THE JOURNAL OF BIOLOGICAL CHEMISTRY

0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 34, Isaue of December 5, pp. 2601626025,1993 Printed in U.S.A.

Structural and Functional Characterization of the HPV16 E7 Protein Expressed in Bacteria*

(Received for publication, April 15, 1993, and in revised form, June 30, 1993)

Gregory Pahel, Ann Aulabaugh,Steven A. Short, Julie A. Barnes, GeorgeR. Painter, Paul Ray, and William C. PhelpsS
Wellcome Research Laboratories, Burroughs Wellcome Co., Research Triangle Park, North Carolina 27709

The E7 gene of the human papillomaviruses (HPV) deletions of viral sequences, the E6 and E7 open reading encodes a 98-aminoacid, multifunctional nuclear phosframes are invariably spared (Baker et al., 1987; Matsukura phoprotein with functional and structural similarities et al., 1986; Schwarz et al., 1985). Furthermore, biochemical T antigens. E7 analyses have demonstrated that the E6 and E7 genes are to adenovirus E1A and the papovavirus is a viral oncoprotein, which will cooperate with an consistently expressed in cervical carcinomas, suggesting that activated ras oncogene to transform primary rodent these proteins may contribute to the malignant phenotype cells, and can cooperatewith the HPV E6 protein for (Smotkin and Wettstein, 1986). the efficient immortalization of primary human keraA number of cellular transforming and growth stimulatory tinocytes. Due to the compelling epidemiological and properties have been attributed to E7 (for review, see Munger experimental association between HPV infection and and Phelps (1993)). Expression of the HPV16 and HPV18 E7 cervical cancer, we have undertaken a detailed study proteins can induce morphological transformation of estabof the structure oftheHPV16E7protein.TheE7 lished rodent cells in culture (Bedell et al., 1987; Kanda et al., protein was expressed inEscherichia coli as a native, unfused polypeptide, and soluble protein was purified 1988; Phelps et al., 1988; Tanaka et al., 1989; Vousden et aL, 1988; Watanabe and Yoshiike, 1988), and E7 can cooperate by conventional chromatographic techniques. The puwith an activated ras or /os oncogene to transform primary rified protein was assessed for various biochemical and rodent cells (Crook et al., 1988, Phelps et al., 1988; Storey et biophysical properties. Purified E7 binds the retinoblastoma protein avidly and specifically, and it can al., 1988). The expression of the high risk HPV E6 and E7 dissociate the E2F transcription factor when assayed proteins together can efficiently induce immortalization of primary human keratinocytes (Hawley-Nelson et al., 1989; in vitro. Circulardichroismspectroscopyindicated that E7 reversibly binds Zn2+and Cd2+, resulting in a Hudson et al., 1990; Miinger et al., 1989a; Watanabe et al., substantialincreaseinthe a-helical contentofthe 1989) which likely represent the most relevant target cell for metal-bound E7 consistent with the stabilization of a natural infection by HPVs. Therefore, both epidemiological hydrophobic core in the COOH terminus of the protein. and biological data suggest that the E6 and E7 proteins play an important role in HPV-associated malignancy. The amino terminus of the HPV E7 proteins shares substantial amino acid sequence similarity with two noncontigOf the nearly 70 different HPV types, approximately 20 uous portions of the adenovirus E1A proteins (Phelps et al., are associated with infection of the oral and genital mucosa 1988). In addition, E7is functionally related to E1A and SV40 (DeVilliers, 1989). Epidemiological and biological data sup- large antigen (TAg) in that it can cooperate with an activated port the division of the mucosal associated HPVs into two ras oncogene, trans-activatethe adenovirus E2promoter groups: those associated with benign lesions that are atlow (Phelps et al., 1988),associate with the retinoblastoma protein risk for malignant progression (HPV6and HPVll), and (pRB) (Dyson et al., 1989), and abrogate the transforming those represented by HPV16 and HPV18, that are considered growth factor-p-induced transcriptional repression of the Chigh risk due to their strongassociation with cervical cancer myc promoter in keratinocytes (Pietenpol et al., 1990). (zur Hausen and Schneider, 1987). Approximately 85% of The HPV16 E7 protein is an acidic, nuclear phosphoprotein human cervical carcinomas harbor HPVDNA with more than with no known enzymatic activity. HPV16 E7 is 98 amino half found to contain HPV16 (Riou et al., 1990; zur Hausen, acids long with a M, 11,000 based on amino acid composition 1991). and an apparentelectrophoretic M , of 19,000. E7 binds Zn2+ HPV types 16 and 18 are archetypical of the high risk virus through two conserved Cys-X-X-Cys motifs present in the group, and analysis of cervical carcinoma tissues andcell lines COOH-terminal half of the protein(Barbosa et al., 1989; has revealed that theviral DNA is frequently integrated into Rawls et al., 1990). Intracellular phosphorylation of E7 occurs the host cell genome. Although integration of the circular on a conserved serine and is apparently mediated by casein viral genome isnormally accompanied by rearrangements and kinase I1 (Firzlaff et al., 1991). Due to the correlation between the expression of the HPV * The costs of publication of this article were defrayed in part by E7 transforming proteins and the growth of neoplastic the payment of page charges. This article must therefore be hereby E6 and marked oduertisement in accordance with 18 U.S.C. Section 1734 cells, we have initiated an effort to examine the tertiary structure of the HPV16 E7 protein. Here, we present a prelimsolely to indicate this fact. 3 To whom correspondence should be addressed Div. of Virology, inary structural and functional analysis of the HPV16 E7 Burroughs WellcomeCo., 3030 Cornwallis Rd., Research Triangle protein expressed in Escherichia coli as a native polypeptide Park, NC 27709. Tel.: 919-315-4022; Fax: 919-315-5243. The abbreviations used are: HPV, human papillomavirus; pRB, without proteinfusion. Purification of the soluble protein was retinoblastomaprotein; DTT, dithiothreitol; CR1 and CR2, conserved by conventional chromatographic techniques under nondenaturing conditions. region 1 and 2.

26018

HPVlG E7 Characterization
MATERIALS AND METHODS

26019

E l (TTQPKKVKRRLFETRELTDSGYGYS) kindly provided by Doug Sherman and described in Bream et al. (1993). Cloning and Expression of HPVl6 E7-The HPV16 E7 gene (nuE2F Dissociation-Preparation of E2F extracts and analysis by gel cleotides 562-858) was amplified from the plasmid p1059 (Phelps et retardation assays has been described previously (Chellappan et al., al., 1988) by polymerase chain reaction using the primers: 5'CGCAA 1991). Briefly, an E2F-containing nuclear extract of human U937 GCTTGCATATGCATGGAGATACACCTACATTGCATG3'and cells which had been partially purified over heparin agarose was 5'GCGCCTAGGTACCTGCAGGATCAGCCATGGTAGATTATGG titrated with 3-300pgof purified E7 protein in a 25-pl reaction 3'. The amplified sequence was cloned as anNdeI-BamHI fragment mixture containing 20 m M Hepes, pH 7.5,40 m M KCl, 50 m M M&h into a bacterial T7 expression vector, pSS582: which utilizes the 1 m M EGTA, 0.5 m M DTT, 4% Ficoll, 1 pg of salmon sperm DNA, bacteriophage T7 gene 10 promoter (Studier and Moffett, 1986). The 0.1% Nonidet P-40, 1 m M DTT. Oligonucleotide probe, labeled with DNA sequence was verified by dideoxy DNA sequence analysis. The T4 polynucleotide kinase, was added, and incubation was a t room expression plasmid (pW130) was transformed into JMlOg(DE3) (RO- temperature for 30 min. Samples were then loaded immediately on senberg et a l , 1987), grown to Am = 1.0 in minimal medium'plus 1% 4% polyacrylamide gels and electrophoresed at 4 "C in 0.25 X TBE casamino acids at 37 "C and induced with 1 m M isopropyl-1-thio-@- (22 m M Tris, 22 m M boric acid, 0.5 M EDTA). D-galactopyranoside for 3 h at 30 "C. Circular Dichroism Spectroscopy-CD spectra were obtained at Purification of E 7 Protein-Purification of the E7 protein was 22"C using a Jasco 5-600 spectropolarimeter. A cylindrical fused similar to the procedure described in Imai et al. (1991). Cells were quartz cell of 0.2-cm path length was used. All spectra were obtained harvested by centrifugation and lysed by three passages through a by subtracting the buffer base-line spectrum from the protein specM DTT, 1 m M EDTA, trum. One ml of stock protein solution was dialyzed at 4 "C uersus French press in 50 m M Tris-HC1, pH 8.0, 1 m 1m M phenylmethylsulfonyl fluoride, 5% glycerol. Supernatants were two changes of 1 liter of buffer solution containing 1 m M Tris, 0.1 clarified by sequential low speed (20,000 X g)and high speed (100,000 m M EDTA, and 0.1 m M DTT with a pH of7.5. Zinc chloride or X g) centrifugation. The high speed supernatant was applied to a cadmium chloride was added to theCD sample from a stock solution DE52 ion exchange column (25 mm X 100 mm) and eluted with a to afford a final concentration of 1 mM. Protein concentration of the linear 0.2-0.6 M NaCl gradient in 10 m M Hepes, pH 7.6, 1 m M D m , E7 stock solution was determined from amino acid analysis and was 5% glycerol. The peak fractions of E7 protein eluting at about 0.4 M 0.78 mM. NaCl were pooled, concentrated (Centriprep-10, Amicon), applied to Results are expressed in terms of mean residue ellipticity (0) in a 20 mm X 810-mm Sephadex G-75 (Pharmacia LKBBiotechnology units of degree. cmz/dmol. Estimates of secondary structure of HPV16 Inc.) gel filtration column, and eluted in the same buffer. To deter- E7 in the presence and absence of zinc or cadmium were obtained by mine the amount of E7 protein contained in each step of the purifi- a least squares curve fitting routine between 186 and 250 nm with cation, purified E7 protein was quantified by Western blot using '%I the program supplied with the Jasco spectropolarimeter (Secondary (see below) and phosphoimage analysis. Structure Estimation, Jasco, Inc.) using the reference spectra: myoTrace Metal Analysis-Purified HPV16 E7 and buffers were sub- globin, cytochrome c, ribonuclease A, lysozyme, and papain. Two mitted for trace metal analysis by Galbraith Laboratories (Knoxville, calculations were performed 1)where the sum of the fractions is one TN). and thefraction of each secondary structure is positive and 2) a nonMolar Extinction Coefficient-Ultraviolet absorption spectroscopy constrained fitting. The results of the two fittings agree within 8%. of purified apo HPV16 E7 was performed on a Perkin-Elmer Cetus A normalized root mean square deviation was also obtained for each Lambda 6 UV/VIS spectrophotometer, and the protein concentration calculation which ranged from 0.08 to 0.2. was determined by amino acid analysis. A wavelength maximum a t Sequence Alignment and Secondary Structure Analysis-Sequence 276 nm was observed with a molar extinction coefficient of 8140 alignments of HPV16 E7 and 11 other mucosal-associated HPVs crn-'"'. (types 6, 11, 18, 31, 33, 35, 39, 42, 45, 57, and 58) were performed Isoelectric Point-The isoelectric point (PI) of HPV16E7 was using the GAP and Pileup procedure in the Protein Comparison determined from the RF of 4 pg of native HPV16 E7 on a Pharmacia Module of the sequence analysis software package of the Wisconsin IEF 4-6.5 PhastGel using 4-5 pg of the following proteins with known Genetics Computer Group Version 7.1 (Devereux, 1989). The alignPI values: human carbonic anhydrase (6.55), bovine carbonic anhy- ment algorithm used the method of Needleman and Wunsch (1970) drase (5.85),j3-lactoglobin(5.20), soybean trypsin inhibitor (4.55), extended for use with clusters of aligned sequences (Higgins and and glucose oxidase (4.15). The theoretical isoelectric point was Sharp, 1989). A gap creation penalty of 3.0 and a gap extension calculated from the amino acid sequence using the Isoelectric module penalty of 0.1 were used. The consensus sequence of the 12 HPV E75 of the sequence analysis software package of the Wisconsin Genetics was determined for each column using a threshold value of Computer Group Version 7.1 (Devereux, 1989). 10.Secondary structure analysis of the mucosal-associated HPVs was RB Binding and Peptide Inhibition-As a source of pRB, Vero accomplished using the Predict-Secondary-Structure command in monkey cells (ATCC CCL 81) were grown to confluence, and total Sybyl Version 5.4 (Tripos Associates, St. Louis, MO). The predictions cellular extracts were prepared by lysis in 50 m M Hepes, pH 7.0,0.1% included the methods of Bayes Statistics (Maxfield and Sheraga, Nonidet P-40, 250 m M NaCl, and 1 pg/ml leupeptin and aprotinin. 19761, Information Theory (Garnier et al. 1978), and Neural Network The protein concentration of the cleared lysates was determined (Qian and Sejnowski, 1988). using the Bio-Rad protein assay (Bio-Rad) and was 2-5 mg/ml. The Kyte and Doolittle (1982) hydropathy profile of HPV16 E7 Purified E7 protein(1-200 ng) was mixed with a constant amount of was accomplished using the Pepplot routine in the Protein Analysis cell lysate (400 pg) and incubated on ice for 2 h. To ensure quantitative Module of the sequence analysis software package of the Wisconsisn immunoprecipitation of the E7 protein in the complexation reactions, Genetics Computer Group Version 7.1 (Devereux, 1989).A six-residue it was determined (not shown) that rabbit polyclonal antibody at a window was used in thecalculations. concentration of 1:20 was in excess under the conditions used (ie. 200 ng of purified E7). Immune complexes were washed twice in the RESULTS AND DISCUSSION extraction buffer and resuspended in SDS-sample buffer for analysis To initiate biochemical and biophysical studies of the terbygel electrophoresis and Western blotting. Immunoprecipitated protein was fractionated on a 10% SDS-polyacrylamide gel and tiary structure of the HPV16 E7 protein, the gene sequences electroblotted to nitrocellulose as described (Phelpset al., 1992). were cloned into abacteriophage T7 gene 10 promoter expresDetection of pRB was with a mouse monoclonal antibody, PMG3sion vector for high level expression of a native, unfused 245.11 (Pharmingen, Inc.) followed by '2SI-antimouse antibody (Amersham Corp.). To quantify the relative amount of pRB in protein in bacteria. Purification of the soluble protein was complex with E7, immunoblots were subjected to phosphoimage achieved by conventional chromatographic techniques to minanalysis (Molecular Dynamics, Inc.). As an internal control for each imize exposure to high salt or chaotropic agents such as urea. sample, the pRB signal was normalized to that obtained from heavy The purified protein was subsequently characterized for a chain Ig. number of functional and biochemical properties to ensure Peptide competition reactions consisted of 200 ng of purified E7 that it represented an appropriate targetfor structural studies. protein and 400 pg of Vero cell extract (containing pRB) in 20 m M M DTT, and 300 m M NaCl. Peptides Hepes, pH 7.5,5% glycerol, 1 m Expression of the HPVl6 E7 Protein used for competition were E7 Tm-Nm(TDLYCYEQLN) and HPV 11 After growth of E. coli to late log phase in minimal media, * S. Short, unpublished results. E7 protein synthesiswas induced by the addition of isopropyl-

26020

HPVl6 E7 Characterization

1-thio-fl-D-galactopyranoside to the culture medium. The cells were harvested and lysed using a French press. Examination of cell extracts indicated that the E7 protein routinely acwith about counted for approximately 30% of the total protein 50% of the E7 protein being soluble (Fig. 1, lune 2, Table I). The soluble E7 protein was isolated essentially according to monitored by SDSImai et al. (1991). Proteinpurityas polyacrylamide gel electrophoresis was greater than 90%. Typical yield of purified E7 protein was 2 mg/g, wet weight, of cells. Polyclonal rabbit antiserawas produced utilizing the purified E7 protein, and the antibody was shown to effectively recognize the bacterially expressed protein as well as E7 made in COS-1 monkey cells or the human cervical carcinoma cell line, Caski (Phelps etal., 1992).
Isoelectric Point of HPV-16 E7 The PI of zinc-bound HPV-16 E7 was obtained from isoa pH 4-6.5 gradient electric focusing. The RFof HPV-16 E7 on isoelectric focusing gel was 0.54 which corresponded to a PI of 5.4 (Fig. 2). Based on the amino acid sequence, the predicted PI was 4.05. The difference between the predicted and observed PI is consistent with folding of the protein and inaccessibility of some charges to thesolvent.

6.56.0-

E 5.55.04.5-

Rf
FIG. 2. Determination of isoelectric point. Migration distance

(RF) uersus pH of purified, zinc-bound HPV16 E7 andprotein standards obtained from isoelectric focusing. Protein standards and their corresponding PI included human carbonic anhydrase (6.55), bovine carbonic anhydrase (5.85), 8-lactoglobin (5.20), soybean trypsin inhibitor (4.551, and glucose oxidase (4.15).

1990; Munger et al., 1989b). To assess the ability of purified, bacterially expressed E7 protein to interact with the pRB, increasing amounts of E7 were mixedwith aconstant amount (400 pg) of total cell lysate from Vero cells, which was previously determined to contain high levels of pRB. Complexes Functional Characterization of E7 were immunoprecipitated with an excess (see Materials and pRB Binding-The ability of the E7 protein to interact Methods) of polyclonal antibody to E7, and complexed pRB with the RB tumor suppressor protein appears to correlate was detected by Western blot analysis (Fig. 2, inset). The well with cellular transforming functions including rus coop- relative amount of complexed pRB was determined by phoserativity (Edmonds and Vousden, 1989; Phelps et al., 1992; phoimage analysis and is plotted as relative pRB concentraStorey et al., 1990; Watanabe etal., 1990). In addition, the E7 tion (Fig. 3). The control lane shows that no pRB is immuproteins from the high risk HPVs, HPV16 and HPV18, bind noprecipitated in the absence of added E7 protein indicating pRB with a greater affinity than the E7 proteins from the low that the E7 antibody has no inherent ability to immunoprerisk HPVs, types 6 and 11 (Barbosa et al., 1990; Gage et al., cipitate pRB. As the amount of purified E7 protein is increased from 2 to 400 ng, the amount of complexed pRB 1 2 3 4 5 increases correspondingly indicating that the purified E7 pro.5 tein can readily form an immunoprecipitable complex with the pRBprotein in a dose-dependent manner. Peptide Competition-Mutational analyses of the HPV16 I1 E7 protein have indicated that amino acids (see Fig. 7) in conserved region 2 (CR2) are required for interaction with the pRB protein (Munger et al., 1989b; Banks et dl., 1990; !1.5 Barbosa et al., 1990; Gage et al., 1990; Firzlaff et al., 1991; Munger et al., 1991; Heck et dl., 1992; Phelps et al., 1992; 1 4 Sang and Barbosa, 1992). To verify that the E7-pRB complexation shown above is sequence-specific, a peptide repreFIG. 1. Purification of the HPVl6 E7 protein. Lane 1, low senting the pRBbinding domain of HPV16 E7 was synthespeed supernatant from an uninduced culture (16 pg); lune 2, high sized and tested for its ability to inhibit the association. As speed (100,000 X g) supernatant from an induced culture (12.5 pg); lane 3, peak fraction from DE52 (4.2 pg); lane 4, peak fraction from shown in Fig. 4, the peptide T20-NBencompassing the pRB SuperDex 75 gel filtration (1 pg); lane 5, molecular weight markers. binding domain effectively inhibits binding of the bacterially Protein was fractionated in a 12% SDS-polyacrylamide gel and expressed E7 protein to pRB. In contrast, a nonspecific pepstained with Coomassie Blue R-250. tide derived from the E l open reading frame of H P V l l had no effect on E7-pRB association. Neither peptide had any TABLE I effect on immunoprecipitation of the E7 protein within the Purification of HPVl6 E7 concentration range indicated (data not shown), consistent Percent PurificaYield with specific inhibition of complexation by the E7 decapeptide step E7 tionb (Fig. 4). Furthermore, it should be noted that, at equimolar w -fold % concentrations of E7 peptide and E7protein, no inhibitionof French press extract 416 125 30.1 100 E7-pRB association was observed. Substantial inhibition reLow speed supernatant 19.6 73.3 374 1.0 58.6 quired greater than a 15-fold molar excess of E7 peptide, with 100,000 X g supernatant 312 20.4 63.7 1.0 50.9 complete inhibitionrequiringa >lOO-fold excess. This is DE52 71.6 21.4 15.3 3.7 12.2 consistent with previous studies which have shown that the Sephadex 2.9 G-75 4.6 90.0 3.7 4.08 native protein has a much higher binding affinity for pRB The amountof E7 protein was determined by quantitative Westthan small inhibitory peptides (Jones et al., 1990, 1992; Paern analysis as described under Materials and Methods. *Fold purification is of the soluble E7 protein which represents trick et ul., 1992). This elevated binding affinity is expected about 50% of the total E7 expressed. to be a propertyof the native E7 protein, as other amino acids

HPVl6 E7 Characterization

26021

cells. In theabsence of E7 protein, gel shift analysis indicates that the E2F cellular transcription factor exists in at least three discreet macromolecular complexes. Incubation of these extracts with deoxycholate reduces the complexity of the pattern to a single shifted species which has been previously shown to represent free or uncomplexed E2F (Fig. 5). The higher molecular weight complexes have been determined to w l o r represent E2F/p107/cdk2/cyclin A (E2Fc) and E2F/pRB (E2Fc*). Titration of purified E7 protein into the U937 extracts led to the gradual dissociation of the E2Fc* complex u L 1 0 - 100 200 300 400 accompanied by the concordant increase in the amount of free E2F. Indeed, the most noticeable alteration in the gel E7 (ng) shift patternis the appearance of substantially more free E2F FIG. 3. Association of purified E7 with pRB. PurifiedE7 as purified E7 protein is titratedintothe reaction. This protein (1-400 ng) was mixed with an total cell extract fromVero cells (400 pg). E7-RB complexes were immunoprecipitated and frac- observation suggests that E7is able to dissociate a fractionof tionatedon a polyacrylamide electrophoresis 9% gel. Protein was E2F which is unable to bind the DNA fragment under these electroblotted to nitrocellulose and pRB detectedby Western blotting conditions. In contrast, the E2Fc complex appeared to be as described under Materials and Methods. The inset at the top more resistant to E7-mediated dissociation as loss of E2Fc shows the autoradiograph of the blot used for quantitation by phos- was only noted at thehighest E7 concentrations. phoimage analysis. The amount of pRB which was immunoprecipiTherefore, in agreement with previous studies, the E7protated is expressed relative to background obtainedwith no E7 added and was normalized to the amountof heavy chain Ig detected ineach tein will selectively target the E2F-RB complex for dissocialane. tion of E2F in vitro (Chellappan et al., 1992). Amino acid sequences necessary for this activity include the pRBbinding region in CR2; however, additional sequences in the carboxyl terminus arealso required (Wu etal. 1993). The specific high affinity interaction with pRB and thein vitro dissociation of loo the E2F transcription factor are functional properties ascribed to the native HPV E7 protein, and suggest that the E7 protein purified and characterized in this work is an appropriate substrate for structural studies.

1
0

\h
I

Structural Analysis
I

10

100

1000

E7 PEPTIDE(molar excess) FIG. 4. Inhibition of pRB association. Peptide competitionwas as in Fig. 3 using 200 ng of E7 protein, 400 pg of Vero cell lysate (pRB),and 1-128-fold molar excess of peptides derived from HPV16 E7 TZo-NB and HPVll El (Bream et al., 1993).

outside of CR2, such as in CR1, may stabilize the secondary structure and contribute additional interactive sites. Therefore, the additional contact points ormore favorable conformation which are responsible for the enhanced affinity are represented in this purified E7 preparation. E2F Dissociation-Recent evidence indicates that HPV16 E7 mediates transcriptional transactivation through modulation of theE2Ftranscription factor (Phelpset al., 1991; Chellopan et al., 1992). The E2F transcription factor was originally identified through its role in activation of the adenovirus E2 promoter (Kovesdi et al., 1986; Yee et al., 1989). The E2F transcriptionfactor is found in most cells in heteromeric protein complexes with several cell cycle associated proteins including pRB and cyclin A (Bagchi et al., 1991; Bandara and La Thangue, 1991; Chellapan et al., 1991; Chittenden et al., 1991). The viral transforming proteins ElA, TAg, and E7 have been recently demonstrated to dissociate E2F from these protein complexes effectively. Release of E2F is thought to result in activationof several cellular promoters known to be important for DNA synthesis such as dihydrofolate reductase, c-myc, thymidine kinase, and DNA polymerase a (Heibert et al., 1991). Bacterially expressed and purified E7 was tested for its ability to dissociate E2F by mixing increasing amounts of E7 protein with partially purified nuclear extracts of U937human

Secondary Structure from CD Spectra-The avid and specific RB binding and E2F dissociation suggested that the purified E7 protein was structurally intact and, therefore, a good substrate for structural analysis. As a preliminary measure of global structural content, the purified protein was subjected to analysis by circular dichroism. HPV16 E7 protein obtainedafter size exclusion chromatography was judged to be greater than 95% pure by SDS-gel electrophoresis. Before biophysical studies were initiated with the purified protein, samples from the size exclusion chromatography step were submitted for metal analysis. Less than 1% (mole %) zinc or any other heavy metal including iron, nickel, copper, and lead was bound to the protein. The CD spectrum of metal-free E7 (Fig. 6) displays a large negative minimum centered at 200 nm indicative of unfolded structure, and a negative shoulder at 222 nm which is consistent with the presence of some secondary structure. A marked change in the ultraviolet CD spectrum of HPV16 E7 was observed upon addition of zinc or cadmium. This metal-induced changeconsisted of a decrease in the negative minimum centered a t 202 nm and anincrease in the positive maximum at 192 nm and the negative minimum at 222 nm (Fig. 6A). Secondary structure contentcalculations indicated the percentage of turn and random coil was the same within experimental error in the presence or absence of metal but there was an increasein a-helixand decrease in@-sheet content upon the addition of zinc or cadmium (Table 11). Reversible metal binding is demonstrated in Fig. 6B in which zinc is first added to E7protein solution,followed by addition of EDTA to regenerate the CD spectrum of metal-free E7. Therefore,preliminary structural analysis of the purified HPV16 E7 protein by CD verified that thisprotein reversibly binds Zn2+or Cd2+(Roth et al., 1992) and that metal coordination induced an alterationin the conformation of the poly-

26022

HPVl6 E7 Characterization
DOC COMP
E7(~4

- - + + - + + - - - - " "

"

"

10

30

100

300

FIG. 5. Dissociation of the E2F transcription factor. A heparin agarose purified E2F-containing lysate kindly provided by Joe Nevins was mixed with purified HPV16 E7 protein (3-300 pg) and labeled E2F oligonucleotide and incubated for 30 min. Complexes were fractionated on a 4% nondenaturing polyacrylamide gel in 0.25% TBE. Deoxycholate (DOC)was added to a final concentration of 0.4% and competitor DNA was unlabeled oligonucleotide a t a 100-fold molar excess.

NON-SPECIFIC

-+

1 5 m

-15ooo1 100 1W

, , , , , , , , ,
200 210 220 230 240 250 20 270 2 8 0

Wavelength (nm)

Wavelength (nm)

FIG. 6. Circular dichroism spectroscopy of E7. CD spectra of 0.78 p~ HPV16 E7 at different EDTA and metal concentrations. A, CD spectra of E7 in the absence of metal (-); in the presence of 1 m M zinc chloride (- - - - -), and in the presence of 1 m M cadmium chloride (. . . . .). B, reversible binding of zinc is demonstrated by addition of zinc chloride to E7 to a final metal concentration of 1 m M (- - - - -); this was followed by the addition of an excess of EDTA (. .. . .). Spectra were recorded at 22 "C M and pH 7.5 in a starting buffer of 1 m M DTT,and 0.1 m M Tris-HC1, 0.1 m EDTA.

peptide. This conformational shift occurs with the addition of either Cd2+or Zn2+resulting in nearly identical spectra. Zinc has been identified as anessential componentof some 300 different proteins and is important for both catalytic and structural functions (Vallee and Auld, 1990). X-ray crystallographic analyses have indicated that a catalytic Zn2+atom is coordinated by 3 amino acids (His, Glu, Asp, or Cys) and an activated water molecule. In contrast, for Zn2+-containing enzymes, structural Zn2+is coordinated by 4 cysteine residues. Tetrahedral coordination of Zn2+through cysteine residues results in a very stable structural motif similar to that provided by disulfide bonds. Furthermore, Zn2+ is inert to oxidoreduction and, therefore, very stable to an intracellular environment that fluctuates in redox potential (Vallee and Auld, 1990). A heterogeneous group of nucleic acid bindingproteins initially exemplified by TFIIIA, has been shown to coordinate

structurally important Zn2+atoms (reviewed in Berg (1993)). Computer searches configured to locate spatially juxtaposed Cys and His residues or two Cys pairs has putatively identified roughly 150 different proteins which may have the capacity to bind Zn2+atoms (Valee and Auld, 1990). Despite the lack of experimental verification of Zn2+binding, there has been a promiscuous use of the concept of zinc fingers derived from the structuralmodel determined for TFIIIA. With the unusually large spacing between the Cys-X-XCys motifs in the COOH terminus of E7, it should not be assumed that coordination of Zn2+ induces a classical zinc finger. The amino acid spacing between the Cys-X-X-Cys motifs (29 amino acids) is rigorously conserved in the sequences of all E7 proteins analyzed to date. Indeed, examination of the predicted amino acid sequence for the E6 proteins of the papillomaviruses revealed that this 29-amino acid spacing is also entirely conserved. This is particularly inter-

HPVl6 E7 Characterization
Similarity
AdE 1A

26023

~ / / / / / ~ C R ? ~ / / / / / / / / / / / / / / ~

16 6 11 18 31 33 35

1 IMQDTPTLHX YNLDLP-PE
W W O ~ L K D IVL-DWPPD IMQRLVTLKD IVI-DWPPD WWQPMTWD IVLHLEPQNE NRQETPTWD WL-DW-PL NRQHXPTLn WL-DLY-PI IMQEITTWD YVL-Dm-PI, NRQPXPTWE IVLDLCPYNE NRQETPTLKD IVLFDIPTCE IMEWFFWS IVLHLEWNB WWQERPSLSD I T L I L S E I P E NRQIWPTLRE YIL-DLKPE

39
42
45 57 58

-TTDLYCYE -PWLHCYE -PVQLHCYE I-PWLLCHE -ATDLHCYE -PTDLYCYE -ATDLYCYE IQPVDLVCXS T-PIDLYCYS LDPVDLLCYE 1-VDLHCDE -PTDL?CYE "DL-C-E

QLNDSSEDSD QLWSSEDEV QLEDSSEDEV

QLSDSDSEND
QLPDSSDEEQLSDSSDEDE QLCDSSLSDE QWXSEDEID QL-DSSDEDD QLSESLESND Q?DNSSEDTN QLCDBSDEDE QL_DS.EE

COnSOnSUS Y-0-

_TLD

_VL-.E

~~

-1-CC-

-D-R-LC-L-V-

-LL-TL-V CP-C-

FIG.7. Homology among the mucosal-associated HPV E7 proteins. HPV E7 sequences were obtainedfrom the GenBank" database,
and alignments were made using the Gap and Pileup programs in the Protein Comparison Module of GCG. A gap creation penalty of 3.0 and a gap extension penalty of 0.1 were used. The region of amino acid sequence similarity is indicated at the top of the figure by the shaded boxes and comprises the amino one-third of E7 (Phelps et a l , 1988). HPV16 E7 is displayed across the top line and the other mucosalassociated viralE7 proteins are shown below. A consensus sequenceis suggested below.

esting since E6 and E7 are both transforming proteinswhose expression is selectively retained in HPV-associatedcarcinomas(Baker et al., 1987; Schneider-Gadicke and Schwarz, 1986; Smotkin and Wettstein, 1986). Conseruation of Primary and Secondary Structure-Primary sequence alignments for the E7proteins of 12 mucosalassociated HPVs were generated using the Protein Comparison Module of the Wisconsin Genetics Computer Group. Proper alignment was derived from the Gap and Pileup procedures, and theresults of this alignment aredisplayed in Fig. 7. The predicted primary amino acid sequences of the E7 proteins are well conserved (Cole and Danos, 1987; Baker, 1987)with the greatest divergence occurring in the region just prior to amino acid residue 50 (HPV16). In particular, HPVs 18, 39, and 45 contain a small insertion, andHPV42, a small deletion in this region that falls between the acidic domain (CKII phosphorylation site) and the first Cys-X-X-Cys motif. Moreover, inspection of the cutaneous and epidermodysplasia verruciformis (EV)-associated HPV E7s indicates that this region is also poorly conserved in these proteins (data not shown). The pRB binding region and the acidic/CKII phosphorylation site in CR2 are highly conserved among all of the E7 sequences; and as observed previously, the COOH-terminal Cys-X-X-Cys motifs and the 29-amino acid spacing is strictly conserved (Cole and Danos, 1987). A prediction of secondary structure for these proteins was determined using the Predict-Secondary-Structure program in Sybyl Version 5.4. A predicted motif was adopted only if it was described by at least two of the three algorithms. A consensus structure was assembled for the mucosal HPVs and is shown in Fig. 8. Secondary structure analysis of the conserved primary amino acid sequence of the mucosal-associated HPV E7 proteins predicts that several structural elements are consistently found, and that HPV16 is representative of this group. From such predictive algorithms, the computed values for a-helix and @-sheetare 24% and lo%, respectively. These numbers are in good agreement with those generated by CD analysis (Table 11) for the Zn2+form of E7, suggesting that metal binding may stabilize the secondary structure of the protein. Mutational studiesof the HPV16 E7 proteinhave indicated that substitution of the COOH-terminal Cys residues leads to the expression of a protein with reduced intracellular stability (Storey et al., 1990; Phelps etal., 1992). It was concluded that

TABLE I1 Estimates of Secondary Structure of HPV16 E7 by CD Spectral Analysis (%) Results are accurate2 5%.
or-Helix Metal @-Sheet
Turn

Random

A P O +ZnZ+ +Cd2+

16.0 29.3

30.0

27.4 10.5 10.5

24.1 27.6 27.7

32.5 32.6 31.8

the primary role of the COOH terminus and the Cys-X-XCys motifs is structural, since the amino acid domains necessary for the biological functions of the protein mapped to the NHderminalhalf of the protein (Edmonds and Vousden, 1989; Phelps et aL, 1992; Storey et al., 1990; Watanbe et al., 1990). A hydrophobicity plot (Fig. 8) of the HPV16 E7 sequence predicts a substantial hydrophobic character for the COOH terminus of the protein. Therefore, chelation of zinc through the Cys-X-X-Cys motifs may stabilize a hydrophobic core in the COOH terminus of the E7protein. Inother systems, zinc binding has been shown to dramatically stabilize the a-helical content of small peptides in aqueous solution (Ruan et aL, 1990) such that de m u 0 metal-binding siteshave been engineered into some proteins to impart structural stability (Ghardiri and Choi, 1990; Handel and DeGrado, 1990). Binding of Zn2+by HIV integrase leads to an increase in the a-helical content of the apoprotein from 14 to 32% (Burke et aL, 1992). Primary sequence and hydrophobicity comparison of the E7 proteins suggest that the proteins are composed of two distinctdomains in the NH2- and COOH-terminal halves separated by a poorly conserved region preceding amino acid 50 of HPV16 E7. Studies with TFIIIA and GAL4 transcription factors indicate that zinc may not be directly involved in DNA binding but instead may stabilize the binding region to maintain an optimal local conformation (Christianson, 1991). By analogy, the optimal local tertiary structure for interaction of E7 with various cellular proteins including pRB and p107, may be substantially affected by coordination of Zn2+in the COOH terminus. This may well account for the relative difference in affinity between the native E7 protein and the E7 peptide encompassing the pRBbinding domain. Recent studies of the viral transforming proteins of the adenoviruses, polyomaviruses, and thepapillomaviruses have led to the proposal of a conserved biochemical mechanism for

26024

(types 6, 11, 16, 18, 31.

33, 35. 39,42,45.57. 58) 66 HPV-16 E7 68

Mucosal HPV E7

58 10 50 16 30 33

HPVl6 E7 Characterization

7 7 8 4
1

Hydrophilic -5 -4

5 ' , . . , . . ' . , . , . ' . , , . . ' , . . . . . , . . . . . . . . . . . . . . . . . . . . . . . . , 10 20 30 40 50 60 70 80 90 100 Hydrophobic 0 FIG. 8. Secondary structure predictions for HPV16 E7 and the HPV E7 consensus sequence are based on a comparison of three different algorithms in Predict-Secondary-Structureof Sybyl Version 6.4. A structural feature, a-helix (cylinder) or &sheet (w),is denoted where at least two of three algorithms are in agreement. The Kyte-Doolittle hydropathy profile was obtained using the protein analysis module of the Wisconsin Genetics Computer Group.

4-1

their growth stimulatory functionswhich is mediated through interactions with tumor suppressor proteins such as p53 and pRB. Infection of quiescent cells by these DNA viruses leads to the early expression of a group of transforming proteins which function to stimulate host cellular growth and DNA synthesis. Replication of the viral DNA either requires or is enhanced under conditions of rapid cell growth. Cell cycle stimulation by HPV E7 is thought to be mediated at least in part through interaction with host regulatory proteins such as pRB and p107, an pRB-related protein(Dyson et al., 1992). The interaction of HPV16 E7 with pRB has been shown to result in the dissociation of the E2F transcription factor which regulates several cellular genes important to cellular growth including: c-myc, dihydrofolate reductase, thymidylate synthetase, thymidine kinase, DNA polymerase a,and epidermal growth factor receptor (Heibert et al., 1991). Therefore, the interface between the E7 protein and cell cycle regulators represents a critical point of intracellular control and is an attractive therapeutic target for antiviral or antitumor intervention. A detailed, structural understanding of the interface between the E7 oncoprotein and thecellular regulatory proteins that mediate growth of the virus is an important step in the design of antiviral inhibitors. Rationaldesign of inhibitors of HPVE7 would be expected to result in the synthesis of compounds which willinterfere withgrowth of HPV-infected benign lesions, as well as malignant tumors.
Acknowledgments-We thank Kim Carpenter for help with purification, Barbara Merrill and Bill Chestnut for protein sequencing and amino acid analysis, Doug Sherman for peptide synthesis, and Carol Ohmstede for help with the gel shift analysis.
REFERENCES Ba chi, S., Weinmann, R., and Raychaudhuri, P. (1991) CeU 66,1063-1072 Bafter, C. C. (1987) in The Popouauiridae 2 (Salzman, N. P., and Howley, P. M., eds) p. 321-348, Plenum Press, New York Baker, C. Phelps, W. C., Lindgren, V., Braun, M. J., Gonda, M. A,, and Howley, P. M. (1987) J. Virol. 61, 962-971 Bandara L. R., and La Thangue, N. B. (1991) Nature 361,494497 Banks, i., Edmonds, C., and Vousden, K. H. (1990) Oncogene 6,1383-1389 Barbosa, M. S., Lowy, D. R., and Schiller, J. T. (1989) J. Virol. 63,1404-1407 Barbosa, M. S., Edmonds, C., Fisher, C., Schiller, J. T., Lowy,D.R., and Vousden, K. H. (1990) EMBO J. 9,153-160 Bedell, M. A., Jones, K.H., and Laimins, L. A. (1987) J. Virol. 61,3635-3640 Berg, J. (1993) Curr. Opin. S t r u t . Biol. 3, 11-16

Bream, G. L., Ohmstede, C.A., and Phelps, W. C. (1993) J. Virol. 67, 26552663

Burke, C. J., Sanyal, G., Bruner, M. W., Ryan, J. A., LaFemina, R. L., Robbins, H.L., Zeft, A. S., Middaugh, C. R., and Cordingley, M. G . (1992) J. Bud. Chem. 267,9639-9644 Chellappan, S. P., Hiebert, S., Mudryj, M., Horowitz, J. M., and Nevins, J. R. (1991) CeU 66,1053-1061 Chellappan, S., Kraus, V. B., Kroger, B., Miinger, K., Howley, P. M., Phelps, W. C.,and Nevins, J. R. (1992) Proc. Natl. Acod. Sci. U. S. A. 89,4549-4553 Chittenden, T., Livingston, D. M., and Kaelin, W.G. (1991) CeU 66, 10731082

Christianson, D. W. (1991) Adu. Protein Chem. 42,281-355 Cole, S. T., and Danos, 0. (1987) J. MOL BWL 193,599-608 Crook, T., Storey, A., Almond, N., Osbom, K., and Crawford, L. (1988) Proc. NatL Acad. Sci. U. S. A. 86,8820-8824 Devereux, J. (1989) The GCG Sequence Analysis Software Package Version 6.0, Genetics Computer Group, Inc., Madison, WI DeVilliers, E.M. (1989) J. ViroL 63,4898-4903 Dyson, N., Howley, P. M., Miinger, K., and Harlow, E. (1989) Science 243, Dyson, N., Guida, P., Miinger, K., and Harlow, E. (1992) J. ViroL 66, 6893cane 934-937

C., and Vousden, K. H. (1989) J. ViroL 63,2650-2656 Firzlaff, J. M., Luscher, B., and Eisenman, R. (1991) Proc. NatL Acod. Sci. U. S. A. 88.5187-5191 Gage, J. R., Meyers, C., and Wettateb,F. 0. (1990) J. Virol. 6 4 , 723-730 Gamier,, J., Osguthorpe, D. J., and Robson, B. (1978) J. Mol. Biol. 120,97-120 Ghardin. M. R.. and Chol. C. (1990) J. Am. Chem. Soc. 112.1630-1632 Handel, T.,andDeGrado,'W. F. (1990) J. Am. Chem. Soc. 112,6710-6711 Hawley-Nelson, P., Vousden, K.H., Hubbert, N. L., h w y ,D. R., and Schiller, J. T.(1989) EMBO J. 8,3905-3910 Hegk, D.V.,Yee,C.L.,Howley, P. M., and Munger, K. (1992) P m . Natl. Acod. Sci. U. S. A. 89,4442-4446 Hiebert, S. W., Blake, M., Azizkhan, J., and Nevins, J. R. (1991) J. Virol. 66, Higgins, D. G., and Sharp P. M. (1989) Comput. Appl. Biosci. 6,151-153 Hudson, J. B., Bedell, M. A., D. J. McCance, and Laimins, L. A. (1990) J. ViroL
64,519-526

& & I s ,

"_.

2F\A7-25.W """

Imai, Y., Mataushima, Y., Sugimura, T., and Terada, M. (1991) J. Virol. 66, Jones, R. E., Wegrzyn, R. J., Patrick, D. R., Balishin, N. L., Vuocolo, G.A., Riemen, M. W.,Defeo-Jones, D., Garsky, V., M., Geimbrook,D. C., and Oliff, A. (1990) J. Biol. Chem. 266,12782-12785 Jones, R. E., Heimbrook, D. C., Huber, H. E., Wegrzyn, R. J., Rotberg, N. S., Stauffer, K. J., Lumma, P. K., Garsky, V.M., and Oliff, A. (1992) J. Biol. Chem. 267,908-912 Kanda, T., Watanabe, S., and Yoshiike, K. (1988) Virology 166,321-325 Kovesdi, I., Rekhel, R., and Nevins, J. R. (1986) CeU 46,219-228 Kyte, J., and Doolittle, R. F.(1982) J. MOLBiol. 167, 105-132 Mataukura, T., Kanda, T., Furuno, A., Yoshikawa, H., Kawana, T., and Yoshiike, K. (1986) J. Virol. 68,979-982 Maxfield, F. R., and Sheraga, H. A. (1976) Biochemistry 16,5138-5153 Miinger, K., and Phelps, W. C. (1993) Biochim. Biophys. Acta 1166,111-123 Munger, K., Phelps, W. C., Bubb, V., Howley, P. M., and Schlegel, R. (1989a) J. Virol. 63,4417-4421 Miinger, K., Werness, B. A,, Dyson, N., Phelps, W. C., Harlow, E., and Howley, P. M. (1989b) EMBO J. 8,4099-4105 Miinger, K.,Yee,C. L., Phelps, W.C., Pietenpol, J. A., Moses. H. L., and Howley, P. M. (1991) J. Virol. 66,3943-3948 Needleman, S. B., and Wunsch, C. D. (1970) J. MOL Biol. 48,443-453 Patrick, D. R., Zhang, K., Defeo-Jones, D., Vuocolo, G. R., Maigetter, R.Z.,
49664972

e.,

HPVIG E7 Characterization
Sardana, M. K., Oliff, A., and Heimbrook, D. C. (1992)J. Biol. Chern. 267, 6910-6915 Phelps, W. C., Yee, C. L., Munger, K., and Howley, P. M. (1988)Cell 63,539Phelps, W. C., Bagchi, S., Barnes, J. A., Raychaudhuri, P., Kraus, V., Miinger, K Howle P M., and Nevins, J. R. (1991)J. Virol. 66,6922-6930 Pheibs, w. ' Munger, K., Yee, C. L., Barnes, J. A., and Howley, P. M. (1992) J. VimL 66, 2418-2427 Pieten 01, J. A,, Stein, R. W., Moran, E., Yaciuk, P., Schlegel, R., Lyons, R. M., Iittelkow. M. R., Miinger, K., Howley, P. M., and Moses, H. L. (1990) Cell 61,777-785 Qian, N., and Sejnowski, T.(1988)J Mol. Bwl. 202,865-884 Rawls, J. A., Pusztai, R., and Green, M. (1990)J. Virol. 64,6121-6129 Riou, G., Favre, M., Jeannel, D. J., Bourhis, J., Le Doussal, V., and Orth, G.
%A7 "-. 4m"mU
" "

26025

A., and zur Hausen, H. (1985)Nature 314,111-114 Smotkin, D., and Wettstein, F. 0. (1986)Pmc. Natl. Acad. Sci. U.S. A. 83, Storey, A., Pim, D., Murray, A., Osborn, K., Banks, L., and Crawford, L.(1988) EMBO J. 7,1815-1820 Storey, A., Almond, N., Osborn, K., and Crawford, L. (1990) J. Gen. Virol. 71,
C I R "K L ~ ~ I "

__"

Z,

Rosenber , A. H., Lade, B. Chui, D., Lin, S., Dunn, J. J., and Studier, F. W. (1987) (Amst.)6,125-135 Roth, E. J., Kurz, B., Llang, L., Hansen, C. L., Dameron, C. T., Winge, D. R., and Smotkin, D. (1992) J. Bwl. Chem. 267. 16390-16395 R m . F.. Chen; Y., and Hopkins, P. B.(1990)J. Am. Chem. SOC.112, 94039404 Schneider-Gadicke. A,, and Schwarz, E. (1986)EMBO J. 6 , 2285-2292 Scbwan, E., Freese, U. K., Gissmann, L., Mayer, W., Roggenbuck,B., Stremlau,

( -I- ~ W" rmnrptxa&. - -, . -- - -, 1171-1174 . -.

~

"

& n e

-- - -

Studier, F. W., and Moffett, B. A. (1986) J . Mol. Bioi. 189, 113-130 Tanaka, A,, Noda, T., Yajima, M., Hatanaka, and Ito, Y. (1989)J. Virol. 63, 1465-1469 Vallee, B.L., and Auld, D. S. (1990)Biochemistry 29,5647-5659 Vousden, K. H., Doniger. J., DiPaolo, J. A., and Lowy, D. R. (1988)Oncogene Res. 3, 167-175 Watanabe, S., and Yoshiike, K. (1988)Int. J. Cancer 41,896-900 Watanabe, S., Kanda, T., and Yoshiike, K. (1989)J. Virol. 63,965-969 Watanabe, S., Kanda, T., Sato, H., Furuno, A., and Yoshiike, K. (1990)J. Virol. 64,207-214 Wu, E. W., Clemens, K. E., Heck, D. V., and Munger, K. (1993) J. Virol. Yee, A. S., Raychaudhuri, P., Jakoi, L., and Nevins, J. R.(1989) Mol. Cell. Bid.
I ) 57%5*5
" , .

"-

zur Hausen, H.(1991)Science 246, 1167-1173 zur Hausen, H., and Schneider, A. (1987)in The Papouaoiridae 2 (Salzman, N. P., and Howley, P. M., eds), pp. 245-263,Plenum Press, New York