi-deficient hosts, in which sensitivity of these cultures to the antibiotic has been attributed to a wide range of DNA damage caused by nitrofurantoin (Guo & Weiss., 1998). However, the recovery of cells upon complementation of the nfi-deficient hosts with recombinant Endo V and FLJ35220 in response to nitrofurantoin-mediated damage is a novel finding that 79

supports the theory that Endo V could be an important molecular player in an alternative DNA repair pathway. Similar to E. coli Endo V protein, the human Endo V homolog may also recognize a broad spectrum of damage. This supports the model that Endo V acts as a backup pathway for correction of base modifications (Gates & Linn, 1977), and may indicate that human Endo V functions to reduce genomic damage caused by DNA deaminations.

Purification and Analysis of Recombinant FLJ35220 The results of my experiments designed towards biochemically defining the activity of FLJ35220 indicate that the recombinant protein is functionally inactive in vitro, although in one cleavage assay recombinant wild type HIS-tagged FLJ35220 showed a weak endonucleolytic cleavage of the deoxyinosine-containing substrate. Following loss of activity of this stock of purified protein, subsequent purifications were attempted. In an effort to get the protein in its active form, I have tried alternative expression lines of E.coli, multiple cloning strategies, different chromatography column buffers, a pH elution gradient, and different purification approaches using various ion-exchange resins. All of these strategies have consistently failed to

80

yield pure and active protein. Further, FLJ35220 aggregates on Ni++ resin, and may unfold during purification. Several amino acid substitutions have been reported in the archeal homolog (Feng et. al., 2005, Dalhus et. al., 2009). These mutational analyses have assessed the tolerability and dispensability of the substitution mutations. Although the wild type and mutant forms of FLJ35220 were successfully purified as MBP-fusion proteins, they failed to cleave the synthetic substrates. The instability of the human homolog in vitro made biochemical analyses extremely difficult. The CD spectra recorded for wt and the different point mutants of FLJ35220 further verified the instability of the human protein. The fact that recombinant FLJ35220 was very unstable, and that it either went into inclusion bodies or aggregated on the resin, suggests that the human homolog of this protein could be very different from its counterparts in other organisms. Instability could also be the reason why human Endonuclease V has not been characterized yet. The possibility that FLJ35220 could be different from its bacterial and archeal homologs is further reinforced by the crystal structure of archeal Endo V, in which the PYIP wedge motif has been thoroughly characterized (Dalhus, 2009). The bacterial homolog has this same PYIP wedge motif, while the murine and human 81

homologs do not have it (Figure 3). In bacteria and archea, the Tyrosine in the PYIP wedge has been shown to be the key amino acid involved in lesion recognition and binding. In FLJ35220, there is only 1 Tyrosine residue which could be involved in lesion recognition and binding, but this is not part of a PYIP motif (Figure 2). Further binding studies need to be done to characterize the role of this Tyrosine residue in DNA binding. Interestingly, the human protein FLJ35220 has repetitive tracks of Proline residues in its primary sequence, compared to homologs in other species and kingdoms (Figure 1 and Figure 2). The significance of having a high number of Proline residues is not clear, but those Proline rich sequences may be the binding sites for the hydrophobic pockets of the SH3 domains of one or more proteins in the cytoplasm of the cell, or may be the recognition sequences for the Ser/Thr kinases involved in signal transduction. There is also a stretch of four Cysteine residues (Figure 1 and Figure 2), which could undergo prenylation on the nucleophilic thiol groups as a post-translational modification in a reduced environment. This modification could be important for Endo V to cross the hydrophobic nuclear membrane in order to reach the DNA. Interestingly, the stretch of two to four Cysteines is seen only in the eukaryotic homologs of Endo V, and not 82

in the bacterial and archeal homologs (Figure 1 and Figure 2), suggesting strongly that these residues may be targets for posttranslational modifications. Taking the protein out of the cell probably disables the post-translational modifications and/or limits the availability of other factors possibly needed for its activity, which may have contributed to the instability of FLJ35220 protein in vitro. The instability of the recombinant protein outside of the cell is an indicator that the genetic approach and mutational analyses are better tools to characterize the activity of human Endo V. Probably, switching to a eukaryotic cell line for protein expression may change the results dramatically, although the instability of the protein in vitro may still be a stumbling block in deciphering the molecular mechanism of action of human Endo V through biochemical assays. Overall, my thesis research has established functions for the previously uncharacterized FLJ35220 gene, strongly suggesting functions that parallel the Endo V protein. This finding enables research into the roles of human Endo V in maintaining genomic stability and potentially functioning in the cytotoxic responses to cisplatin cancer drug treatment.

83

CHAPTER VII SUMMARY, CONCLUSIONS AND RECOMMENDATIONS FOR FUTURE RESEARCH

Genetic Analysis Summary In the absence of a DNA damaging agent, growth of all cultures, irrespective of the presence or absence of nfi, were equally robust. Inducing DNA damage with 70M cisplatin and 10M nitrofurantoin reduced the survival of nfi-deficient cells by about 50%. Recovery response to damage created by cisplatin and nitrofurantoin, upon addition of FLJ35220, was on par with recovery observed upon adding back E.coli nfi. The D52A mutant of FLJ35220 was not able to recover survival compared to wild type protein.

Conclusion Platinated DNA adducts formed by cisplatin are substrates for E.coli Endo V. Since complementation of Endo V-deficient E.coli with human protein FLJ35220 restored cell survival back to the wild type 84

numbers, it can be suggested that FLJ35220 may be a function homolog of E.coli Endo V. Since complementation with FLJ35220 recovered Endo V-deficient E.coli from damage caused by nitrofurantoin, I suggest that human Endo V, like its bacterial homolog, recognizes multiple kinds of damage and triggers repair. In human cells, this may result in directing the cell to (programmed) cell death upon DNA damage. However, this is just a model, and the real molecular mechanism for Endo V action is yet to be deciphered.

Purification and Analysis of Recombinant FLJ35220 Summary Human hypothetical protein FLJ35220 has been cloned, expressed and purified as an N-terminal HIS-tagged recombinant protein in E.coli. The D52A mutant was made, expressed and purified as an N-terminal HIS-tagged recombinant protein in E.coli. Cleavage assays were done on synthetic oligonucleotide substrates containing deoxyinosine. Weak endonucleolytic activity and a 3-5 exonuclease activity were seen. HIS-tagged protein was very unstable, making purification extremely cumbersome. To improve stability and activity, FLJ35220 was purified both in its wt and D52A forms as a recombinant N-terminal Maltose Binding Protein fusion in E.coli. 85

Cleavage assays were repeated. Endonucleolytic activity was not seen. A 3-5 exonuclease activity was weakly observed. A VDGNAAAA quadruple mutant was made to verify if the exonucleolytic activity was an activity of FLJ35220 or of a host exonuclease. Cleavage assays were repeated with wt, D52A and VDGN-AAAA mutant proteins. No activity was observed. Circular Dichroism was performed on wt, D52A and VDGN-AAAA mutant proteins. All of them were found to be improperly folded and so inactive.

Conclusion FLJ35220 is stable inside the cell, but loses stability and activity outside the cell. FLJ35220 may require additional proteins/factors within the cell for its activity. Post-translational modifications may be needed, which is not possible in an E.coli host. However, it requires further characterization.

Recommendations for Future Research In vivo studies can be planned for characterizing downstream repair steps. Fluorescent tags can be added to probe the cellular localization of Endo V with or without exposure to DNA damaging agents. Reverse genetics experiments in a eukaryotic system can be 86

planned to further characterize the activity of FLJ35220. My prediction is that Endo V may localize in the cytoplasm when there is no damage to DNA; however, upon inducing damage by exposure to DNA damaging agents, Endo V may localize in the nucleus. If this prediction is verified to be true experimentally, that would be the promising route to deciphering the molecular mechanism of Endo V-mediated DNA repair. Furthermore, antibodies can be raised to human Endo V, which will be useful for future experimentation.

87

REFERENCES

Baba, T., Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K.A. Datsenko, M. Tomita, B.L. Wanner, H. Mori. (2006). Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2:1-11 Bachmann, B.J. (1987). Derivation and genotypes of some mutant derivatives of Escherichia coli K-12: Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology (Edited by: Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasanik, B., Schaechter, M., & Umbarger, H.E.). Washington, D.C., American Society for Microbiology, 2:1190-1219. Bentz, B.G., Hammer, N.D., Radosevich, J.A., & Haines, G.K. (2004). Nitrosative stress induces DNA strand breaks but not caspase mediated apoptosis in a lung cancer cell line. Journal of Carcinogenesis. 3:16, 1-13. Boulikas, T. & Vougiouka, M. (2003). Cisplatin and platinum drugs at the molecular level. Oncol Rep. 10(6):1663-82. Budke, B., & Kuzminov, A. (2006). Hypoxanthine Incorporation Is Nonmutagenic in Escherichia coli. J. Bacteriol. 188(18), 65536560. Cepeda, V., Fuertes, M.A., Castilla, J., Alonso, C., Quevedo, C., & Prez, J.M. (2007). Biochemical Mechanisms of Cisplatin Cytotoxicity. Anti-Cancer Agents in Medicinal Chemistry. 7, 3-18. Chu, G. (1994). Cellular Responses to Cisplatin. J. Biol. Chem. 269(2), 787-790.

88

Cunningham, R.P., Saporito, S.M., Spitzer, S.G., & Weiss, B. (1986). Endonuclease IV (nfo) Mutant of Escherichia coli. J. Bacteriol. 168(3), 1120-1127. Dalhus, B., Arvai, A.S., Rosnes, I., Olsen, O.E., Backe, P.H., Alseth, I., Gao, H., Cao, W., Tainer, J.A., & Bjoras, M. (2009). Structures of endonuclease V with DNA reveal initiation of deaminated adenine repair. Nat Struct Mol Biol. 16(2), 138-143. David, S.S., OShea, V.L., & Kundu, S. (2007). Review Article: Baseexcision repair of oxidative DNA damage. Nature 447, 941-950. Demple, B. & Linn, S. (1982). On the Recognition and Cleavage Mechanism of Escherichia coli Endodeoxyribonuclease V, a Possible DNA Repair Enzyme. J. Biol. Chem. 257(6), 2848-2855. Duquette, M.L., Handa, P., Vincent, J.A. et al. (2004). Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes Dev. 18: 1618-1629. Feng, H., Dong, L., Klutz, A.M., Aghaebrahim, N., Cao, W. (2005). Defining Amino Acid Residues Involved in DNA-Protein Interactions and Revelation of 3-Exonuclease Activity in Endonuclease V. Biochemistry. 44, 11486-11495. Feng, H., Dong, L., & Cao, W. (2006). Catalytic Mechanism of Endonuclease V: A Catalytic and Regulatory Two-Metal Model. Biochemistry. 45, 10251-10259. Gates, F.T. & Linn, S. (1977). Endonuclease V of Escherichia coli. J. Biol. Chem. 252(5), 1647-1653. Guo, G., Ding, Y., & Weiss, B. (1997). nfi, the Gene for Endonuclease V in Escherichia coli K-12. J. Bacteriol. 179(2), 310-316. Guo, G., & Weiss, B. (1998). Endonuclease V (nfi) Mutant of Escherichia coli K-12. J. Bacteriol. 180(1), 46-51. Hansen, W.K. & Kelley, M.R. (2000). Review of Mammalian DNA Repair and Translational Implications. Journal of Pharmacology and Experimental Therapeutics. 295(1), 1-9. 89

Heringova, P., Woods, J., Mackay, F.S., Kasparkova, J., Sadler, P.J., & Brabec, V. (2006). Transplatin is cytotoxic when photoactivated: enhanced formation of DNA cross-links. J Med Chem. 49(26):7792-7798. Hitchcock, T.M., Dong, L., Connor, E.E., Meira, L.B., Samson, L.D., Wyatt, M.D., & Cao, W. (2004). Oxanine DNA Glycosylase Activity from mammalian Alkyladenine Glycosylase. J. Biol. Chem. 279(37), 38177-38183. Homo sapiens hypothetical protein FLJ35220, mRNA (cDNA clone MGC:74455 IMAGE:5736957), complete cds. Retrieved April 02, 2010, from http://www.ncbi.nlm.nih.gov/nucleotide/40555766 Huang,J., Lu, J., Barany, F., & Cao, W. (2001). Multiple cleavage activities of endonuclease V from Thermotoga maritima: recognition and strand nicking mechanism. Biochemistry 40(30), 8738-8748. Huang, J., Lu, J., Barany, F., & Cao, W. (2002). Mutational Analysis of Endonuclease V from Thermotoga maritima. Biochemistry 41, 8342-8350. Jlang, R., Palk, D.C., Hankinson, J.L., & Barr, R.G. (2007). Cured Meat Consumption, Lung Function, and Chronic Obstructive Pulmonary Disease among United States. Adults Am J Respir Crit Care Med 175, 798-804. Kanugula, S., Pauly, G.T., Moschel, R.C., & Pegg, A.E. (2005). A bifunctional DNA repair protein from Ferroplasma acidarmanus exhibits O6-alkylguanine-DNA alkyltransferase and endonuclease V activities. PNAS, 102(10), 3617-3622. Li J., Billiar, T.R., Talanian, R.V., Kim, Y.M. (1997). Nitric oxide reversibly inhibits seven members of the caspase family via Snitrosylation. Biochem Biophys Res Commun. 240:419-424. Lin, J., Gao, H., Schallhorn, K.A., Harris, R.M., Cao, W., & Ke, P.C. (2007). Lesion Recognition and Cleavage by Endonuclease V: A Single-Molecule Study. Biochemistry. 46, 7132-7137.

90

Lindahl, T., Karran, P. & Wood, R.D. (1997). DNA excision repair pathways. Curr Opin Genet Dev 7:158169. Liu, J., He, B., Qing, H., & Kow, Y.W. (2000). A deoxyinosine specific endonuclease from hyperthermophile, Archaeoglobus fulgidus: a homolog of Escherichia coli endonuclease V. Mutat Res. 461(3), 169-177. Moe, A., Ringvoll, J., Nordstrand, L.M., Eide, L., Bjoras, M., Seeberg, E., Rognes, T., & Klungland, A. (2003). Incision at hypoxanthine residues in DNA by a mammalian homologue of the Escherichia coli antimutator enzyme endonuclease V. Nucleic Acids Res. 31(14), 3893-3900. Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830102C18 product:hypothetical Endonuclease V containing protein, full insert sequence. Retrieved April 02, 2010, from http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=s equenceDetail&id=AK172181 Povirk, L.F. (1996). DNA damage and mutagenesis by radiomimetic DNA cleaving agents: bleomycin, neocarzinostatin and other enediynes. Mutat. Res. 355: 71-89. Rosenberg, B., Van Camp, L., & Krigas, T. (1965). Nature 205,698699. Sambrook, J., & Russell, D.W. (2001). SDS-polyacrylamide gel electrophoresis of proteins. Molecular Cloning A Laboratory Manual Third Edition. Cold Spring Harbor Laboratory Press, 3, A8.40-A8.51. Saparbaev, M., & Laval, J. (1994). Excision of hypoxanthine from DNA containing dIMP residues by the Escherichia coli, yeast, rat, and human alkylpurine DNA glycosylases. Proc. Natl. Acad. Sci. 91, 5873-5877. Simmons, R.R., & Friedberg, E. (1979). Enzymatic Degradation of Uracil-Containing Deoxyribonucleic Acid - Survival of Escherichia coli and Coliphages Treated with Sodium Bisulfite. J. Bacteriol. 137(3), 1243-1252. 91

Thomason, L.C., Costantino, N., & Court, D.L. (2007). E.coli Genome Manipulation by P1-transduction. Curr. Protoc. Mol. Biol. John Wiley & Sons, Inc. 79:1.17.1-1.17.8. Thompson, J.D, Higgins, D.G., & Gibson, T.J. (1994). CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680. Weiss, B. (2006). Evidence for Mutagenesis by Nitric Oxide during Nitrate metabolism in Escherichia coli. J. Bacteriol. 188(3), 829833. Weiss, B. (2001). Endonuclease V of Escherichia coli prevents mutations from nitrosative deamination during nitrate/nitrite respiration. Mutat Res. 461, 301-309. Yao, M. & Kow, Y.W. (1997). Further Characterization of Escherichia coli Endonuclease V Mechanism of Recognition for Deoxyinosine, Deoxyuridine, and Base Mismatches in DNA. J. Biol. Chem. 272(49), 30774-30779.

92

APPENDIX A LIST OF OLIGONUCLEOTIDES

Table A-1 Oligonucleotide Table

Name EDL379 EDL380 EDL381 EDL382 EDL386 EDL387 EDL388 EDL392 EDL393 EDL407

5-3 Sequence CACCATGGCCCTGGAGGCGGCGGGAGGGCCGCCGG AGGAAA TCAACAAAGTGCTGAGGACTCTCCGGAGTCTCCTTTG GGGCATG AAAAAGCCATATGGCCCTGGAGGCGGCGGGAGGGC TTTGAATTCTCAACAAAGTGCTGAGGACTCTCCGGAG TC GAGGAAACGCTGTCACTGTG AGGGCCGCCGGAGGAAACGC TCAACAAAGTGCTGAGGACTCTCCGG CTACTGCCAGTCCTTGCCCGCCTGC TTTGAATTCCTACTGCCAGTCCTTGCCCGCCTGC AATGGTTAGCAATCATAGTGGCAAGTTGGAGTCAATC GTCTCTCGTTATTC

Description FLJ35220 Forward primer for D-TOPO cloning FLJ35220 Reverse Primer FLJ35220 Forward primer with NdeI tail FLJ35220 Reverse primer with EcoRI tail FLJ35220 Forward primer FLJ35220 Forward internal primer FLJ35220 Reverse internal primer FLJ35220 Reverse primer FLJ35220 Reverse with EcoRI tail Complementary to EDL410

93

Name EDL409

5-3 Sequence GAATAACGAGAGACGATTGACTCCAACTTGCCACTAT GATTGCTAACCATT GAATAACGAGAGACGATTGACTCCIACTTGCCACTAT GATTGCTAACCATT GAATAACGAGAGACGATTGACTCCUACTTGCCACTAT GATTGCTAACCATT GAATAACGAGAGACGATTGACTCCA AATGGTTAGCAATCATAGTGGCAAGTGGGAGTCAAT CGTCTCTCGTTATTC CACCATGGATCTCGCGTCATTACGCCG TTAGGGCTGATTTGCTGTATAGCGCACG [Phos]CGTTGCCGTGTCCTTCGTGAAAGGGGACAGT GTCC [Phos]CCCCCGACCCTCTGCAGACCCGAGAAGGC TGTCCTACTCAGGAGAGCGTTCAC GGTCGTCAGACTGTCGATGAAGCC AAAAAGCCATATGGATCTCGCGTCATTACGCG TTTGAATTCTTAGGGCTGATTTGCTGTATAGCGCACG GAATAACGAGAGACGATTGACTCCIACTTGCCACTAT GATTGCTAACCATT*

Description Undamaged substrate similar to EDL410 except for I/A at the 25th position Deoxyinosine containing substrate for cleavage assays Uracil containing substrate for cleavage assays 25-mer size marker for cleavage product Forms U/G mismatch when annealed to EDL411 E.coli nfi Forward primer for D-TOPO cloning E.coli nfi Reverse primer Forward primer for SDM (D52A) of FLJ35220 Reverse primer for SDM (D52A) of FLJ35220 Reverse sequencing primer for constructs in pMAL-c5X Forward sequencing primer for constructs in pMAL-c5X E.coli nfi Forward primer E.coli nfi Reverse primer Deoxyinosine containing substrate with 3 Phosphorothioate modification to resist exonuclease activity 24-mer size marker for cleavage product Forward primer for SDM (VDGN-AAAA) of FLJ35220 Reverse primer for SDM (VDGN-AAAA) of FLJ35220

EDL410 EDL411 EDL412 EDL413 EDL422 EDL423 EDL426 EDL427 EDL463 EDL464 EDL465 EDL466 EDL472

EDL473 EDL480 EDL481

GAATAACGAGAGACGATTGACTCC [Phos]AGCTCGAGGTCCTTCTTGCGGCTGCAGCCGG GGTACTCCACCACCG [Phos]CAGGGAAGCTGAGCACCACCAGGGAAGCACA AGCGCGGACACTGTCC

94

APPENDIX B PLASMID MAPS

Figure B1. Plasmid map of pET100-Ecnfi

95

Figure B2. Plasmid map of pET100-FLJ35220

96

Figure B3. Plasmid map of pET100-FLJ35220 D52A

97

Figure B4. Plasmid map of pMALc5X-FLJ35220

98

Figure B5. Plasmid map of pMALc5X-FLJ35220 D52A

99

Figure B6. Plasmid map of pMALc5X-FLJ35220 D52A VDGN-AAAA

100

APPENDIX C STATISTICAL ANALYSIS Table C-1 Difference Between Mean Survivals of Cultures With 70M Cisplatin Treatment
Mean Survival With No Damage 690 673 690 692 690 680 690 676 690 672 673 692 673 680 673 676 673 672 Mean Survival with 70M Cisplatin Statistical Significance

Cultures compared

P-value

Wild type AS01 Wild type AS01-Ecnfi Wild type AS01-FLJ35220 Wild type AS01-FLJ35220 D52A Wild type AS01-DlacZ AS01 AS01-Ecnfi AS01 AS01-FLJ35220 AS01 AS01-FLJ35220 D52A AS01 AS01-DlacZ

347 171 347 339 347 323 347 200 347 166 171 339 171 323 171 200 171 166

P=0.04 P=0.15 P=0.25 P=0.03 P=0.04 P=0.037 P=0.03 P=0.27 P=0.12

Significant Insignificant Insignificant Significant Significant Significant Significant Insignificant Insignificant

101

Table C-2 Difference Between Mean Survivals of Cultures With 70M Transplatin Treatment
Mean Survival With No Damage 690 673 690 692 690 680 690 676 690 672 673 692 673 680 673 676 673 672 Mean Survival with 70M Transplatin 504 499 504 500 504 502 504 501 504 488 499 500 499 502 499 501 499 488 Statistical Significance

Cultures compared

P-value

Wild type AS01 Wild type AS01-Ecnfi Wild type AS01-FLJ35220 Wild type AS01-FLJ35220 D52A Wild type AS01-DlacZ AS01 AS01-Ecnfi AS01 AS01-FLJ35220 AS01 AS01-FLJ35220 D52A AS01 AS01-DlacZ

P=0.18 P=0.29 P=0.13 P=0.134 P=0.46 P=0.034 P=0.25 P=0.37 P=0.06

Insignificant Insignificant Insignificant Insignificant Insignificant Significant Insignificant Insignificant Insignificant

102

Table C-3 Difference Between Mean Survivals of Cultures With 10M Nitrofurantoin Treatment
Mean Survival With No Damage 690 673 690 692 690 680 690 676 690 672 673 692 673 680 673 676 673 672 Mean Survival with 10M Nitrofurantoin 347 171 347 339 347 323 347 200 347 166 171 339 171 323 171 200 171 166 Statistical Significance

Cultures compared

P-value

Wild type AS01 Wild type AS01-Ecnfi Wild type AS01-FLJ35220 Wild type AS01-FLJ35220 D52A Wild type AS01-DlacZ AS01 AS01-Ecnfi AS01 AS01-FLJ35220 AS01 AS01-FLJ35220 D52A AS01 AS01-DlacZ

P=0.04 P=0.15 P=0.19 P=0.031 P=0.04 P=0.037 P=0.03 P=0.065 P=0.12

Significant Insignificant Insignificant Significant Significant Significant Significant Insignificant Insignificant

103