TOXICOLOGICAL SCIENCES 115(1), 118130 (2010) doi:10.

1093/toxsci/kfq028 Advance Access publication January 27, 2010

Long-term Nicotine ExposureInduced Chemoresistance Is Mediated by Activation of Stat3 and Downregulation of ERK1/2 via nAChR and Beta-Adrenoceptors in Human Bladder Cancer Cells
Rong-Jane Chen,* Yuan-Soon Ho, How-Ran Guo,* and Ying-Jan Wang*,1
*Department of Environmental and Occupational Health, National Cheng Kung University Medical College, Tainan, Taiwan 70428; and School of Medical Technology and Biotechnology, Taipei Medical University, Taipei 110, Taiwan
1

To whom correspondence should be addressed at Department of Environmental and Occupational Health, National Cheng Kung University Medical College, 138 Sheng-Li Road, Tainan 70428, Taiwan. Fax: (886) 6-275-2484. E-mail: yjwang@mail.ncku.edu.tw. Received January 18, 2010; accepted January 22, 2010

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

Previous reports suggested that bladder cancer patients who continue to smoke while receiving chemotherapy have poorer outcomes than their nonsmoking counterparts. Nicotine, the major addictive compound in cigarette smoke, is known to induce chemoresistance in some cancer cells. Chemoresistance has been linked to the activation of Stat3 (signal transducer and activator of transcription). The objective of this study was to identify the role of Stat3 in chemoresistance induced by nicotine in human bladder cancer cell line, T24 cells. Chemoresistant T24 cells were established by persistent nicotine treatment. Apoptosis and cell cycle parameters were analyzed by Annexin V staining, poly(ADP-ribose) polymerase degradation, caspase activity, and propidium iodide staining. Signal transduction mediating the chemoresistance was detected by Western blotting and small interfering RNA (siRNA) transfection. We provide evidence for the rst time that nicotine strongly activated Stat3, leading to Cyclin D1 overexpression, cell cycle perturbations, and chemoresistance. Furthermore, nicotine mobilized Stat3 signaling, resulting in the loss of extracellular signal-regulated protein kinase 1/2 (ERK 1/2) activation and reduced chemosensitivity via nicotinic acetylcholine receptors and b-adrenoceptors. Inhibition of Stat3 by siRNA or a specic inhibitor restored chemosensitivity in T24 cells. Stat3 could be the major target for increasing chemosensitivity in patients who develop chemoresistance during chemotherapy, and avoidance of cigarette smoking or nicotine-based treatments may increase the efcacy of chemotherapy. Key Words: nicotine; chemoresistance; Stat3; ERK1/2; nAChR; b-AR.

Smoking is considered to be one of the most important risk factor for urinary bladder cancer (UBC), the fth most common human neoplasm (Zeegers et al., 2000). Most of the deaths from bladder cancer are due to advanced unresectable disease, which is resistant to chemotherapy (Dreicer, 2001). A number of studies have shown that bladder cancer patients who smoke while receiving treatment for their malignancies have poorer outcomes compared with their nonsmoking counterparts. For

instance, bladder cancer patients with supercial transitional cell carcinoma who continue to smoke tend to have faster recurrences than those who quit smoking (median time to recurrence of 8.9 vs. 13 months, respectively) (Fleshner et al., 1999). In Chens study, the 3-year recurrence-free survival (95% condence interval) of smokers, nonsmokers, exsmokers, and quitters were 45% (3256%), 57% (4370%), 62% (4773%), and 70% (5381%), respectively, which indicated a shorter recurrence-free survival in those who continued to smoke. They concluded that continued smokers have a 2.2-fold greater risk of bladder cancer recurrence than quitters (Chen et al., 2007). These studies suggest that cigarette smoking may exert a protective factor against drug-induced cytotoxicity and further imply a survival mechanism in the maintenance of chemoresistance in these cells. However, very little is known about the mechanism by which cigarette smoke enhances chemoresistance. It has been suggested that nicotine, the major component in cigarette smoke originally thought to be only responsible for tobacco addiction, also alters some cellular functions, such as activation of mitogenic pathways, angiogenesis, and cell growth in many cell types (Arredondo et al., 2006; Mousa and Mousa, 2006). Nicotine acts its biological function mainly through the nicotinic acetylcholine receptor (nAChR) (Schuller et al., 2003), b-adrenoceptors (b-AR) (Shin et al., 2007), or EGF receptor (Laag et al., 2006). Additionally, nicotine has been shown to inhibit apoptosis induced by tumor necrosis factor, UV (ultraviolet radiation) light, or chemotherapeutic drugs such as cisplatin, vinblastine, paclitaxel, and doxorubicin in a variety of cancer cells (Wright et al., 1993; Xu et al., 2007). The antiapoptotic activity of nicotine is known to be regulated by multiple signaling proteins, such as Bcl-2, nuclear factor-jB, Bax, Bad, active human protein kinases (AKT), and survivin (Jin et al., 2004b; Tsurutani et al., 2005; Xu et al., 2007). These studies indicate that exposure to nicotine may result in chemoresistance and decreased efciency of cancer therapies.

The Author 2010. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org

ROLE OF NICOTINE INDUCES CHEMORESISTANCE

119

Tumor cells often respond to chemotherapy by engaging protective mechanisms and survival signaling, which can antagonize the chemotherapy (Mayo and Baldwin, 2000). Furthermore, apoptosis inhibition is necessary to provide cancer cells with the ability to survive in a stressful environment; it has been proposed that oncogenes provide cancer cells with intrinsic resistance. Chemoresistance in several types of cancer has been linked to the activation of Stat3 (signal transducer and activator of transcription), and upregulation of Stat3 directly confers a drug-resistant phenotype (Barre et al., 2007). For example, recent studies have demonstrated that paclitaxel-resistant ovarian cancer cell lines show an abnormal increase of Stat3 activity and that RNAimediated downregulation of the transcription factor reduces paclitaxel resistance (Duan et al., 2006). Stat3 can also inhibit cell cycle arrest and senescence through upregulation of Cyclin D1 and downregulation of p21WAF1 protein expression (Barre et al., 2003). Taken together, these studies indicate that Stat3 confers on cancer cells an enhanced ability to survive from genotoxic treatments and thus may be a predictive marker of drug resistance. Inhibition of the Stat3 pathway in several models of human malignancies induces growth arrest, apoptosis, and chemosensitivity (Duan et al., 2007). Enhancement of the expression of survival proteins and prevention of cell cycle arrest implied that Stat3 may be involved in drug resistance in bladder cancer therapies and that the chemoresistance induced by nicotine in bladder tumors could trigger this process. Studying the mechanisms of cigarette smokeinduced chemoresistance may explain how cancer cells gain a survival advantage to combat chemotherapeutic agentinduced cytotoxicity and could also be helpful for the design of improved therapeutic strategies for enhancing chemosensitivity in bladder cancer patients who continue to smoke. The following were the focus of this study: (1) chemosensitivity of control cells and chemoresistance by longterm nicotine treatment in bladder cancer cells, (2) constitutive activation of Stat3 leading to Cyclin D1 overexpression was correlated with chemoresistance induced by nicotine, (3) effects of Stat3 inhibitor AG490 and Stat3 small interfering RNA (siRNA) on the reversal of chemoresistance, and (4) the role of a7-, a4/b2-nAChR, and b-AR on Stat3 activation, extracellular signal-regulated protein kinase 1/2 (ERK 1/2) downregulation, and protective effects in response to anticancer agents.

(PARP), ERK1/2, Stat3, phospho-ERK1/2, phospho-Stat3 Ser727, phosphoStat3 Tyr-705, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and horseradish peroxidaseconjugated anti-mouse and anti-rabbit secondary antibodies were purchased from Cell Signaling (Beverly, MA) Cell Culture and Pharmacological Treatments T24 bladder epithelial cancer cell line, immortalized human uroepithelial cells SV-HUC-1, human lung cancer cell line A549, and immortalized human lung epithelial cells Beas2B were purchased from ATCC. Human UBC cell line UB47 was a kind gift of Dr Hsiao-Sheng Liu (National Cheng Kung Medical College, Institute of Molecular Medicine, Tainan, Taiwan). T24 cells were maintained in 10-cm2 dishes in McCoy 5A medium (Sigma-Aldrich, Inc), UB47 cells were grown in Roswell Park Memorial Institute medium 1640 (Life Technologies, Inc., Gaithersburg, MD), SV-HUC-1, A549, and Beas2B cells were maintained in Dulbecco/Vogt Modied Eagles minimal essential medium (Life Technologies, Inc.). All culture medium were supplemented with 100 U/ml penicillin, 100 lg/ml streptomycin (Life Technologies, Inc.), and 10% heat-inactivated fetal calf serum (HyClone, South Logan, UT). For the generation of chemoresistance clones, T24 cells were grown in the presence of 1lM of nicotine for 20, 40, 60, and 80 passages. Control cells were cultured in parallel with the treated cells and passaged for every 2 days. Control T24 cells and p80 nicotinetreated T24 cell were used for chemosensitivity comparisons and for studying the mechanism of nicotine-induced chemoresistance in this study. Determination of Cell Viability Trypan blue exclusion assay. Cells were cultured in 96-well plates at a density of 2 3 103 cells per well for 24 h for 5 days. Cell numbers were counted every day after staining with 0.5% trypan blue using a cell counting chamber. MTT assay. Cells were seeded in a 96-well plate at a density of 8 3 103 cells per well for overnight. After removing the medium, 100 ll of serum-free medium containing antitumor agents were added for 72 h. Then, 100 ll of MTT was added to the wells, and the plate was incubated for 2 h at 37C. The medium was removed, and 100 ll of dimethyl sulfoxide (DMSO) was added to the wells. Absorbance was measured using an ELISA plate reader at 570 nm. Assessment of Apoptosis Annexin V staining assay. One of the early characteristics of apoptosis is the rapid translocation and accumulation of the membrane phospholipids phosphotidylserine from the cytoplasmic interface to the extracellular surface. Cells were trypsinized, washed with 13 PBS, centrifugated, and resuspend in 13 Annexin V binding buffer (10mM Hepes, pH7.4; 0.14M NaCl; and 2.5 mN CaCl2) containing 5 ll Annexin V-FITC (Becton Dickinson, San Jose, CA) at room temperature for 15 min. Additional 400 ll of 13 binding buffer was added to stop the reaction, and the percentage of Annexin Vpositive cells were measured by FACScan (Becton Dickinson) Flow cytometry analysis. The percentages of cells below the G1 peak (subG0/G1 fraction) and the distribution of cell cycle were evaluated by propidium iodide staining and analyzed by FACScan (Becton Dickinson) with WinMDI software programs. Caspase activity assay. The activity caspase-3 was quantied by means of the Caspase Fluorometric Assay Kit (R&D Systems, Minneapolis, MN), according to the manufacturers instructions. Briey, cell extracts were incubated with caspase substrate for 1 h at 37C. Caspase-specic peptides that are conjugated to the uorescent reporter molecule 7-amino-4-triuromethyl coumarin (AFC) were then added to the reaction and incubation for 1 h. The cleavage of peptide by caspase released free AFC that can be quantied using a uorescence spectrophotometer (400-nm excitation and 505-nm emission). Western Blot Analysis The isolation of total cellular lysates, immunoprecipitation, gel electrophoresis, and immunoblotting were performed, according to the methods described previously (Lee et al., 2003). Immunoreactive proteins were visualized with the

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

MATERIALS AND METHODS

Materials Nicotine, nonspecic nicotinic receptor inhibitor hexomethonium bromide, nonselective antagonist for beta-adrenergic receptors, propranolol, ERK1/2 inhibitor U0126, JAK2/Stat3 inhibitor AG490, a7-subunit inhibitor methyllycaconitine (MLA), a4/b2 subunit inhibitor a-lobeline (Lob), cisplatin, and paclitaxel were purchased from Sigma-Aldrich, Inc. (St Louis, MO). Antibodies against Cyclin D1, Cyclin A, Cyclin B, proliferation cell nuclear antigen (PCNA), phospho-cdc2, Bcl-2, Bax, poly(ADP-ribose) polymerase

120

CHEN ET AL.

enhanced chemiluminescence detection system (PerkinElmer Life Science, Inc., MA) and BioMax LightFilm (Eastman Kodak Company, New Heaven, CT), according to the manufacturers instructions. Electrophoretic Mobility Shift Assay Nuclear extracts were performed according to Trombino et al. (2004). DNA probes were biotin-labeled using a biotin 3# endlabeling kit (PIERCE Biotechnology, Rockford, IL). Double-stranded labeled DNA oligonucleotides encompassing the Stat3 consensus oligonucleotides (GATCCTTCTGGGAATTCCTAGATC) (Protech Technology Enterprise Co., Ltd, TaoYuan, Taiwan) were used for a binding reaction. The DNA-binding activities of Stat3 were evaluated using an electrophoretic mobility shift assay kit (PIERCE Biotechnology), according to the manufacturers instructions. Ten micrograms of nuclear extracts was subjected to denaturing 4% polyacrylamide gel electrophoresis and developed. Transfection of the Constitutively Active Form Stat3C Plasmid and Stat3 siRNA The constitutively active form of Stat3 (Stat3C) plasmid was kindly provided by Dr Hsiao-Sheng Liu (National Cheng Kung Medical College, Institute of Molecular Medicine, Tainan, Taiwan). Stat3C can bind DNA and activate transcription without a specic stimulation. T24 cells were transfected with 1.5 lg/ml of Stat3C plasmid and then cells were treated with cisplatin or paclitaxel for 48 h. The siRNAs targeting Stat3 used in this study were purchased from Ambion Inc. (Austin, TX). The siRNA sequences targeting human Stat3 used in this study were as follows: sense: 5#-GGAUCUAGAACAGAAAAUGtt-3# and antisense: 5#-CAUUUUCUGUUCUAGAUCCTG-3#. Nic-T24 cells were transiently transfected with Stat3 siRNA (50nM) by electroporation using a MicroPorator (Digital Bio Technology, Suwon, Korea) under condition of 1350 V and 20 ms, according to the manufactures instruction. Determination of Noradrenaline Level T24 and Nic-T24 cells were plated in a 12-well plate at a density of 2 3 104 per well. Cells were pretreated with the a7-subunit inhibitor methyllycaconitine (MLA) at 200lM, the a4/b2-subunit inhibitor a-lobeline (Lob) at 200lM, or the b-adrenoceptor inhibitor propranolol (Prop) at 10lM for an hour. Nic-T24 cells were then treated with 1lM nicotine for 24 h. Supernatants were collected to determine the concentration of noradrenaline. The noradrenaline level was detected using the Noradrenaline ELISA Kit (Immuno-Biological Laboratories, Hamburg, Germany), according to the manufacturers instructions. Statistical Analysis Results are expressed as mean SEM. Experimental data were analyzed using the Students t-test. Differences were considered to be statistically signicant when the p value was less than 0.05.

percentage of subG0/G1 phase cells (Fig. 1B) and a concomitant increase in the percentage of G0/G1 phase cells (Fig. 1C). Among the nicotine-treated T24 cells, p80 Nic-T24 cells, which were exposed to nicotine for the longest time period, exhibited the highest cell proliferation rate, the percentage of cells in G0/G1 phase, and the lowest increased in the percentage of subG0/G1 cells at 24, 48, and 72 h compared with the control and other nicotine-treated T24 cells. These results indicate that long-term nicotine exposure disrupts serum withdrawal mediated apoptosis, leading to continuous cell cycle progression. We then assessed expression of cell cycle regulatory proteins. Figure 1D shows that Cyclin D1 and PCNA expression was increased with increasing exposure periods of T24 cells to nicotine. P80 Nic-T24 cells increased Cyclin D1 expression by 2.1-fold compared with control T24 cells.
Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

Long-term Nicotine Treatment Induces Higher Chemoresistance in Nic-T24 Cells Cyclin D1 is associated with enhanced resistance to apoptosis induced by anticancer agents (Biliran et al., 2005). To investigate the effect of long-term nicotine treatment on apoptosis, control T24 cells (Con) and p80 Nic-T24 cells (Nic) were treated with increasing concentrations of cisplatin (Cis) or paclitaxel (Tax) for 72 h. Cell viability of the Con group was signicantly inhibited by 50% at 5lM cisplatin compared with 19% in the Nic group. Similarly, treated with paclitaxel resulted in a dose-dependent growth inhibition in the Con group but with decreased paclitaxel sensitivity in the Nic group (Fig. 2A). In addition, Con groups treated with Cis and Tax showed a signicantly higher percentage of Annexin V staining (22% by Cis treatment and 18.1% by Tax treatment) compared with Nic groups (13.5% by Cis treatment and 9.8% by Tax treatment) (Fig. 2B). Caspase activity assay revealed that the caspase-3 activity increased by about threefold in Con groups, whereas only increased slightly in Nic groups after antitumor agents application (Fig. 2C). Furthermore, treatment of Con groups with antitumor agents showed cleavage of the DNA repair enzyme PARP. Cleaved PARP was reduced in cisplatin-treated Nic groups and was not observed in paclitaxeltreated Nic groups. Moreover, a high Bax/Bcl-2 ratio can be correlated with apoptotic cell death, while a low Bax/Bcl-2 ratio may represent a prosurvival prole (Perlman et al., 1999). Figure 2D shows that the Bax/Bcl-2 ratio was increased in Con groups (2.97-fold by Cis treatment and 1.4-fold by Tax treatment), whereas a lower Bax/Bcl-2 ratio was observed in Nic groups. We then investigated whether the decreased chemosensitivity in the Nic groups was associated with perturbations in the cell cycle. Nic groups displayed a signicant increase in percentage of cells in G0/G1 phase in response to antitumor agents compared to Con groups (Fig. 2E). Western blot analysis conrmed that the Nic groups maintained an increased expression of Cyclin D1, Cyclin A, and Cyclin B proteins after

RESULTS

Growth Properties of T24 Cells with Long-term Nicotine Exposure In this study, we developed long-term nicotine exposure models in T24 bladder cancer cells. T24 cells were exposed to 1lM nicotine for 20, 40, 60, and 80 passages (referred to as p20, p40, p60, and p80 Nic-T24 cells). Figure 1A shows that nicotine-treated T24 cells have a markedly higher timedependent proliferation rate compared with the control cells. The percentage of subG0/G1 phase cells in control increased signicantly in a time-dependent manner under serum-free condition. In contrast, at the same time point, nicotine-treated T24 cells displayed a signicantly lower increase in the

ROLE OF NICOTINE INDUCES CHEMORESISTANCE

121

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 1. Persistent exposure to nicotine increases cell proliferation, perturbs cell cycle progression, and upregulates Cyclin D1 and PCNA expression. (A) Control (Con), p20, p40, p60, and p80 nicotine-treated T24 cells were seeded in 96-well plates in 10% serum medium for the indicated times. Cell proliferation rates were measured by the trypan blue exclusion assay. Distribution of cells in subG0/G1 (B) and G0/G1 (C) phases were analyzed by ow cytometry after propidium iodide staining. Data are represented as means SD of three independent experiments; *p < 0.05 compared with Con groups. (D) After the treatment, cell lysates were isolated and immunoblotted with anti-Cyclin D1 and anti-PCNA antibodies. The membrane was probed with anti-a-tubulin to conrm equal loading of proteins.

treatment with antitumor agents, whereas the expression levels of these cell cycle regulatory proteins decreased in the Con groups (Fig. 2F). These data indicate that persistent exposure to nicotine may inhibit apoptosis then trigger chemoresistance in bladder cancer cells. Overactivation of Stat3 and Downregulation of ERK1/2 in Chemoresistant Nic-p80 Cells Our recent study indicated that Stat3 and ERK1/2 activation was associated with Cyclin D1 overexpression and was linked to nicotine exposure (Chen et al., 2008). The constitutive activation of Stat3 may contribute to the survival advantage of cancer cells and acquired drug resistance to chemotherapy. Thus, we further examine the activation of Stat3 and ERK1/2 in response to long-term nicotine exposure. Exposure of Con groups exposed to antitumor agents for 48 h resulted in ERK1/2 activation but Stat3 inhibition, by comparison, Stat3 phosphorylation was increased, but ERK1/2 activation was inhibited in Nic groups. Consistent with the Western blot results, the Stat3 DNAbinding activity was strongly induced in Nic groups by antitumor agent treatment compared with Con groups (Fig. 3B). We conclude that chemoresistance in the Nic groups could be mediated by inducing the Stat3 signaling pathway and reducing ERK1/2 activity.

In order to clarify that nicotine-induced Sta3 activation is not limited in T24 bladder cancer cells, normal human lung epithelial cells Beas2B, human lung cancer cells A549, immortalized human uroepithelial cells SV-HUC-1, and human bladder cancer cells UB47 were treated with 1lM nicotine for 15, 30, 60, and 120 min. Figures 3CF showed that nicotine increased the phosphorylation of Stat3 in four cell lines, whereas ERK1/2 activation was only observed in A549 and UB47 cells. We suggested that Stat3 could be the major target for nicotine exposure and may play important roles in proliferation, chemoresistance, or antiapoptosis in response to nicotine. ERK1/2 Activation Mediates Apoptotic Cell Death Induced by Antitumor Agents Previous studies indicated that cell death induced by cisplatin is ERK1/2 dependent; inhibition of ERK1/2 activation reduced the chemosensitivity of cancer cells (Lu and Cederbaum, 2007). ERK1/2-specic inhibitor U0126 was used to determine whether ERK1/2 activity is needed for antitumor agentinduced apoptosis. Pretreatment with U0126 in Con groups effectively attenuated antitumor agentinduced ERK1/2 activation but did not affect Stat3 phosphorylation (Fig. 4C) and resulted in a decrease in the percentage of subG0/G1 cells in Cis- and Taxtreated groups by 20 and 12%, respectively (Fig. 4A). Cell cycle

122

CHEN ET AL.

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 2. Effects of persistent nicotine exposure on chemoresistance. (A) Control (Con) and p80 nicotine-treated T24 cells (Nic) were seeded in 96-well plates treated with 5lM cisplatin (Cis) or 10nM paclitaxel (Tax) under serum-free condition for 72 h. Cell viability was measured by the MTT assay. Following DMSO, serum deprivation (SF), Cis, or Tax treatment, Con and Nic groups were collected and subjected to the following apoptotic assays: (B) Annexin V staining as a specic apoptosis marker; (C) caspase-3 activities; and (D) Western blotting for PARP, Bax, and Bcl-2 expression by using specic antibodies. The intensities of Bax and Bcl-2 bands were quantied by densitometry and expressed as Bax/Bcl-2 ratios. (E) Distribution of cells in G0/G1 phase was analyzed by a ow cytometer. (F) Cell lysates were subjected to the SDS-polyacrylamide gel electrophoresis and probed with anti-Cyclin D1, -Cyclin A, and -Cyclin B antibodies. Equal protein loading was determined by an anti-GAPDH antibody. Data are represented as means SD of three independent experiments; *p < 0.05 compared with Con groups.

distribution was also affected: most of the cells remained in G0/G1 phase after ERK1/2 inhibition (Fig. 4B). The results suggested that long-term nicotine-treated T24 cells inhibited ERK1/2 activation could result in chemoresistance. Role of Stat3 in Chemoresistance in T24 Cells We further investigate whether inhibition of Stat3 activity could reverse chemosensitivity in Nic groups. By transfection

with Stat3 siRNA in Nic-T24 cells (Nic si Stat3), the Stat3 protein levels were reduced by 30% and phosphorylated Stat3 was reduced by 50%, in comparison to Nic-T24 cells (Fig. 5A). Consistently, the Nic si Stat3 groups exhibited higher levels of apoptosis upon antitumor agent treatments compared with Nic groups, as evidenced by the decrease of cell viability (Fig. 5B) and increased number of cells in subG0/G1 phase (Fig. 5C). To further conrm the role of Stat3 in chemoresistance, we examined whether downregulation of Stat3 activity by the

ROLE OF NICOTINE INDUCES CHEMORESISTANCE

123

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 3. Stat3 but not ERK1/2 activity is increased by persistent exposure to nicotine. (A) Control (C) and nicotine-treated p80 T24 cells (N) were treated with DMSO, serum deprivation (SF), 10lM cisplatin (Cis), or 2nM paclitaxel (Tax) for 48 h. Expressions of pStat3, Stat3, pERK1/2, and ERK1/2 were determined by Western blotting. Equal protein loading was determined by anti-GAPDH antibody. (B) After the same treatment, Stat3 DNAbinding activity was assessed using an electrophoretic mobility shift assay as described in Materials and Methods section. (C) SV-HUC-1 cells, (D) UB47 cells, (E) Beas2B cells, and (F) A549 cells were treated with nicotine 1lM under serum-free condition for 0, 15, 30, 60, and 120 min. Phosphorylated ERK1/2, ERK1/2, Stat3 Ser727, and Stat3 were determined by immunoblotting with specic antibodies.

JAK2/Stat3 inhibitor AG490 enhanced susceptibility to antitumor agentinduced apoptosis. Figure 5D shows that pretreatment with AG490 followed by antitumor agents induced a signicant increase in apoptotic cells compared to Nic groups without AG490 pretreatment. We also found that Stat3 inhibition by Stat3 siRNA or AG490 reduced Cyclin D1 expression, indicating that Cyclin D1 expression requires the Stat3 activation and is necessary for chemoresistance in Nic groups (Figs. 5E and 5F). Interestingly, we found a correlation may exist between Stat3 activation and ERK1/2 inhibition after long-term nicotine treatment. Pretreatment with AG490 or Stat3 siRNA restored the ERK1/2 activation, indicating that nicotine-induced inhibition of ERK1/2 phosphorylation could be mediated by Stat3 activation (Figs. 5E and 5F). Previous ndings prompted us to study the effect of constitutively active Stat3 on chemoresistance in response to

chemotherapeutic agents. Transient transfection of Stat3C plasmid into wild-type T24 cells resulted in increased phosphorylation of Stat3 and reduced ERK1/2 phosphorylation compared with control T24 cells (Fig. 5G). In addition, increased expression of Cyclin D1 was observed in T24 cells transfected with Stat3C. Cell viability increased about twofold in Stat3C-transfected T24 cells compared with control T24 cells after treatment with cisplatin or paclitaxel (Fig. 5H). These results conrmed that overexpression and/or constitutive activation of Stat3 could desensitize T24 cells to apoptosis induced by chemotherapeutic agents. Activation of Stat3 and Deregulation of ERK1/2 after Longterm Nicotine Exposure Are Mediated by nAChR and b-AR We have previously indicated that nicotine activates Stat3, leading to Cyclin D1 expression and cell proliferation through

124

CHEN ET AL.

cells. The nonspecic nAChR antagonist hexamethonium bromide (Hexa), a4/b2-specic inhibitor a-lobeline (L), a7selective antagonist methyllycaconitine (MLA), and nonspecic b-AR antagonist propranolol (Prop) were used to conrm which receptors upregulate Stat3 and induce chemoresistance. The results indicate that the a4/b2-specic inhibitor and b-AR antagonist inhibited Stat3 activation, BCl-2 expression (Figs. 6BD), and cell viability (Figs. 6E and 6F), whereas the a7selective antagonist methyllycaconitine (MLA) did not. These results indicate that Stat3 activation and chemoresistance by long-term nicotine stimulation involves the action of a4/b2 nAChR, and b-AR in Nic-T24 cells. Nicotine was found to evoke noradrenaline or adrenaline release through nAChR (Al-Wadei and Schuller, 2009), and in turn, these hormones stimulate human cancer cells growth and metastasis (Shin et al., 2007; Sood et al., 2006). Our previous study showed that nicotine did not induce the release of adrenaline (Chen et al., 2008). However, it is possible that nicotine could induce noradrenaline to stimulate tumor cell growth. Figure 6G shows that nicotine induced the release of noradrenaline, which was inhibited by a4/b2-nAChR and b-AR antagonist but was not affected by a7-nAChR antagonist. Our results further conrm that a4/b2-nAChR and b-AR act upstream of Stat3, cell growth, noradrenaline release, and chemoresistance in long-term nicotinestimulated human bladder cancer cells.

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

DISCUSSION

FIG. 4. Effects of U0126 pretreatment on the percentage of subG0/G1 (A) and G0/G1 (B) observed following 48-h exposure to 5lM Cis or 2nM Tax analyzed by ow cytometry and the expression of pERK1/2, ERK1/2, pStat3, Stat3, and Cyclin D1 levels determined by Western blotting (C). Means SD of three independent experiments; *p < 0.05 compared with Con groups.

a4/b2-, a7-nAChR, and b-AR (Chen et al., 2008). Chronic exposure to nicotine has been reported to upregulate several classes of neuronal nAChRs in a long-lasting manner (Kawai and Berg, 2001). Our results also conrmed that a4- and a7nAChR subunits were upregulated after long-term exposure to nicotine (Fig. 6A). It is not clear whether nAChRs upregulation is involved in Stat3 activation and chemoresistance in Nic-T24

Bladder cancer patients who continue smoking tend to develop chemoresistance compared with patients quit smoking before treatment (Fleshner et al., 1999). The molecular mechanisms of cigarette smokeinduced chemoresistance in bladder cancer remain to be identied. Nicotine is the major component in cigarette smoke and can be detected in the urine of smokers. Previous studies have shown that nicotine inhibits apoptosis and induces chemoresistance in many cancer cells. Thus, we hypothesize that long-term exposure to nicotine in bladder cancer cells could be the leading cause of chemoresistance. To fully understand the potential chemoresistant properties of nicotine, we analyzed various signaling pathways in response to persistent nicotine exposure and its subsequent effects on apoptosis inhibition and cell cycle regulatory events in T24 cells. Herein, we provide evidence for the rst time that overactivation of Stat3 but fails to activate ERK1/2 activity (and downregulation of ERK1/2) contribute to chemoresistance in response to long-term nicotine exposure in bladder cancer cells. Previous studies indicated that ERK1/2 activation is generally considered a survival signaling pathway; however, many evidences exist that the ERK1/2 pathway mediates apoptosis induced by different stimuli in different tissues. Wang et al. (2000) showed that ERK1/2 activation is the single most important factor for cisplatin-induced apoptosis. In human

ROLE OF NICOTINE INDUCES CHEMORESISTANCE

125

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 5. Effects of Stat3 inhibition on cell viability and apoptosis induced by antitumor agents. (A) Nic-T24 cells were transfected with Stat3 siRNA (50nM); incubated for 24-h posttransfection; and Stat3, ERK1/2, pStat3, pERK1/2, and Cyclin D1 expression were determined by Western blotting. (B) Cell viability of Con, Nic, and Nic si Stat3 groups after treated with 5lM Cis or 10nM Tax were measured by the MTT assay. (C) The percentage of subG0/G1 were detected either transfected with Stat3 siRNA or (D) pretreatment with 15lM AG490 followed by treated with antitumor agents for 48 h. *p < 0.05 compared with Con groups; #p < 0.05 compared with Nic groups. (E) ERK1/2, Stat3, pERK1/2, pStat3, and Cyclin D1 expressions were determined by Western blotting in Nic-T24 cells transfected with 50nM Stat3 siRNA for 24 h or (F) pretreated with 15lM AG490 for 1 h and then treated with 10lM cisplatin or 2nM paclitaxel for a further 48 h under serum-free condition. (G) T24 cells were transfected with Stat3C plasmid (1.5 lg) (Stat3C), incubated for 24-h posttransfection, and Stat3, ERK1/2, pStat3, pERK1/2, and Cyclin D1 expression were determined by Western blotting. Equal protein loading was determined by an anti-GAPDH antibody. (H) Cell viability of Con, Nic, and Con Stat3C groups after treated with 5lM Cis or 10nM Tax were measured by the MTT assay. *p < 0.05 compared with Con groups.

126

CHEN ET AL.

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 6. Involvement of nAChR and b-AR in the Stat3 activation and ERK1/2 downregulation in Nic-T24 cells. (A) The expression of a4-, b2-, and a7-nAChRs in T24 and Nic-T24 cells was detected by specic antibodies. (B) Nic-T24 cells were starved and treated with inhibitors nAChR antagonist; hexomethonium bromide (Hexa) 0.1, 0.2, and 0.4mM (MLA, M); or (C) nonspecic b-AR antagonist, propranolol (Prop) 10, 25, and 50lM for 120 min. (D) Nic-T24 cells were pretreated with a7-nAChR inhibitor MLA (M) 200lM or a4-nAChR antagonist Lobeline (L) 200lM for 1 h followed by cisplatin (Cis 10lM) or paclitaxel (Tax 10nM) for 48 h. Protein expression was detected by Western blotting using anti-ERK1/2, pERK1/2, pStat3, Stat3, or BCl-2 antibodies, and (E) Cell viability was then measured by the MTT assay. *p < 0.05 compared with Con groups; #p < 0.05 compared with Nic groups. (F) Pretreatment with propranolol (Prop) 10lM increased drug sensitivity in both T24 and Nic-t24 cells. *p < 0.05 compared with groups in the absence of Prop; (G) pretreatment with propranolol (P) 10lM or a4-nAChR antagonist Lobeline (L) 200lM reduced the release of noradrenaline. *p < 0.05 compared with Con groups; #p < 0.05 compared with Nic groups.

cervical carcinoma SiHa and hepatoblastoma HepG2 cells, suppression of ERK1/2 signal pathway by mitogen-activated protein kinase/extracellular signal regulated kinase kinase (MEK) inhibitor PD98059 resulted in an increase in cisplatin resistance (Yeh et al., 2002). Consistent with these ndings, we found that ERK1/2 activation and subsequent apoptosis were observed in control T24 cells but not in chemoresistant NicT24 cells after antitumor agent treatment. Inhibited ERK1/2 phosphorylation by U0126 effectively reduced anticancer agentinduced apoptosis and increased G0/G1 arrest (Fig. 4). The results provide the evidence that Nic-T24 cells with lower ERK1/2 activity were prone to stay in G0/G1 phase rather than undergo apoptosis in response to antitumor agents.

Stat3 pathway is one of the major prosurvival signal transduction pathways linked to chemoresistance in various cancer cell lines. We provide evidence that nicotine-treated cancer cells exhibit stronger prosurvival signaling through Stat3 activation, which leads to cell survival in response to antitumor agents. We also found that Stat3C-transfected cells had elevated cell viability compared with T24 cells after treatment with cisplatin or paclitaxel (Fig. 5H). Thus, overactivation of Stat3 may stimulate cell cycle progression and provide protection against apoptosis. Indeed, Stat3 promotes uncontrolled cell growth and survival through deregulation of the expression of cell cycle genes, including Cyclin D1 (Kobayashi et al., 2006). Overexpression of Cyclin D1 in

ROLE OF NICOTINE INDUCES CHEMORESISTANCE

127

human cancer cell lines have been shown to perturb cell cycle progression leading to resistance to chemotherapy (Kornmann et al., 1999) Our results also demonstrated that bladder cancer cells can gain a survival advantage after chronic exposure to nicotine. For instance, upon serum starvation, p80 Nic-T24 with Cyclin D1 overexpression consistently displayed shorter doubling times and a higher proliferation rate, suggesting that nicotine treatment renders T24 cells less dependent on growth factors. Through activation of Stat3 and Cyclin D1, Nic-T24 cells were prone to enter into G0/G1 phase rather than apoptosis after treatment with antitumor agents compared with control groups. In the present study, disrupting the Stat3 oncogenic pathway with either a JAK2/Stat3 inhibitor or an Stat3 siRNA resulted in inhibition of Cyclin D1 expression, cell proliferation, and restored the sensitivity antitumor agents. These nding suggest that elevated Stat3 activation from long-term nicotine treatment could trigger subsequent Cyclin D1 overexpression and contribute to chemoresistance in Nic-T24 bladder cancer cells by maintaining cell cycle progression and attenuating drug-induced apoptosis. Duan et al. (2006) reported that the Stat3 pathway is often overexpressed and activated in many paclitaxel-resistant ovarian cancer cells compared to cell lines that are paclitaxel na ve. Stat3 inhibition increased paclitaxel-induced apoptosis even in the paclitaxel-resistant ovarian cancer cells (Duan et al., 2006). Introduction of antisense Stat3, Stat3 decoy DNA, or a dominant-negative Stat3 into human tumor cells with constitutively activated Stat3 leads to apoptosis (Boehm et al., 2008; Leong et al., 2003). These results reveal that Stat3 inhibition is an effective strategy for enhancing chemosensitivity. However, both Stat3 siRNA and AG490 could not completely reverse chemosensitivity in response to chemotherapeutic agents (Fig. 5C), indicating that other mechanisms may also be involved in chemoresistance in nicotine-treated T24 cell. For instance, the AKT pathway (Xu et al., 2007) or AKT/protein kinase C (PKC) pathways (Jin et al., 2004a) may be required for the antiapoptotic effects of nicotine. Further work is necessary to show that the disruption of Stat3 alone or in combination with other pathways such as AKT pathway could be a potential strategy for increasing chemosensitivity in bladder cancer therapy. We found that treatment with Stat3 siRNA or AG490 induced cell death and ERK1/2 activation in response to antitumor agents in Nic-treated T24 cells, indicating the essential role of Stat3 in the suppression of ERK1/2 activity. Several studies suggested a negative regulation between the Stat3 and Src-homology 2 domain-containing tyrosine phosphatase/ERK pathways (Ernst and Jenkins, 2004). For example, Arany et al. found that pretreatment with AG490 or direct inhibition of Stat3 via a dominant-negative mutant restored ERK1/2 activation. They suggested that Stat3 may compete with the binding site of growth factors and thus terminate ERK1/2 activation. The other possibility is that Stat3-mediated activation of SOCS3 can inhibit growth factor receptor activation leading to ERK inactivation

(Xia et al., 2002). Based on these studies, it is possible that Stat3 overactivation in Nic-T24 cells increases SOCS3 activation, leading to the suppression of ERK1/2 activation. Impaired induction of the ERK1/2 pathway in Nic-T24 cells becomes highly susceptible to Stat3-dependent suppression of apoptosis and concomitant induction of proliferation. Thus, inhibition of Stat3 activation by AG490 or siRNA restored ERK1/2 activation and chemosensitivity in Nic-T24 cells. In this study, we found that a4- and a7-nAChR subunits were upregulated in response to chronic exposure to nicotine. A previous study indicated that a7-nAChR is the primary receptor that mediates proliferation and antiapoptosis effects of nicotine in cancer cells. Nevertheless, a3/b4- or a4/b2-nAChR might also be important for these processes (Chen et al., 2008; Marrero and Bencherif, 2009; West et al., 2003). Our results show that long-term nicotine stimulationinduced Stat3 activation and ERK1/2 downregulation were effectively inhibited by a-lobeline (a4/b2-specic inhibitor) (Fig. 6), indicating that the chemoresistance induced by nicotine could be mediated by a4/b2-nAChR and not by a7-nAChR. Thus, we suggest that chronic nicotine exposure results in a a4/b2nAChR-Stat3-Cyclin D1 prosurvival and antiapoptosis cascade in bladder cancer cells. In addition to nAChRs, nicotine has been reported to promote the growth of cancer cells through the engagement of signaling pathways mediated by another receptor, b-adrenoceptor. Jin et al. (2004a) indicated that low-dose nicotine (1lM) is able to induce cell survival through Bad phosphorylation mediated by b-adrenoceptor. Antagonists for b-AR inhibit the development of pulmonary adenocarcinoma induced by 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) (Schuller et al., 2000), reversed the stimulatory action of nicotine on PKC, ERK1/2 activation, and COX-2 expression together with gastric cancer cell proliferation (Shin et al., 2007). These studies demonstrate that adrenoceptors may play a role in nicotine-mediated signaling. Consistently, we found that nicotine induced activation of Stat3, and the release of noradrenaline was blocked by pretreatment with the b-adrenoceptor antagonist propranolol (Figs. 6D and 6E), indicating a direct role of nicotine on b-adrenoceptor. Nicotine is also reported to transactivate b-adrenoceptor by releasing adrenaline or noradrenaline to stimulate the growth of colon cancer cells (Al-Wadei and Schuller, 2009). Some studies have indicated that synthesis of noradrenaline is mediated by nAChRs, such as a7-nAChR, b2-nAChR, or a2-nAChR (Al-Wadei and Schuller, 2009; Wong et al., 2007). These reports are in accord with our study that nicotine may also transactivate b-adrenoceptor through the release of noradrenaline. Our results suggest that a4/b2-nAChR plays a more important role in chemoresistance and regulation of noradrenaline levels than a7-nAChR (Fig. 6). In conclusion, as shown in Figure 7, persistent nicotineinduced chemoresistance in bladder cancer cells could occur via three processes: (1) increased release of noradrenaline through a4/b2-nAChR and may transactivate b-adrenoceptor;

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

128

CHEN ET AL.

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

FIG. 7. A model of chemoresistance by persistent nicotine exposure in T24 bladder cancer cells. Antitumor agents cause moderate ERK1/2 activation, apoptotic cell death, caspase-3 activation, and low activation of Stat3 in T24 cells. However, persistent nicotine exposure induces chemoresistance through three processes: (1) increased release of noradrenaline through a4/b2-nAChR and may transactivate b-adrenoceptor; (2) activation of Stat3 via a4/b2-nAChR and b-adrenoceptor leading to Cyclin D1 overexpression, perturbation of cell cycle progression, and inhibition of apoptosis induced by antitumor agents; and (3) inhibition of ERK1/2 activation and subsequent reduction in sensitivity to chemotherapeutic agents. Inhibition of a4/b2-nAChR and b-AR by antagonists reduced Stat3 activity and reversed ERK1/2 activation. Inhibition of Stat3 activation by siRNA or the specic inhibitor AG490 restored chemosensitivity in T24 cells.

(2) activation of Stat3 via a4/b2-nAChR and b-adrenoceptor, leading to Cyclin D1 overexpression, perturbation of cell cycle progression, and inhibition of apoptosis induced by antitumor agents; and (3) inhibition of ERK1/2 activation and subsequently reduction in sensitivity to chemotherapeutic agents. To the best of our knowledge, this is the rst evidence of longterm nicotine treatment inducing chemoresistance through overactivation of Stat3 leading to inhibition of ERK1/2 activation via a4/b2-nAChR and b-AR. It is noteworthy that nicotine-mediated inhibition of cell death may not only occur in the failure of chemotherapy but may also help to explain the poor prognostic value of bladder cancer patients who continued cigarette smoking during chemotherapy. Most importantly, we also provide evidence that Stat3 aberrant activation could be due to long-term exposure to environmental toxicants, such as nicotine. Our study had given rise to these considerations for clinical bladder cancer therapy: (1) Avoidance of cigarette smoking or nicotine-based treatment may increase the efcacy

of chemotherapy. (2) a4/b2-nAChR, b-AR, and their downstream Stat3 could be the target for increasing chemosensitivity in bladder cancer patients who develop chemoresistance during chemotherapy.

FUNDING

National Science Council (NSC 95-2314-B-006-095-MY3).

REFERENCES
Al-Wadei, H. A., and Schuller, H. M. (2009). Nicotinic receptor-associated modulation of stimulatory and inhibitory neurotransmitters in NNKinduced adenocarcinoma of the lungs and pancreas. J. Pathol. 218, 437445. Arredondo, J., Chernyavsky, A. I., Jolkovsky, D. L., Pinkerton, K. E., and Grando, S. A. (2006). Receptor-mediated tobacco toxicity: cooperation of

ROLE OF NICOTINE INDUCES CHEMORESISTANCE the Ras/Raf-1/MEK1/ERK and JAK-2/STAT-3 pathways downstream of alpha7 nicotinic receptor in oral keratinocytes. FASEB J. 20, 20932101. Barre, B., Avril, S., and Coqueret, O. (2003). Opposite regulation of myc and p21waf1 transcription by STAT3 proteins. J. Biol. Chem. 278, 29902996. Barre, B., Vigneron, A., Perkins, N., Roninson, I. B., Gamelin, E., and Coqueret, O. (2007). The STAT3 oncogene as a predictive marker of drug resistance. Trends Mol. Med. 13, 411. Biliran, H., Jr, Wang, Y., Banerjee, S., Xu, H., Heng, H., Thakur, A., Bollig, A., Sarkar, F. H., and Liao, J. D. (2005). Overexpression of cyclin D1 promotes tumor cell growth and confers resistance to cisplatin-mediated apoptosis in an elastase-myc transgene-expressing pancreatic tumor cell line. Clin. Cancer Res. 11, 60756086. Boehm, A. L., Sen, M., Seethala, R., Gooding, W. E., Freilino, M., Wong, S. M. Y., Wang, S., Johnson, D. E., and Grandis, J. R. (2008). Combined targeting of epidermal growth factor receptor, signal transducer and activator of transcription-3, and Bcl-X(L) enhances antitumor effects in squamous cell carcinoma of the head and neck. Mol. Pharmacol. 73, 16321642. Chen, C.-H., Shun, C.-T., Huang, K.-H., Huang, C.-Y., Tsai, Y.-C., Yu, H.-J., and Pu, Y.-S. (2007). Stopping smoking might reduce tumour recurrence in nonmuscle-invasive bladder cancer. BJU Int. 100, 281 286; discussion 286. Chen, R. J., Ho, Y. S., Guo, H. R., and Wang, Y. J. (2008). Rapid activation of Stat3 and ERK1/2 by nicotine modulates cell proliferation in human bladder cancer cells. Toxicol. Sci. 104, 283293. Dreicer, R. (2001). Locally advanced and metastatic bladder cancer. Curr. Treat. Options Oncol. 2, 431436. Duan, Z., Bradner, J., Greenberg, E., Mazitschek, R., Foster, R., Mahoney, J., and Seiden, M. V. (2007). 8-benzyl-4-oxo-8-azabicyclo[3.2.1]oct-2-ene-6,7dicarboxylic acid (SD-1008), a novel janus kinase 2 inhibitor, increases chemotherapy sensitivity in human ovarian cancer cells. Mol. Pharmacol. 72, 11371145. Duan, Z., Foster, R., Bell, D. A., Mahoney, J., Wolak, K., Vaidya, A., Hampel, C., Lee, H., and Seiden, M. V. (2006). Signal transducers and activators of transcription 3 pathway activation in drug-resistant ovarian cancer. Clin. Cancer Res. 12, 50555063. Ernst, M., and Jenkins, B. J. (2004). Acquiring signalling specicity from the cytokine receptor gp130. Trends Genet. 20, 2332. Fleshner, N., Garland, J., Moadel, A., Herr, H., Ostroff, J., Trambert, R., OSullivan, M., and Russo, P. (1999). Inuence of smoking status on the disease-related outcomes of patients with tobacco-associated supercial transitional cell carcinoma of the bladder. Cancer 86, 23372345. Jin, Z., Gao, F., Flagg, T., and Deng, X. (2004a). Nicotine induces multi-site phosphorylation of Bad in association with suppression of apoptosis. J. Biol. Chem. 279, 2383723844. Jin, Z., Gao, F., Flagg, T., and Deng, X. (2004b). Tobacco-specic nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone promotes functional cooperation of Bcl2 and c-Myc through phosphorylation in regulating cell survival and proliferation. J. Biol. Chem. 279, 4020940219. Kawai, H., and Berg, D. K. (2001). Nicotinic acetylcholine receptors containing alpha 7 subunits on rat cortical neurons do not undergo long-lasting inactivation even when up-regulated by chronic nicotine exposure. J. Neurochem. 78, 13671378. Kobayashi, S., Shimamura, T., Monti, S., Steidl, U., Hetherington, C. J., Lowell, A. M., Golub, T., Meyerson, M., Tenen, D. G., Shapiro, G. I., et al. (2006). Transcriptional proling identies cyclin D1 as a critical downstream effector of mutant epidermal growth factor receptor signaling. Cancer Res. 66, 1138911398. Kornmann, M., Danenberg, K. D., Arber, N., Beger, H. G., Danenberg, P. V., and Korc, M. (1999). Inhibition of cyclin D1 expression in human pancreatic cancer cells is associated with increased chemosensitivity and decreased expression of multiple chemoresistance genes. Cancer Res. 59, 35053511.

129

Laag, E., Majidi, M., Cekanova, M., Masi, T., Takahashi, T., and Schuller, H. (2006). NNK activates ERK1/2 and CREB/ATF-1 via beta-1-AR and EGFR signaling in human lung adenocarcinoma and small airway epithelial cells. Int. J. Cancer 119, 15471552. Lee, W. S., Chen, R. J., Wang, Y. J., Tseng, H., Jeng, J. H., Lin, S. Y., Liang, Y. C., Chen, C. H., Lin, C. H., Lin, J. K., et al. (2003). In vitro and in vivo studies of the anticancer action of terbinane in human cancer cell lines: G0/G1 p53-associated cell cycle arrest. Int. J. Cancer 106, 125137. Leong, P. L., Andrews, G. A., Johnson, D. E., Dyer, K. F., Xi, S., Mai, J. C., Robbins, P. D., Gadiparthi, S., Burke, N. A., Watkins, S. F., et al. (2003). Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth. Proc. Natl. Acad. Sci. U.S.A. 100, 41384143. Lu, Y., and Cederbaum, A. (2007). The mode of cisplatin-induced cell death in CYP2E1-overexpressing HepG2 cells: modulation by ERK, ROS, glutathione, and thioredoxin. Free Radic. Biol. Med. 43, 10611075. Marrero, M. B., and Bencherif, M. (2009). Convergence of alpha 7 nicotinic acetylcholine receptor-activated pathways for anti-apoptosis and antiinammation: central role for JAK2 activation of STAT3 and NF-kappaB. Brain Res. 1256, 17. Mayo, M. W., and Baldwin, A. S. (2000). The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim. Biophys. Acta. 1470, M55M62. Mousa, S., and Mousa, S. A. (2006). Cellular and molecular mechanisms of nicotines pro-angiogenesis activity and its potential impact on cancer. J. Cell. Biochem. 97, 13701378. Perlman, H., Zhang, X., Chen, M. W., Walsh, K., and Buttyan, R. (1999). An elevated bax/bcl-2 ratio corresponds with the onset of prostate epithelial cell apoptosis. Cell Death Differ. 6, 4854. Schuller, H. M., Plummer, H. K., 3rd, and Jull, B. A. (2003). Receptormediated effects of nicotine and its nitrosated derivative NNK on pulmonary neuroendocrine cells. Anat. Rec. 270, 5158. Schuller, H. M., Porter, B., and Riechert, A. (2000). Beta-adrenergic modulation of NNK-induced lung carcinogenesis in hamsters. J. Cancer Res. Clin. Oncol. 126, 624630. Shin, V. Y., Wu, W. K., Chu, K. M., Koo, M. W., Wong, H. P., Lam, E. K., Tai, E. K., and Cho, C. H. (2007). Functional role of beta-adrenergic receptors in the mitogenic action of nicotine on gastric cancer cells. Toxicol. Sci. 96, 2129. Sood, A. K., Bhatty, R., Kamat, A. A., Landen, C. N., Han, L., Thaker, P. H., Li, Y., Gershenson, D. M., Lutgendorf, S., and Cole, S. W. (2006). Stress hormone-mediated invasion of ovarian cancer cells. Clin. Cancer Res. 12, 369375. Trombino, S., Cesario, A., Margaritora, S., Granone, P., Motta, G., Falugi, C., and Russo, P. (2004). Alpha7-nicotinic acetylcholine receptors affect growth regulation of human mesothelioma cells: role of mitogen-activated protein kinase pathway. Cancer Res. 64, 135145. Tsurutani, J., Castillo, S. S., Brognard, J., Granville, C. A., Zhang, C., Gills, J. J., Sayyah, J., and Dennis, P. A. (2005). Tobacco components stimulate Akt-dependent proliferation and NFkappaB-dependent survival in lung cancer cells. Carcinogenesis 26, 11821195. Wang, X., Martindale, J. L., and Holbrook, N. J. (2000). Requirement for ERK activation in cisplatin-induced apoptosis. J. Biol. Chem. 275, 3943539443. West, K. A., Brognard, J., Clark, A. S., Linnoila, I. R., Yang, X., Swain, S. M., Harris, C., Belinsky, S., and Dennis, P. A. (2003). Rapid Akt activation by nicotine and a tobacco carcinogen modulates the phenotype of normal human airway epithelial cells [see comment]. J. Clin. Invest. 111, 8190. Wong, H. P., Yu, L., Lam, E. K., Tai, E. K., Wu, W. K., and Cho, C. H. (2007). Nicotine promotes cell proliferation via alpha7-nicotinic acetylcholine receptor

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013

130

CHEN ET AL. Xu, J., Huang, H., Pan, C., Zhang, B., Liu, X., and Zhang, L. (2007). Nicotine inhibits apoptosis induced by cisplatin in human oral cancer cells. Int. J. Oral Maxillofac. Surg. 36, 739744. Yeh, P. Y., Chuang, S. E., Yeh, K. H., Song, Y. C., Ea, C. K., and Cheng, A. L. (2002). Increase of the resistance of human cervical carcinoma cells to cisplatin by inhibition of the MEK to ERK signaling pathway partly via enhancement of anticancer drug-induced NF kappa B activation. Biochem. Pharmacol. 63, 14231430. Zeegers, M. P., Tan, F. E., Dorant, E., and van Den Brandt, P. A. (2000). The impact of characteristics of cigarette smoking on urinary tract cancer risk: a meta-analysis of epidemiologic studies. Cancer 89, 630639.

and catecholamine-synthesizing enzymes-mediated pathway in human colon adenocarcinoma HT-29 cells. Toxicol. Appl. Pharmacol. 221, 261267. Wright, S. C., Zhong, J., Zheng, H., and Larrick, J. W. (1993). Nicotine inhibition of apoptosis suggests a role in tumor promotion. FASEB J. 7, 10451051. Xia, L., Wang, L., Chung, A. S., Ivanov, S. S., Ling, M. Y., Dragoi, A. M., Platt, A., Gilmer, T. M., Fu, X. Y., and Chin, Y. E. (2002). Identication of both positive and negative domains within the epidermal growth factor receptor COOH-terminal region for signal transducer and activator of transcription (STAT) activation. J. Biol. Chem. 277, 3071630723.

Downloaded from http://toxsci.oxfordjournals.org/ by guest on March 27, 2013