Bachtiar BM et al.

, IJSID, 2013, 3 (1), 101-108

ISSN:2249-5347

IJSID

International Journal of Science Innovations and Discoveries

Research Article

An International peer Review Journal for Science

Available online through www.ijsidonline.info

KNOCKOUT OF htrB GENE OF AGGREGATIBACTER ACTINOMYCETEMCOMITANS AFFECT THE BACTERIA INTERACTIONS WITH PHAGOCYTE AND NON-PHAGOCYTE CELLS
*Department of Oral Biology, Faculty of Dentistry, University of Indonesia, Indonesia
*Bachtiar

B M. and *Bachtiar E W.

Received: 09-01-2013 Accepted: 17-02-2013

*Corresponding Author

gram-negative bacteria, but its involvement in the virulence of Aggregatibacter periodontitis,still requires elucidation. This study aims to investigate the effect on actinomycetemcomitans, which encodes the acyltransferase of lipid A, was deleted by homologous recombination, a gram-negative bacteriumassociated with aggressive

The htrB gene plays an important role in the biosynthesis of the LPS polymers of ABSTRACT

bacterialhost interactions in an A. actinomycetemcomitans strain in which the htrB gene had been selectively inactivated. Methods: The htrB gene of A. actinomycetemcomitans, and the knockout mutant and wild-type strains were compare with respect to bacterial Address: Name: Bachtiar BM Place: University of Indonesia, Indonesia E-mail: boy_mb@ui.ac.id HaCat cells, respectively. In addition Nitrit production by host cell and bacterium serum ability to adhere to HaCat cells. However, in comparison to the parent strain, the mutant mutant strain induce Nitrit production of infected cells but the bacteria was less serum virulence-associated genes of A. actinomycetemcomitans. line. interactions with phagocyte and non-phagocyte cells using rat peritoneal macrophages and sensitive was assased Results: The htrB knockout mutant survived in phagocyte cells, but Additionally, both the wild-type strain and the mutant show no strong differences in the

their numbers were significantly lower (P <0.005) than those of the wild-type strain. could not effectively penetrate the non-phagocyte cells. The study also revealed that phagocyte cells. This study indicated that thehtrB gene is involved in the regulation of Keywords:A. actinomycetemcomitans. htrB. Acyltransferase. Lypopolysacchade. HaCat cell

resistance. Conclusion: These observations demonstrated that inactivation of the htrB gene of A. actinomycetemcomitans reduced its interaction with phagocyte and non-

International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

101

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

potential virulence factors have been identified, their exact role may be determined by making use of isogenic mutants (2). Such mutants can be produced by targeted gene inactivation. Such molecular genetics require the introduction of the DNA into conjugation (3) the target organism, which can be achieved in several ways: natural or induced transformation, electro-transformation, or The lipopolysaccharide (LPS) of A. actinomycetemcomitans, especially the lipid A portion, contributes to bacterial virulence Aggregatibacteractinomycetemcomitans is a gram-negative bacterium that cause aggressive periodontal disease (4).

Research involving pathogenic bacteria has become increasingly dependent on genetic manipulation (1). Once INTRODUCTION

(5,6). However, as the lipid A structure of gram-negative bacteria undergoes variation (7) that can result in the expression of different lipid A units, it is possible that the bacterial-host interaction will vary within an individual strain. Thus, the number of in vitro experiments. the effects of a mutant of A. actinomycetemcomitans in which the htrB gene had been selectively inactivated by performing a MATERIALS AND METHODS

importance of lipid A for the bacteriums survival in the environment makes LPS an appropriate molecule for studying host-

bacterium relationships. In order to investigate whether the htrB gene is involved in bacteria-host interaction, we evaluated

microaerobic conditions containing 10% CO2 on trypticase soy agar or broth (Merck, Darmstadt, Germany) containing 0.6%

yeast extract (TSB-YE/Difco; Becton, Dickinson and Company, Franklin Lakes, NJ, USA) as described previously (8). The A. actinomycetemcomitanshtrBmutant was cultured on the same medium supplemented with kanamycin (30 g/ml; Sigma,St. Louis, MO, USA). Isolates of A. actinomycetemcomityans spp.were cultured at 37C for 18 h in microaerobic conditions and,

A. actinomycetemcomitans, a clinical isolate that is routinely maintained in our laboratory, was cultured at 37oC under

when appropriate, were standardized to a cell suspension with an optical density of 2.1 x 10 8 cells/ml using spectrophotometry and counting of colony-forming units (cfus) in agar medium. Escherichia coli GM 2163 (Fermentas, Findland, EU) was used as the host for pBluescript SKII (+) (a kind gift from Dr Peter Smooker, Department of Biotechnology and Environmental Biology, RMIT University, Australia) as well as all recombinant plasmids. This strain was also used as a USA) with or without ampicillin (100 mg/ml; Sigma, St. Louis, MO, USA) or kanamycin (40 mg/ml; Sigma, St. Louis, MO, USA). HaCat and rat macrophage (RAW 264.7) cells were cultured in Dulbeccos Modified Eagles Medium (DMEM; Invitrogen, Indonesia. Creation of the htrB mutant Salmonella serovarTypimurium was used as a positive control for the adhesion and invasion assays and was grown in LB broth. Carlsbad, CA, USA). This study was approved by the ethical clearance committee of the Faculty of Dentistry, University of negative control for adhesion and invasion assays and was grown at 37oC in Luria-Bertani (LB) medium (Sigma, St. Louis, MO,

create an htrB- mutant in A. actinomycetemcomitans. A suicide vector was constructed using the neighbor-joining method as described by Bachtiar (9). First, a 390 bp DNA fragment, containing 276 bp of the htrB gene and 114 bp of flanking region International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

sequence from the neighboring DNA, was amplified with primer-1 (P-1) (aagccaaaagccccaatgt, forward) and P-2

The acyltransferase gene (www.oralgene.lanl.gov), which is flanked by two other open reading frames, was used to

102

(gtggtcaaaaattgaa, reverse). P-1 and P-2 contained EcoR1 and BamH1 restriction sites, respectively, at their 5 end. The PCR

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

product was cloned into the multiple cloning site of pBluscript SKII (+), and restriction enzyme analysis was used to confirm

that the recombinant plasmid pBluehtrB-1 had been obtained. Second, primers P-3 (gaagtcttcaccgaacag, forward) and P-4 fragment that contained 400 bp of the 3 end of thehtrB gene and 1100 bp of the 5 end of the flanking sequence from the cloning site. The resulting intermediate plasmid was named pBhtrB-2. The kanamycin cassette was isolated from the pMW2 vector by digesting it with BamH1, and a Gene Clean DNA purification kit (Promega, Madison, WI, USA) was used to purify a actinomycetemcomitans. neighboring DNA. The amplified fragment was inserted into pBluehtrB-1 between the BamH1 and Xba1 sites of the multiple

(aacttttcggtcagtcgggaag, reverse) that include BamH1 andXba1 restriction sites, respectively, were used to amplify a 1500-bp

1.4 kb fragment from the agarose gel. The plasmid pBhtrB-2 was cut at the unique BamH1 site to insert the kanamycin cassette Adherence and invasion assays Approximately 2.0 x 105 HaCat cells were seeded into 24-well plates. After 2 days, the semi confluent monolayer of

to obtain the suicide plasmid called pBhtrB-Kmr, which was subsequently used to naturally transform A. cells was prewashed twice with DMEM. Bacteria (2 x 10 8 CFU/ml) were added to the wells and incubated at 37 oC (5% CO2). After 3 h, the unattached bacteria were washed three times with agitation in phosphate-buffered saline (PBS; Sigma, St. Louis, from serial dilutions of lysates. Invasion assays were performed in a similar manner. However, after the bacteria had been mg/ml gentamycin (Sigma, St. Louis, MO, USA) to kill the extracellular bacteria. The cells were subsequently washed three as described above. Adhering bacteria were determined as a percentage of the inoculated bacteria, and invasive bacteria were test. A p-value of 0.05 was considered significant. Intramacrophage survival assays allowed to adhere to the monolayer, the wells were washed three times and then incubated for 3 h in DMEM containing 250 MO, USA), and the cells were disrupted by incubation with 2.5% Triton X-100 (Sigma, St. Louis, MO, USA) in 200 ml DMEM for

15 minutes. The binding of bacteria to the epithelial cells was quantified by counting viable A. actinomycetemcomitans cells times with PBS and lysed with Triton X-100. The suspensions were diluted, and the number of viable bacteria was calculated quantified as internalized bacteria relative to adhered bacteria. All assays were conducted in duplicate and independently

repeated three times. The significance of differences between samples was determined in these assays using the Students t(2000) for Campylobacter jejuni (9) Briefly, A. actinomycetemcomitans was grown as described above. Prior to incubation with macrophages, the bacteria were washed twice in PBS, centrifuged at 1000 x g, and resuspended in DMEM. To allow removed by washing twice with PBS, and the macrophages were exposed to 250 ug/ml gentamycin for another 30 min to kill were wash twice more with PBS without antibiotic and incubated for an additional 3 h and 6 h to analyze the survival kinetics viable bacteria, the sample was platted onto trypticase soy agarplates in duplicate experiments, each repeated three times. International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013 the extracellular bacteria. After this,the intramacrophage survival assays were performed. Briefly, the infected macrophages Infection of macrophages (RAW 264.7) with A. actinomycetemcomitans was performed as described by Day et al.

phagocytosis of the bacteria, the macrophages (105 cells) were exposed to 100 ml of 106 CFU/ml A. actinomycetemcomitans in

DMEM. The wells were placed in a 37C humidified incubator with 5% CO2 for 30 min. The non-adherent bacteria were of the organisms. Following each incubation time, the cells were lysed with 0.25% Triton X-100 (Sigma, St. Louis, MO, USA) for

15 min to release the intracellular bacteria. The suspension was mixed and serially diluted in PBS. To determine the number of

103

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108 Nitrite assay reaction (Promega) from the culture supernatant after 24 h dan 48 h. All experiments were performed in triplicate and each using standard solutions of sodium nitrite prepared in cell culture medium (10). Serum sensitivity assays. Papapanou (11-12). The effect of the inactivation of Aa htrB gene on production of NO by macrophages was determined by Griess

culture was repeated 3 times. Accumulation of nitrite in the culture medium was determined by a colorimetric assay with the

Griess reagent. The collected medium was mixed with an equal volume of Griess reagent (1% sulfanilamide and 0.1% N-(1naphthyl)-ethylenediamine in 5% phosphoric acid). Nitrite concentrations were determined by comparison with the OD 550 The wild type and mutant A. actinomycetemcomitans strains were subjected to in vitro test for serum sensitivity All statistical analysis was performed using T test,with the level of significance set at 5%. RESULTS

assay. The strains were tested for the effect of the inactivation of the htrB on serum sensitivity according to Meyer and The plasmid pBhtrB-Kmr containing the htrB gene was successfully created (Figure 1), and this plasmid was then used
10.

to introduce a kanamycin resistance gene into thehtrb coding region of the A. actinomycetemcomitans genome. The resulting mutant construct was then used to transform an A. actinomycetemcomitansclinical isolate by natural transformation gene were used to transform A. actinomycetemcomitans, thus reducing any possible polar effects. presence and orientation of the kanamycin cassette in the htrB-mutant transformants were confirmed using the PCR using

primers P-1 and P-4, which flanked the inserted fragment, and to confirm the double crossover event between the donor Analysis of adhesion and invasion capabilities and the survival ofthe htrB mutant in phagocyte cells were examined

plasmid and the acceptor genome. Only constructs containing the Km r gene in the same transcriptional orientation as the htrB next. In order to determine the effect of the htrB mutation on bacterial adhesion and invasion, the htrB mutant and its parent strain were exposed to the epithelial cell line (HaCaT). As shown in Table 1, the capacity of the htrB mutant to adhere to HaCat < 0.02).

The

cells was similar to the parent strain. However, the invasion capability of the htrB mutant was lower than that of wild type (P

Figure 1.Schematic illustration of the cloning and inactivation strategy for the htrBgene of A. actinomycetemcomitans. The pBhtrB-Kmrplasmid was constructed by using the neighbour-joining technique as described in the Materials and Methods. E=EcoR1, B = Bam H1, and X = Xba International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

104

rat macrophages is shown in Figure 2. The survival percentage of the mutant strains was lower at all experimental time points (p<0.05) (Fig.3).

Table 1- Adhesion and invasion abilities of A. actinomycetemcomitans Bacteria [cfu/ml] Bacteria [cfu/ml] Bacteria [cfu/ml] Strain Inoculation Adhesion Invasion % 7 5 Wild Type 6.2 X 10 [4.3 3.3] x 10 [1.4 0.8] x 10 0.30% HtrBmutant 3.36 0.1 [3.6 4.4] x 106 [2.6 2.0] x 105 7.00% P >0.05 P >0.05 The table shows the mean standard deviation [SD] of adherence and invasion assays, each of which were carried out in duplicate and repeated three times.

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

(P <0.05). In addition, production of NO could be seen in macrophages infected by Aa mutant htrB- in time dependent fashion
Percentage of recovered bacteria
1.E+02 1.E+02 8.E+01 Mutant 6.E+01 4.E+01 2.E+01 0.E+00 0 hour 3 hours TIME 6 hours Wild type

Intra macrophage survival assays were performed using rat macrophages. The time-dependent kinetics of survival in

Figure 2. Bacterial cell survival within rat macrophages between mutant and parent strains of A. actinomycetemcomitans.The survival percentage was calculated as the percentage of bacteriarecovered after each period of incubation (36 h) after 30 minutes of contact with the phagocyte cells (0 h).

A.actinomycetemcomitans wild type and the htrB mutant in serum and assessment of their status as resistant or sensitive. incubation time. In this case, the mutant strains were considered sensitive because they yielded a survival index < 0.5 after 1h International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

Figure 3. Production of Nitrite in macrophages infected by Aa mutant htrB and wild type after incubation of 24h and 48h.

Although all the bacteria were inhibited in their growth, they were not killed and remains recovered after a 60-minute

The effect of mutating the htrB gene on serum susceptibility was investigated by using FBS to show the behaviour of

105

incubation time. Although it was still able to survive in FBS, the reduced numbers are significantly less compare to the parent strain (p < 0.05) (Figure 4).

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

Figure 4. Susceptibility of wild type (WT) and mutant strains of A. actinomycetemcomitans to serum-mediated bactericidal activity. LPS is an important cell surface component of A. actinomycetemcomitans (5,6). DISCUSSION

concerning the contribution of the htrB gene to bacterialhost interactions, some biological activities associated with bacterial in the A. actinomycetemcomitanschromosome. The constructed plasmids used to create the mutant contained more than the actinomycetemcomitans lipid A as playing an important role in the organisms colonization of epithelial cells.

virulence were analyzed: bacterial attachment and cell invasion. To determine the role of the lipid A structure in bacterial host interactions, a mutant defective in the natural structure of LPS was created by inactivating the acyltransferase gene htrB this study, the htrB mutant and its parent strain showed a similar ability to adhere to cells, but the invasion ability of thehtrB related gram-negative organism Haemophilusinfluenzae. The experiments in this prior study showed that disruption of the The involvement of htrB in bacterial adhesion and invasion has been shown by Lee and Schenkein (13, 14), for the minimal length of flanking DNA necessary to allow homologous recombination as suggested by (7) for Campylobacter jejuni. In mutant was significantly reduced compared to the parent strain. These results implicated acylation of A. htrB gene of H. influenzae resulted in a significant reduction in binding to and internalization by human epithelial cells. Indeed, Being the first line of immunological defense, macrophages play an important role in defending the host against infectious agents, including A. actinomycetemcomitans. Macrophages and monocytes are key members of the innate immune system and

To obtain more information

our data supported the notion that the ability to adhere to and invade host cells is partly dependent on the lipid A structure.

Furthermore, LPS molecules are not the only factors involved in the adhesion and invasion of A. actinomycetemcomitans, as other molecules, including fimbriae and autotransporter (Aae), have been shown to function as adhesion factors (15, 16, 17). play a critical role in the host response during chronic infections such as periodontitis (14). Macrophages are present in higher numbers in active periodontal lesions relative to inactive sites (16). The efficiency of the macrophageA. actinomycetemcomitans interaction depends, in part, upon the ability of macrophages to phagocytose this oral bacterium. This within the phagocytes were not significantly different (P >0.05). Although both the htrB-mutant and wild-type cells showed reduced numbers after a 3 h incubation, by the end of the experiment (6 h) only the wild-type cells survived. Thus, the International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

study revealed, after the gentamicin treatment (phagocytosis period), the amounts of htrB-mutant cells and wild-type cells

106

acyltransferase of A. actinomycetemcomitanslipid A appeared to contribute to the survival of the bacteria in the macrophages

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

after 6 h. These results suggested that altering the LPS structure resulted in a higher sensitivity of the htrB mutant to the actinomycetemcomitans LPS is necessary for the bacteria to bind to the molecules specifically associated with the epithelial cells or macrophages. The experiment shows that inactivation of htrb gene in A. actinomycetemcomitans affect

bactericidal effect of macrophages compared to the wild-type strain (Figure 2). Furthermore, the natural structure of A. actinomycetemcomitans LPS is involved in intramacrophage survival, as the wild-type strain remained viable until the end of the ability of A. the experiment. However, it should be emphasized that the results of this study did not show that the nature of A. actinomycetemcomitans to induce NO production of macrophages after infection of this bacteria. Aa htrB mutant induce a the mutant will be less virulence as an impaired of LPS than the wild type as indicated by NO production by macrophages. NO (10) . In other gram negative bacteria, serum resistance is a result of the interaction of multiple cell envelope components, expressed by A. actinomycetemcomitans contributes against the bactericidal action of serum. actinomycetemcomitans contributes against the bactericidal action of serum. CONCLUSION is known as macrophages survival biomarker when the host cells fight against bacteria infection as A. actinomycetemcomitans including LPS and outer membrane proteins (17). The effect of these other cell surface components were not analyzed in this serum resistance is a result of the interaction of multiple cell envelope components, including LPS and outer membrane proteins (17). The effect of these other cell surface components were not analyzed in this study. However, the increased

higher NO production on RAW 264.7 culture compare to those induced by the wild type strain. This may due the lack of Htrb gene affect synthesis of the structure of lypopolysacharides of A. actinomycetemcomitans as shown in Salmonella. (2) Hence

study. However, the increased frequency with which the mutants were killed by serum indicated that the lipid- A antigens frequency with which the mutants were killed by serum indicated that the lipid- A antigens expressed by A. Further studies are required to improve our understanding of the molecular mechanisms involved in A. actinomycetemcomitanshost interactions. Such knowledge may lead to new approaches for studying the bacterial behavior of periodonto pathogens. ACKNOWLEDGMENTS Indonesia. The authors are grateful for technical assistance of Maysyaroh and Dessy Sulistya at the Oral Biology Laboratory , Faculty of Dentistry, University of Indonesia 1. 2. 3. 2009;33(1):8-13. REFERENCES

It may be concluded that the htrB gene is involved in the interaction between A. actinomycetemcomitans and host cells.

This study was supported by the University of Indonesia Grant 2009 provided by the University of Indonesia, Allaker RP, Douglass CW. Novel anti-microbial therapies for dental plaque-related diseases. Int J Antimicrob Agents. involvement in bacterium-host interactions. FEMS Immunol Med Microbiol. 2007;49(1):149-54. actinomycetemcomitans/Escherichia coli shuttle plasmid. Plasmid. 1994;31(2):207-14. Sreenivasan PK, Fives-Taylors P. Isolation and characterization of deletion derivatives of pDL282, an Actinobacillus International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

Bachtiar, B.M, Coloe PJ, Fry BN. Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its

107

4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17.

Socransky SS, Haffajees AD. The bacterial etiology of destructive periodontal disease: current concepts. J Periodontol. 1992;63(4 Suppl):322-31. M in THP-1 cells by LPS derived from Porphyromonas gingivalis. J Leukoc Biol. 2008;83(3):672-9. Immunopharmacol. 2008;8(11):1513-23.

Bachtiar BM et al., IJSID, 2013, 3 (1), 101-108

Domon H, Honda T, Oda T, Yoshie H, Yamazaki K. Early and preferential induction of IL-1 receptor-associated kinaseexpression induced by Aggregatibacter actinomycetemcomitans lipopolysaccharides in human gingival fibroblasts. Int transformation and electro-transformation. Gene. 1993;132(1):131-5. 2000; 68(11): 6337-45.

Gutierrez-Venegas G, Castillo-Alemans R. Characterization of the transduction pathway involved in c-fos and c-jun Wassenaar TM, Fry BN, Van der Zeijsts BA. Genetic manipulation of Campylobacter: evaluation of natural actinomycetemcomitans isolated from the human oral cavity. J Clin Microbiol. 1994;32(1):75-81. Day WA, Sajecki JL, Pitts TM, Joens LA. Role of catalase in Campylobacter jejuni intracellular survival. Infect Immun. 10- Ho HJ, Huang DY, Ho FM, Lee LT , Lin WW. Inhibition of lipopolysaccharide-induced inducible nitric oxide synthase expression by endoplasmic reticulum stress. Cellular Signalling. 2012; 24(11): 2166-78 Biol Chem. 1995;270(45):27151-9.

DiRienzo JM, McKays TL. Identification and characterization of genetic cluster groups of Actinobacillus

Lee NG, Sunshine MG, Engstrom JJ, Gibson BW, Apicella MA. Mutation of the htrB locus of Haemophilus influenzae nontypable strain 2019 is associated with modifications of lipid A and phosphorylation of the lipo-oligosaccharide. J dynamic, multistep process. Infect Immun. 1996;64(8):2988-97. 2005;84(1):59-63. Rudney JD, Chen R, Sedgewicks GJ. Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, and Tannerella forsythensis are components of a polymicrobial intracellular flora within human buccal cells. J Dent Res. periodontitis. Chin Med J (Engl). 2005;118(11):915-21. 2000. 2006;40:77-93. 36. Meyer DH, Lippmann JE, Fives-Taylors PM. Invasion of epithelial cells by Actinobacillus actinomycetemcomitans: a

Chen LL , Wu YM, Yan J, Sun W L, Sun YZ, Ojcius D. Association between coinfection of Porphyromonas gingivalis, Actinobacillus ctinomycetemcomitans and Treponema denticola and periodontal tissue destruction in chronic Schenkein HA. Host responses in maintaining periodontal health and determining periodontal disease. Periodontol Vogel U, Claus H, Heinze G, Frosch M. Role of lipopolysaccharide sialylation in serum resistance of serogroup B and C meningococcal disease isolates. Infection and immunity. 1999; 67(2):954-7.

Zappa U, Simona C, Grafs H. Episodic progression of periodontitis--histologic associations. Parodontol. 1991;2(1):25-

International Journal of Science Innovations and Discoveries, Volume 3, Issue 1, January-February 2013

108