-

t .J
COMMITTEE
-
TO EXAMINE SCIENTIFIC CLAIMS MADE
WITH REGARD TO THE BNLA106 EVENT
(GENETIC TRANSFORMATION OF AN ELITE
INDIAN GENOTYPE OF COTTON, Gossypium
hirsutum L.J FOR INSECT RESISTANCE
THE REPORT
AUGUST 2012
-
PREFACE
From the initial stage itself, the members of the Committee were aware that they had accepted
an unenviable assignment. It is never easy to look at the work of colleague-scientists, and to offer
critical comments and report shortcomings, if any, in their work. Naturally, my colleagues and I
personally know several of the scientists involved. In spite of this, I am confident and satisfied that the
Committee has done a fair, reasonable and professional job. I am, therefore, firstly indebted to my
colleagues for carrying out of a somewhat unpleasant task, fairly and without fear or favour. A special
word of thanks to Dr. R.Y. Sonti who prepared the first draft and to Dr B.S.Dhillon and Mr Rajiv
Mehrshi who gave their very valuable inputs that resulted in the final report
-
[ am also thankful to other officers of ICAR, specifically our Non-Member Secretary, Dr. N.
Gopalakrishnan, for ably assisting us in our work. The Committee has already expressed, in the report
itself, its thanks to both the ICAR, and the NARS scientists who participated in the processes of this
Committee.
A special word of thanks is also due to Dr. Imran Siddiqi and Dr. Pankaj Rathore who readily
agreed to assist the Committee, and made a sincere and most useful contribution.
Lastly, I would like to thank the Department of Agricultural Research & Education, specifically
the Hon'ble Agriculture Minister and Dr. S. Ayyappan, DG, ICAR for having faith in us and entrusting
this sensitive task to us.
-----;:;(11 \ It
Prof. . . Sopory' \
Chairperson
Biotechnology, specially agricultural biotechnology, is still somewhat new to India. The project
which gave us BNBt was the first serious public sector effort in India to use biotechnology to develop
bollworm resistant crops. Therefore, not only is the effort rooted in honest intentions, it should also be
appreciated for being the first serious attempt at public sector agricultural biotechnology. Indeed there
were errors, as pointed out in the report, but failures/errors are the obverse side of science, All effort
will not necessarily lead to success, and sometimes the scientists must be lauded for the initiative itself.
I hope the report of the Committee is read in this background, and in this spirit, and that ICARINARS
will not only continue but further enhance their efforts in producing safe biotech crops for the benefits
of Indian farmers.
-
-
-
...
-
-
-
-
-
-
-
-
-
-
-
INTRODUCTION
1.01 The Bt-Bikaneri Nerma (BNBt) cotton variety was developed as a collaborative
effort of NRCPB (National Research Center on Plant Biotechnology), New Delhi, UAS
(University of Agricultural Sciences), Dharwad and CICR (Central Institute for Cotton
Research), Nagpur. The results of this project were published in Current Science, titled
"Genetic transformation of an elite Indian genotype of cotton (Gossypium hirsutum L.) for
insect resistance by 1.5. Katageri, H.M. Vamadevaiah, 5.5. Udikeri, B.M. Khadi and
Polumetla A. Kumar in 2007. According to this paper, Bt-Bikaneri Nerma ['BNLA106'
event] was developed by UAS using shoot apex explants through Agrobacterium mediated
transformation using the cry1Ac gene construct provided by NRCPB. The NRCPB
confirmed integration and copy number by a method called "Southern Analysis'.
1.02 In tests conducted using ELISA, presence of CrylAc protein was detected in the
samples. CICR co-ordinated the bio-safety and multi-Iocational field trials of the material
provided by UAS.
1.03 Upon commercial release, after the due regulatory approval, BNBt variety and the
hybrid 'Bt NHH 44' were cultivated in about 8400 hectares in Khari' 2009. In general,
farmers and state seed agencies complained that performance and yields did not match
their expectations. Further, 'BNBt' seed samples were reported to contain Monsanto's
gene/event. Consequently, ICAR had seed multiplication and commercialization
suspended.
1
-
-
-
-
...
1.04 In this background, ICAR constituted a Committee of the following experts to
examine the research claims made by the team, which authored the Current Science
paper titled "Genetic transformation of an elite Indian genotype of cotton (Gossypium
hirsutum L.) for insect resistance" in the Vol. 93 No. 12, December, 2007 issue of the
journal [P.1843-1847].
-
-
(i) Dr. S.K. Sopory, VC, JNU, New Delhi
(ii) Dr. B.S. Dhillon, VC, PAU, Ludhiana
(iii) Dr. R.V. Sonti, Dy. Director, CCMB, Hyderabad
(iv) Sh. Rajiv Mehrishi, Secretary, ICAR
(v) Dr. N. Gopalakrishnan, ADG (CC), ICAR
: Chairperson
: Member
: Member
: Member
: Non-Member Secretary
...
-
-
-
-
-
-
-
-
-
-
1.05 The terms of reference to the Committee are as follows:
(i) To examine whether the team achieved a separate and distinct event other than
Mon531, which they called BNLA106, and whether there was enough evidence for
a claim to be made that BNLA106 was an event separate and distinct from the
Mon531 event of Monsanto.
(ii) .To examine to the deficiencies, if any, in the entire process of development of the
BNLA106. (BNBt cotton event) and subsequent development, release and
commercialisation of BNBt cotton variety and Bt NHH 44 hybrid.
(iii) To examine whether there were any deficiencies in the various tests done at various
stages to establish the distinctive nature of the BNLA106 event.
(iv) To advise on the appropriate steps to be taken now in respect of the BNLA106
event, and the consequential development of BNBt and Bt NHH 44 varieties,
including identifying the person/s responsible.
(v) To advise appropriate steps and methods that ICAR should put in place to ensure,
in future, the purity of process in the development of genetically modified crop
plants, and the process of vetting scientific claims in this regard, from the point of
.view of having a fool proof system that would put the veracity of the claims beyond
doubt.
2
-
-
-
-
-
-
-
-
-
....
-
-
-
-
-
1.06 The order constituting the Committee is enclosed with this report as Annexure-I
(Pgs. 19-20).
1.07 The paper published in Current Science, titled .. Genetic transformation of an elite
Indian genotype of cotton (Gossypium hirsutum L.) for insect resistance" by Drs. I.S.
Katageri, H.M. Vamadevaiah, S.S. Udikeri, 8.M. Khadi and P o l u m ~ t l a A. Kumar, is
at Annexure-II (Pgs. 21-25).
3
-
-
-
-
-
-
-
-
-
-
-
-
.....
-
-
-
-
-
EXECUTIVE SUMMARY
2.00 Based on available evidence, it appears that an event that is different from MON531
is present in "purified" BNBt. Third party verification is needed to conclusively establish
whether the event in purified BNBt is the same as the event in original BNBt, or not. In the
original material, contamination with MON531 appears to have occurred at UAS, Dharwad
and it appears to have occurred by the T
4
generation. All earlier data obtained from
biosafety studies and field trials with BNBt appear to have been conducted with material
that contained the MON531 event, and thus are invalid. The "purified BNBt", as far as its
biosafety and evaluation studies are concemed, is a new event that must now go through
the regulatory process as a fresh application, if ICAR intends to commercialize it. The
project has been poorly planned and implemented with inappropriate distribution of work
elements. The lack of event specific markers, the now apparent lack of technical expertise
at UAS and a failure to select for the relevant event particularly when another event was in
the field have been major contributors to the present situation.
4
-
-
-
-
-
-
-
-
-
-
-
-
-
-
MEETINGS AND THE PROCESS FOLLOWED BY THE COMMITTEE
3.01 -The Committee had its first meeting on February 22, 2012 in the office of Dr. S.K.
Sopory, Vice Chancellor of the Jawaharlal Nehru University, and reviewed the various
documents that were provided by ICAR to the Committee. It was decided that one team
led by Dr. Sonti needs to visit NRCPB and another team led by Dr. Dhillon would visit
UAS. It was decided that Dr. Sonti would need to be accompanied by another scientist,
and the other scientist identified was Dr. Imran Siddiqi. Accordingly, in terms of para 7 of
the order constituting Committee, it was decided to co-opt Dr. Imran Siddiqi as a member
of the Committee (for the visit and reporting its outcome), with the approval of the
competent authority. The Committee also identified Dr. Pankaj Rathore, a cotton breeder
from Punjab Agricultural University, Regional Station, Faridkot to accompany Dr. Dhillon.
Accordingly, in terms of para 7 of the order of the Committee Dr. Pankaj Rathore was also
co-opted (for the visits and reporting its outcome), with the approval of the competent
authority.
3.02 The team consisting of Drs. Dhillon and Rathore visited UAS on March 23 & 24,
2012 and had discussions/meetings with Dr. I.S. Katageri, Dr. B.M. Khadi, Dr. S.S. Udikeri,
Dr. H.M. Vamadevaiah, Dr. S.S. PatH, Dr. Manjula S. Maralappanavar, Dr. Ravi Hunje, Dr.
H.L. Nadaf, Dr. L. Krishna Naik and Dr. C.P. Mansur. The record of discussion this team
had with scientists in UAS is enclosed as Annexure-III-A (Pgs. 26-48). Further queries
raised and replied to by Dr. I.S. Katageri are at Annexure-III-B (Pgs. 49-54).
3.03 The team consisting of Drs. Sonti and Siddiqi visited NRCPB on March 24, 2012,
and met Dr. Kumar, Director of NRCPB and examined the relevant records. The team also
raised certain queries, in writing, copy of which are enclosed as Annexure-IV-A (Pgs. 55-
56), and the response given by Director, NRCPB to these queries' is contained in
Annexure-IV-B (Pgs. 57-70).
3.04 The second meeting of the Committee was held on March 25, 2012 in the office of
-
Vice Chancellor, Jawaharlal Nehru University (JNU). It was decided that Drs. Sonti and
Siddiqi should also meet Dr. K.C. Jain, former Assistant Director General (CC), ICAR, now
-
5
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
settled in Hyderabad. In his meeting with this group in Hyderabad on April, 23, 2012, Dr.
K.C. Jain indicated that all records regarding BNBt were available with ICAR, that he was
unwell and that he could not recollect issues connected with the meetings pertaining to
BNBl. Dr. K.C. Jain's letter is at Annexure-V (Pg. 71). ICAR may like to take note of the
fact that Dr. K. C. Jain was not forthcoming to the committee in this matter.
3.05 In the meeting of March 25, 2012, it had also been decided that the team consisting
of Drs. Dhillon and Rathore would meet the CICR scientists. Accordingly, Drs. Dhillon and
Rathore met the CICR scientists (Dr. K.R. Kranthi, Dr. Suman Bala Singh and Dr. G.
Balasubramani) on April 5, 2012, in Delhi. The record of discussion with Dr. K.R. Kranthi is
at Annexure-VI-A (Pgs. 72-81); that with Dr. Balasubramani is at Annexure-VI-B (Pgs.
82-84); and record of discussion with Dr. Suman Bala Singh is at Annexure-VI-C (Pgs.
85-86).
3.06 The third and fourth meetings of the Committee were held in the office of Vice
Chancellor, JNU on May 5, 2012 and June 7, 2012, to discuss the matter in detail, based
on the papers provided by ICAR, the interaction at NRCPB, UAS and scientists of CICR,
and replies provided by the scientists of these Institutes. The Committee discussed in
detail contents of its report in meetings held on July 24 and August 25, 2012. The
Committee's conclusions are based on the site visits and discussions with parties
concerned, as well as perusal of relevant documents.
THE REPORT
4.00 The first term of reference to the Committee is to examine whether the team
achieved a separate and distinct event other than MON531, which they called
BNLA106, and whether there was enough evidence for a claim to be made that
BNLA106 was an event separate and distinct from MON531 event of Monsanto.
4.01 The presence of MON531 event in BNBt is so extensive that the only sample of the
original BNBt that is available for analysis is the supposedly "purified" BNBl. The
committee therefore focused its attention on determining whether "purified" BNBt is
6
-
-
-
-
-
-
-
-
-
-
-
-
-
-
different from MON531, and whether the characteristics of "purified" BNBt match with
those described for original BNBt in the Katageri et al., 2007, paper in Current Science.
Specifically, the committee examined the molecular characterization of "purified" BNBt that
has been carried out at NRCPB, and assessed whether the described characteristics of
the event in "purified" BNBt are, on one hand, different from MON531 and, on the other
hand, similar to those described for BNBt by Katageri et al., 2007.
4.02 The committee noted that the molecular characterization of BNLA106 event as
described by Katageri et al., 2007, was minimal. Event specific primers that would have
made a comparison with MON531 fairly straightforward had not been described. This
should have been done by NRCPB, which provided the gene construct, as it has the
requisite expertise. The Current Science paper of Katageri et al. describes Southern
hybridization analysis with one probe (cI}'1Ac) and only one restriction enzyme (Hindi II),
whereas the use of different restriction enzyme - probe combinations would have been
more descriptive of the event.
4.03 During the visit of the committee to NRCPB, Dr. Kumar presented Southern
hybridization analysis data which indicates that when the cI}'1Ac gene is used as a probe,
and plant genomic DNA is digested with Hindi II, a - 7 kb fragment is detected in purified
BNBt, and a 8 kb fragment is detected in MON531. Dr. Kumar also presented data from
flanking sequence information of the event in "purified" BNBt, and event .specific markers
for the same which have now been developed. This analysis is indicative that the "purified"
BNBt event is different from MON531. Furthermore, PCR primers that are directed against
NOS promoter (a unique feature of pBinBt3) and the vector backbone amplify a product of
1.4 kb from the "purified" BNBt, but not from MON531. All of the above evidences indicate
that "purified" BNBt is different from MON531. The Southern hybridization analysis with
"purified" BNBt indicates that a -7kb Hindlll fragment is homologous to the cI}'1Ac probe.
The analysis with original BNBt (presented in Katageri et al., 2007) indicated that a - 7kb
Hindlll fragment is homologous to cl}'1Ac. This would suggest that "purified" BNBt and the
original BNBt may have the same event. However, the fact that the -7 kb fragment
detected in "purified" BNBt is very faint calls for further analysis.
7
-
-
-
-
-
-
-
-
0--'
...
-
-
4.04 However, some other important issues still remain with regard to the
characterization of the event in "purified" BNBt. The complete sequence of this event has
not yet been obtained. Whatever information has been obtained indicates that there has
been significant rearrangement of the integrated DNA during the generation of the event
present in "purified" BNBt as indicated by Dr. Kumar in his letter to the committee
(Annexure-VII; Pgs. 87-88). This raises questions regarding the utility of an event with
such re-arrangements for any sort of commercialization, as it could render expression of
the gene/trait of interest unstable. Most importantly, the sequence of the event that has
been obtained to date does not explain the manner in which a -7 kb Hindlll fragment, that
is homologous to cry1Ac, can be generated in purified BNBt. The complete sequence of
the event in purified BNBt must be obtained at the earliest to clarity this point. The
Committee would also like to record, that a minimum of around 100 independent events
should generally be generated and the best eventls selected for commercialization. A
decision to commercialize, based on a single event was, and would be, ill advised.
4.05 Dr. Kumar has requested that a third party verify the Southem hybridization analysis
of the "purified" event. The committee agrees and recommends independent, third party
analysis to establish beyond doubt whether the "purified" BNBt event is the same as the
original event, which was described in the Current Science paper of Katageri et al. Plant
material for the same is to be provided by Dr. Katageri. Dr. Kumar shall provide plasmids
and information on primers. Complete sequence of the event in purified BNBt must be
obtained by NRCPB at the earliest, and if possible, before the third party analysis. In case
the "purified" event is not established to be an event same as the BNLA106, the validity of
the Current Science paper becomes questionable.
THE PROCESS OF DEVELOPMENT
5.00 The second term of reference to the Committee was to examine to the
deficiencies, if any, in the entire process of development of the BNLA106 (BNBt
cotton event) and subsequent development, release and commercialization of BNBt
cotton variety and Bt NHH 44 hybrid.
8
-
-
-
-
5.01 In hindsight, and to say the least, the project entitled "Bt-transgeni<;: pigeonpea, rice
and cotton for insect resistance" under NATP appears not to have been planned well.
Though Dr. Kumar was the P.1. for the project, the role of the P.1. seems to have been
restricted to providing the gene construct, and subsequently to assist in conducting a few
Southern hybridization analyses. As there was no expertise in UAS in crucial areas such
as homozygosity testing, and development of event specific markers, the teams at UAS
and CICR used two private service providers. In documents provided to the committee by
ICAR, both NRCPB (note submitted to DG, ICAR on 20-10-2011 by Director, NRCPB;
Annexure-VIII-A; Pgs.89-96) and CICR (note on characterization of crylAc in purported
BNLA 106 event submitted by Director, CICR on 18-12-2010; Annexure-VIII-B; Pgs.97-
109) have expressed their doubts about the analysis conducted by one of these service
providers. It would have been appropriate if the critical task of developing event specific
primers was handled by one of the team members who had the expertise for carrying out
such a study.
5.02 'Event specific primers should have been developed for BNBt, preferably by the P.1.
of the project, and used for regular DNA based, event specific purity testing of the plants.
Purity testing should have been done by the team at UAS, or at NRCPB, by getting leaf
material from UAS. Neither did so. Dr Katageri stated that he did not have the technical
skills to carry out such studies, and also was not aware of any methodology to differentiate
various events. However, in the proposal of the NATP it has been indicated that Dr.
Katageri would be responsible for molecular analysis of BNSt. Such DNA based tests
should have also been performed when conducting selection in different generations, and
also during commercial seed production by UAS. Such DNA based testing to assess purity
is also crucial when materials are provided for regulatory studies. This was not done. Not
only did Dr. Katageri not undertake the work assigned to him as per the project proposal,
he did not request for requisite help or guidance, in view of his own admitted inability, from
the P.1. On his part, the P.1. did not perform the duties of overall coordination, monitoring
and filling in the gaps that are normally expected of the P.1.
5.03 Only two Southern positive transformants were obtained in the development of
BNBt; one of which was single copy and the other was multi-copy. As the multi-copy line
9
-
-
-
-
-
-
-
-
was not used further, it meant that only one event was available. This is grossly
inadequate, as a large number of events need to be screened in the event selection trials
to identify the best performing line having commercial potential. It may be added that it is
not impossible to get an agronomically desirable strain from a single transgenic event.
However, its probability is extremely low.
5.04 During the BNBt development programme, selection of desirable plants/progenies
was based on the presence of Cry1Ac protein. This was done in spite of knowing fUlly well
that there was already another event (MON531) in the field, which would also test positive
for Cry1Ac protein. Clearly testing for Cry1Ac protein alone was insufficient, as this would
not preclude presence of the MON531 event. Each generation should have been tested for
the event BNLA106. This was not done.
5.05 RT-PCR analysis done at NRCPB indicates that cry1Ac expression in "purified"
BNBt is significantly less, as compared to expression in MON531 (refer Annexure-VIII-A;
Pgs.89-96). If this is a correlate of effectiveness, BNBt would be much less effective than
MON531. This may be kept in view, if ICAR intends to proceed towards commercialisation
of "purified" BNBt.
5.06 The Committee is of the view that there were indications, prior to commercial
-
release, that BNBt was contaminated with MON531. (Please refer to para 7.05). These
were not formally brought to the attention of the relevant authorities. Neither these
indications were followed up appropriately by the scientist who observed them nor was any
attention paid by others who came to know of them. If the corrective measures had been
-
taken at that time, by those involved in development and commercialisation of BNBt and Bt
NHH 44, the situation that has now arisen could have been avoided.
-
-
-
-
5.07 There seemed to be an extreme hurry to come up with a public sector Bt cotton.
Agronomic evaluation is normally started when strain(s) are nearly homozygous and
homogenous. But in the present case, BNBt was put under field evaluation before the
homogeneity was achieved.
10
-
-
-
-
-
-
-
-
--
5.08 Commercial seed production procedure was not followed, even though there is a
well established procedure in this regard. For example, had the breeders/seed production
scientists been more careful in monitoring, the segregation/admixture for morphological
traits like petal and pollen colour could have been easily identified and red flags raised.
5.09 The P.1. (Dr. Kumar) and Co-P.1. (Dr. Khadi) of the NATP funded project (under
which BNLA106 was developed) were members of the GEAC (Genetic Engineering
Approval Committee), and present in a meeting, when the application for approval of large
scale field trials of BNBt was discussed (Annexure-IX; Pgs.11 0-112). This is a clear case
of conflict of interest and should have been avoided. To avoid repetition in future, ICAR
should issue instructions to its scientists to recuse themselves from the meetings of GEAC
and/or RCGM (Review Committee on Genetic Manipulations) when their own work is
being discussed. The same should apply to other scientists working in NARS.
5.10 There was a clear lack of coordination amongst various cooperating
centres/scientists in the project. This began with preparation ofthe NATP project proposal,
when responsibilities were assigned to Dr. Katageri (and accepted by him) for which
according to his own current statement, he does not have the expertise. Thereafter, in
matters of preparing flanking sequences, testing for purity, proper supervision of breeder
seed production, etc. - the whole range of activities reflect this lack of coordination and
overall guidance.
THE TESTS
6.00 'The third term of reference to the Committee is to examine whether there
were any deficiencies in the various tests done at various stages to establish the
distinctive nature of the BNLA106 event.
6.01 A fundamental flaw in the development of BNBt lies in the fact that there was only
one event. The team should have developed more events before taking one of them
forward.
11
-
-
-
-
-
-
-
-
-
-
-
-
6.02 A positive ELISA test is no evidence for presence of BNLA106 event. The ELISA
test is based on protein expression, and not on the presence of any specific event.
Therefore, it cannot distinguish between BNLA106 and MON531.
6.03 Event specific primers were not developed for BNBt. These should have been
developed, preferably by PI, and used by the team to test for presence of the BNLA106
event.
6.04. The NOS promoter is driving nptll in the pBinBt3 construct. This is a configuration
that is not present in MON531. This unique feature could have been exploited by NRCPB
to develop a PCR assay for distinguishing between BNBt and MON531 even in the
absence of event specific markers. This feature of the construct could have been utilized
by NRCPB during the project but this was not done.
6.05. The Southern hybridization analysis conducted in NRCPB on BNBt is somewhat
limited". Only one enzyme-probe combination was used in this analysis. Additional enzyme-
probe combinations would have provided a better description of the uniqueness of the
BNLA106 event.
FUTURE COURSE OF ACTION
7.00 The fourth term of reference to the Committee is to advise on the appropriate
steps to be taken now in respect of the BNLA106 event, and the consequential
development of BNBt and BtNHH 44 varieties, including identifying the person/s
responsible.
7.01 All biosafety studies and field trials conducted with BNBt and Bt NHH 44 are invalid,
as BNBt and Bt NHH 44 do not have the transgene sequences that they.are purported to
carry in the applications submitted to RCGM/GEAC. If these lines are to be pursued
further, fresh process would have to be made, starting at the level of IBSC (Institutional
Biosafety Committee).
12
7.02 In view of the recent RT-PCR data on BNLA106 from NRCPB (refer para 5.05), the
effectiveness of the event should be assessed before it is entered into the regulatory
process.
7.03 Individual responsibility is normally reflected in the relevant paragraphs of this
report. However, some of these are brought out in the subsequent paragraphs, either
because of their salience, or because they may not have been stated elsewhere in the ..
report.
- 7.04 Dr. Kumar, P.1. of the NATP project, should have been more active in engaging
himself with the activities at UAS. He should have been careful at the time of project
- writing and not allotted molecular biology work to Dr. Katageri. He should also have
ensured the development of event specific markers for BNBt.
-
-
-
-
-
-
-
-
7.05 Dr. Khadi should have been more careful, particularly as he had got the information
from Dr. Kranthi on the presence of MON531 in 2008. In fact, Dr. I(hadi maintained
throughout the enquiry, and even in earlier papers which were circulated to the committee
by ICAR, that he did not know about contamination with MON531, whereas the contents of
his letter dated 4.1.2012 addressed to DOG (CS) (Annexure-X; Pg.113) states otherwise.
In this letter, Dr. Khadi states, in its third paragraph that "After the decision of GEAC on
02.05.2008 regarding commercialization of BNBt, following week of May 2008, Dr. K.R.
Kranthi, HOD, Plant Protection, CICR, Nagpur informed me regarding the Mon-531
contamination I presence in the seeds tested". This indicates that Dr. Khadi was aware of
the problem, at least in May 2008. Crucially, this was before actual commercialization of
BNBt. He further states that "Immediately Hon'ble DOG (CS) and ADG (CC) were informed
regarding the same. Hon,ble DOG (CS) arranged a meeting with all concerned Scientists
and discussed the matter in detail on 21-5-2008 (Ref. F. No.2(1I) 2008 CC-1 dated
29.5.2008)" (Minutes at Annexure-XI; Pgs.114-117). However, in his discussion with the
team that visited UAS, Dr. Khadi consistently maintained that he was not aware of
c o n t a ~ i n a t i o n at that time and the proceedings of the meeting held on May 21, 2008, in
which there is no mention of contamination, are correct. Also, Dr. P. L. Gautam, the DOG
(CS) at that time has denied knowledge of the same and has pointed out to the minutes of
the 21-5-2008 meeting (which are signed by all participants of the meeting; Annexure-XI;
Pgs.114-117) that this matter was not discussed in the meeting (letter of Dr. Gautam at
13
-
-
-
-
Annexure-XII; Pgs.118-124). As indicated above, Dr. Jain, the ADG (CC) at that time has
indicated that he is unwell and does not recollect issues related to the meetings on BNBt
(refer also paras 3.04 and 5.06).
7.06 Dr. Katageri says that he is a conventional breeder and did not have competence
and facilities to discriminate MON531 and BNLA106 events. It is pertinent to note that, in
the NATP proposal, Dr. Katageri is listed as the person responsible for molecular analysis
of the transgenics. If he had no requisite expertise, he should have had the necessary
corrections made in the project proposal, at some stage, or at least later have contacted
Dr Kumar, P.I., or any other expert, for help and scientific guidance in the areas where he
had no expertise. Dr. Katageri should have been more careful in the breeding process
(please refer to para 5.08).
7.07 .Dr. Kranthi conducted analysis which gave him reason to suspect in 2005 and 2008
that samples given to him in fact had MON531. Although these were crucial observations,
he did not give written reports to his seniors. He ventured to put his views down on paper
in October 2009 only after it had become public knowledge that BNBt had been
contaminated with MON531. Moreover, he signed and forwarded as Director, CICR,
Nagpur, the application for registration of BNBt to PPV & FR Authority (the said application
has been subsequently withdrawn).
7.08 Both Drs. Khadi and Katageri, being experienced cotton breeders, should have
conducted selection for the event (BNLA106) by testing each generation for this event,
particularly when another event (MON531) was in the field. However, they continued to
select on the basis of protein expression (please refer to Para 5.04).
7.09 In all likelihood, the "contamination" (may be outcrossing or admixture) with
MON5-31 occurred at UAS. This appears to have occurred not only before Dr. Katageri left
for USA in October 2005, but even before Dr. Khadi moved to CICR in May 2005 as the
seeds that Dr. Khadi took with him were already contaminated with MON531. Also, BNBt
has been 'purified' (recently at UAS) using progeny of plants that were reported to be
multicopy in the T
4
generation (grown during 2005-06). Most of these progeny lines
carried MON531 and very few (5 out of 135) had only BNBt. This is again consistent with
the possibility that, by the T4 generation, BNBt had been contaminated with MON531. It is
14
-
-
-
-
-
-
-
difficult to say whether contamination is deliberate or accidental. However, an accidental
contamination would be difficult to explain as the T
4
plants used for South.ern hybridization
analysis at NRCPB showed BNBt event, while the same material taken to and tested at
Nagpur showed extensive contamination with MON531. Thus, assuming only accidental
contamination cannot account for what has happened. Drs. Khadi and Katageri were the
persons who were primarily responsible for ensuring purity of the material at UAS,
Dharwad.
PURITY OF PROCESS
8.00 The fifth term of reference to the Committee is to advise appropriate steps
and methods that ICAR should put in place to ensure, in future, the purity of
process in the development of genetically modified crop plants, and the process of
vetting scientific claims in this regard, from the point of view having a fool proof
system that would put the veracity of claims beyond doubt
8.01 A project should be planned and executed with utmost care. Further, P.1. needs to
be alert all the time to plug loopholes, if any. All concerned, ICAR and/or Universities,
depending on the involvement of their respective scientists, need to be extra cautious in
the project of such national importance, as the present one.
8.02 The P.1. ofthe project should ensure coordination of all concerned.
8.03 Multiple independently obtained transformants (at least around 100 events) should
be developed and evaluated to identify the best events for any given construct.
8.04 Event specific primersltests should be developed and used for selection of the
event in various generations.
8.05 The breeders who are involved in the project (or a biotechnologist associated with
them) should be able to perform various tests to assess the presence and purity of event
in each generation.
8.06 'Results of testing should be documented and reported in writing. Oral
communication of results to superiors is not sufficient. In fact, ICAR should issue detailed
guidelines to various institutes/Universities in NARS, specially referral laboratories,
15
covering essentiality of written requests, written reports, and maintenance of permanent
record, etc.
8.07 The comparative performance of recipient variety/line and the GM (Genetically
Modified) product should be closely monitored.
8.08 The experimental varieties/hybrids should only be tested after strain/parental line
have achieved homozygosity/homogeneity.
8.09 Seed production should be carried out following laid down procedures, including
rigorous monitoring.
8.10 All issues related to IPR for the gene of interest and other genetic elements on the
transformation construct and the methods of using the same must be sorted out at the
outset of the project, if the ultimate goal is to commercialize the transgenic line that is to be
generated.
8.11 ICAR should issue detailed guidelines regarding the process to be followed in the
development of transgenic crops. At each stage of development, from the acquisition or
utilisation of the gene/construct, to commercial seed production and actual
commercialisation, these guidelines should establish fail-safe gateways that are both
internal to the system, and external to it. The Committee would like to stress that while
third party verification is important from the point of view of objectivity, internal checks and
reviews that insist on scientific rigour, are no less important. The Committee suggests that
ICAR set up an Expert Committee for evolving such guidelines, and have them issued at
the earliest.
8.12. ICAR must abide by agreements signed by its officers/scientists which obviously
cannot be treated as "personal" (Please refer to Para 9.02). In case there is any doubt,
ICAR should seek legal opinion. Equally important is that the concerned officers/scientists
while signing an MTA should ensure that related IPR issues, if any, are not too
complicated to hinder commercialization, in view of the fact that ICAR is fully involved in
applied research.
16
OTHER ISSUES
9.00 The last term of reference to the Committee is to report on any other issue
arising from, or identical to, the issue under examination.
9.01 Conflicts of interest should be avoided when ICAR scientists are members of
regulatory bodies. Instructions regarding this need to be issued, as already stated in para
5.09.
9.02 The cry1Ac gene used in the development of BNBt was developed by Dr. I.
Altosaar of the University of Ottawa. It was obtained by Dr. R. P. Sharma, former Director,
NRCPB by signing a Material Transfer Agreement (MTA) with University of Ottawa. In
2006, as informed by Dr. Kumar, he had tried to negotiate a freedom to operate agreement
with Dr. Altosaar. For reasons that are not clear, this did not materialize. At a meeting in
2006, it was surprisingly decided by ICAR that Dr. Sharma had signed on the MTA in his
"personal capacity", and that a freedom to operate agreement was not necessary at that
stage, and that henceforth the construct would be referred to as a "NRCPB construct".
Copy of the minutes of this meeting is at Annexure-XIII; Pgs.125-127). In the opinion of
the Committee this is a violation of the MTA signed with Dr. Altosaar and, to say the least,
unethical. ICAR should even now take appropriate legal opinion and ensure that a freedom
to operate agreement is in place for various genes obtained from Dr. Altosaar or other
sources. Meanwhile, ICAR should compile information on the crops in which these genes
are being incorporated, and legal opinion on infringement of IPR, or otherwise should
- govern decisions regarding further work on these genes in NARS.
9.03 The MTA with University of Ottawa stipulates that either Dr. Altosaar, or one of his
group members, should be an author in publications that arise from use of the cry genes
provided by him. In this regard, Drs. Sonti and Siddiqi were informed by Dr. Kumar that Dr.
Altosaar was an author in earlier versions of the manuscript that described the
development of BNBt. Dr. Kumar indicated that he had removed Dr. Altosaar's name from
the list of authors of this manuscript after it was decided by ICAR that the construct would
henceforth be referred to as "NRCPB construct". For the same reason, the contribution of
Dr. Altosaar by way of providing the cry1Ac gene is not even acknowledged anywhere in
the Current Science paper. Dr. Kumar indicated that any acknowledgement of Dr.
Altosaar's contribution would go against the ICAR policy decision that this should be
17
considered a "NRCPB construct". Therefore, he removed Dr. Altosaar's name from the list
of authors on the BNBt manuscript, even though he felt that this was ethically incorrect. Dr.
Kumar also provided the committee with an earlier version of the manuscript that had Dr.
Altosaar listed as a co-author, a fact that if needed, can be verified with journal. Based on
the above, the committee suggests that ICAR should think about not taking policy
decisions of this nature that would compromise the ability of its scientists to take ethically
correct decisions.
9.04 In view of the fact that this was considered a project of national importance and
priority, ICAR HQ could have, and should have, interacted more with project scientists to
be able to detect the weakness of the effort on BNBt. It should also have been more alert
and sensitive in its approach to respecting Material Transfer Agreements signed by its
officers.
9.05 In some of its projects, ICAR also has the system of having a Mission Leader. In
the NATP project under question, the Mission Leader was Dr. R.P. Sharma. It is not clear
if he, or his successor, Dr. K.R. Koundal provided leadership to the project. However, the
Committee has refrained from commenting on the role of the Mission Leader because
neither Dr. Sharma nor Dr. Koundal became co-authors of the paper published in Current
Science.
10.00 At the end, the Committee would like to place on record its heartfelt thanks to all the
officers of ICAR and UAS who have interacted with it or have helped the Committee
otherwise in its work by way of secretarial assistance. The Committee would also like to
place on record its appreciation for the co-opted members, namely Dr. Imran Siddiqi of
Centre for Cellular and Molecular Biology (CCMB) and Dr. Pankaj Rathore of Punjab
Agricultural University (PAU) for willingly providing their services and assistance to the
Committee. This report has 13 Annexures which are, in view of the Committee, important
in throwing light on the Committee's recommendations.

(B.S. DHILLON) (R.V. SONTI)
18

(RAJIV EHRISHI)( (
ANNEXURE-I
INDIAN COUNCIL OF AGRICULTURAL RESEARCH
KRISHI BHAWAN: NEW DELHI
F.No.2-11/08-CCI
ORDER
Dated the 18
th
January, 2012
-
-
The Bt-Bikaneri Nanna cotton variety was developed as a collaborative effort
of NRCPB (National Research Center on Plant Biotechnology, New Delhi), UAS
(University of Agricultural Sciences, Dharwad) and CICR (Central Institute for Cotton
Research, Nagpur),...The results of this project were published in Current Science,
titled "Genetic tiansfonnation of an elite Indian genotype of cotton
(Gossypiumhirsutum'L.) for insect resistance by I.S.. Katageri, H.M. Vamadevaiah,
S.S. Udikeri, B.M. Khadi and Polumetla A. Kumar in 2007. According tp this paper,
Bt-BikaneriNenna['BNLA106' event] was developed by UAS Oharwad using shl10t
apex explants through Agrobacterium mediated transfonnalion on the basis of the
Cry1Ac gene construct provided by NRCPS. The NRCPB oonfimled integration and
col!ly number by a method called "Southern Analysis".
2. In tests conducted by CICR referral lab, using ELISA, presence of Bt. protein
was detected in the samples provided by UAS, Dharwad. CICR also co-ordinated
the bie-safety and multi-Iocational field trials of the material provided by UAS,
Dharwad.
3. Upon commercial release, after the due regulatory approval, BNBt variety and
the hybrid '81 NHH 44' were reportedly cultivated in about 8400 hectares (0.08% of
cotton acreage) in Kharif 2009. In general, fanners and state seed agencies
complained that perfonnance and yields did not match their expectations. Further,
'BNBt' seed samples were reported to contain Monsanto's gene/event
Consequently, Indian Council of Agricultural Research (ICAR) had seed
multiplication and commercialization suspended after 2009.
4. In this background, President,.ICAR is pleased to constitute a Committee of
the following experts to examine the research claims made by the team, which
authored the Current Science paper tiUed "Genetic transformation of an elite Indian
genotype of cotton (Gossypiumhirsutum L.) for insect resistance" in the Vol. 93 No.
12, December, 2007 issue of the journal [P.1843-1847].
-
(i) Dr. S.K. Sopory, VC, JNU, New Delhi
(ii) Dr. B.S. Dhillon, VC, PAU, Ludhiana
(iii) '-"'Or. R.V. Sonti, Dy. Director, CCMB, Hyderabad
(iv) Sh. Rajiv Mehrishi, Secretary, ICAR
(v) Dr. N. Gopalakrishnan, ADG (CC), ICAR
19
Chairperson
Member
Member
Member
Non-Member Secretary
!.l The terms of reference of the Committee would be as follows:
(I) To examine whether the team achieved a separate and distinct event other
than Mon531, which they called BNLA106, and whether there was enough
evidence for a claim to be made that 8NLA106 was an event separate and
distinct from the Mon531 event of Monsanto.
(ii) To examine to the deficiencies, if any, in the entire process of development of
the BNLA106. (BNBt cotton event) and subsequent development, release and
commercialisation of BNBt cotton variety and BtNHH44 hybrid.
(iii) To examine whether there were any defICiencies in the various tests done at
various stages to establish the distinctive nature of the 8NLA106 event.
(iv) To advise on the appropriate steps to be taken now in respect of the
BNLA106 event, and the consequential development of BNBt and Bt NHH44
varieties, including identifying the personls responsible.

(v) To advise appropriate steps and methods that ICAR should put in place to
ensure, in future, the purity of process in the development of genetically
modified crop plants, and the process of vetting scientiflCdaims in this regard,
from the point of view having a fool proof system that would put the veracity of
the claims beyond doubt.
(vi) Any other issue arising from, or incidental to, the above.
6. The committee may submit its report within three months of the issue of this
order.
7. The committee may examine scientists and officers of the ICAR as it deems
fit, as well as consultlco-opt other experts in the country that it feels are necessary
for it to do its work.
8. The committee may hold as many meetings, and visits to places concemed
with the development of BNLA106 within India, as it considers necessary, and may
hold its meetings at any such concerned venue within India.
9. The members of the Committee will be entitled to travel by air, as per Govt. of
India rules, from the normal place of residence to the venue of the meetings, as well
as to local transportation and daily allowance permissible to DOG rank officers of
ICAR, and sitting fee payable to non-official members of the Governing Body of
ICAR, as per ICAR norms.
10. Secretarial assistance of the Committee will be provided
t-I . J..... \,J5l' v
(N. GOP.A: AKRISHNANt
Asstt. Director General (CC)
20
ANNEXURE-II
RESEARCH PAPER PUBLISHED IN CURRENT SCIENCE
RESEARCH COMMUNICATIONS
i. R,jvindran, R.
o
Mishra. A. K. and Rao. J. R., On the high sera-
prt'viI]t'IIC(' of oovin(' babl.'siosis in Wdyanad district of Keralil. J.
Appl. Anlm. Res., 2002, 22, 43-48.
8. J., Miranpuri, G. S. and Borkakoly. Incidenc(' of h<lCroato-
roa in bovines in nonheaslecn region of Indi.ll.lndion 1. Porosito!.,
1978,2,137-138.
9. McLaughlin. G. l. et 01., PeR del>clion and typing of parasites. In
Vorosilology (or 1M 11s1 Ct'nlUfY (His OU'I, M. A. and Zia alum,
M.), CAD InlMlation",l. Wallingford, t:"K. 1996, pp. 261-277.
10. RilY, D., &lnsal. G. C. and Duua, B., Purification of imroX'rythro
(yllc piroplasms of Thdlulo annu/aro from infE.'<loo bovine
blood. Indion J. Anim. Sci., 1998, &8, 1167-1168.
11. Samhrook. J., Fritsch. E. F. and ManLarD, T., Molecular Cloning:
1\ Laboratory Manual, Cold Spring Harbor Laboralory, Cold
Sl"ring Hamor, Nf'W York, 1989, vol. 2, PI". 9.16-9.22.
12. Bose, R., Jorgensen, W. K., DalgHesh, R. J., Friedhoff, K. T. and
dto A. J., C:ulTf'nl slalf' and fulurf' in lhf' diagnosis of
babf'Slosls. Vrl. Parasitol., 1995,57,61-74.
13. OIF, Rullf'lin df' L'OFFICF Inlemaliooal Of'S EpiUlOlics, Paris,
2000.
14. CKcio, S., umma, C, OnUINI, M. and Sf'YMnl, c.. Tlw prubulin
gl!'fl(, 01 and TlN!i1uia parasites is an infonnalivl' market'"
for s(lf'cif's di\criminatinn. Int. J. Parasitol., 2000,30, 1181-11R5.
15. 5hami, U. V. and Kurundkar, V. D., OCcurrtf\c(' of B. bovis (8.
argrntino) in a buffalo. Indian Vrl. I., 1981,58,61-63.
16. Gautam, O. P. and Chhabra, M. 0., Babesiosis: RKl!'fl1 .dv"all('S
wilh spial r<'fl."!"cnc(' 10 India. Trap. Vr'. Anim. Sci., 1983, 1,
201-207.
17. Mur;JICC'dharoJfl, K., Zlauddin, K. 5., Gopalas'ollamy, K., Mura-
It'e'dhar, T. and Seshadri,S. J., Some observations on clinical
cases of &bl!'Sia bovis (Babes, 1988) Slarcovlcl, 1893, In buffa-
loes (&balus bubolis}.lndian Vrt. J., 1984,61,76-79.
ACKNOWLEDGEMENTS. Wf' IhaDk Ihe DirKlor, IVRI, Iz.atnagal
for thf' facililie'S prDvidt'd and financial assi$tancl' 10 Ihe first author in
IhE' form of Senior Research Fellowship.
Rf'Cf'ivf'l'l 29 January 2007; rl'viwd acceplf'd 24 OclobH 2007
Genetic transformation of an elite
Indian genotype of cotton (Gossypium
hirsutum L.) for insect resistance
I. s. Katageri
J
, H. M. Vamadevaiahl,
s. S. Udikeri
'
, B. M. Khadi' and
Polumetla A. Kumar
3
,.
IAgricul!ural Rf'SE'arch Siallon, of Agncuhural Sdet'lcf'S,
DharwoMl 580 OOC>, hHH,l
lcenual Inslilule for COllon ResE'arch. Nagpur 44{) 010, India
'Naliooal Re'S!.'arch Centre for Plolnt Biolechnology,
Indian Agricultural In$litule, New Ol'lhi 110 012, India
Agfobacterium-mediated genetic transformation of an
elite Indian genotype (Bikaneri Nerma) of coUon (Gos-
sypium hirsutum L.) was achieved using shoot apical
meristems isolated from seedlings as explants and a
Fnr cOfl"f""opondt>ncp. (prnilll: polumf'da@holffiail.com)
CURRENT SCIENCE, VOL. 93, NO. 12, 2S DECEMBER 2007
synthetic gene encoding CrylAc 6-endotoxin of Bacillus
thuringiensis. Regeneration of shoots was carried out
in selection medium containing kanamycin (100 mg/I)
after co-cultivation of the explants with Agrobackrium
tumefaciens (strain EHA 105). Rooting was accom-
plished on a medium containing naphthaleneacerjc
acid and kanamycin. by T.
plants was grown in and screened for
the presence of neomycin phosphotransferase (nprIl),
and crylAc genes by polymerase chain reaction (peR)
and Southern hybridization. Expression of CrylAc in
the leaves of the transgenic plants was detected by
Xpress strips and quantified by Quan-T ELISA kits
(DesiGen). Insect bioassays were performed with the
larvae of collon bollworm (He/icoverpa armigera).
Field tests of the most promising lines ff2 and T] gen-
erations) were performed under contained conditions.
Results of the field tests showed considerable potential
of the transgenic cotton for resistance against cotton
boUworm.
Keywords: Agrobueterium, genetic transformation, Gos-
sypium hirsulUm, insect resistance, shoot apical meriMem.
COTTON is the most important source of naturaJ fibre. India
is the world's third largest coUon producer. One of the
major limiting factors which affects cotton production in
India, is the incidence of pests, especially bollworms,
causing mOfe than 50% yield 10SSI. The limited genetic
variability for bollworm resistance in cotton landlwild
races makes the task of developing pest-resistant lines
difficult. In the past decade insecticidal proteins of Bacillus
thuringiensis (Bt), a Gram-positive soil bacterium, have
been expressed in cOUon and other crop species by genetic
engineering with significant social, environmental and
economic benefits to the fanners
2
In 2005, Be-cotton ex-
pressing CrylAc protein of Be was cultivated in an area
of 20.0 million hectares in more than a dozen countries,
including India
3
.
Introduction of foreign genes in elite genotypes is limited
by the genotype-specific nature of gene transfer in cotton.
Coker genotypes, which are amenable for regeneration in
viero by somatic embryogenesis, are widely used in genetic
transfonnation experiments-
i
. However, altemate proce-
dures to transform non-Coker genotypes have been re-
porteda--ll. In the present study, we report successful
introduction of 8l<rylAc gene in an elite Indian genotype
of cotton follOWing a modified shoot apical meristem
procedure
9
and significant protection from cotton boll-
worm in field conditions.
Cotton cv. Bikaneri Nerma (Gossypium hirsurum) was
selected of its high commercial value. Bikaneri
Nerma, which is the female parent of the popular cotton
hybrid, NHH-44, is also cultivated as a variety in Punjab,
Rajasthan and Haryana.
Seeds were delinted with sulphuric acid and soaked in
HgCI, (50 rngll) for 30 min and kept for shaking (50 rpm)
1843
21
RESEARCH COMMUNICATIONS
.... ..
-,0"
... p.""'"
E.."tloRJ 1JM:JI1i
I I
pBln9t3
Figure I. Reslricllon map of the binary veclOr pBioBIJ carrying truncated codon-modlflt'd Dl-
cryJAc gene.
in a rotary shaker. Seeds were rinsed three times with
sterile double-distilled water and germinated at 28e in
the dark for 3 days and later shifted to light and dark
(1618 h) rotation to obtain healthy seedlings. Seedlings
(7-8-day-old) grown aseptically on MS medium
J2
, were
used for isolation of shoot apex. Isolation of shoot apex
WilS carried out as described by Gould el 01.
13

Agrobacrerium cumefacieos (EHA 105) harbouring a

bin<lry vector (pBinBtJ) was grown overnight at 28e.
The binary vector carries a codon-optimized crylAc gene
driven ~ y CaMV 3SS promoter (Figure 1). Healthy ShOOI
apices were bisected from apex to base producing two
asymmetrical halves. Both the halves were inoculated
with A tumefadens dilutell (1 : 20) in virulence induction
medium (MS medium containing 2.0% glucose, octopine
100 mgtl and 100 mM acetosyringone) followed by vacuum
infiltration for 5 min. The explants were incubated on co
cultivation medium (MS medium containing 2 mg/I of
benzyl adenine) for 3 days at 22C.
After 3 days of co-cultivation, shoots were transferred
to shoot growth medium (MS medium containing 100 mg/l
myo-ino!>itol, 0.5 mg/I thiamine HCI, 0.5 mgtl nicotinic
acid, 0.5 mg/I pyridoxine HCL and 2% sucrose at pH 5.7)
<tnd incubated in diffuse light at 26 2C for a week, fol-
lowed by shifting to selectinn medium (MS medium con-
taining SA 0.2 mg/I, cefotoxime 400 mgtl and kanamycin,
100 mgfl). Explan15 were sub-cultured on tbe same media
at an interval of one week. Kanamydn-resistant shoots were
excised and rooted on MS medium containing 0.1 mgll,
NAA, 15 gil ~ u c r o s e and 400 mgll cefotaxime.
Rooted plants were rinsed well with fungicide (bav-
is[in, 0.2%) and transferred to pots containing peat, soil
and sand in 1: 1 : 1 ratio. Seedlings were covered with
pl.astic b.ags .and kept in .a plant growth chamber (65%
RH) for two weeks, before shifting to natural conditions
in .a transgenic greenhouse.
Plants were grown in a transgenic greenhouse. Stan-
dard method of selfing was followed and seeds harvested
from the To plants were sown to raise Tt-T
J
generations
in the field.
Genomic DNA!> were iwlated from the plants follow-
mg the procedure of Doyle and Doyle
14
. PCR analysis was
c.arried out to detect the presence of nptII .and crylAc.
Southern hybridization analysis of ffindllJ restricted geno-
mic DNA!> wa!> carried OUI using radiolabelled crylAc gene
(1.9 kb).
1844
Analysis of crylAc gene expression in the leaves was
carried out using Xpress strips (immunodiagnostic) and
Quan-T (ELISA) kits (DesiGen, India), according to the
manufacturer's instructions_
Laboratory bioassays were performed using neonate
and first instar larvae of H. armigero reared on artificial
diet'S. Plants (fl amI T) generations) were raised in open
field conditions with permission of the Department of
Biotechnology and following their guidelines. Natural in-
festation by various pests was allowed by not spraying any
insecticides. Severe incidence of Helicoverpa armigera
during 2003-04 (TJ generation) facilitated analysis of the
protection conferred by the expression of CrylAc.
Agrobuclerium-mediated transformation of cotton was
first reponed by Firoozabady el 01." and Umbeck et ol.s.
Among the genotypes of G. hirsulUm, Coker and Acala
genotypes are amenable for genetic transformation'6 be-
cause of their high regeneration potential. Kumar el 01.
17
have attempted to transfer tbe regenerative competence
from Coker varieties to recalcitrant elite cultivars and de-
veloped a Coker 310FR line which coulll be used for gene-
tic transformation. The transgene from the Coker 310FR
can then be transferred to elite genotypes by conventional
breeding. However, this could also lead to introgression
of undesirahle characters from Coker 310FR. Thus trans-
formation of elite genotypes is desirable. Successful ef-
fons to directly transform elite genotypes by alternate
methods have been reponed.
g

tO
Satyavathi el 01.
11
re-
poned genetic transformation of two Indian genotypes of
cotton using shoot apices from 3 to 5-day-old seelliings.
In the present study, we attempted to transform an elite In-
dian genotype of G. hirsutum by regenerating Agrobacle-
rium-treated shoot apical meristems as described by
Gould et 01.') with minor modific.ations. The modes of
explant preparation ilnd regeneration differ in these re-
pons. In our study the explant was bisected venically and
shoot regeneration occurred from the shoot apical meris-
tern. The transformation efficiency was very low (0.2%)
in contrast to 60-70% reponed earlier
lO
Transformation
effidency was calculated based on pbysical presence of
the tran!'.gene a!> analy!'.ed by peR and its expression by
ELISA and not on the number of kanamycin-resistant
shoots.
The shoot apex explantl; infected with Agrobaclerium
and incubated on the selection medium gave rise to
shoots in four weeks. The explants gave rise to lIark cal-
CURRENT SCIENCE, VOL. 93, NO. 12, 25 DECEMBER 2007
RESEARCH COMMUNICATrONS
T,)ble 1. PlanlSSubjft:led to various analYlicallesls
T. T, T, T
1
(Tl.11)
Analysis Tesled Tested Tested Tested
Kanamycin test 79
'4
peR (nptlI)
7'
12
lICK (cryJAc) 79 12 '65 46 4S (Tl-a) 45 136 136
41 (Tl-lI) 41
Xpress snip lest 79 12 '65 46 170 (Tl..4) 170 917 917
182 (n-II)
18'
Quan-T ELISA 79 12 46 4. 45 (Tl-4) 45 97 97
41 (Tlll) 41
SoUlhl"rn analysis 8
,
Table 2. Jnsen bioiSsays performed wilh waves of normal and T, generatiOn plants of Biuneri Nt'fma
(ON) using firsl instilr larvnat He/{cowrpo armigera
No. of larvae died
Genotype' No. of ft'plic.alions" 24h 48b 72b CorrKted mol1alilY
HI-BN (Tl-4) 50 1
,
47 SO
DI-DN (Tl-II) 50
, ,
46 84
NBt-BN 50 1
, ,
0
.One repliullon mt>ans one la..... a feediog on the leaf disc of the St'lecled plam.
figure 2. Soulh"ll} hybt"l(huliun <illd!})I) o( gl'1l0m1C DNAs re-
S1rictE.'d by HindllJ and probed by radiolabellt'd crylAc (C. Control:
1-8,lransformanls).
luses from which the shoots developed. Shoot growth was
slow and the kanamycin-resistant shoots were excised
and pl",ced on rooting medium after three months. Sev-
enty-nine independent transformed Jines (To) of Bikaneri
Nenna cotton were thus selected from 6520 shoot apex
explanL"i in the presence of kanamycin The leaf slices
C ~ R R E N T SCiENCE, VOL. 93, NO. 12, 2S DECEMBER 2007
from the putative transformants remained green when in-
cubated on medium containing kanamycin (100 mgll).
Analysis by PCR to detect the presence of nplII and
crylAc genes showed that twelve plants were positive
(data not shown). However. these plants were chimeric in
nature. The results were supported by observations made
using Xpress immuntxliagnostic strips and Quan-T ELISA.
The transfonnation frequency is thus very low (0.2%).
The positive plants were carefully nurtured in the glass-
house and seeds were collected from the bolls set from
the selfe<! flowers.
Various procedures followed to analyse the plants be-
longing to To through T) generations have been listed in
Table 1. T1 generation progeny (265) of the twelve PCR
positive plants were raised in the transgenic greenhouse
and subjected to various analyses. About 22 seeds from
each To plant were planted. PCR and Xpress strip testS re-
vealed gene segregation in TI generation; only 46 plants
out of 256 showed positive results in PCR (crylAc prim-
ers) and XPrP"iS strip test. Southem hybridization was
performed with samples taken from eight out of 46 PCR-
positive plants, which belonged to different To lines. The
results showed that there were clear hybridization signals
in only two samples (nos 4 and 6) and the copy number
varied from one to two in the transfonned plants (Figure 2).
Although the other six plants were po!>itive in PCR i:lnd
immunological tests, no hybridization Signals were de-
teeted in the Southern analysis. T1 plants originating from
two To events (T1-4 and Tl-l1) corresponding to South-
ern-positive plants and exhibiting high CrylAc content
1845
RESEARCH COMMUNICATIONS
3.
Insect blooiSsay peorformt'd .... ith INV('S of normal and T
J
geDt'falioo planlS (n-ll) of B1k..lni Nerma using firS( iostar
lan.;w>- 01 H. ormigtra
lnitlall.arv.ll Pl.'t" (('nt Larval Per (('01 Idrv.) Per cent pup.ll urv.1 wi (mg) PU)J'j1
WI (mg) survival 10 pupation survival 10 adults survival 10 aduhs befOft' pupation WI (mg)
BN-8f (Tl- t 1) 1.20 0.0 0.0 0.0 0.0 0.0
J:\NNBr 1.40 84.50 79.10 82.0 159.0 89.2
MECH162 & 1.35 0.0 0.0 0.0 0.0 0.0
Artificial eliel 1.31 90.10 84.50 86,5fl 169.50 110.35
CD(l%) NS 8.01 8.43 10.11 6.93 9.96
CV 6.91 4.47 4.93 8.06 9.29 6.15
-Fihy rep)julklns. each rt>pn>sroling one larva feeding on the leaf disc of the selected plant. WI, Weight.
T.. ble 4. Economic characteristics of nornYl and some SE'leclNl transgenic. Bikaneri Nerma
plants (T1II: T
I
grown in the field
Plant nurnbt'r Sffd coltan TOlal number of No. of squaresl
(code) (gJplam) fruiting points bolls sh<."d Shedding %
698 740 139 47 33.8
692 695 211 63 29.8
643 555 187 63 33.7
70S 565 192 64 33.3
465 S28 185 53 28.6
396 465 157 36 22.9
400 450 142 35 24.6
459 475 161 52 32.2
468 478 183 56 30.6
623 451 179 5'
28.4
638 422 140 50 35.7
656 462
'64
66 40.2
658 479 509 52 24.9
OW 468 185 54 29.1
675 478 192 71 37.0
695 428 164 62 37.8
746 430 214 64 30.0
M".
50S 194 55 31.3
Non-Bc
(mean of 30 plants) 65 166 148 88.0
(2' Ilg/g FW) and inse(..1 prolection (Table 2) were chosen
and selfed. T
1
plants (13,136) were grown in the field and
various analyses were conducted. Plants in the T
2
genera-
tion (rapidly expanding leaves at SO days after planting)
showed high levels of Cry1Ac protein expression as
measured by Quan-T ELISA (1.59 to 2.46 f'glg FW). In
comparison, the levels of CrylAc protein in Mech 162 Bt
ranged rrom 1.04 to 1.82 f'g/g FW.
T) progeny of the T
2
plant (T1-11) was used for insect
bioassay. Insect bioassays with first instar larvae of H.
armigero on leaves collected from 45 to 55-daYo.Qld plants
revealed high degree of larval mortality in T) generation,
similar to that observed with the leaves of a commercial
hybrid MECH-162 Bt (Table 3). Further, PCR aod Quan-
T ELISA analyses of T) generation plants showed the
presence of crylAc gene, which indicated that the T1wll
line was homozygous (Table 1). Southern analysis of five
plants of T
4
generdtion (T-1-11) was carried out and all
the five plants tested positive, indicating the homozygosity
1846
(Figure 3). Observations on morphological characters,
seed cotton yield per plant, boll damage and boll shed-
ding due to natural H. armigera infestation of plants (T)
generation) raised under unprotected condition were made.
The results are presented in Table 4. The mean seed cot-
ton yield of B[-BN homozygous plants was 50S glplant as
agaiost 65 glplant of NBI-BN. The pet ceDt boll sbedding
among B[-BN plants was 31.3, while in NB[-BN plants it
was 88 per cent. The number of well-developed but dam-
aged bolls due to pink bollworm in B[-BN was 1-2 per
plant as against 8-11 in NB[-BN. Fibre parameters such
as micronaire value, elongation, maturity ratio and tenac-
ity were measured in both normal and transgenic plants.
There were no differences among the nonnal and trans-
genic fibres (data not shown).
The results have shown that Cry1Ac protein in the two
transgenic lines of Bikaneli Nerma was expressed at lev-
els higher than that observed in the commercially avail-
able MECH-162 hybrid. It is important to achieve high
CURRENT SCIENCE. VOL. 93, NO. 12,25 DECEMBER 2007
2.4
M
kB
IG.O
u
7.0
6.0
Sot
3. hybcidiLllion analysis of gl:'llomk DNAs of BI
k.:lneri Ncrm<l (Normal and T-4) f('strietro by HlndlJl and probed by
radiolabel1ed crylAc ( ... e, Positive control; -e, Normal (allan; 1-5,
Transgenic plants).
levels of CrylAc expression in cotton tissues. especially
terminal leaves, so as to maintain lethal levels of the
toxin during boll development. Greenplate
18
has carried
out extensive analysis of CI'YIAc protein concentration in
Bt cotton tissues and observed that the toxin levels decline
steadily as the growing season progresses. The high lev-
els of CrylAc observed in our study could be attributed
to the truncated nature of the expressed toxin, while the
hybrids derived from the transformation event 531 (Mon-
samo Co., USA) express the CrylAc protoxin
11

The results also demonstrated that it is possible to

transform elite Indian genotypes of cotton (G. hirsutum)
by adopting Agrooocter;um-sboot apex technique which
has been successfully employed earlier in couon, sun-
flower and maize
U
l.19. The degree of insect protection
conferred by the expression of Cryl Ac protein in trans-
formed Bikaneri Nerma was significant Development of
a Bt-couon hybrid (NHH-44) by utilizing transgenic Bi-
kaneri Nerma, which is the female parent, is in progress.
1. Atwal. G. 5., InSU:l Pnts of Indio and Soulh Easl Asia. Kalyani
Publishers, New Delbi. 1976.
2. Kumar. P. A., Insect pest-resislaol Iransgenic ClOps. In Advonus
in Microbial r.ontrol of InseCT Pes-rs (ed. l"padby.llY, R. K.), Klu-
..... er ACiuwmlc, Ne.... York. 2003, pp.
3. James, C., Global SeQIUS of Commercioliud GM Crops. ISAAA,
Ithaca, 2006. Brid 34.
4. Flrooz.abady, E. Deboer. D. L., Merlo. D. J., Halk, E. L, Amer-
son, L. N., Rashka. K. E. and Murray. E. E., Transrormation 01
cotton (Gossypium hirsutum L.) by Agrobactl!rium tumtfocitns
CURRENT SCIENCE. VOL. 93, NO. 12, 2S DECEMBER 2007
RESEARCH COMMUNICAnONS
and regene'l"ation of transgenic planls. Planl Mol. BioI., 1987. 10,
IDS--U6.
5. embed, P., Johson. G., Barton, K. .lind S..... ain. W. wnetically
transformed carton (Gossypium hin'urllm L) planls. BioITl!chnOo-
logy, 1987,5,263-265.
6. Finer, J. J .lind McMullen, M. D., Transformation of conan (Gos-
SypiliM hirsullim l.) vi.ll parlicle bombardment. Plant Rep.,
1990,8. S86-S89.
7. Chaudhary, B., Kumar,S., Prasad, K. V. S. K., Oio.am, G. 5.,
Bunna, P. K. and Pental. D., Slow desiculion Ie-ads 10 high-
frequency shoot recovery from transformed somatic embryos of
C(ll1on (Gossypium hir.lllwm L cv Cokt"f 110 FR) Planl Cdl
Rep., 2004, 21. 955-960.
8. McCabe, D. E. aod Martinell, B. J., Tr.llnsformalion of elile conan
cultivars via panicle bombardfD('nt 01 mffistems. BiolThnology.
1993, 11, 596-598.
9. Gould, J. H. aDd MagalJanes..cedeno, M., of CaROn
shoot apex CulIUrE" tCl Agrobartl"rum-medialed transformalion.
Plam Mol. Bioi. Rl!p., 1998, 16, i-IO.
lO. Zapala, C., Park. 5. 11., EI-Zik, K. M. and Smith, R. II., Transfor-
mation of a Texas callan culrivar by using AgroboCTerlim and
shoot apex. Thf'or. Appl. Celll!t. 1999,98,252-256.
11. 5alyavalhi, V. V., Prasad. V., Gila Lakshmi, B. and Laksmi Sila.
G., High efficiency Iransformalion prolocol for Ihref' Indian conan
varielies via Agrobocterium fIImefacll!ns. Plan! Sci., 2002. 162,
215-223.
12. Murashige, T. and Skoog. F., A revised medium for rapid gro....th
of and bioassays with lobacco 1is.'1ul" C"uhures. Plry..io/. PlanI..
1962. IS, 473-497.
13. Gould. J., Banister,S., Hasegawa, 0., Fahima, M. and Smith.
R. H., Regeneration of Gossypillm h;rsulUm and G. baroodensl!
from for transformarion. Plant ull Rep., 1991.
10,35-38.
14. Doyle. J. J. and Doyle, J. I., lsolation of plant DNA from fresh tis-
sue. Focus, 1990, 12, 13-15.
15. Chakrabarti, S. K., Mandaokar, A. J., Kllmar, P. A. and Shann,}.
R. P.. Toxicity of lepidopteran specific delta endotoxins of &eO-
Ius lhuringiensis lowalds neonate lafV;l(' of Helicoverpo ormi9f'ro.
J.lnvenebr. Palhol., 1998.72,336-337.
16. Rajasekarao, K., Otlan, C. A. and Clneland, T. E., Tissue culture
and genetic lransformation of COtloo. In GeMtiC Improvement of
Collon (eds lenkins, J. N. Saha, S.), Science Publishers,
field. 2001, pp. 269-290.
17. Kumar, S., Shann.J, P. and Peotal, D., A genetic approach 10 in
vivo regene'l"alion of non-regeflft"ating ennon cultivan'. Plant Cl!1I
Rep., 1998. 18,59-63.
18. Greenplate. J. T., Quantiflutioo of &eillus thllringiensis illSKt
conlrol prolein Cry1Ac avec time in Bollgarq cotton fruit and I('C"-
minals. J. Econ. Enromol., 1999.92, 1377-1383.
19. 5cbrammeijer, B., Sljmons, P. c., Van den Elun, P. J. M. and
Hoekema, A., MerisU"m transfonnalioo of sunflowC!'/" vw Agroboc
tuillm. Plan! ull Rep., 1990,24, 9S1-9S4.
ACKNOWLEDGEMENTS. We grateful to Ihe Nalional Agricul-
tural Technology ProjK.t of the Iodian Couoc.i1 of Agricultural Res-
earcb for finandaI support aDd Dr K. R. Koundal, Project Dirp<lor
Mission Leade'l". NRCPB, IARI, Ne..... Delhi for l'flcouragemenl. The
seniol .lIuthor tbanks Dr Jean Gould, TexIS A&M university, eSA, for
providing training iu gl"lll'lic transformation of COtlOD.
Received 25 January 2006; revised accepted 8 October 2007
1847
1.5
ANNEXURE-III-A
Discussion with Drs. I.S. Katageri, B.M. Khadi, S.S. Udikeri and H.M.
Vamadevaiah on March 23, 2012
2. In your opinion what is the order of these institutions on the basis of their
contribution in the development ofBikaneri Nerma Bt (BN Bt) and 'Bt NHH 44'?
1. NRCPB, New Delhi
2. UAS, Dharwad
3. CICR, Nagpur.
3. What was the seed source ofBN that was used for transformation?
-
-
-
-
-
I.
4.
How was the work on the development of 'BN Bt' cotton divided among the three
institutions, namely NRCPB, VAS and CICR?
a) NRCPB, New Delhi:(Lead centre NATP Project)
(i) Providing gene construct for genetic transformation, conducting
gene integration studies through PCR and southern and other
molecularjmalysis.
(iI) Providing required information on gene construct and molecular
analysis information to RCGM and GEAC for approval.
(iii)Coordination and monitoring the NATP project in terms oftechnical
and financial aspect as a lead centre.
b) UAS, Dharwad: (Cooperating centre ofNATP Project)
(i) Genetic transformation
(iI) Screening and advancement of transgenic material based on ELISA
and PCR results from CICR, Nagpur and NRCPB, New Delhi.
(iiI') Providing transgenic seed material for conduct of RCGM, GEAC,
Environmental safety and Biosafety trials
(Iv) Seed production and Supply
c) CICR, Nagpnr: (Cooperating centre of NATP Project)
(i) Time to time conduct of ELISA and PCR tests of transgenic material.
(iI) Conduct ofenvironmental safety studies of Bt cotton;
(iii) Facilitating to conduct biosafety studies through outsourcing.
(Iv) Making application to RCGM, GEAC and PPV and FR.
(v) Procurement, packing and distribution of Bt seeds received from
UAS, Dharwad.
BN seed material was obtained from CRS, Nanded of MAU, Parabhani for
gelletic transformation studies.
How can you explain the morphological differences in BN Bt and non-Bt BN as
presented in PPV & FR application?
The application was made by the Director, CICR, Nagpur and the
information is available iu the Directorate, CICR, Nagpur only.
-
5. Was the BN used different from F 414?
Not aware ofcharacteristics ofF 414.
6. Was there any variability in morphological traits of the BN used for
transformation?
At the time of transformation studies, morpbological traits were not
ascertained. However, available BN seeds possess variations for pollen
colour.
7. When, where and how the different generations ofBN Bt were raised? &
8. What was the approximate area, number of plants I progenies grown and selected
in different generations in your experiment during different years?
Generation wise seed mnltiplication in BNBt
Year Gene- Population size
ration
2001-02 To 79 plants in transgenic green house.
2002-03 T. Twelve progenies were grown in 84 rows each with different
numbers of rows depending on availability of seeds. Each row
was 6 m length. There was no germination for one progeny.
2003-04 T
2
Only eleven progenies were continued, each with 25 rows.
2004-05 T3 917 plants of AT
1
8-10 based on single copy introgression of
southern analysis were sown in open field under isolation. Seeds
ofBt positive plants were used for RCGM trial during 2005-06.
2005-06 T
4
78 plants selected as homozygous based on Bt strip test were
sown each aboutl5 rows under isolation in an open field. Seeds
of Bt positive plants based on Bt strip test were used for RCGM
trial in 2006-07.
2006-07 T
s
Progenies of 25 homozygous (Based on Bangalore Genie report)
plants were raised in open field under isolation.
2007-08 T
6
Progenies of25 plants were raised in open field under isolation.
2008-09 T
7
Bulk seeds of homozygous plants were used in seed production at
different farms ofUAS, Dharwad under isolation.
2009-10 Ts
Bulk seeds were grown at ARS, Dharwad
9. During the development of BN Bt, was there any trial at that Agric. Research
Station havingBt cotton carrying 'MON 53I ' event?
From 2002-03 itself tbe Bt cotton with Mon S31testing trials were taken up at
ARS, Dharwad regularly.
10. How much was the approximate area and number of plants I progenies under such
Bt cotton (MON 531) at that Research Station farm during different years?
-
-

-
Area
Bt
trials
ARS,
Year Breeding Entomology Pathology Total
(in acres) (in acres) (in acres) (in acres)
2002-03 0.5 0.25 0.25 1.0
2003-04 2.0 1.0 1.0 4.0
2004-05 2.5 1.25 1.25 5.0
2005-06 2.0 1.0 1.0 4.0
2006-07 2.5 1.25 1.25 5.0
2007-08 2.5 1.25 1.25 5.0
2008-09 3.0 1.5 2.5 7.0
2009-10 1.0 1.0 2.5 4.5
2010-11 2.5 1.25 3.0 6.7
2011-12 1.0 0.5 3.0 4.5
Dharwad
under
cotton
at
Details of Bt cotton sponsored trials (breedin!!:) at ARS, Dharwad from 2002 to 2010
No. of
Plot Spacing
Approxim
Season Repn. Rows
D.S. ate
Entries
size (cmxcm)
Area
28
No. of Plot Spacing
Approxim
Season
Entries
Repn. Rows
size (cmxcm)
D.S. ate
Area
2002-03 8 3 6 6m 90x40 01-06-02 ~ a c
2003-04 19+1 2+2 6 6m 90x60 30-06-03
2003-04 7+1 3+3 6 6m 90x60 30-06-03
2 ac
HB
2003-04 9+1 3+3 6 5.4 m 90x60 16-07-03
2004-05 16 2 6 6m 90x60 7-07-04
2004-05 9 3 6 6m 90x60 9-7-04
2004-05 9 3 6 6m 90x60 10-7-04 2 Y, ac
HB
2004-05 37+3 3 3 6m 90x60 19-6-04
2005-06 10+4 3 6 6m 90x60 26-6-05
2005-06 29+1 3 3 6m 90x60 26-6-05
2 ac
2005-06 1+3 5 4 6m 90x60 26-6-05
HB
2005-06 10 3 5 6m 90x60 6-7-0)
2006-07 24 3 6 6m 90x60 4-7-06
2006-07 10 3 6 6m 90x60 4-7-06
2006-07 8 3 6 6m 90x60 4-7-06
HB
2006-07 12 3 6 6m 90x60 4-7-06 2 Y, ac
RCGM
2006-07 18+2 3 6 6m 90x60 12-7-06
2006-07 11+1 3 6 6m 90x60 12-7-06
2006-07 8 3 4 6m 90x60 13-7-06
2006-07 7 3 4 4.8 m 90x60 3-8-06
2007-08 12 2 6 7.2 m 90x60 7-7-07
2007-08 26 3 6 6m 90x60 2-7-07
2007-08 26 3 6 6m 90x60 2-7-07
2007-08 II 3 6 6m 90x60 2-7-07
2 Y, ac
2007-08 7+1 3 6 6m 120x60 2-7-07
HB
2007-08 II +1 3 6 6m 120x60 2-7-07
HB
2008-09 20+2 3 6 6m 90x60 12-7-08
2008-09 18+2 3 6 6m 90x60 12-7-08
2008-09 23+1 3 6 6m 90x60 12-7-08
HB
2008-09 4+2 4 6 6m 90x60 12-7-08
HB
3 ac
2008-09 20 3 4 6m 90x60 12-7-08
HB
2008-09 6 4 6 6m 90x60 12-7-08
HB
2008-09 35+1 3 6 6m 90x60 24-7-08
HB
-
-
-
2008-09 35+1 3 6 6m 90x60 24-7-08
HB
2008-09 5+2 3 6 6m 90x60 24-7-08
HB
2009-10 25+3 3 6 6m 90x60 18-6-09 I ac
2010-11 14 3 6 6m 90x60 4-7-10
2010-11 4 5 6 6m 120x60 4-7-10
HB
2 Y, ac
2010-11 II +1 3 6 6m 90x60 4-7-10
2010-11 15+1 3 6 6m 90x60 4-7-10
2010-11 6+2 3 6 6m 120x60 5-7-10
2011-12 24 3 6 6m 90x60 23-6-11 I ae.
II. Were your experimental material in different generations grown in a plot having the
required isolation, i.e., 50 m?
All experimental material in different generations were grown with a minimum
isolation distance of 50M.
12. Was there any possibility of contamination of your material with MON 531 event
during the advancement of generations?
A minimum of 50M isolation distance was maintained in all the generations
between BN Bt and Mon 531 experiments. However, the possibility of
contamination may not be ruled out due to the activity of honey bees near
vicinity, handling of material by labourers I field assistants during harvesting,
storing, ginning, cleaning etc.
13. How did you select the material for advancement of generation? On the basis of
presence of your event or on the basis ofexpression of Cry protein?
Advancement of generations was made as follows:
To- TI - Tz: Based on expression of Cry 1 Ac.
T
z
- T]: Based on PCR and southern.
T] - T4 : Based on expression of CrylAc (Bt strip test)
T4 - T
5
: Based on expression of CrylAc (Bt strip test) and Homozygosity test
report of Bangalore Genie Private Ltd., Bangalore.
T
s
- Ts: : Based on expression of Cry1Ac (Bt strip test)
T
s
- Ts: Seed production, not carried out any tests.
14 In your opinion, was there any deficiency in follow up of procedure in course of
development of BN Bt?
There was n't any deficiency in transformation methodology hut the procedure
to differentiate between BN Bt event and Mon 531 event was not known to us.
15. Was there any methodology available during that period to differentiate events
MON 531 and BNLA 60I (BN Bt event)?
No methodology to differentiate different events of CrylAc was known to us at
that juncture.
16. Which institution identified MIs Awasthagen for outsourcing and who signed the
"30
agreement?
Dr. Anand Kumar, Director, NRCPB, New Delhi suggested to outsource for
analysis of flanking sequences of BN Bt event through MIs Avesthagen. Order
was placed from CICR, Nagpur.
17. Was the information supplied by MIs Awasthagen regarding flanking sequence,
event specific primers of BNLA 601 event etc., correct and working?
Test not carried out at Dharwad and report was sent to Dr. Anand Kumar,
Director, NRCPB, New Delhi.
18. When did you knowthat the infonnation supplied by MIs Awasthagen was not correct?
Came to know only after the complete molecular analysis of purified BN Bt hy
Dr. Anand Kumar in October, 2011.
3\
-
-
-
-
-
-
-
-
-
-
-
19. What were the steps taken to rectifY the procedure in the development of BNLA 60 I
event after knowing that the information supplied by MIs Awasthagen is not
correct?
Dr. Anand Kumar identified new flanking sequences of BNLA601 event
through molecular analysis.
20. Was the non-Bt BN check in different RCGMlGEAC trials same or different from
that of BN used for transformation?
The quantity of non BN Bt seed was limited, hence, seeds of other sources was
also used as check in RCGM and GEAC trials.
21. Dr BM Khadi, When did you carry BN Bt materials from UAS, Dharwad to CICR,
Nagpur? Please specify the generation and quantity of the material. Did you carry
only this material or some other material also? What was done with this material at
CICR?
The BN Bt material of about 35-40 seeds was obtained from VAS, Dharwad.
This material was of 2004-05 produce (f3). This material was used to compare
with CICR transgenic material at CICR, Nagpur.
22. Dr Khadi, was the breeding work shifted to CICR Nagpur from UAS, Dharwad
after your joining at CICR?
No Sir, the conversion of elite varieties and parental lines ofUAS and State was
continued at UAS, Dharwad. And conversion of nationally important varieties
and parental lines of hyhrids was initiated and continued at CICR, Nagpur.
23. Dr Khadi, do you think, there was contamination or something else happened?
Where and when there was possibility of contamination? Please be specific about
the time when you came to know about contamination?
Yes Sir, I believe it is only due to contamination. I really don't know whether
contamination was intentional or natural. The contamination must have
occurred at Dharwad. It is rather difficult to specify the time of contamination.
I was informed about the contamination 2-3 months before the DDG(CS)
meeting (Dec, 2009), and immediately this was brought to the notice of the
concerned scientists.
24. Dr Khadi, did Dr. K.R. Kranthi inform you about contamination? If yes, when?
Yes Sir, Dr Kranti informed, which may be 2-3 months before the DDG(CS)
meeting held during Dec, 2009.
25. Dr Khadi, in the documents supplied to us it is stated again and again that Dr
Kranthi informed you about the presence of Mon 531 during 2005 and 2008?
No Sir, if it was informed about Mon 531 contamination, I would not have
proceeded to promote and would have stopped immediately at that juncture.
26. Dr Katageri, did any other scientist help you or you alone looked after the work at
UAS throug/!out?
Until 2004-05, work was monitored by Dr. B.M. Khadi who was CCPI of the
project. Dr. H.M. Vamadevaiah and Dr. S.S. Udikeri were also helping as they
were associates of this project. Field assistants, SRF's, Skilled helpers and
labourers were helping in various field and laboratory work. In 2005-06,
32-
sowing was done in my presence and selfing was also done until I was there. I
was relieved on 27
th
sept, 2005 and returned on 4
th
April, 2006. During this
period I handed over the charge to Dr S.S.Patil(Principal Scientist(Cotton) and
Head), ARS Dharwad as per the University order(No.AOlEst-III/886.C/0S-06
dated 21-9-2005). I handed over the details of the material, list of operations
and observations to be taken. Further with office order No.PSIEST/4691200S-
06 dated 27
th
Sept 2005 Dr. Manjula MaraIappanavar (Assst Cytogenetist) was
asked to look after the Bt cotton work. From April 2006, I continued handling
the material with the help of others.
27. So Dr Katageri, you went to the USA for training from October 2005 to ApriI2006?
Sir, I went to Texas A & M University, USA from Aug, 2000 to Nov, 2000 for
training under Dr. Jean Gold on apical metistem genetic transformation
technique. From Oct 2005 to April 2006, I went to UK on Common wealth
academic staff fellowship.
28. When does cotton flower and is harvested at Dharwad ?
Flowering starts in August (If sown during June) and September (If sown in
July) flowering continues until harvest or as long as sufficient moisture
available in the soil Harvesting will be generally completed by Feb-March, for
the crop sown during Juue-July.
29. Is it easy to detect segregation for petal colour?
Yes Sir, It is easy to detect petal colour segregation.
30. What is the petal colour of BN and BN Bt?
As per the seed production guideHnes for NHH-44 cotton hybrid, the petal
colour of BN is cream and petal colour of BNDt is also cream.
31. Did anyone of you notice segregation in petal colour, anther colour, plant height,
susceptibility to sucking pests in different generations and seed production plots of
both BN Bt for its use as a variety and parent of the hybrid till2008?
No variations. with respect to petal and pollen colonr and plant height were
noticed. However, Dr. B.M.Kbadi Director, CICR, Nagpur after his visit to
Surat, suggested to observe for any variations in poDen colour. After critical
observations presence of plants having cream petal with yellow pollen and few
plants having cream petal with cream pollen were also observed. Therefore
plants having cream petal with cream pollen were discarded.
32. Dr Katageri, if something went wronglhappened T:YT. generation, then why was it
not detected during the advancement of generations up to T
s
and seed production
plots before commercialization?
I was not aware of anything wrong that happened in BN Bt event until 2009.
33. How (we mean by open pollination in isolation or by selfing) and where did you
produce seed of' BN Bt' during 2008?
BN Bt seed was produced in different research stations belonging to UAS,
Dharwad under 50 M of isolation during 2008.
-
-
-
-
-
-
-
-
...
-
-
-
34. What was done to the seeds of BN Bt received from CICR during 2008?
It was not used in further any other programmes.
35. Did any of your other colleagues/collaborators/test centres inform UAS/CICR about
variation for petal colour before commercialization?
Director, CICR,Nagpur on his visit to Surat, received feedback on variation in
pollen colour and the same was communicated to Dr. I.S.Katagei.
36. Did you get information about segregation for other traits before
commercialisation?
The BN Bt variety was uniform with respect to all other characters even
including petal colour. However, few plants having cream pollen instead of
yellow were observed.
37. Dr Khadi, so you got input about variation from your collaborators/test centres at
Surat, what action/corrective measures did you take?
During my visit to Cotton Research Centre, Surat, Scientist informed me about
variations in pollen colour and the same was informed to Dr. Katageri for
further needful.
38. Dr Kartageri, please explain in details the corrective measures yon took?
No variations with respect to petal and pollen colour and plant height were
noticed. However Dr B.M.Khadi Director, CICR,Nagpur suggested to observe
for any variations in pollen colour. After critical observations presence of
plants having cream petal with yellow pollen and few plants having cream
petal with cream pollen were also observed. Therefore plants having cream
petal with cream pollen were roughed out.
39. Should not one have grown plant-to-progeny testing to clean up the material?
Plant to progeny row was followed for maintaining the uniformity.
40. Why was commercial seed production taken without taking any proper corrective
measures (growing plant-ta-progeny)?
Plant to progeny rows were also maintained with no variations for plant height
and petal colour.
41. When did you come to know about contamination of BN Bt with MON 531 event?
Dr. Anand Kumar Director NRCPB New Delhi informed in Aug, 2009 about
the presence of Mon-531 based on his field sample survey.
42. When talking about purification, when did you identify the plants carrying BNLA
60I event and how?
It was possible to identify BN Bt plants not carrying Mon-531 in Jan, 2010.
The plants were identified based on PCR test, by using Mon 531 specific
primers. The plants which did not show presence of Mon 531 were tested with
primers designed for Cry 1 Ac. The plants negative for Mon 531 and positive
for Cry lAc specific were identified.
34
-
43. Details of number of seeds/plants tested, their generation, and the results of the
tests, i.e., how many plant were +ve for both MON 531 and BN Bt, +ve for MON
531 and -ve for BN Bt, -ve for MON 531 and +ve for BN Bt, and -ve for both?
The details of PCR test carried out is mentioned in the table below
Year
No. of plants Mon 531 Cry lAc
of Generation
Testine:
screened +
-
+
-
2009 Tg
(Standing crop) ) 587 587 0 587 0
2010 T6
(plants raised from old seeds 135* 130 5** 135 -
of 2007(T5) produce of five
progenies with multiple Bt
types)
-
-
-
-
,
10-10-09 74 25-10-091 75 11-11-09\
112-10-09 32 . 26-1 0-09! 20 ! 11-11-091
* Only 135 old seeds germmated out 0[6200 sown
** cryJAc positive but negative[or Mon 531
Details ofPCRconducted at ARS, Dharwad during.l!!1rific;:;ati"'o"=n'-r _
I Date B Date R Date B.- Date B
117-08-091 04 115-10-091 08 ! 29-10-091 10 !14--11-091 12 1 10-02-101 24 1
i24-08-09jjD20-1 02-11-09 08 i14--02-10 i 03 i
108-09-09! 18 123-1O-09! 75 ! 05-11-091 15 !17-11-09! 12 I 24--02-10 I 22 i
13
105-10-09: 48 125-10-091 23 ! 10-11-091 49 :23-11-09: 03 : 23-03-10: 28 i
07 . 25-03-10 03'
, i. ! I ! 29 1
28
-
01
-
10
1 32 1
19
-04--10
1
20 .
114-10-09026-10-09\ 04 119-04-10 I 04 I
44. How many plants were selected from that T
3
materials?
It was not theT3 plants used for purifICation but for purification, T
s
generation
field grown plants and T
s
generation old seed material were used.
45. How many T
J
plants with multicopies were raised during 2oo9? What was the
segregation pattern for MON 531 and BNLA 601?
Progenies of five multiple Bt plants of 2007 produce was screened by raising in
2010. Since germination was poor, segregation pattern was not noted; however
Mon 531 negetive but with cry lAc positive plants were identified.
46. Did Mabyco-Monsanto approach UAS, Dharwad or CICR, Nagpur to complain
about the presence ofMON 531?
Mahyco - Monsanto did not approach or complain UAS, Dharwad about the
presence ofMon - 531.
35
47. Who prepared the application for submission to RCGM and GEAC?
Applications to RCGM and GEAC were prepared by CICR, Nagpur.
48. Why the application was submitted to RCGM and GEAC without carrying out all
the required tests and purification of BN Bt?
At tbe time of making applications for RCGMlGEAC, the problem of
contamination was not known.
49. Was th'e gene construct used to develop BN Bt was developed by NRCPB, New
Delhi or obtained from some other source?
Gene construct was supplied by NRCPB, IARI, New Delhi.
50. We understand that the construct was obtained from Prof. IIIimar Altosaar. Why
that was not acknowledge in 'Current Science' paper on BNLA 60 Ievent?
The crylAc gene construct was received form NRCPB, New Delhi
51. Where, when and by whom the work of transfer of BNLA 60 I event to genotypes
other than BN was undertaken?
Transfer of BNLA601 event was intiated from 2005-06 at CICR, Nagpur under
the supervision of Dr(Smt) Sumanbala Singh. Similarly same activity was
initiated at VAS, Dharwad during 2006-07 under the supervision of Dr
I.S.Katageri.
52. What is the fate of above materials? &
53. So, those are also positive for MaN 531?
About 587 plants of BN Bt tested during 2009 were found Mon53! positive. As
the same material was used in back c ~ s s breeding programme, all tbe material
generated seems to be Mon 531 positive.
54. It is stated in a meeting held under chairmanship of DOG (CS) on May 21, 2008
that "The chairman pointed out that Dr Kranthi was an entomologist and therefore
the results should not be taken seriously. He also asked Dr Kranthi not to carry out
any further molecular testing of the samples and only to carry forward the
commercialization process with full zeal, adhering to all instructions laid out in the
proceeding"
Dr Khadi, you attended this meeting? What do you remember about this meeting?
Yes Sir, No Such statements were made by DDG(CS), The road map for
commercialisation of BN Bt was discussed in the meeting.
Other collegues: You also attended this meeting, what do you remember about this
meeting?
To the best of our knowledge and remembrance, no such statements were
made by DDG(CS), ICAR, New Delhi in that meeting.
55. Dr Khadi, you said that you did not get any information on the presence of MaN
531 event in your material, i.e., BN Bt before the meeting held on Dec 10,2009.
Your comment on the light of above statement in the meeting held on May 21,
2008.
If I remember correctly, I came to know about contamination 2-3 months
before the Dec, 2009 meeting called by DDG(CS).
56. Did Dr Kranthi mention in that meeting about the problem of presence of MaN 531
in BNBt?
Presence of Mon 531 in BN Bt was mentioned in the Dec:, 2009 meeting by Dr
Kranthi
57. How was the performance ofBN Bt in seed production plots?
Performance of BN Bt in seed prodnction plots at different research stations of
UAS, Dharwad was satisfactory.
58. Was the seed production suspended due to segregation or presence of MaN 531?
In the meeting held on 10-12-2009 at NRCB, New Delhi under the
chairmanship of DDG(CS), the seed production of BN Bt was suspended due to
the presence of Mon 531.
59. Did you visit the seed production plots ofMAHABEEJ? What was the report about
segregation? Please make available the reports submitted to UAS/CICR.
A team of Scientists constituted by UAS, Dharwad along with Scientists of
CICR, Nagpur visited and submitted detailed report(copy of report endosed)
60. Did you receive any complaint about segregation from indenters other than
MAHABEEJ? Did you visit the plots ofother indenters?
There were no complaints from others.
61. Do you know Dr Manssor and Dr Surendra?
Yes Sir, We know both ofthem, who are working in the university.
62. Do they have any clash of interest with you?
We do not have any dash of interest with them and We have never come doser
to them so far.
63. Once again, did you carry out any test on the presence or absence of cry lAc and
MaN 531 and BNLA 60I; and if not why?
Test for crylAc expression was carried out from To to Ts generation through
ELISA and Bt Strip test. Test for presence or absence of Mon 531 was carried
out from 2009 after knowing about the contamination.
-
-
-
-
-
SdI-
(l.S KATAGERI)
SdI-
(B.M.KHADI)
SdI-
(S.S UDlKERI)
SdI-
(H.M.VAMADEVAIAH)
REPLY TO THE QUESTIONS ASKED BY ENQUIRY COMMITTEE ON
BNBt
Dr.S.S.PatH, ARS, Dharwad
Q 1) When Dr Katageri was away during 2005-06, were you Head of the
Cotton Research Station? We understand that the charge of the
development of 'BN Bt' programme was given to you?
Ans: Yes, I was Head of the Research station, Dharward during 2005-08. As
Head of the Research station, I facilitated Dr.Katageri to get relieved on time
and proceed for his training abroad during 200S.The responsibilities of different
activities of Dr. Katageri were allotted to different scientists as follows:
a) Breeding material and TMC projects- Dr. S. S. Patil, Principal Scientist and
Head, ARS, Dharwad
b) Laboratory activities- Dr. RM. Vanadevaiah, Biochemist, AICCIP, ARS,
Dharwad
c) Bt. Cotton activities- Dr. Manjula S. Maralappanavar, Asst Cytogeneticist,
ARS, Dharwad
The highly specialized and advanced programme of Bt cotton being
developed by Dr.Katageri and his team maintained as a confidential research.
The details of the programme and experiments were not shown to us. Hence as
desired by Dr.Katageri the charge of his Bt. Cotton research programme was
given to Dr.Manjula on paper only, while all the detailed handling of the
material was done by his team members, Mis. Anita Bandari, Research
Associate and Mr.Basavraj Tegginhalli who was managing his programme.
Q 2) As Head of Cotton Research station after Dr Khadi left VAS,
DharwlJrl, what were your duties in 2005-06?
Ans: As Head my duties were to execute different developmental programme of .
the station and to provide required support to all the scientists and enable them
to carry out their research programme.
Q 3) Did you visit the research plot having material on BN Bt
development?
Ans: No, Before Dr. Katageri left, much of the flowering was over and
Dr,Katageri never took me to field after my taking charge as Head and hence I
had not seen the material before he left. As mentioned earlier during his training
period Dr.Manjula and I gave support to his team in the form of handling labor
bills and management. As desired by Dr.Katageri, during the remaining short
period of the crop we did not get into the trial for seeing the material.
Q 4) Was required isolation was kept in experiment on BN Bt?
Ans: During land allotment care was taken to maintain isolation distance in
different programmes.
Q S) At Cotton Research Station where BN Bt development was going on,
were there any 'Bt' cotton material (i.e., MON 531) other than BN Bt? Ifso
approximate number of entries and approximate area under them? What
was the isolation distance?
Ans: During different years, private Bt hybrid trials were conducted where the
hybrids carried Mon 531 event. Every year care was taken to maintain 50mt
isolation distance between these trials and other breeding programme.
Q 6) How was the generation advanced: by selfing or only open pollination
in isolation?
Ans: During 2005-06, Dr.Katageri had handled the material during flowering
and he is the right person to answer this question.
Q 7) Did you observe or get information about any segregation for
morphological traits in the BN Bt material?
Ans: I have not visited the field and hence I do not have any idea about this.
Q 8) Did you report about the confidentiality of programme (that you are
not able to visit experimental plot of BN Bt) to your seniors?
Ans: When Dr.Khadi left Dharwad and handed over the charge of Principal
scientist and Head of the campus to me, the complete charge of Bt research
programme was handed over to Dr.Katageri without associating me or
Dr.Manjula in it. The details of this arrangement were submitted to the
University. To honor the views of Dr Khadi the then Director CICR Nagpur and
the wish of Dr.Katageri, the confidentiality of this Bt programme was
maintained and continued.
Q 9) Are you aware of petal colour of 'BN'?
Ans: No.
Q 10) MAHABEEJ reported the presence of yellow and cream colour
petals in the ratio of 50: 50? What are your comments about this?
Ans: According to my view, the percent of off type plants (segregation) seen in
MAHABEEJ plot depends on the percent of off type plants present in the
previous season and the dominance relationship between the alleles responsible
for different petal colors.
-
-
-
-
-
-
-
-
-
-
Q JI) Were you involved in the development and seed production of BN
Bt?
Ans: During my tenure as head, I provided all the required facilities and support
by strengthening biotechnology lab, establishing green house, generator set, lab
fumitures, air conditioners, equipments etc., To this extent I am involved in
helping the programme ofBN Bt cotton.
Signature: sd/-
Place: Dharwad
Date: 16.4.2012
40
.../
REPLY TO THE QUESTIONS ASKED BY ENQUIRY COMMITTEE ON BNBt
Dr.Manjnla S. Maralappanavar, ARS, Dharwad
Q 1) Were you involved in development or seed production of 'BN Bt'?
Ans: I was involved in the standardization of genotype independent
transfonnation protocol in the tissue culture laboratory. To this extent I was
involved in development of BN Bt cotton programme for standardizing
transfonnation protocol.
Q 2) We understand that during the absence of Dr Katageri (2005 - 2006),
you were the inchrage of research programme on BN Bt. What is your
contribution during that period, i.e., your activities?
Ans: During 2002 I joined for my Ph.D. From this point onwards I was
detached from the BN Bt programme. In 2005 even though I joined back cotton
research station, I was kept away from BN Bt programe. While leaving
Dharwad, Dr.Khadi handed over the entire charge of BN Bt programme to Dr.
Katageri. Further the papers published during 2007 in current science and paper
presented at WCRC, USA(2007) do not include my name proving this fact.
While Dr. Katageri left for his training during 2005-06, though the charge
of Bt cotton programme was given to me, as per the wish of Dr.Katageri, the
details of materials was not shown in the field and the details of field plan were
not given to me. The peak flowering period was over before Dr. Katageri left
Dharwad. All the detailed handling of the material was done by his team
members, Ms. Anita Bandari Research Associate and Mr.Basavraj Tegginhalli
who were managing his programme.
My contribution during the absence of Dr.Katageri was to give the
required support to his team (Ms. Anita Bandari Research Associate and
Mr.Basavraj Tegginhalli) for managing the crop in the last few days as peak
flowering was already over and help to settle the financial issues like labour
bills.
Q 3) How many times you monitored/undertook the pollination and other
field operations particularly harvesting? We understand that you worked
on cotton transformation. Did you work on transformation of BN for the
development of BN Bt?
Ans: By the time Dr.Katageri left peak flowering was over. The material was
not shown in the field and the detailed field plan was not handed over to me. As
desired by Dr.Katageri the harvesting was taken by his team members (Mis.
Anita Bandari Research Associate and Mr.Basavraj Tegginhalli) Upon his
return from USA, Dr. Katageri never approached me for his material as it was
-
-
-
-
-
-
-
-
-
-
-
under the custody of his team which proves my non- involvement in harvesting
of the material during his absence.
Q 4) Did you hear or observe variation in experimental plot of BN Bt?
No.
Q 5 Did you receive any certificate from Dr Khadi for the recognition of
your work in the development of BN Bt?
No.
Signature: sdl-
Place: Dharwad
Date: 16.4.2012
Replies to the Questions on BN Bt-Cotton by Dr Ravi Runje
1. Were you involved in seed production of 'BN Bt'?
Not involved in seed production of BN Bt, but requested to co-ordinate the seed
production ofBN Bt by special Officer (Seeds).
2. Where was the seed production programme ofBN Bt undertaken?
The Seed Production of programme of BN Bt was undertaken on 17 University Research
Stations/Farms.
3. Had you visited seed production plot ofBN Bt?
Visited seed production plots of BN Bt at ARS, Mundgod and ARS Soundalaga once
along with Dr. 1. S Katageri and Mr. Eshanna.
4. Had you observed any segregation for petal colour or any other morphological trait in the
seed production plot?
I have not observed.
5. What was the performance ofBN Bt in seed production plot?
General appearance was good.
6. Was there any team for monitoring of seed production of BN Bt?
No.
7. Did any team member(s) give you information about segregation?
No.
8. Did Dr Katageri visit seed production plot? Ifso, how many times (approximate)? Did he
observed variation? If so, what remedial measure taken to remove any off-types?
Visited Seed Production plots, but I do not know how many times.
9. In your opinion whJl seed production ofBN Bt was suspended?
I do not know.
43
-
-
-
-
-
-
Replies by Dr HL Nadaf, Special Officer (Seeds) to the questions raised by Dr.Baldev
Singh Dhillon on Bt-cotton .
1. Were you involved in seed production of 'BN Bt' and 'Bt NHH 44'?
In the capacity of Special Officer ( Seeds), I facilitated in seed
production of BN-Bt and Bt NHH44.
2. Who actually carried out seed production of BN Bt and Bt NHH 44?
From Seed Unit, Dr.Ravi Hunje co-ordinated the seed production of
BN-Bt & BT NHH44 under the supervision of concerned cotton
scientists.
3. What was the source of seed to carry out seed production of BN Bt during 2008?
The source of Seed for seed production of BN-Bt during 2008 was
from the concerned Cotton Scientist, ARS, Dharwad.
4. Was there any problem of variation in two seed production plots of BN Bt, i.e., seed
production of variety BN Bt and that of its plots sown as parent ofBt NHH 44?
I am not aware of such variations in seed production plots of BN-Bt
and parent of Bt NHH44.
5. Was there any segregation for petal colour?
I am not aware of the segregation for petal colour.
6. Did you observe or anyone inform you about the segregation for petal colour or any
other character in seed production plots?
I did not observe and no one informed me about the segregation for
petal colour or any other character in seed production plots
7. Did monitoring team(s) visit the seed production plots ofBN Bt?
The cotton scientists only monitored the seed production plots ofBN-
Bt.
8. Did Dr Katageri visit seed production plot? If so, how many times (approximate)?
Did he observed variation? If so, what remedial measure taken to remove any off-
types?
Dr.I.S.Katageri visited the seed production plots along with his fellow
colloquies 3-4 times. Few off type plants were observed by them which
were removed at the time of their visits.
44-
9. Which class of seed of BN Bt was produced during 2oo8?
Since it was only pre-release multiplication it was truthful seed
production during 2008.
10. Were you satisfied with the yield potential of BN Bt?
The crop stand and boll bearing was normal but I left the Seed Unit after
my transfer from there before harvest of the crop.
11. Why seed production programme ofBN Btand Bt NHH 44 was suspended?
It seems there was contamination of other events in BN-Bt and
hence seed production of BN Bt and Bt NHH44 were suspended until
further clarifications.
-
-
-
-
-
-
-
Following are the reply on the discussions had with Dr. L. Krishna Naik,
Special Officer (Seeds) from Dec.2008 - July 2010, Director of Extension
Education up to Dec. 2010 and Director of Research from Nov.2011 on
March 24, 2012
Q 1) Were you associated with the seed production of 'BN Bt' and 'Bt NHH 44'?
- No. The season was over by the time I took the change of Special Officer
(Seeds) (Dec.2008).
Q2) Did you visit seed production plot ofBN Bt and that ofBt NHH 44?
- No.
Q 3) Did anybody inform about variation and rouging in BN Bt?
- No.
Q4) Was there any serious problem of variation?
- Not aware.
Q 5) Did Dr Katageri visit seed production plot? If so, how many times
(approximate)? Did he observed variation? If so, what remedial measure
taken to remove any off-types?
- This was not brought to the notice.
Q 6) What class of seed of BN Bt was produced and supplied to ClCR
Nagpur?
- It was 11... only.
Q 7) You said it was TL seed and you informed about that to CICR not to
use the seed for hybrid seed production of Bt NHH 44. Please confirm. If it
is so, can we get relevant correspondence?
- It was 11... only because BN Bt was not notified variety and was just than
developed.
Q 8) You have worked as special Officer (Seeds) when seed of BN Bt and Bt
NHH 44 were produced, and then Director of Extension Education and
Now you are Director of Research. You may be aware of the fact of Dr
Katageri proceeding on training in 2005-06. Do you remember to whom the
responsibilities of looking after the material was given in Dr Katageri
absence, name and designation of the scientist(s) responsible for BN Bt
46
development programme in the absence of Dr Katageri from Oct. 2005 to
ApriI2006?
- The issue concerned to in charge arrangement of Dr.I.S. Kargeri while
proceeding on training during 2005-06 is not known to me. However, as
per the office records obtained from station Head and the arrangement
was as follows. Copy enclosed.
Q 9) We understand that Dr SS Patil and Dr Manjula did not see eye-to-eye
with Dr Katageri and both these scientists did not take interest or monitor
work. Any comment.
- It is difficult to comment as I had no association with the Scientists
working then in the station.
Q10) In such scenario, should the need of Station (Dr SS Patil) should have
informed the senior about the manner in which he and Dr Manjula
performed their duties due to inter-personal relationship.
- In this regard the official attachment with respect to responsibilities
entrusted to the official should answer.
Signature: sdJ- 16.4.2012
-
-
-
-
-
-
X)tscu'ssion wlUt Dr CV Mansur. Professor-of Agronomy Ott i\{arch 24. 2(l12
.
r
l.

'1.
2.
J.
Are you-wotkinG in dcpartme'nt ofOAS. please'!
\'ourdesignmlonplease?
Do you ha'o'e good knowledge Plant Breeding and
-
-
-
-
ANNEXURE-Uf-B
ADDITIONAL INFORMATION RECEIVED FROM Dr. I. S. KATAGERI
Query # 1: How was the "purification" of Bn-Bt carried
out. What is the population of plants used, and over how
many generations has the purification taken place?
Query # 2: What are the primers used to separate the MON531
and BNLA106 event during the process of "purification"?
There has been mention of thousands of peR being done by
UAS, Dharwad especially for identifying purified event
containing BNBt plants. Information regarding the
chronology of experimentation, population size, primers
used, results etc. need to be provided.
It was possible to Identify BN Bt plants not carrying Mon-531 in Jan, 2010. The plants were identified
based on PCR test, by using Mon 531specific primers. The plants which did not show presence of Man
531 were tested with primers designed for Cry 1 Ac. The plants negative for Man 531 and positive for
Cry lAc specific were identified.
The detans of PeR test carried out Is mentioned In the table below
Vearof No. of plants
Man 531 Cry lAc
Testing
Generation
screened
+ -
+ -
2009 T.
(Standing crop) )
587 587 0 587 0
2010 T.
(Plants raised from old seeds
of 2007(T,1 produce of five
135 130 5 135 -
progenies with multicopy Bt
types)
Only 135 oldseeds germmated out of6200sown
crylAc positive but negotlve for Man 531
Multiple Bt types: In 2006, homozygosity test was done by MIS. Bangalore Genie for BN Bt. Out of 78
plants tested, 25 were homozygous, 24 were heterozygous, and 18 were multicopy Bt. Seeds of only 25
homozygous plants were further used. Rest of them was rejected. Five progenies of multicopy Bt were
however sown in 2006-07 but their seed was not used. 50 this old seed was used to screen. Plants
negative for Man 531 but positive for crylAc were identified.
Respected sir
Information for your queries is mentioned here
1. How did Bangalore genie identifY multi-copy Bt plants. Did they perform Southerns11t is
difficult to identifY multi-copy plants by PCR, unless they did qPCR analysis using a single
copy gene as a reference.
They perfonned semi-quantitative PeR using the STR-<lpecific primers. These are the primers
which used to give semi-quantitative PCR results reproducibly and They used to do only 25
cycles of PCRs using limited genomic DNA. Also, the windows of errors were huge as any data
between 0.8 and 1.2 were considered as single copy and 1.7 to 2.3 were considered 2
copies.AIl conclusions were made based on experiments repeated :uimes.
2. What are the aylAc specific primers that you used?
cry 1Ac specific primers for 1kb that were designed Dr Dr.AnandKumar
With regards
Katageri
50
-
-
-
-
-
-
-
-
-
-
Dear Sir
Following is the formation
Was there a reason for choosing an sTR instead of single copy gene for this analysis?:
Sir, we were not sure about the method to be followed at that time. This method was decided by
the firm.
How many copies were adjudged to be present in the lines from which Bn-Bt was ultimately
repurified?
The material that was used for re purification was adjudged as multicopy Bt by Bangalore Genel
Can you send me a timeline, in terms of the years in which different generations (starting from TO/Tl
until T7/TS) were grown. This will give the committee, in a nutshell, the chronology of the
development and repurification of BnBt.
Generation wise information was Enclosed
Yours sincerely
Katageri
Dr.!. S. Katageri,
Principal Scientist (Cotton),
Agriculture Research Station,
Dhmwadfarm, Dharwad-580007
INDIA.
Mobile: +919448822266
Office: 0836-2741092
51.
Generation wise seed multiplieation in BNBt
Year Gene- Population size
ration
2001-02 To 79 plants in transgenic green housc.
2002-03
TI Twelve progenies were grown in 84 rows each with different
numbers of rows depending on availability of seeds. Each row
was 6 m length. There was no germination for one progeny.
2003-04
T2 Only eleven progenies were continued, each with 25 rows.
2004-05 T, 917 plants of AT, 8-10 based on single copy introgression of
southern analysis were sown in open field under isolation. Seeds
ofBt positive plants were used for RCGM trial during 2005-06.
2005-06 T. 78 plants selected as homozygous based on Bt strip test were
sown each aboutl5 rows under isolation in an open field. Seeds
of Bt positive plants based on Bt strip test were used for RCGM
trial in 2006-07.
2006-07 Ts Progenies of 25 homozygous (Based on Bangalore Genie report)
plants were raised in open field under isolation.
2007-08
T6 Progenies of25 plants were raised in open field under isolation.
2008-09 T
7
Bulk seeds of homozygous plants were used in seed production at
different farms ofUAS, Dharwad under isolation.
2009-10 Ts Bulk seeds were grown at ARS, Dharwad
-
-
Dear Sir
Following is the information
Answer to queries.
1. The materials and methods section of the Current
Science paper indicates that T3 generation of plants were
grown in the 2003-04 growing season. The table that you
have sent me indicates that T2 generation was grown in
the 2003-04 season. Can you please clarify? If necessary,
please revise your table.
Sir, the generation raised in 2003-04 was T2 only.
2. You had indicated earlier that Bangalore Genei has
done homozygosity test in 2006. Was this done in January
2006? What was the generation of plants that was used for
PCR based homozygosity testing by Bangalore genei? If the
table is being revised, please indicate the correct
generation as per revised table.
Homozygosity test was done in May-June, 2006 by
Bangalore Genei. T4 generation plants were used for
this test.
3. The Current Science paper indicates that Southern
analysis was done on T4 plants. In which year and month
was this analysis done?
Southern analysis was done at NRCPB New Delhi.
Records may be available at NRCPB New Delhi
4. The Current science paper indicates that Southern
analysis in T4 generation was done on T-l-ll plants. Your
table indicates that in T3 generation, 917 plants
belonging to T-1-8-l0 were advanced further. Does it mean
that progeny of T-l-ll, on which Southerns were done, had
not been advanced further?
Tl-ll is nothing but Tl-8-10
5. You had indicated that in 2009, you had found that T8
standing crop contained only MONS3l. What was the month
of testing? I presume that this crop grown during the
2009-10 season.
August- November, 2009
6. You had indicated that plants containing cryIAc and
5"3
not containing MONS31 were identified in January 2010.
Does this mean that old seeds (6200 in number) of multi-
copy Bt containing TS generation were grown in the 2009-
10 season? What was the reason to grow them during 2009-
10 growing season?
Old seed was sown January, 2010 green house fur
screening only
7. When did you first come to know that BnBt had been
contaminated with MONS31?
August 2009
Yours sincerely
Katageri
Dr.IS. Katageri,
Principal Scientist (Cotton),
Agriculture Research Station,
Dharwad farm., Dhanuad-580007
INDIA.
kfobile:+919448822266

-
-
Request for infonnation to be made available during visit of sub-committee
to NRCPB on 24
th
March 2012
The details of the gene construct and plasmid vector provided by Dr. Ananda
Kumar to UAS, Dharwad is to be provided. This information should include the
sequence of the vector and it's restriction map.
Was this vector and gene construct developed at NRCPB? If not, what is the
source of this vector? Was this vector obtained via an MTA? Is a copy of the
MTA available?
Is-there a single Hindlll site within the T-DNA of the binary vector provided by Dr.
Ananda Kumar? Is Southern analysis with Hindlll digested genomic DNA
expected to reveal a junction fragment of BnBt (BNLA106 event)?
The Southern blots presented in Kategeri et al 2007 (Current Science) and the
recently conducted Southern blots on purified Bn-Bt are be presented to the
committee. Would original lab records from the earlier analysis and the recent
analysis be available? Are the old DNA samples still available?
How was the sequence of the flanking DNA and vector DNA sequence at the
integration site established with the purified BnBt event? Was this outsourced or
done 'in-house'? The details of this recent work need to be provided? How is this
different from the earlier work done by Avasthagen?
The newly obtained sequence of the BnBt event that shows the flanking DNA
and vector DNA sequence at the integration site is to be made available. Can a 7
kb Hindlll fragment, that encompasses the Cry 1Ac gene in the event, be
predicted by analysis of this sequence?
Have the newly developed "event specific primers" been used with old genomic
DNA from the 2007 work (if that DNA sample is available)?
How as the "purification" of Bn-Bt carried out. What is the population of plants
used, and over how many generations has the purification taken place?
What are the primers used to separate the MON531 and BNLA106 event during
the process of "purification"? Where were these primers developed? There has
been mention of thousands of PCR being done by UAS, Dharwad especially for
identifying purified event containing BNBt plants. The details of the
55
methodology, chronology of experimentation, population size, primers used,
results etc. need to be provided.
What is the evidence to show that the BNLA106 event is on the same
chromosome as MON531?
56
-
-
-
-
. ~
ANNEXURE-IV-B
Report of the visit of Dr. Ramesh V. Sontl (RVS) and Dr. Imran Siddiqi (IS)
to NRCPB on 24"' March 2012
RVS and IS met with Dr. P. Ananda Kumar (PAK) on 24/3/12 at NRCPB. New Delhi to discuss his and
NRCPB role and contribution in the development of BNBt cotton and the issues resulting from the
same. PAK made a technical presentation describing his contribution and subsequent follow-up work
in the light of questions that have been raised on the connection between BNBt and the paper he
co-authored (corresponding author) in Current Science reporting on the development of novel Bt-
transgenic cotton. He also provided a written response to a list of questions that had been
communicated to him earlier by RVS with regard to his work relating to BNBt cotton. The
information provided by PAK and the related discussions are summarized below.
1. PAK presented data from the Southern hybridization analysis in the Current Science paper and his
recent Southern hybridization studies with purified Bn-BT. In the recent study he has also included
the MON-531 material. This study indicates that the Dharwad event is different from MON-531. Dr.
Ananda Kumar also presented data from flanking sequence information of the Dharwad event and
development of event specific markers for the same. This analysis also indicates that the Dharwad
event is different from MON-531. Dr. Ananda Kumar also requested that a third party verify the
Southern analysis. The committee agrees with same. Some grey areas in the analysis were pointed
out by PAK. These have to do with details about the event and will shed further light on the nature
of the integration and are to be carried out. Further characterization of line no. 23 (purified Bn-BT)
is in progress in PAK's laboratory with respect to the sequence of the insert which is expected to
further establish its relationship to the construct pBINBt3 that was used for making the transgenic.
Conclusion: Prima facie, it appears that the Dharwad event in the purified Bn-Bt, and presumably the
original Bn-Bt, is different from MON0531
Recommendation: Third party analysis of Southern hybridization. Dr. Veluthambi of Madurai
Kamaraj University has experience of performing Southern hybridizations with plant material. He
may be contacted by ICAR for this 'service'. Alternatively or in addition, CDFD Hyderabad may also
be requested to carry out the analysis. Plant Material to be provided by Dr. Katageri. PAK to provide
plasmids and information on primers. ICAR to facilitate the same.
2. PAK has provided MTA signed in 1996 by Dr. R. P. Sharma, then Director, NRCPB, with Dr. Altosaar
of U. of Ottawa (Annexure II provided by PAK). He indicated that he tried to negotiate a Freedom to
Operate agreement with Dr. Altosaar which attempt was unsuccessful. He also provided the minutes
of a meeting held on 5-10-2006, chaired by DOG (CS &H) and proceedings recorded by Dr. Mauria
(ADG,IPR), which indicated that the MTA "may not be considered as an agreement at the national
level" and that the said CrylAc construct should be called "truncated CrylAc toxin gene from NRCPB,
New Delhi". In the meeting "it was also decided that the freedom to operate analysis as desired by
University of Ottawa in email correspondence with Dr. P. Ananda Kumar is not required at this
stage". Subsequent to the same, PAK removed all references to Dr. Altosaar from the Katageri et
Current Science paper. The earlier version of the manuscript which had Dr. Altosaar as a co-author
was provided by PAK. He also indicated that the same can be verified from the journal.
3. PAK indicated that he was in no way connected with commercialization, breeding work and
biosafety analysis of Bn-Bt. PAK also indicated that he has never received any seed material of Bn-Bt
at any point. All his analysis has been conducted with leaf material, either sent or brought {by Dr.
(
atageri) from UAS, Dharw d. He was in no way connect . the outsourcing of work to
wasthagen for flanking sequence analysis of Bn-Bt. All of this was taken care y ClCR.
Conclusion: If indeed PAK has not received any seed material of BN-Bt, the contamination with
MON-531 would have to have happened outside NRCPB.
4. PAK does not agree with the sequence of events indicated by the proceedings released by ICAR
regarding the meeting on December 10
h
2009 which refer to earlier meetings (particular the May
21" 2008 meeting). He prOVided a draft minute ofthe meeting circulated by Dr. K. C. Jain of the
December 10'" meeting. He categorically denies that contamination with MON-531 was discussed in
the meeting held on May 21" 2008 by DOG (CS). He also denies haVing been informed at any time
prior to September 2009 by either Dr. Kranthi or Dr. Khadi that contamination with MON531 had
occurred.
The documents provided by PAK are handed over to the committee (list of the same enclosed).
58

-
-
-
~ .
-
-
-
-
-
Documents provided by NRCPB to sub-committee of 50pory Committee that visited NRCPB on 24'"
March 2012.
1. Response to queries of sub-committee with thirteen annexures that contain the requested
information.
2. Letter of Dr. P. Ananda Kumar to Dr. Ramesh 50nti, member of the committee, requesting that
certain information and documentation be placed before the committee. This includes the following:
a. a note regarding the so-called proceedings of the meeting on December 10'" 2009 related to BN-
Bt variety that were not proceedings.
b. A note pointing out that Dr. Kranthi had numerous oppurtunities to indicate that the Bn-Bt that
was released has MON-531 event.
c. Draft proceedings of the meeting held on 10-12-2009 which was sent by ADG (CC) to members for
.comments. This draft is in variance to that released in response to RTI application.
d. Proceedings of the meeting on BN-Bt that was conducted by DOG (CS) on 21-5-2008. These
proceedings are not in consonance to the events that are described in the "proceedings of Dec. 10'"
2009 meeting" released in response to RTI application.
e. A letter dated June 16'" 2011 addressed to DOG (C5) indicating that certain modifications be made
to the draft minutes of a meeting held on April 27'", 2011.
3. Earlier draft of Katageri et al manuscript which indicates that I. Altosaar was listed as an author of
this paper.
4. An additional note pointing out deficiencies in the proceedings of the Dec. 10'" 2009 meeting.
5. A listing of further work that needs to be done with regard to molecular characterization of the
Bn-Bt event.
Genome walking in TDNA part ofBNBt Event
(from March 30,2012 to April 18, 2012)
-
-'
InteRration pattern of crylAc-pllinBt3 in cotton Renome in RNBt event
Genome walking has been performed in T-DNA starting from the Left and Right
borers simultaneously (as indicated by arrows). The complete sequence of RB,
Nos-promoter, nptll and nos-terminator are available intact. The sequence from
LB, CaMV 35 S promoter, crylAc (1000bp) are available intact.
i). Further walking beyond nos-terminator is in progress.
ii). Further walking beyond 1000bp of crylAc is in progress.
Sequence information available so far indicates that the selectable marker gene
cassette and crylAc gene cassette (except the uncharted terminator region) as
exist in pBinBt 3 seems to have been integrated undisturbed. Further sequencing
will indicate if the terminators are intact or deleted or rearranged.
-
-
-
Genome walking in T-DNA part of BNBt Event
(from March 3D/April 18, 2012 to June 1, 2012)
--- .plll a)IM EEEJ----
--
Integration pattern of crytAcpBlnBt3 In cotton genome In BNBt event
The sequences obtained so far and which were found intact are given below:
WALK-I:
Primer Sequence: CGCTCACTGCCCGCTTTCCA (pBinl9 6965-6983)
>061-IV177_6965-3_SP6-B07.abl
GGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTC
cloning vector
6965
GCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAA
sequence between crylAc and nptlJ gene cassettes
TCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCCAAAGACAAAAGGGC
GACATTCAACCGATTGAGGGAGGGAAGGTAAATATTGACGGAAATTATTCATTA
AAGGTGAATTATCACCGTCACCGACTTGAGCCATTTGGGAATTAGAGCCAGCAAA
ATCACCAGTAGCACCATTACCATTAGCAAGGCCGGAAACGTCACCAATGAAACC
ATCGATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGTTTGCCTTTAGCGTCA
GACTGTAGCGCGTTTTCATCGGCATTTTCGGTCATAGCCCCCTTATTAGCGTTTGC
CATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACCGGAACCGCCTCCC
TCAGAGCCGCCACCCTCAGAACCGCCACCCTCAGAGCCACCACCCTCAGAGCCGC
CACCAGAACCACCACCAGAGCCGCCGCCAGCATTGACAGGAGGCCCGATCTAGT
AACATAGATGACACCGCGCGCGATAATfTATCCTAGTrTGCGCGCTATATrTTGTT
nos lelminalo..
TTCTATCGCGTATTAAATGTATAATTGCGGGACTCTAATCATAAAI\ACCCATCTCA
TAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAG
AAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTT
TATTGCCAAATGTTTGAACGATCGGGGATCATCCGGGTCTGTGGCGGGAACrCCA
sequence between 1I0S tenninalor and nptTI
CGAAAATATCCGGAACGCAGCAGATATCGCGGTTGCATCTCGGTCTTGCATGGG
7842
>022-IVI77_6965-3_SP61-F04.abl
7746
TTTGACGATCGGGGATCATCCGGGTCTGTGGCGGGAACTCCACGAAAATATCCGA
sequence between nos and npll/
61-
A C G C A G C A A G A T A T C G C G G T G C A T C T C G G T C T T G C C T G G G C A G T C C ~ C G C C G A C G
C C G T T G A T G T G G A C G C C C N G C C C G A T C A T A T T G T C C ~ T C A G G A T C G T G G C G T T G T
GCTTGTCGGCCGTTGCTGTCGTAATGATATCGGCACCTTCGACCGCCTGTTCCGCA
GAGATCCCGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATC
nplll
CAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCG
GTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGA
ACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCG
CTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTC
GCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGG
TCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCA
CCATGATATTCGGTAAGCAGGCATCGCCATGGGTCACGACGAGATCATCGCCGTC
GGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGC
TCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTC
GCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCCGGATCAAGCG
TATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAG
ATGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTC ~ 7 3
WALK II: crylAc
Primer Sequence: GTTCGCCGGCTTTCCCCGTC (pBinl9 6581-6562)
>036-IVI77_6581-3_SP6-G06.abl
GCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTAACCCA
GCACCTGGCACGAACTCGCTGAGCAGAAACTGTGTCAAGGACAAGGAGATGTCG
CrylAc
ATGGGAGTGTAACCGGTTTCAATGCGTTCTCCACCAAGTACTTCAACTTCTGGGTT
ACTCAAGCAGTTGTATGGAATGCATTCGTTGATGTTTGGGTTGTTGTCCATGGATC
CCCGGGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGT
358 promoter
CTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACA
TCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTC(11I ICCACGATGCTCC
TCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGAT
GGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTA
TCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGG
ATATTACCCTTTGTTGAAAAGCCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCT
TTGATATI-TTTGGAGTAGACAAGCGTGTCGTGCTCCACCATGTTTGACGAAGATTT
TCTTCTTGTCATTGAGTCGTAAGAGACTCTGTGTGAACTGTTCGCCAGTCTTTACG
GCGAGTTCTGTTAGGTCCTCTATTTGAATCTTTGACTCCATGGGGA\ II (' '1C IGllC
CGTn(!TT I AC c\.\( Ull 'G IC,,\CTGUGAAAACCCIGGCGTTAUCAAC I L\ \ I, '(it
CTTGC\GCACXJ(t:CC'Cl'ITCCiCC\GCT(i{,CGT;\:\T\G('(i,\\(u\(;" (;( .\CI (,\
rCGCCCTTCCC\\(' ,\(, Inil 'CiC ,\GITTG:\:\'l GC,UiCCC(;CTCCTTf <., i,TT I CT IC
CCrrCCITIC ICG,,( !\('Ci,; I U.I(:GGCTTTU'CC(; lC\G{: I(TAA;\ I(,;(;C;(,CCI, C
CI'1'6538
Primer sequence: CCCAGAAGTTGAAGTACTTGGTGG (crylAc 54-78)
-
-
-
-
-
-
-
'-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
G C T C C G G C C G C C A T G G C G G C C G C G G G A A T T C G A T T ~ C C C A G A A G T T G A A G T A C
cloning vector
TTGGTGGAGAACGCATTGAAACCGGTTACACTCCCATCGACATCTCCTTGTCCTT
crylAc
GACACAGTTTCTGCTCAGCGAGTTCGTGCCAGGTGCTGGGTTCGTTCTCGGACTA
GTTGACATCATCTGGGGTATCTTTGGTCCATCTCAATGGGATGCATTCCTGGTGCA
AATGAGCAGTTGATCAACCAGAGGATCGAAGAGTTCGCCAGGAACCAGGCCATC
TCAGGTTGGAAGGATTGAGCAATCTCTACCAAATCTATGCAGAGAGCTTCAGAGA
GTGGGAAGCCGATCCTACTAACCCAGCTCTCCGCGAGGAAATGCGTATTCAATTC
AACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAACT
ACCAAGTTCCTCTCTTGTCCGTGTACGTTCAAGCAGCTAATCTTCACCTCAGCGTG
CTTCGAGACGTTAGCGTGTTTGGGCAAAGGTGGGGATTCGATGCTGCAACCATCA
ATAGCCGTTACAACGACCTTACTAGGCTGATTGGAAACTACACCGACCACGCTGT
TCGTTGGTACAACACTGGCTTGGAGCGTGTCTGGGGTCCTGATTCTAGAGATTGG
ATTAGATACAACCAGTTCAGGAGAGAATTGACCCTCACAGTTTTGGACATTGTGT
CTCTCTTCCCGAACTATGACTCCAGAACCTACCCTATCCGTACAGTGTCCCAACTT
ACCAGAGAAATCTATACTAACCCAGTTCTTGAGAACTTCGACGGTAGCTTCCGTG
GTTCTGCCCAAGGTATCGAAGCTCCATCAGAGCCCACACTTGATGGACATCCTGA
ACAGCATAACTATCTACACCGATGCTCACAGAGGAGAGTATTACTGGTCTGGACA
CAGATCAT965 GCCGTCGACCACGCGTGCCCTATAGTTCCACAGTCAGCn}
Adaptor cloning vector
832
GGTAGCTTCCGTGGTTCTGCCCAAGGTATCGAAGGCTCCATCAGGAGCCCACACT
crylAC
TGATGGACATCCTGAACAGCATAACTATCTACACCGATGCTCACAGAGGAGAGTA
TTACTGGTCTGGACACCAGATCATGGCCTCTCCAGTTGGATTCAGCGGGCCCGAG
TTTACCTTTCCTCTCTATGGAACTATGGGAAACGCCGCTCCACAACAACGTATCGT
TGCTCAACTAGGTCAGGGTGTCTACAGAACCTTGTCTTCCACCTTGTACAGAAGA
CCCTTCAATATCGGTATCAACAACCAGCAACTTTCCGTTCTTGACGGAACAGAGT
TCGCCTATGGAACCCCTTCTAACTTGCCATCCGCTGTTTACAGAAAGAGCGGAAC
CGTTGATTCCTTGGACGAAATCCCACCACAGAACAACAATGTGCCACCCAGGCAA
GGATTCTCCCACAGGTTGGGCGGCGTGTCCATGTTCCGTTCCGGATTCAGCAACA
GTTCCGTGAGCATCATCAGAGCTCCTATGTTCTCTTGGATACACCGTAGTGCTGAG
TTCAACAACATCATCGCATCCGATAGTATTACTCAAATCCCTGCAGTGAAGGGAA
ACTTTl444
63
CJ"'
...t'"
Location of peR Primers to amplify crylAc gene
1 486
. ~
I cryl7lc >
c +-
703 1554
Red : Primer pair 1; Length of of amplicon is 1068 bp
Black: Primer pair 2; Length of amplicon is 700 bp
(
I 1
( {
I < ' 1
,

1
, ( ( ,(
I I (
! (
t
(
t ~
{ (
0'
lTI
PCR amplification efficiency of new primer set within first 1OOObp of cry1Ac.
All the samples seem to amplify with equal efficiency.
M: ladder -ve: water control
C: control Ac23 :UASD Ac-23
Mon: Mon531 pBin: pBinBt3
Dear Dr Ramesh gam,
I was little perplexed and it took some time for me to comprehend the possibly correct
sequence.
I spoke to Dr Khadi at length and I could construct the events as:
1. Year 2003-2004 (July 2003 - January 2004): T 3 generation
2. Year 2004-2005 (July 2004 - January 2005): T-4 generation (sampled for
Southern). Dharwad station celebrated centenary in November 2004. The research
staffwas busy with preparations and celebrations. It seems several visitors visited the
BNBt site. Not much data collection took place.
3. Year 2005-2006 (July 2005 - January 2006): T-5 generation (Dr Khadi was in
Nagpur and Dr Katageri was in UK; Dr Khadi raised plants in the Glass house; Dr
Khadi must have referred to the seed he obtained from T-4 plants. That means the
plants he raised in Nagpur would be T-5 generation; It seems Dr Sumanbala did a few
crosses during this time)
4. Year 2006-2007: As I understand, large scale crossings were done in 2006 by
utilizing the seed from the glass house raised plants as well as seed from UAS-
Dharwad (collected under the supervision ofDr S. S. Patillo
I do not rule out some errors. I tried my best by keeping myself in the place in an
imaginary situation.
Sincerely
P. Ananda Kumar
On Sun, Apr 8, 2012 at 1:59 PM, Ramesh Sonti <sonti@Ccmb.res.in> wrote:
Dear Dr. Ananda Kumar gam,
We are not going by Dr. Kranthi's version ofevents.
However, a scientist at CICR started a crossing program to transfer BoBt event into other
gennplasm. All of her material also has MON53 I. Therefore, MON53 I was already present
in the donor material tbat she used in the crossing program.
Dr. Dhillon's impression was tbat she bad used T4 plants as donors. Could it be that she used
T5 plants instead. Can you please shed some light regarding the same.
Regards,
Ramesh sonti
On Sat, Apr 7,2012 at 5:11 PM, polumetla kumar <polumetla@gmail.com>wrote:
Dear Dr Ramesh gam,
66
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Here is a private account of matters related to BNBt development.
The Southern data (T1- and T-4) showed that the BNBt is quite different from Mon 531. T-l
Southern was carried out in mid-20OJ and T-4 Southern in early 2005 (samples from the
plants probably raised from fresh seeds collected in December 2004/January 2005).
What happened/might have happened in 2005-2006:
In the following account, I tried to reconstruct a scenario of what happened/might have
happened during 2005-2006, which was the crucial transition period. I also told you and Dr
Imran certain things for which tangible evidence/proofcannot be provided at this juncture.
The seeds ofthis generation (collected during November 2004 to January 20(5) might have
been planted in VAS--Dharwad during Kharif2005 (usually starts in June-July). Dr Khadi left
for CICR in May 2005 and Dr Katageri left for UK in October, 2005. The plants must have
started flowering when Dr Katageri was about to leave.
The experiment/field/plot was entrusted to Dr S. S. PatH and his associate scientist Dr
Manjula Maralappannavar during the absence ofDr Katageri (such records exist in VAS-D).
Dr Khadi took the permission ofDr Kalloo, DOG (CS) to conduct an experiment at CICR to
compare Dharwad material and CICR material. He was asked to go ahead. Dr Khadi must
have used the seed given by Dr Katageri. Dr Kranthi did ELISA and informed Dr Khadi that
Dharwad material was better.
There was no evidence to show that Dr Kranthi carried out PeR to detect Mon 531, at least
at this stage (Please do not go by the "Proceedings" of December 2009 meeting. Please ask
Dr Kranthi to furnish proof ofthese tests and that he communicated them to Dr Khadi).
Even if he did the testing, one wonders what was the logic that prompted him to test for Mon
531?
Assuming that Dr Kranthi did carry out PCR and informed Dr Khadi that the material tested
positive for Mon 531, Dr Khadi would not have ventured to continue further. Dr Khadi, in
fact, gave it in writing to ICAR recently that Dr Kranthi never informed him about
such a thing (A copy ofthis letter might have been given to you).
Also, Dr Khadi would have certainly informed me that Dr Kranthi found something wrong
with the material.
The seed collected by Dr S. S. PatH and his associate(s) was handed over to Dr Katageri upon
his return in 2006. This was the T-5 seed, which was sent by Dr Katageri in 2006 to CICR
and which was used for making hybrid NHH-44 and for biosafety testing at CICR. I
understand that they also sent samples in 2006 to MIS Bangalore Genei for testing.
Sincerely
Anandakumar
P.s:
My official involvement with BNBt ended in December 2004. The material for the
publication was collated by Dr Katageri (up to the data from field experiment conducted in
2003-04) and he requested me to write the manuscript and communicate it, which I did so.
It was only when DOG (CS) asked me in December 2009 to help facilitate isolation of the
lost event I started having a relook at what happened. You know the rest as I explained in the
March 24tb meeting.
-
-
-
-
-
-
-
-
-
....
-
-
-
-
-
Dear Dr Santi,
My Gmail message was sent incomplete. I continue here again:
As I indicated ear1ler in my Gmail message dated April 9, 2012:
""-1 Southern was carried out in mid-2003 and T~ Southern in earty 2005 (samples from the plants probably raised from fresh
seeds collected In December 2O<WJanuary 2005)".
T-1 plants (gfOMl in glasshoose) were sampled by Dhatwad group <rid leaves were brought 10 NRCPB from january 2003 on wards.
Southerns we-e repeated about three times and were canplete by mid-2003.
T-<4 plants were raised in glasshouse at UAS-O and leaf sanples were.sent 10 Delhi by courier in moist pdythene bags (8 couple 0(
times) in January 2005. As mentioned above, these plants were young raised fran fresh seed cdlected from 2004-2005 plants..
Reganing the information frml Or Kalageri about T-2 generation raised in 2003-04. I s h ~ go with his laboratory records.
Sincerely
Dr P. Ananda Kumar
Project Director
NRC on Plant Biotechnology
lARl Campus
New Delhi 110012, India
Phone: 091-11-25848783
Fax: 091-11-25843984
Email: polumetla@hotmail.com
kumarpa@nrcpb.org
Web: www.nrcpb.org
~
- --
~
VB RB NOS-
nptll
NOS:'
OCS3 NOS3
crylAc
35S-P LB VB
- -
+-
..u
o
+-
peR Primers Specific to BNBt
Set No. Sequence Size of
Amplicon
l(LB) S ~ ' 1 1 l
5' TGCAACTCAATTTGATCCACCAGCC
Z(RB)
5' CTTGGCGACAAGGCGGCTCC
{ , I , ( ( I I
I f 1
t /' f
f ! I I
'-
ANNEXURE_V I
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
I j
j
j
. j
j
-=1-1
1Q
/
R\).

(M)
.'. fcJNtb1--
tZ\ k'e:i 'IQ1'>1 'hO'\-
r
. 1N)
hQ. avel
:Lc-A-R _ l

P)'Ort
j



.....
-
-
-
-
-
...
-
-
-
-
-
-
-
-
-
-
ANNEXURE-VI-A
Discussion meeting with Dr K.R. Kranthi, Director, CICR, Nagpur on April OS, 2012
-
1. How was the work on the development of'BN-Bt' cotton divided among the three
institutions, namely NRCPB, VAS and CICR?
-
BN-Bt was developed under NATP project 1999 to 2004. Details of the roles of
institutions are clearly mentioned in the current science paper: Genetic transformation of
an elite Indian genotype of cotton (Gossypium hirsutum L.) for insect resistance. 2007. I. S.
Katageri, H. M. Varnadevaiah, S. S. Udikeri, B. M. Khadi and Polumetla A. Kumar. Current
Science, 93,1843-1847.
- a) NRCPB was to provide gene constructs, confirm gene integration, event
characterization and assess expression
b) VAS Dharwad for transformation ofBikaneri Narma (BN), and Sahana
c) CICR for transformation of LRA 5166 and LRK 516.
2. In your opinion wbat is the order of tbese institutions on tbe basis of their
contribution in tbe development of Bikaneri Nerma Bt (BN-Bt) and 'Bt NHH 44'?
-
...,.
-
-
The Current Science paper, 2007 is a published document that describes the entire
methodology used to develop BN-Bt and the institutions where the development.took place.
The same may please be referred to for clarity on the contribution of individuals and their
affiliation with institutions.
a) VAS Dharwad developed the event 'BNLA601 ' through transformation and
regeneration of BN to produce BN-Bt and Bt NHH 44. UAS Dharwad also produced
the seed.
b) NRCPB for gene construct and molecular analysis of gene integration and event
characterization of the original BN Bt and subsequently for purification of the BN-
BtBNLA601.
c) CICR for co-ordinating biosafety from 2005-2008 ofBN Bt and Bt NHH 44 when Dr.
B. M. Khadi was the Director
3. Wbat was the role of CICR in tbe development of BN Bt?
Bio-safety studies were coordinated from 2005-2008 through CICR under the leadership of
Dr B. M. Khadi, Director CICR
4. We understand tbat tbe 'BN Bt' material from TI to T
3
generations during 2001-
2004 were tested for presence of cry lAc at 'Bt referral lab' at CICR, Nagpur. What
type of planl malerial and huw many samples were tested?
Samples from VAS Dharwad were brought only once to CICR in 2002. 874 vials containing
crushed leaf homogenates were brought on 9
th
December 2002 by Dr Vamadevaiah, Assoc.
Prof Biochemistry and Miss Anita (RA VAS Dharwad). All the samples were tested through
ELISA for presence ofCrylAc protein.
The analysis was carried out only to help/assist the researchers. I was not associated in the
NATP project, though some initial preliminary proposal documents listed my name for
aspects on resistance management.
5. When was the 'Bt Referral Lab' established at CICR, Nagpur?
The CICR laboratory was declared as Bt referral laboratory on 1211> N<>vember 2003
6. What were the techniques used to detect the presence of cry lAc, BN Bt event and
Cry protein? Were the samples also tested for 'MON531'? What were the results
and were these communicated to UAS, Dharwad?
Only ELISA techoique was used to test the samples for the presence ofCryI Ac protein. The
samples were not tested for Mon 531. Some samples were positive. Dr Vamadevaiah carried
the results with him personally.
7. DUring 2005, what plant material and how many samples were analysed for the
presence of cry lAc, 'BN Bt' event and Cry protein.
a) Twenty leaf samples were sent by Dr V. V. Singh in August 2005. Sixteen were
positive forCrylAc protein on ELISA test. Sixteen samples were also positive on
PCR for 500 bp amplicon ofcrylAc gene. PeR gel was run on 21-8-2005.
b) Twenty two Ieafsamples were sent by Dr V. V. Singh on 13-9-2005 and tested for the
presence ofCrylAc protein using dip-sticks. Nineteen were positive.
c) Nine leaf samples were sent to the lab on 26-9-2005 by Dr Sumanbala Singh for
CrylAc ELISA. Seven were positive for CrylAc protein.
d) Ten DNA samples (DNA extracted on 19-8-05 and positive for crylAc) were tested
for Mon 531 5'-junction region specific primers using PeR on 27-9-05. All ten were
positive for Mon 531.
e) Thirty seven leaf samples were sent by Dr V. V. Singh on 27-9-05. PCR testing was
done on 29-9-05 using three primers specific for Mon 531. Six were homozygous and
twenty three were heterozygous for Mon 531.
f) Sixteen samples were sent by Dr V. V. Singh on 9-10-2005. Mon 531 event specific
primers were used in PCR on 11-10-2005. Six samples were homozygous and eight
were heterozygous for Mon 531.
g) No primers were available for BN Bt.
h) The results (ELISA print-out and gel photographs) were communicated, to Dr V. V.
Singh, Dr Sumanbala Singh and Dr B. M. Khadi immediately after the tests.
8. What was the sonrce of these samples, i.e., who provided these samples?
The names ofscientists who sent the samples to the Bt ReferraVtesting Lab have been
mentioned above. Source ofthe samples may please be obtained from Dr B. M. Khadi.
9. What were the results?
Results presented above
10. We understand that these samples were also tested for presence ofMON 531 event.
What prompted to test the samples for presence ofMON531 event when it was not
done in previous years, i.e., from 2001-2004?
The samples tested on 911> December 2002 were only tested through ELISA for the
presence ofCry1Ac protein-toxin as requested by Dr KhadiIDr KatageriIVamadevaiah.
-
,-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
...
-
-
-
-
-
-
Dr Khadi requested for crylAc specific PCR test in August 2005. The crylAc specific
primers used in the referral laboratory were actually specific for a region at 2619 bp to
3117bp in the full length 3534 bp crylAc gene of Monsanto's Mon 531 event. These
primers were used routinely in the lab with the samples in PCR tests carried out on 21-8-
2005. The primers were designed in the Bt-referral lab for routine testing of Monsanto's
Bt-cotton. It was realized later that the amplicon was not expected to have been present
in the truncated 1848 bp crylAc gene used in BN-Bt. Therefore PeRtests were
conducted on 27-9-2005 with Mon 531 5'-junction region specific primers on 10 samples
that had been previously tested positive for crylAc on 21-8-2005. All the samples that
were positive for the crylAc gene were also found to be positive for Mon53 I -5'junction
region.
Subsequently 37 samples were tested on 29-9-2005 for the 'three-primer Mon 531 event
specific test'. Six samples were homozygous for Mon 531.
n. Were the results communicated to Dr Khadi and/or Dr Katageri? Were
communicated, verbally or in writing? Ifnot in writing, why?
The results were communicated to Dr B. M. Khadi verbally as well as the result sheets
were given to him. The gel pictures were shown and the implications were explained
clearly. The Bt-testing laboratory facilities at the institute are used commonly to assist
scientists in their work. There is no such practice at the institute to prepare a written
report for internal samples provided by scientist colleagues. However result sheets are
provided and verbal communication is done normally as was done in this case.
12. Did 'Bt referral Laboratory' test the samples between 2005-2008? What were the
results? Were the results communicated to the concerned?
Samples for DNA tests were NOT received by the Bt referral laboratory after 11-10-2005 and
before 26-4-2008. ELISA tests may have been done sometimes since the laboratory assists all
the scientists of the institute for Bt ELISA testing routinely.
13. Did you inform your seniors about the presence of MON 531 event in the BN Bt
material?
Yes. The presence ofMon 531 event in the putative 'BN-Bt' material as a 'perceived
concern' was informed in August 2005 to
I. Dr B. M. Khadi, Director, CICR
2. Dr Sheoraj, Head Crop Protection and
3. Dr S. K. Banerjee, Principal Scientist Entomology.
14. Why not others, i.e., DDG (CS), Dr V.V. Singh and Dr Sumanbals Singh?
It was only a perceived concern at this stage in 2005 and Dr B. M. Khadi was to take
remedial measures if needed. In any case, it would be the job of the Director to inform DOG
(CS), not that ofa senior scientist (I was senior scientist in 2005). After the matter was
brought to the notice ofthe immediate seniors Dr S. K. Banerjee, Principal Scientist,
Entomology, Dr Sheoraj HOD, and Dr B. M. Khadi, Director, there was no perceived need to
-
-
mention the same to anyone else. Dr V. V. Singh and Dr Sumanbala Singh were provided
with the result sheets as is the normal practice.
15. There are various documentslletters from CICR during 2008-2009 regarding the
performance, spacing, fertilizer requirement, seed production, t"lXation of price for
procurement of BN Bt from UAS, Dharwad and t"lXlItion ofsale price. Under what
circumstances these communications have been carried out keeping in context the
problem existing with the BN Bt event?
There was never any context ofany admitted problem with the BN-Bt event about the
presence of Mon 531, mentioned by either NRCPB or VAS Dharwad until date at any point
oftime, until date, either before distribution of seeds for cultivation or thereafter. However
the possible presence ofMon 531 in the 'purported' 10 BN-Bt seeds was discussed on 21
st
May 2008, only at the behest of Dr B. M. Khadi who brought it to the notice of the DOG
(CS). There were no instructions from the ICAR headquarters, or any contra-indications from
NRCPB or VAS Dhawad subsequent to the meeting held on 21 st May 2008, at any point of
time before the seeds were distributed for cultivation, either to go slow or stop distribution or
re-examine the commercialization or any such instruction contrary to the process of
commercialization. Therefore CICR went ahead with the process ofcommercialization.
There were two meetings held in 2008 under the chairmanship ofthe DOG (CS). The fIrst
meeting was 'regarding road map for the promotion and utilization ofBN-Bt cotton' held on
21
st
May 2008 and the second meeting held on 12
th
December 2008.
In the fIrst meeting on 21 st May 2008, the 'presence ofMon 531 in eight out often seeds
provided by Dr B. M. Khadi' was discussed. Also the issue offlanking sequences
(Avesthagen data) submitted to GEAC for BNLA60I was discussed. The Avesthagen data
characterizing BNLA601 event showed right border cotton genome sequences flanking the T-
DNA insert which were convincing, since the junction region specifIc primers amplifIed the
BNLA60l-event-speciflC amplicon in the WD tests as presented by Dr KatageriIDr P. A.
Kumar. However the right border flanking sequences were not contiguous with left border
sequences ofcotton on the corresponding bac clone sequence available on NCBI. I had
suggested that these sequences may be re-examined and also that an independent laboratory
confIrmation may be carried outto rule out the possibility ofany presence ofMon 53I.
However the Director NRCPB asserted that the data were correct He made a presentation of
the unique nature of the Dharwad event based on flanking sequence analysis. The left border
flanking sequences belongs to cotton hac clone No. I06 I 22(NCBI) and Right border belongs
to Iipoxygenase (Lox I) gene. Dr Kumar also presented the results of BN-Bt analysis to show
that the Dharwad event is different from that of the other known Bt transgene events.
-
-
-
...
-
-
-
-
-
-
The Director NRCPB asserted that molecular studies conducted by him using seeds provided
by Dr Katageri, did not show any presence ofMon S31 in the seeds tested by them. Dr
Katageri also said that pure seeds were available at VAS Dharwad which did not contain
Mon S3 I. Further, strong convincing evidence ofLOD (limits ofdetection) data based on the
junction region ofthe right border ofthe T-DNA of the 'BNLA601' event was presented to
show that an original event was present. The data were oulsourced from Avesthagen. ...
Based on the discussions all members agreed to make efforts to commercialize this event by
developing popular -Bt varieties and hybrids. VAS Dharwad was asked to take up seed
...
-
-
-
-
-
-
-
-
-
....
-
-
-
-
production ofBN-Bt in 150 acres and Bt-NHH-44 in 200 plots ofUAS Dharwad farm. Dr
Katageri assured to produce pure BN-Bt seeds without any chance of Mon 531 in the seeds.
Between 21
st
May 2008 until 12
lh
December 2008, at the instance of the AOG (CC), only one
document was prepared to finalize commercialization modalities.
The second meeting was held on 12
lh
December 2008 under the chairmanship of the DOG
(CS), to f"malize the commercialization modalities of 'BN-Bt' Bt-cotton event, BN-Bt variety
and the Bt-cotton hybrids developed using the 'BN-Bt' event. It was expected that if any Mon
531 presence would have been detected by NRCPB and UAS Dharwad in the BN-Bt
foundation seed at UAS Dharwad in the interim period of6 months between 21st May and
12th December 2008, the same would be pointed out by the concerned scientists. However,
the Director NRCPB and Dr Katageri participated in the meeting and the discussions clearly
indicated that all required tests were conducted by all concerned and that everything was fme
with the seed production and the seeds were ready for commercialization and the same would
be transported to CICR in Jan-Feb 2009.
The proceedings of the meeting held on 12
th
December 2008, emphasized on the need to
popularize BN-Bt, submit PPV & FR application and finalization ofcommercialization
formalities by CICR. The Director NRCPB and the scientists from UAS Dharwad were
absolutely confident and assured that everything was fine with the BN-Bt seed produced for
sale. The documentslletters from CICR during 2009 regarding the performance, spacing,
fertiljzer requirement, seed production, fixation of price for procurement ofBN Bt from
UAS, Dharwad and fixation 'of sale price etc were based on these meetings and were done in
compliance with the proceedings ofthe meetings held on the 12
th
December 2008.
The proceedings emphasized on active commercialization, based on which the process to
commercialize was intensified by CICR immediately from January 2009. Preparatory
arrangements for seed packing were made, commercialization modalities worked out, Press
notes were issued and PPV & FR application filed.
16. CICRsent some quantity ofseed to UAS Dbarwad tbrougb special messenger, Sb
S.P. Mucbali on June 13,2008. Wbat was tbe quantity ofseed? Wbere and how this
seed was produced? Wbat was tbe source of seed to produce this seed?
The seed may have been about two to three kg packet received by Dr P. R. Bharambe, Head,
Crop Production Division, at his residence address. Dr Bharambe handed it over to Dr V. V.
Singh who did not open it and the same was returned back to Dr Katageri through Sh S. P.
Muchali. The original source ofthe seed was Dr Katageri who sent it for trial purposes to
CICR.
17. Was tbe seed received from UAS Dharwad packed in different lots?
Yes. Seeds were received in only two lots as. The lot-I was 165 q and and lot-2 had 84 q.
18. We understand that UAS Dharwad sent seed ofBN Bt packed in different lots. Was
the packing done at CICR? WhO monitored the packing ofseed? Do you have lot-
. wise record ofseed sold to different seed producing agencies? Please provide the
relevant record.
There were only two lots which were packed. The seed given to Mahabeej were from the lot-
I and lot-2. All other agencies received material from lot-2. The packing was done at CICR
under the direct supervision of Dr V. V. Singh and Dr P. R. Vijaya Kumari, Senior Scientist
(Seed Technology). Relevant records have been submitted to AOG (Ce).
19. We understand that the seed sent by UAS Dharwad to CICR during 2009 was TL.
Why TL seed was sold to various agencies to produce seed of BN Bt and Bt NHH
44?
A letter written by Director of Research UAS Dharwad to Mahabeej on 2-6-2010 clearly
mentions 'the BNBt seeds produced by the scientists ofAgricultural Research Station,
Dharwad during 2009-10 were supplied to CICR, Nagpur for seedproduction ofNHH44
Bt'. A copy of the letter has been submitted. Please note that the letter erroneously mentions
the date as 2009-10 instead of 2008-09 which was when the seeds were supplied to CICR,
Nagpur. In the discussions that were held previously with Dr Katageri regarding seed
production, he stated that the BN-Bt seed provided to CICR could be used for further seed
production, since this was the only lot available at VAS Dharwad which was multiplied under
his direct supervision.
20. Test were performed by CICRand NBPGR on the seeds drawn from seed
production lots (report submitted in 2010 stating that all the samples contained
MON 531 event). What was the source of seed? If it was received from VAS
Dharwad during 2009 then why the seed was sold to different seed producing
agencies in the light of above report? Please provide the report received from
NBPGR.
The study was carried out in 2010 by CICR and NRCPB under the instructions ofthe DOG
(CS) for re-confmnation. When the study was carried out in 2010, the results couldn't have
any reference for seed distribution done in 2009.
Seeds were randomly drawn from lot-I and lot-2 and mixed. One batch of 100 gms was sent
to NBPGR and other kept at CICR for future reference. These seeds were tested for ELISA in
May 2009 for the presence ofCrylAc. The seeds were 94% positive for CryIAc. The seeds
were tested later in August/September/October 2009 for Mon 531 only after repeated
problems were noticed in fields. Copy ofthe NBPGR report has been provided to the ADG
(Ce).
21. Why did yon not get tested BN Bt seed received from UAS Dharwad and given to
various indenters during 2009 for the presence or absence ofMON 531 since you
are the Director, CICR, Nagpur?
Farmers in Central India procure seeds in April-May. The seeds from VAS Dharwad were
received very late in May 2009. Sowing starts immediately after the flI'5t rains in early June.
The seeds had to be manually weighed and packed into :::13,000 packets. Farmers, Mahabeej
and other agencies were extremely anxious. There was hardly any time for any detailed
molecular testing during the period. Since the VAS Dharwad and NRCPB had strongly
assured their responsibility for the event purity and seed purity ofBN-Bt, the immediate
urgency to conduct molecular testing was not felt.
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
22. Did CICR receive any complaint from seed producing agencies otber tban
MAHABEEJ?
Seed production was taken up only by Mahabeej and no other seed producing agency.
23. MAHBEEJ never mentioned segregation for petal colour (visibly one of the most
prominent traits to observe), bowever, in tbe various documents submitted in Iigbt
of above complaint tbe segregation for petal colour was mentioned. Was it from the
reports of various monitoring teams visited seed production plots of different
agencies? Please provide the reports.
The MAHABEEJ mentioned segregation for petal colour in their letters. Copy of the letter
has been provided. Copies of monitoring team reports were sent to the ADG (CC).
24. When you know the problem as early as 2005, why did not inform seniors?
Whatever information was known to me in 2005 was informed to my immediate seniors, Dr
S. K. Banerjee, Principal Scientist, Entomology, Dr Sheoraj HOD, and Dr B. M. Khadi,
Director at CICR.
25. Why did not inform DDG (CS) and DG, after you took over as the Director, CICR
particularly at the Directors' Conference wherein all are present?
I took over as Director in February 2010. By then the matter was discussed in detail on lOth
December 2009 under the chairmanship of the DDG (CS) and decisions were taken. I took
over as acting-Director on May 24
th
2008 and the matter was already discussed in detail
under the chairmanship of the DDG (CS) on 21
st
May 2008 and decisions were taken. There
was no perceived need for any further discussion in any forum. Once the matter has been
discussed in detail with the DOG (CS), it is his prerogative to take it further with the DG if
needed, not that of the Director.
26. You praised performance ofBN Bt even after taking over as the Director, CICR
but your stand changed after the problem came into open. Please comment.
Whatever I did to promote and commercialize BN-Bt and Bt-NHH-44, was in compliance
with the decisions taken by ICAR headquarters as laid out in the proceedings of the meeting
held on 21
st
May 2008 and also the crucial meeting held on 12
th
.December 2008 under the
chairmanship of the DDG (CS). As the acting-Director of an ICAR institute I followed the
instructions. I did not praise the performance ofBN Bt. I only spoke about the possible
virtues of a Bt variety, which I helieve can be superior to a Bt hybrid, since the seeds do not
segregate for the Cry toxin in the bolls of straight varieties as it happens in hybrid plants. We
at CICR would have certainly been happy if the seeds were pure for the BN-Bt event as
assured by the breeders ofUAS Dharwad and the Director NRCPB. Based on their confident
assurances, the support was complete from CICR and in compliance with the proceedings of
the meetings held on 21 $I May 2008 and 12
th
December 2008.
I informed the DDG (CS) immediately after our results showed that all the BN-Bt Cry1Ac
toxin positive seeds were found to contain Mon 531 event. The problem never came into
open before that. I also informed the DDG (CS) in a detailed letter in October describing all
the issues related to BN-Bt in detail requesting for guidance.
27. CICR under you takes credit in the development of BN-Bt but your stand changed
to that BN Bt is developed by VAS Dharwad. Please comment.
It is grossly incorrect to say that CICR took any deliberate credit for the development ofBN-
Bt cotton. The role ofCICR was clearly that ofbio-safety prior to 2008 and
commercialization subsequently. The commercialization process was in continuation of Dr
Khadi's biosafety co-ordination work at CICR. It was known to the entire cotton fraternity,
that the BN-Bt product was developed under his leadership at VAS Dharwad in collaboration
with NRCPB. There was no other second opinion to that and it is wrong to say that CICR
claimed any credit at any point oftime. The current Science paner on BN-Bt (I. S. Katageri.
H. M. Yamadevaiah. S. S. Vdikeri, B. M. Khadi and Polwnetla A. Kumar. 2007. Genetic
transformation ofan elite Indian genotype ofcotton (Gossvoiwn hirsutwn L.) for insect
resistance. Current Science. 93, 1843-1847> and the WCRC-4 paper and several other
documents credited the development ofBN Bt only to NRCPB and VAS Dharwad. CICR
was mentioned because Dr B. M. Khadi was the Director CICR when the paper was
submitted and published. There was no attempt whatsoever by any of the CICR scientists to
stake or make any claim in the development ofBN-Bt, which is very clear from the paper,
wherein, there are no acknowledgements or any references to the role ofCICR in the process
of product development and testing or any role ofany kind until 200712008. It was only in
May 2009 that at the insistence of Dr Khadi, the names of Dr Sumanbala Singh and Dr
Balasubramani were included in the PPY & FR application.
The role ofCICR was in compliance ofthe ICAR meeting proceedings that the BN-Bt was to
be promoted and commercialized, which we effi:ctively did.
There is no evidence anywhere that I have ever used or even mentioned BN-Bt anywhere in
my bie-data at any point oftime or for that matter for any purpose ofcredit whatsoever. As a
matter ofprinciple, I have always taken credit only for whatever scientific work that I have
done. I was recogniied as the ICAC International researcher of the year in 2009 by ICAC
Washington only for the work that I did on development of immunological strips and IRM
strategies for bollworms. I never felt the need to take even an iota ofcredit for the product
BN-Bt which was not developed by CICR. I have my own standing as a scientist and have
never felt the need to include anything not done by me for credit.
28. When you were aware of the problem, why did not inform GEAC? Did you sign the
application submitted to GEAC?
I was not aware of any problem. I only analysed samples provided by Dr B. M. Khadi. I did
perceive it as a possible problem in 2005 if the tested material was authentic BN-Bt which
could be authenticated only by Dr B. M. Khadi. I informed my seniors including Dr Khadi,
who informed that he would sort out the issue in consultation with Dr P. A. Kumar and Dr
Katageri. The matter ended there from my perspective. Subsequently when Dr Khadi gave
me 10 seeds in 2008 and asked me to test for the presence ofMon 531, Itested them and
informed the results. Only he knew the authenticity of the material he had provided in 2005
and the seeds that he gave for testing in 2008. Ifanything Dr Khadi may have been aware of
the problem, not me. The samples tested, were and still are considered by our lab as unknown
samples which were found to contain Mon 531. I had always maintained and shall still do so
that the results reflect concern only ifthe test-sample material and the test-seeds are
authenticated by Dr Khadi as original BN-Bt seeds, something which he never ascertained.
-
-
-
-
-
-
....
....
-
-
-
-
-
-
....
-
-
--
-
-
,.....
I became aware of the problem only after August/September/October 2009 when molecular
tests conducted at CICR revealed that the BN-Bt seeds provided to farmers, contained Mon
531 event. I informed the DDG (CS) immediately verbally in August/September and later in
written form in October 2009. Until August 2009, ClCR supported and promoted BN Bt and
Bt-NHH 44. If the ICAR would have instructed me to inform GEAC, I would have done so at
any time after the problem surfaced.
I requested the GEAC in a signed letter in May 2009 to approve Bt NHH 44 in compliance of
the proceedings of the meeting held on 12
th
December 2008.
29. Wben you were aware of tbe problems, wby CICR submitted tbe application for
registration of BN Bt during May 2009 to PPY & FR Autbority? Moreover, why
did you sign tbe application?
The Bt-testing lab at CICR assists all scientists in a routine manner. I only tested the few
unknown samples provided by Dr Khadi in 2005 and once in 2008. That does not make me
aware of any problems. As mentioned before, the persons providing the samples only would
know the nature of the problems after coming to know the results depending on the
authenticity of the samples which only they can vouch for. They would have known the
problem and should have taken remedial measures, which was certainly not my'
responsibility.
The two meetings held in 2008 under the chairmanship of the DOG (CS) discussed the
concerns tissues and prepared the proceedings giving the go-ahead for BN-Bt promotion and
commercialization. I was not aware of anything more which was not discussed in the
meetings and of any other facts that were not known to the participants of the meetings
including the DDG (CS), Director NRCPB, Dr B. M. Khadi, Dr Katageri, UAS Dharwad and
concerned AOGs.
The submission of the PPY & FR application was in compliance of the following:
a) The meeting proceedings of21st May 2008 and 12
th
Dec 2008 emphasized the
need for PPY registration as important recommendation.
b) A letter received from the Director NRCPB dated 9-1-2009 and
c) The letter received from AOG (IPR), ICAR on 13
th
April 2009 linked the PPY
FR application as mandatory requirement prior to commercialization and also
stated that only CICR should submit the PPY & FR application.
Therefore CICR forwarded the application on 7
th
May 2009 before commercialization to
comply with all the stated requirements as per the instructions laid out in the meeting
proceedings and the letter received from ADG (IPR).
I signed the PPY & FR application as the forwarding authority as the acting Director of CICR
(lCAR) on behalf of the five scientists. I signed on all the pages because it was a mandatory
requirement.
30. Tbere are some differences in tbe minutes of various meetings like May 21, 2008
and Dec. 10,2009 and scbedule of events in tbe development ofBN-Bt? Wbat are
your views particularly regarding discussion on BN-Bt in two proceedings?
80
The proceedings of the 10
th
December 2009 meeting were actually based on the text that I
presented as slides in the meeting. The detailed text in my slides was presented in a
chronological manner constructing the sequence of events so as to apprise the DDG (CS)
with complete details ofthe entire matter as much as was known to me. The following
persons were present in the meeting DDG (CS), ICAR., Chairman, ADG (CC), ADG (lPR),
Director, NRCPB; Dr K. R. Kranthi, Acting Director, CICR, Nagpur; Dr Suman Bala Singh,
Principal Scientist, Plant Breeding, ClCR, Nagpur; Dr Shalimath, Director, Research UAS
Dharwad; Dr Krishna Kant, Director, Seeds, UAS Dharwad; Dr B. M. K h a d ~ Director,
Instruction, UAS Dharwad; Dr Katageri, Principal Scientist, UAS, Dharwad; Dr
Vamadevaiah, Principal Scientist, UAS, Dharwad and Dr Udikeri, Senior Scientist, UAS,
Dharwad. The proceedings were prepared by me at the request of the ADG (CC) and
submitted to him in December 2009.
31. Please authenticate the proceedings of the meeting held on 10.12.2009 with records.
All the pages of the proceedings prepared by me were signed /authenticated and sent to the
ADG (CC). The matter was discussed in complete detail in the presence of the DG on 27
th
December 20i I. Kindly refer to the proceedings approved by tbe DDG (CS). The
records/data mentioned in the proceedings have been submitted to the ADG (CC) and can be
obtained from his files.
I hereby affum thal the information providedabove is true to the best ofmy knowledge and
inforllUlJion.
CII1'-
..
".. '.' ..... <.' '
, . ,"
K. R. Kranthi
Director, ClCR
25-4-2012
-
...
...
...
-
...
-
-
...
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
ANNEXlJRE-VI-B
Discussion meeting with Dr G. Balasubramanl, Senior Selentist (Biotech), CICR, Nagpur on April OS,
2012
1. What was your role in the development of BN Bt?
Iassisted Dr B. M. Khadl, Director, CICR In the b10safety requirements for BN Bt. I complied
the data prepared reports for submission to RCGM!GEAC, New Deihl.
2. Old you take various tests to ascertain the presence of cry lAc in BN Bt?
During Multl-location Confined field trial (2006-07), expression of CRY protein
was tested in BN Bt at various stages of plant growth viz., 60, 90, 130 and 160
days by conducting ELISA in my lab. ELISA testing was ALSO carried out at
respective centres by the concemed scientists using ELISA kits sent from CICR.
3. Old you test the various samples proVided by Dr Katageri ! Dr Khadi for the presence of cry lAc
in BN Bt material?
No, I did not receive any samples from Dr. Katageri I Dr. Khadi for testing
cry1Ac gene presence in BN Bt.
4. Specify the years when the various tests were undertaken?
Only ELISA (Bt-Quant) was carried out by me during RCGM trial (2006-07) with
BN Bt.
5. What were the results? Please provide details about material received and tested also.
CRY Protein results are attached herewith. No separate materials were received or tested,
only leaf samples from RCGM trials of BN Bt were collected and were tested with EUSA (Bt-
Quant)
6. Did you inform the results of various tests undertaken by you to concerned quarters? Please if
possible provide relevant records.
CRY protein expressions were submitted to Dr B. M. Khadl and reported to
RCGM/GEAC, the results are provided In the following table.
7. In which year, the BN Bt material was tested for the presence of MON 531 event? What
prompted you to test the material for MON 5311 What were the results? If the material were
positive to MON 531, did you inform the seniors about this? Please provide relevant records, if
available?
Not applicable, I did not test for the presence of MON 531 event.'
8. Old you know about the presence of MON 531 in BN Bt?
I was Informed that there might be a contamination with MON 531 event, but It was not
confirmed. I believed BN Bt was a genuine event.
9. When did you come to know about this? What was the source?
-
-
-
-
-
In May 2008, Dr. B. M. Khadi was worried about some results reported by Dr. K. R. Kranthi,
I.e. MON 531 event contaminations, but he did not believe and told me that BN Bt event
(BNLAI06)Is a pure one, flanking sequences were also confirmed. Thus I trusted and
continued to support the BN Bt. Since in May 2009, Dr Khadl asked me to Include my name In
the PPV& FR application, In recognition of the hard work that I did for biosafety testing, data
compilation and report preparation. I agreed and collated the PPV & FR fonns, obtained the
signatures, signed the application and submitted the same personally at the PPV& FR office.
But after commercialization It became big Issues.
Cry Protein estimation by ELISA test
-
-
-
-
Title
Objects
Experiment conducted at
Date of study
Date of submission of RCGM
Experimental Design:
Quantification of crystal toxic protein production
in transgenic plants using Bt-Quant).
Estimation of Cry! Ac Cry protein production at
various stages of plant growth in the transgenic
cotton plants.
ClCR, Panjari farm, Nagpur.
During Kharif 2006-07
After the trial, the results were submitted to
RCGM, DBT, New Deihl.
-
Fresh leaf samples (second or third leaf from top) were collected from the field using cold
container. Around 10-12 mg of leaf disc was made and proteins were extracted by ice-cold buffer.
Then 50 ttl of samples were used for estimation of Cry protein using ELISA protocol. The estimated
values are. presented in the table-21. In general the protein expression found highest In early stage
of plant growth (S-71J1l) and decreasing trend in later stage. However the Cry protein expression was
recorded 4-6 IJIl even after 130 ~ a y s of plant growth.
Table: 21. Cumulative data of Cry protein expression In leaves at different stages of plant growth
(l'I!g of fresh leaf total protein).
Entry Name 6O-days 9O-days 13O-days l6O-days
OBt- HI 7.230 6.102 4.250 0.337
NHH-44 5.852 5.165 5.178 0.221
OBt- H2 5.123 4.836 4.180 0.259
OBt- H5 5.558 5.758 4.398 0.346
BN-Bt 6.160 5.129 4.642 0.245
-
-
-
-
-
-
-
-
...
-
-
-
-
"-
-
-
...
-
-
-
-
-
ANNEXURE-VI-C
Discussion meeting with Dr Suman Bala Singh, Principal Scientist, CICR, Nagpur on April OS, 2012
The presence of cry protein was tested at all the stages of back crossing using Elisa kits and Dip
sticks.
-
9. Did you inform the results to your seniors? Provide details.
Yes, the results were presented / discussed dUring the monthly meetings and IRe.
-
-
-
10. How many genotypes were taken for transfer of cry lAc from BN Bt?
Sixty one genotypes from different cotton growing regions of the country were selected for
conversion.
11. What were the tests performed for the detection of cry lAc during transfer?
Elisa kits and Dip sticks were used.
12. What was the segregation pattern of cry lAc during backcrossing?
50:50
13. Was this material also tested for the presence of MON 531 event? If yes, when was the
presence of MON 531 conveyed to your seniors? Give details.
No.
14. What is the present status of this material?
The material is in various stages of backcross (BC 2 to BC 4F3).
15. We understand that some quantity of BN Bt seed was sent to UAS Dharwad during 2008 for
taking seed production? Where and how much seed was produced? What was the quantity of
seed sent to UAS Dharwad?
BN Bt seed was not sent to Dharwad. The seed which was receiv.ed from Dharwad itself was
sent back without opening the packet and was delivered by hand.
16. Did you observe any for morphological traits during seed
multiplication?
The seed was not multiplied at Nagpur.
17. Were you also involved in the packing and sale of BN Bt?
No. Dr. V.V. Singh and Dr. P.R. Vijayakumari were involved in seed packing
18. Old you raise any trials to know the performance of BN Bt and Bt NHH 44 at eleR? If yes, in
which year and what was the source of seed? What was the performance of BN Bt and Bt
NHH 44 In these trials?
Yes. RCGM trial was conducted in 2006-{)7 to test the performance of BN Bt and NHH 44 Bt.
TIie seed was received from Dharwad.
The performance of BN Bt and NHH 44 Bt was better than their non Bt counterpart as well as
the local check varieties and hybrids.
19. There are some reports from elCR about the presence of MON 531 In the transformed BN?
Were you aware of that, if so, when did you know of that? Did somebqdy inform you take
action?
I was not aware of the presence of MON 531 in the transformed BN as it was never discussed in
any meetings. I came to know only after the commercialisation of BN BT when complaints
started coming in about the variations in pollen and petal colour, presences of non BT plants
based on boll worm attack and presence of MON 531 event.
20. If no action was taken, why so please?
Since Iwas not aware of the presence of MON 531 in transformed BN, no action was taken.
&6
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Zimbra
ANNEXURE-VII
Zimbra
RE: CrylAc-NRCP,B
sonti@ccmb.res.in
- .. _--------_._- -_..__._----- --
..... -. ------ ---------_._--_.
From: Polumetla Ananda kumar
<polumetla@hotmail.com>
,
Subject: RE: Cry1Ac-NRCPB
To : sonti@Ccmb.res.in
Qear Dr Ramesh garu,
Fri, Jun 29, 2012 10:58 AM
01 attachment
The sequencing of T-DNA of BNBt event has shown a few interesting things.
1. A short stretch of OCS terminator got deleted (104 bp) which explains why we
never got PCR amplification (based on OCS-terminator primer sequences).
2. Nos terminator and interstitial space got duplicated in reverted direction.
I attached a PPT slide depicting the current status and features.
The sequence files Wi!' be sent after arranging them in order.
Sincerely
Dr P; Ananda Kumar
Project Director
NRC on Plant Biotechnology
IAR! Campus
New Delhi 110012, India
Phone: 091-11-25848783
Fax: 091-11-25843984
Email: polumetla@hotmail.com
kumarpa@nrcpb.org
Web: www.nrcpb.org
From: polumetla@hotmail.com
To: sonti@ccmb.res.in
Subject: RE: Cry1Ac-NRCPB
Date: Tue, 5 Jun 2012 10:25:18 +0000
Dear Dr Ramesh garu,
The sequencing of T-DNA of BNBt is almost complete but for a small segment at the
centre.
The progress is slow because of reasons associated with my RA's health and family
problems.
312J
!if.. _. ....
SEQUENCING OF BNBt T-DNA
(June 29, 2012)
't "riA, 1
358
-
p
EJ VB I
?
HindIlI
I
VB Bios-f
nptlI
110
r:f)
OCS3'(87 bp)
104 bp deletion
NOS3'(28 bp)
To be sequenced further
1. IS: Interstitial space
2. 1848 bp of cryIAe is intact.
3. Adeletion of 104 bp occurred in OeS-terminator
4. IS and Nos-terminator got inserted in inverted direction after OeS-terminator
S. Nos-terminator of cryIAe is sequenced up to 28 bp. To be continued further.
6. Ashort distance is yet to be covered by sequencing (designated as: ?)
ANNEXURE-VIII-A

tl.'
!\ .
.' 'k

q]Gq
NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY
'iffi '!fuR. 0012 ('lfffil)
PUSA CAMPUS, NEW DELHI-110012 (INDIA)
<no '!fto 311'10<

Please find enclosed a Comprehensive analysis of trallllllotlio cotton (BNBt)
developed by UAS-DharwadlCICR. As per the suggestion of DOO (CS), BNBt
event has been purified by UAS (0) and provided to NRCI'D tbr analysis and its
comparison With Mon 531 (Monsanto's BG I event).
-
-
-
-
Dr. P. Ananda Kumar
Project Director t--I u' r--.I (J..c.(' f3 rf' So - '1 'L.( '7
Dr S. Ayyapp;:n
Director Genel'll!, ICAR and Secreatary DARE
Krishi Bhavan
New Delhi 110114
Sub: Molecular analysis ofBNBt
Dear Sir,
Ocl"hcl 20, 20 I I
analysis wteqiJivocally confirmed dllit BNBt is a uniqllf ',*,I and is exactly
siIIJiIar to that cksaibed in the Pl!bJicalion in Ctum1t by Katageri
era!. . '. -
I MqUest you to take suitable actlon for further of BNBt by its
dt:pIoymeDt incotton hybrids ofNARS. ... '
a..regairds

.,'
E-mail: kumarpa@nrllt,b,"'ll and poIumetl
Copy: .

--;;/d V.
V
I
Dr S. K. Datta. DDG(CS), lCAR . t- (U.
Dr R.R. HancbinaI, Ville Chancellor, UAS-D I.
Dr B. M. Khadi,. Dean, PG Studies, UAS-D &)), 'L (( )
Dr K.R. Krantbi, Director, CICR r
Dr L S. Katageri, Principal Cotton Breeder, UAS-D blo4 ,r ,,.\
. :;iI, \\'1
.PP"
P.Aninda Kumar
!'hone: (0) 01'1-25848783. Fax: 011-25843984 (R) 01125841748.
I
-
-
ANALYSIS OF BNBt
1. Gene
Comparison ofcrylAc-NRCPB and crylAc-Monsanto (Mon 531)
._------ --_. --_.
Cry1AcrNRCP8 Cry1Ac-Monsanto
1. Length (bases) 1.848kb 3.51cb
2. Promoter CilMV 355 Enhanced 35 S
3. Terminator QcsandNos 7Sterminator
4. Marker nptll nptll
S. Vector pBin Bt3(12.7kb) f>lM>HBK04{1l.4kb)
6.80rders RB and LB (from Only RB (from p1137)
pl137)
PeRani!lyslsfor transgene
(A) PCR with crylAc speelfltprillUllSgIvIng an ampUconof 1kb
(8) peR lInalysiswith nptll spedfu; primers ampltconof 750bp
(e) PCR anatysis with cry1Ac Cterminus prirnelS that liTe specific to MON531 giving an
amplicon of 1.1kb
M-1kb ONAladder 1- IlQn-tran.tgenk:amtrol 2- MONS:U
3 - BNBt 4 - water control S.p8InBt3

-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
,
,
I
____~ 1'1-'''1
ElEB__"_"_"_'_-...JEEEJ- ---
-
PeR analysis of dY1Ac-nos terminator: Forward primer specific to (ryIAe
and reverse primer specific to nos terminator 'Were used to amplify a
product of 1.2 kb
M-lkb DNA ladder 1 non-transgenic control 2- MON531
3 DN81 4- water control SpBinBt3
2. Event
BNBt Mon 531
1. CoPY"number One One full insertion along
with truncated copy
2. Integration site Gossyploides kirkii Similar to Ochroma
clone GKH016Uo- pyramidale 265
jmd ribosomal RNA gene
3. Features Has an integration Has an truncated Insert
of-4kb vector at RB end and -2.5kb
backbone at LB and vector backbone at
-1.8kb at RB opposite end
Integration pattern of crylAc-pvGHBK04 In cotton genome in MON531 event
Integration pattern of crylAc-pBinBt3 In cotton genome in BNBt event
----I VB m nptll
~ cry/A.c
~ - - -
J
I
'11
PeR analysis of presence of NOS proniater a unlque feature of the vector.
Forward primer was designed in Nos promoter and reverse primer on
backbone of vector that is inserted Into cotton genome. The amplieon size
Isof 1.4kb.
M-lkb DNAladder 1- non-transgenlc.controt 2- MON531
3 - BNBt 4- water control S-pBinBt3
+-,-----
__.:"'" _ ~ nptll
~
3. Southern Analysis
,-_""_'_A_C E:EEJ- ---.
-
-
-
-
-
-
20jig of DNA from each sample was
restricted to camplelion with HfnOlll
and probed with 1.Bkb Cl)'lAc framnent.
1- AHindIIl; 2- control DNA; "3- MON 531:
2- 4- BNBt
Katageri et al. 2001
(Current Science)
-
/
,
-
4. Expression analysis
Northern analysisof transcript sizes of MON531 Jnd BNBt. 1.8kb crylAc
probe was used. The picture depicts the transCrIpts length in MON531 is
3.5kb and in BNBt it is 1.8kb.
M- RNA ladder M53l- MON531 BNBt- Bt Bikaneri Nerma
l-
I'
qRT-PCRanalysisofexpression levels of c!vlAc In t\I 0M531 and BNBt
J
s.rCRby .Eveq.t Spe<:ilic primers
----EEE3 npIll
PCAantJ.ysis wl1h_tpOCffio primeIs. primer Js plelIellt in
_bociboocoud_primerispn!OClIt .... oolIon genomic DNA .
Tbcompllfiedproduct of size - 2.SI:b Is tJaIy_t in BNBt
M-IId>DNAladder 1- nooH:nnIsg<niccontloI2-M0N531
3 BNBt 4- water coDtmI SoflBinBt3
Primers Specificfor BNBt
-
-
-
-
-
-
-
Z S'AACl;CGCGGC'rGAG S'CGCGGCCGTGAGGC 1.4kb
TGGCTCCTI'CAAC3' T'OOGACGC'rAGGG3'
3 5'TGCMCTCAATM" 2,Skb
GG,lGCGCAiCCGACT3' GATI:CACCAOCe 3'
SoNo Pol"WU'd primer
1 S'ACGCCGC'OCCACA
ACAACGTS'
Reverse Ptimer Ampltoon
S'TAGATGACACCGCG Ukb
CGCGAT3' .
Feature
Coustluct
specific
(Ac-n()ST)
Bvent
spedfic
priBJersl
Bvent
SJIOGI1ic

M0N531 BNBt
-ve +ve
-ve +ve
-ve +ve
r
r
-
I
-
94-
-
1-
Annexure I
Insect Bioassay of the leaves ofBNBt (Left) Bikaneri Nerma (Right)
with the larvae ofHelicoverpa armigera
I
Annexure II
Wltat Is wroqWltll Ranking ScqUlllltos ...genl:
Tho fWIk1118 are CKpectlld f(j Iire$8ll1118 II contiguous stretch of
l)N""1li:thlligM()mic seqUOMe ofnolmal (nOn.it'attsglmicI plants where the T
fjhJif, the genome at the integflltiot1 silll. In dIe -.Alysis carried out by
lite integration sites at left border and right bonier regions are two
<tdtWhf genomic regions allro&elber. as MaI)rsod from sequence Ilomology.
The dglrt border site AF3611193A (Avesthagen) and me left
b<lrllcr integnrtion site viz.. de not overlap 01" show
me sequence homology to ...other.
The lent bordeI' ftlIIIking obhriMd OQI1tlUos no signlfiollnt bomoIogy
tll the vector sequence used. The homoWgy shown conWns onlythe primer
sequence used fOf amplifying the f\anklng region. The odds ofhaving the
. .
integnltion site exactly at the end ofprimclI" sequence are too low. This can
happen due tll non specific binding and{UllJIftficatinn ofthe primers used.
The above two reasons are .llmeient tll belteve the earlier flanking
sequence eondncted .were aawed and not sllfTtciently
analysed.
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
ANNEXURE-VIII-B
Characterization of the cry1Ac in the purported 'BNLA106' event
Submitted by Director CICR, Nagpur 18
th
December 2010
Objective: Testing of BN BT variety cotton seeds for cry1Ac gene events with
specific reference to the presence of 'Mon531' event and or 'BNLA106' event.
Summary: Event specific primers of 'MON531' and 'BNLA106' were used to
characterize the seed lots of BNBt and BtNHH44 that were produced by UAS
Dharwad and commercialized through CICR, Nagpur. The primers for 'MON531'
event are standard and used regularly in the Bt referral laboratory to detect the
event for all legal purposes as directed by the judiciary. The primers for 'BNLA106'
were based on the flanking regions of the cry1Ac insert of 'NRCPB' New Delhi.
The gene construct and the sequences were provided by Dr P. Ananda Kumar,
Director, NRCPB and submitted to the GEAC prior to approval. The gene
sequences of cry1Ac of Mon531 and the gene sequence from prof lIIimar Altosaar
are >99.4% identical up to 1857 bp of the 5' region. The cry1Ac in 'MON531' event
of Monsanto is a full length gene and is 3534 bp in length. The details of primers
and the brief methods are provided below:
Samples: A total of 8 randomly selected packets of BNBt I BtNHH44 (2 each)
belonging to different seed lots were used for the study. Twenty five seeds from
each packet (2kg pack BNBt and 750g pack of BtNHH44) were drawn and 100
seeds were sent to the GM referral laboratory of NBPGR, New Delhi for
independent analysis to detect the cry1Ac event in the seed lots and 100 seeds
were tested at the Bt referral laboratory CICR, Nagpur. Thus seeds of 8 different
commercial packs representing 4 different seed lots were used for the test being
reported herein and the test carried out by NBPGR, New Delhi.
peR: Genomic DNA was isolated from both BNBt and Bollgard MRC6301 seeds
with the latter serving as reference for the MON531 event. DNA was isolated from
50 seeds, each of BNBt, BtNHH44 and MON 531, using standard ammonium
acetate protocols. Seeds of non-Gm were used as control. PCR was carried out
with each DNA sample in 25 ul volumes, using the following event specific primers
'MON 531' and 'BNLA106' that are specific for the 5' and 3' junction regions (as
separate PCR reactions) as listed below. The amplified prodUcts were resolved on
1.2 % agarose gel and visualized under the Alpha Innotech Gel documentation
unit.
Primers specific for 'MON531' 5' junction region -
Forward primer: 5'-aaccaatgccaccccactga-3'
Reverse primer: 5'-<:tccttgtaagcggtcacac-3'
Amplicon size: 499 bp
Primers specific for 'MON531' 3' junction region-
Forward primer: 5'-<:gttttcgccgatttgcgag-3'
Reverse primer: 5'-gccaatgcctcgtcgtcattgtt-3'
Amplicon size: 274 bp
Cot primers - Cotton primers were used as control which amplifies cotton DNA.
Forward primer: 5'-ccgggttgaaattgggttcatttatg-3'
Reverse primer: 5'-cactacttttatgcacataagatgaaag-3'
Amplicon size: 400 bp
'Flanking sequences specific to 'BNLA106' Event (Avesthagen)
TGTCAACTACGGACAATACGCTTACGGAGGCTACTTCCCCAACCBCCCAACACTAAGCCGAA
GGTTCATGCCTGAGAAAGGCACCCCTBAGTATGCAGAGCTTGAAAAGAACCCTGAGAAGGTC
TTCTTTAGAATCATGTCTTCGCAGCTACAGTCCCTBATTGTCATTACBGTGGTCGAAACGCTGT
CAAACCACGCATCGGATGAGGTBTATCTTBGACAGCGAACCCCCAACTGGACCACTGATGCA
GTTCCGCTACAAGCTTCGGATGCTTTCAATAGGAGACTTGCTGAAATCGAAGGGGAAATCTTA
AAGATGAACAGCGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGC
CGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTT
Left border
CATTAAAAACGTCCGCAATTTGTTATCAAAGTCAAAGTCCAGACTCGGGAAAGATGAATGTGC
TTTTTGTCATGAGAAATGCCAGTGGAAGAAAAATTGTCCAAAGCTGAAGAATAAGGGAAAAGCT
GCTGTAGATGCTTGTGTTGCTAAGCATGATACTAGTGACTCTGAACTATCACTGGTTGCATCAT
CATCGTCGTTCCATTCAGATGAGTGGATATTGGATGCATATTGATACCAGCCCGGGCCGTCGA
CCACGCGTGCCCTATAG
Right Border
CTGTGTCAACTACGGACAATACGCTTACBGAGGCTACTTCCCCAACCGCCCAACACTAAGCCGA
AGGTTCATGCCTGAGAAAGGCACCCCTGAGTATGCAGAGCTTGAAAAGAACCCTGAGAAGGTCT
TCTTTAGAATCATGTCTTCGCAGCTACAGTCCCTGATTGTCATTACGGTGGTCGAAACGCTGTCA
AACCACGCATCGGATGAGGTGTATCTTGGACAGCGAACCCCCAACTBGACCACTGATGCAGTTC
CGCTACAAGCTTCGGATGCTTTCAATAGGAGACTTGCTGAAATCGAAGGGGAAATCTTAAAGATG
AACAG
BNBtRB F: 5' 'tGTCAACTACGGACAATACGC 3'
BNBtRB R2: 5' AACGTIGCGGTICTGTCAGTICC 3'
BNBtRB R1: 5' TICGATTICAGCAAGTCTCCT 3'
PCR profile - 38 Cycles: 94C 10 min followed by 38 cycles of 94C 1 min; 54 c
/58C 1 min; 72 c 1 min and finally 72 Cl0 min. Annealing temperatures were
determined by gradient PCR.
PCR reaction'
Reactants Volume per 25 ul Concentration Companv name
Distilled water 16.7 ul
10 X Taa buffer 2.5 ul 1 X Bannalare Genei
dNTPs (2.5mMl 1 ul 100 uM Banaalare Genei
MgCI
2
(25mM) 1.5 ul 1.5mM Banaalare Genei
Forward orimer (10 uM 1 ul 10 amales Siama-A1drich
Reverse orimer (10uM 1 ul 10 nmoles Siama-A1drich
Taa palvmerase (3U/u 0.3 ul 1 U Banaalare Genei
Template DNA 1 ul 100na (aoDroxl
PCR amplification using Cot AlCot B primer set:
Primer: Cot AlCot B
Expected product size: 400bp
-
-
-
Cot A and Cot B primers are specific to the cotton genome and is present in BNBT,
Mon 531 Bt and non Bt. Since amplification with this primer set was observed in all
reactions, it indicated the suitability of reaction mix and the absence of any
inhibitors.
Presence of MON531 5' junction region (499 bp) in BNBt
Cotton-F 5'-aaccaatgccaccccactga-3'
ctyfAc-R 5'-etccttgtaagcggtcacac-3'
peR amplification using primers specific to the 5' junction region:
Primer: 5' junction forward primer/5' junction reverse primer
Expected amplicon: 500 bp
500bp --';>-
of- 400 bp
500bp -7-
9'1
~ 400bp
S'Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
Alignment of 5' junction region (499bp fragment):
1 1 .. 1.. 1 1 1 1 1 1 1 1. 1
5 15 25 35 45 55
AACCAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGAGAA
-ACCAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGAGM
---------- ---------- ---------- ---------- ---------- -ACGTGAGAA
---CAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGA.GAA
-
-
-
-
S'Junction
BNBt-RC
BNBt-F
Mon 531-RC
MOn 531-F
5 'Junction
BNBt-RC
BNBt-F"
Mon 531-RC
Mon 531-F
S'Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
S'Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
5'Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
5' Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
1 1 1 1 1 1 1. 1 . 1 1 . 1. 1
65 75 85 95 105 115
ACTCGAATGG GAAACTAACA TCGTTTACAA GGAGGCCAAA GAGTCCGTGG ATGCTTTGTT
ACTCGAATGG GAAACTAACA TCGTTTACAA GGAGGCCAAA GAGTCCGTGG ATGCTTTGTT
A C T C G ~ ~ . T G G G ~ _ ~ . C T ~ ~ C A TCGTTTAChA G G A G G C C ~ ~ ~ GACTCCGTGG A T G C ~ ~ T G T T
ACTCGAATGG GAAACTAACA TCGTTTACAA ~ A G G C C A A A GAGTCCGTGG ATGCTTTGTT
---------- ---------- ---------- --------AA GAGTCCGTGG ATGCTTTGTT
1 1 I 1 1 1 - I. ... 1 1 1 1. I
125 135 145 155 165 175
CGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC
CGTGAACTCC CAATATGATC AGT'l'GCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC
CGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC
CGTGAACTCC CAATATGA'I'C AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC
CGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC
1 1 1 1 1 1 1 1 1 1 1 1
185 195 205 215 225 235
AGACAAACGT GTGCACAGCA TTCGT-GAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG
AGACAAACGT GTGCACAGCA TTCGTGhGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG
AGACAAACGT GTGCACAGCA TTCGTGAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG
AGACAAACGT GTGCACAGCA TTCGTGAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG
AGACAAACGT GTGCACAGCA TTCGT-GAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG
1 _.1 1 1 1 1 1 1 1 1 1 1
245 255 2f;5 275 285 295
TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA
TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA
TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA
TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA
TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA
_ 1 _.1 1 1 1 1 1.... 1 1 1 1 1
305 315 325 335 345 355
CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT
CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT
CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT
CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT
CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT
1 1 1 1 .: 1 1 1 1 1 1 1 1
365 375 385 395 405 415
GAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCGTCCTGG TTGTGCCTGA
GAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCG------ ----------
GAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCGTCCTGG TTGTGCCTGA
GAAAGGTCAT GTGGACGTGG AGGAACAGAA C--------- ---------- ----------
GAAAG----- ---------- ---------- ---------- ---------- ----------
-
-
-
-
-
-
-
-
5'Junction
BNBt-RC
BNBt-F
Mon 531-RC
Mon 531-F
- 1 1 1 1 1 1 1 ' 1
425 435 445 455
GTGGGAAGCT GAAGTGTCCC AAGAGGTTAG AGTCTGTCCA
GTGGGA---- ----------
100
' .1 . 1
465
GGTAGAGGCT
1 1
475
ACATTCTCCG
-
5'Junction
BNBt-RC
BNBt-f'
Hon S31-RC
Mon 531-f'
1 1 1
485 495
TGTGACCGCT TACAAGGAG
Sequences from the MON531 5' junction region
derived from the 499 bp BNBt amplicon
~ o e ~ 0 4 ~
aaccaatgccaccccactgacccacttagcagagaagaagtggagggac
aaacgtgagaaactcgaatgggaaactaacatcgtttacaaggaggccaa
agagtccgtggatgctttgttcgtgaactcccaatatgatcagttgcaagcc
gacaccaacatcgccatgatccacgccgcagacaaacgtgtgcacagca
ttcgtgaggcttacttgcctgagttgtccgtgatccctggtgtgaacgctgcc
atcttcgaggaacttgagggacgtatctttaccgcattctccttgtacgatgc
cagaaacgtcatcaagaacggtgacttcaacaatggcctcagctgctgga
atgtgaaaggtcatgtggacgtggaggaacagaacaatcagcgttccgtc
ctggttgtgcctgagtgggaagctgaagtgtcccaagaggttagagtctgtc
caggtagaggctacattctccgtgtgaccgcttacaaggag
peR amplification using primers specific to the 3' junction region:
Primers: Forward primer 3' junctionl Reverse primer 3' junction
Amplicon: 274bp
~ 274 bp
The bands were eluted; DNA was pooled and sequenced with Eurofins, Bangalore.
The sequences of 5' and 3' junction regions of BNBt and MON 531 were aligned
separately and were found to be identical.
101
274 bp
oriV-F 5'-cgttttcgccgatttgcgag-3'
cotton-R 5'-gccaatgcctcgtcgtcattgtt-3'
-
-
3' junction
MON 531-F
BNBt-F
Alignment of 3' junction ngion (274bp band):
1 1 1 1
5 15
CGTTTTCGCC GATTTGCGAG
1 1
25
GCTGGCCAGC
1 1
35
TCCACGTCGC
1 1 1 1
45 55
CGGCCGAAAT CGAGCCTGCC
-
-
1 1 . 1 1 1 1 .. 1 1 1 1 1. 1
65 15 85 95 105 115
3' junction CCTCATCTGT CAACGCCGCG CCGGGTGAGT CGGCCCCTCA AGTGTCAACG TCCGCCCCTC
MON 531-F ---------- ---------- ---------- ---------- ---------- TCCGCCCCTC
BNBt-F
---------- ----GCCGCG CCGGGTGAGT CGGCCCCTCA AGTGTCAACG TCCGCCCCTC
3' junction
MON 531-F
BNBt-F
1 1
125
ATCTGTCAGT
ATCTGTCAGT
ATCTGTCAGT
1 1 1 1
135 145
GAGGGCCAAG TTTTCCGCGA
GAGGGCCAAG TTTTCCGCGA
GAGGGCCAAG TTTTCCGCGA
. 1 1 1 1 1 1
155 165 175
GGTATCCACA ACGCCGGCGG CCGCGGTGTC
GGTATCCACA ACGCCGGCGG CCGCGGTGTC
GGTATCCACA ACGCCGGCGG CCGCGGTGTC
3' junction
MON 531-F
BNBt-F
3' junction
MON 531-F
BNBt-F
1 1 1 1 1 1 1 1 1. 1 1.. 1
185 195 205 215 225 235
TCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGT
TCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGT
TCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGT
1 1 1 1 1 1
245 255 265
ATATTCTTGC AGAGAACAAT CACGAGGCAT TGGC
ATATTCTTG- ---------- ----------
ATATTCTTG- ---------- ----------
io:L
-
-
Sequences from the MON531 3' junction region
derived from the 274 bp BNBt amplicon
-
cgttttcgccgatttgcgaggctggccagctccacgtcgccggccg
aaatcgagcctgcccctcatctgtcaacgccgcgccgggtgagtc
ggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggcc
aagttttccgcgaggtatccacaacgccggcggccgcggtgtctc
gcacacggcttcgacggcgtttctggttataatatacacatatataatt
tatcactgtatattcttgcagagaacaatcacgaggcattggc
Reconfirmation of the presence of Mon531 3' junction
274 kb amplicon in BNBt and NHH44 seeds
:1..03
Event! Zygosity detection through PCR
B
..

C
A: Cotton-F 5'-tccgagactcctagtacctcaact-3'
B: OriV-F 5''1Jatttgcgaggctggccagctccacg-3'
C: Cotton-R 5''1Jgtttcctcttcttcttgaccttgtaag-3'
Evidence for the presence of full length crylAc gene in BNBt
CONCLUSIONS:
1. Ninety two seeds were positive for cry1Ac from the 100 seeds tested from
the lots produced by UAS Dharwad. All the 92 seeds were found to contain
only 'MON531' event of Monsanto and did not amplify positive for the
purported 'BNLA106'. Eight seeds were negative for Cry1Ac. The flanking
regions of the event 'BNLA106' provided by Dr P. Ananda Kumar and the
primer sequences of purported 'BNLA106' were used to examine if the
event was present in any of the seeds. None of the seeds was found to be
positive for any primers tested, thereby indicating that the seeds do not
contain the purported 'BNLA106' event.
-
-
2. Seeds samples from the BNBt seed lots produced by UAS Dharwad were
also sent to the GM referral laboratory of NBPGR for testing. The results
received from them confirmed the findings of Bt referral laboratory CICR,
that all the seeds contained only the MON531 event.
Sequence (3534 bpI of cry1Ac full length Monsanto gene
Sequences in blue are identical to NRCPB/Dharwad Cry1 Ac truncated gene 1857 bp
itggacucaacccaucatcucgutgcattccatacuetgcttgagtaacceag:ugttgugtaettggrggagucgcattgUiccggttacattcecatcgilCatetccngtccttgaca
ca.gtnagetagcgagttcgtgccaggtgctgggttcgrtacggaetagtrgaCl.tcatagngtatetnggtttatclcutgggalgclUCQgglgcaaallgagCilgttgarcaaccagag
gatcgugagttcgccaggucaggccatetetaggttggaaggattgagcaataetacca.a.atctatgcagagagetlcagagagtgggaagccgatccuetaacccagetetccgcgagga
ulgcgU.acuttcu.cgacatgucilgcgccng<1CCacagd:UCCCutgttcgcagtccagucuccugttcetetatgtccgtgu.cgttcu.gagetutclIucetcagcgtgCa.cg
agacgttagcgtgra:gggcauggrggggattcgatgagcaaccatcuugccgtucucgacclticuggaganggaaaetacaccgaccacgetgncgttggtacaacaetggatgg




tuggaacClatacaettgccaccgetgmacagl.u.gagcggaaccgngancmggacguatccca.ccacagucaacutgtgccacccaggcaaggattacccacaggngagcca
cgl gtccatgttccgnccggattca.gcaacagnccgt gagcatcatcagagacaatgttaettggau.ca.ccgtagtgagagttcaacuca.tcatcgcatccgat agtattaClcautccagc
igtgugggauanacncucggttetgtca.tncaggaccagganciaggtggagaa:t.eguagattcloacagcagtggu..ataac.attcagi,.fagagggt.ttl.ngugnc(uncaet
tcccatce.tcatetaccagUallgagttcgtgtgaggtatgett<1gtgacecetauacctcucgttaattggggtUgtc.atccllettetccutacagttccagetl.c.agaaceteatggafut
etccutccagcsatttcggttaetttgaugtgccaargettttaca.tettaacggtucatcgtgggtgttagu.aetttagtgggaagcaggagtgattatcgaagancgigncanccagtU
etgcucaacgaggetgagtilC:aacettgagagagcccagaasgetgtgaacgccetetnacaccaccaucagatggcnguaactucgttaetgactatca.cattgacca.agtgtccuet
tggtcaceticettagcgatgagttagcetcgacgagugcgtguetetccgagaaa.gttuacacgccugcgtetcagcgacgagaggaatetCltgcugaetccuetlcuugacalcl.
acaggcl.gccagia<:glggnggggtggugcaccgggatcaccatccuggaggcgacgl.tgtgttcuggaguctacgtcaceetaccggaaetttcgacgagtgetaccal.CClICllgt
accagugatcgatgl.gtccauetca.u.gcenca.ccaggtatcaaataglggetacacgugacagcca.agl.Cettga.aatClaacgatcaggtacutgccugcacgagaccgtgutg
tccc.aggtaaggttceetetggccaerttagcocutetet:ca.ttgggugtgtggagagcaucagatgcgetccaca.cettgagtggutcctgaatggaagetcetgcl.gggatggcgag
lagtgtgcce.tccantteatcaettetcCltggacatcgatctgggaz:gtaagacetgaatga.g;gaeetcgga.gt:etgggtea.tettcugatcaagacccugacggacacgcuga.cn.ggcu
cettgagmacguglguaccanggtcggtgaagctctcgctcgtgtgugagacc.aglgugugtggagggaculcgtgl.gUlCiega.atgggulClucatcgtttac
laggaggceuagagtccgtggatgetttgttcgtguClcca.atatgatcagt:tgcaagcrgacaccaacatcgc:catgatccacgccgcagaca.u.cgtgtgcacagattcgtgaggettaet
tgcagagngtccgtgatccetggJgJgucgagccarcttcgaggaacugagggacgtuanaccgcattaccttgtacga.tgccagaaacgtcatcaagl.acggtgacncucaatggca
cagetgetggutgtga.uggtc.atgtggacgtggl.ggucagucu.tcagcgnccgtcctggttgtgcctgagtgggugagugtgtcccugaggttagagtagtcca.ggtagaggeti.
cattetccgtgtgac,cgcttacaaggagggatacggtgagggngcgtgaccatccacgagatcgagaaC2l.Cl.ccgacgagctu.a.gttetecuetgcgtcgagguguatetatc
ccaacaacaccgttaettgcaacgacra.cactgtga.a1caggaagagta.cggaggtgeetacacu.gccgtaa.cagaggttacucgaagetcettccgncagagacratgcetccgtgtacgag
gaguatcetacaca.gl1ggcagacgtgagucccttgcga..gttcucagaggttacagggactacacacacttocagttggetatgttacca.a.gga.gatgagtaetttcctgl.gl.cegaca.ug
tgtggarcgagatcggtgul.ccgaggguccncalcgtggacagcgtggagettetatgarggt.ggu
Development of 'BNBt' and 'Bt-NHH44' with 'BNLA106' event
1. 2000-2001: Dr P. Ananda Kumar provided the cry1Ac gene construct to Dr Katageri
and Dr Khadi, UAS Dharwad.
2. 2000-2001: Dr Katageri used shoot apex explants using Agrobacterium mediated
transformation to develop the event 'BNBtLA106'.
3. 2001-2002: Dr Anand Kumar confirmed gene integration and conducted the complete
molecular studies to confirm the original event.
4. 2001-2004: Dr Khadi, Dr Katageri, Dr Udikeri and Dr Vamadevaiah used ELISA and
bioassays to identify homozygous lines and advanced the BN Bt to T3 generation at
UAS Dharwad.
5. The work was published in Current Science (I. S. Katageri, H. M. Vamadevaiah, S. S.
Udikeri, B. M. Khadi and Polumetla A. Kumar. 2007. Genetic transfonnation of an
elite Indian genotype of cotton (Gossypium hirsutum L.) for insect resistance.
Current Science, 93, 1843-1847).
6. 2005: Dr Khadi joined as Director CICR in May 2005 and brought a few T4 'BN Be
seeds with him.
7. 2005: The seeds were given to Dr Suman Bala Singh, Plant Breeder, CICR, and
grown in a polyhouse at CICR, Nagpur and biosafety studies were initiated through
CICR under the leadership of Dr Khadi.
8. 2005: Subsequently, in August 2005, Dr Khadi sent twenty leaf samples from twenty
plants to Dr Kranthi, Bt referral laboratory CICR requesting ELISA and PCR tests.
9. ELISA results showed that sixteen leaf samples were positive for Cry1Ac. The PCR
results for cry1Ac showed that the samples contained a full length gene of 3534 bp
which indicated the probability of 'Mon531' event.
10. The samples were subjected to Mon531 5' junction and Mon531 3' junction
specific primers to amplify 499bp and 274bp amplicons. The samples confirmed to
contain cry1 Ac from Mon531.
11. The samples were SUbjected to PCR using a three primer set (derived from inverse
PCR) that detects 'Mon531' event of Monsanto. All sixteen samples were found to be
positive for 'Mon531 '. Six samples were homozygous and ten were hemizygous for the
'Mon531'. The results were communicated to Dr B. M. Khadi.
12. The plants in nethouse were tested with Bt-Express strips and 37 leaf samples were
subjected to the Mon three primer test. Nine plants were homozygous.
13.2005: Dr Khadi expressed that the presence of 'Mon531' in the putative 'BN Bt' T5
generation plants could have been due to contamination and care would be taken to
remove the same from the original event. He informed that he communicated the
results and concerns to Dr Katageri and Dr Ananda Kumar and that appropriate steps
would be taken up.
-
-
-
-
-
-
-
-
-
-
-
...
14. 2005-2008: Contained Open Field Trial, Multi Location Research trials and Biosafety
studies were carried out by Dr Khadi, Director CICR and applications to RCGM and
GEAC were submitted through CICR.
15. The BN Bt variety and 'Bt NHH 44' was tested under RCGM "Contained Open Field
Trial" at three locations in three collon growing zones during 2005-2006 and Multi-
Location Research Trials (MLRT) in 12 locations in all the three zones in 2006-07 and
2007-08. The BN Bt and Bt NHH 44 showed over-all yield superiority in both seed
collon and lint yield when compared with Non-Bt check and local checks.
16. 2006-2008: Biosafety studies were carried out at various institutions through CICR.
17.2006-07: The Dharwad event was characterized by Dr Khadi and Dr Ananda Kumar
through outsourcing the work to MIS Awasthagen, Bangalore. The right border and left
border flanking regions of the 'Dharwad event' were identified through inverse PCR
and Primers were designed based on the flanking regions.
18. 2008: After completing all the mandatory biosafety testing and field experimentation,
the 'BN Bt variety' was approved for commercial cultivation in the 84
th
meeting of
Genetic Engineering Approval Committee (GEAC) held on 2
nd
May 2008
19. Subsequently, Dr Khadi sent ten seeds to the Bt referral laboratory on 4" May 2008,
for reconfirmation of the event present in 'BN Bt'. He provided results of the flanking
region sequences and primers from Awasthagen. PCR was carried out using the
primers but there was no amplification in any of the samples. The samples were then
subjected to PCR using a three primer set that detects 'Mon531' event of Monsanto.
Eight samples were found to be positive for ELISA and also for 'Mon531'. The same
was communicated to Dr Khadi.
20. A meeting was convened by the DDG, CS, (Dr P. L. Gautam) and the issues related
to the Mon531 event were discussed in depth in his chamber on the 21" May 2008 in
the presence of Dr P. Anand Kumar, Dr B. M. Khadi, Dr Katageri and other officials
including the ADGs, Dr K C. Jain and Dr Jhambhale.
21. Dr Kranthi described the results obtained by the Bt referral laboratory and requested
that it would be appropriate to take remedial measures in view of the detection of
'Mon531' in the purported 'BN Bt' seed samples. He pointed out that the Awasthagen
data were flawed since the left border sequences of the insert were not contiguous
with the right border sequences on the bac clone and also the primers were not
functional. He requested for a third party analysis to reconfirm the event data so that
serious repercussions could be avoided in future.
22. Dr Ananda Kumar made a presentation of the unique nature of the Dharwad event
based on flanking sequence analysis. The left border flanking sequences belongs to
collon bac clone No. 106122 (NCBI) and the right border belongs to lipoxygenase
(Lox1) gene. Dr Kumar also presented the results of BN-Bt analysis to show that the
Dharwad event was different from that of the other known Bt transgene events.
23. The chairman asked Dr Kranthi not to carry out any further molecular testinll of the
samples and only to carry forward the commercialization process with full zeal,
adhering to all instructions laid out in the proceedings.
24. The chairman decided that the BN-Bt seeds would be produced only by UAS
Dharwad in about 150 acres. UAS Dharwad was also asked to produce 200 quintals
of the hybrid 'Bt NHH 44'. Accordingly the seed production was taken up only by UAS
Dharwad by the original breeders.
25. Dr B. M. Khadi joined back UAS Dharwad on the 23'" May 2008.
26. Dr K R. Kranthi took over as acting Director of CICR on 24
th
May 2008.
27. A meeting was held on 12
th
December 2008 under the Chairmanship of
Dr P. L. Gau1am, Deputy Director General (CS) on the 12" December 2008 in Krishi
Bhavan, New Delhi, to finalize the commercialization modalities of 'BN-Bt' Bt-eotton
event, BN-Bt variety and the Bt-eotton hybrids developed using the 'BN-Bt' event.
28. Commercialization and seed production plans were finalized.
29. UAS Dharwad produced 250 quintal seed in 2008-09 kharif season. The seed was
sent to CICR in two lots (165 Q on 4" May and 84 Q on 6" May 2009) at Rs 50 per Kg.
30. The seeds were packed at CICR in 2kg seed bag containing packs of 2009 pigeonpea
refugia seed to be sold at Rs 200. A total of
10,900 bags were given to MSSC, Maharashtra during 14-19" May 2009
500 bags to GSSC, Gujarat on 25" May 2009
119 bags to MSSRF (Prof Swaminathan Foundation), 1-8
th
June 2009
200 bags to MAFSU (Animal and Fisheries University, Nagpur) 6" June 09
275 bags to APSSDCI, Andhra Pradesh on 9" July 2009
50 bags to Ratan Tata Trust, Maharashtra on 14
th
May 2009
Rest of the bags were given for FLDs dUring July 2009
31. The hybrid 'Bt NHH 44' was approved by GEAC on 13
th
May 2009 for commercial
cultivation in the Central and South zones during Kharif season 2009. 'BN Bt' is female
parent and AC738 is the male parent for Bt NHH 44.
32. UAS Dharwad produced 15 quintals Bt NHH 44 seed and sent to CICR at Rs 370 per
Kg on 28
th
May 2009. The seeds were packed at CICR in 750 g Bt NHH 44 seeds per
bag containing packs of 200g pigeonpea seed for refugia purposes, to be sold at Rs
400.
1600 bags were given to MSSC, Maharashtra during 15-17
th
May 2009
100 bags to MAFSU (Animal and Fisheries University, Nagpur) 8
th
June 09
100 bags to APSSDCI, Andhra Pradesh on 9
th
July 2009
Rest of the bags were given for FLDs during July 2009
33. The Maharashtra state seed corporation (MAHABEEJ) has taken up seed production
of Bt NHH 44 in 360 hectares in Gujarat and 595 ha of BN Bt in Maharashtra with 1875
farmers. They have entered into an agreement with the seed producers to procure the
'Bt NHH 44' hybrid seed at Rs 210 per 450 g and Rs 50 per Kg of the BN Bt variety.
34. All the seed producing farmers have complained that the 'BN Bt' seed is not pure with
respect to several traits including the Cry1 Ac. Therefore the hybrid seed would face
problems at the time of certification and 'grow out test'.
-
-
-
-
-
-
-
35. CICR scientist teams (Including Dr Katageri, UAS Dharwad and Dr Kumar, GAU,
Surat) visited the seed producing plots in GUjarat and Maharashtra. Six independent
scientist teams from CICR have been making constant visits to assess the
performance and have confinmed trait segregation.
36. The MAHABEEJ reported the matter to the Principal Secretary (Agriculture),
Govemment of Maharashtra and a meeting was convened on the 8'" October 2009 in
Mumbai, to discuss the steps that can be taken up as remedial measures to minimize
the possible financial losses (Rs 5-6 crores) on account of the impure parent 'BN Bt'.
37. MAHABEEJ sold 1.25 lakh packets of 'Bt-NHH 44' DURING 2010 using the seed lots
that were rigorously tested and certified by CICR through ELISA testing of individual
seed lots. Therewas not even a single complaint during the 2010 season and farmers
were very happy with the performance.
38. Monsanto (MMB India) have stated that their tests have revealed the complete
presence of Mon531 in all positive seeds and are constantly reminding MAHABEEJ
and CICR for possible royalties.
Certified that the above report contains data from the Bt Referral laboratory, CICR,
Nagpur carried out under my direct supervision. The chronological list of events
reported in the report above have been presented without any bias to individual or
institution and represent only facts best known to me.
Date: 18
th
December 2010
CwS
K. R. Kranthi
Director, CICR
I O ~
Zimbra
ANNEXURE-IX
Zimbra
Re: regarding BnBt
From: RANJINI <warrier@nic.in>
Sender: warrier@nic.in
Subject: Re: regarding BnBt
To : sonti@ccmb.res.in
Cc : vc@mail.jnu.ac.in, vc@pau.edu, secy iear
<secy.icar@nic.in>, imran
<imran@ccmb.res.in>
sonti@ccmb.res.in
Fri, May 04, 2012 04:17 PM
Dear Dr Ramesh Sonti, .
PI ignore the earlier mail. Revised information with minor correction on the date of
RCGM meeting may be seen below:
Please find below factual information on the two queries raised by the EnqUiry
Committee in respect of BnBt Cotton.
1. Could you please let us know the name of the person who made the
presentation regarding BnBt to the GEAC?
No presentation was made to the GEAC on the Biosafety Studies conducted
on BnBt. However, the 'proposal of CICR seeking approval of GEAC for large
scale field trials with BnBt was considered in the 83
rd
and 84
th
meetings of the
GEAC held on 2.4.2008 and 2.5.2008 respectively.
In the 83
rd
meeting of the GEAC, Dr Kranthi, Senior Scientist, CICR, Nagpur
had made a presentation on "Results on monitoring the susceptibility of boll
worms to Bt gene and development of insect resistance" (ref Agenda Item 4.2)
2. Were Dr. Ananda Kumar and Dr. Khadi, who were members of GEAC, sitting
in on this presentation regarding BnBT?
Both Dr. Ananda Kumar, Project Director, NRCPB and Dr. B.M. Khadi,
Director, OCR, Nagpur (former) were present in the 83
rd
GEAC meeting held
on 2.4.2008 while the BnBt proposal was discussed. There was no
presentation on the subject matter.
Dr. B.M. Khadi was present in the meeting held on 2.5.2008.
It may also be noted that Dr B.M. Khadi had made a presentation to the
RCGM in the 53
rd
meeting held 22.5.2007 on the Biosafety Studies conducted
with Bt Transgenic Cotton Hybrid NHH44 Bt. Based on the RCGM
http://webmail.ccmb.res.inlzimbrafh/prinunessage?id=41292
\10
i
,
I
I
i
I
I
i
I
I
!
I
!

Zimbra
recommendation, the proposal was considered by the GEAC.
With regards,
(Dr. R. Warrier)
Director & M ~ , GEAC
.1-

1I ,
-
-
-
-
-
-
-
-
-
-
Ltmbra
On 04/24/12, sonti@ccmb.res.in wrote:
Dear Dr. Ranjini Warrier,
I am writing in cOllnection with the enquiry committee that has been set up
by ICAR, under the chairmanship of Prof. Sudhir Sopory, to enquire into the
events surrounding development and release of BnBt (Bikaneri Narma-Bt). In
this connection, I am writing on behalf of Prof. Sopory and the committee to
request the following information:
1. Could you please let us know the know the name of the person who made
the presentation regarding BnBt to the GEAC?
2. Were Dr. Ananda Kumar and Dr. Khadi, who were members of GEAC,
sitting in on this presentation regarding BnBT?
I am looking forward to hearing from you at your earliest convenience.
Best regards,
Ramesh Sonti
Dr. R Warner
Director
Ministry of Environment & Forests
Government of India
Paryavaran Bhawan
CGO Complex, Lodhi Road
New Delhi - 110 003
Tel: +91-11-24363964
email: warrier@nic.in
http://webmail.ccmb.res.inlzimbralhlprintmessage?id=41292
II)...
Grams: UNIVAGRIS
Tele Fox-91-836-2446272
e-mail: dipgs.u:J.sd..@gmaiLcom
dipgs_u<lsd@re.diffmail.colO
bTukhadi@rcdirfmail.com
ANNEXURE-X
Tel: (0) 0836-2440947
2448321 Ext. 213
(R) 0836- 2776263
(M) ?44849531I
No. Dean (PGSY 1a 1201112 Dale: 04-01-2012
-
Respected Sir,
nlallk )'OU Sir for the proceedings of lhe meeting held on 27122011 at Committee room of
ICAR, New Delhi regarding issues related to BNBt colton. Sir, I would like 10 bring 10 your kind nOlia:
following points for your kind consider.uion and needful.
Regarding point No. 4 of proceedings; we as a \earn in CICR wanted to take up back. cross
hreeding (or conversion of he<;r varietie.li and hybrid!' parental of the country (about 45 lines)
simuttaneousty (0 avoid the time lapse. Hence, it was decided to identify the homozygous pl3nls from the
BNSt pl3nts grown 2.1 eleR in 2005. HOD. Plant Protection made analysis on homozygosity and
indicated that there were about six plants that were: homozygous. So. nowers of these plants used for
conversion orhesl varieties and hybrids parental lines by the breeders. If we would have known that il \....as
Monsanto 8t, IoI.'C would not have made any venlure of promoting, convening the elile Hoes and conducling
'he trials. FUrlher, the RCGM and GEAC trials were conducted during ,he period by obtaining seeds from
UAS, Dharwad. Each and every step of promo'ion, conversion, testing was discussed with HODs and
concerned Sciemists of ClCR, Scientists of UAS, Dharwad and NRCPB, New Delhi. I am unawue of
process or procedure of analysis of homozygosity, but I am dear chat whal an "event' is. Several inhouse
meelings, IRC, RAC. IBSC as well as during visits of dignitaries including Hon'ble [)G, DOG (CS),
AOGs and otl"'rs were apprnised time to time, collectively by all of us including the Heads and Scientists
concerned about (he progress of Bt cotton in eleR. The progress of the work was presented time to time
and the informa'ion conlen' was prepared colleclively by concerned Scientists and Heads.
After the decision of GEAC on 2;2008 regarding commercializa'ion of BNBt, following week
of May 2008 Dr. K.R. Kranthi. HOD, Plant Protection infonned me regarding the Mon53I contamination
I presence in the seeds 'ested. Immediatel)' Hon'ble DOG (CS) and AOG (cq were informed regarding
the same. Hon'ble DOG (CS) arranged a meeting with all concerned Scientists and discussed the mailer in
detail on 21-5-2008 (Ref. F.No.2 (II) 2008 CC-I dated 29.5."2008).
Hence, I request you to kindly consider and do Ihe needful. Please mention that only homozygous
plfllnts (not Mon-53l) were identified and informed to use them for conversion programme. Hence. I
request you to kindly consider the corrections in the proceedings.
This is for your kind infonnation and needful.
Thanking you, with kind regards,
nle Hon'ble Deput)' Director General (Crop Science)
Indian Council of Agricultural Research (ICAR)
Krishi Bhawan, New Delhi - 11000I.
COP)' submitted to the Hon'ble Director General, ICAR, Krishi Bhawan, New Delhi for kind information.
Copy submitted 10 the Hon'ble Vice Chancellor, UAS, EJharwad for kind informalion.
1/3

f
- ---:-,; - -
l \ -'.
/ ." .
.'
~ ~ 3fjfftrR ~
INDIAN COUNCIL OF A6RICULTURAL RESEARCH
~ 'lfq.l, ~ ~ I;ffiK 1Wf. '% ~ - 1 1 0 0 0 1
Krishi Bhawan. Dr. Rajendra Prasad Road New Delhi 110 114
F.No. 2(11)(2008 CC-!
DRKR.Kranthi.
Principal Scientist,
Head Crops Protection Division
CICR-440 010
Dated 29-5-2008
'.
Sub: Pr<>eeedings of the meeting under the chairmanship of Dr. P.L.Gautam,
. DDG(CS), IcAR on 21-5-08 regarding road map for the promotion and
utilization of BN-Bt cotton.
Sir,
I am to enclose herewith the proceedings of the meeting under the
chairmanship of Dr. P.L.Gautam, DOG(CS) , ICAR on 21-5-08 regardiilgroad map
for the promotion and utilization of BN-Bt cotton for information and necessary
action,
Yours faithfully,
(K.C. m)
Asstt. Director General(CC)
Enel : As above.
\Ilj-
"
/
-/
r
Proceedings of the meeting with Dr. P. L. Gautam, Deputy Director
General (Crop Science), ICAR;-New Delhi on 21-05-2008 regarding the
road map for the promotion and utilization of BN-Bt cotton
\
\
,
1
,
I
'/
i
i
I
Attendance: As per AnnekI
The meeeting was held at ICAR HQ under the chairmanship of Dr. P.L.Gautam,
Deputy Dirdtor of General (Crop Science), ICAR, New Delhi to discuss future
strategies
The' Chairman congratulated all those involved in the development of BN BL
. . .
Thereafter discussions were held on the different aspects related to the popularization of
the product and future research work. AcCordingly discussions were held and the
following decisions were taken.
1. Seed production ofBN Bt will be taken up on ISO acres ofUAS Dharwad Farms
d '2008-09.
unng . >
(Action: vAs, Dhal'?':l.d)
-
z. Seed production ofNHH-44 Bt will be organized by UAS Dharwad on 200 plots
to pro<Juce minimum of 200 q.
(Action: UAS Dharwad)
3. BN Bt seeds sale price was discussed and it was decided that VAS Dharwad may
work out the cost by taking into account the cost of seed production, etc.
(Action-: VAS, Dharwad)
4. Package ofpractices of cultivadon of'BN Bt and NHH-44 :St has to be developed.
(Action: Concerned centreslProject Co-ordinator, AICCIl')
5. Refugia seeds of similar fibre quality or BN nonBt and NHH-44 Non Bt may be
supplied along With Bt seeds as per GEAC guidelines.
(Action: VAS, DJ,llirwad)
6. ConverSion of popular varieties! parents of hybrids of Bt using the Dharwad event
will continue.
(Adion: VAS, DhaIWad, CICR, Nagpur, NRCPB, New Delhi)
<'Ia iilfi tk:Jmiqu!;>nan,ue
on 'f1anking sequence analysIs. The jeft border f1iliililiig sequeI1,ces
to cotton bac clone No.106 I 22(Nc;BI) and Right border belongs 10
.(Lox I). gene. Dr also presented the results of
il$..-l!SlS that the Dharn:ad event IS different from that of the other known
, f'ti'3bsgene events. .

'u\\ 'V\ ..
liS
"
"
'j
,
,

.f
-I
J
1
-
-
-I
8. DDG (CS) instructed the group to identify the particular chromosome in which Bt
gene got inserted.
(Action: Director, NRCPB, New Delhi)
9. Registration of BNpt with PVPFR has to be done on priority jointly by, NRCPB,
CICR, UAS, Dharwad and Rajasthan Agriculture University, Rajasthan.
(Action: Director, NRCPB)
10. Further work on gene pyramiding has to be taken up.
(Action: NRCPB, VAS Dharwad and CICR Nagpur)
11. 1m: compliance of GEAC and RCGM orders and permission have to be done by
-Dr P. Ananda Kumar NRCPB, New Delhi, Dr G. Balasubrarnani, CICR, Nagpur
and Dr 1. S. Katageri, Senior cotton Breeder VAS, Dharwad immediately.
(Action: NRCPB & VAS Dharwad)
12. Trypsin inhibitor trait identified already in the cotton germplasm should also be
incorporated in BN Bt which will be better option for broaden protection against
lepidopteran insects.
(Action: OCR, Nagpur)
All me)Ilbers agreed to make efforts ,to commercialize this event by developing popular
-Bt varieties and hybrids. '
The meeting ended with a vote of thanks to the chair:
;l
~
l
I
I
116
7. Dr. KR.Kranthi, Principal Scientist, Head, Crop Protection Division,
Jlr,n t.
CICR. Nagpur.
ccdings ofthe meeting with Dr. P.L.Gautgam, Deputy II
'tral(Crop Science), ICAR, New Delhi on 21-05-2008 at
l. Dr K.CJain ADG(CC)
"'1\
2. ADG(Seeds)
3. Dr P Anandlrumar, Director, NRCPB, New Delhi
4. Dr...B.M.Khadi, Director, CICR, Nagpur
5. Dr I.S.Katageri, Senior Cotlon Breeder, UAS, Dharwad
6. Dr H.M.Varnadevaiah, Biochemist, UAS Dharwad
'."
.,
6 following members were present
I
!
!
-I
I
/11-
ANNEXURE-XII
Confidential
PPV&FRA/PS-2/
01 June 2012
CHAIRPERSON
protE-ct ..'" of Plart Vartetles and ra!'"l""1e
r
s
I.utlle It'l 'Mlnlstry of Agncu!ture,
GovernMent of 'nd1a
21d Floor SOCieties Blon NASC
OPS Marg !\lpw De-It"! 1100 2

G'I>l1 3/r7 "j'./'l>f( 4HI"l

,=
ilM iffi<l;.
. .
.."rq 4"1 "".t... tJIT1

-;;r i
I
f:' ...
tE: !

.;i
,

.'" Please refer to your D.O. letter No.2-11/0B-CLI dt.l6 May 2012, regarding queries
E-1 i- raised by the Expert Committee examining the issues relating to contamination of BnBt with
&: MONS3!.
2. At the very outset. it would be relevant and significant to point out that I served as
Deputy Director General (Crop Science), ICAR from 12/10/2007 to 31/12/2008 Le. about 14
months. Thereafter. 1 was Chairman of National Biodiversity Authority. Chennai, an autonomous
body of Ministry of Environment and Forests from 31/12/2008 to 3/11/2010. Consequent upon my
appointment as Chairperson, Protection of Plant Varieties & Farmers. Rights Authority, an
autonomous body of the Ministry of Agriculture, I am carrying this responsibility from 4/11/2010 till
date.
3. The matter under reference pertained to the meetings held in 2008, about 4 years
ago, and hence I had to request for referring / consulting the relevant records on the subject
maintained by the Crop Science Division of ICAR 1 am thankful to you for providi.ng me the
opportunity to browse the related documents and fOlwarding the copies oftbe relevant papers.
4. After inspection of the records, 1find the following documents of relevance to the
issues indicated in your letter under reference:
Minutes of the meeting held on 21 May 2008 under my Chairmanship.
Minutes oftbe meeting held on 12 Dec 2008 under my Chairmanship.
General note ofDr Khadi on 'Development of Blkaneri Nerma (BN) Bt' dtI7/0S/2008.
Letter of Dr. Kranthl addressed to Dr. K. C. Jain, ADG (CC) (F.No.PS.l/2/2008
dtOS/09/2008) regarding "Draft Proposal for Licensing BN Bt Bt-Cotton".
Confidential letter from Dr Kranthi addressed to Dr K C lain, ADG (Ce)
F.No.PS/ConfidentiaI/2009 dt21/10/2009 on 'Development of Bt BIkaneri Nanna with
Bt event BNLA 106'.
So called proceedings of 'meeting held under the Chairmanship of DDG (CS) on 10th
December 2009' at NRCPB, New Delhi.
Minutes of the meeting held under the Chairmanship of Dr S K Dutta, DDG (CS) on
27/12/2011. .
Meeting held under the Chairmanship of Dr 5 K Dutta, DDG (CS) on 7/1/2012 for
responding to letter from Lok Sabha Secretariat
List of points reqUired by Lok Sabha Secretariat pertaining to BNBt issue (F.No.2-11/08-
Cc.l dt,24-/01/2012).
News clipping in Express India and Hindustan Times.
Tel: 01125848127. fa. 0112S840478 Website www.pl.ntauthorlty.gov.in
'. f mall: c.hatrperson--ppvfra@nic.in.
118

5. In addition, In my present capacity as Chairperson. Protection of Plant Varieties &

Farmers' Rights Authority. New Delhi. a file was put up for my orders in Jan 2012 for withdrawal of
the registration of the BnBt variety. Application for registration of the BNat variety was received
from Director, CleR by PPV&FR Authority {application assigned no.REG/2009/241 file na.N13 GH126
09241 - Tetraploid Cotton, Gossypium hirsutum L BN 8t Variety, filed on 08/05/2009}. The request
to withdraw /cancel the said application for BN Bt was received from Dr KRKranthi, CICR, Napgur
vide F.No.PS.l/2/2012/2 dt.t4.01.2012. Leave for withdrawal of appIkation of registration ofBN Ot
was granted by PPV & FR Authority .vlde order No.PPVFRA/Registrar/18-13/2007/2885
dt.16.01.2012 [Annex I).
6. Based on the aforesaid documents, the following facts are being stated with respect
to the two points indicated in your letter under reference:
i) Dr Kranthi did not inform me about the cQlltamlnation of BnBt with MONS31 either dUring
or after the meetings he:ld under my Chairmanship In 21 May and 12 Dec 2008. The minutes of
these meetings are official records reflecting the unanimous decisions of the members and were
circulated to all concerned. Even after circulatio.n of the minutes, no member reported any
dlscrepancy or any issue pertaining to recordingof the minutes. It is pertinent to mention that Dr
Kranthi was present in both the meetings held in May and Dec 2008. Further, in the letter
dt.OS/09/2008 addressed by Dr Kranthi to Dr KCJain. ADG (CC). in the draft proposal for licensing
of ON Bt cotton ofICAR, Dr Kranthl has narrated as under:
'The first Bt cotton variety in G. hlrsuI:UQILi,nn 'BIkaneri NannaBt'developed by ICAR
(UAS, Dharwad, CICR, Nagpur ami 1ARl, new DeDit) was offldally released for tlOIDilterdal
CUltivation In 2008 in the IJ4th Jneeling of GtlA(: held on 2nd May 2008. This Is a landmark
athJevement In biotech research in the institute as well in dae K:AR. This is the first biotech
product of the public Institute research and has for dae first lime created an eamolnil:a1
option for the farmers in India".
In addition. Dr Kranthi has written the folloWing letters, wherein he has not mentioned about
any contamination of the QNBt.
3/2/2009 ro DlfeCtorO/Seeds, Dhll/woo;
11/2/2009 ro Dr KCjain, ADG (CC);
19/2/2009 roDrKCjOin,ADG (CC}-'NriJiTglySigned.as 19/2/2008;
S/03/2(}fJ9 to 1'Jr KCjair!, ADG (CC);
24/3/2009 to DrS Mauria, ADG(IPR&Pol/cy);
30/3/2009 ro ViaChancellor, DharWGd;
2/4/2Q09; email dt 16/6/2009atfdre$Sed to Dr KCjain, ADG (CC)
i1) Similarly, Dr Kbadi also did not inform after GEAC clearance for com.merctalizatilln of
BnBt. that BoBt ha(l been-COlltamiJlated witht@llS3+ either. during or after the m.eetings ofMayor,
Dec 2008. Dr Khadi was present!nthe meeting held. inMay 2.000 and has signed the iIlinutes of the
meetingallke other merl1bats. Had the matter been r'l!jJoi'tl!tl /conveyed to ICAR or the undersigned.
It could have been discussed and necessary inclnding the issuance of corrigendum, if
reqnired.
Further, Dr. Khadi's note dt.17/0S/2008 on development of Bikaneri Narma (BN Bt) also
does not indicate any contamination. Rather, lie Is full of praise and acimowleilges the
entouragement of all I!fficers of ICAR including the undersigned, in guiding the develppl1lent of BN
Bt. (Annex II)
2/Poge
//9
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
i
-
Even in the letter dt23 May 2008 of Dr Khadi (written before his leaving CICR, Nagpur to
join UAS, Dharwad) addressed to Dr Ranjini Warrier, Member Secretary, GEAC, (with a copy to ADG
(CC), there is no mention of any contamination.
7, The perusal and scrutiny of the documents reveals that it was only through the
'Confidential note doted 21/10/2009' on development of Bt Bikaneri Narma with Bt event BNLA
106; addressed to Dr KCJain. ADG (CC), that Dr Kranthi for the first time reported to the ICAR about
the contamination of BNBt with Man 531. doing so, he has tried to distort the minutes of the
meetings held under my Chairmanship in May 2008 and Dec 2008. which is apparent from the facts
stated in Annex III.
8. Subsequently, in the so called meeting held on 10 Dec 2009, Dr Kranthi has added
new dimensions to the matter, which are at variance from the recorded facts. The minutes of this
meeting held on 10 Dec 2009 are signed by Dr Kranthi only. The same is neither appended with
any covering letter, nor It appears to have been circulated or Issued by the competent officer of
the lCAR HQ. The said meeting was also attended by Dr Henchinal, V.C, Dharwad and Dr C 0 Mayee.
the then Chairman, ARSB. I could have also been invited as 1was available in India for any guidance /
clarification on the subject Alternatively, the author of the so called minutes could have referred to
the original proceedings of the May and December 2008 or could have sent the minutes for my
comments / inputs. However. none of these courses were followed. Instead, information as distorted
by the author of the so called minutes was taken as the basis for inclusion in some of the subsequent
meetings/events on the subject including providiog the information under RTI and / or
communication to press / media. Hence this act on the part of the author of the distorted
proceedings is abnormal. unexpected. unacceptable and undesirable. In this regard. some glaring
distortions in the so called minutes of the meeting held on 10 Dec 2009 are mentioned in Annex lV.
9. Based on the above facts and circumstances, it is reiterated that neither Dr Kranthi
nor Dr Khadi had informed me about the contamination of the BN Bt with MON531 during my tenure
as DDG (CS) ICAR from 12/10/2007 to 31/12/2008 or thereafter. Such narrations on their part are
unnatural. shocking and undesirable, being far from facts on record. 1hope that this clarifies the facts
on the matter as available on records. which may be helpful to the Expert Committee.
Yours sincerely,

(P LGautam)
Sh. Rajiv Mehrishi
Spedal Secretary, DARE
GoVt. of India
Ministry of Agriculture,
Krishi Bhavan, New Delhi 110014
End: As above

l:l..O
Annex I
-
-
-
-
Leave for withdrawal ofapplication ufregistration ofBNBt
granl:JJd by PPV& FR Authority
dmtierlh
....C..... G'''C4U
To.
DlNctOl'
_ .... ""e-_rchIClCRl
PIlet _ NO. 2, SIl...... "-PO
........ -t4O 1110 """"""-'11tldIe
PratactilMl .. PIHt VadeIIes and
........... RIgfll AlIdIOrIY
M!lIItIry "
...su........
-
-
-
M:' of JltliJlIc.lout of caftdld .,.,.... 8M8t
,.....ac= 'c, Cd _ ftI!GI:2UlOIt)
".... _10,.... _ _ F No. P8 1OJ2012 d-.cIJInuwy 13. 2012 ,.c._irI _
_ -, In _ NlJ8"l. 10 _"-h you _ ,.,... F No
PS.11212Q10r.D55 -57 _ 03. 20" IQr _._-.f.....__.. '
M
" ..OMce.ltiltDlnIormyou"''' Lr'dW are und!Ir"pror I. etlan
...- _ 24 (6} olPP\I&FR IvI. 2001. In _ ""_"' "'_I; " tilW'_
10< __'" STV,,- "" _ 01 _e- R_I d\(ICAAl wlIl
nl:lt be PIC ," furth...m me pRWiMJnat pfC'oQ'gn aIeo ... oa"c.,tlldwMh urn, tilall

......... _forWllhlt4.... ..Q
........ . dUll' ......, _ 01 wi .... ,..... 1_hOIdete _ III
.. 1C... forNQllldl.
copy"".
./ 1. C1ii11tt...._,PmtDtioo or ..... V.. ....
I. 'it .. 11 .. ...'I.odo"..r..-""""'1 ,,.,,.a-,,,lJdlOIiCr.Hw
0eIlil.

__ -ttteu (1lItW)
fWltClJlllill'., -..-.TICI, OMIlI-UDal1NllJt)
-'15
....l .............. t :JftAlI"f 11[""'" aodft
4/"g.
1.2-1
-
-
-
-
-
-
-
-
.
,
Annex 11
Note ofDr BM Khadi dated 17/05/2008 on
The development ofBlkaneri Henna Bt (G.hlrsutumj
It is a great pleasure to place on record about the development of Blkoneri Hermo Bt (G.hirsutum). The work
started under the NATP Mission Mode programme with the provision oJ Cry 1 Ac gene by Dr.P.Anand Kumar. I
NRCPB New Delhi and PI oJ the project involving VAS Dharwad and CICR Nagpur. The tronsJormation was
successfully done at ARS Dharwad by Dr I S Katageri. Senior Cotton Breeder after obtaining training at Texas II
A&M USA and identified with preliminary tests alongwith DrS.5.Udikeri. Dr HM Vamadevaiah and Dr.Manjula
M. under Cooperating Center PI Dr.B.M.Khadi. Most oJ the molecular aspect of presence and integration oJ!
gene by Dr.P.Ananda Kumar. NRCP8 New Velhi and gene expression through E"/,ISA by Vr.K.R.Kranthi were
carried out at NRCPB New Delhi and CICR Nagpur respect/vely.
wter the conduct oJstrip trial. RCGM Multilacation trials were proposed from ClCR involving ClCR Regional
stations. SAUs oJall the three catton growing zones. The data on required traits were collected by group oJ
scientists at ClCR Nagpur; Caimbotare. Sirsa. SAUs. HAU Hisar. PAU /'udhiana, RAU Sriganganagar, MAU
Nanded, NAU Surat, ]NKW Khandwa, VAS Dharwad, ANGARU, /,am and Nandyal. Dr.I.S.Katageri, Dr.SB.Patii.
Dr.SS.Pat/l, Dr.S.N.Chattonnavar and Dr.5.5.Hallikeri involved in multiplication, providing of required
quantity oJseeds ta different trials and data. Dr.B.M.Khadi, Dlreetor, ClCR Nagpur and his scientists Jacilitated
in conductingfield trials in the centres and biosaJety tests at different ICAR and private Institutes with the help
oJ scientists from ClCR Nagpur and VAS Dharwad and the environmental safety studies like pallen flow
(Dr.VSanthyJ, soil microflara (Dr.P.K.Chakraborty), effects on earthworms (Dr.Blaise), crossability with wild
species (Dr. Vinito Gotmare) were corried aut at ClCR Nagpur under Networlc project on Tronsgenics ofICAR.
Simultaneously conversion oJdifferent elite varieties and parentollines ofhybrids were carried out at ClCR by
Dr.5uman Bola Singh, Dr. V. V.5ingh and at VAS Dharwad by Dr.I.5.Katageri and his group. I acknowledge the
work carried out by Dr.LS.Katageri, Dr.P.Anandakumar, Dr.KR.Kranthl, Dr G.Balasubramani, Heads, ClCR
NOBpur, Regional Station Sirsa and operating centres and their Involvement right from initiation to
identification ofBN BtJar commercialization.
DurifllJ the course aJtransfonnation and testing ofBN Bt the encouragement received from Dr.5. Lingappa and
Dr SAPatil, then Director a! Research and Vice Chancellor respectively and present Vice Chancellor Dr.
].H.Kulkami is duly acknowledged. It is a great pleasure in placifllJ on record the encouragements received
durifllJ the course of development, testifllJ and identification ofBNBt for commercial cultivation especially by
Dr.CD.Moyee, as a Director, CICR Nagpur, Agriculture Commissioner and Chairman ASRB New Delhi.
Dr,/(Cjai1l, ADG(CC) Dr.G.Kalloo, fanner DDG(CS) and Dr.P.LGautam, DDG(CS), ICAR New Delhi, their
encouragement, advise and help is a so duly acknowledged.
It is a matter of great pleasure ta acknowledge Han'ble DG ICAR Dr.Mangala Rai for his constant
encouragement and guidance right from the initiation of the work as a DDG(CS) lCAR under NATP and
throughout the course of development and testing and identificatian. Everyone directly or indirectly involved
and helped In the develapment ofBNBt Is duly acknowledged.
Sdl-
BMKhadi
Director
ClCR, Nagpur
Dated 1Z 1)S '2008
Annex III
Confidential note ofDr Kranthi dated Zl/1O/Z009 on 'Development ofBtBlkaneri
Norma with Bt event BNLA 106; addressed to Dr KCJain, ADG (cq
Point No. Misrenresentatlon I distortions I facts on record
8/9
2005, _The peR result,; for crylAc showed that the samples IThis was never discussed or reported in the meetings
contained a full length gene of 3435 bp which indicated the held in May and Dec 2008
I
probability or MonS31 cvent...__The rcswlts were I
commuOIcated to Dr KhadL Dr Khadl fell thal lh.e PI'eSCtlCt:'
of MonS31 in the putative BN Bt TS generation plants could
nave been due to cont3minatlon and care would be taken to
remove the same from the original event. He Infonned that
he communicated the results and concerns to Dr Katgeri
and Dr Ananda Kumar and the appropriate steps would be
taken un
I'
2008: After completing all the mandatory biosafety testing Neither Or Khadi nor Dr Kranthi raised the issue of
and field expenmentation, the BN Bt variety was approved contamina.tion dur1ng tbe GEAC meeting
for commerda.1 cultivation in the 84
th
meeting of the GEAC
on ZMav Z008
115
Dr Khadi sent ten seeds to the Bt referraJ labs on 4
th
May This was also not discussed or reported in the meetings
2008 (which was a Sunday) tar reconfirmation of the event held in May and Dec 2008
present in BN Bt...... Eight samples were found to be
, for USA and also for MONS31.
16 A meeting was convened by Honourable DOC ( Dr P L No meeting was held an the ZI" of March 2008.
Gautam J and the issues related to MONS31 event were However, two meetings were held under my
discussed tn depth in his chamber on the 215\ March 2008 chairmanship as DOG (CS).
in the presence of Or P Aoanda Kumar. Dr B M Khadi. Dr The first meeting on 21- May 2008 was "for discussing
Katageri and other officials including the ADGs. Dr KC Jain the road map I fut1Jre st:r'aUflYfor the promotion and
and Dr Jahalemb utiliSQtfon ofBNSt cotton" and the second meeting on
12 Dec 2008 was convened to ..dlsalss the m,odaJities
for c:ommerdaUsatton / liunslng of BN Bt cotton
event BN Bt variety and lire Bt catton h,ybrkls
developed using the BNBt n'eIIt'.
This was neitheT discussed nor reported in the minutes
of the meetings held in May and Dec 2008. Had Dr
Kranthi or Dr Khadi or Dr Anaeda Kumar infonned
about the contamination in the BN Bt cotton. the
could have been recorded in the minutes and c:orreec;ive
action/me.asur:es ensured. The m1nutes of the two
meeting are official documents and ma.y be re(erred'(or
authenticitv.
17 Dr Kranthi described the results obtained by the Bt referral As indiated above. no such d1scusslon took place either
laboratory and requested that if would be appropriate to in the meeting held on 21 May or 12 Dec 2008. This is
take remedLal measures. in view of me detection of the false and call be verifIed from the proceedings of
Mon531 in the nUnlortcd BN Btsamnles.
met!tinJZS held in Mav and D.ec,2008.
19 The chairman pointed out that Dr KTantbi was an As IndIcated above, this Is touJly an after lhollibt tn
entomologtst: and therefore the results should not be blken order to mislead and misrepresent the facts. as t:}l.e
seriously. He also asked Dr Kranthl not to carry out any statement is far from (acts on records.
further moleroJar testing Qf the samples and only to tarI')'
forward the commercialisation process with full zul,
iildherinp to all the instructions laid out in the
20 The chairman decided that the BN Bt seeds would be All the decisions """ere taken unanimously after
produced by UAS Dharwad.
considerable discussions and deliberations and w;th the
conCUrrence oJ all tlle..meOlbert present In the" meetings,
inclUding Dr. Khadi (May ZOOS) and Dr Kranthl (May
and Dec 2008). It was a consensus decision and does
not reflect the Views of any individual.
6/Pogt
1:2.3.
-
-
-
-
-
-
-
Annex IV
Minutes of the so called meeting held on 10 Dec 2009 viz-a-viz facts on record
51 I Para I Distortions as indicated In the so called meeting Facts on record
Pue of 10 Dec 2009
Para 7, Ameeting was convened by DOG (CS) Dr P LGautam The meeting on 21.5.2008 held under the
10.12.2009 and issues related to Mon531 were discussed in chainnanship of Dr P L Gautam was "for dtscussln.o
(page 3): depth on 2I" May 2008 in the presence of Dr A the rood map / future strategy far the promotIon
Dr Khadi, Dr Katagen and offfidals Including and utIlIsatIon ofBNBt cotton" and not as reported.
ADGs etc. No report to this effect was received and hence these
chairman instructed that eN et seeds should bt'
sentences are out of context as they are not at all part
'ofminutes of these meetings circulated to all
concerned
Para 7 . li was derided th;"lf "rcd production will be taken up
10.12.2009 produced VAS Dharwad tn about 150 acres by all the concerned institutions and "not only by VAS
(page 3) Dharwad". It was a consensus decision and does not
reflect the views of any individual.
Para 7: Dr Kranthi described the results obtained by the Bt The entire paragraph as Indicated is not at all in
10.12.2009 referral labs. and requested that It would be confonnlty being totally at variance from the
(page 3) : appropriate to take remedial measures in view of the recorded minutes of the meetings held in May and
detection of Mon531In all the purported BN et seed December 200B. It has been wrougly quoted as my
samples. He pointed out that the Awasthagen data statement with ulterior motives in my absence.
were flawed since the lell: border sequences of the
insert were not contiguous with the right border
sequences on the bac done and also the primers were
not functional. He requested for a third pany analysis
to reconfinn the event data so that sertolls
repercussions couJd be avoided in future.
................The chairman (Dr P LGautam) had then
concluded that the possible presence of Mon531 was
not an issue any more because of the strong
molecular evidence produced by Dr Ananda Kumar.
He said that the issue was dosed and asked the
Director OCR to carty forward the commercialisation
process with full zeal. adhering to all instructions laid
out in the nrocee,Hno<
Para 12: Dr Ananda Kumar said \h;Jt even pri.or to the 21 May The contamination of BN Bt event with that of
10,12.2009 200e meeting. he had been Infomed by the seed MonS31 event In BN Bt cotton seeds was neither
(page 5): industry sources about the possibility of the presence pointed out in IBSC meetlugs held in May 2007 and
of the MOD 531 event In the BN Bt seeds. In response, March 200S nor in the GEAC meetings held In 2008
he had conducted event testing with Mon531 specific or at the time of filing for registration of the variety
primers using old DNA samples that were obtained with PPV&FR Authority In May 2009. It was
from the original eNLAI06 event of VAS Dharwad. Incumbent on the part of the respective Institutions I
The results were negative. He saId It was possible scientists involved in the development of the said
that contamination with MonS31 would have variety to report the problem, if any, to the ICAR as
occurred sometime before the testfng was CllTried out and when noticed,
In Dr Kranti's lab in 2005. In specific response to a
query by the cbainnan. Dr Ananda Kumar _.._
agreed that the flanking region sequences ofthe
purporte<l eNLAI06 event provlded by Awasthagen ,
were flawed and the primers suggested by them do
not wod< for event Identification
OnO' signed by Dr Krantht has no covering does nat appear to hove been circulated or issued by ,
the.Camperento!ficers ofthe'/CAR HQ
INDIAN COUNCIL OF AGRICULTURAL RESEARCH
KRISHI BHAVAN: NEW DELHI
F.No. 13(6)/2006-IPR
Dated 16.10,2006
SUB: PROCEEDINGS OF THE MEETING ON THE "ISSUE OF
COMMERCIALIZATION OF Bt-Gry1Ac GENE OBTAINED FROM
UNIVERSITY OF OTTAWA, CANADA FOR THE BENEFIT OF COTTON
FARMERS IN INDIA" HELD UNDER THE CHAIRMANSHIP OF DDG(CS & H)
ON 5.10.2006 AT 12.00 NOON
Please find enclosed herewith the above proceedings
information/necessary action.
for your kind
~
Asst!. Director General (IPR &Policy)
Distribution
1. Dr. N.D. Jambhale, ADG (Seeds)
2. Dr. V.D. Patil, ADG (PP)
3. Dr. S.N. Shukla, ADG (FFC)
4. Dr. K.C. Jain, ADG (GG)
5. Dr. T.P. Rajendran, ADG(OP)
6. Dr. S.N. Pandey, ADG(H)
7. Dr. KV Ramanna, ADG(PC)
8. Dr. 8.M. Khadi, Director, C'CR, Nagpur
9 Dr. P. Ananda Kumar, Principal Scientist, NRCP8
1Lf: .. ;" ;.. _,,,:,j,,,., Di,dctC,I, t,I',CPB, Pusa. New Delhi.12
11. Copy for kind information PS to DDG(CS&H)
./
/
PROCEEDINGS OF THE MEETING ON THE "ISSUE OF COMMERCIALIZATION OF
Bt-Cry1Ac GENE OBTAINED FROM UNIVERSITY OF OTTAWA, CANADA FOR THE
BENEFIT OF COTTON FARMERS IN INDIA" HELD UNDER THE CHAIRMANSHIP
OF DDG(CS & H) ON 5.10.2006 AT 12.00 NOON
The list of participants is placed as Annexure-I.
The meeting began with a brief background on the issue by ADG (IPR). Two
facts that emerged in the preliminary discussion were as follows:
1. R&D work related to release of indigenously developed Bt cotton
hybrids/varieties and containing Cry1Ac gene obtained from the University of
Ottawa, Canada is at a very advanced stage. It is expected that the ICAR-
SAU system may be able to propose the release of these materials for
cultivation by the farmers by the year 2008. The release of indigenously
developed Bt cotton varieties is an issue of immense interest for the poor
cotton farmers. Farmers cultivating these Bt cotton varieties shall not have to
buy the expensive hybrid Bt cotton seed from the private seed companies
every year. Even the cost of indigenously developed Bt cotton hybrids from
the ICAR-SAU system is expected to be much less than the cost of similar
seed from the private sector.
2. In view of the advanced stage of research and the likely economic benefits to
Indian cotton farmers and the economy, the legality of the 'agreement'
between Dr. RP. Sharma, the then Director NRCPB, New Delhi and the
University of Ottawa to use this CryiAc gene is an issue to be examined for
its implications in the Indian context.
Subsequently, the following decisions were taken.
1. The so-called 'Biological Material Transfer and Collaboration Agreement' in
question is between Dr. RP. Sharma, the then Director NRCPB, New Delhi and
the University of Ottawa. It appears to be only a kind of understanding at their
personal level. It may not be considered as an agreement at the national level.
This view emerged in view of the fact that this matter was never referred by
NRCPB at that stage to the ICAR Hqrs., and Dr. R P. Sharma signed the
understanding in his individual capacity. Accordingly, it was felt that in' case
ICAR-SAU system has to submit in future the proposals for release of
indigenously developed varieties/hybrids in India and containing this gene, the
issue of IPR or ownership on this gene may not be any issue at the national
level. However, it was considered appropriate to send the so-called 'agreement'
and these proceedings to Legal Advisor ICAR for the opinion of Law Section
ICAR on the 'legal validity' of the so-called 'agreement' in India. ADG (IPR) can
explain the case to Legal Advisor ICAR for arriving at an opinion.
(Action: ADG (IPR) and LA. ICAR)
\ )..6
/
/
..
2. The nature of the gene was discussed in detail. Four Cry1Ac genes in the Indian
context were referred to. It was noted that other than the Cry1Ac gene of
Monsanto-Mahyco venture which was first released in the form of different 8t
cotton hybrids in India, two other similar CrY1Ac gene(s) from the public sector
have also been allowed in the current year 2006 by GEAC, Ministry of
Environment and Forests, Gal to two other Indian private companies for release
into the environment in the form of Bt cotton hybrids. Accordingly, it was felt that
for all practical purposes this gene in question from NRCPB shall be called
1\ 'truncated Cry1Ac toxin gene from NRCPB, New Delhi'. Nevertheless, it was felt
that the ICAR-SAU system should be prepared to meet any GEAC requirement
at the time the question of release of materials containing NRCPB gene arises. It
was, accordingly, decided that as a preparatory exercise we must be ready with
the likely GEAC requirement with respect to the NRCP8's gene vis-a-vis all other
Cry1Ac gene.s in India'. For the purpose, a note be jointly prepared by Drs. P.
Ananda Kumar and B. M. Khadi. This note will be strictly confidential for internal
use only.
(Action: Drs. P. Ananda Kumar and B. M. Khadi)
3. It was decided that we should continue with R&D and bio-safety related work for
release of indigenously developed Bt cotton varieties/hybrids. If any difficulty is
encountered in future, that will be handled at that time in future. For the same
reason, it was also decided that the 'Freedom to Operate' analysis as desired by
the University of Ottawa in its e-mail correspondence with Dr. P. Ananda Kumar
is not required at this stage.
The meeting ended with a vote of ihanks to the House and the Chair.
.