Anda di halaman 1dari 197

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

I CONGRESO LATINOAMERICANO Y II NACIONAL DE ALTA MONTAA TROPICAL: DESAFOS ANTE EL CAMBIO CLIMTICO DE LOS ECOSISTEMAS DE BOSQUE ALTOANDINO, PRAMOS Y GLACIAR

CON EL APOYO:

DIRECCIN DE INVESTIGACIONES-UPTC

GOBERNACIN DE BOYAC

UNIVERSIDAD DE LAS NACIONES UNIDAS-PROGRAMA DE BIOTECNOLOGA PARA AMERICA LATINA Y DEL CARIBE

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

MEMORIAS

Tunja Agosto 27 02 de septiembre de 2012

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

2012. I Congreso Latinoamericano y II Nacional de Alta Montaa Tropical: Desafos ante el cambio climtico de los Ecosistemas de Bosque altoandino, Pramos y Glaciar: memorias [recurso informtico] / Vol. 1 (2012) Tunja: UPTC, 2012 1CD www.uptc.edu.co/eventos/2012/index.html ISSN: 2322-9101. Fecha: 2012-11-14
Universidad Pedaggica y Tecnolgica de Colombia Gustavo Orlando lvarez lvarez, Rector Orlando Vergel Portillo, Vicerrector Acadmico Nelson Vera Villamizar, Director de Investigaciones Gabriel Patarroyo Moreno, Decano Facultad Ciencias Bsicas

Grupo de Investigacin Biologa Ambiental


Dra. Luz Marina Lizarazo Forero Coordinadora General del Evento Deisy Lisseth Toloza Moreno Biolga. Coordinadora de los Comits David Ricardo Hernndez Velandia Estevan Lpez Velandia Giovanna vila Martnez Fabin Daro Cuadros S. Greisy Andrea Estupin Cindy Johanna Nio Camacho Yeimy Marcela Sanabria Lorena Vega Acevedo Estudiantes de pregrado de Biologa

Coordinadora Editorial: Yolanda Romero A.

Responsable de las memorias Dra. Luz Marina Lizarazo Forero Escuela de Ciencias Biolgicas. Facultad de Ciencias Universidad Pedagogica y Tecolgica de Colombia luz.lizarazo@uptc.edu.co

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

TABLA DE CONTENIDO

EDITORIAL I Congreso Latinoamericano y II Nacional de Alta Montaa Tropical: Desafos ante el cambio climtico de los Ecosistemas de Bosque altoandino, Pramos y Glaciar

CONFERENCIAS MAGISTRALES La fijacin biolgica del nitrgeno en el contexto del cambio climtico Dr. JUAN SANJUN PINILLA (Espaa).. Uso de microorganismos promotores de crecimiento como tecnologa para incrementar la produccin de madera y secuestro de carbono de Schizolobium amazonicum Huber ex ducke (Paric) en condiciones de campo Dr. GALDINO ANDRADE FILHO (Brasil) Comunidades acuticas de lagos: vulnerabilidad ante eventos de cambio climtico Dr. NELSON JAVIER ARANGUREN RIAO (Colombia)..... Mamferos andinos y el mundo de los cambios globales Dr. FRANCISCO ALEJANDRO SNCHEZ BARRERA (Colombia)....... Experiencias de restauracin ecolgica en la regin andina de Colombia Dr. ORLANDO VARGAS ROS (Colombia).... La ecologa de la restauracin en Boyac y su relacin con el cambio climtico DR. FRANCISCO CORTS PREZ (Colombia)....... El cambio climtico y el efecto en especies vegetales ( Chalybea: Melastomataceae) en va de extincin en los andes tropicales Dra. MARA EUGENIA MORALES PUENTES (Colombia).. Sistemas humanos naturales acoplados: el desafo del anlisis de los cambios globales DR. CLAUDIO FABIAN SZLAFSZTEIN (Argentina).. Modernizacin, modernidad y biodiversidad en Amrica latina realzando el desarrollo sostenible como respuesta a la crisis civilizadora y ambiental DR. CAMILO TORRES SANCHEZ... La alta montaa en Colombia: dinmica y perspectivas DRA. LUZ MARINA ARVALO SANCHEZ..... Planificacin y gestin adaptativa de los socioecosistemas de alta montaa: elementos claves para la adaptacin al cambio climtico

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL DRA. DIANA CAROLINA USECHE RODRGUEZ (Colombia) Paramos y sistemas de vida DRA. BIBIANA DUARTE ABADA (Colombia) CONFERENCIAS CORTAS ESTUDIO METAGENMICO DE LA MICROBIOTA RIZOSFRICA DE Espeletia sp, EN EL PRAMO DE SANTA INS-ANTIOQUIA. Henry Arenas-Castro, Juan Alzate-Restrepo, Pilar Ximena Lizarazo-Medina................................... USO DE HBITAT DE AVES Y MAMFEROS GRANVOROS EN UN BOSQUE ALTOANDINO DE BOYAC: COMPARACIN DE DOS TIPOS DE BORDE Wilderson Alfonso Medina Barn.. CARACTERIZACIN FLORSTICA DEL SECTOR DE PIEDRA GORDA (SOCHA, BOYAC) Astrid Milena Caro Roa, Orlando Rivera Daz...................... EVALUACIN DEL ESTADO DE CONSERVACIN DE LOS BOSQUES Y ESPECIES DE LOS ANDES TROPICALES Natalia Tejedor, Esteban Alvarez, Sandra Arango, Alejandro Araujo, Cecilia Blundo, Tatiana Boza, Mara de los Angeles La Torre, Juan Gaviria, Nstor Gutirrez, Peter Jrgensen, Blanca Len, Ren Lpez, Lucio R. Malizia, Betty Milln, Mnica Moraes, Silvia Pacheco, Carlos Reynel, Martn Timan, Carmen Ulloa, Omar Vacas, Adrian Newton... VERIFICACIN DE COBERTURAS Y CARACTERIZACIN FLORSTICA DEL MACIZO DE BIJAGUAL-BOYAC, COLOMBIA Pablo Andrs Gil Leguizamn, Mara Eugenia Morales Puentes BROMELIACEAE EN BOYAC Y CASANARE, COLOMBIA Viviana Maritza Alvarado-Fajardo, Mara Eugenia Morales-Puentes. BRIFITOS Y LQUENES DE RAMIRIQU (BOYAC): DIVERSIDAD GENRICA Y ESTRATEGIAS ADAPTATIVAS Merly Yenedith Carillo Fajardo, Jorge Enrique Gil Novoa, Mara Eugenia Morales Puentes. DIVERSIDAD DE ANGIOSPERMAS EN LAS ZONAS PARAMUNAS DE RAMIRIQU Y VIRACACH (BOYAC-COLOMBIA). Merly Yenedith Carillo Fajardo, Mara Eugenia Morales Puentes, Pablo Andrs Gil Leguizamn, Andrea Liliana Simbaqueba... FLORA DE LOS PRAMOS DE ANTIOQUIA Fernando Alzate Guarn, Oswaldo Daz Vasco, Santiago Varela Velsquez ESPECIES AMENAZADAS DE ASTERACEAE EN EL MACIZO PRAMO DE RABANAL, BOYAC-COLOMBIA Andrea Liliana Simbaqueba-Gutirrez, Mara Eugenia Morales-Puentes.. RESTAURACIN ECOLGICA DE LOS PRAMOS ANDINOS TRASFORMADOS POR ACTIVIDADES DE GANADERA, PARQUE NACIONAL NATURAL (PNN) CHINGAZA, COLOMBIA Jennyfer Insuasty-Torres; Oscar Zamora-Rojas; Orlando Vargas Ros; Liz vila-Rodrguez; Laura Victoria Prez-Martnez; Felipe lvarez-Castiblanco; Natalia Rodrguez-Castillo HORMIGAS INDICADORAS EN LA RESTAURACIN DE BOSQUES MONTANOS CERCANOS AL VALLE DE ABURR Juan David Snchez-Rodrguez, Juliana Cardona-Duque, Carlos Alberto Gutirrez.. UNA APROXIMACION A LA RECONSTRUCCION BIOGEOGRAFICA EN LAS AREAS DE PARAMO EN EL NOROCCIDENTE DE LA CORDILLERA DE LOS ANDES Carlos Jimenez-Rivillas, Juan M. Daza

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL VARIACIN ALTITUDINAL Y TEMPORAL DE LAS REDES DE INTERACCIN PLANTAPOLINIZADOR EN UN BOSQUE TROPICAL ANDINO Sandra E. Cuartas Hernndez, Laura Gmez-Murillo... ACALIPTINOS (COLEOPTERA: CURCULIONIDAE) DE ZONAS ALTAS: ESTADO DEL CONOCIMIENTO E INTERACCIN CON SUS PLANTAS HOSPEDERAS Juliana Cardona-Duque, Juan David Snchez-Rodrguez... MARIPOSAS EN LA RESERVA NATURAL EL ROMERAL: APORTE DE VERTIENTES PARA LA CONSERVACIN DE LA DIVERSIDAD REGIONAL. Mario Alejandro Marn Uribe, Carlos Federico lvarez-Hincapi, Alejandra Clavijo-Giraldo, Alba Lucia Marn Valencia... RIQUEZA Y COMPOSICIN DE LAS MARIPOSAS EN LA PARTE ALTA DE LAS LADERAS DEL VALLE DE ABURRA Laura Isabel Ros Marn, Carlos Alberto Gutirrez AVIFAUNA ASOCIADA A CULTIVOS DE PAPA EN BOYAC Y CUNDINAMARCA. Gina Liliana Rojas Lizarazo, Pablo Emilio Rodrguez Africano, Javier Alvarado Macias ... MODELO DE DISTRIBUCIN DE Quercus humboldtii (BONPL.) EN COLOMBIA ngela Del Pilar Vianch Snchez... EFECTO DEL ROBLE (Quercus humboldtii) SOBRE LOS ENSAMBLAJES DE PLANTAS DE LOS ROBLEDALES DE COLOMBIA Diana Galindo, Sebastin Gonzlez-Caro, Irina Mendoza, Cesar Velsquez, Marcela Serna, Fernando Fernndez, Omar Melo, Oswaldo Velsquez, Esteban lvarez SISTEMATIZACIN Y VALIDACIN DEL CONOCIMIENTO Y PRCTICAS BIOCULTURALES COMO ESTRATEGIA PARA DEFENSA INTEGRAL TERRITORIAL Y COMUNITARIA DEL PUEBLO NASA Mery Victoria Velasco Prada.. PLANIFICACIN TERRITORIAL PARA LA SOSTENIBILIDAD DE ECOSISTEMAS MONTAOSOS ANDINOS. ESTUDIO DE CASO: RQUIRA (BOYAC) Claudia Lorena Ortiz Melo, Orlando Vargas Ros.. DELIMITACIN PARTICIPATIVA EN ESCALA LOCAL Y DETALLADA DEL SECTOR DEL PRAMO DE MORAS LOCALIZADO EN EL RESGUARDO DE LA COMUNIDAD NASA DE MOSOCO (CAUCA) Sebastin Bohrquez Santamara

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

PSTER ESTUDIO DE LA MICROBIOTA RIZOSFRICA DE Espeletia occidentalis EN EL PRAMO DE SANTA INS-ANTIOQUIA Pilar Ximena Lizarazo-Medina, Diana Gmez-Vsquez... CARACTERIZACIN MICROBIOLGICA DE SUELOS CIDOS SULFATADOS DEL MUNICIPIO DE PAIPA BOYAC Fabin Cuadros, Greisy Estupian, Juan Juez, Angela Leguizamo, Yenny Lpez, Karen Nio, Alejandro Poveda, Yeimy Ramrez, Zully Rincn, Javier Sierra, Luz Marina Lizarazo Forero... NDICE DE ESTADO LIMNOLGICO PARA RIOS ANDINOS CASO DE ESTUDIO (CUENCA ALTA DEL RO CHICAMOCHA) Ivn Martnez DESCRIPCION DE GRUPOS FUNCIONALES DEL FITOPLANCTON BASADOS EN RASGOS MORFOLGICOS Erika Alexandra Triana Balaguera CLASIFICACIN TRFICA DE INSECTOS ACUTICOS EN DOS QUEBRADAS TRIBUTARIAS DEL RO VERDE (QUINDO, COLOMBIA) Alejandro Villarreal-Grisales, Katherine Rodrguez-Marn, Roco Garca-Crdenas COMPOSICIN Y ESTRUCTURA DE LA COMUNIDAD DE MACROINVERTEBRADOS ACUTICOS DE ALTA MONTAA (QUINDO, COLOMBIA) Alejandro Villarreal-Grisales, Delly Roco Garca-Crdenas.... El GNERO ANASTROPHYLLUM (SPRUCE) STEPH. (MARCHANTIOPHYTA, ANASTROPHYLLACEAE) EN COLOMBIA Wilson lvaro Alba, Jaime Uribe Melndez. CARACTERIZACIN DE LA VEGETACIN DEL PRAMO DE PISBA EN EL SECTOR DE PIEDRA GORDA (Socha, Boyac) CON FINES DE CONSERVACIN Astrid Caro, Orlando Rivera... MIRAFLORES DE COLORES (RESERVA FORESTAL PROTECTORA CUCHILLA DE SUCUNCUCA) BOYAC - COLOMBIA. Naisla Manrique, Mara Morales GERMINACIN DE ALGUNAS ESPECIES DEL PRAMO DEL PNN CHINGAZA EN CONDICIONES DE LABORATORIO Laura Victoria Prez-Martnez, Natalia Rodrguez-Castillo, Jennyfer Insuasty-Torres, Oscar RojasZamora, Orlando Vargas Ros... CONTROL DE GRAMNEAS EXTICAS EN ZONAS DE PRAMO ALTERADO A TRAVS DE MATRICES DE LEGUMINOSAS ARBUSTIVAS Y HERBCEAS PARA LA CONFORMACIN DE NCLEOS DE REGENERACIN Liz vila, Felipe Castiblanco, Jennifer Insuasti, Oscar Rojas, Orlando Vargas EFECTO DE LA FERTILIZACIN SOBRE EL CRECIMIENTO Y SOBREVIVENCIA DE ESPECIES NATIVAS Deisy Johanna Moreno Betancur, Sandra E. Cuartas Hernndez. CONTROL DE PASTOS EXTICOS MEDIANTE SOMBREADO ARTIFICIAL COMO ESTRATEGIA DE RESTAURACIN ECOLGICA DE PRAMOS ANDINOS Felipe Castiblanco, Liz vila, Jennyfer Insuasty-Torres, Oscar Rojas-Zamora, Orlando Vargas..

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ESTUDIO ETNOFICOLGICO EN AGUAS TERMOMINERALES EN EL DEPARTAMENTO DE BOYAC (COLOMBIA) Javier Enrique Sierra Forero, Mayer Isnardo Lagos Lpez.. ESTUDIOS PRELIMINARES DE PROPAGACIN IN VITRO DE Espeletia paipana ENDMICA DEL PNM RANCHERA-PAIPA-BOYAC, ESPECIE EN PELIGRO CRTICO DE EXTINCIN Eyda Araque, Mara Bohrquez EVALUACION DE LA LLUVIA DE SEMILLAS DE Gaiadendron punctatum (LORANTHACEAE) Y Ternstroemia meridionalis (THEACEAE) EN EL PARQUE NATURAL MUNICIPAL RANCHERA Martha Parada.. REDESCUBRIMIENTO DE Miconia Imbricata GLEASON Y NOVEDADES COROLGICAS DE MELASTOMATACEAE PARA EL PARQUE NACIONAL NATURAL TATAM. Juan Mauricio Posada-Herrera.. VARIABILIDAD AMBIENTAL Y RESPUESTAS FISIOLGICAS DE Polylepis cuadrijuga (ROSALES, ROSACEAE) EN UN AMBIENTE FRAGMENTADO EN EL PRAMO DE LA RUSIA (COLOMBIA) Carolina Ramos, Sindy Buitrago, Karen Pulido, Leidy Vanegas. PRINCIPALES ARVENSES EN CULTIVOS DE PAPA (Solanum tuberosum L.) EN UN PRAMO DEL MUNICIPIO DE VILLAMARA, CALDAS Nstor Fabio Alzate Quintero. DIVERSIDAD DE LEPIDPTEROS DIURNOS EN EL COMPLEJO DE PRAMOS Y BOSQUES ALTOANDINOS DEL MUNICIPIO DE BELMIRA, ANTIOQUIA Alejandra Clavijo-Giraldo, Carlos Federico lvarez-Hincapi, Mario Alejandro Marn Uribe, Francisco Restrepo Carrasquilla... MARIPOSAS DE ALTA MONTAA. UN CASO DE ESTUDIO EN EL MACIZO DE BIJAGUAL, BOYAC Dumar Ariel Parrales R... CONOCIMIENTO PRELIMINAR DE LOS ESTAFILNIDOS (COLEOPTERA: STAPHYLINIDAE) EN EL BOSQUE HMEDO TROPICAL DE SANTA MARA (BOYAC) Yudy Sissa Dueas. LOS ANDES COMO FUENTE DE ESPECIACIN, UNA EVIDENCIA CON RANAS DE LLUVIA DEL GNERO Pristimantis. Felipe Duarte-Cubides, Juan M. Daza. ACERCAMIENTO A LA COMPOSICIN DE LA DIETA DE BOLITOGLOSSA HYPACRA (CAUDATA: PLETHODONTIDAE) Carlos Jimenez-Rivillas; Mara Prez; Jos Fang, Nayibe Cala.. COMPOSICIN DE REPTILES EN UN RELICTO DE SELVA ANDINA EN LA PERIFERIA URBANA DE MANIZALES, CALDAS Elizabeth Snchez... MAMIFEROS RESIDENTES EN LA UNIVERSIDAD PEDAGOGICA Y TECNOLOGICA DE COLOMBIA Gina Liliana Rojas Lizarazo, Javier Alvarado Macas, Alcibiades Escrraga Saavedra .. EVALUACIN DE LA AVIFAUNA EN EL SECTOR DEL PRAMO RABANAL RAQUIRA, BOYAC - Y SU IMPORTANCIA EN LA CONSERVACIN DE ECOSISTEMAS ALTOANDINOS Samuel Rodrguez P, Lizeth Vega, Yeimy Sanabria, Pablo E. Rodrguez A

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL ALTERNATIVAS ANTE EL CONFLICTO ENTRE AUTORIDADES AMBIENTALES Y HABITANTES DE REAS PROTEGIDAS EN PRAMOS COLOMBIANOS Manuela Avellaneda-Torres, Esperanza Torres, Toms Len. RESPUESTA SOCIO-AMBIENTAL DE LA COMUNIDAD DE ARCABUCO-BOYAC FRENTE A LA EXPLOTACIN DE MINERIA A CIELO ABIERTO EN EL PRAMO VALLE DE LOS ENSUEOS Nataly Poveda Daz, Milena Crdenas Avella, Camilo Andrs Crdenas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CONFERENCIAS CORTAS
SIMPOSIO 1. BIODIVERSIDAD MICROBIANA Y CAMBIO CLIMTICO

LA FIJACIN BIOLGICA DEL NITRGENO EN EL CONTEXTO DEL CAMBIO CLIMTICO Dr. JUAN SANJUN PINILLA (Espaa). Estacin Experimental de Zaidn juan.Sanjuan@eez.csic.es Siendo el nitrgeno el elemento ms abundante de nuestra atmsfera, representa al mismo tiempo una de las principales limitantes para el crecimiento y desarrollo vegetal en sistemas agrcolas. El coste energtico de la produccin de fertilizantes nitrogenados a nivel mundial, pero sobre todo el coste ambiental derivado de la quema de energas no renovables conllevan un coste cada vez mayor de los mismos, asociado adems a la produccin y liberacin de CO 2 y sobre todo de N2O que tienen incidencia directa en el calentamiento global. As, las necesidades de tipo social, ambiental y econmico estn conduciendo a una reduccin progresiva del uso de fertilizantes nitrogenados. Sin embargo, la nica alternativa a la fijacin antropognica de nitrgeno (proceso de Haber-Bosch) es la fijacin biolgica de nitrgeno (FBN), que por s misma es responsable de ms de la mitad del nitrgeno incorporado a la biosfera. No obstante, solo ciertos microorganismos procariticos (bacterias y arqueas) son capaces de realizar la FBN, a travs de la enzima nitrogenasa. Muchos fijadores de nitrgeno se asocian con plantas, estableciendo relaciones simbiticas en las que la bacteria posee la actividad nitrogenasa y la planta proporciona el ambiente y la energa necesarios para el proceso de FBN. Conocer y comprender el funcionamiento de estos sistemas puede conducirnos a mejorarlos y, por qu no, a ampliar su aprovechamiento e incluso generar nuevas simbiosis entre microorganismos y plantas no leguminosas. La simbiosis que establecen ciertas bacterias del suelo, conocidas como rizobia, y plantas leguminosas permite a stas utilizar el nitrgeno atmosfrico para su nutricin. Esta simbiosis fijadora es la ms eficiente y la de mayor relevancia agronmica de todos los sistemas fijadores conocidos. Gracias a esta propiedad, las leguminosas pueden desarrollarse incluso en suelos carentes de nitrgeno combinado. El elemento visible de esta simbiosis son los ndulos, generalmente

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

localizados en la raz de la planta, y que representan un verdadero nuevo rgano vegetal donde se alojan las bacterias para poder llevar a cabo el proceso de fijacin de nitrgeno. La formacin, infeccin y desarrollo de los ndulos conlleva un continuo y complejo intercambio de seales qumicas, una especie de dilogo molecular entre los simbiontes, que an no es del todo comprendido. De la correcta sealizacin entre bacteria y planta depende la eficiencia de este sistema simbitico, que puede verse afectado por mltiples limitantes de tipo gentico, fisiolgico y ambiental. Muchos laboratorios internacionales se afanan en estudiar y comprender este sistema fijador, que podra darnos las claves para ampliar la capacidad fijadora de nitrgeno a plantas no leguminosas de alto valor agroalimentario, como los cereales. Esta posibilidad, para muchos utpica, es una de las varias alternativas por las que sera posible aprovechar mejor la FBN para una produccin de alimentos ms energtica y ecolgicamente responsable en el futuro.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

USO DE MICROORGANISMOS PROMOTORES DE CRECIMIENTO COMO TECNOLOGA PARA INCREMENTAR LA PRODUCCIN DE MADERA Y SECUESTRO DE CARBONO DE Schizolobium amazonicum Huber ex Ducke (Paric) EN CONDICIONES DE CAMPO Dr. GALDINO ANDRADE FILHO (Brasil). Universidad Estatal de Londrina andradeg@uel.br El paric (Schizolobium amazonicum Heber ex Ducke) es una especie arbrea que ocurre naturalmente en la Amazona y tiene una gran importancia comercial debido a las cualidades de su madera y su rpido crecimiento, as como por su viabilidad en diferentes sistemas de cultivo. Esto ha generado en los ltimos aos un gran inters por el estudio de nuevas estrategias para mejorar la produccin de madera de sta especie. La utilizacin del potencial de promocin de crecimiento de los microorganismos del suelo, entre ellos los hongos micorrzicos y bacterias fijadoras de nitrgeno aparece como una importante herramienta a ser utilizada en los sistemas de cultivo intensivo de paric en el norte Brasilero. En experimentos realizados en campo ha sido evaluada la eficiencia de la inoculacin de hongos micorrzicos arbusculares (MA) de las especies Glomus etunicatum y Acaulospora sp., junto con dos cepas nativas de bacterias fijadoras de nitrgeno (BFN) del gnero Rhizobium (Rh1, Rh2) y una cepa exgena del gnero Burkholderia, diferentes combinaciones de estos microorganismos fueron inoculados en semillas y plntulas con adicin no de fertilizante qumico (dosis media = 75 g/ planta y dosis completa = 150 g/ planta). Dos aos despus de la siembra fue medido el crecimiento del paric y calculada la produccin de madera y la cantidad de carbono fijado. En el mtodo de siembra por semillas en los tratamientos sin fertilizante, fue observado un mayor crecimiento con la inoculacin de la cepa Rhizobium Rh1 junto con Acaulospora sp. Con la dosis media y completa de fertilizante la bacteria Rhizobium Rh1 estimul el crecimiento de las plantas cuando inoculada en combinacin con los hongos Acaulospora sp. o Glomus etunicatum. Un mayor crecimiento fue observado en las plntulas sin fertilizante e inoculadas con Glomus etunicatum y la bacteria Rhizobium Rh1, as como en las plantas fertilizadas con la dosis media de fertilizante e inoculadas con el hongo AM Acaulospora sp., y la bacteria Rhizobium Rh1. Los mejores tratamientos alcanzaron valores de 21.73 t/ha de produccin de madera y 12 t/ha de carbono fijado. Estos resultados muestran que la inoculacin de microorganismos puede ser una buena herramienta para ser utilizada en el sistema de cultivo de S. parahyba var amazonicum, ya que ambas especies de hongos AM han estimulado

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

el crecimiento de esta especie en combinacin con la cepa Rhizobium Rh1 y el uso de la dosis de media de fertilizante.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 2. DIVERSIDAD Y DINMICA DE LAS COMUNIDADES DE ORGANISMOS ACUTICOS Y EL IMPACTO DEL CAMBIO CLIMTICO

COMUNIDADES ACUTICAS DE LAGOS: VULNERABILIDAD ANTE EVENTOS DE CAMBIO CLIMTICO Dr. NELSON JAVIER ARANGUREN RIAO (Colombia). Universidad Pedaggica y Tecnolgica de Colombia. Profesor Asistente Escuela de Biologa. nelson.aranguren@uptc.edu.co Sin duda uno de los fenmenos que ha llamado la atencin de los investigadores en la ltima dcada es el efecto de escenarios de cambio climtico sobre la biodiversidad del planeta. Son muchas las investigaciones que se han adelantado al respecto, y a pesar de la gran variabilidad de grupos taxonmicos y de metodologas, se apunta a que habra una reduccin considerable de la variedad de especies en escala global. Particularmente en los ecosistemas acuticos continentales, en especial de lagos, se conoce sobre implicaciones causadas por eventos de incremento de temperatura en aspectos estructurales y funcionales de estos ambientes. A nivel estructural se prevn modificaciones en la composicin de especies que puede darse en dos sentidos, primero en una reduccin de la diversidad taxonmica y segundo en el desplazamiento de especies nativas por especies invasoras en un nuevo escenario ambiental. Esta modificacin tendr implicaciones no solo en la diversidad taxonmica en escalas local y regional, tambin en la diversidad ecolgica asociada con los cambios en los roles e interacciones ecolgicas de las especies. Dado que los eventos ecolgicos son de naturaleza sinrgica, los cambios en la estructura tendran implicaciones importantes en aspectos funcionales, como flujos de materia y energa, productividad y estabilidad de los ecosistemas. Algunos estudios experimentales, muestran que se alteraran procesos de reciclaje de nutrientes, con incremento potencial en la productividad de los lagos y con una incidencia significativa en un mayor efecto regulatorio de las especies de niveles trficos superiores como los peces sobre las dems especies de la red trfica. En lagos tropicales muy poco se conoce sobre estas dinmicas, sin embargo estudios recientes sugieren que los lagos fros de alta montaa seran ms vulnerables en un escenario de calentamiento global. Lo que est claro es la necesidad urgente de potenciar y definir polticas de investigacin en estos mbitos, especialmente en ecosistemas acuticos tropicales sobre los que se desconocen las implicaciones de un

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

inminente escenario de cambio climtico de escala global.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 3. COMUNIDADES VEGETALES Y ANIMALES EN LOS ECOSISTEMAS DE ALTA MONTAA. EFECTOS DEL CAMBIO CLIMTICO SOBRE LAS ESPECIES NATIVAS MAMFEROS ANDINOS Y EL MUNDO DE LOS CAMBIOS GLOBALES Dr. FRANCISCO ALEJANDRO SNCHEZ BARRERA (Colombia). Universidad Militar Nueva Granada. Programa de Biologa Aplicada, Facultad de Ciencias Bsicas. fasbos@gmail.com El cambio climtico global es derivado del aumento de la poblacin humana y del uso desmedido de los recursos naturales. Los estudios sobre dicho cambio global sugieren que ste podra reducir el rea de los ecosistemas necesarios para algunas especies que habitan en los Andes; especialmente aquellas dependientes de bosques altoandinos y pramos. Sin embargo, otros cambios globales asociados a los humanos podran tener incluso mayores impactos sobre la diversidad de mamferos andinos que los cambios climticos. De particular preocupacin es la transformacin de los ecosistemas naturales y el abuso del suelo. Por ejemplo, las transformaciones derivadas de la agricultura, el urbanismo y la minera son responsables de la prdida de ms del 70% de los bosques andinos colombianos. Este cambio contina a una tasa que posiblemente dejar sin hbitat a la mayor parte de los mamferos andinos, y probablemente esto ocurrir antes que los cambios climticos globales puedan causar un efecto similar. Por lo anterior, argumento que considerar los cambios climticos, que implican modificaciones en la temperatura y disponibilidad de agua para los ecosistemas andinos, es muy importante, pero debe hacerse ms nfasis sobre el impacto del deterioro y prdida de los ecosistemas naturales sobre los mamferos. Debemos hacer estudios para entender mejor qu mamferos andinos toleran o no las transformaciones a los ecosistemas naturales. Adicionalmente debemos obtener informacin para disear alternativas que permitan a los mamferos silvestres persistir en reas alteradas por el ser humano, ya que stas dominan y dominarn la mayor parte de los Andes. Palabras clave: Andes, cambio del uso del suelo, conservacin, reconciliacin ecolgica, transformacin de ecosistemas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

EXPERIENCIAS DE RESTAURACIN ECOLGICA EN LA REGIN ANDINA DE COLOMBIA Dr. ORLANDO VARGAS ROS (Colombia). Universidad Nacional de Colombia. Grupo Departamento de Biologa. jovargasr@unal.edu.co

de

Restauracin

Ecolgica.

En este trabajo se presentan varios enfoques conceptuales para abordar la restauracin ecolgica de ecosistemas altoandinos. Se toma como ejemplo, reas invadidas por Ulex europaeus (retamo espinoso) en zonas de bosque altoandino, reas con plantaciones de especies forestales exticas, humedales urbanos altoandinos y pramos (ecosistema de alta montaa tropical). Un aspecto comn para las cuatro reas son las especies invasoras como barreras a la restauracin, para lo cual los modelos sucesionales tradicionales no se pueden aplicar y es necesario utilizar otros enfoques como los modelos de estados y transiciones. Adems de los enfoques conceptuales un aspecto importante es el enfoque de participacin de las comunidades locales si se quiere trabajar a una escala regional (restauracin ecolgica con participacin comunitaria). Generalmente estos trabajos tienen tres fases en comn. En la primera fase se hace la caracterizacin regional con estudios diagnsticos y experimentales a pequea escala, una segunda fase de aplicacin de estrategias de control y restauracin a escala local con mantenimiento y monitoreo, y una tercera fase de proyeccin a escala regional. En cada una de estas fases se debe tener en cuenta la participacin de las comunidades locales. El conocimiento de los rasgos de historia de vida de las especies problema y de las especies nativas que inician el proceso de restauracin es un aspecto de gran importancia para poder elaborar un modelo sucesional de estados y transiciones el cual incorpora posibles desviaciones del ecosistema. Finalmente se construye un modelo para la restauracin de las reas incluyendo las diferentes etapas o posibles trayectorias sucesionales generadas con la oferta de especies nativas de la regin. Palabras clave: modelos de restauracin ecolgica, especies invasoras, sucesin ecolgica.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

LA ECOLOGA DE LA RESTAURACIN EN BOYAC Y SU RELACIN CON EL CAMBIO CLIMTICO DR. FRANCISCO CORTS PREZ (Colombia) Universidad Pedaggica y Tecnolgica de Colombia. Profesor Asistente Escuela de Biologa. Cand PhD Ciencias Biolgicas Pontificia U. Javeriana. Coordinador Grupo de investigacin Ecologa de Bosques Andinos Colombianos EBAC. frcortes2001@yahoo.com Las actividades humanas en el territorio boyacense, centradas en agricultura y minera han transformado amplias superficies del departamento, llevando al agotamiento de su productividad, con prdida de estructura y funciones fundamentales de los ecosistemas naturales, y la consiguiente prdida de servicios para los habitantes de las cuencas hidrogrficas afectadas. Sumado a lo anterior, el cambio climtico global se ha hecho sentir en Boyac, especialmente en los ltimos aos, cuando las pocas secas han sido ms agudas y las lluviosas ms intensas, provocando un aumento en la afectacin por las sequias y las inundaciones. La construccin urbana, vial, oleoductos y gasoductos, necesarios para atender los requerimientos de una poblacin cada vez mayor, tambin tienen sus efectos sobre los ecosistemas de Boyac y contribuyen a hacer ms intensos los cambios observados en el clima. Las actividades mencionadas afectan todos los compartimientos de los ecosistemas, quizs los ms afectados sean el componente bitico, los suelos y el ciclado de nutrientes, por lo que las soluciones que demos tienen que considerarlos. Sin embargo, la magnitud de los problemas identificados provocan una gran preocupacin que lleva a confundir las acciones necesarias para restaurar, rehabilitar o recuperar las reas afectadas por usos antrpicos, con acciones de reforestacin y aun de conservacin, desvirtuando el conocimiento que aporta la Ecologa de la Restauracin y ms an la Restauracin Ecolgica de los ecosistemas, al hacer creer que stas son simples reforestaciones con especies nativas. En Boyac hemos comenzado a realizar experimentos de Ecologa de la Restauracin para conocer los siguientes aspectos: listados de especies vegetales nativas que contribuyan a la restauracin de ecosistemas, efectividad de algunas de estas especies en experimentos de restauracin ecolgica, cambios de los Bancos de Semillas del Suelo a lo largo del tiempo. Otros experimentos, actualmente en etapa de montaje tendientes a la rehabilitacin o recuperacin de reas afectadas por minera a cielo abierto, especialmente referidos a probar tcnicas que permitan recuperar algunos atributos del suelo y analizar si pueden ayudar a recobrar coberturas vegetales. En

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

esta ponencia, damos a conocer los resultados que hemos venido obteniendo de estos trabajos de Ecologa de la Restauracin, los que sin duda, nos ayudarn a entender mucho mejor el funcionamiento de los ecosistemas del departamento de Boyac y sus respuestas a diferentes acciones que venimos implementando para su restablecimiento en cuanto a estructura y funciones que prestan a la poblacin campesina y urbana.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

EL CAMBIO CLIMTICO Y EL EFECTO EN ESPECIES VEGETALES (CHALYBEA: MELASTOMATACEAE) EN VA DE EXTINCIN EN LOS ANDES TROPICALES. Dra. MARA EUGENIA MORALES-PUENTES (Colombia) Universidad Pedaggica y Tecnolgica de Colombia. Profesor Asistente Escuela de Biologa. maria.morales@uptc.edu.co El impacto que el hombre ha ejercido sobre el medio ambiente es demoledor, y ms an, en los procesos de transformacin de uso del suelo y el cambio de ecosistemas naturales, muchos de ellos, en agrosistemas, condiciones de incidencia directa e indirecta en las poblaciones naturales. El neotrpico no se escapa de tal impacto, debido a su enorme riqueza vegetal distribuida en una menor rea, por lo cual, los procesos de extincin son significativos. Tras un estudio puntual, se evaluaron las especies del gnero Chalybea (Morales-P. et al., en eval.), taxa con rangos de distribucin muy restringidos y todas ellas, con diferentes grados de amenaza: C. calyptrata (Ecuador), C. corymbifera (Norte de Santander), C. ecuadorensis (Ecuador), C. kirkbridei (Sierra Nevada de Santa Marta), C. penduliflora (Huila) y C. peruviana (Per) en peligro crtico [CR B1a], tambin la nueva especie C. yariguies (Santander) (Morales-P. & Aguilar, en eval.), igualmente C. macrocarpa (Boyac), C. minor (Boyac), C. mutisiana (Santander) y C. occidentalis (Cauca) se evalan en peligro [EN B1b (ii)]. Se evidencia que el principal impacto sobre los fragmentos de bosque en zonas andinas, altoandinas y pramos, corresponden a los cultivos de papa y matrices de pastizal; estas intervenciones han diezmado la presencia de polinizadores (abejas, avispas, colibres y murcilagos) y dispersores (dpteros, avispas y aves), han ocasionado cambios en los microclimas especficos (a causa de la reduccin de parche de bosque, la entresaca de rboles, etc.), discontinuidad entre fragmentos de bosque, y el equilibrio enterespecfico. Palabras clave: especies amenazadas, impacto humano, Melastomataceae, transformacin de ambiente.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 4. POLTICAS PBLICAS-HERRAMIENTAS DE PLANIFICACIN Y GESTIN: UNIVERSIDADES ESTATALES, UNIVERSIDADES PRIVADAS, GOBERNACIN DE BOYAC, ORGANIZACIONES GUBERNAMENTALES Y NO GUBERNAMENTALES, ORGANIZACIONES CVICAS, ALCALDAS MUNICIPALES SISTEMAS HUMANOS NATURALES ACOPLADOS: EL DESAFO DEL ANLISIS DE LOS CAMBIOS GLOBALES DR. CLAUDIO FABIAN SZLAFSZTEIN (Argentina) Instituto de Geociencias. Facultad de Geologa. Universidad Federal de Par. Brasil iosele@ufpa.br Los ltimos aos han visto el despertar de una nueva visin en la forma de comprensin de las problemticas ambientales, los llamados sistemas humanos naturales acoplados (Coupled Human-Natural Systems - CHANS). Estos modelos simulan las interacciones entre los grupos humanos y el paisaje natural, y cmo se modifican estos comportamientos con base a la percepcin de los cambios en el ambiente debido a estas acciones. Aunque las interacciones humano-ambientales, tanto actuales como de la antigedad, se han estudiado durante muchos aos, resulta novedoso utilizar tcnicas matemticas y de computacin para abordar estos estudios. Por consiguiente, estos sistemas procuran relacionar e comprender mediante el uso de modelos, las relaciones uni/multidireccionales existentes entre las presiones socioeconmicas y naturales (drivers) sobre los ambientes y la sociedad, los impactos o cambios de estado decurrentes de estas presiones, las respuestas adaptativas existentes. Las tcnicas modernas de modelos multi-agente (MMA) facilitan las simulaciones del comportamiento de los sistemas humanos, ya que capturan lo esencial de los procesos de decisin y valores o preferencias que conllevan a cambios en el uso del territorio. A su vez estos cambios generan efectos en el sistema natural simulado por modelos basados en procesos y funciones del ecosistema. Aun ms, las capacidades computacionales permiten el anlisis de los patrones emergentes de SHN reconocidos como una forma de biocomplejidad. Varios aspectos caracterizan el estudio de biocomplejidad: escalas temporal y espacial mltiples, niveles mltiples de organizacin biolgica, interacciones mltiples y dinmica nolineal.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Para los objetivos del modelado, los valores o preferencias de los grupos humanos se expresan cuantitativamente con base a los factores que influyen en las acciones de los grupos de presin. El modo convencional de hacer esto es por medio de una mtrica monetaria, pero este enfoque ha sido criticado por reducir el complejo de valores humanos a un solo tipo, el valor econmico. Los economistas defienden el uso de esta mtrica postulando que el dinero es slo una medida para expresar valores de otra manera inconmensurables. Sin embargo, mucha gente se siente incapaz de responder cuando se le pregunta lo que querran pagar por cosas consideradas como 'inestimables'; los iconos culturales, la belleza de la naturaleza, y los servicios del ecosistema. Con esta conferencia har una presentacin objetiva visualizando la utilizacin de los modelos CHANS, las principales presiones globales existentes y los potenciales escenarios, sus impactos y las respuestas existentes.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

PLANIFICACIN Y GESTIN ADAPTATIVA DE LOS SOCIOECOSISTEMAS DE ALTA MONTAA: ELEMENTOS CLAVES PARA LA ADAPTACIN AL CAMBIO CLIMTICO DRA. DIANA CAROLINA USECHE RODRGUEZ (Colombia) Agencia GIZ Bogot. Deutsche Gesellschaft fr Internationale Zusammenarbeit (GIZ) GmbH diana.useche@giz.de El Cambio Climtico global es una realidad e independientemente de la certeza con la pueda pronosticarse a futuro, desde hoy debemos planificar la adaptacin de los sistemas sociales y ecolgicos socioecosistemas- a los cambios de temperatura, precipitacin y los efectos que esto pueda conllevar. Existen mltiples documentos que sealan cambios, alteraciones y modificaciones positivas y negativas observadas en las diferentes dimensiones de la biodiversidad mundial (ver: CDB 2007, 2009). Se reconoce el impacto que el cambio climtico antropognico pueda tener sobre el comportamiento y la fisionoma de algunas especies y las pocas de migracin o reproduccin, entre otros efectos. As mismo, es reconocido que los ecosistemas de alta montaa o aquellos que se encuentren aislados espacialmente, tales como los pramos, son ms vulnerables al cambio climtico. A pesar del reconocimiento, es complejo planificar las medidas de adaptacin al cambio climtico de los ecosistemas de la alta montaa cuando los modelos meteorolgicos futuros tienen una alta incertidumbre de ocurrencia real y de acuerdo a la escuela que lo realice, se tienen diferentes resultados y algunas veces, contradictorios. As mismo, tratar de predecir la respuesta de la biodiversidad de la alta montaa al cambio climtico tambin es complejo, puesto que las especies respondern de manera distinta de acuerdo a varios factores intrnsecos de cada una (variabilidad gentica y capacidad de desplazamiento y dispersin) y factores extrnsecos tales como el grado y tipo de modificacin del paisaje en el que se encuentren. Por lo tanto, urge planificar la adaptacin de los socioecosistemas y crear estrategias de gestin de la biodiversidad en escenarios de cambio, incertidumbre y sorpresas climticas. Para ello es necesario aumentar o mantener la resiliencia de los sistemas ecolgicos y sociales, alejarse de los umbrales de estados indeseados, manejar los disturbios, considerar el futuro en la dinmica espacial del territorio donde se est inmerso y lo ms importante, gestionar el cambio.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Aumentar la resiliencia de un territorio para lograr la adaptacin de la biodiversidad y garantizar la prestacin de servicios de los ecosistemas de la alta montaa, en especial aquellos claves para el bienestar de la poblacin de las montaas, como la provisin y regulacin de agua, provisin de alimentos, medicinas y abrigo y mantener aspectos culturales y religiosos, entre muchos otros servicios que prestan estos ecosistemas, se debe realizar bajo la planificacin ambiental y adaptativa del territorio, el diseo e implementacin de estrategias de monitoreo de la respuesta de las diferentes dimensiones de la biodiversidad al cambio climtico, la generacin e integracin de la informacin y el conocimiento generados por diferentes disciplinas y actores y la formulacin y ejecucin de polticas pblicas adaptativas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

PARAMOS Y SISTEMAS DE VIDA DRA. BIBIANA DUARTE ABADA (Colombia) Investigadora Pramos y Sistemas de Vida. Instituto de Investigacin de Recursos Biolgicos Alexander von Humboldt El proyecto Pramos y sistemas de vida es un estudio que entrelaza las dimensiones conceptuales, analticas y prcticas para comprender la vinculacin entre pobreza, bienestar humano y sostenibilidad en los pramos. Esto como aporte a la comprensin del cumplimiento de los Objetivos de Desarrollo del Milenio en Colombia, especficamente la meta 1 (erradicacin de pobreza) y la meta 7 (sostenibilidad ecosistmica). El proyecto tiene una duracin de 3 aos y se desarrolla en tres ventanas de estudio en los pramos de Rabanal, Guerrero y Santurban. A travs de estos tres casos se busca fortalecer la toma de decisiones en los temas relacionados con la pobreza y la sostenibilidad ecolgica de los pramos a una escala nacional. Para esto, se han definido tres objetivos especficos: el primero consiste en ampliar el conocimiento socio-ecosistmico del pramo, el segundo tiene como fin generar recomendaciones de polticas para los tomadores de decisiones locales, regionales y nacionales, y el tercero formular e implementar una estrategia de comunicacin, sensibilizacin y divulgacin para la apropiacin del conocimiento de los actores que directamente e indirectamente intervienen y se benefician del pramo. Se propone desarrollar el proceso de investigacin mediante la implementacin de un proceso formativo denominado Escuela de campo sobre polticas ambientales para el manejo, uso y conservacin del pramo y ecosistemas asociados. Esta escuela est dirigida a las comunidades campesinas e instituciones del rea de influencia del proyecto y ha sido diseada desde una visin que permite integrar elementos culturales de conservacin de la biodiversidad y actividades productivas por considerar de vital importancia la constitucin de espacios para el intercambio y recreacin del conocimiento individual y colectivo en el desarrollo del proyecto. El concepto de medios de vida lo hemos adaptado a sistemas de vida, siendo estos una representacin de modelos de vida de un grupo de personas, familias y/o empresas rurales con condiciones socio culturales, econmicas y tecnolgicas especificas y diferenciables, que desarrollan actividades en un rea geogrfica determinada, con la finalidad de suplir sus necesidades y alcanzar sus objetivos e intereses (sociales, econmicos, culturales, polticos). Por consiguiente,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

entendemos al pramo como un socio-ecosistema que est en continuo cambio dadas las constantes interacciones de unas variables biofsicas y sociales. La forma en cmo se estn presentando estas relaciones determinan el estado actual de los ecosistemas de los pramos y de la biodiversidad asociada a este. El proyecto tiene un enfoque sistmico, lo que implica entenderlo desde una integralidad territorial que est condicionada por la dinmica de los sistemas produccin. Estos ltimos van ms all de la caracterizacin y definicin de los agro-ecosistemas que los contiene pues tambin incluye la comprensin de las relaciones sociales y de las fuerzas econmicas y polticas que los dinamizan e inciden en las transformaciones socio-ecosistmicas. En este sentido, el conocimiento del socio-ecosistema pramo se define desde la interaccin de tres componentes: los Servicios Ecosistmicos (SE), las dinmicas de los sistemas de produccin y las dinmicas socio-culturales.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CONFERENCIAS CORTAS
SIMPOSIO 1. BIODIVERSIDAD MICROBIANA Y CAMBIO CLIMTICO

ESTUDIO METAGENMICO DE LA MICROBIOTA RIZOSFRICA DE Espeletia sp, EN EL PARAMO DE SANTA INES-ANTIOQUIA Henry Arenas-Castro1, Juan Alzate-Restrepo2, Pilar Ximena Lizarazo-Medina1,
3 1

Grupo de Investigacin en Ecologa Microbiana y Bioprospeccin. Instituto de Biologa. Universidad de Antioquia. 2Centro Nacional de Secuenciacin GenmicaCNSG. Universidad de Antioquia. Universidad de Antioquia Calle 67 No. 53-108 Oficina 7- 218 Medelln - Antioquia Colombia 3 pilarximenalizarazo.udea@gmail.com RESUMEN Los pramos constituyen un ecosistema con caractersticas nicas, hallndose el 60% de ellos en Colombia. Actualmente, las actividades antrpicas como la ganadera, la minera y las quemas estn causando el deterioro de estos ecosistemas. La microbiota de suelo y la rizosfrica como agente dinamizador de nutrientes y minerales es responsable de garantizar la estructura del suelo y el establecimiento de las especies vegetales. La composicin bacteriana del suelo de los pramos no ha sido explorada, siendo necesarios los estudios que permitan su conocimiento para adelantar acciones encaminadas a la conservacin y restauracin de estos ecosistemas. En este estudio se determinaron las poblaciones bacterianas presentes en la rizosfera del frailejn ( Espeletia sp.) mediante el empleo de tcnicas metagenmicas para la secuenciacin del gen de la subunidad ribosomal de ARN pequea 16S, y se asignaron a una categora taxonmica contrastando las secuencias con diferentes bases de datos. Los principales phyla reportados fueron Proteobacteria y Acidobacteria, seguidos por Bacterioidetes, Actinobacteria, Cloroflexi y Firmicutes. Bradyrhizobium fue el gnero predominante. Este estudio demuestra la enorme riqueza de poblaciones bacterianas en los suelos de pramo, y valida el poder de las de tcnicas de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

secuenciacin de alto rendimiento en el estudio de la diversidad microbiana, que no podra conocerse en tal detalle con aproximaciones clsicas. Palabras clave: 16S RNA, bacteria, Espeletia sp., pramo, rizosfera INTRODUCCIN Con el levantamiento final de la cordillera de los Andes, hace cinco millones de aos, se establecieron los bosques andinos y por encima de los 3.000 msnm, los ecosistemas de pramo. Estos ecosistemas estn presentes desde el norte del Per hasta Ecuador, Colombia y Venezuela, y aisladamente en Panam y Costa Rica. Colombia tiene 34 complejos, representando el 60% de las zonas de pramo del mundo (1). Los pramos son una fuente permanente de agua y captacin de carbono atmosfrico, convirtindolos en un ecosistema estratgico de amplia importancia nacional e internacional. El rea de pramos colombiana alberga cerca de 4.700 especies de plantas, 154 de aves, 70 de mamferos, 87 de anfibios, 14 de reptiles y 130 de mariposas; para los grupos microbianos la informacin es prcticamente inexistente. El endemismo especfico para toda el rea es alto, su gran biodiversidad est relacionada con la variedad de condiciones ecolgicas vinculadas con la geomorfologa glaciar, que ha resultado en un gran nmero de diferentes asociaciones y especies vegetales nicas, como el frailejn (Espeletia sp.) (2). La vegetacin es uno de los principales factores en la formacin de los suelos, a travs del proceso de acumulacin de la materia orgnica. La evolucin de los suelos en los pramos es muy restringida debido a que las temperaturas bajas aletargan la actividad microbiana. Por esta razn, los procesos de formacin de humus y la mineralizacin de los restos orgnicos ocurren de forma muy lenta y esto hace que la materia orgnica tienda a acumularse parcialmente descompuesta. En trminos generales, los suelos son considerados los ambientes que albergan las comunidades bacterianas ms diversas en el planeta (3, 4). Las estimaciones del nmero de especies bacterianas por gramo de suelo varan entre 2.000 y 8.300.000, y en sitios prstinos hasta 10 9 clulas (5); la mayora asociadas a las races de las plantas (6). A pesar de esta riqueza, el conocimiento de la diversidad y procesos funcionales del suelo es limitado, pues los estudios de cuantificacin de la biodiversidad y procesos funcionales en el suelo son mucho menos comunes que aquellos centrados en organismos de la superficie, especialmente plantas (7).

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Los esfuerzos en caracterizar la biodiversidad de microorganismos en los suelos de pramos colombianos han sido pocos (8), y la mayora se han centrado en hongos filamentosos (1, 9). Por lo tanto, estudiar la diversidad microbiana de los suelos de pramos se convierte en un imperativo, si el inters ms all de conocer la diversidad bacteriana del sitioest en descubrir nuevas estrategias metablicas, ntimamente relacionadas con los ciclos biogeoqumicos y degradacin de la materia orgnica; pues es un ecosistema con condiciones ambientales nicas en el mundo y niveles de endemismo elevados. Nuestro conocimiento de la diversidad microbiana del suelo es limitado en parte por las propias limitaciones tcnicas para estudiar los microorganismos del suelo. Las aproximaciones clsicas se basan en mtodos de cultivos, los cuales, a parte de ser selectivos para microorganismos de rpido crecimiento, desconocen el 99% de la diversidad microbiana, considerada no cultivable (10). Las aproximaciones metagenmicas son las mejores para conocer la fraccin no cultivable (11, 12), las que adems cuentan con el desarrollo creciente de herramientas para el anlisis de la gran cantidad de datos generados, y algoritmos cada vez ms complejos (7); as, se pueden descifrar los ensamblajes taxonmicos y funcionales de comunidades bacterianas locales de una forma rpida y confiable (13). Entre las estrategias de secuenciacin de ltima generacin para estudios metagenmicas se destaca la pirosecuenciacin con tecnologa 454 GS FLX (14), pues genera un elevado nmero de reads con longitud media mayor a 250 pb, y su uso ha sido ampliamente validado en estudios metagenmicos (15, 16, 17). El presente estudio tuvo como objetivo determinar la composicin bacteriana del suelo adherido a las races de Espeletia sp. en el Pramo de Santa Ins, (Belmira, Antioquia). Para alcanzar el objetivo se utiliz una metodologa independiente de cultivo mediante la amplificacin y secuenciamiento directo a partir ADN de suelo rizosfrico del gen del RNA ribosomal 16S. MATERIALES Y MTODOS El pramo de Santa Ins est ubicado al norte de la cordillera Central, entre los 3.100 y 3.340 msnm, con un rea central de 1.080 ha. La zona registra valores altos de humedad relativa, temperatura promedio entre 10 y 16 C, y precipitacin anual entre los 1.900 y 2.200 mm, correspondiendo a un rgimen monomodal con un perodo seco de diciembre a marzo y uno lluvioso de abril a noviembre (2). Las muestras fueron recolectadas a 15 km al norte de la cabecera municipal del municipio de Belmira, a una altura de 3.214 msnm (N 637.9' - W 75 38.6'), el 18

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

de junio de 2011. Se tomaron 20 muestras de suelo a 10 cm de profundidad, en la rizosfera de frailejones (Espeletia occidentalis var. antioquensis, familia Asteraceae), especie vegetal predominante en la zona. Se realiz un muestreo aditivo, las submuestras se combinaron y mezclaron para formar una nica muestra de 500 g, la cual fue transportada al laboratorio bajo refrigeracin. Durante el muestreo se registraron datos de temperatura, humedad relativa e intensidad lumnica. El ADN total de la muestra de suelo se extrajo usando el kit comercial PowerMax Soil DNA Isolation (MoBio Laboratories Inc., Carlsbad, CA, USA). Para la amplificacin se emplearon oligonucleotideos para las regiones V1-V3 del rDNA16S (RV-5 CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGAGTTTGATCC TGGCTC3 y FW 5CCATCTCATCCCTGCGTGTCTCCGACTCAGAAGGTGCAT TACCGCGGCTGCTGG 3), los fragmentos obtenidos fueron secuenciados en un secuenciador Roche GS-FLX 454 (Roche, Mannheim, Germany). Los reads fueron filtrados y se seleccionaron aquellos con longitud entre 350 y 600 pb y se eliminaron de la bases correspondientes a los adaptadores de secuenciacin. Se corri un algoritmo de BLAST local contra la base de datos de 16S microbiano del NCBI para la asignacin taxonmica de los reads, al igual que contrastamos las secuencias usando los algoritmos y base de datos de RDP multiclassifier (18). Ambas asignaciones taxonmicas fueron interpretadas usando MEGAN (19), y centramos el anlisis de la clasificacin a nivel de phylum, familia y gnero. RESULTADOS Y DISCUSIN En cuanto a los resultados, las condiciones de temperatura y humedad relativas durante el momento de muestreo se encuentran reportadas en la Tabla 1

Factor Temperatura al nivel del suelo Temperatura al nivel de las hojas Humedad relativa al nivel del suelo

Valor Promedio 24.86 C 24.74C 74.53

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Humedad relativa al nivel de las hojas 66.51 Tabla 1. Condiciones climticas registradas durante el muestreo. Los datos indicaron que no se presentan variaciones de temperatura a nivel de la la altura de las hojas y entre la temperatura a nivel del suelo rizosfrico, sin embargo la humedad en estos dos microhbitats es diferente. En general, las condiciones a nivel del suelo rizosfrico son las esperadas para un ecosistema de pramo, sin embargo, es importante indicar que el muestreo fue realizado entre las 11:00 am y 2:00 pm, y que las temperaturas ms bajas han sido reportadas en la noche y la madrugada. El anlisis de suelo mostr caractersticas de un suelo cido con un valor de pH bajo (Tabla 2). El contenido de materia orgnica es bajo y el de nitrgeno es medio, para lo esperado en este tipo de suelos a diferencia del contenido de azufre, que presenta un valor alto. Caracterstica Valor Porcentaje de humedad 53.23 1.88 Textura del suelo Arcillo arenoso pH 4,35 Porcentaje materia orgnica 8,45 Nitrgeno 0,42 Fosforo 5,14ppm Azufre 17,96ppm Potasio 0,15meq/100g Magnesio 0,24meq/100g Calcio 0,48meq/100g Aluminio 2,73meq/100g Sodio 0,07meq/100g Capacidad intercambio catinico 3,66148meq/100g Tabla 2. Caractersticas fsico-qumicas del suelo rizosfrico de Espeletia sp, en el paramos de Santa Ins- Antioquia A partir de la secuenciacin del rDNA 16S se obtuvieron 74.000 reads, de los cuales 48.000 fueron seleccionados por presentar tamaos superiores a 350 pb. La asignacin taxonmica usando algoritmo de BLAST con la base de datos del NCBI no clasific ms del 25% de los reads, por lo que se desisti de posteriores anlisis con estos datos. Por otro lado, casi el 100% de los reads fueron

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

clasificados en al menos phylum, usando la base de datos RDP. Fueron identificados en la muestra 26 phyla, 179 familias y 588 gneros bacterianos, cifra no alcanzada antes por ningn estudio valindose de mtodos clsicos de cultivo. El 52.83% de los phyla correspondieron a Acidobacterias, el 37.45% a Proteobacterias y cerca del 2% a Bacterioidetes, Actinobacteria, Cloroflexi y Firmicutes cada uno. A nivel de familia el 43,80% de los reads fueron exitosamente asignados, siendo Bradyrhizobiaceae la familia con mayor representacin (6,64%), seguida por Acetobacteraceae (4%). Dentro del phylum Proteobacteria la familia y el gnero ms abundantes fueron Acetobacteraceae y Steroidobacter respectivamente. Dentro de la clase Alfaproteobacterias se presenta en mayor proporcin las bacterias fijadoras de nitrgeno del gnero Bradyrhizobium. En la clase betaproteobacteria la familia Burkholderiadeae y Oxalobacteraceae fueron tambin abundantes, caracterizadas por presentar especies patognicas y que utilizan el cido oxlico como fuente de carbono. El pH bajo cumple un papel determinante en los suelos del pramo de Santa Ins, sin embargo los phyla reportados aqu en mayor proporcin corresponden a los reportados en la mayora de suelos neotropicales, adems, llama la atencin la baja representacin del phylum Firmicutes. Este estudio sienta las bases para futuros anlisis comparativos de la diversidad microbiana en suelos de pramos y bosques de alta montaa, pues constituye el primer referente que usa tcnicas de secuenciacin de alto rendimiento en estudios metagenmicos en pramos, y seala una gran riqueza microbiolgica como ningn estudio lo haba sealado anteriormente. BIBLIOGRAFA 1. Chitiva-Jaramillo A, Torrenegra R, Cabrera-Parada C, Daz-Puentes N, PinedaParra V. Contribucin al estudio de microhongos filamentosos en los ecosistemas pramo de Guasca y el Tablazo. Facultad de Ciencias, Pontificia Universidad Javeriana Bogot D.C. 2001. 2. Morales M, Otero J, van der Hammen T, Torres A, Cadena C, Pedraza C, Rodrguez N, Franco C, Betancourth J, Olaya E, Posada E, Crdenas L. Atlas de pramos de Colombia. Bogot: Instituto de Investigacin de Recursos Biolgicos Alexander von Humboldt; 2007. 3. Roesch L, Fulthorpe R, Riva A, Casella G, Hadwin A, Kent A, Daroub S, Camargo F, Farmerie W, Triplett E. Pyrosequencing enumerates and contrasts soil microbial diversity. The ISME Journal. 2007; 1(4): 283290.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

4. Delmont T, Robe P, Cecillon S, Clark I, Constancias F, Simonet P, Hirsch P, Vogel T. Accessing the Soil Metagenome for Studies of Microbial Diversity. Applied and Environmental Microbiology. 2011; 13151324. 5. Gans J, Wolinsky M, Dunbar J. Computational improvements reveal great bacterial diversity and high metal toxicity in soil. Science. 2005; 309: 1387-1390. 6. Treusch A, Schleper C. The microbial soil flora. En: Intestinal microorganisms of termites and other invertebrates; 6:407-424. 2006. 7. Maron P, Mougel C, Ranjard L. Soil microbial diversity: methodological strategy, spatial overview and functional interest. Comptes Rendus Biologies. 2011; 334: 403411. 8. Montaa J, Jimnez D, Hernndez M, ngel T, Baena S. Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome. Antonie van Leeuwenhoek. 2012; 101(2): 205-215. 9. Arias E, Pieros P. Aislamiento y clasificacin de hongos filamentosos de muestras de suelo de los pramos de Guasca y Cruz Verde. Facultad de Ciencias, Pontificia Universidad Javeriana Bogot D.C. 2008. 10. Kirka J, Beaudettea L, Hartb M, Moutoglisc P, Klironomosb J, Leea H, Trevors J. Methods of studying soil microbial diversity. Journal of microbiological methods. 58: 169 188. 11. Rajendhran J, Gunasekaran P. Strategies for accessing soil metagenome for desired applications. Biotechnology Advances. 2008; 26: 576 590. 12. Hudson M. Sequencing breakthroughs for genomic ecology and evolutionary biology. Molecular Ecology Resources. 2008; 8: 317. 13. Desai N, Antonopoulos D, Gilbert J, Glass E, Meyer F. From genomics to metagenomics. Current Opinion in Biotechnology. 2012; 23:72 76. 14. Harkins T, Jarvie T. Metagenomics analysis using the Genome Sequencer FLX system. Nature Methods. 2007: iii-iv. 15. Quince C, Lanzn A, Curtis T, Davenport R, Hall N, Head I, Read L, Sloan W. Accurate determination of microbial diversity from 454 pyrosequencing data. Nature Methods. 2009; 9: 639-641. 16. Luo C, Tsementzi D, Kyrpides N, Read T, Konstantinidis K. Direct comparisons of Illumina vs. Roche 454 sequencing technologies on the same microbial community DNA sample. PLoS One. 2012; 7(2): e30087. 17. Nacke H, Thrmer A, Wollherr A, Will C, Hodac L, Herold N, Schning I, Schrumpf M, Daniel R. Pyrosequencing-based assessment of bacterial community structure along different management types in German forest and grassland soils. PLoS One. 2011; 6(2): e17000. 18. Cole J, Wang Q, Cardenas E, Fish J, Chai B, Farris R, Kulam-Syed-Mohideen A, McGarrell D, Marsh T, Garrity G y Tiedje M. The Ribosomal Database Project:

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

improved alignments and new tools for rRNA analysis. Nucleic Acids Research. 2009; 37. 19. Huson D, Auch A, Qi J y Schuster S. MEGAN analysis of metagenomic data. Genome Research. 2007; 17: 377-386.

SIMPOSIO 3. COMUNIDADES VEGETALES Y ANIMALES EN LOS ECOSISTEMAS DE ALTA MONTAA. EFECTOS DEL CAMBIO CLIMTICO SOBRE LAS ESPECIES NATIVAS USO DE HBITAT DE AVES Y MAMFEROS GRANVOROS EN UN BOSQUE ALTOANDINO DE BOYAC: COMPARACIN DE DOS TIPOS DE BORDE Wilderson Alfonso Medina Barn

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Grupo de investigacin Sistemtica Biolgica. Escuela de Biologa, Universidad Pedaggica y Tecnolgica de Colombia. Tunja, Boyac-Colombia. wameba7@gmail.com RESUMEN El entendimiento de los procesos que suceden en fragmentos de bosque, incluyendo los posibles efectos de los bordes sobre las comunidades del bosque, puede servir para evaluar la cantidad de hbitat disponible y as disear estrategias de manejo y seguimiento de la biodiversidad. En este estudio, mediante la teora de uso ptimo de parches, evalu el uso de hbitat de aves y mamferos granvoros en tres sitios: un borde suave, i.e. un borde de bosque de bajo contraste con la matriz adyacente, bosque-pinar; el interior del bosque, y un borde abrupto, i.e. borde de alto contraste con la matriz adyacente, bosquepastizal, en un fragmento de bosque andino, como herramienta para revelar cmo interactan especies funcionalmente similares. Para realizar esto, se evaluaron parches alimentarios, los cuales consistieron en bandejas plsticas de 45 cm de dimetro por 6 cm de profundidad que contenan 3 g de maz pira mezclado en 3 L de arena cernida. Cada bandeja siempre estaba acompaada de un algodn impregnado con esencia de vainilla y esencia de banano como atrayente. As, para cada sitio compar el nmero de visitas y el forrajeo de aves y mamferos; adems, analic el efecto de la iluminacin de la luna y la lluvia sobre el uso de hbitat. Con base en lo anterior, encontr que al menos una especie de roedor, un marsupial y al menos dos especies de aves visitaron los parches alimentarios. Las aves slo estuvieron activas en el da y prefirieron el interior del bosque, mientras que los roedores y los marsupiales estuvieron activos slo en la noche, y prefirieron el borde bosque-pinar y el borde bosque-pastizal, respectivamente. La iluminacin de la luna afect negativamente el comportamiento de las aves en el interior y el borde bosque-pinar, al igual que los roedores en el borde bosque-pinar y a los marsupiales en el interior del bosque. La precipitacin no afecto las visitas ni el forrajeo de aves y mamferos. Estos resultados indican marcadas diferencias en la seleccin de hbitat, sugiriendo una reparticin de nicho en su componente espacial. De esta manera, las modificaciones al bosque hechas por los humanos podran servir como mecanismo para permitir la coexistencia de las especies. Con este estudio se concluye que no todas las modificaciones al ambiente son perjudiciales para los animales; esto podra depender de la magnitud y el rea modificada. Palabras clave: aves y mamferos, bosque altoandino, coexistencia, efecto de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

borde, uso de hbitat. INTRODUCCIN El entendimiento de los procesos que suceden en fragmentos de bosque en los Andes colombianos, incluyendo los posibles efectos de los bordes sobre las comunidades del bosque, puede servir para evaluar la cantidad de hbitat disponible y as disear estrategias de manejo y seguimiento de la biodiversidad. Objetivos. En este estudio, mediante la teora de uso ptimo de parches, evalu el uso de hbitat de aves y mamferos granvoros en tres sitios: un borde suave, i.e. un borde de bosque de bajo contraste con la matriz adyacente, bosque-pinar, el interior del bosque y un borde abrupto, i.e. borde de alto contraste con la matriz adyacente, bosque-pastizal, en un fragmento de bosque andino, como herramienta para revelar cmo interactan especies funcionalmente similares. Para realizar esto, compar el nmero de visitas y el forrajeo de aves y mamferos en cada sitio; adems, analic el efecto de la iluminacin de la luna y la lluvia sobre el uso de hbitat. MATERIALES Y MTODOS Examin el uso de hbitat de mamferos no voladores, masa<5 kg, y de aves granvoras con base en su presencia en estaciones construidas para registrar sus huellas y su forrajeo. Las estaciones que utilic fueron bandejas plsticas de 45 cm de dimetro por 6 cm de profundidad que contenan 3 g de maz pira mezclado en 3 L de arena cernida. Cada bandeja siempre estaba acompaada de un algodn impregnado con esencia de vainilla y esencia de banano como atrayente. Las estaciones fueron protegidas de la lluvia con techos plsticos. En total utilic 21 estaciones, siete para cada sitio, distanciadas 30 metros entre s, para reducir la probabilidad de que un mismo individuo se alimentara de ms de una estacin durante la misma jornada. Las estaciones de los bordes fueron ubicadas a 10 m de distancia desde el lmite del fragmento hacia el interior del bosque. El trabajo de campo lo realic en tres fases: habituacin (23 das), evaluacin del nmero de visitas a las estaciones (presencia/ausencia; 55 das) y medicin del consumo de maz pira (34 das). Anlisis estadstico. Hice dos anlisis empleando modelos lineales generalizados, dado que un anlisis de residuales evidenciaba fuertes desviaciones de los supuestos de normalidad y homogeneidad de varianza (Zuur 2007). Adems hice un anlisis de correlacin para examinar la variacin del uso de hbitat respecto a iluminacin de la luna, el sitio y el grupo animal (ave o mamfero). RESULTADOS

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Encontr que al menos dos especies de aves posiblemente usaron las estaciones, Columbina talpacoti y Grallaria ruficapilla, al igual que por lo menos una especie de roedor y un marsupial, Didelphis pernigra. El anlisis de las huellas revel adems que los roedores nicamente visitaron el borde bosque-pinar y los marsupiales nicamente el interior y el borde bosque-pastizal. Adicionalmente, durante el da las estaciones fueron visitadas slo por aves, y durante la noche slo por roedores y marsupiales. As, la jornada result ser indicativa del grupo animal que visit la estacin. Estos resultados se explican en parte por la presencia de slo aves en el da y de slo mamferos en la noche. La precipitacin no fue incluida en el modelo debido a que no tuvo un efecto significativo sobre las visitas de los animales. Adicionalmente, el anlisis de correlacin revel una relacin negativa de la iluminacin de la luna sobre el nmero de visitas de aves en el borde bosque-pinar, y de mamferos en el interior del bosque. En contraste, hubo una correlacin positiva de la iluminacin de la luna sobre las aves en el interior. La iluminacin de la luna no se correlacion con las visitas de mamferos en el bosque-pastizal, ni en el bosque-pinar, ni de aves en el bosque-pastizal. Encontr evidencias de forrajeo de por lo menos una de las dos especies de aves identificadas en la evaluacin de visitas, y entre los mamferos slo registr consumo por parte de los pequeos roedores. Estos resultados se explican en parte, debido a que al menos una de las aves slo se aliment de las estaciones del interior y por lo menos un roedor slo se aliment de las estaciones del borde bosque-pinar. Adems, en correspondencia con los resultados de presenciaausencia, al menos una de las aves slo forraje durante el da y los mamferos durante la noche. Encontr un efecto negativo de la iluminacin de la luna sobre el forrajeo de las aves en el interior y de los roedores en el borde bosque-pinar. La precipitacin no tuvo un efecto significativo sobre el forrajeo por parte de aves y mamfero, por lo tanto no fue incluido dentro del modelo. DISCUSIN A la fecha, y hasta donde sabemos, este es el primer estudio que analiza los posibles efectos de borde para aves y mamferos en los Andes colombianos. Por lo tanto, los resultados obtenidos slo es posible compararlos con estudios que involucran uno de estos taxa. Por ejemplo, este es el segundo estudio para los Andes colombianos que revela una mayor uso de semillas (depredacin) por parte de aves en hbitats del interior del bosque en comparacin con bordes de origen antrpico (Restrepo & Vargas 1999). Estas respuestas concuerdan con el estudio de Hansbauer et al. (2008) en bosques de Brasil, los cuales evidenciaron que las aves depredaban ms semillas en el interior del bosque que en bordes adyacentes a praderas o plantaciones de especies exticas. Pero contrastan con estudios en bosques de roble perturbados por eventos naturales y por accin humana en Mxico (Bonfil y Soberon, 1999) y en fragmentos de bosque adyacentes a pastizales abandonados en Costa Rica (Jones et al. 2003), los

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

cuales muestran mayor depredacin por aves en hbitats de borde que al interior del bosque. Por otro lado, los resultados obtenidos para los mamferos concuerdan parcialmente con lo encontrado por Narvez (2008) en un bosque de roble altoandino en la Cordillera Occidental, quien mostr que los pequeos mamferos forrajearon poco en el borde bosque-pastizal, pero difieren considerablamente al demostrar que prefirieron el interior del bosque. Adems, los resultados obtenidos concuerdan con una mayor abundancia de roedores y marsupiales en bordes de bosque y bosques secundarios en el Atlntico en Brasil (Pardini 2004), y de roedores en bordes suaves con respecto a bordes abruptos (Lpez-Barrera et al. 2005). Esta variacin en la estructura del paisaje puede ser responsable de las diferencias encontradas, aunque Narvez y Snchez (en preparacin) han sugerido que la respuesta de la fauna a los bordes puede depender de las caractersticas particulares del paisaje. Nuestros resultados indican marcadas diferencias en la seleccin de hbitat por parte de tres grupos animales, sugiriendo una reparticin de nicho en su componente espacial. As, este estudio revela, por primera vez, cmo las perturbaciones hechas por el ser humano en los paisajes rurales de los Andes, va la generacin de bordes, pueden impactar la estructura de las comunidades. Brown et al. (1997) encontraron que aves y mamferos del desierto del Negev difieren en la seleccin de hbitat, y sugirieron que estos comportamientos se relacionaban con mecanismos de coexistencia (Rosenzweig 1981) que involucran una variabilidad espacial y temporal de la abundancia de semillas. Al igual que en el presente estudio, Brown et al. (1997) encontraron que las aves y los roedores explotaban los parches alimentarios en distintos sitios y a distinta hora, de tal manera que no se reduca competencia (Schoener 1983). Por otra parte, los resultados de este estudio revelaron que la iluminacin de la luna se correlacion con el nmero de visitas y el consumo por aves diurnas. Aunque varios estudios a nivel mundial reconocen que las fases lunares afectan el comportamiento de aves migratorias, marinas y nocturnas (Penteriani et al. 2011), a la fecha no hay evidencia de relacin alguna entre el comportamiento de aves andinas diurnas y las fases lunares. As, la luna en fase llena pudo haberse relacionado con los cambios en los campos magnticos de la tierra, aumentando a la vez la sensibilidad de la recepcin magntica de los animales (Nishimura & Fukushima 2009), determinando as, el comportamiento de las aves diurnas. Estos cambios, pudieron modificar el comportamiento de las aves haciendo que consumieran menos recurso y visitaran ms el interior del bosque, realizando actividades alternas tales como defender el territorio, encontrar pareja, cuidar cras, descansar, entre otras (Brown 1988). As, este estudio por primera vez y parcialmente revela una relacin entre la posicin de la luna y el comportamiento de aves andinas diurnas. Con respecto a los mamferos, en noches de luna llena los roedores consumieron menos en el borde bosque-pinar mientras que D.pernigra visit menos el interior del bosque. Estos resultados se relacionan con el efecto significativo de la iluminacin de la luna verificado en algunos estudios (Kotler 1993), en donde se encontr una correlacin negativa significativa entre la iluminacin de la luna y la seleccin de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

hbitat, atribuyendo estos resultados a la percepcin por parte de los mamferos a posibles costos de depredacin. CONCLUSIONES Los resultados indicaron marcadas diferencias en la seleccin de hbitat por parte de tres grupos animales, sugiriendo una reparticin de nicho en su componente espacial. Este estudio evala por primera vez el efecto de borde en una comunidad y demuestra el impacto del ser humano en el uso del espacio de aves y mamferos. Las modificaciones al bosque hechas por los humanos podran servir como mecanismo para permitir la coexistencia de las especies. Las fases lunares pueden estar influenciando el comportamiento de aves diurnas en los Andes colombianos. La lluvia no afecto el uso de hbitat de aves y mamferos granvoros. Los resultados de mi estudio revelan que no todas las modificaciones al ambiente son perjudiciales para los animales. Esto podra depender de la magnitud y el rea modificada. BIBLIOGRAFA BONFIL, C. & SOBERON, J. 1999. Quercus rugosa seedling dynamics in relation to its re-introduction in a disturbed Mexican landscape. Applied Vegetation Science 2: 189-200. BROWN, J.S. 1988. Patch use as an indicator of habitat preference, predation risk, and competition. Behavioral Ecology and Sociobiology 22:37-47. BROWN, J S. KOTLER, B.P. &MITCHELL, W.A. 1997. Competition between birds and mammals: A comparison of giving-up densities between crested larks and gerbils. Evolutionary Ecology 11:757-771. FANSON, B.G. FANSON, K.V. & BROWN, J.S. 2008. Foraging behaviour of two rodent species inhabiting a kopje (rocky outcrop) in Tsavo West National Park, Kenya. African Zoology 43:184191. HANSBAUER, M.M. STORCH, I. LEU, S. NIETO-HOLGUIN, J-P. PIMENTEL, R.G. KNAUER, F. & METZGER, J.P.W. 2008.Movements of Neotropical understory passerines affected by anthropogenic forest edges in the Brazilian Atlantic rainforest. Biological Conservation 141 (2008) 782791. JONES, F.A. PETERSON, CH.J. & HAINES, B.L. 2003. Seed predation in Neotropical pre-montane pastures: site, distance, and species effects. Biotropica 35: 219-225. LPEZ-BARRERA, F. NEWTON, A. & MANSON, R. 2005. Edge effects in a tropical montane forest mosaic: experimental tests of post-dispersal acorn removal. Ecological Research 20:3140. NARVEZ, G. 2008. Uso De Hbitat De Los Pequeos Mamferos En Un Fragmento De Bosque Alto-andino: Comparacin Entre Borde E Interior De Bosque. Trabajo de Grado. Universidad De Nario, Pasto. NISHIMURA, A.T. FUKUSHIMA, M. 2009.Why animals respond to the full moon:

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Magnetic hypothesis. Bioscience Hypotheses 2: 399-401. PARDINI, R. 2004. Effects of forest fragmentation on small mammals in an Atlantic Forest landscape. Biodiversity and Conservation 13:25672586. PENTERIANI V. KUPARINEN, A. DELGADO, M.M. LOURENO, R. CAMPIONI, L. 2011.Individual status, foraging effort and need for conspicuousness shape behavioural responses of a predator to moon phases. Animal Behaviour 82:413420. RESTREPO, C. & VARGAS, A. 1999. Seeds and seedlings of two Neotropical montane understory shrubs respond differently to anthropogenic edges and treefall gaps. Oecologia 119:419-426. ROSENZWEIG, M.L. 1981.A theory of habitat selection. Ecology 62:327335. SCHOENER, T.W. 1983. Field Experiments on Interspecific Competition. The American Naturalist, 122 (2): 240-285. ZUUR, A.K. IENO, E.N & SMITH, G.M. 2007. Analysing Ecological Data. Springer Science.ISBN-10: 0-387-45967-7.

CARACTERIZACIN FLORSTICA DEL SECTOR DE PIEDRA GORDA (Socha, Boyac) Astrid Milena Caro Roa1, Orlando Rivera Daz2 Universidad Nacional de Colombia. Sede Bogot. Instituto de Ciencias Naturales.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL


1

amcaror@unal.edu.co, 2 oriverad@unal.edu.co.

RESUMEN Colombia tiene aproximadamente 20 millones de hectreas de bioma de pramo, Boyac es uno de los departamentos con mayor rea de este ecosistema, donde el Pramo de Pisba con una extensin de 81000 ha, distribuidas en 11 municipios, se est viendo afectado por la ganadera y en mayor grado la minera. Se estableci como objetivo, conocer la diversidad florstica del sector de Piedra Gorda, ubicado en el municipio de Socha; se reconocen las especies que presentan alguna categora de amenaza y las endmicas. Se levantaron 14 parcelas de 25 m2 en frailejonales de laderas y valles inundables, matorrales de laderas y valles hmedos, en cada una se recolect material vegetal en diferentes estados fenolgicos, el cual fue determinado en instalaciones del Herbario Nacional Colombiano (COL) Se calcularon IVI e IPF a partir de mediciones directas. Se registraron 35 familias, 92 gneros y 173 especies, los grupos ms diversificados fueron: Asteraceae (37 especies/ 18 gneros), Poaceae (13/9), Ericaceae (7/3), Melastomataceae (9/4), y Rosaceae (11/5). A nivel de gnero, los ms representativos fueron Miconia (6 especies) Hypericum (5), Diplostephium (4), Espeletia, Ageratina y Achyrocline (3 cada uno). Se encontraron especies endmicas locales (Espeletia mutabilis y Puya cryptantha), endmicas nacionales (Espeletia lopezii y E. boyacensis), 1 especie en peligro crtico (Puya barkleyana) y 2 especies en bajo riesgo (Cyrtochilum revolutum y Tillandsia turnei). Debido a la cercana del PNN-Pisba al rea estudiada se recomienda establecer medidas de conservacin para este sector como un bioma de vital importancia para el desarrollo de la comunidad. Palabras clave: Conservacin, endemismo, Espeletia, pramo, Pisba INTRODUCCIN El ecosistema de pramo en Colombia, ha sido dividido de acuerdo a la posicin geogrfica en cuatro grandes sectores, dentro de los cuales se distinguen distritos y complejos. En el sector de la cordillera oriental, distrito pramos de Boyac, se

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

encuentra el complejo Pisba, el cual, est ubicado entre los departamentos de Boyac y Casanare, y cubre 81.481 ha, representado en los pramos de San Ignacio, El Chuscal, Cadillal, Mesalta, Lajas, Verde y Pisba, y las lagunas de Socha y Batanera (Morales, 2007). El pramo de Pisba, se ubica en la vertiente oriental de la cordillera oriental, es categorizado como un pramo hmedo (Rangel-Ch, 2000), hace parte del corredor biolgico Cocuy-Pisba, el cual permite mantener la oferta hdrica en las cuencas de ros Chicamocha, Casanare y Arauca, as como facilitar la conservacin de especies endmicas o con alguna categora de amenaza (Morales, 2007). El pramo hace parte del Parque Nacional Natural Pisba (PNN-Pisba), el cual fue declarado junto a otros PNN como rea del gran corredor de los Andes del Norte, y fue seleccionado por el proyecto Conservacin y uso Sostenible de la biodiversidad de los Andes Colombianos, con el fin de fortalecer los planes de manejo de las reas protegidas (Morales, 2007). Dentro de las veredas que hacen parte del municipio de Socha, (mas no dentro del rea protegida) se encuentra la Vereda o Sector de Piedra Gorda, ubicada al suroccidente del municipio, cuenta con comunidades vegetales tpicas de Pramo como son frailejonales, pajonales, chuscales, matorrales entre otras, las cuales se distribuyen de acuerdo a la geomorfologa, hidrologa, geologa y dems caractersticas tpicas de este ecosistema.

Objetivo
1. Analizar la diversidad florstica del Sector de Piedra Gorda 2. Brindar informacin que ayude al establecimiento de planes y/o herramientas que permitan la conservacin y manejo racional de este sector.

MATERIALES Y MTODOS Fase de campo. Se levantaron parcelas aleatorias de 5x5 m 2, en diferentes zonas del Sector de Piedra Gorda. Dentro de cada una se recolectaron tres muestras botnicas por individuos de las especies de plantas vasculares encontradas, buscando cubrir los diferentes estados fenolgicos (vegetativo, floracin, fructificacin). Para cada individuo colectado se registr color de las hojas, flores, indumento y frutos, as como olor y textura, adems de otras caractersticas que se pierdan como hbito, altura, dimetro, cobertura, presencia de exudados, etc.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Todos los individuos recolectados se prensaron y utilizando las tcnicas clsicas de herborizacin se preservaron empleando etanol al 70%, fueron ingresados en la coleccin del Herbario Nacional Colombiano (COL). Fase de Laboratorio. La determinacin del material se realiz en las instalaciones de COL, se utilizaron claves descriptivas como: Cuatrecasas 1967, Camargo 1979, Robson 1987, Dillon & Sagstegui-Alva 1991, Daz-Piedrahita & Correa 2002, Vargas & Madrian 2006, Balslev & Zuluaga 2009, complementando con monografas y comparaciones directas con los ejemplares depositados en COL. Manejo y Anlisis de la Informacin. Se realiz una base de datos en la que se incluy informacin taxonmica, de distribucin local y general, y la asociada a los ambientes en donde creca cada especie. Se estableci la riqueza, el nmero de taxones a nivel de familia, gnero y especie, riqueza por formas de crecimiento. Adems se establecieron los ndices de diversidad de Simpson, Shannon y Margalef, para lo cual se utiliz el software Past. De igual forma se calcul el ndice de valor de importancia (IVI) y el ndice de predominio fisionmico (IPF). Categora de riesgo para las especies registradas. Se consult bibliografa especializada (Caldern et al 2002, Linares et al 2002, Caldern, et al 2005, Garca et al 2006, Caldern-Senz, 2006, Caldern et al 2007, Garca et al 2007) para definir si existan especies en alguna categora de riesgo segn la IUCN. Elaboracin del Catlogo. Se incluy la lista de plantas vasculares presentes en el rea de estudio, siguiendo el sistema taxonmico de Cronquist (1988) para las angiospermas y Murillo et al (2008) para los pteridofitos. A su vez se utiliz el sistema de Brummitt & Powell, (1992) para las abreviaciones de los nombres de los autores de las especies. Los taxones se organizaron segn grandes grupos (pteridofitos, gimnospermas, angiospermas), y dentro de estos se organizaron las familias, gneros y especies alfabticamente. Se incluye informacin sobre los nombres comunes empleados en la regin, que fueron obtenidos directamente de los pobladores. Para cada especie se presenta el material estudiado, indicando para cada ejemplar su localidad y altitud, fecha de coleccin, colector y pliego. Para los taxones con alguna categora de amenaza se indica cual. RESULTADOS Se registraron un total de 353 individuos, pertenecientes a 35 familias, agrupados en 92 gneros, y 173 especies. Las familias ms diversas fueron Asteraceae (37

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

especies/ 18 gneros), Poceae (13/9), Ericaceae (7/3), Melastomataceae (9/4), y Rosaceae (11/5). A nivel de gnero los ms diversos fueron Miconia (6 especies), Hypericum (5), Diplostephium (4), Espeletia, Ageratina y Achyrocline (3 cada uno). Diversidad Florstica por ambientes censados. Dentro de las unidades vegetales, se encontr que la mejor representada, en cuanto al nmero de especies fue la del Arbustal dominado por Gynoxys (116 especies), seguida del Arbustal-matorral achaparrado dominado por Gynoxys (40), mientras que unidades como el arbustal-Frailejonal dominado por Escallonia myrtilloides, Ageratina fastigiata, Espeletia lopezii, E. mutabilis y E. boyacensis (10), es el menos diverso. ndice de Valor de Importancia para Familias (IVF). La familia que present mayor valor de importancia es Asteraceae (116,3), seguida de Melastomataceae (27,35), Poaceae (17,16), Juncaceae (14,56) y Ericaceae (11,88). ndice de Valor de Importancia (IVI). La especie que present mayor valor de importancia ecolgica es Gaultheria anastomosans (20.35), seguida de Ageratina sp 01 (14.68), Espeletia lopezii (14.03), Ageratina fastigiata (12.47) y Escallonia myrtilloides (12.15). DISCUSIN Al observar los datos registrados para otros ecosistemas de pramo de la cordillera oriental colombiana, como Chingaza, Perij y Sumapaz, se observa que la riqueza presente en el Sector de Piedra Gorda es significativa, pues presenta cerca del 28.83% de especies que tiene Chingaza, 22.73% de Sumapaz y 28.31% de la riqueza florstica de Serrana de Perij. Este acontecimiento, se podra explicar teniendo en cuenta las condiciones ambientales y geogrficas de Pisba que han permitido que elementos provenientes del norte se hayan diversificado en esta regin, sin embargo, tambin se deben tener en cuenta fenmenos naturales y antrpicos, como el recambio de especies (diversidad beta) que se ha dado como producto de la sucesin ecolgica, que se ha visto en este sitio, situacin que ha hecho que el banco de semillas que antes estaba detenido por el disturbio, hoy est brotando y colonizando ambientes que en aos pasados el hombre le haba quitado como producto de la sobreexplotacin del suelo, generando de esta forma una regeneracin natural a causa de la extraccin del disturbio (Vargas Ros, 2000).

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CONCLUSIONES Teniendo en cuenta que este sector ha sido afectado por actividades tan drsticas como la quema y pastoreo, es notable encontrar una alta diversidad alfa con presencia de especies endmicas tan importantes como Espeletia mutabilis (nivel local) o Puya cryptantha (nivel nacional con ampliacin del rea de distribucin), por lo cual, se hace necesario establecer medidas de conservacin con las que se preserve no slo este ecosistema sino el recurso hdrico que presta a la comunidad, tomando como herramientas aspectos florsticos como los mencionados anteriormente. BIBLIOGRAFIA Balslev, H., & Zuluaga, A. (2009). Juncaceae. In F. d. C. Instituto de Ciencias Naturales, Universidad Nacional de Colombia (Ed.), Flora de Colombia (Vol. XXVI, pp. 80). Bogot, D. C. Brummitt, R., & Powell, C. E. (1992). Authors of Plants Names. London: Kew: Royal Botanical Gardens. Calderon-Senz, E. (2007). Libro Rojo de Plantas de Colombia. Orquideas (Vol. 6, primera parte). Bogot, D. C.: Instituto de Recursos Biologicos Alexander von Humboldt, Ministerio de Ambiente Vivienda y Desarrollo Territorial. Caldern, E., G. Galeano & N. Garca (eds). (2005). Libro Rojo de las Plantas de Colombia (Vol. Volmen 2: Palmas, Frailejones y Zamias). Bogot D.C.: Instituo Alexander von Humboldt. Instituto de Ciencias Naturales de la Universidad Nacional - Ministerio de Ambiente, Vivienda y Desarrollo Territorial. Caldern, E., Galeano, G., & Garca, N. (2005). Libro Rojo de Plantas de Colombia. Palmas, Frailejones y Zamias (Vol. 2): Instituto de Recursos Biologicos Alexander Von Humboldt, Instituto de Ciencias Naturales-Universidad Nacional de Colombia, Ministerio de Ambiente Vivienda y Desarrollo Territorial. Camargo-G, L. A. (1979). Orden: Ericales. In F. d. C. Instituto de Ciencias Naturales, Universidad Nacional de Colombia (Ed.), Catalogo Ilustrado de las Plantas de Cundinamarca (Vol. VII). Bogot, D. C. Cronquist, A. (1988). The Evolution and Classification of Flowering Plants (Second Edition ed.). New York: The New York Botanical Garden. Cuatrecasas, J. (1967). Revision de las Especies Colombianas del Gnero Baccharis. Academia Colombiana de Ciencias Exactas, Fsicas y Naturales, 13(49), 102. Dillon, M. O., & Sagstegui-Alva, A. (1991). Sinpsis de los Gneros de Gnaphaliinae (Asteraceae-Inuleae) de sudamrica. Arnaldoa, 1(2), 5-91.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Daz-Piedrahita, S., & Correa, A. (2002). Novedades en Senecioneae de Colombia. Nuevas especies de Scrobicaria, Gynoxys y Aequatorium. Revista de la Academia Colombiana de Ciencias Exactas, Fisicas y Naturales, XXVI, 341-346. Morales M., O. J., Van der Hammen T., Torres A., Cadena C., Pedraza C.,Rodrguez N., Franco C., Betancourth J.C., Olaya E., Posada E. y Crdenas L. (2007). ATLAS DE PRAMOS DE COLOMBIA. Bogot D.C.: Instituto de Investigaciones de Recursos Biolgicos Alexander von Humboldt. Rangel-Ch, J. O. (2000). COLOMBIA DIVERSIDAD BITICA III. La Regin de Vida Paramuna (PRIMERA EDICIN ed. Vol. III). Bogot D.C.: Universidad Nacional de Colombia. Rivera-Daz, O. (2001). Caracterizacion Florstica y Fitogeogrfica de la Serrana de Perij (Departamento de Cesar Y la Guajira, Colombia). Magister SciantiaeLnea Sistemtica Universidad Nacional de Colombia, Bogot, D. C. Vargas, O. M., & Madrian, S. (2006). Clave para la Identificacin de las Especies del Gnero Diplostephium (Asteraceae, Astereae) en Colombia. Revista de la Academia Colombia de Ciencias Exactas, Fsicas y Naturales, 30(117), 489-494. Vargas Ros, J. O. (2000). Sucesin-regeneracin del Pramo despus de quemas. Msc. en Biologa - Lnea Ecologa, Universidad Nacional de Colombia, Bogot D.C.

EVALUACIN DEL ESTADO DE CONSERVACIN DE LOS BOSQUES Y ESPECIES DE LOS ANDES TROPICALES Natalia Tejedor1, Esteban lvarez2, Sandra Arango3 , Alejandro Araujo4, Cecilia Blundo5, Tatiana Boza6, Mara de los ngeles La Torre7, Juan Gaviria8, Nstor Gutirrez9, Peter Jrgensen10, Blanca Len11, Ren Lpez12, Lucio R. Malizia13, Betty Milln14, Mnica Moraes15, Silvia Pacheco16, Carlos Reynel17, Martn Timan18, Carmen Ulloa19, Omar Vacas20, Adrian Newton21.
1

Bournemouth University, England, Poole, Dorset, BH12 5BB.Tel: 01202 965260 2 ntejedor@bournemouth.ac.uk. IAvh, Colombiay JBMED, 3 Colombia.esalvarez3000@gmail.com. MBG, USA.sacpriv@yahoo.com. 4MNK, Bolivia.araujomurakami@hotmail.com.5 F ProYungas, Argentina.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ccblundo@yahoo.com.ar. 6UNAML, Per.tatianaerika@gmail.com. 7UNALM y WAC, Per.angeleslatorre@lamolina.edu.pe. 8ULA, Venezuela.gaviria@ula.ve. 9 TAMU, USA.nestorgutierrez@ula.ve. 10MBG, USA.peter.jorgensen@mobot.org. 11 TAMU, USA y UNMSM, Per.leon@austin.utexas.edu. UDFJC, Colombia. 13 rlopezc@udistrital.edu.co. UNJU, y FProYungas, 14 Argentina.luciomalizia@proyungas.org.ar. UNMSM, Per.bmillans@gmail.com. 15 UMSA, Bolivia.monicamoraes45@gmail.com. 16FunProYungas, Argentina. 17 silviapachecus@gmail.com. UNALM, Per.reynel@lamolina.edu.pe. 18PUCP, Per.mtimana@gmail.com. 19MBG, USA.carmen.ulloa@mobot.org. 20PUCE, Ecuador.omarvacas@yahoo.com. 21BU, England.anewton@bournemouth.ac.uk. RESUMEN Debido a su elevada riqueza biolgica, endemismos y amenazas, los bosques montanos de los andes son considerados actualmente como una de las mayores prioridades de conservacin mundial. El objetivo de esta investigacin es identificar el riesgo de extincin de las especies de rboles de los bosques montanos de los Andes tropicales (latitudes 11752 N y 284038 S entre el norte de Argentina y Venezuela), mediante la elaboracin de una Lista Roja (sensu UICN), la modelacin de su distribucin espacial y de los efectos potenciales del cambio climtico. Mediante consulta de bases de datos se elabor una lista preliminar de 3700 especies reportadas para los Andes. Posteriormente se identificaron aquellas que fueran exclusivas de la regin, estuvieran reportadas principalmente por encima de los 1500 msnm y se encontraran al menos en dos pases. Finalmente se obtuvo una lista de 150 especies que cumplieron estos criterios. Para cada especie se han obtenido mapas de distribucin junto con la estimacin del rea en el rango donde han sido reportadas. De las 150 especies, la mayora se encuentran en Ecuador (105), seguido por Per (97), Bolivia (62), Colombia (58), Venezuela (25) y Argentina (8). Una vez identificadas las especies ms amenazadas a nivel regional, esta iniciativa constituir una slida base para el desarrollo y enfoque de polticas y respuestas de manejo dirigidas a la reduccin de la deforestacin y la prdida de especies en estos bosques, incluyendo acciones para promover la creacin de reas de proteccin, restauracin forestal y manejo forestal sostenible. Palabras clave: Andes, amenazas, biodiversidad, lista roja. INTRODUCCIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Los Andes son la cadena montaosa ms larga en la tierra, que se extiende ms de siete mil kilmetros a travs de latitudes tropicales, subtropicales y templadas. El amplio gradiente altitudinal y latitudinal han resultado en una gran variedad de ecosistemas (Josse et al. 2009) que tienen enorme valor por sus servicios ambientales (Cuesta et al 2009). Los bosques montanos de los andes son actualmente una de las principales prioridades de conservacin global, debido a su riqueza biolgica, alto nivel de endemismo y amenazas (Bush et al 2007; Olson y Dinerstein, 1997). Adems, estn considerados entre los ecosistemas menos conocidos en los trpicos (Bubb et al 2004). La Lista Roja de especies amenazadas de la UICN (Unin Internacional para la Conservacin de la Naturaleza) es actualmente reconocida a nivel mundial como una herramienta importante para evaluar el riesgo de extincin de las especies (Newton y Oldfield 2008),ya que utiliza normas cuantitativas basadas en el tamaos de las poblaciones silvestres, las tasas de disminucin de la poblacin y reas de distribucin (Akcakaya et al 2006). En este sentido, las listas de especies amenazadas elaboradas por los distintos pases andinos (con excepcin de Argentina) proporcionan informacin de relevancia cientfica y poltica, contribuyen al desarrollo de estrategias de conservacin y son la base de algunos estudios sobre la adaptacin de los ecosistemas al cambio climtico (Zamin et al. 2010). Sin embargo, no existe una evaluacin de este tipo a escala de los Andes tropicales. El objetivo de esta investigacin es identificar el riesgo de extincin de las especies de rboles de los bosques montanos de los Andes tropicales mediante la elaboracin de una Lista Roja a escala regional. Este proceso tiene las siguientes fases: (i) elaborar una lista de especies de rboles de los bosques montanos de la regin, (ii) obtener datos de distribucin geogrfica de cada especie, (iii) elaborar mapas de distribucin para cada especie, de acuerdo con el proceso de LR, (iv) validar los mapas de distribucin con criterio de expertos dentro de la regin, (v) realizar una evaluacin preliminar de la LR de cada taxn de acuerdo a las categoras y criterios de LR. (vi) modelar los efectos del cambio climtico en la distribucin de las especies seleccionadas. Las etapas (i) - (iii) ya estn terminados, y las medidas adicionales estn actualmente en curso. MATERIALES Y MTODOS mbito de aplicacin y rea de estudio. El rea de estudio corresponde a la regin de los Andes tropicales entre Venezuela hasta Argentina, entra las latitudes

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

11752N y284038 S por encima de 1500 m de altitu d hasta la lnea del bosque, como se describe en Josse et al. (2009). Un umbral altitudinal de 1500 m fue elegido porque la composicin de especies tpicamente cambia en esta altitud y los bosques son florsticamente diferente de las tierras bajas (Josse et al. 2009).Los bosques se definen como aquellas zonas que tienen ms de 10% de cubierta forestal (Schmitt et al. 2009), con base en el ndice de cobertura forestal continua generado a partir de imgenes MODIS con una resolucin de 500 m (Hansen et al. 2003). El objetivo es trabajar con las especies arbreas asociadas a los bosques nublados, otros tipos de bosques, como los estacionales han sido incluidos en la evaluacin porque la distribucin de algunas de ellas es independiente de las diferencias climticas. Los rboles se definen aqu como planta leosa con al menos 3 m, e incluyen palmas y helechos arborescentes. Para no duplicar el esfuerzo de las evaluaciones nacionales de la Lista Roja de los diferentes pases, el objetivo se enfoca en las especies que son compartidas por ms de un pas. Sin embargo, los detalles de las especies evaluadas a nivel nacional se tomarn en cuenta para la evaluacin regional y para el anlisis de los impactos del cambio climtico. Mtodos 1) Mediante un trabajo conjunto con expertos de los diferentes pases, se elabor una lista de especies candidatas mediante la consulta de diferentes bases de datos como Trpicos ((www.Tropicos.org), GBIF (www.gbif.org), herbarios y floras regionales y nacionales. 2) Los registrosde distribucin geogrfica de las especies de rboles que ocurren exclusivamente en la regin, son compartidas por ms de un pas y se encuentran principalmente por encima de los 1500 msnm fueron utilizados para producir mapas de distribucin para cada especie y aplicar los criterios de la UICN versin 3.1 (2001) para determinar el mximo nivel de amenaza. RESULTADOS PRELIMINARES Y TRABAJO FUTURO Una lista de 150 especies de rboles ha sido compilada y revisada, con la colaboracin de la red de expertos de la regin. Para cada especie se han obtenido mapas de distribucin junto con la estimacin del rea que ocupan en el rango donde han sido reportadas. De las 150 especies, la mayora se encuentran en Ecuador (105), seguido por Per (97), Bolivia (62), Colombia (58), Venezuela

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

(25) y Argentina (8). En la Figura 1 se presentan ejemplos de la distribucin de tres de las especies seleccionadas para el presente estudio. DISCUSIN Y CONCLUSIONES En la compleja terea recopilar informacin de especies de rboles para 6 pases y llevar a cabo una evaluacin, nos hemos enfrentado con una serie de limitaciones que tan solo empiezan con la simple definicin de rbol. El acceso a la informacin geo referenciada e las especies es fundamental para confirmar si cumplen con los

Figura 2. Ejemplo de tres de las especies seleccionadas con amplia distribucin y alta abundancia local (C. tomentosa) y amplia distribucin y baja abundancia local (P. microphylla y M. yarumalensis). criterios de seleccin (exclusivas de los andes, su principal presencia por encima de 1500 msnm, compartidas al menos por dos pases), pero esta informacin para muchas de las especies est llena de incertidumbres, relacionadas principalmente con la falta de inventarios y de estudios de ecologa de poblaciones en muchas regiones. De un nmero inicial de 3700 especies registradas para la regin, se seleccionaron 150 que cumplen con los criterios mencionados. No obstante, en algunas de estas especies se requiere un esfuerzo adicional para decidir finalmente si amerita o no su inclusin en los anlisis. Por ejemplo, Magnolia yarumalensis que es una especie que ha sido reportada como amenazada para Colombia (EN A2acd) ha sido reportada recientemente en Per en una poblacin disyunta a la de Colombia, y por ende ha sido incluida en la evaluacin regional; sin embargo, existen algunas dudas sobre la veracidad del reporte. Una vez identificadas las especies ms amenazadas a nivel regional, esta iniciativa

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

constituir una slida base para el desarrollo y enfoque de polticas y respuestas de manejo dirigidas a la reduccin de la deforestacin y la prdida de especies en estos bosques, incluyendo acciones para promover la creacin de reas de proteccin, restauracin forestal y manejo forestal sostenible. Se debe adems hacer nfasis en la necesidad de implementar polticas de manejo del territorio enfocadas en la conservacin de la biodiversidad en paisajes rurales productivos. BIBLIOGRAFA Akcakaya, H. R., Butchart, S. H. M., Mace, G. M., Stuart, S. N., y Hilton-Taylor, C., 2006. Use y misuse of the IUCN red list criteria in projecting climate change impacts on biodiversity. Global Change Biology, 12, 2037-2043. Bush, M. B., Hanselman, J. A., y Hooghiemstra, H., 2007. Andean montane forests and climate change. En: Bush, M. B., y Flenley, J. eds. Tropical rainforest response to climatic change. Berlin, Heidelberg, Germany: Springer,59-79. Bubb, P., May, I., Miles, L., y Sayer, J., 2004. Cloud forest agenda. Cambridge, UK: UNEP-WCMC. Hansen, M. C., Defries, R. S., Townshend, J. R. G., Carroll, M., Dimiceli, C., y Sohlberg, R. A., 2003. Global percent tree cover at a spatial resolution of 500 meters: First results of the MODIS vegetation continuous fields algorithm. EarthInteractions, 7 (10), 1-15. Josse, C., Cuesta, F., Navarro, G., Barrena, V., Cabrera, E., Chacn- Moreno, E., Ferreira, W., Peralvo, M., Saito, J., y Tovar, A., 2009. Ecosistemas de los andes del norte y centro. Bolivia, colombia, ecuador, per y venezuela. Lima, Peru: Secretara General de la Comunidad Andina, Programa Regional ECOBONA, CONDESAN-Proyecto Pramo Andino, Programa BioAndes, EcoCiencia, NatureServe, LTA-UNALM, IAvH, ICAE-ULA, CDC-UNALM, RUMBOL SRL. Newton, A., y Oldfield, S., 2008. Red listing the worlds tree species: A review of recent progress. Endangered Species Research, 6, 137-147. Olson, D. M., y Dinerstein, E. 1997.Global 200: Conserving the worlds distinctive ecoregions. USA: WWF-US. Schmitt, C. B., Burgess, N. D., Coad, L., Belokurov, A., Besanon, C., Boisrobert, L., Campbell, A., Fish, L., Gliddon, D., Humphries, K., Kapos, V., Loucks, C., Lysenko, I., Miles, L., Mills, C., Minnemeyer, S., Pistorius, T., Ravilious, C., Steininger, M., y Winkel, G., 2009b. Global analysis of the protection status of the world's forests.BiologicalConservation, 142 (10), 2122-2130.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Zamin, T. J., Baillie, J. E. M., Miller, R. M., Rodrguez, J. P., Ardid, A., y Collen, B., 2010. National red listing beyond the 2010 target.ConservationBiology, 24 (4), 1012-1020.

VERIFICACIN DE COBERTURAS Y CARACTERIZACIN FLORSTICA DEL MACIZO DE BIJAGUAL-BOYAC, COLOMBIA Pablo Andrs Gil Leguizamn1, Mara Eugenia Morales Puentes2. 1,2 Universidad Pedaggica y Tecnolgica de Colombia 1 pablo.gil@uptc.edu.co, 2maria.morales@uptc.edu.co RESUMEN Se caracteriz la flora de bosque altoandino y frailejonal-herbazal, fase de verificacin de coberturas vegetales para multitemporalidad en el Macizo de Bijagual (2900-3200 m). Se emple la metodologa de Rangel & Velzquez (1997) con transectos de 500m2. Se analiz la riqueza de familias y gneros, adems de identificar el estrato dominante, as como las familias y especies ms abundantes; tambin, se gener la distribucin de individuos a partir de la altura y DAP (intervalos), igualmente se determinaron 98 especies, en 60 gneros y 34 familias. Los taxa ms ricos fueron Asteraceae (6 gneros/13 especies), Ericaceae (5/9) y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Poaceae (4/6), y gneros como Pentacalia (5 especies), Miconia (4) y Oreopanax (4); no obstante, los taxones ms abundantes fueron Ericaceae (107 individuos/12.58%), Asteraceae (80/9.41%) y Poaceae (76/8.94%), y Blechnum auratum (60), Drimys granadensis (52) y Puya goudotiana (41) como las especies ms abundantes. El estrato dominante fue el herbceo (47.05%), seguido del arbustivo (21.41%), arbreo (15.41%), epfitas y bejucos. El 96.11% de los individuos presentan alturas <8.26 m y el 3.88%, alcanzan alturas de 16.5 m (Weinmannia rollottii, Clusia alata, Pentacalia vaccinioides). El 90.1% de los individuos presentan DAP <0.19 m y el 9.9% >0.19 m (Weinmannia rollottii, Clusia alata y Myrsine dependens). La diversidad por formacin vegetal en rango altitudinal, es mayor a bajas alturas y viceversa, la riqueza es superior a la evidenciada en otras reas naturales de la cordillera Oriental. La vegetacin pertenece a zonas transicionales de bosque altoandino y pramo, con alta intervencin (potrerizacin-ganadera). Palabras clave: diversidad. INTRODUCCIN Caracterizacin, flora, Macizo de Bijagual, Coberturas,

Las investigaciones sobre coberturas vegetales a nivel espacio-temporal, as como, los anlisis de composicin y estructura florstica, permiten identificar los actores que intervienen en los cambios del paisaje y como la vegetacin de un espacio natural ensu funcin ecosistmica, permite identificar el estado actual de la biodiversidad. Por lo anterior, es importante realizar anlisis florsticos y aplicar tcnicas que integren la medicin de la intervencin y sus consecuencias, que a su vez, permitan obtener un espectro visual de las condiciones actuales en reas con un amplio potencial biodiverso, como es el caso del Macizo de Bijagual, rea geogrfica que comprende los municipios de Viracacha, Cinega, Ramiriqu y Tibana (Boyac). Aunque Bijagual integre la red de pramos de Colombia, toda su extensin no es declarada Reserva Forestal Protectora. Bijagual, sus ecosistemas de pramo y bosque alto andino son vulnerables, dada la actividad de deforestancin y transformacin de sus suelos en agroecosistemas extensivos, dirigidos hacia sus reas altas. No obstante, se resalta que ste Macizo esta estratgicamente ubicado debido a que es una conectividad biolgica con la serrana de Mamapacha dentro del ramal Oriental de la cordillera Oriental, y por su extensin, es la principal y potencial zona de recarga hdrica, conformada por 18

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

microcuencas que abastecen a los municipios de Viracacha, Cinega, Ramiriqu y Tiban (PMA-Bijagual, 1996). Por lo anterior, este estudio busc realizar un anlisis de composcin florstica vascular del Macizo de Bijagual (municipio de Cienega, vereda San Vicente), como soporte incial de vereficacin e identificacin de coberturas, para la aplicacin de tcnicas de percepcin remota y clasificacin supervisada. Es as como se han realizado cinco transectos de vegetacin de 500 m 2 (cuatro en bosque secundario y uno en frailejonal-herbazal) para un total de 2500 m 2 (Rangel-Ch. & Velzquez, 1997) entre los 2900 y 3200 m de elevacin. Para cada unidad de rea se muestrearon los individuos encontrados, se registraron parmetros estructurales de altura, cobertura, dimetro a la altura del pecho (DAP para rboles) y rea basal (AB para arbustos) en cada uno de los individuos. La identificacin de los hbitos de crecimiento (rbol, arbusto, herbcea, bejuco, epfita, hemiepfita y rasante) se sigui a partir de las definiciones propuestas por Font-Quer(2001). De cada especie recolectada se tomaron tres muestras, la cuales han sidodepositadas enel Herbario UPTC de la Universidad Pedaggica y Tecnolgica de Colombia, para su procesamiento. La determinacin de las muestras botnicasse realiz por medio de claves ilustradas, floras y bases de datos (www.tropicos.org ywww.inpi.org) para la correcta escritura de los nombres cientficos. Finalmente, el material fue corroborado con las colecciones y los especialistas de diferentes instituciones y Herbarios, como COL, HECASA, HUA, UPTC, entre otros. Los ejemplares muestreados se depositaron en el Herbario UPTC, bajo la numeracin de Gil-Leguizamn, P.A. Con los parmetros estructurales tomados y la determinacin de muestras botnicas, se realizaron tablas de riqueza para familia y gneros por cada unidad muestreada. Se identific el total de individuos pertenecientes a una determinada familia y/o gnero, para todas las reas de muestreo. El estrato dominante se identific a partir de tablas de abundancias y de porcentaje por hbito de crecimiento, basado en la cobertura y el nmero de individuos por estrato.Se identific la distribucin de individuos a partir de la obtencin de intervalos de clases para la altura y el dimetro a la altura del pecho (inclusin de individuos con DAP 2.5 cm) (Rangel-Ch. & Velzquez, 2007): C=(Xmax - Xmin)/M ; M=1+(3.3*(log n)) n: nmero total de individuos; M: nmero de intervalos; C: amplitud de clase; X: parmetro estructural a analizar (altura y DAP) en metros.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESULTADOS Y DISCUSIN Para las cinco unidades muestreadas se identificaron 98 especiesincluidas en 60 gneros y 34 familias. El 64.7% (22) de las familias son dicotiledneas, el 14.7% (5) monocotiledneas y el 20.58% (7) pteridofitos. La riqueza de familias esta definida por Asteraceae (6 gneros/13 especies), Ericaceae (5/9), Poaceae (4/6), Bromeliaceae (4/5),Orchidaceae (3/10), Melastomataceae (3/6), Rubiaceae (3/3), Polypodiaceae (2/4), Piperaceae y Myrsinaceae con dos gneros y dos especies respectivamente. Los gneros con mayor riqueza son Pentacalia(5 especies), Miconia (4), Oreopanax (4), Diplostephium(3), Gaultheria(3), Weinmannia(3), Chusquea(3), Polypodium(3), Bomarea(2) y Anthurium (2). De los transectos realizados en bosque secundario, el transecto uno present mayor riqueza de gneros y especies (35/46), y el transecto cinco present el menor riqueza taxonmica (26/28). La unidad vegetal de tipo frailejonal-herbazal, present 11 familias 17 gneros 17 especies. Las familias ms abundantes son Ericaceae (107 individuos/12.58%), Asteraceae (80/9.41%), Poaceae (76/8.94%), Bromeliaceae (69/8.11%) e Hypericaceae (62/7.29%). Las especies ms abundantes son Blechnumauratum (60), Drimysgranadensis (52), Puya goudotiana (41) y Elaphoglosum sp1 (37). Las especies ms abundantes por transecto son: en el transecto uno (1) Blechnumauratum (44 individuos) e Hypericum sp2 (32); el transecto dos Drimysgranadensis (22) y Weinmanniacf. rollottii (15); el transecto tres Elaphoglosumsp1 (25) y Chusqueascandens (17); en el transecto cuatro Puya goudotiana (28) y Pernettya sp. (22) y el transecto cinco Disterigma aff. Micranthum (16) y Weinnmannia sp. (8). La estratificacin est dominada por elementos de tipo herbceo (47.05%), 182 arbustos (21.41%), 131 rboles (15.41%), 117 epfitas (13.76%), 13 bejucos (1.52%) y especies de Galiumhypocarpium y Nerteragranadensis como rasantes.El 96.11% de los individuos presentan alturas inferiores a 8.26 m y solo el 3.88% alcanzan alturas mximas de 16.5m, como es el caso de Weinmannia cf. rollottii, Clusia cf. alata, Pentacalia vaccinioides, Oreopanaxaff. Lancifolium y Clusiaelliptica. El 90.1% de los individuos tienen un DAP inferior a 0.19 m y el 9.9% presentan dimetros mayores a 0.19 m, como es el caso de Weinmannia cf. rollottii, Clusia cf. alata y Myrsinedependens.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

La composicin florstica en los diferentes tipos de vegetacin estudiados son el producto de cambios ocasionados por el hombre (potrerizacin y entresaca) (Cortes et al., 1999; Crawley, 1997), proceso que ocasiona la variacin en la composicin de especies para cada unidad de muestreo. La diversidad identificada guarda igual patrn de distribucin altitudinal (Galindo et al., 2003;Marn-Corba & Betancur, 1997; Gentry, 1995; Van der Hammen, 1974),con un menor nmero de especies y gneros en frailejonal-herbazal, con respecto a bosque secundario (92/61). Las especies Bucquetia glutinosa, Hypericum sp2. Tibouchinagrossa, Chusquea sp1, Hedyosmun sp1, Weinmannia sp., Gaultheria erecta, Cortaderia ntida, Pernettya sp3 y Blechnumauratum son comunes a los dos tipos de vegetacin caracterizados, tpicos de zonas transicionales entre bosques altoandinos y pramos; no obstante, B. auratum es considerada una especie pionera en zonas con sucesin temprana (Rangel-Ch. & Velazquez, 1997). El incluir especies con DAP inferior a 2.5 cm se evidencio en un aumento de la riqueza de especies, dentro de ellas, Diplostephium juajibioyi, D. phylicoides y Ageratinatinifolia, Pernettyaprostrata y Miconiacleefii, as como, algunas poceas.Estas especies son consideradas de til importancia en restauracin natural por sus caractersticas reproductivas y pioneras en procesos de colonizacin (Corpochivor, 2008; Vargas-Ros, 2008; Vargas, 2002;Mendoza & Ramrez, 2000). Aunque se identifique gran impacto ambiental sobre las formaciones vegetales estudiadas, ste trabajo es representativo en riqueza de unidades taxonmicas (34 familias, 60 gneros, 98 especies) comparado con los realizados en el SFF Guanent (24/35/49 a 3000m y 23/36/45 a 3100m), SFF de Iguaque (27/34/53), Sabana Rusia-Cesar (32/51/2900m), Cantera Soratama-Cundinamarca (30/37/44), para Colombia y P.N. Podocarpus (23/44/55 entre 2850-3190m) en Ecuador, con alturas e intervenciones similares a las evidenciadas en ste estudio. Este trabajo hace parte del proyecto biodiversidad y objetos de conservacin de los ecosistemas estratgicos de Sucuncuca y Bijagual (provincia de Lengup) Boyac, convenio Ecopetrol-Uptc, as como de la tesis de maestra de PA GilLeguizamn. BIBLIOGRAFA

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CORPOCHIVOR. 2008. Complementacin y actualizacin del estudio sobre el estado actual del rea de pramos en los sectores de Bijagual, Mamapacha, Cristales y Castillejo, en la Jurisdiccin de Corpochivor y formular un plan ambiental para dichas reas. Pramo de Bijagual. Santaf de Bogot. CORTES, S. P.; VAN DER HAMMEN, T. & RANGEL-CH., O. 1999. Comunidades vegetales y patrones de degradacin y sucesin en la vegetacin de los cerros accidentales de Chia-Cundinamarca-Colombia. Revista Acadmica Colombiana de Ciencias Exactas, 23(89):529-554. CRAWLEY, M. 1997. Plant ecology.Second edition. United States, Blackwell Publishing. FONT-QUER, P. 2001. Diccionario de botnica. Segunda Edicin. Ediciones Pennsula. Barcelona, Espaa. GALINDO, R., BETANCUR, J. & CADENA, J. 2003. Estructura y composicin florstica de cuatro bosques andinos del Santuario de Flora y Fauna Guanent-Alto Ro Fonce, Cordillera Oriental Colombiana, Caldasia25(2): 313-335. GENTRY, A. 1995.Patterns of diversity and floristic composition in Neotropicalmontaneforest.En: Churchill, S.; Balslev, H.; Forero, E. &Luteyn, J. (Ed.).Biodiversity and conservation of Neotropicalmontaneforest. The New York Botanical Garden, Bronx, pp. 103-126. MARN-CORBA, C.& BETANCUR, J. 1997. Estudio florstico en un robledal del Santuario de Flora y Fauna de Iguaque Boyac, Colombia. Revista Acadmica Colombiana de Ciencias Exactas, 21(80):249-259. MENDOZA, H. & RAMIREZ, B. 2000. Plantas con flores de la Planada. Gua ilustrada de familias y gneros. Fundacin FES Social, Instituto de Recursos Biolgicos Alexander von Humboldt, WWF. RANGEL-CH., O. & VELZQUEZ, A. 1997. Mtodos de estudio de la Vegetacin.En: Rangel-Ch., O; Lowy, P. D. & Aguilar, M. (Ed.).Colombia diversidad bitica II: Tipos de vegetacin en Colombia. Universidad Nacional de Colombia, Facultad de Ciencias, Instituto de Ciencias Naturales. Bogot, Editorial Guadalupe Ltda. pp. 59-87. PLAN DE MANEJO AMBIENTAL (PMA) DEL PRAMO DE BIJAGUAL. 1996. Unin Temporal SIMA LTDA. CORPOCHIVOR-CORPOBOYAC. VAN DER HAMMEN, T. 1974. The Pleistocene changes of vegetation and climate in tropical South America, Journal of Biogeography 8(1):3-26. VARGAS, William. 2002. Gua ilustrada de las plantas de las montaas del Quindo y los Andes centrales. Corporacin Autnoma Regional del Quindo, Manizales, Colombia, Editorial Universidad de Caldas. VARGAS-ROS, O. 2008. Estrategias para la restauracin ecolgica del Bosque Altoandino: El caso de la Reserva Forestal Municipal de Cogua, Cundinamarca,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Bogot, Universidad Nacional de Colombia, Facultad de Ciencias.

BROMELIACEAE EN BOYAC Y CASANARE, COLOMBIA Viviana Maritza Alvarado-Fajardo1, Mara Eugenia Morales-Puentes2 Herbario UPTC, Grupo de investigacin en Sistemtica Biolgica (SisBio), Universidad Pedaggica y Tecnolgica de Colombia. 1 vivis.alvarado@gmail.com, 2maria.morales@uptc.edu.co RESUMEN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Se realiz un estudio de la familia Bromeliaceae en algunos municipios de los departamentos de Boyac y Casanare, en un rango altitudinal de 500-3000 m. Se registraron 308 individuos de Bromeliaceae distribuidos en 38 especies, de los cuales cinco especies pertenecen a los gneros Aechmea y Greigia de la subfamilia Bromelioideae, y cuatro especies de la subfamilia Pitcairnioideae distribuidos en los gneros Pitcairnia y Puya, y la subfamilia Tillandsioideae con 29 especies, con la mayor riqueza, distribuida en los gneros Tillandsia, Guzmania, Racinaea y Vriesea. Las especies ms abundantes fueron Guzmania patula (32%), Puya sp. (10%), Pitcairnia maidifolia y Guzmania triangularis, cada una de las anteriores con el 6%, las cuales en conjunto, ocupan el 54% de la abundancia total. Los ndices de diversidad (Simpson y Shannon-Wiener) y riqueza (Margalef) utilizados, muestran que el rango altitudinal donde se registra ms diversidad de estas plantas es entre los 2500 y 3000 m, debido probablemente a que la vegetacin de las reas muestreadas son menos homogneas (fragmentos de bosque altoandino) y corresponden a bosques secundarios que presenta diferentes niveles de estratificacin de la vegetacin (hierba, arbusto y rbol). Palabras clave: Boyac, Bromeliaceae, Casanare, diversidad. INTRODUCCIN Objetivo. Conocer la diversidad y distribucin de las especies de la familia Bromeliaceae, a lo largo del gradiente altitudinal en los departamentos de Boyac y Casanare, Colombia.

MATERIALES Y MTODOS. El estudio se realiz en los municipios de Miraflores, Pez, Ramiriqu, San Luis de Gaceno y Zetaquir en el departamento de Boyac y en Sabanalarga y Monterrey en Casanare, en un rango altitudinal desde los 500 hasta los 3000 m. Se identificaron diferentes zonas de vida (Holdridge, 1967), entre las que se encuentran Bosque muy Hmedo Tropical (bmh-T), Bosque muy hmedo premontano (bmh-pm), Bosque muy Hmedo Tropical (bmh-T), entre otros. A su vez, las coberturas vegetales predominantes en el rea de estudio, los cuales son bosque secundario, zona de transicin y bosque alto andino achaparrado.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

El muestreo comprendi la recoleccin de bromelias (terrestres y epfitas); se registr informacin de todos los individuos presentes dentro de cada transecto, as como, los rboles (forfitos) que sirven de soporte para las especies de bromelias epfitas; adicionalmente, se tomaron datos de localidad (municipio, vereda, sector, coordenadas, altitud) y se hizo la descripcin de la vegetacin presente, se seleccionaron los mejores individuos por especie, preferiblemente que presentaran flor y/o fruto, debido a su importancia al momento de la determinacin. Las muestras recolectadas fueron llevadas al Herbario de la UPTC, para proceder a su secado, etiquetado, determinacin y montaje. Este material se deposit en la coleccin del Herbario UPTC con duplicados en FMB. Para la determinacin se utilizaron claves taxonmicas para bromelias de Flora Neotropica (Smith & Downs, 1974, 1977, 1979), Flora Mesoamericana (Utley et al, 1994), Flora de Nicaragua (Utley et al, 2001), entre otros. Se revisaron las colecciones de referencia de Bromeliaceae presentes en el Herbario de la Universidad Pedaggica y Tecnolgica de Colombia (UPTC). A su vez, se corrobor con especialistas y mediante comparacin de ejemplares de los Herbarios FMB y COL. La informacin registrada en cada una de las salidas de campo, fue sometida a clculos estadsticos para estimar por rango altitudinal la diversidad, distribucin, riqueza (ndices de Margalef, Shannon & Wiener, Simpson). Los anteriores anlisis, se llevaron a cabo con soporte del software PAST (Hammer et al, 2001).

RESULTADOS Y DISCUSIN. Se registraron 308 individuos de la familia Bromeliaceae, distribuidos en nueve gneros y 38 especies, de los cuales 29 especies pertenecen a los gneros Guzmania, Racinaea, Tillandsia y Vriesea, que corresponden a la subfamilia Tillandsioideae y representa la mayor riqueza; cinco especies pertenecen a los gneros Aechmea y Greigia de la subfamilia Bromelioideae y cuatro especies pertenecen a los gneros Pitcairnia y Puya de la subfamilia Pitcairnioideae.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Las especies ms abundantes fueron Guzmania patula con 100 individuos (32% de la abundancia total), seguido de Puya sp1 (30/10%), Pitcairnia maidifolia (15/6%) y Guzmania triangularis (15/6%). Las especies anteriormente mencionadas, fueron recolectadas en parches de bosques secundarios que permiten (condiciones de humedad y clima) una alta productividad y diversidad de los mismos; es importante resaltar, que los ejemplares encontrados son de amplia distribucin en Colombia, ya que pueden ser encontrados desde los 1500 hasta los 2500 m (Betancur & Jaramillo, 1998). Los ndices de dominancia (Simpson), equidad (Shannon-Wiener) y de riqueza especfica (Margalef) muestran que el rango altitudinal donde se registr la mayor diversidad de especies est entre los 2500 y 3000 m. El tipo de cobertura vegetal que predomina en este rango altitudinal corresponde a bosque secundario, donde se observ una gran cantidad de flora no vascular (brifitos y lquenes) adherida a los troncos de rboles y arbustos. Los hbitos de crecimiento predominante fueron los rboles con alturas entre los 8 y 15 m, con amplias coberturas que permiti una baja incidencia de luz (20%) al interior del bosque, lo que gener un ambiente hmedo, el cual favorece el mayor desarrollo de las bromelias. ndice de Simpson. Al hallar el ndice de dominancia se observ en la mayora de los municipios valores cercanos a uno (1), donde hay especies dominantes, como Racinaea subalata y Tillandsia complanata, taxones que poseen una amplia distribucin en bosques nublados de los Andes, se distribuyen desde Venezuela hasta Bolivia y predominan en ambientes perturbados como bosques que han tenido algn tipo de intervencin y generalmente est asociada a claros que permiten mayor ingreso de radiacin solar (Oliva & Steyermark, 1987), mientras que en el ndice no supero un valor de 0.057 en Sabana Larga.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ndice de Shannon. Se encontr que el rango altitudinal de 2500 a 3000 m present el valor ms alto, con 2.5, seguido del rango de 2000 a 2500 m (2.3); lo anterior, indica que ambas zonas muestran especies con una distribucin ms uniforme de los individuos, por lo cual se puede decir, que la vegetacin de estas zonas es ms homognea. Contrario a lo que ocurre en el rango altitudinal de 1000 a 1500 m, el cual, present el valor ms bajo (0.16) que indica la poca uniformidad de la vegetacin dentro de los transectos, en parte porque, se realiz dentro de una matriz de vegetacin altamente intervenida (pastizales abiertos con presencia de algunos pequeos matorrales). En general, los valores de uniformidad de los valores de importancia son intermedios, teniendo en cuenta, que oscilan entre 1.2 y 2.5, lo que evidencia que la mayora de los transectos mantienen una alta diversidad. Distribucin de las especies por formaciones vegetales Formacin bosque secundario. La riqueza de especies encontrada en este tipo de formacin vegetal es alta, debido a las condiciones climticas de humedad, luminosidad y temperatura, generadas a partir del crecimiento de rboles de gran porte y forma de la copa del rbol. Generalmente los bosques secundarios presentes en el pas son fruto de una sucesin ecolgica de muchos aos, luego de procesos de disturbio de tamao intermedio y grande, debido a causas naturales o procesos humanos (Mrquez, 2003). Las especies con mayor abundancia son Pitcairnia kalbreyeri, P. maidifolia y Guzmania triangularis, las cuales, tienen una amplia distribucin en el pas, especialmente en el costado oriental de la cordillera Oriental y crece en bosques hmedos a veces perturbados, entre los 240 y 2200 m. Formacin rastrojo bajo. La riqueza de especies de esta formacin vegetal, en contraste con la formacin de bosque secundario presenta un nmero de bromelias menor. Las especies ms representativas en esta formacin son Tillandsia complanata, T. turneri y Puya sp. Las formaciones vegetales de rastrojos, constituyen ecosistemas de transicin y de sucesin ecolgica, donde confluye vegetacin herbcea, arbustiva remanente y rboles emergentes dispersos, adems del encuentro de especies de borde de bosque y pioneras de pradera. Son localizadas la mayora de veces en zonas aledaas a bosques con entresaca (tala) y en tierras donde ocurre un proceso de recuperacin luego de intervencin por agricultura y ganadera.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Formacin rastrojo alto. En la formacin rastrojo alto se registraron cuatro especies de bromelias con una abundancia de 22 individuos; la especie ms abundante fue Guzmania cf. glomerata (15 individuos). La diversidad de forfitos y epfitas es alta a diferencia de rastrojos bajos. Los rastrojos altos se caracterizan por una vegetacin secundaria de tipo arbreo, que supera los 5 m, con una cobertura densa, lo que ha propiciado el crecimiento de la vegetacin de bromelias; adems, el nmero de ramas y el aumento de dimetro permite un mayor establecimiento de estas plantas. CONCLUSIONES Se registraron 38 especies (308 individuos), en nueve gneros; las especies ms abundantes fueron Guzmania patula con 100 individuos (32% de la abundancia total), seguido de Puya sp1 (30 /10%), Pitcairnia maidifolia (15/6%) y Guzmania triangularis (15/6%), especies frecuentemente encontradas. El rango altitudinal ms diverso est entre 2500-3000 m, dominado por las especies de Puya sp. (30 individuos, 34%), seguida por Tillandsia turneri (13 individuos, 15%), T. complanata (8 individuos, 9%) y Greigia stenolepis (7 individuos, 8%).

BIBLIOGRAFA Betancur, J. & M. A. Jaramillo. 1998. Distribucin de la familia Bromeliaceae en dos vertientes andinas del sur de Colombia. Selbyana, 19(1): 52-65. Hammer, ., D. A. T., Harper & P. D. Ryan. 2001. PAST: Paleontological statistics software package for education and data analysis. Palaeontologa Electrnica, 4(1): 9 pp. Holdridge, L. R. 1967. Life zone ecology. Tropical Science Center San Jos. Costa Rica. 206 pp. Mrquez, G. 2003. Ecosistemas estratgicos de Colombia. Boletn de la Sociedad Geogrfica de Colombia, 46(135): 87-103. Oliva, F. & J. Steyermark. 1987. Las bromelias de Venezuela. Nativas y cultivadas. Ed. Armitano. Caracas, Venezuela. 398 pp. Smith, L. B. & W. J. Downs. 1974. Pitcairniodeae, Bromeliaceae. Flora Neotropica Monograph, 14(1): 1-658.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Smith, L. B. & W. J. Downs. 1977. Tillandsiodeae, Bromeliaceae. Flora Neotropica Monograph, 14 (2): 659-1942. Smith, L. B. & W. J. Downs. 1979. Bromeliodeae, Bromeliaceae. Flora Neotropica, Monografa 14 (3): 1767-1953. Utley, J. F. & K. Burt-Utley. 1994. Bromeliaceae. Pp.: 89-156. En: G. Davidse, M. Sousa S. & A. O. Charter (Eds). Flora Mesoamericana. Volumen 6. Alismataceae a Cyperaceae Universidad Nacional Autnoma de Mxico, Missouri Botanical Garden y The Natural History Museum. Utley, J. F. & K. Burt-Utley. 2001. Bromeliaceae. En: Steven, W. D., C. Ulloa Ulloa, A. Pool & O. M. Montiel (Eds). Flora de Nicaragua. Introduccin Gimnospermas y Angiospermas (Acanthaceae-Euphorbiaceae). Monograph Systematic Botany Missouri Botanical Garden, 85(1): 460-495.

BRIFITOS Y LQUENES DE RAMIRIQU (BOYAC): DIVERSIDAD GENRICA Y ESTRATEGIAS ADAPTATIVAS

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Merly Yenedith Carillo Fajardo1, Jorge Enrique Gil Novoa 2, Mara Eugenia MoralesPuentes3 Grupo Sistemtica Biolgica-SisBio, Herbario UPTC, Escuela de Biologa, Universidad Pedaggica y Tecnolgica de Colombia. 1 2 merlycarrillofajardo@gmail.com, jorge.gil@uptc.edu.co, 3 maria.morales@uptc.edu.co RESUMEN Se estudi la diversidad genrica de plantas no vasculares y hongos liquenizados en fragmentos de bosque altoandino y pramo del municipio de Ramiriqu, en transectos de 100 m, sobre forfitos estratificados en cinco niveles (base del rbol, tronco y corona interna, media y externa) en bosque y en diferentes tipos de sustratos paramunos (plantas, suelo y materia orgnica). Las coberturas se estimaron mediante cuadrcula de acetato de 400 cm2. Se registraron 198 hepticas, 103 musgos, cinco antoceros y 34 lquenes, en 46 familias y 71 gneros. Las familias ms diversas fueron Dicranaceae (7 gneros), Lejeuneaceae (5) y Lepidoziaceae, Parmeliaceae y Pottiaceae (4). En el bosque, las epfitas dominaron en tronco y base sobre forfitos de Weinmannia rollottii. El 31% de los gneros se encontraron nicamente en bosque, el 33.8% en pramo y el 35.32% en ambos ecosistemas. En los gneros paramunos, se observan adaptaciones celulares, anatmicas y morfolgicas que les permiten soportar altos niveles de intensidad lumnica, prdida de humedad y fuertes vientos: los musgos, presentan variaciones en la pared y el color de las clulas, hojas lanceoladas y crecimiento acrocrpico; las hepticas, clulas ms gruesas con variaciones de coloracin; y en los lquenes, predominan formas de crecimiento foliosa y costrosa. Las hepticas y lquenes del bosque, presentan estructuras ms delicadas y formas de crecimiento reptantes. La flora no vascular y los hongos liquenizados a nivel genrico en bosques altoandinos de Ramiriqu, constituyen el 21% de hepticas, 14% de musgos, 25% de antoceros y 4% de los lquenes presentes en Colombia. Palabras claves: brifitos, diversidad, estrategias adaptativas, lquenes, Ramiriqu.

INTRODUCCIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Identificar la diversidad genrica de brifitos y lquenes en dos ecosistemas (bosque y pramo) del municipio de Ramiriqu (Boyac) y establecer las adaptaciones morfolgicas que presentan stas plantas. MATERIALES Y MTODOS rea de estudio. Se realiz en jurisdiccin del municipio de Ramiriqu, ubicado en el departamento de Boyac, dentro del sistema montaoso denominado Macizo de Bijagual en alturas entre 2990 y 3235 m. En el bosque alto andino se establecieron tres transectos de 100 m, en los que se escogieron cuatro rboles maduros (Gradstein, et al. 1996; 2003), de tal manera que permitieran el asenso a dosel, mediante tcnica de escalada simple (Perry, 1978) y que se evitara la inspeccin de rboles vecinos (Gradstein, 1996; 2003; Wolf, 1993). Para efecto de la recolecta del material, las estimaciones de la biodiversidad y patrones de distribucin espacial, cada rbol (forofito) se dividi en cinco niveles (base de rbol, tronco, dosel interno, dosel medio y dosel externo) (Johansson, 1974; Zotz, 2007). En el pramo, igualmente se delimitaron tres transectos de 100 m y se muestrearon todos los tipos de sustratos ubicados en recorrido de la cuerda (Pinzn & Linares, 2006). Adicionalmente, se realiz un transecto en ecotono, el cual se demarco con 50 m de bosque y 50 m de pramo. Las estimaciones de cobertura se calcularon mediante una cuadricula de acetato de 400 cm2. La determinacin del material se llev a cabo en el Herbario UPTC, mediante la utilizacin de claves especializadas y la revisin con material de referencia, as como la consulta con especialistas. RESULTADOS. Se recolectaron en total 340 ejemplares, distribuidos de la siguiente manera: 198 hepticas, 103 musgos, cinco (5) antoceros y 34 lquenes; a su vez, se clasificaron en 46 familias y 71 gneros. Las familias ms diversas fueron Dicranaceae (7 gneros), Lejeuneaceae (5) y Lepidoziaceae, Parmeliaceae y Pottiaceae (4 gneros cada uno). Bosque altoandino: En esta formacin vegetal, se recolectaron 211 muestras, en los cinco estratos. Teniendo en cuenta esta clasificacin, los brifitos y los lquenes se distribuyeron de la siguiente manera: Base de rbol: se registran 62 ejemplares, de los cuales 50 son hepticas (9

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

familias/11 gneros), 11 musgos (4/6) y un lquen. Plagiochilaceae (19 ejemplares), Lepidoziaceae (12), Dicranaceae (8), y Trichocoleaceae (7) se destacan como las familias con mayor riqueza, en tanto que a nivel genrico, Plagiochila (19), Trichocolea (7), Herbertus, Campylopus y Lepidozia (5 cada uno), son los que presentan los valores ms altos de riqueza. Tronco de rbol: en este estrato se recolectaron 72 ejemplares, 54 de ellos son hepticas (12 familias/14 gneros), 15 musgos (6/9) y tres lquenes (1/3). La riqueza a nivel de familias est dada por Plagiochilaceae (17), Herbertaceae (10), Trichocoleaceae y Dicranaceae (6); en cuanto a los gneros, se destacanPlagiochila (17), Herbertus (10), Trichocolea (6) y Radula (5). Dosel interno: este estrato es el que presenta mayor riqueza en el dosel, con 31 registros, divididos en 19 hepticas (5 familias/6 gneros), ocho musgos (5/6) y cuatro lquenes (1/3). Se destacan familias Plagiochilaceae (9 gneros), Jubulaceae (4), Parmeliaceae (4), Lepidoziaceae y Pottiaceae (3). A s mismo, los gneros Plagiochila (9), Frullania (4) y Bazzania (3), son los mejor representados. Dosel medio: 22 ejemplares, distribuidos en 12 hepticas (7 familias/7 gneros), cuatro musgos (3/3) y seis lquenes (2/3); condicin que indica una menor riqueza genrica. Las familias Parmeliaceae y Plagiochilaceae fueron las ms diversas con cinco y cuatro gneros respectivamente. As mismo, los gneros Plagiochila (4) e Hypotrachyna (3) muestran los mayores valores de riqueza. Dosel externo: En este nivel se recolectaron 24 ejemplares, distribuidos en 14 hepticas (6 familias/4 gneros), seis musgos (4/4) y cuatro lquenes (2/3). Las familias Lejeuneaceae (5 gneros), Jubulaceae y Parmeliaceae (4) con la mayor riqueza, mientras que los gneros Frullania (4), Metzgeria, Hypotrachyna, Aptychella y Campylopus (2) presentan la mayor diversidad. Especificidad de gneros por estrato: Del total de gneros colectados (71), el 35.2%, mostr especificidad por alguno de los estratos, dez gneros, presentaron preferencia por el tronco, entre ellos: Kurzia, Noteroclada y Radula, y en el dosel medio slo dos gneros fueron especficos; as mismo, las hepticas tienen un mayor nmero de gneros por estrato (12), seguido de los musgos (11) y de los lquenes con dos (2) gneros.Preferencia de forfito: En los transectos se escogieron ocho gneros de plantas vasculares como hospederos para el estudio. Weinmannia rollottii es el forfito que alberga mayor nmero de ejemplares (76) y el mayor nmero de espeies (30).

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Pramo: Se recolectaron 129 ejemplares, distribuidos en 49 hepticas, 59 musgos, cinco antoceros y 16 lquenes. Epfitos: 103 muestras se encontraron sobre troncos, ramas u hojas de arbustos; 42 pertenecen a hepticas, 40 musgos, cinco antoceros y 16 lquenes. Dicranaceae (10 gneros), Pottiaceae (9), Jubulaceae (9) y Plagiochilaceae (6) fueron las familias con mayor riqueza, igual que los gneros Campylopus (10 registros), Frullania (9), Metzgeria y Plagiochila (5 cada uno). Terrcola: en el suelo, slo se colectaron hepticas (7 registros) y musgos (17), las familias con mayor riqueza fueron Sphagnaceae (8) y Dicranaceae (5). Gneros como Sphagnum (8) y Campylopus (4) presentaron los valores ms altos de riqueza; los dems gneros, presentaron entre uno (Breutelia y Jensenia) y dos registros (Monoclea y Rhodobryum). Materia orgnica: en este sustrato, se recolectaron muestras de dos gneros de musgos, Campylopus (Dicranacaeae) y Breutelia (Pottiaceae).

DISCUSIN Con relacin a la diversidad de las plantas no vasculares registradas para el pas, en el municipio de Ramiriqu se registran 28 gneros de hepticas que equivalen al 20,61% del total nacional (136 gneros) (Uribe & Gradstein, 1999); respecto a las familias ms diversas a nivel genrico se encuentran Lejeuneaceae con cinco y Lepidoziaceae (4). As mismo, se identificaron 30 gneros de musgos que constituyen el 14,02% del total para el pas (259 gneros) (Aguirre-C, 2008a); las familias mejor representadas son Dicranaceae (7 gneros) y Pottiaceae (4) ajustado a los datos registrados para Colombia. En el caso de los antoceros se presenta en el pas cuatro gneros en dos familias, y aqu se identific una familia con un gnero, es decir, el 25% inscrito en Colombia y el 4,07% (12 gneros) de los lquenes del pas (295 gneros) (Aguirre-C, 2008b). La familia ms diversa para este grupo es Parmeliaceae con cuatro gneros. Los resultados muestran que el pramo es el ecosistema que present mayor diversidad genrica, lo que contrasta con otras investigaciones, donde mencionan a los bosques alto andinos, como las zonas con mayor diversidad de plantas no vasculares (Aguirre-C, 2008c; Wolf, 1993; Churchill & Linares, 1995). La alta

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

diversidad en el pramo, se presume, que esta influenciada por la presencia de los gneros como Campylopus, Frullania y Breutelia, los cuales tienen un gran nmero de especies helifilas, condicin que les permite desarrollar adaptaciones morfolgicas para soportar ambientes extremos (Pinzn & Linares, 2006). Las plantas no vasculares del pramo de Bijagual (Ramiriqu) se distribuyeron de acuerdo a los diferentes sustratos presentes en el ecosistema; las hepticas y los musgos tuvieron mayor preferencia por los troncos y ramas y por las hojas, con relacin a los otros grupos (antoceros y lquenes); el suelo, igual que en el pramo de Mamapacha, es el sustrato que alberga mayor diversidad, en especial de musgos como Sphagnum y Campylopus (lvaro-A., et al. 2007). Este trabajo hace parte del proyecto biodiversidad y objetos de conservacin de los ecosistemas estratgicos de Sucuncuca y Bijagual (provincia de Lengup) Boyac, convenio Ecopetrol-Uptc, as como es apoya al trabajo de grado de D.A. Moreno. BIBLIOGRAFA LVARO-ALBA, W., M. DAZ-PITA,& M. MORALES-PUENTES. 2007. Catlogo comentado de las hepticas del Cerro de Mamapacha, municipio de ChinavitaBoyac, Colombia. Acta Biolgica Colombiana 12(1):67-86. AGUIRRE-C, J. 2008a. Diversidad y riqueza de los musgos en la regin natural andina o sistema cordillerano. pp. 19-54. En: RANGEL-CH, O. (Ed.). Colombia Diversidad Bitica VI: Riqueza y diversidad de los musgos y lquenes en Colombia, Bogot, Universidad Nacional de Colombia, Facultad de Ciencias, Instituto de Ciencias Naturales. AGUIRRE-C, J. 2008b. Diversidad y riqueza de los lquenes en la regin natural andina o sistema cordillerano. pp. 337-382. En: RANGEL-CH, O. (Ed.). Colombia Diversidad Bitica VI: Riqueza y diversidad de los musgos y lquenes en Colombia. Bogot. Universidad Nacional de Colombia, Facultad de Ciencias, Instituto de Ciencias Naturales. AGUIRRE-C, J. 2008c. Diversidad y riqueza de musgos y lquenes en Colombia generalidades y metodologa. pp.1-17. En: RANGEL-CH, O. (Ed.). Colombia Diversidad Bitica VI: Riqueza y diversidad de los musgos y lquenes en Colombia, Bogot, Universidad Nacional de Colombia, Facultad de Ciencias, Instituto de Ciencias Naturales. CHURCHILL, S. & E. LINARES. 1995. ProdromusBryoloqiae Novo-Granatensis, Introduccin a la flora de musgos de Colombia, Partes 1 y 2, Bogot, Editorial

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Guadalupe Ltda. GRADSTEIN, R.,P. HIETZ, R. LCKING, A. LCKING, H. SIPMAN, H. VESTER, J. WOLF &E. GARDETTE. 1996. How to sample epiphytic diversity of tropical rain forest. Ecotropica 2:59-72. GRADSTEIN, R., N. NADKARNI, T. KRMER, I. HOLZ, &N. NZKE. 2003. A protocol for rapid and representative sampling of vascular and non-vascular epiphyte diversity of tropical rain forest. Selbyana 24(1):105-111. JOHANSSON, D. R. 1974. Ecology of vascular epiphytes in West African rain forest.ActaPhytogeographycaSueca 59:1-136. PERRY, D. 1978. A method of access into the crowns of emergent and canopy trees.Biotropica 10:155-157. PINZN, M.&E. LINARES. 2006. Diversidad de lquenes y brifitos en la regin subxeroftica de la Herrera, Mosquera (Cundinamarca-Colombia). I. Riqueza y estructura. Caldasia 28(2):243-257. URIBE, J. & S. R. GRADSTEIN. 1999. Estado del conocimiento de la flora de hepticas de Colombia. Revista de la Academia Colombiana de Ciencias Exactas, Fsicas y Naturales 23(87):315-318. WOLF, J. H. D. 1993. Diversity patterns and biomass of epiphytic bryophytes and lichens along an altitudinal gradient in the Northern Andes. Annals of Missouri Botanical Garden 80(4):928-960. ZOTZ, G. 2007. Johansson revisited: the spatial structure of epiphyte assemblages. Journal of Vegetation Science 18:123-130.

DIVERSIDAD DE ANGIOSPERMAS EN LAS ZONAS PARAMUNAS DE RAMIRIQU Y VIRACACH (BOYAC-COLOMBIA). Merly Yenedith Carillo Fajardo1, Mara Eugenia Morales Puentes2, Pablo Andrs Gil Leguizamn3, Andrea Liliana Simbaqueba4

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Grupo Sistemtica Biolgica-SisBio, Herbario UPTC, Escuela de Biologa, Universidad Pedaggica y Tecnolgica de Colombia. 1 2 merlycarrillofajardo@gmail.com, maria.morales@uptc.edu.co, 3 4 pablo_agl2@yahoo.es, alsimbaqueba@gmail.com. RESUMEN Las reas pramo de Ramiriqu y Viracach (Boyac), hacen parte del macizo de Bijagual, importante conector biolgico entre los ecosistemas paramunos del sur del departamento, y cuyo registro de su biodiversidad ha sido incipiente, lo que ha restringido la posibilidad de identificar especies objetos de conservacin para definir estrategias de proteccin frente a las presiones que ejercen las comunidades del rea de influencia. Se presentan avances de la caracterizacin de angiospermas, a partir de recolectas generales y 17 transectos de 100 m (2970 y 3300 m). Preliminarmente, la diversidad de estos pramos est conformada por 50 familias, 54 gneros y 76 especies. Asteraceae, Orchidaceae, Melastomataceae, Ericaceae y Poaceae, son las mejor representadas con 10 especies cada una, entre ellas: Espeletia boyacensis, E. argentea, E. cf. murilloi (Asteraceae); Epidendrum sp., Pleurothalis sp., Telipogon sp. (Orchidaceae); Bucquetia glutinosa, Miconia ligustrina, Monochaetum myrtoideum (Melastomataceae); Gaultheria erecta, Macleania rupestris, Pernettya prostrata (Ericaceae); Calamagrostis bogotensis, C. effusa y Chusquea tessellata (Poaceae). El grado de amenaza de los frailejones registrados es de preocupacin menor (LC), igual que las bromelias, Guzmania gloriosa, G. squarosa, Racinaea riocreuxii, R. tetrantha yTillandsia turneri; Puya goudotiana, se considera casi amenazada (NT); para stas y otras especies no categorizadas, se definir la condicin local, a partir de la distribucin geogrfica, grado de endemismos, rareza y nivel de afectacin de las principales presiones del rea (actividades agropecuarias); a partir de lo cual, se construir una estrategia que aporte al manejo para la conservacin de la biodiversidad del pramo de Bijagual. Palabras clave: angiospermas, Boyac, conservacin, diversidad, pramo. INTRODUCCIN Objetivo. Caracterizar preliminarmente la flora vascular (angiospermas) de las zonas de pramo de los municipios de Ramiriqu y Viracacha (pramo de Bijagual), y analizar su diversidad y grado de amenaza.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

MATERIALES Y MTODOS. A travs de cartografa bsica y verificacin en campo, se identificaron las coberturas vegetales y se seleccionaron las reas de muestreo teniendo en cuenta los tipos de vegetacin (Rangel & Velsquez, 1997), y el nivel de intervencin humana. Se realizaron seis salidas de campo, entre diciembre de 2011 y junio de 2012, en las que se realizaron salidas de reconocimiento y salidas de muestreo con la recoleccin de material vegetal (tres duplicados por muestra y preferiblemente en estado frtil) en 17 transectos de 100 m, ubicados sobre el ecosistema de pramo en un rango altitudinal entre 2970-3300 m; adems, se hicieron recolectas generales en las zonas aledaas; as mismo, se realizaron registros fotogrficos y descripciones de las caractersticas morfolgicas que podran perderse en el proceso de secado (color, olor, entre otras), los datos de localidad, georeferenciacin, nmero de coleccin, colectores, fecha, estado fenolgico y hbito de crecimiento. En la fase de laboratorio, adelantada en el Herbario UPTC, se siguen los protocolos de herborizacin; el proceso de determinacin se realiza mediante claves, descripciones, comparacin con ejemplares de coleccin en los Herbarios UPTC, COL y FMB, as como, a travs de consultas a especialistas. Para garantizar la preservacin del material vegetal, ste ser incluido en la coleccin de referencia de los Herbarios UPTC y COL. El anlisis de diversidad se realiza mediante la cuantificacin de la diversidad alfa, a partir de la riqueza a nivel de familia, gnero y especie (o morfoespecie) teniendo en cuenta los resultados del proyecto, el material de coleccin de los herbarios revisados y otros estudios comparables (Magurran, 1988; Murgia & Rojas, 2001). Para establecer el grado de amenaza de las especies, se tiene en cuenta la Resolucin 383/2010 del Ministerio de Ambiente, Vivienda y Desarrollo Territorial, los Libros Rojos de plantas de Colombia (basados en las categoras de la UICN); as como, la condicin local de las mismas, definida a partir de la distribucin geogrfica, grado de endemismos, rareza y nivel de intervencin observado en el momento de la recoleccin del material vegetal. Dicha informacin permitir construir una estrategia que aporte al manejo para la conservacin de la biodiversidad del pramo de Bijagual en los municipios de Ramiriqu y Viracach. RESULTADOS.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

La diversidad de angiospermas del pramo de Bijagual (municipios de Ramiriqu y Viracach), comprende 76 especies agrupadas en 54 gneros, y 50 familias, de las cuales, Asteraceae, Orchidaceae, Melastomataceae, Ericaceae y Poaceae, son las mejor representadas. Algunos de los registros son: Espeletia boyacensis, E. argentea, E. cf. murilloi, Diplostephium floribundum, Ageratina tinifolia y Pentacalia sp. (Asteraceae); Epidendrum sp., Pleurothalis sp. y Telipogon sp. (Orchidaceae); Bucquetia glutinosa, Miconia ligustrina y Monochaetum myrtoideum, Tibouchina grossa (Melastomataceae); Bejaria resinosa, Disterigma empetrifolium, Gaultheria erecta, Macleania rupestris, Pernettya prostrata (Ericaceae); Calamagrostis bogotensis, C. beffusa, Chusquea tessellata, Cortaderia sp. y Neurolepis sp. (Poaceae). Otras especies como Hypericum laricifolium (Hypericaceae), Juncus effusus (Juncaceae), Lachemilla aphanoides (Rosaceae), Arcytophyllum nitidum y Nertera granadensis (Rubiaceae). Con relacin al grado de amenaza, los frailejones, Espeletia boyacensis, E. argentea y E. cf. murilloi, se encuentran en categora de preocupacin menor (LC), igual que las bromelias Guzmania gloriosa, G. squarosa, Racinaea riocreuxii, R. tetrantha yTillandsia turneri y Puya goudotiana, cuyas poblaciones se estiman casi amenazadas (NT) (Caldern et al., 2006; Garca & Galeano, 2006). Se ha establecido como las principales presiones locales, la ganadera y la agricultura, afectando directamente la distribucin como se presenta a continuacin: en Ramiriqu se encontr que E. boyacensis y R. tetrantha son exclusivas de la vereda Chiguat, donde tambin est, R. riocreuxii en la vereda Guacamayas, junto con Guzmania gloriosa, G. squarosa y Tillandsia turneri; Puya goudotiana, fue ubicada en la vereda Escobal (Ramiriqu) y La Isla (Viracach), en la que se identificaron adems, E. argentea y E. cf. murilloi en la vereda Caros del mismo municipio.

DISCUSIN. Los resultados preliminares evidencian que la composicin de la flora vascular del pramo de Bijagual est representada por las familias ms diversificadas de los ecosistemas paramunos del pas y el Ecuador, es decir, Asteraceae, Orchidaceae, Poaceae, Melastomataceae y Bromeliaceae (Luteyn, 1999; Rangel, 2000; MenaVsconez, 2002); lo cual, se puede interpretar en primera instancia como un buen estado de conservacin del mismo; tambin, en los avances de la identificacin de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

especies amenazadas se registran principalmente frailejones y bromelias, pertenecientes a las familias Asteraceae y Bromeliaceae respectivamente, las cuales, ocupan el primer y tercer lugar en el listado nacional de las familias con mayor nmero de especies amenazadas de este ecosistema (Rangel, 2002); razn por la cual, la percepcin sobre dicho estado puede cambiar. Adicionalmente y segn las observaciones en campo, las principales presiones que generan riesgo para dichas especies, estn dadas por el desarrollo de actividades agropuecuarias realizadas por las comunidades asentadas en el macizo y su zona de influencia, lo cual, no solo genera fragmentacin de la flora paramuna, sino del bosque andino (Castao-Uribe, 2002); al revisar los antecedentes, se estableci que esta condicin est dada por tradicin cultural frente al uso del suelo, y los cambios ms notables en dichos ecosistemas se dieron en las dcadas de los setenta y noventa en los departamentos de Cundinamarca, Boyac, Santander, Cauca, Nario y sur del Tolima (IDEAM 2002), lo cual deja en evidencia el poco xito que ha tenido la gestin de las autoridades ambientales en la zona a lo largo del tiempo. CONCLUSIONES Para tener un panorama certero sobre el estado del pramo de Bijagual y plantear estrategias de manejo, es prioritario establecer cules son las especies que lo constituyen, dado que otras familias que han sido identificadas con alto riesgo de amenazada nacional (Ericaceae, Scrophulariacae, Orchidaceae y Poaceae) han sido registradas dentro de las mejor representadas para el rea de estudio. As mismo, es importante consolidar la informacin proveniente de estudios realizados en los otros municipios de la jurisdiccin de este pramo (Zetaquira, Rondn y Tibana), con el propsito de construir una estrategia cuya cobertura permita plantear e implementar acciones con enfoques integrales para proteger el macizo, el cual, ha sido considerado un importante conector de los ecosistemas alto andinos del sur del departamento, donde el registro de su biodiversidad se considera escaso y el deterioro avanza en contra de su conservacin, lo cual afecta a las comunidades que se benefician de su recurso hdrico (generacin de energa elctrica al 10% del pas) y reduce las posibilidades de conocer los paisajes nativos de la regin (Corpochivor, 2006; Ciri, 2002). Este trabajo hace parte del proyecto biodiversidad y objetos de conservacin d e los ecosistemas estratgicos de Sucuncuca y Bijagual (provincia de Lengup) Boyac, convenio Ecopetrol-Uptc, as como es apoya de las tesis de maestra de MY Carrillo y PA Gil.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

BIBLIOGRAFA Caldern E., Galeano G. & N. Garca (eds.). 2006. Libro rojo de plantas de Colombia. Volumen 2: Palmas, Frailejones y Samias. Serie Libros Rojos de Especies Amenazadas de Colombia. Bogot, Colombia. Instituto Alexander von Humboldt - Instituto de Ciencias Naturales de la Universidad Nacional de Colombia - Ministerios de Ambiente, Vivienda y Desarrollo territorial. 454 pp. Castao-Uribe, C. 2002. Aproximacin al efecto del Global Climatic Tensor en el Bioma Pramo. En: C. Jaramillo, C. Castao-Uribe, F. Arjona-Hincape, J.V. Rodrguez & C.L. Durn (Eds.). Memorias Congreso Mundial de Pramos Tomo I. Paipa, Boyac, pp. 21-45. Ciri, L.F. 2002. Investigacin, planificacin y desarrollo en zonas ecotursticas. Caso de estudio: Plan de desarrollo ecoturstico para la zona de los macizos de Mamapacha y Bijagual (Boyac), pp. 8. Corpochivor, 2006. El plan de ordenamiento y manejo de la cuenca del ro Aragoa -sntesis ambiental, pp. 10. Garca, N. & G. Galeano (eds.) 2006. Libro rojo de plantas de Colombia. Volumen 3: Las bromelias, las labiadas y las pasifloras. Serie Libros Rojos de Especies Amenazadas de Colombia. Bogot, Colombia. Instituto Alexander von Humboldt Instituto de Ciencias Naturales de la Universidad Nacional de Colombia Ministerios de Ambiente, Vivienda y Desarrollo territorial. IDEAM. 2002. Lnea base indicadores ambientales de suelos. Magurran, A.E. 1988. Diversidad ecolgica y su medicin. Ediciones Vedra. Barcelona. Mena-Vsconez, P. 2002. La biodiversidad de los pramos en el Ecuador. En: C. Jaramillo, C. Castao-Uribe, F. Arjona-Hincape, J.V. Rodrguez & C.L. Durn (Eds.). Memorias Congreso Mundial de Pramos Tomo I. Paipa, Boyac, pp. 496511. Murgia, M. & Rojas, E. 2001. Biogeografa cuantitativa. En: Llorente-Bousquets, J. & Morrone, J. 2001. Introduccin a la biogeografa en Latinoamrica: Teoras, conceptos, mtodos y aplicaciones (Eds.). Facultad de Ciencias, UNAM. Mxico, D.F., pp. 39-47. Luteyn, J.L. 1999. Paramos a checklist of plant diversity, geographical distribution, and botanical literature. Memoirs of the New York Botanical Garden 84:278 pp. Rangel-Ch., O. & Velsquez, A. 1997. Mtodos de estudio de la vegetacin. En: O. Rangel-Ch., P. Lowy-C. & M. Aguilar-C. (Eds.). Colombia diversidad bitica III. Tipos de vegetacin en Colombia, Editorial Guadalupe Ltda. Santaf de Bogot, D.C.- Colombia, pp. 59-87.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Rangel-Ch., J.O. (ed). 2000. Colombia, diversidad bitica III. La regin de vida paramuna. 902 pp. Universidad Nacional de Colombia. Facultad de Ciencias, Instituto de Ciencias Naturales. Bogot. Rangel-Ch., O. 2002. Biodiversidad en la regin del pramo con especial referencia a Colombia. En: C. Jaramillo, C. Castao-Uribe, F. Arjona-Hincape, J.V. Rodrguez, & C.L. Durn. (Eds.). Memorias Congreso Mundial de Pramos, Paipa, Boyac, I:168-200.

FLORA DE LOS PRAMOS DE ANTIOQUIA Fernando Alzate Guarn1, Oswaldo Daz Vasco2, Santiago Varela Velsquez3. Universidad de Antioquia. Instituto de 2 wodv13@yahoo.es, 3santifox14@gmail.com. RESUMEN El departamento de Antioquia cuenta con una extensin de 6`361.200 ha y dentro Biologa.
1

alzatef@gmail.com,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

de su jurisdiccin se reconocen 7 reas de pramo con un areal de 27.360 ha, lo cual representa el 0.43% de su superficie. Este proyecto pretende realizar el inventario de la diversidad de las plantas angiospermas encontradas en los principales pramos del departamento de Antioquia, generando una amplia divulgacin y la utilizacin esta informacin para definir prioridades de conservacin. Los inventarios realizados hasta el momento permiten cuantificar la diversidad plantas angiospermas en los pramos del departamento, en 535 taxones. El mayor nmero de registros de plantas se concentra en el rea correspondiente al pramo de Urrao-Frontino, cordillera Occidental, con un total de 388 especies. El pramo de Santa Ins, ubicado en la cordillera Central, cuenta con un total de 220 especies. Por su parte el complejo paramuno de Paramillo ubicado al norte de la cordillera Occidental y con un rea de 1550 ha, cuenta con registros de 106 especies. El pramo de Sonsn registra un total de 160 especies. Las pequeas unidades de pramo ubicadas en Medelln, conocidas como Padre Amaya, Las Baldas y San Flix, cuentan con 204 especies. Palabras clave: Pramos, Antioquia, diversidad, conservacin. INTRODUCCIN El departamento de Antioquia cuenta con 7 reas de pramo, distribuidas en las cordilleras Central y Occidental, estas reas ascienden a 27.360 ha.

Pramo Paramillo Complejo Santa Ins Frontino-Urrao Citara San Flix Padre Amaya Sonsn Total

Jurisdiccin rea (ha) Dabeiba, Ituango, Peque 1.550 Belmira, Entrerrios, Santa Rosa, San 11.000 Jos de la montaa, Liborina Caicedo, Salgar, Urrao, Frontino 3.950 Andes, Betania, Ciudad Bolvar 2030 Bello 50 Medelln 50 Sonsn 10 27.630

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Tabla 1. Listado de los pramos de Antioquia, discriminando extensin y jurisdiccin municipal. La formacin vegetal pramo contiene una diversidad vegetal estimada por Luteyn (1999) y Rangel (2000) en 4700 especies distribuidas en 124 familias y 644 gneros, con una alta tasa de endemicidad a nivel de especies. Un alto porcentaje de esta diversidad presenta una alta vulnerabilidad, ya que para el caso de Colombia, solo el 33% de las reas de pramo se encuentran protegidas dentro del sistema de parques nacionales. La exploracin botnica de los pramos en el departamento de Antioquia se inicio hacia 1923 por el botnico estadounidense Francis Pennell (Pennell, 1943), reanudada por exploradores nacionales, en especial por aquellos adscritos al Museo de San Jos de la Salle para mediados del siglo XX, en reas correspondientes al pramo de Sonsn y Santa Ins. Si bien tales colecciones permitieron en un principio el conocer la flora de estos lugares del departamento, esto sera apenas el prembulo del estudio de estos sitios dada la existencia de otros pramos que an su conocimiento permaneca por realizarse, tales como los pramos de Frontino, Caramanta y Paramillo. La realizacin del proyecto flora de Antioquia por investigadores de los herbarios HUA (Herbario Universidad de Antioquia), MO (Missouri Botanical Garden) y NYBG (New York Botanical Garden) ha producido quizs el mayor aumento en el conocimiento de la flora de los ecosistemas paramunos del departamento, al producirse una intensificacin en la coleccin de la flora de estos lugares que qued depositada en los herbarios de estas instituciones y que contribuy para realizar el catalogo de plantas vasculares del departamento de Antioquia, siendo la mayora del trabajo realizado en estos lugares para finales de 1980 y principios de 1990. A pesar de la realizacin de tal catalogo, an permanece un gran nmero de especies vegetales por registrarse para cada una de las zonas de alta montaa en el departamento y quizs por descubrirse, debido a que factores tales como el tamao del rea, acceso, condiciones de orden pblico han limitado la exploracin botnica en estos ecosistemas, afectando esto el esfuerzo de muestreo que permita caracterizar bien la flora paramuna. La conservacin de la biodiversidad debe incluir la preservacin de un amplio y abundante nmero de especies, especialmente aquellas de rareza particular. En este sentido Allen et al. (2009) proponen que una estimacin de prioridades de conservacin de reas de pramo, debe estar cuantificada de forma tal que refleje la riqueza de especies, similitud y disimilitud.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

La generacin de informacin sobre la diversidad y las relaciones filogenticas de la biota existente en una regin, permite su utilizacin en la definicin de decisiones de conservacin (Forero-Medina & Jopa, 2010). A este respecto se encuentran dos posiciones encontradas, una de ellas plantea que la conservacin debe priorizarse hacia proteger linajes en radiacin, lo cual de acuerdo a Erwin (1991) conllevara a crear diversidad a futuro. Vane-Wrigth et al. (1991), proponen por el contrario, enfatizar en la conservacin de la mayor cantidad de linajes. De acuerdo a Sutherland (2001) la priorizacin de reas a conservar, debe ser cuantificada con base en aspectos como nmero de especies, nmero de especies vulnerables, rareza del ecosistema y tasa de prdida o transformacin. Estos criterios de priorizacin constituyen herramientas para la toma de decisin en la inversin de recursos en conservacin, que constituyan las ms ptimas destinaciones y asignaciones de esfuerzos invertidos en la preservacin de pramos. La definicin de prioridades de conservacin de reas debe asumirse desde una amplia consideracin de factores, siendo indispensable como primer paso, conocer la diversidad existente y los factores ambientales incidentes. Esta tarea se pretende lograr con el inventario de los pramos de Antioquia, facilitando y divulgando la flora contenida en este ecosistema. MATERIALES Y MTODOS rea de estudio. El muestreo del presente proyecto, se adelanta en las reas de pramo de las cordilleras Occidental y Central del departamento de Antioquia, intentando incluir las mayores extensiones y los fragmentos menos explorados. Para esto se ha hecho inicialmente, el inventario de los estudios y colecciones vegetales disponibles para estas formaciones y que se encuentran conservadas en los herbarios locales, los centros de documentacin de las corporaciones regionales y las universidades de Medelln, incluyendo as mismo la compilacin de la informacin realizada por el proyecto Expedicin Antioquia 2013 y los datos de colecciones de los herbarios disponibles en lnea. Colecciones de herbario y fuentes de informacin secundaria . El proyecto Flora de Antioquia ha venido generando y depurando una extensa cantidad de informacin referente a la diversidad vegetal del departamento, informacin que constituye la primer fuente de datos de este proyecto. As mismo la utilizacin y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

consulta de los resultados y publicaciones de diferentes estudios tendientes a establecer la flora de los pramos de Antioquia y Colombia, representa otra fuente importante para definir e inventariar la diversidad vegetal en los pramos del departamento. Una fuente adicional de informacin para este proyecto, est representada en las bases de datos de tropicos.org (Missouri Botanical Garden), New York Botanical Garden, Kew herbarium, Smithsonian National Musseum of Natural History, Museo Nacional de Historia Natural de Francia y otras colecciones disponibles online. Composicin florstica. La determinacin taxonmica se ha realizado por observacin directa en campo, comparacin botnica en herbarios locales y mediante el uso de manuales y claves taxonmicas. Descripcin de los pramos. Para cada uno de los pramos incluidos en este inventario, se ha realizado una descripcin fisiogrfica y ambiental, donde se destacan las condiciones actuales para cada pramo, su estado de conservacin y riesgos potenciales. RESULTADOS La exploracin de los pramos de Antioquia ha permitido establecer el nmero de especies de plantas angiospermas registradas en los pramos del departamento, en un nmero de 535 taxones hasta el desarrollo actual del muestreo. El mayor nmero de registros de plantas se concentra en el rea correspondiente al pramo de Urrao-Frontino, en jurisdiccin de los municipios de Urrao, Frontino y Caicedo, con un total de 388 especies. En segundo lugar en cuanto a registros de flora se ubica el pramo de Santa Ins con un total de 225 especies, este pramo constituye el complejo paramuno ms al norte en la cordillera Central colombiana, adems tiene una gran importancia econmica y logstica para el rea metropolitana del valle de Aburr, ya que surte de agua a cerca de un milln de habitantes de esta conurbacin. El pramo de Sonsn tiene un inventario de 170 especies, lo cual constituye una considerable diversidad vegetal si se tiene en cuenta su escaso areal. La exploracin de este pramo ha sido difcil debido a dificultades de acceso por la pendiente pronunciada y por condiciones de orden pblico. En el complejo paramuno de Paramillo ubicado en los municipios de Dabeiba, Ituango y Peque se han registrado 97 especies de angiospermas. Esta rea cuenta con alrededor de 1550 hectreas y una altura mxima de 3720 m y es el sector paramuno ms al norte en la cordillera Occidental. Paramillo constituye el

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

pramo menos explorado del departamento de Antioquia, esto explicado por las difciles condiciones de acceso y de orden pblico. En los fragmentos de pramo en jurisdiccin de Medelln (Padre Amaya, Las Baldas y San Flix), se ha inventariado un total de 204 especies. Estos tres fragmentos, cuentan con un rea muy pequea y alcanzan una altura mxima de 3150 m. Los inventarios han permitido establecer tanto la riqueza de especies como los grados de endemicidad de las floras de cada uno de los pramos considerados en el estudio. Se advierte la necesidad urgente de establecer planes de conservacin y manejo para los pramos de Antioquia y especialmente se destaca el pramo de Sonsn, el cual con un areal estimado en 4 ha, mantiene 3 especies endmicas del pramo y 10 especies endmicas para el departamento. El pramo de Frontino-Urrao, representa el rea continua de mayor extensin en pramo del departamento y con la mas alta diversidad de angiospermas. Este pramo contiene 13 especies de angiospermas restringidas para Antioquia, lo cual da validez a las necesidades de conservacin para mantener una biota propia de esta zona. El pramo de Santa Ins mantiene 7 taxones de angiospermas endmicas del departamento de Antioquia. Paramillo cuenta con solo dos especies endmicas, pero es evidente que este bajo nmero es producto de la pobre exploracin de que ha sido objeto este pramo. Este estudio, que se ha realizado casi en su totalidad, ha permitido definir el inventario de la flora angiosperma de los pramos del departamento y proponer prioridades de conservacin para las reas de pramo en Antioquia. BIBLIOGRAFA Allen B., Kon M., Bar-Yam Y. 2009 A new phylogenetic diversity measure generalizing the Shannon index and its application to phyllostomid bats. American Naturalist, 174, 236243. Erwin, T.L. 1991. An evolutionary basis for conservation strategies. Science, N.Y. 253, pp. 750752 Forero-Medina G, Joppa L. 2010. Representation of global and national conservation priorities by Colombia's Protected Area Network. PLoS One, 5(10): e13210. Luteyn, J.L. 1999. Pramos, a checklist of plant diversity geographical distribution and botanical literature. Memoirs of the The New York Botanical Garden vol. 84,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

The New York Botanical Garden Press, New York. Pennell, F.W. 1943. To the Pramo de Chaquiro. American Fern Journal, 33, JulySeptember, No 3. Rangel-Ch. J.O. 2000. Catlogo florstico de los macizos de Chingaza y Sumapaz. En: J.O. Rangel-Ch, ed. Colombia. Diversidad bitica, III. La regin de vida paramuna. Univ. Nacional de Colombia. Bogot. Pp: 563-598. Sutherland WJ. 2001. The conservation handbook. Research, management and policy. Blackwell Science Ltd., London, United Kingdom. 278 pp. Vane-Wright, R.I., Humphries, C.J. & Williams, P.M. 1991. What to protect: systematics and the agony of choice. Biological Conservation, 55: 235254.

ESPECIES AMENAZADAS DE ASTERACEAE EN EL MACIZO PRAMO DE RABANAL, BOYAC-COLOMBIA Andrea Liliana Simbaqueba-Gutirrez1, Mara Eugenia Morales-Puentes2
1

Biloga, (e) MSc. Grupo de investigacin en Sistemtica Biolgica (SisBio), Universidad Pedaggica y Tecnolgica de Colombia. alsimbaqueba@gmail.com. 2 PhD. Herbario UPTC, Grupo de investigacin en Sistemtica Biolgica (SisBio), Universidad Pedaggica y Tecnolgica de Colombia. RESUMEN El Macizo pramo de Rabanal, est en la cordillera Oriental (Boyac y Cundinamarca), ocupa 17567Ha distribuidas entre los 3200-3585 m, con

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

coberturas de pramo (4000Ha), bosques andinos (13000Ha), humedales, pastizales y embalses. Asteraceae es una gran familia con cerca de 25000 especies, y una subtribu destacada es Espeletiinae con ocho gneros, Carramboa (7 especies), Coespeletia (8), Espeletia (75), Espeletiopsis (25), Libanothamnus (16), Paramiflos (1), Ruilopezia (24), Tamania (1), y 146 especies. De 75 especies del gnero Espeletia, 68 son endmicas de Colombia (36 estn amenazadas y siete en peligro crtico). En la cordillera Oriental, se conocen 58 especies, de stas 33 estn amenazadas, mientras seis especies se encuentran en las cordilleras Central y Occidental con una sola especie amenazada, lo que evidencia la riqueza y vulnerabilidad de la cordillera Oriental. El estudio comprendi la evaluacin de taxones, a partir de muestreos poblacionales, distribucin geogrfica, fenologa, vegetacin acompaante, uso y revaluacin del grado de amenaza mediante trabajo de campo, revisin de herbario y anlisis a partir de metodologa de la UICN. De acuerdo al material recolectado y el depositado en el herbario UPTC, se registran, Espeletia boyacesis, E. argntea, E. grandiflora y E. murilloi, con especies acompaantes como Agrostis sp., Calamagrostis effusa y Chusquea tesellata (Poaceae), Niphogeton sp. y Ottoa sp. (Apiaceae),Arcytophyllum cf. muticum y Galium hypocarpium (Rubiaceae), y otras familias con una sola especie como Blechnaceae, Bromeliaceae, Cyperaceae, Ericaceae, Eriocaulaceae, Gentianaceae, Geraniaceae, Hypericaceae, Lycopodiaceae y Melastomataceae, informacin vital para disear planes de manejo y conservacin de taxa amenazadas. Palabras clave: grado de amenaza, pramo, Rabanal, vegetacin acompaante. INTRODUCCIN La familia Asteraceae, es una de las ms numerosas (~25000 especies) y ampliamente distribuidas en todos los continentes (excepto en la Antrtida), el mayor rango de distribucin se encuentra en las zonas altas de los Andes, (Luteyn, 1999, Funk, et al., 2009), en Colombia est representada por cerca de 200 gneros y 1200 especies (Garca et al., 2005). En el ecosistema de pramo, es comn encontrar Asteraceae, (Luteyn, 1999, Funk, et al., 2009), grupo representativo de esta familia es la subtribuEspeletiinae, con ocho gneros Carramboa (7 especies), Coespeletia (8), Espeletia(75), Espeletiopsis (25), Libanothamnus (16), Paramiflos (1), Ruilopezia (24), Tamania(1) y 153 especies(Van der Hammen, 1974; Cuatrecasas, 1976; Cleef,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

1980; Garca et al., 2005; Daz-Piedrahita&Rodrguez, 2008). Las especies que se agrupan en esta subtribu, se caracterizan por ser plantas arrosetadas (con o sin tallo) u ocasionalmente arborescentes y de numerosas hojas grandes y vellosas, al menos en la base, usualmente amarillentas a plateadas y de grandes inflorescencias terminales, amarillas, ms raramente blanquecina o prpura (Cuatrecasas, 1976). En este estudio se busca evaluar el grado de amenaza de la subtribu Espeletiinae (Asteraceae) en el Macizo Pramo de Rabanal, municipios de Ventaquemada, Samac y Rquira, a travs de la identificacin de las especies de la subtribu, as como la caracterizacin del hbitat a partir de la vegetacin acompaante a las especies de la tribu y la revaluacin del grado de amenaza de las taxa de estudio, a partir de los parmetros de la Unin Internacional para la Conservacin de la Naturaleza (UICN, 2001).

MATERIALES Y METODOS Fase preliminar: Const de revisin exhaustiva de material bibliogrfico, colecciones de herbarios (FMB y UPTC),bases de datos y revisin cartogrfica. Fase de campo: Se realizaron salidas de reconocimiento para identificar las reas donde se encontraban las especies de la subtribu Espeletiinae y se tomaron datos de coordenadas geogrficas, altitud y registros fotogrficos. Adicionalmente, se realiz la evaluacin e identificacin de la subtribu Espeletiinae, siguiendo la metodologa de Rangel & Velsquez (1997), se realizaron levantamientos en parcelas de 5x5 m (25m2), se censaron los individuos, y se tomaron medidas de la altura total, altura del tallo, dimetro de la roseta, nmero de floraciones y nmero de inflorescencias muertas (Sturm, 1990; Lpez, 2004,Snchez & Rausher, 2005 ;Daz-Piedrahita & Rodrguez, 2008).; Daz-Piedahita& Rodrguez, 2010). En las parcelas evaluadas se tomaron datos de descripcin florstica, localidad, georreferenciacin, nmero de colector, colectores, fecha de coleccin, estado fenolgico, perfil de vegetacin, registro fotogrfico, pendiente aproximada en grados, altitud y descripcin del hbitat (composicin del suelo, luminosidad, losimpactos de origen natural y/o antrpico sobre la zona y/o especie encontrados entre otros).

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Dentro del muestreo poblacional se evalu la densidad y tamao poblacional, estructura poblacional, distribucin geogrfica, fenologa, estado de conservacin del hbitat, adems de recoleccin de informacin histrica local de la subtribu Espeletiinae y se caracteriz la vegetacin asociada. Fase de anlisis de la informacin y trabajo de laboratorio: la determinacin del material vegetal se realiz en ellaboratorio del Herbario de la UPTC, y se utilizaron las claves propuestas por Badillo (2000), Cassini (1819), Cuatrecasas (1969, 1986, 1996), Daz & Cuatrecasas (2000), Funk,et al. (2009), Gentry (1993), Kubitzqui (2007), Vlez, 2004, entre otras. Reevaluacin del grado de amenaza: se evalu mediante trabajo de campo, revisin de herbario y anlisis a partir de metodologa de la UICN (2001).Se tuvieron en cuenta caractersticas exclusivas como el tamao poblacional, nmero de localidades, la distribucin potencial de la poblacin y el impacto de origen natural y/o antrpico sobre la zona. Como documentos gua de esta reevaluacin se tuvo en cuenta el libro rojo de flora amenazada de Colombia en el que se confrontaron los datos obtenidos contra la serie de criterios, subcriterios, umbrales y calificadores establecidos por la UICN, contenida en la versin 3.1 ao 2001 (Garca, et al. 2005).Para la identificacin de grados de amenaza de la subtribu Espeletiinaese tuvieron en cuenta los criterios B (Areal Pequeo, fragmentado, en disminucin o fluctuante) y C (Poblacin pequea y en disminucin), propuestos por la Unin Internacional para la Conservacin de la Naturaleza (UICN, 2001; versin 3.1). RESULTADOS Y CONCLUSIONES De acuerdo al material recolectado hasta el momento y el depositado en el herbario UPTC, se registra Espeletia boyacesis, E. argntea, E. grandiflora y E. murilloi, con especies acompaantes como Agrostissp., Calamagrostis effusa y Chusquea tesellata (Poaceae), Niphogeton sp. y Ottoa sp. (Apiaceae), Arcytophyllum cf. muticum y Galium hypocarpium (Rubiaceae), y otras familias con una sola especie comoBlechnaceae, Bromeliaceae, Cyperaceae, Ericaceae, Eriocaulaceae, Gentianaceae, Geraniaceae, Hypericaceae, Lycopodiaceae y Melastomataceae. Los taxones de Espeletiinae se encuentran distribuidas en el subpramo, sujetas a presiones antrpicas (agricultura extensiva, ganadera, minera y quemas), lo que permite inferir que son altamente vulnerables al riesgo de extincin.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Debido a la situacin que se presenta, se requiere disear planes de manejo y conservacin en ecosistemas de alta montaa, en particular, aplicados a la subtribu Espeletiinae, y registrar informacin puntual de las especies de este grupo que se distribuyen en Rabanal y que no se encuentran citadas en el Libro rojo de plantas de Colombia de Palmas, Frailejones y Zamias (Garca, et al. 2005), documento gua de especies amenazadas. BIBLIOGRAFA Badillo, V. 2000. Los gneros de las Compositae (Asteraceae) de Venezuela: Clave artificial para su determinacin. Facultad de Agronoma, Instituto Botnica Agrcola. Universidad Central de Venezuela, Maracay, Edo Aragua. Cassini,H.1819. Description des nouve auxgenresGaruleum et Phagnalon. Bulletin des Sciences de la Socit Philomatique de Paris 1819: 172-174. Cleef, A.M. 1980. La posicin fitogeogrfica de la flora vascular de pramo neotropical. Revista Instituto de Geografa Agustn Codazzi 7:68-66. Cuatrecasas, J. 1969. Prima Flora Colombiana 3, Compositae-Astereae. Webbia 24: 1-335. _______________.1976. A new subtribe in the Heliantheae (Compositae): Espeletiinae. Phytologia 35(1):43-61. _______________.1986. A new subtribu in theHeliantheae (Compositae): Espeletiinae. Phytologa 35:43-61. _______________.1996. Clave provisional de las especies del gnero EspeletiopsisCuatrec. (Asteraceae, Heliantheae, Compositae). Anales del Jardn Botnico de Madrid. 54: 370-377 p. Daz-Piedrahita, S & J. Cuatrecasas. 2000. Asterceas de la flora Colombiana Senecioneae I, gneros Dendrophorbium y Pentacalia. Academia Colombiana de Ciencias Exactas Fsicas y Naturales. Coleccin Jorge lvarez Lleras 12. _______________& B. V. Rodrguez-Cabeza.2008. Novedades en los gneros Espeletia Mutis ex Humb. &Bonpl. yEspeletiopsisCuatrec. (Asteraceae, Heliantheae, Espeletiinae). Revista de la Academia Colombiana de Ciencias Exactas Fsicas y Naturales. 32 (125): 455-464 p. _______________& B.V. Rodrguez-Cabeza.2010. Nuevas especies colombianas de EspeletiopsisCuatrec. y de Espeletia Mutis ex Humb. &Bonpl. (Asteraceae, Heliantheae, Espeletiinae). Revista de la Academia Colombiana de Ciencias Exactas Fsicas y Naturales 34(133):441-454. Funk, V.A.; Susana, A; Tod F. Stuessy& Randall J. Bayer (eds.).2009. Systematics, evolution, and biogeography of Compositae. Smithsonian Institution, Washington, D.C., USA.965 p.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Garca, N., E. Caldern & G. Galeano.2005. Frailejones. Pp. 225-386. En: Caldern, E., G. Galeano & N. Garca. (eds). 2005. Libro rojo de planta de Colombia. Volumen 2: palmas, frailejones y zamias. Series Libros de Especies Amenazadas de Colombia. Bogot, Colombia. Instituto Alexander von Humboldt - Instituto de Ciencias Naturales de la Universidad Nacional de Colombia-Ministerio de Ambiente, Vivienda y Desarrollo Territorial. Gentry, A.H.1993. A field guide to the families and genera of woody plants of northwest South America (Colombia, Ecuador, Peru) with supplementary notes on herbaceous taxa. ConservationInternational. Washington, D.C. Kubitzki, K. 2007.The families and genera of vascular plants. Flowering plants eudicots: Asterales. Volumen VIII. Germany. Lpez, F. 2004. Diagnstico del estado de conservacin de Espeletiapaipana y E. jaramilloi(Asteraceae), especies endmicas del departamento de Boyac, Colombia. Trabajo de grado. Escuela de Ciencias Biolgicas, Facultad de Ciencias Biolgicas, Universidad Pedaggica y Tecnolgica de Colombia, Tunja. Luteyn, J. 1999. Pramos: A checklist of plant diversity, geographic distribution, and botanical literature. Memoirs of the New York Botanical Garden 84: 1-278. Quito. Rangel,O. & A. Velsquez. 1997. Mtodos de estudio de la vegetacin: 59-87. En: Rangel J.O., P. Lowy&M. Aguilar. (Eds.). Diversidad bitica II: tipos de vegetacin en Colombia. Universidad Nacional de Colombia, Facultad de Ciencias, Instituto de Ciencias Naturales. Editorial Unibiblos, Bogot, Colombia. Snchez, A. &Rausher, J.T. 2005. Filogentica molecular de los Espeletiinae, una radiacin adaptativa andina. Tesis de Maestra en Biologa. Universidad de los Andes. Bogot. Sturm, H. 1990. Contribucin al conocimiento de las relaciones entre los frailejones (Espeletiinae, Asteraceae) y los animales de la regin del pramo andino. Revista de la Academia Colombiana de Ciencias Exactas Fsicas y Naturales 17(67):667-685. Unin Internacional para la Conservacin de la Naturaleza (UICN). 2001. Categoras y criterios de la lista roja de la UICN: versin 3.1. Comisin de supervivencia de especies de la UICN. UICN, Gland, Suiza y Cambridge, UK. Van der Hammen, T. 1974. The pleistocene changes of vegetation and climate in troplical South Amrica.Journal of Biogeograghy 1:3-26. Vlez, M. 2004. Curso- Taller elementos de morfologa y clasificacin de la familia Asteraceae.III Congreso Colombiano de Botnica. Noviembre 8 al 12 de 2004.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESTAURACIN ECOLGICA DE LOS PRAMOS ANDINOS TRASFORMADOS POR ACTIVIDADES DE GANADERA, PARQUE NACIONAL NATURAL (PNN) CHINGAZA, COLOMBIA Jennyfer Insuasty-Torres1; Oscar Zamora-Rojas2; Orlando Vargas Ros2; Liz vila-Rodrguez2; Laura Victoria Prez-Martnez2; Felipe lvarez2 2 Castiblanco ; Natalia Rodrguez-Castillo .
1,2

Grupo de Restauracin Ecolgica (GREUNAL). Universidad Nacional de Colombia. 1jinsuastyt@unal.edu.co RESUMEN Aunque los pramos son importantes por la biodiversidad que sustentan y los servicios ambientales que prestan, tal como la regulacin del ciclo hidrolgico, estos ecosistemas tienen una larga historia de disturbio, particularmente en Colombia la ganadera junto con actividades asociadas como la quema de la cubierta vegetal y posterior ramoneo de rebrotes, afectan la composicin y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

estructura vegetal, las propiedades del suelo y favorecen el establecimiento de pastos exticos. Con el fin de establecer estrategias de restauracin ecolgica exitosas en reas de pramo pastoreadas, se evaluaron dos estrategias en la primera fase del proyecto de restauracin: 1) la reubicacin de individuos de Espeletia grandiflora y especies de pajonal, principalmente Calamagrostis effusa,y 2) la siembra de Lupinus bogotensis como especie fijadora de nitrgeno y facilitadora del establecimiento de especies vegetales nativas. Despus de tres aos de seguimiento, el resultado ms importante fue la formacin exitosa de ncleos de restauracin en los que se reubicaron individuos de E. grandiflora, de los cuales sobreviven ms del 70% y facilitan el establecimiento de otras especies nativas que se trasladan en el bloqueo de estos individuos. Igualmente fue exitosa la reubicacin de especies de pajonal, y se recomienda esta estrategia de reubicacin con otras especies nativas para consolidar las acciones de restauracin en el pramo. En la segunda fase de este proyecto se evala la reubicacin de otras especies, se prueban mtodos para eliminar la regeneracin de pastos exticos y se formulan protocolos de propagacin para especies nativas de las cuales es escaso el conocimiento. Palabras clave: estrategias de restauracin, invasin de pastos exticos, ncleos de restauracin, pramos, protocolos de germinacin, restauracin ecolgica . INTRODUCCIN Objetivos Evaluar el potencial de regeneracin natural y asistida de zonas de pramo hmedo con historia de disturbio por fuego y pastoreo, identificando obstculos en la sucesin natural con el fin de establecer estrategias que favorezcan la restauracin ecolgica. Consolidar estrategias de restauracin ecolgica de pramos mediante seleccin, manejo y propagacin de especies nativas. MATERIALES Y MTODOS. Se plantearon estrategias de restauracin para reas de pramo degradadas por la

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

pastoreo de ganado vacuno junto con actividades asociadas como la quema de la cubierta vegetal, de tal manera que se iniciara, acelerara y redireccionarn los procesos de sucesin-regeneracin hacia estados sucesionales con una composicin de especies y estructura cercana a las comunidades tpicas de pramo. En la primera fase del proyecto, la cual se desarrollo desde el 2007 al 2010, se estudiaron dos principales componentes de investigacin: uno bitico y otro abitico. El componente bitico evalu la supervivencia y el crecimiento de especies propias y fundamentales de estados avanzados de la sucesin ecolgica en los pramos, como Espeletia grandiflora y Calamagrostis effusa, las cuales fueron reubicadas a parcelas en zonas con pastos exticos con el fin de crear ncleos de restauracin y aumentar la diversidad con especies vegetales nativas. El componente abitico se concentr en manejar algunas caractersticas ecolgicas del suelo tal como el banco de semillas y los micrositios que favorecen el establecimiento de especies vegetales propias del pramo. Esto se realiz mediante la descompactacin mecnica del suelo en reas potrerizadas y la adicin de mantos de suelo provenientes de zonas conservadas. Adems se evalu la siembra de Lupinus bogotensis, como especie fijadora de nitrgeno atmosfrico y facilitadora de la sucesin vegetal en parcelas donde se haban reubicado plantas de E. grandiflora y C. effusa. En la segunda fase del proyecto, la cual comenz desde el 2011 y tiene vigencia actual, se evala el sombreado artificial mediante el cubrimiento de los pastos exticos con plstico negro, y el sombreado natural mediante la cubrimiento de los pastos exticos con una cobertura vegetal de leguminosas arbustivas y herbceas. Adicionalmente se evalan la supervivencia y el crecimiento de otras cuatro especies nativas (rosetas: Paepalanthus columbiensis y Puya trianae, y los arbustos: Pentacalia ledifolia y Arcytophyllum nitidum) que fueron reubicadas para crear otros ncleos de restauracin y enriquecer estas zonas degradas de pramo con especies nativas. Por otro lado, se estn desarrollando experimentos sobre la fisiologa de la germinacin de semillas de 15 especies de pramo, subpramo y bosque alto andino, con el fin de obtener la informacin necesaria para saber cmo se propagan y manejan estas especies en vivero para obtener mayor cantidad de material vegetal y con la calidad necesaria para adelantar experiencias de restauracin ecolgica a gran escala. Estos experimentos se realizan con condiciones de temperatura, luz y humedad controladas en laboratorio, con el fin

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

de encontrar los requerimientos de germinacin para estas especies nativas. Finalmente se har una sntesis de los resultados y estrategias ms exitosas en la restauracin de los pramos andinos con el fin de plantear los lineamientos para la construccin de planes de manejo y restauracin de reas degradadas de pramos. RESULTADOS Y DISCUSIN. En la primera fase del proyecto, los resultados ms importantes de esta investigacin fueron la formacin exitosa de pequeos parches o nodos con plantas de la comunidad vegetal paramuna, lo cual permite acelerar y enriquecer la sucesin vegetal de estas parcelas experimentales en zonas disturbadas, gracias al trasplante o reubicacin de especies tan importantes como E. grandiflora y C. effusa. En general, el 74.62% (SE = 2.6%) de todos los trasplantes (n = 600) se encontraban vivos luego de 24 meses despus de la siembra (RojasZamora et al. 2012). El trasplante o reubicacin de individuos ha sido ampliamente usado para la adicin de especies en procesos de restauracin, y puede ser una estrategia eficaz para superar las etapas vulnerables de germinacin y reclutamiento en sitios con condiciones fsicas o ambientales extremas (May et al. 1982, Urbanska 1994, Fattorini 2001, Orozco 2007, Trujillo-Ortiz 2007, Garca-Orth & Martnez-Ramos 2011, Wallin et al. 2009). Despus del monitoreo durante 18 meses en los experimentos de siembra de L. bogotensis y trasplante de individuos jvenes de E. grandiflora y macollas de pajonal, la supervivencia de E. grandiflora siempre fue superior al 75%, y para las macollas de pajonal siempre fue del 100%. Los resultados positivos respecto a la supervivencia y crecimiento de los individuos de E. grandiflora y de las macollas al trasplantarse junto a los individuos de L. bogotensis, sugiere un posible efecto facilitador por parte de la especie leguminosa, lo cual est acorde con Callaway (1997) quien afirma que la accin de plantas nieras facilitan el establecimiento de otras especies bajo su dosel. Se determin que L. bogotensis logra mejorar las condiciones microambientales del suelo, reduciendo los cambios bruscos de temperatura, al dar proteccin contra vientos fuertes y evitar una tasa alta de evapotranspiracin por la sombra que genera su cobertura vegetal. La descompactacin del suelo ayuda al establecimiento de nuevas plntulas ya que este procedimiento favorece las condiciones estructurales del suelo, como la porosidad, y ayuda a superar la barrera fsica que se impone a las semillas en suelos afectados por la compactacin debida al pisoteo del ganado.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

El propsito del trasplante de suelo fue superar la barrera a la dispersin de las semillas y la carencia de propgulos de especies de pramo, por medio del enriquecimiento de las parcelas con suelo proveniente de reas sin disturbio que contuvieran semillas y propgulos vegetativos. Aunque esta estrategia aument la riqueza de especies, no result ser exitosa ya que se present una germinacin poco activa de las especies nativas, debido en primera instancia a la caracterstica del ecosistema pramo de tener procesos lentos a todo nivel, desde el crecimiento de las plantas, la descomposicin de la materia orgnica y la recuperacin a su deterioro. Otra posible causa es generada por la competencia de los pastos exticos que impiden el establecimiento de nuevas plntulas, ya que los pastos exticos crecen rpido y con un denso entramado de rizomas lo cual impide la germinacin y el desarrollo de especies nativas, ya que la muchas especies de pramo requieren de condiciones especficas y de ms tiempo para su germinacin y establecimiento. En todos los experimentos que se realizaron en la primera fase se hizo evidente la necesidad de erradicar los pastos exticos para reducir la competencia con especies nativas. Igualmente se recomend generar distintos tipos de ncleos de regeneracin compuestos por otras especies nativas de pramo, y de esta manera aumentar la diversidad de plantas, los recursos disponibles para animales y microorganismos, y la escala espacial del proceso de restauracin ecolgica. Debido a estas recomendaciones se plante el desarrollo de una segunda fase en el proyecto de restauracin ecolgica en los pramos andinos. Aunque la segunda fase tiene resultados parciales se evidencia la importancia de la conformacin de ncleos de regeneracin y la reubicacin de varias especies nativas para enriquecer las zonas de restauracin. Igualmente es importante determinar estrategias de control para la regeneracin de pastos exticos en los pramos, por lo que se prueba una estrategia exitosa mediante el sombreado artificial. Hasta el momento, la estrategia de sombreado artificial se ha implementado en las montaas andinas mediante polisombra usada en la restauracin ecolgica del bosque altoandino (Len 2009, Snchez-Tapia 2007), tanto para contrarrestrar la regeneracin del retamo espinoso, como para proteger a las plantas del estrs hdrico por las altas temperaturas en el da y las bajas temperaturas en la noche (Vargas & Daz 2007). Tambin, el sombreado fue usado en zonas abandonadas de cultivos en Panam, Kim et al. (2008) donde demostr ser un mtodo efectivo para controlar y disminuir la biomasa del pasto extico Saccharum espontaneum, ya que ste impide la regeneracin de las

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

plntulas arbreas. Por otro lado se prueba el efecto sobre el control de pastos mediante el uso de coberturas naturales de leguminosas, aunque estas coberturas tambin se proponen para mejorar el desempeo de las especies nativas. En experiencias anteriores de restauracin en ecosistemas altoandinos, la presencia de doseles arbustivos y herbceos tuvo efectos positivos en el desempeo de especies nativas, especialmente en cuanto a superviviencia y crecimiento se refiere (Vargas et al. 2009). La especie L. bogotensis, fue reportada como facilitadora ya que redujo el impacto sobre plantas nativas en condiciones de potrero, provocado por las heladas (Gmez-Ruz 2012). Adicionalmente es evidente la necesidad de aumentar el conocimiento que se tiene acerca de las semillas, sus rasgos de historia de vida y la fisiologa de la germinacin, en el panorama de los esfuerzos y actividades de restauracin ecolgica. CONCLUSIONES Dada la baja productividad de los pramos, se identifica y corrobora la eficacia de la reubicacin de individuos, como estrategia de enriquecimiento con especies nativas en reas de pramo en procesos de restauracin ecolgica. Adelantar investigaciones en torno al control de pastos exticos, con el fin de maximizar el xito de las posibles estrategias de restauracin ecolgica de pramos andinos. Se identifica la necesidad de generar protocolos de propagacin que garanticen la obtencin de material vegetal de calidad necesario para los procesos de restauracin ecolgica de los pramos andinos.

BIBLIOGRAFA Callaway, R.M. 1997. Positive interactions in plant communities and the individualistic-continuum concept. Oecologia, 112:143-149. Fattorini, M. 2001. Establishment of transplants on machine-graded ski runs above timberline in the Swiss Alps. Restor. Ecol. 9: 119-126. Garca-Orth, X. & M. Martnez-Ramos. 2011. Isolated trees and grass removal improve performance of transplanted Trema micrantha (L.) Blume (Ulmaceae)

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

saplings in tropical pastures. Restor. Ecol. 19: 24-34. Gmez-Ruz P. y O. Vargas. 2012. Efecto de la densidad de siembra sobre las interacciones biolgicas entre las leguminosas Lupinus bogotensis y Vicia benghalensis con las nativas Solanum oblongifolium y Viburnum tinoides en parcelas experimentales de restauracin ecolgica del bosque altoandino. Tesis de maestra. Departamento de Biologa. Universidad Nacional de Colombia. Kim, T.J., F. Montagninib & D. Dentc. 2008. Rehabilitating Abandoned Pastures in Panama: Control of the Invasive Exotic Grass, Saccharum spontaneum L., Using Artificial Shade Treatments. Journal of Sustainable Forestry 26 (3):192-203. Len, O. 2009. Sombreado artificial y natural en el control y restauracin ecolgica de reas invadidas por Ulex europaeus. p. 131-147. En: Vargas, O.; O. Len, O. & A. Daz-Espinosa (Eds.). Restauracin ecolgica en zonas invadidas por retamo espinoso y plantaciones forestales exticas. Universidad Nacional de Colombia. May, D.E., P.J. Webber & T.A. May. 1982. Success of transplanted alpine tundra plants on Niwot Ridge, Colorado. J. Appl. Ecol. 19: 965-976. Orozco, N. 2007. Crecimiento y desarrollo de cuatro especies nativas en el corredor ripario potrerizado del ro Chisac, sector Capilla del Hato Localidad de Usme, Bogot D.C., p. 382-401. En: O. Vargas (ed.). Restauracin ecolgica del bosque altoandino. Estudios diagnsticos y experimentales en los alrededores del embalse de Chisac (localidad de Usme, Bogot D.C.). Universidad Nacional de Colombia, Bogot, Colombia. Rojas-Zamora, O.; J. Insuasty; CdlA. Crdenas & O. Vargas. 2012. Reubicacin de plantas de Espeletia grandiflora (Asteraceae) como estrategia para el enriquecimiento de areas de pramo alteradas (PNN Chingaza-Colombia). Revista de Biologa Tropical. En prensa. Snchez-Tapia A. 2007. Efecto del sombreado artificial sobre el retamo espinoso (Ulex europaeus L.) en el Embalse de Chisac. p. En: Vargas, O. & Grupo de Restauracin (eds). Restauracin ecolgica del bosque altoandino. Estudios diagnsticos y experimentales en los alrededores del Embalse de Chisac, Localidad de Usme, Bogot D.C. Trujillo-Ortiz, L. 2007. Evaluacin de la regeneracin natural y sobrevivencia de especies nativas en parcelas experimentales en potreros, p. 402-424. En: O. Vargas (ed.). Restauracin ecolgica del bosque altoandino. Estudios diagnsticos y experimentales en los alrededores del embalse de Chisac (localidad de Usme, Bogot D.C.). Universidad Nacional de Colombia, Bogot, Colombia. Urbanska, K.M. 1994. Ecological restoration above the timberline: demographic monitoring of whole trial plots in the Swiss Alps. Bot. Helv. 104: 141-156. Vargas, O. & A. Daz. 2007. Gua metodolgica para la restauracin ecolgica de reas potrerizadas. p. 159-168. En: Vargas, O. (ed.). Gua metodolgica para la

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

restauracin del bosque altoandino. Grupo de Restauracin Ecolgica. Universidad Nacional de Colombia. Vargas O., O. Len y A. Daz-Espinosa (Eds.). 2009. Restauracin Ecolgica en zonas invadidas por retamo espinoso y plantaciones forestales de especies exticas. Universidad Nacional de Colombia. Facultad de Ciencias, Bogot, Colombia.

HORMIGAS INDICADORAS EN LA RESTAURACIN DE BOSQUES MONTANOS CERCANOS AL VALLE DE ABURR Juan David Snchez-Rodrguez1,2, Juliana Cardona-Duque1, Carlos Alberto Gutirrez2.
1

Grupo de Entomologa Universidad de Antioquia (GEUA). juanpixie@gmail.com, jcardonad@gmail.com 2 Centro para la Investigacin en Sistemas Sostenibles de Produccin Agropecuaria (CIPAV). carlosguty@gmail.com RESUMEN Para evaluar la efectividad de los procesos de reforestacin se escogen grupos con rangos estrechos de tolerancia a factores ambientales. Para establecer una lnea base que permita monitorear los procesos de Regeneracin Natural Asistida (RNA), se realiz el estudio de la diversidad de hormigas en cuatro localidades en zonas montanas del Valle de Aburr, en el marco del proyecto Ms Bosques para Medelln de la Secretara del Medio Ambiente de Medelln. Los muestreos se realizaron entre septiembre y noviembre de 2011. En cada rea se muestrearon las zonas de RNA y los parches de bosque. Se definieron transectos lineales con diez estaciones, en las cuales se instalaron trampas de cada, trampas cebadas (atn y panela) y se realiz muestreo manual. El material colectado se deposit en

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

el laboratorio de Colecciones Entomolgicas de la Universidad de Antioquia. En total se obtuvieron 510 registros de hormigas, pertenecientes a cinco subfamilias (Dolichoderinae, Ecitoninae, Formicinae, Myrmicinae y Ponerinae), 22 gneros (Linepithema, Tapinoma, Labidus, Acropyga, Brachymyrmex, Camponotus, Myrmelachista, Paratrechina, Acromyrmex, Aphenogaster, Crematogaster, Cyphomyrmex, Pheidole, Pyramica, Rhopalothrix, Rogeria, Solenopsis, Strumigenys, Gnamptogenys, Hypoponera, Odontomachus y Pachycondyla) y 39 especies. Aphenogaster y Rhopalothrix son nuevos registros para el departamento. El gnero ms diverso fue Pheidole con un total de siete especies, y la especie dominante en todos los corregimientos fue del gnero Linepithema. Los patrones de diversidad en los cuatro corregimientos fueron diferentes para los bosques y las RNAs. Se proponen como posibles especies indicadoras de la regeneracin para cada corregimiento, las especies nicas a las zonas boscosas. Palabras clave: bioindicadores, Formicidae, Ms bosque para Medelln, reforestacin. INTRODUCCIN Los procesos de reforestacin a largo plazo, requieren monitoreos que permitan evaluar la efectividad del proceso en trminos de restauracin del ecosistema y sus funciones. Para esto se utilizan grupos bioindicadores, cuyos rangos de tolerancia a la variacin de factores ambientales son estrechos (Arcila y LozanoZambrano, 2003). Las hormigas (Formicidae) son consideradas buenas indicadoras de los cambios en los ecosistemas, pues son fcilmente colectables, presentan una gran diversidad, son abundantes en muchos ecosistemas, responden rpidamente a cambios ambientales, tienen una gran variedad de funciones dentro de los ecosistemas y es posible clasificarlas en grupos funcionales y relacionarlas con otros componentes biticos del rea; adems, son un grupo taxonmicamente bien estudiado (Alonso y Agosti, 2000; Arcila y Lozano-Zambrano, 2003; Wilson, 2000). Con el fin de mejorar la conectividad entre las reas naturales y proteger las fuentes de agua, la Alcalda de Medelln, a travs de la Secretara de Medio Ambiente, la Gobernacin de Antioquia, Ecopetrol y el rea Metropolitana, ha comenzado un proceso de reforestacin de algunas reas montanas cercanas al Valle de Aburr (proyecto Ms Bosques para Medelln ejecutado por la

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Fundacin CIPAV), por medio del establecimiento de sembrados de especies nativas, con el proceso conocido como Regeneracin Natural Asistida (RNA). Con el propsito de establecer una lnea base que permita evaluar los cambios en el tiempo de estos sembrados y la recuperacin del ecosistema, se realiza un estudio de la diversidad de hormigas en estas reas. MATERIALES Y MTODOS El estudio se realiz en cuatro localidades del municipio de Medelln; tres de estas localizadas al occidente: corregimiento de San Sebastin de Palmitas (vereda La Volcana), corregimiento San Antonio de Prado (vereda El Astillero) y corregimiento de San Cristbal (vereda La Palma); y la cuarta localizada al oriente de la zona urbana: corregimiento de Santa Elena (vereda El Llano). Los sitios muestreados se caracterizan como bosque muy hmedo montano bajo (bmh-MB) (Holdridge, 1978). En cada localidad se establecieron dos zonas de muestreo: RNA y Bosque. En cada zona se instalaron dos transectos lineales de 100 m, distanciados entre s por aproximadamente 200m. En estos transectos se definieron 10 estaciones, separadas entre s por 10m. En cada estacin se coloc una trampa de cada (pitfall) por un periodo de 48h y dos trampas de cebo (atn y panela) colocadas sobre la superficie del suelo; las hormigas atradas a estos cebos se recogieron al cabo de tres horas. Finalmente, se realiz una captura manual en cada estacin, por un perodo de 10 minutos. As, en cada localidad se colocaron 40 trampas de cada, 40 trampas con atn, 40 con panela y se realiz un muestreo manual de aproximadamente 7 horas. Los especmenes colectados fueron separados, montados, etiquetados e identificados utilizando las claves de Bolton (1994), Serna y Vergara (2001) y Fernndez (2003a). Finalmente fueron depositados en la Coleccin de Entomologa de la Universidad de Antioquia. Para evaluar la diversidad de hormigas en cada localidad, se calcularon los ndices de diversidad de Simpson (1-D), Shannon-Wiener (H), Equidad de Pielou (J) y el ndice de Dominancia (D) con el programa PAST v. 2.07 para Windows (Hammer et al., 2001). RESULTADOS En total, para las localidades muestreadas se obtuvieron 510 registros de hormigas (aproximadamente 7500 individuos), pertenecientes a cinco subfamilias

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

(Dolichoderinae, Ecitoninae, Formicinae, Myrmicinae y Ponerinae), 22 gneros (Linepithema, Tapinoma, Labidus, Acropyga, Brachymyrmex, Camponotus, Myrmelachista, Paratrechina, Acromyrmex, Aphenogaster, Crematogaster, Cyphomyrmex, Pheidole, Pyramica, Rhopalothrix, Rogeria, Solenopsis, Strumigenys, Gnamptogenys, Hypoponera, Odontomachus y Pachycondyla) y 39 especies. Aphenogaster y Rhopalothrix son nuevos registros para el departamento de Antioquia (i.e. Fernndez et al., 1996; Fernndez y Sendoya, 2004) y Cyphomyrmex se registr por primera vez a alturas mayores a 2000msnm (Fernndez, 2003b). La subfamilia con una mayor riqueza de especies fue Myrmicinae con el 51% de las especies, seguida de Ponerinae con el 23%, Formicinae con el 16% y por ltimo las subfamilias Dolochoderinae y Ecitoninae cada una con el 5% de las especies encontradas. El gnero ms diverso fue Pheidole con un total de siete especies, y la especie dominante en todas las localidades fue del gnero Linepithema. Los patrones de diversidad en los cuatro corregimientos fueron diferentes para los bosques y las RNAs. La alta riqueza de las subfamilias Myrmicinae y Ponerinae se debe principalmente a que dentro de stas se encontraron los gneros con mayor riqueza de especies: Pheidole (Myrmicinae) con siete especies, Pachycondyla (Ponerinae) con cuatro especies e Hypoponera (Ponerinae) con tres especies. Los dems gneros encontrados contaron con una o dos especies colectadas. Aunque los ndices de diversidad para cada localidad muestran que las comunidades no estn completamente dominadas por una especie, probablemente Linepithema s est desplazando a otras especies de hormigas. La diferencia en los patrones de diversidad en las cuatro localidades, puede deberse a factores como la altura, las precipitaciones, el porcentaje de cobertura boscosa y grado de conservacin de las mismas. Las especies nicas a las zonas boscosas, se proponen como posibles especies indicadoras de la regeneracin. Dichas especies son para San Cristbal: Pheidole sp2, Rhopalothrix sp1, Rogeria sp2; para San Antonio de Prado: Aphaenogaster sp1, Camponotus sp1, Camponotus sp2, Cyphomyrmex sp2, Myrmelachista sp1, Pheidole sp7; para Santa Elena: Camponotus sp1, Rogeria sp1, Crematogaster sp1, Hypoponera sp2, Myrmelachista sp1, Pachycondyla sp2, Pheidole sp6, Solenopsis sp2; y finalmente para San Sebastin de Palmitas: Pheidole sp2, Myrmelachista sp1 y Cyphomyrmex sp1. Para el Valle de Aburr no exista mucha informacin, principalmente de zonas altas. As, este es el primer trabajo de hormigas realizado exclusivamente en

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

reas montanas en el valle, lo cual constituye un valioso aporte al conocimiento de la mirmecofauna montana del norte de la Cordillera Central de los Andes colombianos. El establecimiento de la lnea base de diversidad de hormigas, requiere realizar muestreos en perodos de transicin y perodos secos del ao, puesto que se ha mostrado que en las diferentes pocas del ao la diversidad de insectos cambia significativamente. Igualmente es importante continuar con los monitoreos a mediano y largo plazo, cubriendo todos periodos climticos del ao, que permitan observar cambios en la composicin de especies de estas comunidades, que a su vez muestren cambios reales en la funcionalidad del ecosistema y la efectividad de los procesos de restauracin. BIBLIOGRAFA Alonso LE, Agosti D. 2000. Chapter 1: Biodiversity studies, monitoring, and ants: An Overview, pp. 1-8 en Agosti D, Majer JD, Alonso LE, Schultz TR. (eds.). Ants: Standard methods for measuring and monitoring biodiversity . Smithsonian Institution Press, Washington. Arcila AM, Lozano-Zambrano FH. 2003. Captulo 9: Hormigas como herramienta para la bioindicacin y el monitoreo, pp. 159-166 en Fernndez F. (ed.). 2003. Introduccin a las Hormigas de la regin Neotropical. Instituto de Investigacin de Recursos Biolgicos Alexander von Humboldt, Bogot, Colombia. Bolton B. 1994. Identification Guide to the Ant Genera of the World. Harvard University Press. Massachusetts, USA. Fernndez F. 2003a. Introduccin a las Hormigas de la Regin Neotropical. Instituto de Investigaciones de Recursos Biolgicos Alexander Von Humboldt. Bogot, Colombia. XXVII + 398 p. Fernndez F. 2003b. Captulo 22: Subfamilia Myrmicinae . En: Fernndez F. (ed.). Introduccin a las Hormigas de la Regin Neotropical. Instituto de Investigaciones de Recursos Biolgicos Alexander Von Humboldt. Bogot, Colombia. XXVII + 398 p. Fernndez F, Palacio EE, MacKay W, MacKay E. 1996. Introduccin al estudio de las hormigas (Hymenoptera: Formicidae) de Colombia, pp. 349-412 en Andrade G, Amat G y Fernndez F (eds.), Insectos de Colombia. Estudios Escogidos. Academia Colombiana de Ciencias Exactas, Fsicas y Naturales, Coleccin Jorge lvarez Lleras No. 10 y Centro Editorial Javeriano (CEJA), Bogot D.C. Fernndez F, Sendoya S. 2004. List of Neotropical ants (Hymenoptera: Formicidae). Biota Colombiana 5(1): 3-93.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Hammer O, Harper DAT, Ryan PD. 2001. PAST: Paleontological Statistics software package for education and data analysis. Version 2.07. Paleontologia Electronica, 4(1): 9. Holdridge L. 1978. Ecologa basada en zonas de vida. San Jos, Costa Rica. Serna FJ, Vergara EV. 2001. Claves para la identificacin de subfamilias y gneros de hormigas de Antioquia y Choc, Colombia. Revista del Instituto de Ciencias Naturales y Ecologa, 7(1):5-41. Wilson EO. 2000. Foreword, pp. xv-xvi en Agosti D, Majer JD, Alonso LE, Schultz TR. (eds.). Ants: Standard methods for measuring and monitoring biodiversity. Smithsonian Institution Press, Washington. UNA APROXIMACION A LA RECONSTRUCCION BIOGEOGRAFICA EN LAS AREAS DE PARAMO EN EL NOROCCIDENTE DE LA CORDILLERA DE LOS ANDES Carlos Jimenez-Rivillas1, Juan M. Daza. Instituto de Biologa. Facultad de Ciencias Exactas y Naturales Universidad de Antioquia. A.A: 1226. Telfono: (57) (4) 2195624. Medelln, Colombia. Grupo Herpetolgico de Antioquia, Museo de Herpetologa Universidad de Antioquia. Medelln, Colombia. 1 carlosjr555@gmail.com La panbiogeografa es una escuela de la biogeografa que infiere conexiones histricas mediante el empleo de trazos que conectan fragmentos de una biota anteriormente continua. En este trabajo se realiz un anlisis panbiogeogrfico de los pramos del noroccidente de la cordillera de los andes, con el fin de establecer una hiptesis histrica sobre el origen y diversificacin de la fauna de alta montaa. Para esto se delimitaron las reas de paramo presentes en la cordillera de los andes en diferentes distritos, resultando en 15 distritos en total. Mediante la bsqueda en bases de datos de diferentes colecciones biolgicas y muestreos en campo, se aproximaron los listados de especies de vertebrados terrestres tales como Anfibios, Reptiles, Aves y Mamferos, que componen las biotas de las regiones de paramo. El anlisis de los datos se realiz mediante el empleo del software MartiTracks para la obtencin de los trazos simples, trazos generalizados y nodos. Se obtuvo un mapa con los puntos de distribucin de las diferentes especies de vertebrados terrestres y se muestran los trazos que son indicativo de afinidades biogeogrficas entre los distritos de pramo. Se obtuvieron trazos generalizados que surcan cada brazo de la cordillera de los andes, indicando una conexin histrica entre las diferentes reas de pramo. Este trabajo puede

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

considerarse como una fuente para estudios ecolgicos, evolutivos y permite disear planes de conservacin basados en endemismos biogeogrficos. Palabras clave: biogeografa, Colombia, Suramrica, vertebrados terrestres, vicarianza.

INTRODUCCIN Objetivo general Realizar un anlisis biogeogrfico de los pramos del noroccidente de la cordillera de los andes. Objetivos especficos Identificar la distribucin de las diferentes especies de vertebrados terrestres cuya rea de distribucin abarquen los complejos de paramos ubicados en el norte de la cordillera de los andes. Emplear el mtodo panbiogeogrfico para la elaboracin de una hiptesis biogeogrfica utilizando a las especies de los distintos linajes que componen las biotas de las regiones de paramo. MATERIALES Y MTODOS. Para este estudio se emplearn las reas de pramo ubicadas en el noroccidente de la cordillera de los andes. Se utilizar la delimitacin empleada segn Morales et al (2007), quien clasific las reas de pramo del noroccidente de los andes en tres grandes sectores que se subdividen a su vez en distritos. Ser finalmente los distritos las reas empleadas para el anlisis. Sector Cordillera Oriental: presenta 6 distritos, el primero es el distrito de Paramos Perij. Segundo, Distrito Paramos de los Santanderes. Tercero, Distrito Paramos de Boyac. Cuarto, Distrito Paramos de Cundinamarca. Quinto, Distrito Paramos los Picachos. Finalmente, Distrito Paramos Miraflores.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Sector Cordillera Central: presenta 4 distritos, el primero es el distrito Paramos Belmira. Segundo, Distrito Paramos Viejo Caldas-Tolima. Tercero, Distrito Paramos Valle-Tolima. Finalmente, Distrito Paramos Macizo Colombiano. Sector Cordillera Occidental: presenta 3 distritos, el primero es el distrito paramos de Paramillo. Segundo, Distrito Paramos de Frontino-Tatam. Tercero, Distrito Paramos del Duende-Cerro Plateado. Sector Nario-Putumayo: incluye el distrito Paramos Nario-Putumayo. Sector Sierra nevada de Santa Marta: incluye el Distrito Paramos de Santa Marta. Para el anlisis panbiogeogrfico se tomaran los puntos de distribucin de las especies de vertebrados terrestres (Anfibios, Saurpodos y Mamferos) cuyos registros abarquen los distritos de paramos delimitados para el estudio. Para efectuar el mtodo de panbiogeografa se empleara un nuevo algoritmo desarrollado por Echeverra y Miranda (2011) llamad o MartiTracks. Este algoritmo brinda un marco geomtrico y cuantitativo para llevar a cabo anlisis panbiogeogrficos como una herramienta alternativa a los mtodos ms tradicionales (i.e: mtodo de matrices de conectividad e incidencia y mtodo es compatibilidad de trazos) (Morrone, 2004). MartiTracks incluye funciones geomtricas y procesos que hacen de esta herramienta una alternativa cuantitativa y factible al anlisis tradicional de trazos (Echeverra y Miranda, 2011). RESULTADOS Y DISCUSIN. Se obtuvo un listado de las especies de vertebrados terrestres que habitan las reas de paramo del noroccidente de la cordillera de los andes. Tambin un mapa de la regin donde se ubican los puntos de distribucin de las diferentes especies de vertebrados terrestres y donde se muestre, los trazos que sean indicativo de afinidades biogeogrficas entre los distritos de paramo como prueba de la existencia de relaciones biogeogrficas entre los distritos de paramos. Los trazos equivalen a componentes biticos los cuales pueden ser ordenados jerrquicamente en un sistema de clasificacin biogeogrfica (Morrone, 2004). En este trabajo se obtuvieron trazos generalizados que indican una fuerte relacin biogeogrfica entre las distintas reas de paramos, indicando que los pramos ubicados en cada cordillera comparten afinidades biogeogrficas que indican una historia comn en su formacin. En el anlisis se muestran adems nodos, los cuales son identificados en los mapas como reas complejas, donde dos o ms trazos generalizados se superponen. Fueron interpretados por Croizat como zonas

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

de convergencia geobitica. El reconocimiento de nodos es uno de los aportes ms importantes de la panbiogeografa, y constituye el punto de partida para especular sobre la existencia de reas compuestas (Morrone, 2004). CONCLUSIONES. Este estudio permitir no solo proponer una hiptesis biogeogrfica para las zonas de paramos, adems tambin servir de fuente para estudios ecolgicos, evolutivos y para disear planes de conservacin basados en endemismos biogeogrficos. BIBLIOGRAFIA Echeverra-Londono S, Miranda-Esquivel DR. 2011. MartiTracks: a geometrical approach for identifying geographical patterns of distribution. PLoS ONE. 6(4): 18460 Morales M, Otero J, Van der Hammen T, Torres A, Cadena C, Pedraza C,Rodriguez N, Franco C, Betancourth JC, Olaya E, Posada E Cardenas L. 2007. Atlas de paramos de Colombia. Instituto de investigacin de recursos biolgicos Alexander von Humboldt. Bogota. p. 208. Morrone JJ. 2004. Panbiogegrafia, componentes biticos y zonas de transicin. Revista brasileira de entomologa. 48 (2): 149-162.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

VARIACIN ALTITUDINAL Y TEMPORAL DE LAS REDES DE INTERACCIN PLANTA-POLINIZADOR EN UN BOSQUE TROPICAL ANDINO Sandra E. Cuartas Hernndez1, Laura Gmez-Murillo. 1,2 Instituto de Biologa, Universidad de Antioquia; Medelln. 1 scuartas@biologia.udea.edu.co, 2scuartashdez@gmail.com RESUMEN El entendimiento de los factores que determinan la estructura de las interacciones mutualistas a nivel de comunidad es uno de los actuales objetivos en ecologa de redes. El propsito de este trabajo fue evaluar el efecto de un gradiente de elevacin y del tiempo en la estructura de las redes de interaccin plantapolinizador en un bosque montano en Colombia. Se trazaron 8 transectos separados 100 m a travs de un gradiente altitudinal entre 2200 y 2900 msnm. Se realizaron muestreos mensuales de plantas florecidas y todos los insectos visitantes florales. Se analizaron un total de 44 matrices bipartitas y se obtuvo para cada una de ellas, el nmero de especies de plantas y animales, el tamao de la matriz, el nmero de interacciones, la conectancia y el anidamiento. Se evalu la relacin entre dichos estimadores con la altitud y la precipitacin promedio mensual. En general, las redes fueron pequeas, mostraron alta conectancia y presentaron un patrn de organizacin de las interacciones no anidado. Se detect que la variacin en el nmero de plantas, el tamao de la matriz, el nmero de interacciones y la conectancia es mejor explicada por el tiempo que por la elevacin. Estos resultados estn asociados a la variacin en precipitacin. La escala espacial y temporal a la que fueron analizadas las redes de interaccin en este estudio permiti detectar patrones de interaccin contrastantes con los patrones previamente descritos en redes acumulativas. Adems, el patrn de interaccin especializado pero errtico, sugiere que la alta conectancia acoplada con interacciones dinmicas y oportunistas pueden representar un patrn de interaccin alternativo que confiere estabilidad ante las perturbaciones en ecosistemas tropicales Andinos.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Palabras clave: Anidamiento, Antioquia, Conectancia, Bosque montano, Redes de interaccin.

INTRODUCCIN Objetivos Evaluar el efecto del gradiente altitudinal y el tiempo en la estructura de las redes de interaccin planta-polinizador en un bosque montano tropical. Evaluar si la composicin de las comunidades de visitantes florales varan con la altitud o a lo largo del tiempo. MATERIALES Y MTODOS. Este estudio se realiz en la reserva La Mesenia-Paramillo, localizada en el Municipio de jardn, Antioquia, Colombia (5 30' 11"N, 75 51'7"E). y administrada por la Fundacin Colibr. La reserva comprende un rea de 1723 ha entre zona de conservacin y zona de uso intensivo del suelo. El rea de conservacin consiste en bosque pluvial nublado con fuertes pendientes entre 2150 y 3100 msnm. La precipitacin exhibe un patrn bimodal con dos periodos lluviosos y dos periodos secos (Ledesma-Castaeda 2011). Para registrar la presencia de polinizadores y plantas floreciendo se utiliz un mtodo basado en muestreo en transectos. Se trazaron ocho transectos de 100 x 4 m transversal a la pendiente de la montaa cada 100 m de elevacin entre 2200 y 2900 msnm. En estos transectos se realizaron ocho muestreos mensuales entre Octubre 2010 y Mayo 2011. En total se registraron datos para 64 unidades de muestreo. En cada visita, se registraron todas las plantas en flor y todos los insectos visitando las flores. Se construyeron las matrices de interaccin para cada unidad de muestreo y se analizaron. El tamao de la matriz, el nmero de plantas, el nmero de animales, el nmero de interacciones, la conectancia y el grado de anidamiento fueron calculados. De igual manera, el nmero de especies especialistas en cada red de interaccin fue calculado.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

El efecto de la elevacin y el tiempo fue evaluado usando un anlisis de varianza con dos factores.

RESULTADOS. Durante el periodo de ocho meses de este estudio, se registraron 42 especies floreciendo y 75 especies de insectos visitando las flores. En general, el nmero de especies por red fue pequeo. Estas redes son constituidas en promedio por 4 especies de plantas y 8 especies de insectos. Los valores de conectancia fueron en general altos, variando entre 0.17 y 0.57. En contraste, los valores de anidamiento fueron bajos. La elevacin tuvo efecto sobre el nmero de interacciones por red, mientras que el tiempo tuvo efecto sobre el nmero de plantas y el tamao de la red. El nmero de especies especialistas de plantas y polinizadores aument con la altitud. La composicin de especies fue altamente variable entre elevaciones y entre meses, con muy pocas especies en comn y ninguna especie de planta o insecto presentes en todas las elevaciones y meses. DISCUSIN. La estructura de las redes de interaccin planta-polinizador en el bosque montano estudiado revel amplia variacin a lo largo del gradiente altitudinal y del tiempo. Adems se detect una alta tasa de recambio de especies entre altitudes y meses. En general, las redes fueron pequeas con alta conectancia y un patrn de organizacin de las interacciones no anidado, todas, caractersticas contrastantes con lo reportado hasta el momento para redes de polinizacin en otros ecosistemas, en la mayora de los cuales los anlisis se han realizado en redes acumulativas, en contraste con este estudio en el cual el anlisis de unidades de muestreo con mayor resolucin espacial y temporal permiti detectar altos niveles de variacin. CONCLUSIN. Este estudio es un aporte inicial al entendimiento de los patrones de interaccin planta-polinizador en ecosistemas montanos en el trpico. Aunque altamente variables en estructura y composicin, las redes de interaccin de elevacin.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ACALIPTINOS (COLEOPTERA: CURCULIONIDAE) DE ZONAS ALTAS: ESTADO DEL CONOCIMIENTO E INTERACCIN CON SUS PLANTAS HOSPEDERAS Juliana Cardona-Duque1, Juan David Snchez-Rodrguez2. 1,2 Grupo de Entomologa Universidad de Antioquia (GEUA). Medelln, Colombia 1 jcardonad@gmail.com, 2juanpixie@gmail.com RESUMEN Los Acalyptini Thomson, son un grupo de Curculioninae con aproximadamente 280 especies descritas, en 41 gneros. La mayora de las especies visitan inflorescencias de Arecaceae y Cyclanthaceae, y algunas otras visitan Araceae, Asteraceae y e incluso otras eudicotiledneas. Pese a su importancia ecolgica, la fauna de acaliptinos en Colombia slo ha empezado a documentarse en los ltimos aos con el incremento de las colecciones de ciclantceas en Antioquia y con la reciente revisin de material proveniente de otras regiones del pas. Sin embargo, el conocimiento de los acaliptinos de zonas altas an es incipiente y la mayora de las especies reportadas, resultan en especies nuevas para la ciencia. Con el propsito de contribuir al conocimiento de los Acalyptini en Colombia, se presentan los registros de este grupo en bosques de alta montaa y pramo, y sus interacciones con sus plantas hospederas. Se registra la presencia de acaliptinos en dos gneros de Cyclanthaceae: Asplundia Harling y Sphaeradenia Harling; dos gneros de Araceae: Anthurium Schott y Xanthosoma Schott; un gnero Asteraceae: Espeletia Mutis ex Bonpl.; y un gnero de Melastomataceae: Tibouchina Aubl. Se encontraron especies de acaliptinos de los gneros Azotoctla Cardona-Duque & Franz (1 especie), Cotithene Voss (1 especie), Cyclanthura Franz (8 especies), Phyllotrox Schnherr (3 especies) y adems cuatro especies nuevas pertenecientes a dos gneros no descritos, uno de ellos con sus larvas parasitadas por bracnidos. Palabras clave: acaliptinos, Araceae, Cyclanthaceae, pramo, nuevos registros.

INTRODUCCIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Los colepteros son el grupo ms especioso y ampliamente distribuido en el planeta (Erwin 1997; Ghilarov 1981); dentro de estos, la familia Curculionidae con aproximadamente 51 000 especies descritas, es la ms diversa (Oberprieler et al. 2007). La mayora de los curculinidos son estrictamente fitfagos y su xito evolutivo ha sido atribuido principalmente a sus asociaciones con Angiospermas (Anderson 1995; Farrell 1998; Marvaldi et al. 2002). Una de estas asociaciones, es exhibida por los curculioninos de la tribu Acalyptini Thomson, 1859 y las Cyclanthaceae. Los Acalyptini, son un grupo con distribucin pantropical con cerca de 280 especies descritas, agrupadas en 41 gneros. Estn asociados especficamente a especies de Araceae, Arecaceae y Cyclanthaceae entre otras Angiospermas (Franz y Valente 2005), e incluyen a los polinizadores exclusivos de la subfamilia Carludovicoideae (Cyclanthaceae). A su vez, las inflorescencias de estas plantas hospederas, proveen a los curculinidos de un hbitat propicio para encontrar pareja, resguardarse, alimentarse, copular, ovipositar y en muchos casos, desarrollarse (Eriksson 1994). Para Colombia se haban registrado slo tres especies de Acalyptini en tierras bajas del occidente del pas, pertenecientes a los gneros Staminodeus, Ganglionus y Perelleschus, y especies del gnero Phyllotrox s.l. Sin embargo con el incremento de las colecciones botnicas en Antioquia y la revisin de material adicional proveniente de otras regiones del pas, se ha recolectado una cantidad considerable de muestras de los insectos asociados a las inflorescencias e infrutescencias de arceas y ciclantceas principalmente. Presentamos los registros de la tribu para algunas zonas altas, principalmente del departamento de Antioquia, incluyendo los primeros registros de algunas plantas hospederas. MATERIALES Y MTODOS Se recolectaron acaliptinos y sus hospederos en varias localidades del centro y oriente de Antioquia, generalmente en reas boscosas o en remanentes de bosques al occidente del Valle de Aburr. Para esto, se revisaron inflorescencias e infrutescencias almacenadas en etanol, de colecciones botnicas anteriores a 2007. Adicionalmente, se han realizado colectas no sistemticas en campo desde el 2007, buscando plantas en floracin o fructificacin, y recolectando los espdices completos. Adems se ha examinado material colectado por estudiantes y colegas durante los ltimos tres aos en diferentes regiones de Antioquia. Se revisaron las inflorescencias e infrutescencias, para recoger todas

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

las larvas, pupas y adultos. RESULTADOS La mayora de los ejemplares botnicos colectados fueron depositados en el Herbario de la Universidad de Antioquia (HUA). Los especmenes de insectos colectados se almacenaron en etanol al 70%, se llevaron al laboratorio de Colecciones Entomolgicas de la Universidad de Antioquia. Los Acalyptini se identificaron hasta gnero utilizando las descripciones y revisiones. Las identificaciones fueron confirmadas utilizando holotipos y paratipos, disponibles en la Coleccin de N. M. Franz en la Universidad de Puerto Rico en Mayagez (UPRM-InvCol). Finalmente los especmenes se depositaron en la Coleccin de Entomologa de la Universidad de Antioquia (CEUA). Los mapas de distribucin de los gneros se hicieron utilizando el programa ArcGis v. 9.3 (ESRI 1999-2008). Hasta el momento se han encontrado especmenes de Acalyptini pertenecientes a los gneros Azotoctla (1 especie), Cotithene (1 especie), Cyclanthura (8 especies), Phyllotrox (3 especies) y cuatro especies nuevas pertenecientes a dos gneros no descritos: Acalyptini gen. 2 (sensu Franz 2006), y un gnero de Phyllotrogina cercano a Systenotelus, cuyas larvas se han encontrado parasitadas por bracnidos. Se registraron acaliptinos en los gneros Asplundia Harling y Sphaeradenia Harling de Cyaclanthaceae; Xanthosoma Schott y Anthurium Schott de Araceae; Espeletia Mutis ex Bonpl. de Asteraceae; y Tibouchina Aubl. de Melastomataceae. Adicionalmente se encontraron curculinidos de la subfamilia Baridinae en ciclantceas, y se registraron otras familias de Coleoptera como Hydrophilidae, Melolonthidae (Cyclocephala spp.), Ptilidae y Staphylinidae. En los ltimos aos se han descrito varios gneros y especies de acaliptinos, principalmente de Centroamrica y algunas especies del norte de Suramrica, lo que ha dejado un marco de referencia importante que permite abordar la exploracin de la diversidad de este grupo en Colombia. El gnero Cotithene slo haba sido reportado por debajo de los 2 000 msnm; en Colombia se han encontrado dos especies, una nueva en tierras bajas y esta colectada a mas de 2 500 msnm. Del gnero Cyclanthura, se han encontrado 8 especies (1 descrita), a alturas superiores a los 2 000 msnm. Adicionalmente se

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

recolectaron adultos de un gnero no descrito de la subtribu Phyllotrogina, en infrutescencias de Sphaeradenia cuatrecasana Harling en la Cordillera Occidental. Gnero Azotoctla, recientemente descrito, es principalmente de tierras bajas, con una especie reportada hasta el momento por encima de los 2 000 msnm. Dentro Acalyptini gen 2. (sensu Franz) se encuentran los principales polinizadores de ciclantceas. Son visitantes frecuentes de varios gneros Araceae y Cyclanthaceae, y hasta el momento se han encontrado tres especies asociadas a Asplundia spp., y Sphaeradenia spp. Teniendo en cuenta la variacin morfolgica, la diversidad de hospederos que estos visitan y la carencia de un estudio sistemtico para este grupo de acaliptinos, cabe considerar que se trate de varios gneros. Aunque se han colectado especmenes de manera espordica en otros departamentos del pas, el conocimiento que se tiene de los acaliptinos en Colombia es casi nulo. As, es necesaria la colaboracin y el entusiasmo de investigadores que se interesen por descubrir, y documentar la diversidad tanto de plantas como de sus insectos asociados en el pas. BIBLIOGRAFA ANDERSON, R. S. 1995. An evolutionary perspective on diversity in Curculionoidea. Memoirs of the Entomological Society of Washington, 14: 103-114. ERIKSSON, R. 1994. The remarkable weevil pollination of the neotropical Carludovicoideae (Cyclanthaceae). Plant Systematics and Evolution 189: 75-81. ERWIN, T. L. 1997. Chapter 4: Biodiversity at Its Utmost: Tropical Forest Beetles. En: Reaka-Kudla, M. L.; Wilson, D. E.; Wilson, E. O. (eds.). Biodiversity II. Understanding and Protecting Our Biological Resources. Joseph Henry Press. Washington, D.C. USA. 551 p. FARRELL, B. D. 1998. Inordinate Fondness Explained: Why Are There So Many Beetles? Science 281: 555-559. FRANZ, N. M. 2006. Towards a phylogenetic system of derelomine flower weevils (Coleoptera: Curculionidae). Systematic Entomology 31: 220-287. FRANZ, N. M.; VALENTE, R. M. 2005. Evolutionary trends in derelomine flower weevils: from associations to homology. Invertebrate Systematics 19: 499-530. GHILAROV, M. 1981. Foreword. En: Crowson, R. A. 1981. The Biology of Coleoptera. Academic Press Inc. (London) Ltd. 745 p. MARVALDI, A. E.; SEQUEIRA, A. S.; OBRIEN, C. W.; FARRELL, B.D. 2002. Molecular and morphological phylogenetics of weevils (Coleoptera:

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Curculionoidea): do niche shifts accompany diversification? Systematic Biology 51(5): 761-785. OBERPRIELER, R. O.; MARVALDI, A. E.; ANDERSON, R. S. 2007. Weevils, weevils, weevils everywhere. Zootaxa 1668: 491-520.

MARIPOSAS EN LA RESERVA NATURAL EL ROMERAL: APORTE DE

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

VERTIENTES PARA LA CONSERVACIN DE LA DIVERSIDAD REGIONAL. Mario Alejandro Marn Uribe1,2, Carlos Federico lvarez-Hincapi1,3*, Alejandra Clavijo-Giraldo1,4, Alba Lucia Marn Valencia 1,5 1 Laboratorio de Biologa y Sistemtica de Insectos, Universidad Nacional sede Medelln 2 Estudiante doctorado en Biologa Universidad de Antioquia, mamarin0@unal.edu.co. 3 Docente Corporacin Universitaria Lasallista, Estudiante doctorado en ecologa Universidad Nacional de Colombia sede Medelln, carlosfederico.lasallista@gmail.com. 4 Estudiante pregrado en Biologa Universidad de Antioquia, biologiamclg@gmail.com. 5 Egresada Ingeniera Forestal Universidad Nacional de Colombia sede Medelln, albamarin2003@gmail.com. RESUMEN La diversidad presente en reas sometidas a intervencin antrpica especialmente alrededor de las metrpolis contemporneas, representa un inters clave tanto para la conservacin como para las actividades de educacin ambiental-regional y es fundamental para el reconocimiento del capital natural como elemento para el desarrollo sustentable de las sociedades humanas. En el presente estudio se desarroll un inventario de la diversidad de mariposas diurnas presentes en la Reserva Natural El Romeral (desde 2500 a 2850 m.s.n.m.) en las vertientes del ro Cauca y del Valle de Aburr (a partir del muestreo con trampas de cebo y captura con jama), zonas que representan elementos para la conservacin de la fauna silvestre regional en el entorno urbano del Valle de Aburr y reas aledaas. Se reportan ms de 70 especies entre ambas vertientes, con 42 especies en la vertiente del ro Cauca, 52 especies en la vertiente del Valle de Aburr y 54 especies en la parte alta de la divisoria de ambas vertientes, presentndose especies no compartidas y abundancias diferenciales entre vertientes y la divisoria. Esto resalta la importancia de ambas vertientes para la conservacin de la lepidopterofauna presente en el rea y la necesidad de complementar estrategias de conservacin entre los municipios para preservacin de la diversidad regional. Palabras clave: Antioquia, conservacin de biodiversidad, Romeral, vertientes. INTRODUCCIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

En los Andes tropicales la sustitucin de las reas naturales hacia paisajes dominados por la actividad humana ha llevado a la eliminacin de organismos nativos y una reduccin de las reas de bosque natural en las cuales para algunas regiones solo persisten unos pocos remanentes de hbitat natural que juegan un importante papel en el mantenimiento de la diversidad de especies nativas (KINTZ et al. 2006, LA TORRE-CUADROS 2007, RICHTER 2008). Este fenmeno de fragmentacin es especialmente marcado en las zonas circundantes a las grandes concentraciones urbanas que, para el caso del Valle de Aburr, deja la presencia de una serie de fragmentos de bosques de diferente tamao que rodean el rea metropolitana y donde la Reserva Natural El Romeral tiene un papel prioritario siendo la mayor rea boscosa del occidente del valle (GONZLEZ 2003; CORANTIOQUIA 2004). As, el estudio de la diversidad presente en los remanentes de bosque provee herramientas tiles para el diseo de estrategias de conservacin que permiten maximizar la persistencia de la biodiversidad local y favorecer su conectividad (MARGULES et al. 2002, HILTY et al. 2006, GRADSTEIN 2008). En este sentido, los inventarios de diversidad focalizados en grupos taxonmicos particulares han sido propuestos como un mecanismo til que permite una aproximacin al conocimiento del estado de la biodiversidad en un rea determinada (DUELLI & OBRIST 2003, MAC NALLY & FLEISHMAN 2004, NIEMI & MCDONALD 2004). las mariposas son uno de los grupos taxonmicos ms empleados en este tipo de estudios, tanto en ecosistemas tropicales (CLEARY 2004, MILLER et al. 2011) como templados (MAC NALLY & FLEISHMAN 2004, WARD & LARIVIRE 2004, ROSSI & VAN HALDER 2010). El uso de las comunidades de mariposas como indicadores ecolgicos se debe a que estas son sensibles a los cambios que se producen por perturbaciones en su hbitat que pueden afectar su estructura, composicin o funcin de sus especies, poblaciones y/o historias de vida (BROWN 1997, NEW 1997, ANDRADE 1998), razn por lo cual la medicin de algunas o varias de estas caractersticas constituyen una herramienta valida para evaluar las condiciones de un ecosistema (NIEMI & MCDONALD 2004). Principalmente en mariposas, los estudios se han enfocado en conocer la composicin de especies y gneros, brindando informacin del ecosistema como la composicin vegetal (CLEARY 2004, FLEISHMAN et al. 2005a), la biodiversidad (FLEISHMAN et al. 2005b, FLEISHMAN & MURPHY 2009, BRERETON et al. 2011), conservacin del paisaje (BROWN & FREITAS 2000) o cambio climtico (PARMESAN et al. 1999). El objetivo del presente estudio fue determinar la diversidad, estructura y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

composicin de la comunidad de mariposas presente en la Reserva Natural El Romeral, evaluando el estado de preservacin de esta rea protegida y reflejando su importancia como relicto de bosque del permetro urbano del Valle de Aburr, adems de contribuir al conocimiento zoogeogrfico de las mariposas de tierras altas. Por otra parte, se busc comparar el grado de similitud y las diferencias en composicin y estructura de la comunidad de mariposas entre las dos vertientes que hacen parte del rea de estudio: una orientada hacia el ro Cauca y la otra hacia el Valle de Aburr, esto ltimo como aporte al conocimiento y estado de conservacin de la diversidad regional. MATERIALES Y MTODOS. Zona de estudio: La Reserva Natural El Romeral se encuentra ubicada al suroccidente del Valle de Aburr sobre la Cordillera Central entre los paralelos 605 a 613 de latitud Norte y los meridianos 7539 y 7543 de longitud Oeste, en jurisdicciones de los municipios de Medelln, Caldas, Heliconia, Angelpolis y La Estrella. Abarca una extensin total de 5.171 hectreas y su altura mxima est representada por el Alto El Romeral con una altura cercana a los 2900 msnm (CORANTIOQUIA 2004). El Romeral, junto con el Cerro del Padre Amaya y El Alto Las Baldas conforma el Distrito de Manejo Integrado del rea de Reserva de la Ladera Occidental del Valle de Aburr -DMI AROVA- y hace parte de los ecosistemas estratgicos del rea metropolitana (URIBE 2011). La zona est caracterizada por una alto nivel de lluvias con un promedio anual por encima de los 2000 mm, siendo los meses ms hmedos entre mayo y octubre y los menos hmedos entre diciembre y febrero (CORANTIOQUIA 2004). En la reserva, el bosque de niebla se encuentran en las zonas altas por encima de los 2500100 m.s.n.m., que de acuerdo al sistema de clasificacin de zonas de vida de HOLDRIDGE (1967) hace parte del bosque muy hmedo montano bajo (bmh-MB) y en su parte ms alta por encima de los 2800 msnm al bosque pluvial montano (bp-M). Muestreo: Se realizaron 13 das de colecta con un equipo de 6 personas entre 8 am - 5 pm, para un total de 702 horas de muestreo. El muestreo se realiz entre febrero de 2010 y marzo de 2011, abarcando los diferentes ciclos de lluvias para zona. La captura de las mariposas se hizo mediante bsqueda activa con redes entomolgicas y el empleo de 12 trampas Van Someren-Rydon (DEVRIES 1987) colocadas entre 1 y 3 m sobre el nivel del suelo y cebadas con pescado o fruta en descomposicin. La distancia entre trampas fue de 100 m altitudinales para

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

aquellas ubicadas en la vertiente y de 100 m lineales para trampas ubicadas en la parte alta de la montaa. Los datos de colecta se georreferenciaron en GPSmap Garmin 60CSx calibrados a puntos fijos conocidos. Todos los individuos fueron guardados independientemente en sobres de papel, marcando in situ los datos de georreferenciacin correspondientes. Taxonoma: El material colectado fue examinado en el Laboratorio de Biologa y Sistemtica de Insectos de la Universidad Nacional de Colombia Sede Medelln y posteriormente depositado en la coleccin del Museo Entomolgico Francisco Luis Gallego (MEFLG). Los taxa en su mayora fueron identificados a nivel de especie y cuando fue necesario, se llevo la identificacin a nivel de subespecie. Para especies taxonmicamente complejas se realizaron disecciones de la genitalia del macho siguiendo el procedimiento estndar de maceracin de la estructura en KOH al 10% y preservando permanentemente la genitalia en glicerol. Las estructuras fueron examinadas bajo un esteremicroscopio Olympus SZX16. Analisis de datos: los datos obtenidos se analizan bajo parmetros propuestos por Lou Jost (2006) utilizando los nmeros de Hill y calculado los valores q o, q1 y q2 (riqueza de especies, exponencial de Shannon e inverso de Simpson respectivamente) como perfiles de diversidad verdadera y nmeros equivalentes. RESULTADOS Y DISCUSIN. Se reporta para la zona de estudio en la Reserva Natural El Romeral un total de 75 especies, 42 especies en la vertiente del ro Cauca, 52 especies en la vertiente del Valle de Aburr y 54 especies en la parte alta de la divisoria de ambas. Las especies se encuentran distribuidas entre las familias Nymphalidae, Pieridae, Riodinidae, Lycaenidae y Hesperiidae. Ya que se trata de un ecosistema altoandino con altitudes superiores a los 2500 m.s.n.m., la subfamilia Satyrinae y en especial la subtribu Pronophilina presenta la mayor riqueza de especies, sobrepasando el 50% del total reportado. Son las familias diferentes a Nymphalidae las que poseen poca representacin dentro del muestreo bien puede ser por la dominancia de la familia Satyrinae como por las dificultades de muestreo de las dems o los tipos de cebo utilizados ya que son pocas las veces que se logra capturar individuos diferentes a esta subfamilia en las trampas empleadas. Se registra una tendencia general hacia el aumento en el nmero de individuos para todas las especies entre los meses de enero a marzo, los cuales han sido reportados como los ms lluviosos. Aunque las abundancias son variables, se

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

observa una fuerte dominancia de las especies Pedaliodes baccara Thieme y Pedaliodes praegmontagna Pyrcz & Viloria, siendo tambin este gnero altamente diverso y abundante. Al comparar composicin de especies (valor qo) entre las vertientes y la divisoria, se observa que existe una tendencia a la diferenciacin en cuanto a las especies compartidas, pero en cuanto a abundancias y dominancias de las especies en cada sitio, los valores q1 y q2 (Exponencial de Shannon e inverso de Simpson) dan evidencia de un grado mayor de similaridad entre las localidades al compartirse las especies abundantes y ser estas igualmente dominantes para todos los sitios. Finalmente, es la divisoria de las vertientes el sitio que se encuentra ms diferenciado en cuanto a composicin y abundancia. Aunque presenta especies compartidas con ambas vertientes, el rango que ofrece a estas es mucho ms estrecho tanto por su ubicacin como por altitud, presentando una variedad de nichos diferentes que los ofrecidos por las vertientes. Debido a esta considerable diferenciacin en cuanto a la composicin de especies sostenidas por las dos vertientes y la divisoria, se resalta la gran importancia de la implementacin de estrategias de conservacin y restauracin de estos ecosistemas aledaos a los centros urbanos, as como la sostenibilidad de estos corredores ecolgicos que aseguren la permanencia de la diversidad a escala local y regional. BIBLIOGRAFA ANDRADE-C, M.G. 1998. Utilizacin de las mariposas como bioindicadoras del tipo de hbitat y su biodiversidad en Colombia. Revista de la Academia Colombiana de Ciencias Exactas, Fsicas y Naturales 22 (84): 407-421. BRERETON, T.; D.B. ROY; I. MIDDLEBROOK; M. BOTHAM & M. W ARREN. 2011 The development of butterfly indicators in the United Kingdom and assessments in 2010. Journal of Insect Conservation 15 (1-2): 139-151. BROWN, K.S. 1997. Diversity, disturbance, and sustainable use of Neotropical forests: insects as indicators for conservation monitoring. Journal of Insect Conservation 1: 25-42. BROWN, K.S. & A.V.L. FREITAS. 2000. Atlantic forest butterflies: indicators for landscape conservation. Biotropica 32: 934-956. CORANTIOQUIA. 2004. Programa integral de educacin y comunicacin a las comunidades de Angelpolis, Caldas y La Estrella, para la conservacin y el

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

manejo sostenible de los recursos naturales de la reserva forestal alto el romeral y la va parque Angelpolis Caldas. Medelln. Fundacin con Vida.194 p. CLEARY, D.F.R. 2004. Assessing the use of butterflies as indicators of logging in Borneo at Three Taxonomics Levels. Journal of Economic Entomology 97 (2): 429435. DEVRIES, P.J. 1987. The Butterflies of Costa Rica and their Natural History. New Jersey, Princeton University. 327 p. DUELLI, P. & M.K. OBRIST. 2003. Biodiversity indicators: the choice of values and measures. Agriculture, Ecosystems and Environment 98: 87-98. FLEISHMAN, E. & D.D. MURPHY. 2009. A realistic assessment of the indicator potential of butterflies and other charismatic taxonomic groups. Conservation Biology 23 (5): 1109-1116. FLEISHMAN, E.; R. MAC NALLY & D.D. MURPHY. 2005a. Relationships among nonnative plants, diversity of plants and butterflies, and adequacy of spatial sampling. Biological Journal of the Linnean Society 85 (2): 157-166. FLEISHMAN, E.; J.R. THOMSON; R. MAC NALLY; D.D. MURPHY & J.P. FAY. 2005b. Using indicator species to predict species richness of multiple taxonomic groups. Conservation Biology. 19 (4): 1125-1137. GONZLEZ, A. 2003. El Romeral como proveedor de Servicios Ambientales para el Valle de Aburr. EOLO Revista Ambiental 3 (8): 16-17. GRADSTEIN, S.T. 2008. Epiphytes of tropical montane forests - impact of deforestation and climate change, p. 51-65. In: S.R. Gradstein., J. Homeier & D. Gansert (Eds). Biodiversity and Ecology Series 2: The Tropical Mountain Forest Patterns and Processes in a Biodiversity Hotspot. Gttingen, Universittsverlag Gttingen, 217p. HILTY, J.A.; W.Z. LIDICKER & A.M. MERENLENDER. 2006. Approaches to achieving habitat connectivity, p. 89-112 . In: J.A. Hilty., W.Z. Lidicker & A.M. Merenlender (Eds). Corridor Ecology: The Science and Practice of Linking Landscapes for Biodiversity Conservation. Washington DC, Island Press, 344 p. HOLDRIDGE, L.R. 1967. Life Zone Ecology. San Jos. Tropical Science Center. 206 p. KINTZ, DB.; K.R YOUNG & K.A. CREWS-MEYER. 2006. Implications of land use/land cover change in the buffer zone of a national park in the tropical Andes. Environmental Management 38 (2): 238-252. LA TORRE-CUADROS, M.; S. HERRANDO-PREZ & K.R. YOUNG. 2007. Diversity and structural patterns for tropical montane and premontane forests of central Peru, with an assessment of the use of higher-taxon surrogacy. Biodiversity and Conservation 16: 29652988. LOU JOST. 2006. Entropy and Diversity. OIKOS 113 (2): 363-375.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

MAC NALLY, R. & E. FLEISHMAN. 2004; A successful predictive model of species richness based on indicator species. Conservation Biology 18 (3): 646-654. MARGULES, C.R.; R.L. PRESSEY & P.H. W ILLIAMS. 2002. Representing biodiversity: data and procedures for identifying priority areas for conservation. Journal of Bioscience 27 (Suppl. 2): 309326. MILLER, D.G.; J. LANE & R. SENOCK. 2011. Butterflies as potential bioindicators of primary rainforest and oil palm plantation habitats on New Britain, Papua New Guinea. Pacific Conservation Biology 17 (2): 149-159. NEW , T.R. 1997. Are Lepidoptera an effective umbrella group for biodiversity conservation?. Journal of Insect Conservation 1: 5-12. NIEMI, G.J. & M.E. MCDONALD. 2004 Application of ecological indicators. Annual Review of Ecology, Evolution, and Systematics 35: 89-111. PARMESAN, C.; N. RYRHOLM; S. CONSTANT; J.K. HILL; C.D. THOMAS; H. DESCIMON; B. HUNTLEY; L.KAILA; J. KULLBERG; T. TAMMARU; W.J. TENNENT; J.A. THOMAS & M. WARREN. 1999. Poleward shifts in geographical ranges of butterfly species associated with regional warming. Nature 399: 579-583. RICHTER, M. 2008. Tropical mountain forests distribution and general features, p. 7-24. In: S.R. Gradstein., J. Homeier & D. Gansert (Eds). Biodiversity and Ecology Series 2: The Tropical Mountain Forest Patterns and Processes in a Biodiversity Hotspot. Gttingen, Universittsverlag Gttingen, 217 p. ROSSI, J-P. & I. VAN HALDER. 2010. Towards indicators of butterfly biodiversity based on a multiscale landscape description. Ecological Indicators 10 (2): 452-458. URIBE, C.M. 2011. Gua de campo reserva El Romeral. Medelln, rea Metropolitana del Valle de Aburr, 38 p. WARD, D.F. & M-C. LARIVIRE. 2004. Terrestrial invertebrate surveys and rapid biodiversity assessment in New Zealand: lessons from Australia. New Zealand Journal of Ecology. 28 (1): 151-159.

RIQUEZA Y COMPOSICIN DE LAS MARIPOSAS EN LA PARTE ALTA DE LAS LADERAS DEL VALLE DE ABURRA Laura Isabel Ros Marn1, Carlos Alberto Gutierrez2.
1

Grupo de Entomologa, Lauraisrima@gmail.com.

Universidad

de

Antioquia

(GEUA),

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL


2

Centro para la investigacin en sistemas sostenibles de produccin agropecuaria (CIPAV) carlosguty@gmail.com. RESUMEN Debido a su abundancia, diversidad, su grado de sensibilidad a cambios ambientales, las mariposas han sido utilizadas ampliamente como grupo bioindicador. Con el fin de conocer la composicin y la estructura de la comunidad de mariposas presentes en los bosques montanos de la ciudad de Medelln y realizar comparaciones con parturas intervenidas con procesos de regeneracin natural asistida (RNA) se realiz el levantamiento de la lnea base del programa de monitoreo de diversidad biolgica del proyecto Ms bosques para Medellns, ejecutado por la fundacin CIPAV con financiacin de la SMA, el rea metropolitana, la gobernacin de Antioquia y Ecopetrol. Se realizaron muestreos en cuatro corregimientos: Palmitas, Santa Elena, San Cristbal y San Antonio de Prado, en dos diferentes tipos de cobertura vegetal, Bosque y RNA, con redes entomolgicas y trampas. Se colectaron 720 individuos pertenecientes a 6 familias y 68 especies, la familia ms abundante y diversa fue Nymphalidae, a nivel de subfamilia la que presento mayor nmero de especies fue Satyrinae, la cual estuvo representada totalmente por la tribu Satyrini. En todas las localidades el bosque fue el tipo de cobertura vegetal ms diverso. Se reportan cuatro nuevos registros altitudinales. Con este muestreo se pudo obtener informacion que prmitio conocer a grandes rasgos las comunidades de las laderas del Valle del Aburr, indicando la importancia de seguir realizando monitoreos a largo plazo, para as asegurar la representatividad de las especies presentes y conocer las dinmicas de las poblaciones y los cambios en la vegetacin durante los procesos de RNA. Palabras clave: Bosque montano. Regeneracin Naturaral Asistida, Satyrinae, Mas Bosques para Medelln

INTRODUCCIN Objetivos Realizar la lnea base (composicin y estructura) de las mariposas en las bosques montanos de la ciudad de Medelln. Evaluar las diferencias de composicin de mariposas que ocurren entre la Regeneracin Natural Asistida y los bosques montanos aledaos de referencia. Seleccionar las principales especies indicadoras de cada tipo de ecosistema

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

MATERIALES Y MTODOS Los muestreos se realizaron en cuatro predios de la Alcalda de Medelln donde se adelantan labores de restauracin mediante la siembra de rboles nativos en lo que se conoce como regeneracin natural asistida (RNA). Todos los predios estudiados pertenecen al del Municipio de Medelln (Antioquia, Colombia): 1 Corregimiento San Sebastin de Palmitas Vereda La Volcana (parte alta) 2 Corregimiento de Santa Elena, vereda el Llano 3 corregimiento San Cristbal, vereda La Palma, finca El Moral y 4 corregimiento de San Antonio de Prado, Vereda Astillero sector piedra Galana, estas localidades estn ubicadas entre los 2440 msnm y 2876msnm. En cada sitio de muestro se ubicaron dos tipos de cobertura vegetal: Bosque secundario y predios con RNA. En cada tipo de cobertura vegetal se realizaron colectas por medio de redes entomolgicas o jams y trampas Van Someren Rydon (TVSR), como las describe Villareal y colaboradores (2006) adems de avistamientos en los mismos lugares; los ejemplares colectados se marcaron con sus respectivos datos de colecta. Una muestra de 5 ejemplares por especie se mont en alfiler entomolgico y el resto se conservaron en sobres de papel glasine. Todos los anteriores debidamente rotulados, se les asign un cdigo nico de la Coleccin de Entomologa Universidad de Antioquia (Registro Nacional de colecciones 36), donde fueron depositados. La determinacin taxonmica se realiz por comparacin con imgenes de las guas ilustradas de D Abrera (1987), DeVries (1987, 1997), Le Crom et al. (2002, 2004), Neild (1996), Valencia (2005), Velez et al. (2009), Willmott (2003) y Warren et al. (2006, 2011). En el ordenamiento taxonmico de la familia Hesperiidae se sigui a Warren y colaboradores (2008) y para actualizacin de la nomenclatura en general, se emple la lista de revisin editada por Lamas (2004). Las determinaciones fueron corroboradas por la Magister Patricia Duque con la coleccin de referencia del Museo entomolgico de Piedras Blancas. Para la composicin de especies se determin la riqueza en cada tipo de cobertura vegetal seleccionada y para la estructura se utilizaron los ndices de Hill (1973) (N0, N1 N2, N3), Shannon & Weaver (1949) y Simpson (1949), al igual que los ndices de riqueza de Margalef (1958) (R1) y de Menchinick (1964) (Ludwig y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Reynolds (1988). Para observar el grado de diferencia en la composicin de especies se realizo grfico de especies compartidas entre el RNA y el bosque reuniendo los datos de todas las localidades. Se seleccionaron las especies ms relevantes como grupo bioindicador. RESULTADOS Y DISCUSIN Se colectaron 720 individuos pertenecientes a 6 familias, 18 subfamilias, 38 gneros y 68 especies. No se encontraron trabajos con los cuales se pudiera comparar la riqueza observada del rea de estudio, y el nico listado de especies para la zona es la gua de campos de mariposas del parque ecolgico de Piedras Blancas elaborada por Vlez y colaboradores en 2006, quienes reportan 130 especies en un trabajo intenso durante 5 aos. Nymphalidae fue la familia con mayor nmero de especies y la ms abundante seguida por Hesperidae, Pieridae, Lycaenidae, Riodinidae y Papilionidae, el que la familia Nymphalidae fuese la ms colectada y con el mayor nmero de especies, se explica, porque esta familia presenta la mayor variedad a nivel de subfamilias, gneros y especies, a tal punto que se ha estimado que un tercio de las especies de mariposas del mundo pertenecen a esta familia. A nivel de subfamilia, la que presenta mayor nmero de especies es Satyrinae, la cual estuvo representada totalmente por la tribu Satyrini, dominante en tierras altas, ya que estn adaptadas fisiolgica y comportamentalmente (tipo de coloracin y horas de vuelo) para soportar dichas condiciones extremas, adems de su relacin con las platas presentes en estos tipos de hbitat. Los ndices de riqueza y diversidad calculados, basados en nmero de especies y su abundancia, muestran que en todas las localidades el bosque es el lugar ms diverso, As mismo, hay mas especies exclusivas en el bosque que en la RNA, y se comparte solo el 29% de las especies mostrando a si un gran recambio de especies. Se pudo apreciar que el nmero de individuos en la localidad de Santa Elena es mucho mayor, en esta localidad el bosque est altamente intervenido y un rea muy reducida, adems esta embebido en una matriz, en la cual se estn realizando las labores de RNA, por esto en esta localidad es la que presenta menor cantidad de recursos de alimentacin a las mariposas. La especie mas abundante en esta localidad fue Panyapedaliodes cf. drymaea (Hewitson, 1858)

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

con 245 individuos, la cual se colect principalmente en RNA, esta especie se alimenta posiblemente de los pastos de los gneros Agrostis y Poa, y es la de las pocas especies de la subtribu Pronophillilina, al igual que Pedaliodes manis (C. Felder & R. Felder, 1867) que prefiere habitats deforestados (Velez et al. 2006), lo que la hace una especie indicadora de un fuerte grado de intervencin. La segunda localidad con mayor cantidad de individuos es Palmitas, en esta localidad el bosque estaba bien conservado y el rea de bosque es casi ininterrumpida, presentaba gran cantidad de Chusquea scandens., planta nativa que se reproduce con mucha facilidad y en la que muchas de las especies de la tribu Satyrini (la gran mayora en estos muestreos) se alimentan. En la localidad de palmitas las TVSR fueron las ms efectivas, mientras que en el Astillero y el Moral con jama se colectaron la mayor cantidad de individuos, y por ltimo el avistamiento en Santa Elena fue el ms efectivo. Estas diferencias en los mtodos de colecta por localidad, indican la importancia de utilizarlos, en todas ellas. Adems las familias Pieridae, Papilionidae y Riodinidae y la subfamilia Ithomiinae fueron colectadas solo con jama, estos resultados se deben principalmente al tipo de hbito alimenticio de cada grupo, como es el caso de estas familias que se alimentan principalmente con nctar de flores (DeVries 1987, 1997), y no son atradas a las TVSR. Otro factor que influye altamente es la cantidad de lluvias, durante los muestreos en esta en la localidad de Santa Elena las lluvias fueron muy frecuentes en horas de la tarde lo cual impeda la recolecta de algunos individuos en las TVSR. Eurema salome salome, Dismorphia arcadia diana y D. mirndola estn reportadas hasta los 2500 msnm, y en este trabajo se encontraron a una altura de 2600 msnm. Patricia dercyllidas, Tiene su distribucin desde Venezuela hasta Per, en Colombia se encuentra distribuida en las tres cordilleras, con alturas entre 1600msnm y 2300msnm, en la localidad de palmitas se colecto a 2650msnm. Convirtindose en un nuevos registros altitudinal. CONCLUSIONES Se encontr que el nmero de especies en los bosques montanos de Medelln es alta con 68 especies, siendo la Subfamilia Satyrinae la que presenta mayor nmero de especies e individuos, debido principalmente a sus hbitos alimenticios y la abundancia de sus plantas hospederas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Se encontr que en general el bosque tiene una mayor diversidad de mariposas que la RNA, esto debido principalmente a la mayor cantidad de especies de plantas en estos ecosistemas y a mejores condiciones microclimticas para la mayora de las especies, aunque los bosques montanos donde se realizaron los muestreos presentan algn grado de intervencin, son mucho menos intervenidos que la RNA, cuyo proceso se est iniciando en potreros abiertos. El nmero de individuos en las localidades est estrechamente ligado a las condiciones de los lugares, stas pueden ser muy abundantes por homogeneidad en los recursos, implicando muchos individuos de la misma especie; o por heterogeneidad de los recursos, con muchos individuos de especies diferentes. Es importante al realizar muestreos de mariposas con diferentes mtodos de colecta, los cuales permitan muestrear toda la diversidad de los lugares. Puesto que depende de las condiciones de los lugares, vara la efectividad de uno u otro tipo de muestreo. Los datos recogidos permitieron ampiliar el rango de distribucin altitudinal de las especies Eurema salome salome, Dismorphia arcadia diana, D. mirandola y Patricia dercyllidas, ya que solo estaban reportadas entre los 1200 y 2500 msnm. Durante los muestreos, individuos representantes de estas cuatro especies se colectaron a una altura de 2600 msnm. BIBLIOGRAFIA D Abrera B. 1987. Butterflies of the Neotropical Region. Part III. Brassolidae, Acraeidae, Nymphalidae (partim.) .Hill House. Victoria, Australia.525 p. DeVries PJ. 1987. Butterflies of Costa Rica and their natural history: volumen I (Papilionidae, Pieridae, Nymphalidae) Princeton Univ. Press, New Jersey. DeVries PJ. 1997. Butterflies of Costa Rica and their natural history: volumen II (Riodinidae) Princeton Univ. Press, New Jersey. Lamas G. (ED.). 2004. Atlas of neotropical Lepidoptera. Checklist: Part 4A. Hesperoidea-Papilionoidea. Florida, Gainesville: Association for Tropical Lepidoptera 439 pp. Le Crom J, Constantino LM y Salazar JA. 2003. Mariposas de Colombia. Tomo I. Familia Papilionidae. Bogot (Colombia): Carlec Ltda. Edicin Espaola. Le Crom J, Constantino LM y Salazar JA. 2004. Mariposas de Colombia. Tomo II: Familia Pieridae. Bogot (Colombia): Carlec Ltda. 113. Ludwig JA y Reynolds JF. 1988. Statistical ecology: a primer on methods and

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

computing. United States of America. Wiley-interscience publication. 337p. Neild AFE. 1996. The butterflies of Venezuela, Parte1: Nymphalidae I (Limenitidinae, Apaturinae, Charaxine). Greenwich (London) Meridian Publications. 144 p. Valencia C, Gil Z y Constantino LM. 2005. Mariposas diurnas de la zona Central Cafetera Colombiana. Gua de Campo. Cenicaf, Chinchina, Colombia. 244 p. Velez B, Duque P y Wolff M. 2009 mariposas del parque ecolgico de piedras blancas, guia de campo. Fondo editorial Comfenalco Antioquia. Medelln,Colombia. 209p. Villarreal H, lvarez M, Crdoba S, Escobar F, Fagua G, Gast F, Mendoza H, Ospina M, Umaa AM. 2006. Manual de mtodos para el desarrollo de inventarios de biodiversidad. Segunda edicin. Bogot: Colombia. Programa de Inventarios de Biodiversidad. Instituto de Investigacin de Recursos Biolgicos Alexander Von Humboldt. 236 p. Warren AD, Davis KJ, Grishin NV, Pelham JP, Stangeland EM. 2011. Interactive Listing of American Butterflies. [9-VI-11] <http://www.butterfliesofamerica.com/ >. Warren AD, Llorente-Bousquets JE, Luis-Martnez A, Vargas-Fernndez I. 2006. Interactive Listing of Mexican Butterflies. Listado Interactivo de las Mariposas Mexicanas. [11-VII-08] < http://www.mariposasmexicanas.com/> Warren AD, Ogawa JR, y Brower AVZ. 2008. Phylogenetic relationships of subfamilies and circumscription of tribes in the family Hesperiidae (Lepidoptera: Hesperioidea). Cladistica. 24,1-35. Willmott KR. 2003. The Genus Adelpha: Its Systematics, Biology and Biogeography (Lepidoptera: Nymphalidae: Limenitidini). Gainesville (U.S.A.). Association for Tropical Lepidoptera. p 322.

AVIFAUNA ASOCIADA A CULTIVOS DE PAPA EN BOYAC Y CUNDINAMARCA. Gina Liliana Rojas Lizarazo1, Pablo Emilio Rodrguez Africano2, Javier Alvarado Macias3 Grupo de estudios ornitolgicos GEO_UPTC, Escuela de Ciencias Biolgicas. Universidad Pedaggica y Tecnolgica de Colombia. 1 giliroli@yahoo.es, 2pablo1emilio@gmail.com, 3jahualma@hotmail.com RESUMEN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Los departamentos de Colombia donde ms se cultiva papa (Solanum tuberosum) son Cundinamarca y Boyac. Esta actividad agrcola se realiza en cotas altitudinales superiores a 3.000 m; ubicndose en ecosistemas como bosques altoandinos y pramos, trayendo consigo una transformacin paulatina en la estructura y composicin de comunidades vegetales y animales que habitaban estos espacios. En el presente trabajo se evalu e identific las especies de aves asociadas a parcelas cultivadas con papa en cuatro localidades con alta produccin en los departamentos de Boyac y Cundinamarca, durante junio de 2010 a junio de 2011, teniendo en cuenta la metodologa del Grupo de Exploracin y Monitoreo Ambiental del Instituto Humboldt para inventarios de biodiversidad y gracias al apoyo de Tecnoqumicas S.A. Colombia. Se encontr que este ecosistema artificial es utilizado por las aves para consecucin de alimento, y construccin de nidos. Se registr un total de 49 especies distribuidas en 8 rdenes y 21 familias en las localidades muestredas, se presentaron variaciones en trminos de riqueza de especies en las diferentes fases del desarrollo del cultivo y localidad evaluada, presentando la mayor riqueza de especies el municipio de Villapinzn (N=29), seguido por Toca (N=24), Samac (N=22) y Sutatenza (N=17). Las etapas de desarrollo del cultivo donde se registr mayor actividad de avifauna, fueron floracin y cosecha, en estas, las aves se alimentaron en los surcos y el follaje, evidenciando que estos agroecosistemas pueden ser una opcin para alimentarse en determinados perodos del ao cuando la oferta alimenticia escasea en sus hbitats naturales. Palabras clave: aves, Boyac, Cundinamarca, cultivos, papa.

INTRODUCCIN OBJETIVOS Identificar las especies de aves asociadas a cultivos de papa en cuatro zonas de mayor produccin, en los departamentos de Boyac y Cundinamarca. Establecer la riqueza y abundancia relativa de especies de aves asociadas a los cultivos de papa en las localidades muestreadas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Identificar las especies de aves con mayor dependencia del cultivo en las localidades muestreadas. MATERIALES Y METODOS El presente trabajo se llev a cabo en los departamentos de Boyac y Cundinamarca, en los cuales se identificaron cuatro localidades cultivadas con papa (Toca, Villapinzn, Sutatenza y Samac). Recoleccin de Informacin preliminar: Se realizaron visitas de reconocimiento a las posibles reas de estudio, con el fin de verificar la existencia de parcelas representativas cultivadas con papa, extensin de los cultivos y acercamiento con los agricultores para obtencin de la informacin preliminar necesaria. Determinacin de las etapas del cultivo: Se procedi a establecer las etapas de desarrollo del cultivo a tener en cuenta para realizar los muestreos. Las etapas de desarrollo del cultivo presentadas fueron resumidas de la literatura consultada y la recoleccin directa de la informacin a los cultivadores. Inventario de avifauna: se realizaron 6 muestreos (dos por localidad con una intensidad de 4 das por muestreo) con el fin de evaluar variaciones en la riqueza de la avifauna asociada a los cultivos de papa, las localidades estudiadas fueron seleccionadas en funcin de la accesibilidad, extensin de los cultivos y facilidades logsticas (contactos previos con los dueos de los predios). El levantamiento del inventario de la avifauna se llev a cabo siguiendo estrictamente la metodologa propuesta por el Grupo de Exploracin y Monitoreo Ambiental (GEMA) del Instituto de Investigacin de Recursos Biolgicos Alexander von Humboldt. (VILLARREAL et al. 2006) el cual consta de registros visuales, auditivos, captura de aves e identificacin de especies. RESULTADOS Inventario de la avifauna asociada a los cultivos de papa
ORDEN GALLIFORMES FAMILIA Odonthophoridae Columbidae COLUMBIFORMES NOMBRE CIENTIFICO Colinus cristatus Patagioenas fasciata Zenaida auriculata Icterus nigrogularis Icteridae Icterus chrysater Molothrus bonariensis Sturnella magna Fringillidae Carduelis spinescens Carduelis psaltria Emberizidae Atlapetes palidinucha NOMBRE COMUN perdz paloma collareja paloma turpial amarillo turpial montaero chamn chirlobirlo jilguero andino chisga atlapletes cacbeciblanco MUNICIPIO TyV Sutatenza Todos VyS VyS Samac Todos Ty V Ty V Villapinzn IUCN LC LC LC LC LC LC LC LC LC LC DISTRIBUCION LOCAL LOCAL LOCAL LOCAL LOCAL LOCAL LOCAL LOCAL LOCAL LOCAL

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Determinacin etapas del cultivo

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Tabla 1. Cuadro determinacin y descripcin etapas del cultivo de papa. Riqueza de especies en las etapas del cultivo

Figura 1. Riqueza de especies en las fases del cultivo muestreadas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Figura 2. Familias y nmero de especies encontradas en el estudio.

DISCUSION La riqueza de especies en las fases del cultivo present una media de 23 especies con valores mximos de 29 especies para el municipio de Villapinzn y mnimos de 17 especies en el municipio de Sutatenza. Las fases de desarrollo del cultivo con mayor nmero de especies registradas fueron la fase 2 (desyerba, aporque) y la fase 3 (Floracin, maduracin) debido a que stas etapas del cultivo gracias a sus caractersticas morfolgicas y fisiolgicas, confieren a las aves microhbitats potenciales para explotacin de sus recursos o servicios ecosistmicos tales como consecucin de alimento o espacios aptos y seguros para fabricacin de nidos. Las diferencias entre especies y entre zonas de muestreo pudo deberse a la presencia de relictos de bosque en unas ms que en otras y a las diferencias en las altitudes, como fue ms notorio en el municipio de Sutatenza. Las especies de aves que presentaron una mayor relacin con el cultivo fueron: Zenaida auriculata, Zonotrichia capensis, Turdus fuscater y Notiochelidon murina, cada una de estas especies presenta hbitos alimenticios granvoros, insectvoros y frugvoros, aspecto que contribuye en mantener una relacin entre el cultivo y sus diferentes fases de desarrollo y la avifauna.

CONCLUSIONES Aunque 41 de las 49 especies registradas se encuentran categorizadas en preocupacin menor (LC), sin embargo es importante destacar que se registr la presencia confirmada de especies importantes para la conservacin como son: una especie casi amenazada (NT) Eriocnemis cupreoventris, dos especies endmicas (END) Conirostrum rufum y Synallaxis subpudica, dos especies casi endmicas (C-END) Eriocnemis cupreoventris y Leptopogon rufipectus, tres especies migratorias boreales (Mb) Coccyzus americanus, Stelgidopteryx ruficollys, e Hirundo rustica y una especie migratoria austral (Ma) Elaenia parvirostris asociadas a los cultivos de papa. Lo anterior hace que estas zonas estudiadas merezcan consideracin para medidas de evaluacin y/o proteccin, especialmente ante la falta de zonas de conservacin cercanas.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

BIBLIOGRAFIA BIRDLIFE INTERNATIONAL. 2011. BirdLifes online World Bird Database: the site for bird conservation. Version 2.1. Cambridge, UK: BirdLife International. MINAMBIENTE 2004. Gua ambiental para el cultivo de papa. PROAVES. 2010. Gua de Campo de las aves de Colombia. VILLARREAL H., M. LVAREZ, S. CRDOBA, F. ESCOBAR, G. FAGUA, F. GAST, H. MENDOZA, M. OSPINA Y A.M. UMAA, 2006. Manual de mtodos para el desarrollo de inventarios de biodiversidad. Instituto de Investigaciones Biolgicas Alexander Von Humboldt.

MODELO DE DISTRIBUCIN DE Quercus humboldtii (BONPL.) EN COLOMBIA NGELA DEL PILAR VIANCH SNCHEZ. Candidata Msc. Biodiversidad en reas Tropicales y su Conservacin. Universidad Internacional Menndez Pelayo (Ecuador). Grupo de investigacin Biologa para la Conservacin. Universidad Pedaggica y Tecnolgica de Colombia (Tunja, Boyac). anyiviancha@gmail.com RESUMEN Se realiz un modelo de distribucin de Quercus humboldtii para Colombia en el ao presente y para los aos 2020, 2050 y 2080. Se tuvo en cuenta variables climticas ambientales para determinar su distribucin estas fueron temperatura y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

precipitacin. Los datos se obtuvieron a travs de la base de datos Biotrpicos, con 40 registros para Colombia. Se encontr que el modelo de idoneidad corresponde a la distribucin altitudinal de Quercus humboldtii para las tres cordilleras (AUC= 0.836). La prediccin para los aos 2020, 2050 y 2080 presentan una disminucin en la distribucin de la especie. Probablemente el cambio climtico con el aumento de la temperatura y cambios en la precipitacin generan alteraciones en el establecimiento de Quercus humboldtii. Asimismo los puntos de presencia de la especie no se encuentran en el Sistema de reas Protegidas de Colombia. Todo esto nos permite generar planes y propuestas encaminados a la conservacin de esta especie y de los bosques altoandinos fuertemente amenazados por acciones antrpicas principalmente. Palabras clave: Colombia, distribucin, precipitacin, Quercus humboldtii, temperatura. INTRODUCCIN Objetivo. El objetivo del presente estudio fue modelizar las poblaciones de Quercus humboldtii con el fin de identificar la distribucin altitudinal de la especie en Colombia para las tres cordilleras y su posible distribucin a lo largo del tiempo teniendo en cuenta factores tales como el aumento de la temperatura y cambios en la precipitacin.

MATERIALES Y MTODOS. Los datos de coordenadas geogrficas se tomaron de la base la de datos Biotrpicos, en el cual se utilizaron 42 registros de Colombia, estos datos arrojados se depuraron convirtiendo las coordenadas geogrficas a planas. Se hicieron 10000 puntos al azar de presencias/ausencias mediante Arcgis V.9.3. Se seleccionaron las variables ambientales de BIOCLIM para ajustarlas al rea de estudio en este caso Colombia y se ajustaron algunasal rea de estudio. Las variables que se tomaron que influencian en la distribucin del Q. humboldtii fueron las 19 variables de Bioclim, se verific si estas variables estaban correlacionadas, para esto se tomaron los puntos extrapolados de distribucin por background como puntos al azar. Los datos de todas las variables fueron testeados por SPSS 15 mediante un anlisis de correlacin bivariada. De esta

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

correlacin se seleccionaron variables de temperatura Bio_ 02, 03, 04, 05 y de precipitacin Bio_15, 16, 17, 18,19. Estas variables ambientales seleccionadas se utilizaron posteriormente con los puntos extrapolados (background) a travs del programa MAXENT para correr el modelo de idoneidad con ajuste de Jacknife bajo la curva Roc. El modelo se ajust teniendo en cuenta la altitud como factor de determinacin para la distribucin de Quercus humbolditii y se utilizaron proyecciones del presente y los aos 2020, 2050 y 2080 con 10 rplicas o iteraciones. Asimismo se tuvo en cuenta la distribucin de las reas naturales protegidas a travs de los datos registrados en el Sistema Nacional de reas Protegidas y el Instituto Geogrfico Agustn Codazzi.

RESULTADOS Y DISCUSIN. Con los datos obtenidos se observa en la figura 1 que el modelo para el presente corresponde a la distribucin de Quercus humboldtii para Colombia el cual presenta una amplia distribucin en la zona andina, se encuentra en las tres cordilleras entre los 1.200 y los 3.200 msnm (Gonzlez 2003; Caldern 2001; Pacheco y Pinzn 1997; Espinal 1964, 1992 y 1993; Cuatrecasas 1958). Los Departamentos que poseen las mayores reas de robles en el pas son Boyac y Santander (Cabezas 2008). stos bosques se caracterizan porque albergan gran proporcin de flora y fauna andina de la cual gran porcentaje se encuentra en peligro de extincin. Esta especie es caracterstica por su gran importancia en el uso de su madera lo que ha originado fuertes presiones para sus poblaciones con una prdida significativa de sus coberturas originales.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Figura 1. Modelo de distribucin presente (ao 2012) del Quercus humboldtii para Colombia. La figura 2 muestra que el modelo de distribucin para el presente se ajusta y presenta alta idoneidad con una media de AUC= 0.836.

Figura 2. Ajuste curva ROC del modelo presente de Quercus humboldtii para Colombia.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Figura 3. Modelo de distribucin futuro (aos 2020, 2050, 2080) del Quercus humboldtii para Colombia La figura 3 muestra la distribucin del Quercus humboldtii para los aos 2020, 2050 y 2080 las zonas ms oscuras son las presencias de la especie, se observa que a medida que pasa el tiempo la distribucin de la especie disminuye drsticamente. CONCLUSIONES. Actualmente Q.humboldtii presenta un rango de distribucin que coincide con la presencia altitudinal para las tres cordilleras de Colombia. Las caractersticas de temperatura y precipitacin al parecer favorecen el establecimiento de Q.humboldtii en los andes de Colombia. Sin embargo, la proyeccin a futuro muestra que se disminuye la distribucin de la especie, lo que podra indicar que se ve influenciada por cambios en la temperatura y la precipitacin (cambio climtico) que afectara su distribucin en Colombia. Esto nos llevara a considerar medidas urgentes de conservacin, pues la gran mayora de los puntos de distribucin de la especie as como sus posibles presencias se encuentran fuera de los Sistemas de reas Protegidas Nacionales. Se recomienda realizar restauraciones ecolgicas que puedan ayudar a propagar la especie y aumentar su distribucin. BIBLIOGRAFA

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Cabezas, A. 2008. Anlisis del paisaje y de su influencia sobre la regeneracin del bosque (Quercus humboldtii) en el municipio de Popayn. Tesis de pregrado. Universidad del Cauca. 68 p. Caldern, E. 2001. Plantas colombianas en peligro, extintas o en duda. Bogot: Instituto Alexander Vonn Humboldt. Cuatrecasas, J. 1958. Aspectos de la vegetacin natural de Colombia. Revista de la Academia Colombiana de Ciencias, 10: 221-268. Espinal, L. S. 1964. Algunos aspectos de la vegetacin del oriente antioqueo. Bogot: Instituto Geogrfico Agustn Codazzi. . 1992. Geografa ecolgica de Antioquia. Red Medelln: Universidad Nacional de Colombia. . 1993. Regiones de Colombia. Medelln: Universidad Nacional de Colombia. Gonzlez, C. E. 2003. Serrana de San Lucas: novedades florsticas para Colombia y su conservacin. Indito. Pacheco, R. A. y C. A. Pinzn. 1997. Notas divulgativas: el roble ( Quercus humboldtii Bonpland). Bogot: Jardn Botnico de Bogot Jos Celestino Mutis.

EFECTO DEL ROBLE (Quercus humboldtii) SOBRE LOS ENSAMBLAJES DE PLANTAS DE LOS ROBLEDALES DE COLOMBIA Diana Galindo1, Sebastin Gonzlez-Caro2, Irina Mendoza3, Cesar Velasquez4, Marcela Serna5, Fernando Fernandez6, Omar Melo7, Oswaldo Velasquez8, Esteban Alvarez9
1

Universidad de los Andes. dianagalindouribe@gmail.com, 2Corporacin Bosques de Colombia. sebastian.gonzalez.caro@gmail.com, 3Jardn Botnico de Medelln. irinamendozapolo@gmail.com, 4Integral S.A. ca_rua@hotmail.com, 5Tecnologico de Antioquia. msernag@gmail.com, 6Universidad del Tolima. fmendez@ut.edu.co. 7 8 Universidad del Tolima. omelo@ut.edu.co, Oswaldo Velsquez.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

jovelasquez2@hotmail.com, esalvarez3000@gmail.com. RESUMEN

Jardn

Botnico

de

Medelln.

Generalmente se asume que las especies dominantes de un ecosistema estn bien adaptadas a su entorno y tienen altas capacidades competitivas. Por otra parte, la teora neutral ha propuesto que por procesos de deriva ecolgica, ciertas especies tienden a dominar en un rea determinada por efecto solamente de su capacidad de dispersin. Quisimos evaluar estas hiptesis, enfocndonos en el Roble (Quercus humboldtii), el cual es un especie dominante en algunos bosques en los Andes colombianos y de la cual se reportan efectos alelopticos sobre otras especies, aunque las evidencias empricas son escazas. En este trabajo evaluamos el efecto de la presencia de roble sobre el crecimiento y la densidad de la madera, dos rasgos funcionales relacionados, de las especies que lo acompaan usando 20 parcelas donde se tienen datos de crecimiento de 114 especies incluyendo el roble. Una prueba de T-pareada indica que las tasas de crecimiento del 70% de las especies disminuye en presencia del roble (T=50.28, p<0.001). Luego, mediante un ANOVA encontramos que las especies con tasas de crecimiento no afectadas por el roble tienen una densidad de la madera significativamente mayor que las afectadas (F=5.21, p<0.05). Estos resultados sugieren que el Roble tiene ventajas competitivas sobre un gran nmero de especies y ayudan a entender su a dominancia en muchas regiones de los andes. Adicionalmente, ya que la especie est siendo utilizada ampliamente en programas de recuperacin de reas degradadas los resultados puede ser una gua para disear modelos de restauracin ms eficientes. Palabras clave: Competencia. INTRODUCCIN. El Roble andino colombiano (Quercus humboldtii) es una especie de origen holrtico que lleg hace 350.000 aos al noroccidente de los Andes. Actualmente es una especie dominante llegando a conformar rodales casi puros en altitudes entre 1000-3000 m en las tres cordilleras (Van der Hammen et al. 2008). En las ltimas dcadas se han realizado muchos estudios sobre la estructura y diversidad de los bosques de roble (Pulido et al. 2006, Van der Hammen et al. 2008, Gentry 1995, Galindo-T. & Correa 2006, Gonzlez et al. 2006, Len et al. 2009), pero los Quercus Humboldtii; Tasa de crecimiento; Robledal;

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

estudios sobre su dinmica son escasos (lvarez et al. 2007, 2009). El hecho de que Q. humboldtii sea una especie recin llegada en trminos geolgicos a Suramrica y que haya tenido tanto xito, la hace interesante para poner a prueba algunas hiptesis ecolgicas. Ms aun, su xito se ha explicado en trminos de que tiene ventaja adaptativas relacionadas con efectos alelopticos sobre otras especies (Lozano y Torres 1974). Sin embargo, aunque existen reportes del efecto aleloptico de muchas especies de rboles tropicales (Flores-Carmona et al. 2008), en el caso de Q. humboldtii los datos son apenas anecdticos. Uno de los principales supuestos en ecologa es que cuando una especie es comn o abundante en un sitio, es porque existen las condiciones ptimas para mantener la dinmica de sus poblaciones (McGill 2012); esto se basa en el concepto de nicho ecolgico, donde se renen condiciones apropiadas que permiten el desempeo y presencia de una especie determinada (Hutchinson 1957). Por otra parte, la teora neutral ha propuesto que por procesos de deriva ecolgica, ciertas especies tienden a dominar en un rea determinada por efecto solamente de su capacidad de dispersin (Hubbell 2005). En base a esto la abundancia de una especie es un indicador de la aptitud de la misma en un sitio determinado. Sin embargo caractersticas propias de las especies como tasa de crecimiento o rasgos funcionales permiten establecer una relacin ms estrecha con su desempeo fisiolgico y por ende su aptitud (McGill 2012). En este trabajo quisimos evaluar estas hiptesis, enfocndonos en el Roble (Quercus humboldtii), partiendo de informacin de parcelas temporales y permanentes establecidas en la ltima dcada en Colombia (lvarez et al. 2007). MATERIALES Y MTODOS. En este trabajo evaluamos el efecto de la presencia de roble sobre el crecimiento y la densidad de la madera, dos rasgos funcionales relacionados negativamente (Baker et al. 2009), de las especies que lo acompaan usando 20 parcelas donde se tienen datos de crecimiento de 114 especies incluyendo el roble. Las parcelas estn distribuidas en las cordilleras central y oriental de Colombia en los departamentos de Antioquia, Caldas y Santander. RESULTADOS Y DISCUSIN. Una prueba de T-pareada, usando cada una de las especies como rplica, mostr que las mismas especies en presencia y ausencia de roble cambian su tasa de crecimiento. Este anlisis indica que las tasas de crecimiento del 70% de las

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

especies disminuye en presencia del roble (T=50.28, p<0.001; Figura 1A). Sin embargo, hay una buena proporcin que no es afectada. Por lo cual evaluamos si existan diferencias entre las especies afectadas y las no afectadas. Para esto hicimos un ANOVA, donde encontramos que las especies con tasas crecimiento no afectadas por el roble tienen una densidad de la madera significativamente mayor que las afectadas (F=5.21, p<0.05; Figura 1B).

Figura 1. (A) Diferencia en la tasa de crecimiento para 114 especies en presencia y ausencia de Roble (Quercus humboldtii). (B) Diferencia en la densidad de madera entre especies que sus tasas de crecimiento son afectadas y las que no por los robles. Estos resultados sugieren que el Roble tiene ventajas competitivas sobre un gran nmero de especies y ayudan a entender su dominancia en muchas regiones de los Andes. Diversos estudios indican que la alelopata es un mecanismo importante al tratar de comprender las causas y consecuencias de que ciertas especies predominen sobre otras (Gmez-Aparicio y Canham 2008) y este enfoque posiblemente pueda ayudar a entender la ecologa de Q. humboldtii, como lo sugieren Lozano y Torres (1974). Adicionalmente, nuestros resultados muestran que el efecto de una especie con ventajas competitivas puede ser de largo plazo y debe ser evaluado a nivel de la comunidad. Los factores que determinan que una especie sea dominante y afecte el comportamiento de sus

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

vecinas son numerosos y tienen que ver no solamente con efectos alelopticos potenciales sino tambin con muchas otras variables que determinan su adaptacin a un sitio determinado. En sntesis, este resultado ms que definitivo es una puerta para seguir buscando los mecanismos mediante los cuales los robles afectan las dems especies, ya sea por interferencia qumica, patgenos u asociaciones con hongos (Givnish1999). CONCLUSIONES La afirmacin anecdtica de los efectos alelopticos de Q. humboldtii (Lozano y Torres 1974), parece ser corroborada por los resultados reportados en este trabajo. La presencia de Q. humboldtii en los bosques andinos est relacionada con menores tasas de crecimiento y mayor densidad de la madera de las especies acompaantes en una muestra representativa que incluye bosques de la cordillera occidental, central y oriental. Estos resultados contribuyen parcialmente a entender el xito de la especie en muchas reas pero se requiere de ms informacin para identificar otros factores que le dan ventajas competitivas. Ya que Q. humboldtii est siendo utilizada ampliamente en programas de restauracin y en la implementacin de sistemas silvopastoriles en Colombia (Calle y Murgueitio 2009) y los resultados presentados en este trabajo pueden ser una gua para disear modelos ms eficientes de combinacin de especies (Lisanework y Michelsen 1993). BIBLIOGRAFIA lvarez, E., A. Cogollo, O. Melo, E. Rojas, D. Snchez, O. Velsquez, E. Jimnez, D. Bentez, C. Velsquez, M. Serna, J. Prez, F. Cardona & W. Devia. 2007. Monitoreo de los Andes colombianos (2000-3000 msnm) a travs del establecimiento de parcelas permanentes, pp.: 75-89. En: Armenteras, D. & N. Rodrguez. (eds.). Monitoreo de los ecosistemas andinos 1995-2005: Sntesis y perspectivas. IAvH. Bogot. lvarez, E., . Cogollo, O. Melo, D. Snchez, O. Velsquez, C. Velasquez y J. Prez. 2009. Diversidad, estructura y dinamica de los bosques de roble (Quercushumboldtii) en las tres cordilleras de Colombia. Memorias del II Simposio Internacional de Robles. Fundacin Natura-Universidad Distrital Francisco Jos de Caldas. Bogot. Baker T.R., Phillips O.L., Laurance W.F., Pitman N.C.A., Almeida S., Arroyo L., DiFiore A., Erwin T., Higuchi N., Killeen T.J., Laurance S.G., Nascimento H.,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Monteagudo A., Neill D.A., Silva J.N.M., Malhi Y., Lpez Gonzalez G., Peacock J., Quesada C.A., Lewis S.L., Lloyd J. 2009. Do speciestraits determine patterns of woodproduction in Amazonianforests? Biogeosciences, 6, 297-307. Calle, Z. y E. Murgueitio. 2009. El roble andino: Tesoro de las montaas colombianas que algunos ganaderos ayudan a conservar. Carta Fedegn N. 115, 82-86. Flores-Carmona, M. D. C., R., Cruz-Ortega, R., and Anaya, A. L. 2008. Allelopathic potential of some tropical trees of Ecological Reserve El Eden, Quintana Roo, Mexico. Allelopathy Journal 21(1), 57-72. Galindo-T, R., J. Betancur & J. Cadena-M. 2003. Estructura y composicin florstica de cuatro bosques andinos del Santuario de Flora y Fauna Guanent-Alto Ro Fonce, Cordillera Oriental colombiana. Caldasia 25, 313-325 Gentry, A.H. 1995. Patterns of diversity and floristic composition in Neotropical Montane Forest, pp.: 103-126. En: Churchill, S.P., H. Balslev, E. Forero & J.L. Luteyn(eds.). Biodiversity and Conservation of Neotropical Montane Forests. Proceedings of the Neotropical Montane Forest Biodiversity and Conservation Symposium. Bronx, New York Givnish, T.J, 1999. Onthe causes of gradients in tropical treediversity. Journal of Ecolofy, 87, 193-210. Gmez-Aparicio, L. & C.D. Canham. 2008. Neighbourhood analyses of the allelopathic effects of the invasive tree Ailanthusaltissima in temperate forests. Journal of Ecology 2008, 96 , 447458. Gonzlez, C., A. Jarvis& J.D. Palacio. 2006. Biogeography of the Colombianoak, Quercus humboldtii Bonpl.: geographical distribution and their climatic adaptation. International Centre for Tropical Agriculture (CIAT)/Museo de Historia Natural, Universidad del Cauca. Popayn. 10 p. Hubbell, S. 2005. Neutral theory in community ecology and the hypothesis of function alequivalence. Functional Ecology 19, 166172. Hutchinson GE (1957) Concludingremarks. Cold Spring Harb Symp Quant Biol 22, 41527. Len, J.D., Velez, G. y Yepes, A. P. 2009. Estructura y composicin florstica de tres robledales en la regin norte de la cordillera central de Colombia. Rev. biol.trop [online]. 57(4), 1165-1182. Lisanework, N. and A. Michelsen. 1993. Allelopathy in agroforestry systems: the effects of leafextracts of Cupressus lusitanica and three Eucalyptus spp. On four Ethiopiancrops. Agroforestry Systems. 21 (1), 63-74. Lozano, C. & G.J. Torres. 1974. Aspectos generales sobre la distribucin, sistemtica fito sociolgica y clasificacin ecolgica de los bosques de robles (Quercus) en Colombia. Ecologa Tropical 1, 45-79.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

McGill, B.J. 2102. Trees are rarely most abundant where they grow best. Journal of PlantEcology. 5 (1), 4651. Pulido, M.T., J. Cavelier& P. Corts. 2006. Structure and composition of ColombianMontaneOakForests. pp: 141-151. En: Kappelle, M. (ed.). Ecology and Conservation of Neotropical Montane Oak Forests. Ecological studies 185. Springer-Verlag Berlin Heidelberg. Van der Hammen, T., R. Jaramillo & M.T. Murillo. 2008. OakForests of theAndeanForestzone of the Eastern Cordillera of the Colombian Andes. pp: 595614. En: Stuttgart, J. (ed.). Studies in Tropical Andean Ecosystems 7. Universidad de Amsterdam. Amsterdam.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 4. POLTICAS PBLICAS-HERRAMIENTAS DE PLANIFICACIN Y GESTIN: UNIVERSIDADES ESTATALES, UNIVERSIDADES PRIVADAS, GOBERNACIN DE BOYAC, ORGANIZACIONES GUBERNAMENTALES Y NO GUBERNAMENTALES, ORGANIZACIONES CVICAS, ALCALDAS MUNICIPALES SISTEMATIZACIN Y VALIDACIN DEL CONOCIMIENTO Y PRCTICAS BIOCULTURALES COMO ESTRATEGIA PARA DEFENSA INTEGRAL TERRITORIAL Y COMUNITARIA DEL PUEBLO NASA Mery Victoria Velasco Prada Asociacin de cabildos indgenas Nasa xhaxha., Pregrado biologa, Universidad de Caldas, GELA Colombia, meryvictoria@gmail.com RESUMEN La investigacin se desarroll en primera instancia con el objetivo de servir como trabajo de grado para optar por el ttulo de Bilogo pero desde su concepcin personal y al ser acogida por las autoridades tradicionales y la comunidad buscaba constituirse en una herramienta til que trascendiera el nivel acadmico y contribuyera al objetivo primordial de defensa integral del territorio y la cultura Nasa. As, a travs del equipo de Territorio y Naturaleza de la Asociacin de Cabildos Indgenas Nasa xhaxha, el proceso de formulacin, maduracin y ejecucin del proyecto, se integr a la matriz de trabajo de la Institucin Prestadora de Servicios de Salud Indgena IPS-I y del Consejo de Educacin de la Asociacin, definiendo metodolgicamente el tul como unidad espacial objeto del desarrollo de la investigacin. El tul, en la cultura del pueblo Nasa juega un papel muy importante como espacio de generacin, construccin y replicacin de conocimientos, en razn de que a travs del manejo agrcola se plasman las concepciones y conocimientos culturales propios respecto a las plantas como elementos de poder que a travs de su uso y manejo permiten, por medio de la medicina tradicional, mantener una comunicacin directa y permanente con el mundo natural y los espritus que son percibidos, apropiados y fortalecidos en su cosmovisin, y constituyen elementos

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

indispensables para el fortalecimiento cultural ya que proporcionan conocimiento, seguridad alimentaria, educacin y salud. Bajo el objetivo general de defender de manera integral el territorio y la cultura Nasa se plantea la importancia de sistematizar y validar el conocimiento tradicional como estrategia de conservacin biocultural partiendo del conocimiento y prcticas culturales tradicionales de uso y manejo de la diversidad vegetal asociada a los espacios de cultivo. INTRODUCCIN Objetivos especficos - Propiciar escenarios de reflexin colectiva en relacin a la importancia del conocimiento y prcticas agrcolas tradicionales para la defensa integral del territorio, la diversidad biolgica y la cultura Nasa - Describir las prcticas culturales de uso y manejo de los vegetales asociados a la agricultura tradicional Caracterizar las especies de plantas presentes en los espacios de cultivo en relacin a sus categoras de manejo y uso locales Construir una propuesta que aporte al avance y fortalecimiento del proyecto de educacin propia de las comunidades Nasa

MATERIALES Y MTODOS Zona de estudio. La investigacin se desarroll en cuatro resguardos indgenas de origen colonial (Mosoco, Vitonc, San Jos y Lame), ubicados sobre la cordillera central, en el suroccidente Colombiano, al nororiente del departamento del Cauca, en la regin de Tierradentro municipio de Pez-Belalcazar. Se cont con la participacin y apoyo de pobladores de las veredas: Tierrasblancas en el resguardo de Lame; Botatierra y Minaflores en el resguardo de San Jos; El cabuyo en el resguardo de Vitonc y Escalereta, Santamarta, Moras y Mosoco centro en el resguardo de Mosoco. En la tabla 1 se presenta informacin general de los resguardos en los cuales se realiz el trabajo de campo. Mtodos. Se obtuvo informacin etnobotnica sobre los vegetales asociados a la

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

agricultura tradicional Nasa, siguiendo y replicando el mismo tipo de dinmicas y escenarios reflexivos seguidos en los procesos colectivos de construccin de pensamiento y conocimiento propios de la cultura: la tradicin oral, a travs de asambleas generales, mingas de pensamiento, reuniones familiares; en espacios culturales como la tulpa o fogn, el tul, las casas de los cabildos o en instalaciones de la Asociacin de Cabildos Nasa xhxha; se utilizaron herramientas etnogrficas (diario de campo, grabadora, cmara fotogrfica, entrevistas, observacin participante), talleres autodiagnsticos, Cartografa social, colecta etnobotnica, y mtodos de investigacin accin participativa IAP bajo una perspectiva que unifica el punto de vista de investigacin cientfico y emprico, definida en torno a la interculturalidad. La investigacin se desarroll en las siguientes fases - Fase preliminar: en la cual se realizaron reuniones con autoridades tradicionales y espirituales para estudiar la viabilidad de la propuesta, discutir la iniciativa y ajustar su ejecucin en relacin a las exigencias y requerimientos planteados por la comunidad - Talleres: se realizaron 12 talleres en cuatro veredas de los resguardos citados, buscando sensibilizar y contextualizar la investigacin en el ncleo social y la reflexin conjunta sobre los temas abordados. - Visitas de campo: Se realizaron con el fin de caracterizar especies vegetales asociadas a la agricultura tradicional en relacin a las categoras de uso y manejo. Se entrevist de manera abierta mediante encuestas no estructuradas al representante de cada una de las 80 familias (20 por resguardo) que conformaron el grupo de investigacin. - Talleres escolares: Se realizaron 6 talleres en las escuelas de las veredas visitadas, donde se abordaron temas relacionados a la identidad cultural y la diversidad biocultural - Colecta botnica: Siguiendo a Alexiades (1996) se realiz la recoleccin de material botnico, en compaa y con la colaboracin de Th walas, estudiantes y lderes comunitarios. Los ejemplares colectados fueron revisados, clasificados taxonmicamente e incluidos en el herbario CAUP de la Universidad del Cauca con revisiones complementarias e inclusin de duplicados en los herbarios FAUC de la Universidad de Caldas y CUVC de la

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Universidad del Valle. La informacin en lnea del herbario de la Universidad Nacional http://www.biovirtual.unal.edu.co se us como material de referencia, la nomenclatura y arreglo taxonmico por familias y fue revisado en la base de datos en lnea del Missouri Botanical Garden: http://www.tropicos.org RESULTADOS. Se sistematiz la informacin obtenida a partir de las reflexiones colectivas, con lo cual se gener el libro bilinge Fxizsawesx tul plantas y saberes, en este, se conceptualiza el pensamiento Nasa en relacin a: el saber ancestral y conocimiento tradicional, la naturaleza, la biodiversidad y el significado que tienen el territorio y el tul. Se presenta una base introductoria al sistema de clasificacin cultural Nasa de las plantas, se referencian tambin 70 plantas de uso cultural, con descripciones botnicas, aspectos ecolgicos generales y usos. Los usos que se dan a estas se presentaron de manera general en nasa yuwe (idioma Nasa), con el fin de que estos conocimientos se entiendan desde el sentir Nasa y como una manera de proteger el conocimiento tradicional acerca de las mismas. En el libro tambin se plantean algunas sugerencias de consulta, invitando a la recuperacin de la oralidad a la reunin familiar, a la minga de pensamiento y a recrear el nasa yuwe en intercambio de saberes. En cuanto a la diversidad vegetal asociada a los espacios de cultivo, se reportan 220 especies botnicas de uso cultural, representadas por 86 familias y 180 gneros. Se identifican 12 categoras de uso de las cuales sobresalen 61 especies en la categora alimento, 19 de las cuales presentan variantes; 45 en la categora rboles y sombro; 82 medicinales y 32 ornamentales. A partir de las colectas botnicas, se herboriz el material de referencia para el establecimiento del Herbario Nasa xhaxa que cuenta con una coleccin de 200 ejemplares organizados en dos grupos, Angiospermas y pteridofitos; representados por 70 familias botnicas y 135 gneros. DISCUSIN Y CONCLUSIONES. Con el desarrollo de esta investigacin construimos los cimientos y condiciones de soporte para empezar y, posibilitar la continuidad a largo trmino, de la aplicacin de una estrategia centrada en torno al proyecto educativo propio, con nfasis en los contenidos relacionados con el territorio y los principios rectores de su uso y manejo que permitan garantizar su sostenibilidad ambiental y la existencia

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

cotidiana, que llevan asociados la replicacin del saber ancestral y los conocimientos y prcticas bioculturales, el fortalecimiento de la identidad cultural, y la construccin de los planes de vida, propiciados e incentivados por medio de la investigacin intercultural a travs del establecimiento del Herbario Nasa xhaxha como centro de investigacin para el desarrollo de programas y actividades de educacin ambiental, que conduzcan a la generacin de conciencia ecolgica, y por esta va al objetivo de defensa integral deseado. Esta iniciativa constituye un ejemplo concreto de desarrollo endgeno ya que tiene la capacidad de contribuir a la sostenibilidad surgida de la interaccin entre la comunidad y el territorio. BIBLIOGRAFA ALEXIADES, Miguel N. 1996.Selected Guidelines for ethnobotanical research: A field manual (Captulo 2. Collecting plants Specimens) The New York Botanical Garden, Bronx. http://www.biovirtual.unal.edu.co http://www.tropicos.org

PLANIFICACIN TERRITORIAL PARA LA SOSTENIBILIDAD DE ECOSISTEMAS MONTAOSOS ANDINOS. ESTUDIO DE CASO: RQUIRA (BOYAC)

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Claudia Lorena Ortiz Melo1. Orlando Vargas Ros2. 1 Universidad Autnoma de Manizales. 2Universidad Nacional de Colombia, Departamento de Biologa 1 lorenaortizmelo@gmail.com, 2jovargasr@unal.edu.co RESUMEN El objetivo central fue establecer la relacin entre el sistema natural y el sistema social utilizando la planificacin territorial para la sostenibilidad de ecosistemas montaosos andinos. Se evaluaron los sistemas de produccin econmica del municipio y su relacin con los patrones de transformacin de los ecosistemas, los bienes y servicios ecosistmicos y su relacin con el uso del suelo y las estrategias de planificacin territorial aplicadas durante los ltimos diez aos. Se formul una propuesta de planificacin con enfoque territorial para ecosistemas andinos. Se seleccionaron cuatro cuencas, por medio de encuestas estructuradas se caracterizaron los socioecosistemas (dimensiones econmica, cultural, ambiental y poltica). En cada cuenca se establecieron las coberturas de la tierra y los ecosistemas predominantes, aplicando la metodologa Corine Land Cover y recorridos en campo. Con un total de 86 encuestas analizadas, se evidencia la insostenibilidad de las actividades econmicas, el grado de deterioro de los ecosistemas producto de la intervencin antrpica y del escaso conocimiento de las polticas territoriales. Tambin, se muestra la dependencia existente entre servicios ecosistmicos y actividades econmicas, as como con los patrones culturales y sociales que identifican al municipio. Con estos resultados se construyo una propuesta de planificacin, que tiene como elemento articulador el agua, se sugiere un marco conceptual y las principales herramientas y elementos que se deben tener en cuenta para desarrollar procesos de planificacin en ecosistemas montaosos, teniendo en cuenta la vocacin del territorio, y procesos sociales y polticos que permitan su aplicacin y funcionamiento en otros ecosistemas andinos del Pas. Palabras clave: Ecosistemas montaosos andinos, planificacin territorial, sistema natural, sistema social, sostenibilidad. INTRODUCCIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Objetivo General. Establecer la relacin entre el sistema natural y el sistema social utilizando la Planificacin territorial para la sostenibilidad de Ecosistemas montaosos andinos, tomando como caso de estudio, el municipio de Rquira. Objetivo especficos. Evaluar los sistemas de produccin econmica del municipio (Artesanal, Agropecuario, Minero y Turstico) y su relacin con los patrones de transformacin de los ecosistemas, como base para establecer la relacin entre el Sistema Natural y el Sistema Socioeconmico en Montaas andinas. Identificar bienes y servicios ecosistmicos y su relacin con el uso del suelo en el municipio. Evaluar las estrategias de planificacin territorial utilizadas en el municipio durante los ltimos diez (10) aos. Formular una propuesta de planificacin con enfoque territorial para la sostenibilidad regional en Ecosistemas montaosos andinos. MATERIALES Y MTODOS IMPLEMENTACIN DE LAS FASES METODOLGICAS FASE I. DOCUMENTACIN: Se realiz una revisin de los documentos relacionados con la planificacin territorial en el municipio, formulados durante los ltimos 10 aos: planes de desarrollo, Esquema de Ordenamiento territorial, Plan de gestin ambiental regional y agenda ambiental municipal. FASE II. DIAGNSTICO TERRITORIAL: Por el carcter integrador del agua en gran parte de los procesos ecolgicos, la cuenca hidrolgica se convierte en una excelente unidad territorial de manejo (Laterra et al, 2011) y de estudio. Por esto, se seleccionaron las cuatro (4) cuencas principales del municipio (Ro Candelaria, Ro Rquira, Laguna de Fquene, Ro Quebrada Honda). Para la caracterizacin ecosistemica y de coberturas en cada cuenca, se utiliz la metodologa CORINE Land Cover adaptada para Colombia por el IDEAM y el Ministerio de ambiente y desarrollo sostenible (Antes MAVDT) y el trabajo realizado por Sinning (2010). En cuanto a la evaluacin de variables, se realizaron

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

encuestas y charlas con los pobladores enfocadas en la caracterizacin de la estructura del sistema campesino (artesana, agricultura, Turismo y minera), teniendo en cuenta las variables mencionadas dentro del siguiente esquema (basado en las Investigaciones Internacionales en Montaas, realizadas por Messerli (1983) e Ives & Messerli (1984,1990)).

Figura 1. Esquema Terico-Metodolgico para el Estudio del Ecosistema Montaoso Andino en el Municipio de Rquira

RESULTADOS Se realizaron 86 encuestas, distribuidas as: Cuenca del Ro Candelaria: 28; Cuenca ro Rquira, 35; Cuenca Laguna de Fquene: 13; Cuenca Ro Quebrada Honda, 10. De acuerdo al anlisis realizado, la caracterizacin de las cuencas se resume as:

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL Vegetacin


CUENCAS Ecosistema predominante XerofticoTierras desnudas y/o degradadas, algunos relictos de bosque nativo predominante (por predio) Extica Pedregosidad y/o erosin 75% de los predios encuestados

CUENCA RO CANDELARIA. Es la cuenca de mayor extensin en el municipio.

Actividades econmicoproductivas desarrolladas Actividades agropecuarias (cebolla, maz, papa, ovinos, caprinos, bovinos) Explotacin de carbn Actividades comerciales y tursticas

Conflictos territoriales identificados Problemas de suelos en ms del 50% de la cuenca Actividades de minera aguas arriba que contaminan el agua Paramizacin Desastres naturales relacionados con erosin de suelos Siembra de especies exticas Contaminacin atmosfrica por coccin de artesanas en hornos de carbn Suburbanizacin desage del acueducto directamente al ro Extraccin de arcilla sin control.

CUENCA RO RQUIRA (Se encuentra corredor importante de bosque de Roble)

Bosque de Roble

Extica

51.42% de los predios encuestados

CUENCA LAGUNA DE FQUENE (en esta cuenca se ubica la Laguna de Fquene)

Laguna, robledales, pastizales

Nativa

46,15% de los predios encuestados

CUENCA QUEBRADA HONDA (En esta cuenca se localiza el pramo de Rabanal y zona de amortiguacin de la reserva forestal Robledal)

Robledales, Pramo y subpramo

Nativa

20% de los predios encuestados

Actividades artesanales, mineras, comerciales y tursticas, relacionadas con la elaboracin de artesanas en arcilla, algunos cultivos de maz y frutales, ovinos, caprinos, porcinos Ganado de Leche (Bovinos), algunos cultivos de maz, aromticas, uchuvas. Elaboracin de artesanas, Minera de carbn, siembra de papa, Bovinos, gallinas, porcinos

Eutrofizacin de la laguna Inundaciones frecuentes dao al bosque por recoleccin de agraz Invasiones ecolgicas: Retamo espinoso Explotacin de carbn en inmediaciones del pramo de Rabanal Daos ambientales al pramo por causa de la minera y Ampliacin de la frontera agrcola Contaminacin a fuentes hdricas Tala de Bosque de Roble en Bocaminas Siembra de especies exticas

DISCUSIN. Las actividades econmicas son indispensables para el desarrollo del municipio, al

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

igual que en otros lugares del Pas, sin embargo, el modelo econmico extractivo que domina, hace que exista una alta dependencia entre el modelo y la explotacin de recursos naturales. Es por eso, que a la hora de analizar la problemtica ambiental, es necesario entender, que adems de ser un fenmeno fsico y biolgico, es un problema eminentemente social ya que resulta del modo en que una sociedad se relaciona con su medio, relacin que emerge de manera problemtica al perder elementos de armona y equilibrio. La planificacin territorial se convierte en una herramienta eficaz para integrar el sistema ambiental y el sistema social, en pases en desarrollo, como Colombia, dada la alta dependencia existente entre recursos naturales, servicios ecosistmicos y dados los complejos conflictos territoriales, agudizados por problemas de orden social como desempleo, hambre y pobreza. El presente trabajo, formula una propuesta de Planificacin territorial que propone como elemento articulador el agua. La red hidrolgica plantea la conexin entre la produccin de bienes y servicios de los ecosistemas en escalas concordantes con unidades administrativas como municipios y departamentos, en las que las sociedades suelen tener instituciones y organizaciones activas capaces de articular intereses y necesidades encontradas. En estas escalas, los servicios hdricos pueden generar, adems, un puente entre los actores rurales y urbanos, sobre el cual construir una visin y ordenamiento ms claro y justo del territorio (Jobbagy, 2011). Esta propuesta de planificacin territorial para ecosistemas montaosos andinos, se basa en las variables presentadas en la figura 1 de este resumen, y teniendo en cuenta una evaluacin multicriterio sobre el uso del suelo, as: Uso potencial para la conservacin de cuencas, para las actividades econmicas, para la conservacin de biodiversidad, y Potencial de desarrollo comunitario. Adicional, debe tener en cuenta componentes importantes como la investigacin cientfica, de calidad y en un tiempo prudencial con el fin que el conocimiento cientfico se constituya en un bien pblico para los tomadores de decisiones y un componente de comunicacin e integracin entre los diferentes grupos sociales que interactan en un territorio. BIBLIOGRAFA Ives, J & B, Messerli. 1984. Stability and instability of mountain ecosystems: Lesson learned and recommendation for the future EN Mountain research and development. Vol 4 N 1 (Febrero de 1984). Pp 63-71.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

__________________. 1990. Progress un theoretical and applied mountain research 1973-1989, and major future needs EN Mountain research and development. Vol 10 N 2. Transformation of Mountain Environments (tome) part one (May 1990). Pp 101-121. Jobbgy, E. 2011. Servicios hdricos de los ecosistemas y su relacin con el uso de la tierra en la llanura chaco-pampeana. Captulo 7. Pp 163-183 EN Laterra, P; Jobbgy, E., Paruelo, J.M. 2011. Valoracin de Servicios Ecosistmicos: conceptos, herramientas y aplicaciones para el Ordenamiento territorial. ISBN: 978-987-679-018-5. 726 pp. Buenos Aires, INTA. Laterra, P; Jobbgy, E., Paruelo, J.M. 2011. Valoracin de Servicios Ecosistmicos: conceptos, herramientas y aplicaciones para el Ordenamiento territorial. ISBN: 978-987-679-018-5. 726 pp. Buenos Aires, INTA. Sinning, A. (2010). Relaciones ecolgicas urbano rurales en el municipio de Rquira (Boyac). Tesis de Maestra en planeacin urbana y regional. Facultad de Arquitectura y Diseo, Pontificia Universidad Javeriana. Bogot, Colombia.

DELIMITACIN PARTICIPATIVA EN ESCALA LOCAL Y DETALLADA DEL SECTOR DEL PRAMO DE MORAS LOCALIZADO EN EL RESGUARDO DE LA COMUNIDAD NASA DE MOSOCO (CAUCA) Sebastin Bohrquez Santamara Cabildo de Mosoco. Pregrado en Ecologa- Fundacin Universitaria de Popayn, Cauca, Colombia, sebsantamaria@yahoo.es

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESUMEN La ponencia trata de un proyecto de investigacin aplicada, intercultural y participativa, que apenas se encuentra en su fase preliminar de ejecucin, orientado a la delimitacin en escala local y detallada del sector del ecosistema alto andino del pramo de Moras, en el territorio del resguardo de la comunidad indgena Nasa de Mosoco, localizado en los municipios de Belalczar y Silvia, departamento del Cauca, la cual se encamina en primera instancia al objetivo de servir como trabajo de grado para optar por el titulo de eclogo, pero que no obstante desde un comienzo, a partir de su concepcin y a travs de todo el proceso de maduracin y ejecucin, ha obedecido y atiende al inters de trascender el cumplimiento del deber acadmico, y busca constituirse en una herramienta til que contribuya a resolver problemas o necesidades de orden social. En este orden de ideas la presentacin de la ponencia pretende relevar la importancia que tiene una estrategia de defensa ambiental, territorial y comunitaria de origen indgena, la cual permite integrar la necesidad oficial y social de la defensa del medio ambiente y el territorio, con el inters indgena de participar como ejecutores, en tanto que ellos son los habitantes originarios y ancestrales de los territorios a proteger, en adicin a otros objetivos importantes que se incluyen en la propuesta. La estrategia posibilita articular y gira en torno a 4 componentes bsicos a saber: 1. La importancia estratgica que guardan y el papel vital, indiscutiblemente claro, que juegan los ecosistemas de pramo para todo el pas, en razn a la riqueza de la biodiversidad de estas zonas de vida, representadas en mas de 3.379 especies de plantas, 70 especies de mamferos, 154 especies de aves y 90 especies de anfibios, muchos de ellos endmicos lo que les confiere la categora de hot spot; de su funcin como reguladores del aprovisionamiento de agua, resultante de la capacidad de sus suelos y vegetacin paramuna que propician la existencia de lagunas que operan como almacenadoras en poca de invierno y proveedoras en poca de verano, siendo el origen de las corrientes receptoras de las cuencas hidrogrficas ms importantes del pas, por lo que el 70% del agua que llega a las ciudades proviene de la alta montaa de los andes; regulacin climtica ; por ltimo, y tal vez el ms importante, la retencin de carbono, ya que la vegetacin, los suelos y en especial las turberas pueden retener 10 veces la cantidad de carbono que un metro cuadrado de bosque tropical.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

2. La presencia superficialmente significativa de los ecosistemas de paramo en los territorios de las comunidades indgenas en el Cauca. 3. Los riesgos y amenazas actuales que gravitan principalmente por causa del inters de las grandes multinacionales mineras en realizar sus actividades extractivas en gran escala en los pramos, unidos a las fuertes presiones de las actividades ganaderas y agrcolas que ejerce el modelo de desarrollo econmico nacional para incorporar estas reas a la produccin, poniendo en grave riesgo la sostenibilidad ambiental de estos ecosistemas 4. As pues, sin necesidad de explicaciones adicionales surge evidentemente la importancia de esta estrategia que al articular estos 3 componentes, se constituye en un medio que posibilita mltiples aplicaciones a la proteccin de diversos ecosistemas de importancia crtica para la nacin en toda su extensin territorial. Teniendo en cuenta que en el marco general de sus planes de vida y, ms especficamente de sus proyectos de educacin propia, las comunidades indgenas del departamento del Cauca vienen adelantando la incorporacin y aplicacin de dicha estrategia para la defensa integral del medio, el territorio y sus poblaciones originarias habitantes ancestrales, el fundamento de la estrategia radica en el uso de la figura jurdica de las reas legalmente protegidas, debidamente delimitadas y reconocidas oficialmente, como son en particular los ecosistemas de pramo, los cuales revistiendo dicho estatus excluyen de pleno derecho la ejecucin de actividades mineras en los pramos, cumpliendo as con el objetivo de defensa y, contribuyendo adicionalmente al logro de otros objetivos complementarios o no, igualmente importantes como son, el incentivar el inters por la investigacin; fomentar el intercambio intercultural de saberes; propiciar el fortalecimiento del conocimiento propio y del de otras culturas, con su respectivo acervo de saberes y la creacin de conciencia ecolgica, a travs del nico medio eficaz para el propsito: el proceso educativo, siendo as como la estrategia se constituye en el instrumento que nos permite cumplir tanto con el objetivo inmediato del proyecto, de orden acadmico as como tambin con el objetivo ltimo de orden social. Para que el proyecto cumpla con las exigencias, acadmicas de servir como proyecto de grado, legales para lograr el reconocimiento oficial de la informacin y comunitarias de constituir una herramienta que contribuya efectivamente a la defensa integral y garantice la participacin de los habitantes ancestrales como ejecutores de la estrategia y su pervivencia a largo plazo o, valga decir, para

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

cumplir con tales objetivos, el fundamento terico, conceptual y metodolgico deber satisfacer un conjunto de requisitos que para los dos primeros objetivos obedecen a lo que entendemos son los conceptos propios de la investigacin cientfica occidental y para el ltimo objetivo, obedece a los principios, lineamientos, lgica y pensamiento de lo que se entiende como la investigacin emprica, que sigue el proceso de creacin y construccin de conocimiento propio de las culturas indgenas. En consecuencia el soporte terico y conceptual adoptado y al cual se encuentra supedita la elaboracin y ejecucin del proyecto, en este caso en particular involucra: 1. Bajo la perspectiva de la investigacin occidental: las directrices, los principios y conceptos de la Ecologa del paisaje, apoyados con la manipulacin e interpretacin de imgenes satelitales con resolucin geomtrica o espacial, espectral, radiomtrica y temporal apropiadas para la escala local y detallada de la delimitacin a ejecutar; de los mtodos para el desarrollo de inventarios de biodiversidad definidos en el manual del instituto Alexander von Humbolt y, de los criterios bio-geofsicos y socioculturales establecidos en la Gua divulgativa oficial promulgada para tal delimitacin. 2. Bajo la perspectiva de la investigacin emprica indgena: la concepcin de los usos culturales del territorio que, constituye una visin holstica de la realidad formulada desde el punto de vista de la lgica y el pensamiento propio de las culturas indgenas, la cual entraa su cosmovisin, principios y directrices bsicas orientadoras de la vida individual y comunitaria, los cuales han posibilitado su adaptacin y supervivencia en el medio basndose en la convivencia armnica y equilibrio del hombre con todas las formas de existencia material e inmaterial, que garantizan la sostenibilidad ambiental y la pervivencia de las comunidades a largo plazo en el territorio, y como tales, son la expresin practica de todo el acervo de conocimiento tradicional -tcnicas, practicas, usos, costumbres- y de sabidura ancestral -mitos de origen, creencias, mandatos, controles sociales-, en cuya virtud, se logra la sobrevivencia tnica y cultural y el desarrollo futuro a largo plazo por ellas deseado. El fundamento metodolgico radica en el desarrollo del proyecto bajo una perspectiva que unifica el punto de vista de ambos sistemas de investigacin

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

cientfico y emprico, definida en torno a las primicias esenciales de desarrollo participativo, interculturalidad e interdisciplinariedad. En este sentido la orientacin tcnica y acadmica del proyecto est a cargo del ponente; a su turno la orientacin cultural est a cargo de los mdicos tradicionales, mayores y los delegados asignados del cabildo para esta finalidad, el trabajo interdisciplinario cuenta con la participacin permanente o puntual de profesionales en las reas de botnica, taxonoma, geografa, geologa, meteorologa, sistemas de informacin geogrfica, zoologa, tcnicos en manipulacin y uso de imgenes satelitales; apoyo institucional a cargo del cabildo de Mosoco, la asociacin de cabildos del municipio de Belalcazr nasa cxhacxha, y por conducto de esta ltima con el convenio Marco suscrito ente la misma y el observatorio sismolgico del sur occidente colombiano (OSSO) financiado con la corporacin para la reconstruccin de tierra dentro Nasa Kiwe, la ejecucin est a cargo de 2 grupos de comuneros con un nivel de preparacin de nivel acadmica de bachillerato escogidos por su inters y por experiencia en la ejecucin de proyectos ambientales, los cuales realizaran trabajos de campo relacionados con el muestreo y el trabajo de oficina involucrado con la organizacin y procesamiento de la informacin, acompaados y supervisados cada uno por un profesional responsable de grupo durante todos los recorridos y a su turno dirigidos por el responsable general del proyecto. El procedimiento definido para la ejecucin del proyecto, una vez y previamente diseado y planificado en detalle y adelantados todos los aspectos preliminares relativos a la capacitacin comunitaria y a la implementacin de los elementos logsticos de la ejecucin, consiste primero en la aplicacin de la ecologa del paisaje, para la definicin de las unidades, seleccin preliminar de oficina y definitiva en campo de los recorridos para muestreos a realizar en cada una de las unidades y de los transectos de cada uno de los recorridos, organizacin de muestras y procesamiento de informacin, elaboracin de informes de avance parcial y de la memoria descriptiva general conteniendo reportando el desarrollo completo del proyecto y los resultados conclusiones y productos finales obtenidos con su ejecucin. Los productos esperados y previstos aparte del reconocimiento oficial de la delimitacin y la defensa integral del territorio precitados son: crear el soporte de capital social comunitario que permita iniciar el desarrollo de un proceso permanente asociado al proyecto de educacin propia encaminado a la generacin de conciencia ecolgica, posibilitando su continuidad futura a largo

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

trmino; el fortalecimiento y ampliacin del saber indgena y del conocimiento cientfico sobre estos ecosistemas entre otros productos.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

POSTER
SIMPOSIO 1. BIODIVERSIDAD MICROBIANA Y CAMBIO CLIMTICO

ESTUDIO DE LA MICROBIOTA RIZOSFRICA DE Espeletia occidentalis EN EL PRAMO DE SANTA INS-ANTIOQUIA Pilar XimenaLizarazo-Medina1, 2, Diana Gmez-Vsquez1, 3 1 Grupo de Investigacin en Ecologa Microbiana y Bioprospeccin. Instituto de Biologa. Universidad de Antioquia. 2pilarximenalizarazo.udea@gmail.com. 3 dianalg@gmail.com RESUMEN Estudios encaminados a establecer la composicin y dinmica de las comunidades bacterianas en el suelo de los pramos colombianos an no han sido realizados, siendo necesario establecer el acervo microbiolgico en estos ecosistemas para contribuir en su conocimiento, conservacin y restauracin. En este estudio se estableci la biomasa y composicin bacteriana cultivable asociada a Espeletia occidentalis en el pramo de Santa Ins (Antioquia) y se determinaron cambios en la estructura de la comunidad microbiana en dos condiciones temporales diferentes. La biomasa bacteriana fue establecida mediante el recuento de UFC/g de suelo en diferentes medios de cultivo (Agar nutritivo para hetertrofos totales, EMB para coliformes, King B para Pseudomonas spp. y Tripticasa de soya para bacilos aerobios formadores de endospora (BAFEs). Los aislados fueron clasificados mediante tincin de Gram. Las bacterias Gram positivas fueron evaluadas para determinar actividad amiloltica y celuloltica y las Gram negativas fueron sometidas a pruebas bioqumicas para su identificacin. Los recuentos de biomasa mostraron que el total de hetertrofos cultivables se mantiene estable en las dos temporadas de muestreo, 1.29x10 6 UFC/g y 1.43x106UFC/g. La biomasa de los grupos funcionales present diferencias en las dos temporadas, los coliformes y los BAFEs aumentaron del 62.7% al 82.5% y del 0.6% al 1.4%, respectivamente, mientras las Pseudomonas fluorescentes disminuyeron del 31.8% al 11.5%. De los 160 morfotipos analizados, hasta el momento, 29 son Gram positivos, siendo 10 positivos para actividad amiloltica y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ninguno present actividad celuloltica. Las pruebas bioqumicas han permitido la identificacin de morfotipos pertenecientes a los gneros Pseudomonas, Enterobacter, Yersinia y Shigella entre otros. Los resultados obtenidos muestran una comunidad bacteriana que permanece estable en cuanto a la biomasa total de hetertrofos pero que presenta fluctuaciones en los grupos funcionales en el tiempo, posiblemente como consecuencia de las variaciones de las condiciones fisicoqumicas. Palabras clave: Microbiota, Pramos, Grupos funcionales.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CARACTERIZACIN MICROBIOLGICA DE SUELOS CIDOS SULFATADOS DEL MUNICIPIO DE PAIPA BOYAC Fabin Cuadros1, Greisy Estupian2, Juan Juez, Angela Leguizamo, Yenny Lpez, Karen Nio, Alejandro Poveda, Yeimy Ramrez, Zully Rincn, Javier Sierra, Luz Marina Lizarazo Forero.
1,2

Universidad Pedaggica y Tecnolgica de Colombia. Grupo de Investigacin Biologa Ambiental. 1fandagreen03@gmail.com, 2andreitaest91@gmail.com RESUMEN Los procesos de acidificacin en suelos cidos sulfatados, se producen por la presencia de sales minerales y bajo condiciones de inundacin, estos suelos contienen grandes cantidades de sulfuros de hierro y productos de oxidacin, los cuales debido a la exposicin con el oxgeno, reaccionan formando cidos, de lo cual, se generan metales pesados como hierro y aluminio; lo que ocasiona una gran cantidad de problemas que limitan la funcionalidad de los suelos. En el caso de los suelos cidos sulfatados de Boyac, este problema se extiende por alrededor de 3000, afectado en gran parte la productividad de estos suelos en diferente grado. El objetivo de la presente investigacin fuecuantificar grupos funcionales de microorganismos: Pseudomonas fluorescentes, amiloliticos, bacterias fijadoras asimbiticas de Nitrgeno, bacterias solubilizadoras de fsforo, hongos filamentosos y levaduriformes. Se realiz un muestreo al azar estatificado del suelo total. Se emple la tcnica de recuento en placa para el aislamiento y cuantificacin de los grupos funcionales de microorganismos utilizndose medios selectivos para cada grupo. Los resultados mostraron valores 30 colonias para Actinomicetos, bacterias solubilizadoras de fosfatos, amilolticas, bacterias fijadoras asimbioticas de Nitrgeno. En relacin con los hongos, los gneros ms representativos fueron Aspergillus, Penicillium, Rhizopus, Cladosporium. Palabras clave: Suelos cidos sulfatados (SSA), Recuento en placa, Grupos funcionales de Microorganismos.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 2. DIVERSIDAD Y DINMICA DE LAS COMUNIDADES DE ORGANISMOS ACUTICOS Y EL IMPACTO DEL CAMBIO CLIMTICO

NDICE DE ESTADO LIMNOLGICO PARA RIOS ANDINOS CASO DE ESTUDIO (CUENCA ALTA DEL RO CHICAMOCHA) Ivn Martnez. Universidad Pedaggica y Tecnolgica de Colombia Tunja, (Boyac). ivandallos@yahoo.es RESUMEN Planteamiento del Problema. En el Plan de Ordenamiento de la cuenca alta del ro Chicamocha, elaborado por los grupos de investigacin Gestin en recursos hdricos y Gestin ambiental de la Universidad de Boyac, se analizaron distintos aspectos de la calidad ambiental del ro Chicamocha pero no se profundiz sobre la calidad de los afluentes. De esta forma, se desconoce actualmente el estado ecolgico y ambiental de los tributarios del rio Chicamocha y de cmo y en qu medida estos afluentes estn determinando la calidad ambiental del ro. A si mismo este trabajo pretende contribuir con el desarrollo de nuevos ndices y modelos para evaluar la calidad ambiental y ecolgica de los ros de alta montaa en la zona Andina. Objetivo General. Establecer un ndice de calidad ambiental y ecolgica que involucre parmetros biolgicos, fisicoqumicos e hidrolgicos para los afluentes y la corriente principal de la cuenca alta del ro Chicamocha. Mtodos. Para la elaboracin del ndice se evaluarn ms de treinta variables (hidrolgicas, fisicoqumicas, microbiolgicas y biolgicas) en tres afluentes y la corriente principal de la cuenca alta del ro Chicamocha. Estos ros son ecosistemas que estn sometidos a constante presin por parte de las comunidades humanas. En la construccin de este ndice multiparamtrico se realizar un anlisis de componentes de las variables evaluadas y despus se construirn grficas de calidad de las variables seleccionadas. Finalmente, se establecer una ponderacin dependiente de la importancia de cada variable en la calidad ecolgica y ambiental de los ros con la cual se construir un ndice general. Palabras clave: ros, ndice, Limnologia, Chicamocha

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

DESCRIPCION DE GRUPOS FUNCIONALES DEL FITOPLANCTON BASADOS EN RASGOS MORFOLGICOS Erika Alexandra Triana Balaguera Universidad Pedaggica y Tecnolgica de Colombia. Escuela de Ciencias Biolgicas., Tunja. Colombia. erikaalexandrat04@hotmail.com. RESUMEN Introduccin. Los organismos del fitoplancton difieren unos de otros por caractersticas que definen sus tasas mximas de produccin: cantidad y calidad de pigmentos, contenido de enzimas, relacin entre superficie y volumen celulares; la respuesta es desigual y la evolucin o coexistencia de las especies se explica en trminos de una mayor eficiencia o adaptacin a cierta combinacin frecuente de caractersticas ambientales (Margalef, 1983). Margalef (1978), hace referencia a la distribucin de las poblaciones fitoplanctnicas como resultado de la interaccin entre los ciclos de vida de un gran nmero de especies y las propiedades selectivas del ambiente. De esta manera identifica categoras designadas como formas de vida (life-forms) las cuales expresan la adaptacin de los organismos a ciertos patrones recurrentes de factores selectivos que son principalmente el suministro de energa externa, el suministro de nutrientes, turbulencia y la descomposicin. Adems los grupos morfolgicos muestran una relacin ms ntima a las condiciones ambientales que los grupos filogenticos, esto sugiere que la morfologa comparativamente con la taxonoma representa mejor los aspectos funcionales (Kruk et al., 2010), esto conlleva a la aplicacin del trmino Grupo Funcional el cual hace referencia al conjunto de caractersticas especiales de adaptacin y al conjunto de especies que las poseen, hasta el punto en que es posible predecir la presencia de especies individuales en ubicaciones determinadas. Por tanto este sistema ofrece una de las maneras ms claras de comprender y predecir la distribucin y dinmica de las poblaciones naturales de fitoplancton. Objetivo general. Dar a conocer una descripcin de los principales trabajos propuestos para el desarrollo de los grupos funcionales basados en rasgos morfolgicos para fitoplancton. Mtodos. La revisin de los principales trabajos en grupos funcionales basados en rasgos morfolgicos se hizo desde el ms antiguo hasta el ms reciente, con el fin de dar a conocer la dimensin de los grupos funcionales y su aplicacin en la dinmica del fitoplancton, entre los principales autores estn: Hutchinson,(1967); Margalef (1958, 1978, 1983); Reynolds et al. (1980,1984, 1988, 2002,2010) Kruk et al., (2010); Kruk & Segura (2012). Palabras clave: fitoplancton, grupo funcional, morfologa, descripcin.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CLASIFICACIN TRFICA DE INSECTOS ACUTICOS EN DOS QUEBRADAS TRIBUTARIAS DEL RO VERDE (QUINDO, COLOMBIA) Alejandro Villarreal-Grisales1, Katherine Rodrguez-Marn, Roco GarcaCrdenas Universidad del Quindo. 1alejovillarreal@gmail.com RESUMEN La mayora de estudios se han desarrollado en sistemas de orden mayor, sin embargo Colombia cuenta con gran cantidad de cuerpos de agua de primer y segundo orden ubicados en gradientes altitudinales por encima de los 2800 msnm. El principal problema es la baja produccin cientfica en estos ecosistemas, lo cual demuestra la importancia de desarrollar estudios en este gradiente altitudinal. El objetivo fue determinarla estructura trfica del ensamblaje de insectos acuticos asociados a dos quebradas de alta montaa en Quindo, Colombia. La recolecta se hizo en quebradas ubicadas a una altitud de 3.000 m.s.n.m. donde se ubicaron 20 estaciones de 1m2 por cada quebrada. Se utiliz red de mano tipo D y captura directa, tratando de abarcar todos los microhabitats de las quebradas. Los taxones encontrados fueron asignados a grupos dietarios con base en clasificaciones trficas bibliogrficas. En total se colectaron 2711 individuos, distribuidos en 34 grupos taxonmicos, de los cuales 31 fueron clasificados en cuatro grupos dietarios. El grupo de insectos colectores fue el ms abundante 35%, seguido por losfragmentadores26%, los depredadores en un 18% y los raspadores12%. No se clasific por falta de informacin el 9% de individuos. Las quebradas presentaron sustrato con abundante materia orgnica particulada gruesa, lo cual favorece que en estos ambientes predominen los insectos clasificados dentro del grupo dietario de los colectores. Lo encontrado en cuanto a la estructura trfica para este estudio, es similar a los estudios realizados para otras quebradas andinas, demostrando que la comunidad de insectos acuticos presenta poca variacin para este tipo de ambientes. Palabras clave: insectos acuticos, grupos dietarios, estructura trfica.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

COMPOSICIN Y ESTRUCTURA DE LA COMUNIDAD DE MACROINVERTEBRADOS ACUTICOS DE ALTA MONTAA (QUINDO, COLOMBIA) Alejandro Villarreal-Grisales1, Delly Roco Garca-Crdenas. Universidad del Quindo. 1alejovillarreal@gmail.com RESUMEN Se determin la composicin de la comunidad de macroinvertebrados acuticos presente en la microcuenca La Sonadora y tributarios de ro Verde, se evalu la diversidad alfa y beta de la comunidad, entre los meses de agosto y diciembre de 2010. Se seleccionaron los afluentes que se encontraban entre los 2800 y 3100 m.s.n.m, encontrando un total de cinco fuentes de agua. En cada quebrada se ubicaron 20 estaciones de muestreo con un rea de 1m 2 cada una, partiendo del nacimiento cada 15 metros aguas abajo. El muestreo se realiz utilizando red de mano tipo D y captura directa. Se recolectaron 4806 individuos distribuidos en 51 taxones. Los rdenes ms representativos fueron Dptera y Trichoptera con una riqueza de 11 familias cada uno y las familias con mayor abundancia para el estudio fueron Helicopsychidae, Baetidae y Perlidae. Las curvas de acumulacin indicaron un registro del 98% y 100% de las especies esperadas segn los estimadores Jacknife 1 y Chao 1 respectivamente. La diversidad alfa mostr que la riqueza y el ndice de Shannon presentaron valores medios y la dominancia se ubic en un rango bajo. Para la diversidad beta se observ que las quebradas comparten ms del 50% de las especies, evidenciando la capacidad de dispersin de los taxones all presentes. Con base en los resultados obtenidos de riqueza especifica y exclusividad de taxones se puede inferir el buen estado de conservacin en el que se encuentra el rea de estudio. Palabras clave: acuticos. Diversidad, comunidad, estructura, macroinvertebrados

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

DESCRIPCIN BATIMTRICA Y COMPOSICIN DE MACRFITAS RIVEREAS DE LAGUNA NEGRA ZONA AMORTIGUADORA PNN LOS NEVADOS Juan Pablo Betancur1, Juan Pablo Cardona. Universidad de Caldas. Departamento de Ciencias Exactas y Naturales Programa de Biologa. RESUMEN Se efecto una descripcin batimtrica y anlisis de la composicin de macrfitas en la rivera Laguna Negra, zona amortiguadora Parque Nacional Natural Los Nevados, a 3851 m, formada por eventos vulcanolgicos, glaciales y procesos agrcolas; en Laguna Negra se describe la morfometra y composicin de macrfitas de su rivera. Se ubic la mira limnimtrica (Limnologa Regional 2009) en el centro de la laguna para realizar monitoreo del estiaje por la pluviometra (Fernndez-Duran 1993), el rea del espejo de agua fue medida con el sistema de triangulacin y es 11616,47 m, la profundidad se estima cada 5 m en transectos lineales formando la rosa de los vientos, ubicados de extremo a extremo con una lnea mtrica. Se registr una profundidad mxima relativa de 1,92 m, donde se recomienda hacer la extraccin de los ncleos de estudios paleoecolgicos en posteriores investigaciones (Velsquez et al. 2004), se midi la turbidez con la ayuda del disco de Secchi (Ramsar 2005), muestra un alto grado de eutrofizacin y la proporcin de materia orgnica suspendida en la columna de agua acumula nutrientes para la colonizacin de las macrfitas, causando el opacamiento del espejo de agua. El caudal de salida fue 0,8L/s, medido con el mtodo volumtrico; s tom la frecuencia relativa y total para las macrfitas con una cuadricula de 3x3 m, dividida en 225 cuadrantes identificando 65 ejemplares en 16 familias y 60 gneros; como Carex pichichensis, especie pionera en la colonizacin; se observa la reduccin del rea del espejo de agua, debido a procesos como la deforestacin, pastoreo y monocultivo, que producen descargas y provoca la acumulacin de materia orgnica, perdida y sequa de los abastecimientos de agua dulce. Se recomiendan procesos de restauracin, as como, la prohibicin de ganado y cultivo pisccola para la recuperacin del cuerpo de agua.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

SIMPOSIO 3. COMUNIDADES VEGETALES Y ANIMALES EN LOS ECOSISTEMAS DE ALTA MONTAA. EFECTOS DEL CAMBIO CLIMTICO SOBRE LAS ESPECIES NATIVAS

El GNERO ANASTROPHYLLUM (SPRUCE) STEPH. (MARCHANTIOPHYTA, ANASTROPHYLLACEAE) EN COLOMBIA Wilson lvaro Alba1, Jaime Uribe Melndez Universidad Nacional de Colombia. 1wilrialal@gmail.com RESUMEN El presente trabajo trata de la revisin del gnero Anastrophyllum para Colombia, con base en el anlisis de su morfologa. Se estudiaron los caracteres morfoanatmicos de tallo (forma apical de los vstagos, tipo de ramificacin y corteza del tallo), hoja (forma, profundidad del seno entre segmentos y tipo de insercin), clulas (forma de las clulas basales de la hoja y trgonos), perianto y cpsula (forma y nmero de engrosamientos de las clulas epidrmicas y tipo de bandas de las clulas internas). Se incluyen los resultados de las mediciones en ejemplares de herbario y salidas de campo, realizadas con el fin de obtener material fresco y frtil. Se registran para Colombia seis especies de Anastrophyllum, agrupadas en tres subgneros: A. auritum (Lehm.) Steph., A. nigrescens (Mitt.) Steph., A. piligerum (Reinw., Blume & Nees) Steph. (subg. Anastrophyllum), A. austroamericanum Va (subg. Crossocalyx), A. stellatum R.M. Schust. y A. tubulosum (Nees) Grolle (subg. Schizophyllum). Para cada una de las especies se proporciona una descripcin detallada, ilustraciones, datos sobre su distribucin geogrfica y una clave de identificacin donde se destacan principalmente caracteres del gametofito. Se destaca a A. piligerum como novedad corolgica para el pas. En este trabajo se propone como sinnimo nuevo a: A. leptodictyon de A. auritum y se excluyen de Colombia las especies A. minutum y A. minutirete, ejemplares que corresponden a A. auritum. Palabras clave: Anastrophyllum, Colombia, Hepticas, Morfologa, Taxonoma.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

POTENCIAL DE Sphagnum EN LA GERMINACIN DE PLANTAS CON INTERS ORNAMENTAL Julin Zapata Zea1, Margarita Escobar Acosta2. Instituto de Biologa, Universidad de Antioquia. 2 esmarga@yahoo.com RESUMEN El gnero Sphagnum, est distribuido a travs de todo el mundo y en Colombia crece desde los 1200 hasta los 4400 msnm. Histricamente ha sido objeto de extraccin por parte de la comunidad campesina debido a sus usos. En el presente trabajo se evalu el musgo como sustrato para camas de germinacin de especies con alto potencial ornamental como bromelias y anturios; la recolecta del material se hizo en los municipios Belmira, Guarne, Jardn y Medelln en Antioquia; Murillo, Tolima; Tatam en Risaralda. Posteriormente, el material de Sphagnum fue trasplantado en las camas de germinacin, donde se evidenci la regeneracin de ramas dicotmicamente, prosperando en todos los espacios y con viabilidad a largo plazo, dado que acidifican el medio por intercambio catinico con el agua, y as evitan los procesos de descomposicin. En el experimento con anturios, Anthurium scandens a los 15 das, se registr el 95.59% de germinacin, con A. obtusum a los 13 das/96% de germinacin, A. antioquiensis, a los 10 das/99% de germinacin; y para las bromelias, Guzmania glomerata, G. squarrosa G. monostachya, Tillandsia heliconioides, 10 das despus de estar directamente en contacto con Sphagnum sp., mostraron una germinacin exitosa, al igual que para otras especies no determinadas. El aprovechamiento sostenible de los recursos no maderables del bosque en los trpicos como Sphagnum y las especies ornamentales evaluadas es propuesto como un mecanismo para promover la conservacin, mantener el ambiente y mejorar la calidad de vida de una parte de la poblacin rural. Palabras clave: aprovechamiento, conservacin, epifitas, Sphagnum.

garrapatazapata@gmail.com,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

CARACTERIZACIN DE LA VEGETACIN DEL PRAMO DE PISBA EN EL SECTOR DE PIEDRA GORDA (Socha, Boyac) CON FINES DE CONSERVACIN 1 Astrid Caro , Orlando Rivera. Universidad Nacional de Colombia. Sede Bogot. Instituto de Ciencias Naturales. 1 amcaror@unal.edu.co RESUMEN El bioma de pramo se encuentra presente en el continente americano. En Colombia, el departamento con mayor representatividad de esta zona de vida es Boyac, donde el pramo representa la fuente hdrica de diferentes municipios; actualmente esta se ve afectada por procesos de alteracin asociados a la agricultura y minera. El Sector de Piedra Gorda se encuentra ubicado en el Pramo de Pisba, importante por el corredor biolgico que forma con Cocuy y por ser la principal fuente para irrigar ros como el Chicamocha. El objetivo principal fue conocer la estructura vertical y horizontal de la flora del sector de Piedra Gorda. Se levantaron 14 parcelas de 25 m 2, dentro de las cuales se midi altura, cobertura y CAP a cada individuo. El anlisis se realiz mediante el establecimiento de clases para dimetro, altura y cobertura, adicionalmente se realiz un anlisis de conglomerados para establecerla similitud entre parcelas teniendo como criterio los parmetros medidos y las especies compartidas. Se encontr que la estructura de la vegetacin, est conformada por tres estratos (arbustivo, herbceo y rasante), con alturas que alcanzan los cinco metros, los valores ms altos en dimetro se registraron en frailejonales, y los mayores valores de cobertura en el estrato arbustivo (hasta 4m2). El anlisis de conglomerados mostr la existencia de arbustales, arbustalesfrailejonales y arbustales-pajonales. Las especies con mayores valores de importancia fueron Ageratina fastigiata, Hesperomeles ferruginea, Espeletia lopezii, E. mutabilis, E. boyacensis, Espeletiopsis guacharaca, Gynoxys sp. Y Cortaderia nitida. Se concluye que este sector presenta gran variabilidad fisionmico-estructural, con comunidades tpicas de pramo propiamente dicho, aunque con leves procesos de disturbio; la diversidad beta es alta y se deben establecer medidas de control y conservacin. Palabras clave: Asteraceae, Comunidades vegetales, Espeletia.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ESTUDIO FLORSTICO Y ESTRUCTURAL DE TRES BOSQUES DE PRAMO EN EL PARQUE NACIONAL NATURAL LOS NEVADOS, CORDILLERA CENTRAL COLOMBIANA Andrs Bohrquez Osorio1, Luis lvarez Meja2 Herbario Universidad de Caldas - FAUC, Grupo de Investigacin en Biodiversidad y Recursos Fitogenticos, Universidad de Caldas. 1 andresfelipebo@hotmail.com RESUMEN Se caracteriz la composicin florstica y la estructura de tres bosques de pramo en el Parque Nacional Natural los Nevados, localizados en la Cordillera Central de los Andes colombianos. Este ecosistema ha sido reducido y simplificado gradualmente a cultivos de papa y a la explotacin ganadera lo cual deja como resultado pequeos relictos de bosque representativos de la flora local, por tal razon se describe la vegetacin y se profundiza en el conocimiento sobre estas comunidades. Los bosquesa evaluar se ubicaron en tres cotas altitudinales: La Secreta (3500 m), El Edn (3600 m) y Buenos Aires (3690 m), en cada una de las cuales se muestre 100 m2, mediante una parcela de 50 x 2 m, donde se censaron a un metro del lado derecho del rectngulo todos los individuos con DAP 1 cm y al lado izquierdo todos los individuos que no alcanzaran la categora diametrica DAP 1 cm, registrndose las alturas de 0 a 10 cm, 10 a 50 cm, 50 a 150 cm y >150 cm. La riqueza de especies con DAP 1 cm, para las tres localidades fueron (9 para Buenos Aires, 7 para El Edn y 13 para La Secreta) y la diversidad de especies las cuales no alcanzan la categora diametrica, presenta El Edn con 35 especies, seguido de Buenos Aires y La Secreta (31 y 25 especies respectivamente). Los bosques no presentan una similitud significativa en nmero de especies, las que tienen categora diametrica presenta que Buenos Aires y La Secreta son los ms distintos, solo comparten el 30% de especies. Befaria cf., Buddleja incana, Miconia salicifolia, Viburnum pichinchinse son las se registan en los tres bosques. En todas las zonas la mayor proporcion de individuos tuvieron alturas inferiores a cinco metros. Las especies dominantes fueron Baccharis sp. Para Buenos Aires (21,3%) Polylepis sp. para La Secreta (35,8%) y Vallea stipularis para El Eden (65,4%). La cota altitudinal registra la heterogeneidad de especies y la singularidad de estas para dominar el ecosistema, es evidente que es un ecosistema frgil y que se debe ampliar su conocimiento para futura restauracin ecolgica para as mantener la diversidad biolgica y as cumplir con los tratados sobre la proteccin de la vida en estos

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

ecosistemas. Palabras clave: Andes, flora, diversidad.

MIRAFLORES DE COLORES (RESERVA FORESTAL PROTECTORA CUCHILLA DE SUCUNCUCA) BOYAC - COLOMBIA.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Naisla Manrique1, Mara Morales. Universidad Pedaggica y Tecnolgica de Colombia. Facultad de Ciencias. 1 naislamanrique@gmail.com. RESUMEN La Reserva Forestal Protectora de Cuchilla de Sucuncuca, se encuentra ubicada en el municipio de Miraflores (Boyac), sobre la cordillera Oriental en la cuenca alta del ro Lengup, e incluye una porcin de la Cuchilla o Cerro de Mundo Nuevo. Con una extensin de aproximadamente 1.773 ha, entre los 2.000 y 3.300 m. Serealiz la caracterizacin florstica, con el fin de compilar y analizar la vegetacin presente en la zona; a su vez, serealizaron transectos de 100 m 2, entre los 1800 y 2900 m, correspondientes a los ecosistemas de bosque andino y altoandino. Se colectaron ejemplaresque fueron procesados y determinados en el Herbario UPTC, mediante la consulta de literatura,as como de especialistas en diferentes grupos de plantas.Se registraron39 familias, destacndose representadas por Melastomataceae (6 gneros), Rubiaceae (5), Poaceae (5), Gesneriaceae (4), Ericaceae (6), Lauraceae (3), Bromeliaceae (5), Piperaceae (2), Orchidaceae (5), Begoniaceae (1). Entre los generos sobresalen Miconia, Blakea,Palicourea, Psychotria, Chusquea, Neurolepis, Besleria, Disterigma, Macleania, Ocotea, Greigia, Tillandsia y Piper, Stelis, Begonia. Se resalta la importancia de algunas familias que presentaron una sola especie y/o individuo como Onagraceae (1 gnero/ 1 especie), Sapotaceae (1/1), Marcgraviaceae (1/1), Cucurbitaceae (1/1) y Actinidaceae (1/1). Actualmente, la zona presenta alta perturbacin humana relacionada con extraccin maderera. Lo que ha generado un deterioro en el ecosistema disminuyendo la diversidad que presenta. Palabras clave: bosque altoandino, composicin,diversidad, flrula.

INVENTARIO DE LA FLORA VASCULAR DE UN BOSQUE PREMONTANO DE LA CUENCA DEL RO CHINCHIN, CORDILLERA CENTRAL COLOMBIANA

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Julio Andrs Sierra-Giraldo1, Juan Mauricio Posada-Herrera, David Sann Semillero de Investigacin en Biodiversidad y Recursos Filogenticos, Herbario de la Universidad de Caldas (FAUC), Instituto de Investigaciones Estratigrficas. 1 andresierra25@gmail.com RESUMEN Los Andes colombianos se consideran una de las regiones con mayor diversidad florstica del planeta. En la cordillera Central colombiana se ha documentado la importancia de llevar a cabo estudios que reflejen su composicin florstica. Tambin se menciona que es la ms alterada en comparacin con las otras cordilleras colombianas (Occidental y Oriental), lo cual ha modificado los patrones originales de la flora y sus afluentes hdricos, y ha afectado a los organismos asociados y los asentamientos humanos aledaos. Por esta razn, se realiz el inventario de la flora vascular de un bosque premontano ubicado en la vereda el guila entre 1800 y 2000 m de altitud en la cuenca del ro Chinchin, debido a que no existe ninguna figura de ordenamiento para ste territorio. Se registraron 126 especies de plantas vasculares, distribuidas en 44 familias y 69 gneros, donde Araceae (14/8), Melastomataceae (12/8) y Orchidaceae (8/5), presentaron el mayor nmero de especies y gneros. Polypodiaceae cuenta con la mayor cantidad de especies (4) dentro de los helechos. Derivado de este trabajo se obtuvieron colecciones de las especies Monstera lechleriana y Topobea superba que son novedades corolgicas para Caldas. Tambin se realiz un acercamiento con la comunidad para integrarla al cuidado del bosque, ya que este oferta bienes y servicios ambientales como afluente principal y nico del acueducto veredal, adems, como fuente de productos maderables y no maderables para los habitantes. Lo cual representa un argumento que apoya la conservacin del bosque El guila y justifica la intervencin de los diferentes actores de la comunidad (colegio, Junta de Accin Comunal y comunidad acadmica en general) en su ordenamiento ambiental. Palabras clave: Inventario florstico, Novedades corolgicas, Bienes y servicios ambientales, Ordenamiento del territorio.

GERMINACIN DE ALGUNAS ESPECIES DEL PRAMO DEL PNN CHINGAZA EN CONDICIONES DE LABORATORIO

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Laura Victoria Prez-Martnez, Natalia Rodrguez-Castillo, Jennyfer InsuastyTorres1, Oscar Rojas-Zamora, Orlando Vargas Ros. Grupo de Restauracin Ecolgica (GREUNAL). Universidad Nacional de Colombia Sede Bogot. 1jinsuastyt@unal.edu.co RESUMEN El manejo de semillas y el conocimiento de los requerimientos para su germinacin, constituyen un punto fundamental en los procesos de restauracin ecolgica, teniendo en cuenta que es prioritario obtener mayor cantidad de material vegetal y con la calidad necesaria para adelantar proyectos de restauracin de manera exitosa. Para la mayora de las especies vegetales de pramo se desconoce esta informacin, por lo que tiene gran valor estudios que integren el conocimiento de la fisiologa de las semillas y mtodos prcticos de propagacin con fines de restauracin. En el presente estudio se evalu la germinacin de semillas de 15 especies de pramo en condiciones controladas de laboratorio: 12 horas de termoperodo 20/10C, a 85% de HR y ausencia/presencia de luz durante el da. Las especies evaluadas se escogieron segn la poca de fructificacin y dispersin, de manera que se pudiera obtener suficiente cantidad de semilla para realizar las pruebas en el tiempo determinado para el estudio. Para semillas abundantes y pequeas se colocaron 100 semillas por caja de Petri, mientras que para semillas grandes y escasas se colocaron 40 semillas por caja de Petri. El nmero de rplicas por especie vari desde tres hasta seis segn la disponibilidad de semillas. Hasta el momento los resultados indican que la luz es un factor determinante para la germinacin de estas especies. Una de las especies de Bucquetia estudiada, Halenia major, Pernettya prostrata Gaultheria anastomosans y Puya trianae y Puya santosii tienen un porcentaje de germinacin mayor al 50%, caracterstica que hace de estas especies potencialmente tiles para la restauracin ecolgica de los pramos. Especies de Pentacalia, Puya y Bucquetia presentaron su pico de germinacin antes del da 21, ms rpido que otras especies. Aunque la condicin de luz sea importante para la germinacin de las semillas, cada especie tiene un patrn y requerimientos particulares para la germinacin. A partir de estos resultados se proponen protocolos de propagacin para estas especies de pramo. Palabras clave: Restauracin ecolgica, germinacin de semillas, estrategias de restauracin, pramos andinos.

CONTROL DE GRAMNEAS EXTICAS EN ZONAS DE PRAMO ALTERADO A TRAVS DE MATRICES DE LEGUMINOSAS ARBUSTIVAS Y HERBCEAS PARA LA CONFORMACIN DE NCLEOS DE REGENERACIN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Liz vila1, Felipe Castiblanco2, Jennifer Insuasti3, Oscar Rojas4, Orlando Vargas5 Grupo de Restauracin Ecolgica de la Universidad Nacional de Colombia, 1 Universidad Nacional de Colombia. laavilar@unal.edu.co, 2 3 4 felicastiblanco@gmail.com, jinsuastyt@unal.edu.co, oarojasz@unal.edu.co, 5 jovargasr@unal.edu.co RESUMEN Se plantea una propuesta de restauracin en zonas de pramo ubicadas en el Parque Nacional Natural Chingaza, afectadas por actividades ganaderas y que se encuentran dominadas por gramneas exticas. Estas gramneas son una barrera para la regeneracin natural y por esta razn es necesaria la implementacin de estrategias de restauracin ecolgica que permitan la eliminacin de las coberturas de especies exticas y la supervivencia y crecimiento de especies nativas. La investigacin consiste en crear ncleos de regeneracin compuestos por leguminosas arbustivas (Lupinus bogotensis) o herbceas (Lupinus microphyllus) y especies nativas del pramo trasplantadas desde zonas no alteradas. Estas ltimas, corresponden a dos tipos de formas de vida: rosetas (Paepalanthus columbiensis y Puya trianae) y arbustos (Pentacalia ledifolia y Arcythophylum nitidum). Con el fin de encontrar un balance ptimo entre competencia y facilitacin se emplean tres distancias de siembra: 40 cm, 60 cm y 80 cm. Se espera que la matriz de leguminosas compita con las gramneas exticas y a la vez permita un mejor desarrollo de las especies trasplantadas. Tambin se espera una respuesta diferencial de las especies trasplantadas y las gramneas provocada por el tipo de cobertura (arbustiva o herbcea) y la densidad de siembra. Actualmente, se monitorean la cobertura de pastos bajo las leguminosas, la cobertura y supervivencia de la matriz y la supervivencia y crecimiento de las especies trasplantadas. Adicionalmente se realiza un monitoreo de las condiciones de temperatura y humedad relativa para examinar los cambios ambientales que pueda generar la matriz de leguminosas. Palabras clave: Chingaza, facilitacin, competencia, leguminosas, gramneas

EFECTO DE LA FERTILIZACIN SOBRE EL CRECIMIENTO Y SOBREVIVENCIA DE ESPECIES NATIVAS

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Deisy Johanna Moreno Betancur1, Sandra E. Cuartas Hernndez. Universidad de Antioquia. Instituto de Biologa, Medelln. 1dejoha0224@yahoo.es RESUMEN En la regin lechera del centro de Antioquia el paisaje ha sido transformado de bosques montanos a pastos para pastoreo de ganado vacuno. La restauracin de zonas definidas como prioridad de conservacin por entes territoriales debe incorporarse en el plan de uso de la tierra debido a que corresponden a ecosistemas estratgicos que ofrecen bienes y servicios a las comunidades locales (i.e. recurso hdrico). El objetivo general de este estudio es seleccionar tres especies arbreas nativas que promuevan el proceso de regeneracin natural de los bosques montanos y evaluar el efecto del tipo de fertilizacin sobre el establecimiento de las plntulas. Quercus humboldtii, Myrsine coriacea y Weinmannia pubescens fueron seleccionadas por presentar altos valores de importancia ecolgica y disponibilidad de propgulos. Se sembraron 1448 individuos en bloques en un rea de 1.5ha en el municipio de Belmira. La mitad de ellos recibieron fertilizacin qumica y el resto fertilizacin orgnica. Los resultados sugieren que no hay un efecto del tipo de fertilizacin en el crecimiento de los individuos para M. coriacea y W. pubescens, mientras la sobrevivencia fue mayor bajo fertilizacin orgnica. Por su parte, Q. humboldtii tuvo mayor tasa de crecimiento con fertilizacin qumica y no se encontr un efecto de la fertilizacin sobre su sobrevivencia. Q. humboldtii es la especie ms exitosa por mostrar mayor probabilidad de sobrevivencia y mayor tasa de crecimiento, mientras M. coriacea y W. pubescens presentaron alta probabilidad de mortalidad principalmente en la poca de heladas, indicando susceptibilidad a la disminucin de la temperatura durante la noche del verano. Considerando la problemtica ambiental ocasionada por el uso excesivo de fertilizantes qumicos y una mayor probabilidad de sobrevivencia bajo fertilizacin orgnica, se recomienda su uso como suplemento del suelo en proyectos que implique la siembra de plantas en reas extensas para asegurar el establecimiento de plntulas. Palabras claves: Restauracin ecolgica, potrero, bosques montanos, ndice de valor de valor de importancia ecolgica. CONTROL DE PASTOS EXTICOS MEDIANTE SOMBREADO ARTIFICIAL COMO ESTRATEGIA DE RESTAURACIN ECOLGICA DE PRAMOS ANDINOS Felipe Castiblanco1, Liz vila, Jennyfer Insuasty-Torres, Oscar Rojas-

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Zamora, Orlando Vargas. Grupo de Restauracin Ecolgica - Universidad Nacional de Colombia. 1 fcastiblancoa@unal.edu.co RESUMEN Uno de los principales usos de la tierra, causante en la mayora de los casos de la destruccin de los ecosistemas de alta montaa, como son los pramos, ha sido el desarrollo de actividades agrcolas y la creacin de pastizales para la crianza de ganado. Muchas de las reas de pramo alteradas por pastoreo presentan gramneas exticas altamente competitivas, como Anthoxanthum odoratumy Holcus lanatus, que limitan la implantacin, establecimiento y reclutamiento de individuos de especies propias del ecosistema. Con el fin de evitar los efectos no deseados de esta matriz de pastos exticos, controlando la regeneracin de stos, se implement el uso de sombreado artificial para poder debilitar los rebrotes ante la ausencia de luz solar y el aumento de la temperatura y de la humedad. Se establecieron 16 parcelas de 3x3m en las cuales se elimin la biomasa epigea y se descompact el suelo con azadn. Luego, 8 parcelas se cubrieron con plstico negro durante tres meses; pasado este tiempo, se midi el porcentaje de cobertura de los pastos exticos en cada una de las 16 parcelas, usando un cuadrante con marco plstico de PVC de 0.5x0.5m. Los datos obtenidos fueron comparados a travs de un ANAVA de un factor. Luego de tres meses de sombreado artificial, esta estrategia disminuy significativamente la regeneracin de las gramneas exticas (F1,14=10.546, p=0.006). Adems, en las parcelas que no fueron cubiertas (control) hubo una fuerte expresin de la especie ruderal Rumex sp, frente a las parcelas que estuvieron cubiertas, donde la falta de luz evit la expresin de dicha especie. El uso de sombra artificial durante tres meses, logr limitar la regeneracin de pastos exticos, por lo que puede recomendarse como estrategia para el control de stas. Sin embargo, tambin es importante monitorear la regeneracin cuando sombra se prolongue por ms tiempo. Palabras clave: pramo andino, sombra artificial, regeneracin, pastos exticos. ESTUDIO ETNOFICOLGICO EN AGUAS TERMOMINERALES EN EL DEPARTAMENTO DE BOYAC (COLOMBIA) Javier Enrique Sierra Forero1, Mayer Isnardo Lagos Lpez2 Grupo de investigacin Biologa para la Conservacin, Lnea Etnobiologa. Universidad Pedaggica y Tecnolgica de Colombia

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL


1

javiersierrauptc010@gmail.com, 2isnardolagos@gmail.com

RESUMEN Desde el punto de vista etnoficolgico, es importante recopilar la informacin existente en lugares donde se presenta la implementacin y uso de algas con aplicacin esttica y medicinal, en relacionados con el cuidado de la piel, manejo del estrs, y enfermedades del sistema circulatorio, entre otros. El departamento de Boyac, cuenta con una riqueza hdrica termomineral, al ubicarse geogrficamente en una zona de mesetas y reas montaosas, irrigadas por medianos ros y aguas minerales subterrneas (aguas termales). Principalmente, en los municipios de Iza, Guateque y en especial Paipa, es donde se enmarca el reconocimiento termomineral con amplia acogida turstica a nivel nacional e internacional. En la actualidad, como consecuencia del aumento del nivel de vida medio y de la popularizacin en los tratamientos estticos (se desea vivir ms y mejor), a diario se ve la gran difusin de balnearios y zonas de spa. Profundizar en el estudio de la medicina esttica hidrotermal hoy da es realmente interesante, pues la sociedad actual demanda tcnicas estticas menos crueles y mucho ms efectivas. Conocimientos que no solo arrojan importante informacin respecto al verdadero uso potencial medicinal y en tratamientos estticos, sino que permiten evaluar el estado del arte y sus mltiples usos. El conocimiento de estas poblaciones, su investigacin y determinacin taxonmica, constituyen un importante aporte a bases de datos referentes a la diversidad ficolgica para el pas. Se destaca la presencia de gneros como Oscillatoria y Noctoc en cada una de las muestras analizadas. Palabras clave: Algas, Boyac, Etnoficolgia, Termomineral.

ESTUDIOS PRELIMINARES DE PROPAGACIN IN VITRO DE Espeletia paipana ENDMICA DEL PNM RANCHERA-PAIPA-BOYAC, ESPECIE EN PELIGRO CRTICO DE EXTINCIN 1 Eyda Araque , Mara Bohrquez Grupo de Investigacin BIOPLASMA, Universidad Pedaggica y Tecnolgica de Colombia, Tunja. 1johanna.200710338@gmail.com

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESUMEN Espeletia paipana S. Daz & Pedraza, frailejn endmico del Parque Natural Municipal Ranchera (Paipa-Boyac-Colombia), est catalogada como especie En Peligro Crtico de Extincin, debido a la drstica y progresiva disminucin de su poblacin causada tanto por el deterioro de su hbitat natural y accin de predadores, como por la escasa germinacin y baja viabilidad de la semilla; por estas condiciones adversas los procesos de su regeneracin natural estn detenidos. De otro lado, los estudios sobre propagacin in vitro enfocados a la recuperacin y conservacin de especies vegetales amenazadas aun son escasos. Por tanto, este trabajo pretende establecer un protocolo de micropropagacin que permita la propagacin masiva de E. paipana. Como explantes iniciales se utilizaron embriones sexuales y se cultivaron en MS y MS con macrosales en concentraciones menores a la original, sin reguladores de crecimiento; la proliferacin de brotes se realiz en MS suplementado con auxinas y citoquininas adicionadas individualmente o combinadas. Para induccin de enraizamiento se probaron varias concentraciones de diferentes auxinas y para la aclimatizacin las microplantas se transfirieron a un sustrato compuesto por turba/capote; el proceso se inici en cuarto de crecimiento y finaliz en invernadero. Los resultado obtenidos mostraron que el 3.5% de embriones cultivados germinaron en MS y MS, suplementados con GA 3 (cido giberlico) y Kin (Kinetina), mientras que la proliferacin de yemas (1:4) fue ms alta en MS suplementado con AIB (cido 3-indolbutrico) ms BA (6-Bencil amino purina). Los mayores porcentajes (80-90%) de brotes enraizados se cuantificaron en MS ms ANA (cido naftaleactico). Despus de 30 das de iniciado el proceso de aclimatizacin 70% de microplantas fue viable. Estos resultados preliminares demuestran una alternativa posible para implementar un programa de propagacin masiva que permita la recuperacin de E. paipana, as como la aplicacin del procedimiento establecido a otras especies en peligro de extincin. Palabras Clave: Espeletia paipana, propagacin in vitro, endmica, En Peligro Critico (CR). EVALUACION DE LA LLUVIA DE SEMILLAS DE Gaiadendron punctatum (LORANTHACEAE) Y Ternstroemia meridionalis (THEACEAE) EN EL PARQUE NATURAL MUNICIPAL RANCHERA Martha Parada. Grupo de Investigacin Biologa para la Conservacin. Universidad Pedaggica y Tecnolgica de Colombia. marticapq@gmail.com

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESUMEN Gaiadendron punctatum (Ruiz & Pavn) G. Don y Ternstroemia meridionalis Mutis ex L.f. son especies nativas de bosque altoandino, con frutos adaptados para la dispersin por animales. G. punctatum es abundante en el Parque Natural Municipal Ranchera, y T. meridionalis rara localmente. Este estudio busc evaluar el patrn temporal de la lluvia de semillas, importante como indicador del potencial de regeneracin de estas especies en esas reas. El muestreo se realiz entre marzo y diciembre de 2010, perodo que incluye poca seca y lluviosa. En 5 individuos en estado reproductivo de cada especie se cuantific la oferta de frutos. Para evaluar la lluvia de semillas se instalaron 8 trampas, ubicadas a 10 m del parental ms cercano, y con un rea de recoleccin de 1 m 2. Las semillas de G. punctatum y T. meridionalis encontradas en las trampas, fueron separadas y se cont el nmero de semillas intactas, a las cuales se les hizo prueba de viabilidad con Tetrazolium. La fructificacin de las dos especies fue continua; la mayor fructificacin se present en poca lluviosa. Las dos especies presentaron lluvia de semillas durante todo el estudio, G. punctatum present mayor lluvia de semillas con 169/m2, mientras que T. meridionalis present 50 semillas/m2. La mayor abundancia de semillas de G. punctatum se present en poca seca, mientras que en T. meridionalis fue en poca lluviosa. A pesar de la baja lluvia de semillas, T. meridionalis, mostr un porcentaje alto de semillas viables. La mayor lluvia de semillas y alta fructificacin de G. punctatum representa un potencial para que la especie permanezca en el rea y ratifica el potencial sealado para ser empleada en bordes de bosque y paramizado. Aunque el nmero de semillas de T. meridionalis no fue muy alto, es importante para que la especie pueda persistir en el rea. Palabras clave: Gaiadendron punctatum, Ternstroemia meridionalis, lluvia de semillas, bosque altoandino. REDESCUBRIMIENTO DE Miconia Imbricata GLEASON Y NOVEDADES COROLGICAS DE MELASTOMATACEAE PARA EL PARQUE NACIONAL NATURAL TATAM. Juan Mauricio Posada-Herrera Semillero de Investigacin en Biodiversidad y Recursos Filogenticos, Herbario de la Universidad de Caldas (FAUC). juan.posada87@gmail.com. RESUMEN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

En los Andes tropicales se ha postulado que las altas tasas de especiacin, producidas por las sucesivas contracciones y expansiones de las reas de las especies andinas a travs de los cambios climticos, parecen haber producido altos niveles de riqueza y endemismos. La familia Melastomataceae muestra una alta riqueza en los ecosistemas andinos y es frecuente encontrar una alta diversidad en los estudios florsticos, asimismo, es frecuente su alto porcentaje de endemismos y especies con marcadas restricciones altitudinales. El Parque Nacional Natural Tatam alberga diversos ecosistemas andinos entre los 20004000msnm, no obstante se han realizado pocos estudios que recopilen datos sobre la flora de la zona, sin embargo, se sabe que Melastomataceae es la segunda familia ms diversa en el Parque (99 especies). Por este motivo, en enero del 2011 se llev a cabo una expedicin en la vertiente oriental del Parque Natural y como producto de estas exploraciones, se obtuvieron colecciones de las especies Graffenrieda emarginata (Ruiz & Pav.) Triana, Meriania quintuplinervis (Triana) Almeda, Miconia asperrima Triana, Miconia quintuplinervia Cogn, Miconia rhodantha Wurdack, Miconia spinulidentata Cogn. & Gleason, Miconia tonduzii Cogn, Miconia turgida Gleason, Miconia wurdackii L. Uribe y Ossaea micrantha, Macfad ex Cogn, que son novedades corolgicas para el Parque y adems, se presenta el redescubrimiento de Miconia imbricata Gleason, especie endmica para Tatam y con una alta restriccin altitudinal, de la cual, solo se conoca por su coleccin tipo realizada por Francis W. Pennel en 1922. Estudios de este tipo son importantes para obtener datos sobre la distribucin de las especies en el territorio nacional y su grado de endemismo. Palabras clave: Novedades, endemismo, Tatam, Andes, conservacin.

VARIABILIDAD AMBIENTAL Y RESPUESTAS FISIOLGICAS DE Polylepis cuadrijuga (ROSALES, ROSACEAE) EN UN AMBIENTE FRAGMENTADO EN EL PRAMO DE LA RUSIA (COLOMBIA) Carolina Ramos1, Sindy Buitrago2, Karen Pulido3, Leidy Vanegas4 Universidad Pedaggica y Tecnolgica de Colombia. 1 2 3 carolina.ramos@uptc.edu.co, kalisahe@hotmail.com, biopao.k18@gmail.com, 4 leidyvanegas_8915@hotmail.com. RESUMEN

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Polylepis cuadrijuga es una especie leosa endmica de la cordillera oriental de Colombia, donde la agricultura y el pastoreo han generado la fragmentacin de sus bosques. Para determinar si existe un efecto borde en fragmentos ubicados en el Pramo de la Rusia, se establecieron diferencias ambientales y se evalu las respuestas ecofisiolgicas de P. cuadrijuga entre matriz de pastura, borde e interior de los fragmentos, mediante la medicin de temperatura ambiental, humedad relativa, capacidad de retencin de agua del suelo y radiacin fotosintticamente activa, a lo largo de dos transectos de 50 m desde la matriz hacia el interior. En cada sitio se escogieron seis rboles para evaluar el contenido de clorofila, rea foliar, biomasa foliar, rea foliar especfica, anatoma foliar, sanidad y pubescencia. En matriz fue mayor la temperatura y la radiacin, condiciones relacionadas con la disminucin del rea Foliar Especfica y el aumento del contenido de clorofilas, evidenciado por la presencia de un parnquima en empalizada biestratificado. Caractersticas ecofisiolgicas similares a las expuestas en borde, que confirman un efecto de borde que podra penetra unos 17 m en el interior de los fragmentos. Se concluye que P. cuadrijuga es una especie plstica, capaz de enfrentar condiciones de estrs generadas por actividades antropognicas. Palabras clave: rea foliar especfica, bosque altoandino, clorofila, efecto borde, plasticidad.

VARIACIN DEL ESTABLECIMIENTO DE LAS ESPECIES Hypericum juniperinum Kunth. E Hypericum laricifolium Juss. EN DOS ECOSISTEMAS DE PRAMO DE LA CORDILLERA CENTRAL COLOMBIANA Yadi Toro1, Juliana Cern2 1,2 Universidad de Caldas, Colombia. 1yatoro4@gmail.com RESUMEN Los estudios de las relaciones interespecficas en ecosistemas de pramo son herramientas necesarias para la planificacin de programas de conservacin y

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

manejo racional de los recursos naturales. La estructura de las comunidades vegetales refleja la dinmica de establecimiento y las respuestas adaptativas de las plantas a determinadas condiciones. El objetivo fue determinar la variacin del establecimiento de dos especies del gnero Hypericum en dos ecosistemas de pramo de la cordillera central. El rea de estudio presenta una altitud de 3817m; zona amortiguadora del Parque Nacional los Nevados, departamento de Caldas, Humedad Relativa del 90%, Temperatura promedio de 4,5 C, precipitacin de 1428mm. En dos asociaciones vegetales: rosetal-arbustal y arbustal, se ubicaron transectos de 100x5m, uno por cada hbitat: Borde e interior de arbustal y borde e interior de rosetal-arbustal. Los transectos de borde se establecieron entre 5 y 10m del borde, los de interior entre 60 y 90 m del mismo, se registr la altura y permetro del grupo de tallos de cada individuo, se compararon las medias de los valores de abundancia de individuos de las dos especies en cada tipo de hbitat y se analizaron los valores de reas basales de dichos hbitats mediante ANOVA a una va. Se encontraron diferencias estadsticamente significativas (p=0.0453) entre los valores de reas basales por especies y entre hbitats, mientras que el nmero de individuos no vari significativamente comparando entre especies y entre transectos. La abundancia de individuos no constituye un parmetro para determinar que existe asociacin entre las especies estudiadas y los diferentes hbitats, adems las divergencias entre valores de reas basales no debe atribuirse nicamente a la influencia del hbitat, tambin estn relacionados con aspectos biolgicos y ecolgicos particulares de las especies. Palabras clave: Comunidad vegetal, establecimiento, rosetal, arbustal.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

PRINCIPALES ARVENSES EN CULTIVOS DE PAPA (Solanum tuberosum L.) EN UN PRAMO DEL MUNICIPIO DE VILLAMARA, CALDAS Nstor Fabio Alzate Quintero Docente Departamento de Ciencias nestor.alzate@ucaldas.edu.co. RESUMEN Las arvenses constituyen especies de plantas que al convivir en competencia con cultivos econmicos, algunas veces deterioran significativamente sus rendimientos. Con la finalidad de identificar las principales arvenses en cultivos de papa (Solanum tuberosum L.) en un pramo aledao a la Laguna Negra, municipio

Biolgicas.

Universidad

de

Caldas,

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

de Villamara, Caldas, Colombia, se recolectaron muestras en dos predios de 5 ha cada uno (Hacienda La Laguna y Finca El Porvenir), mediante el lanzamiento al azar de un rectngulo de madera (0,5 0,5 m), estimndose 5 lanzamientos/ha, durante el perodo de lluvia (Octubre-Noviembre) de 2011. La zona geogrfica muestreada se encuentra ubicada entre los 3817 y los 3995 msnm, con coordenadas 4 59 40.5 N y 75 20 17.9 W, en la zona amortiguadora del Parque Nacional Natural Los Nevados. Las especies de mayor prevalencia fueron Anthoxanthum odoratum L.(36%), Rumex acetosella L. (32%), Lachemilla orbiculata (Ruiz &Pav.) Rydb. (26%), Holcus lanatus L. (21%), Bromus catharticus Vahl(19%), Hypochaeris radicata L.(17%), Trifolium repens L. (16%) y Oxalis corniculata L. (15%). En ambos predios se observa una distribucin homognea de las especies de arvenses, estimndose un ndice de similaridad de Jaccard de 89,6% para La Laguna y 83,3% para El Porvenir, sugiriendo que ambas explotaciones agrcolas pertenecen a una misma unidad fisiogrfica del pasaje. El valor de equitatividad de Pielou (41,3%) muestra que ninguna de las arvenses presentes es ampliamente dominante en la comunidad vegetal, mostrando preferencias de asociacin con especies poco o medianamente agresivas y de gran capacidad competitiva. Se recomienda implementar medidas integrales de control de arvenses (qumico y aleloptico) y continuar los estudios de prevalencia a fin de detectar a tiempo, cualquier cambio en su composicin y abundancia que pudiera afectar seriamente los cultivos de papa en la regin. Palabras clave: Arvenses, Solanum tuberosum, Laguna Negra, Villamara, Caldas. DIVERSIDAD DE LEPIDPTEROS DIURNOS EN EL COMPLEJO DE PRAMOS Y BOSQUES ALTOANDINOS DEL MUNICIPIO DE BELMIRA, ANTIOQUIA Alejandra Clavijo-Giraldo1, Carlos Federico lvarez-Hincapi, Alejandro Marn Uribe, Francisco Restrepo Carrasquilla. 1 Universidad de Antioquia. biologiamclg@gmail.com. RESUMEN A pesar de la alta diversidad biolgica y el alto grado de endemismo que presentan los bosques altoandinos y pramos a lo largo del territorio colombiano, poco se conoce acerca de las dinmicas ecolgicas que presentan las comunidades de lepidpteros en respuesta al efecto la intervencin antrpica y la Mario

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

fragmentacin de estos ecosistemas. En este estudio, se compar la diversidad de lepidpteros diurnos en cuatro localidades ubicadas dentro del complejo de pramos y bosques altoandinos del centro del departamento de Antioquia. Las cuatro localidades estn separadas por el valle de la cuenca alta del ro Chico, una zona de alta intervencin antrpica y dependiente de los servicios ambientales del pramo. Se realizaron muestreos desde los 2800 a 3300 m.s.n.m. para cada localidad con trampas de cebo y captura activa con jama. Se reportan ms de 80 especies para las cuatro localidades siendo los Satyrinae-Pronophilina los ms diversos (56 especies). El agrupamiento por similitud entre las localidades muestra un grupo conformado por los sitios de muestreo de la vertiente occidental del ro Chico (Alto el Indio y Alto Malvaz) posiblemente debido a la cercana y conectividad entre ambos sitios. Por otra parte, el predio Montaitas en la vertiente oriental del ro se reporta como la localidad menos diversa y ms diferenciada, lo que coincide con su mayor grado de aislamiento y fragmentacin y la menor conectividad con el resto de bosques dentro del complejo. Se registra adems que del total de especies reportadas 45% no son compartidas entre las localidades, lo que resalta la importancia de la implementacin de planes de manejo, conservacin, recuperacin e implementacin de corredores biolgicos que garanticen la permanencia y proteccin de la diversidad para la regin. Palabras clave: Satyrinae. agrupamiento por similitud, fragmentacin, Pronophilina,

MARIPOSAS DE ALTA MONTAA. UN CASO DE ESTUDIO EN EL MACIZO DE BIJAGUAL, BOYAC Dumar Ariel Parrales R. Universidad Pedaggica y Tecnologa de Colombia. dumar7@gmail.com. RESUMEN El departamento de Boyac es una de las regiones geogrficas de Colombia con mayores vacos de informacin sobre la diversidad de mariposas diurnas y en especial la alta montaa debido a varios factores como la ausencia de inventarios sistematizados y la extrapolacin de informacin con otras regiones del pas. Con lo expuesto se intenta conocer y describir las comunidades de mariposas con criterios de diversidad, presentes en 3 coberturas vegetales en el macizo de Bijagual en Boyac. En estas reas del macizo, las coberturas fueron bosque

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

secundario temprano (8-12 aos), tardo (16-20 aos) y un rastrojal de aproximadamente de 10 aos; estas se encuentran en una franja altitudinal de 2800 a 3100 msnm. Los muestreos se realizaron en dos pocas climticas durante el segundo semestre del 2011 y parte del primero del 2012 (septiembre/octubre hmeda- y diciembre/enero -seca-). Se colectaron 1465 ejemplares de mariposas distribuidas en cuatro familias, 8 subfamilias, 33 especies y 11 subespecies para un total de 44 taxones a nivel especfico y subespecfico de mariposas. De otra parte las curvas de acumulacin de especies por cobertura vegetal presentan una alta representatividad del esfuerzo de muestreo segn la estimadores de riqueza utilizados (Chao1, Jack1, ACE).Como respuesta al rgimen climtico se observaron cambios significativos en las abundancias, la diversidad y la dominancia mientras que la riqueza se mantuvo relativamente constante. La nica cobertura que mostr diferencias en el ensamblaje fue el rastrojal. Palabras clave: Andes, diversidad, mariposas, alta montaa.

CONOCIMIENTO PRELIMINAR DE LOS ESTAFILNIDOS (COLEOPTERA: STAPHYLINIDAE) EN EL BOSQUE HMEDO TROPICAL DE SANTA MARA (BOYAC) Yudy Sissa Dueas Universidad Pedaggica paulis0926@yahoo.es. RESUMEN La familia Staphylinidae es el grupo ms diverso dentro del orden Coleoptera y en todo el reino animal con 55,440 especies descritas entre extintas y existentes. Esta diversidad se debe a la gran variedad de hbitat como hojarasca principalmente en donde utilizan como alimento materia orgnica en descomposicin y otros son depredadores; tambin se les puede encontrar en el dosel, troncos en descomposicin, hongos, en la carroa y excremento de

Tecnolgica

de

Colombia,

Tunja,

Colombia.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

diferente origen animal. Este trabajo pretendi conocer la fauna de Estafilnidos en el bosque hmedo tropical de Santa Mara (Boyac), en donde se realiz un muestreo de 10 das en el sector La Almenara en diferentes altitudes (1.000m, 1.200m y 1.400m), donde se establecieron transectos de 100m, utilizando trampas de cada con cebo (Calamar y fermento), cernido de hojarasca, berlese y colecta directa. Los especmenes colectados se preservaron en alcohol al 70% y se transportaron al Laboratorio de entomologa de la Universidad Pedaggica y Tecnolgica de Colombia, para su posterior montaje e identificacin con ayuda del trabajo de Navarrete (2002) y para la morfologa se utiliz el libro de Blackwelder 1936. Se colectaron 607 individuos distribuidos en 9 subfamilias siendo la familia Aleocharinae (63.59%), Staphylininae (10.21%), y Osorinae (5.43%), Oxytelinae (4.61%) las ms abundantes y aportando un listado preliminar de gneros en el bosque hmedo tropical de Santa Mara, contribuyendo con el conocimiento de la familia Staphylinidae en el departamento de Boyac y en el pas. Palabras clave: Coleoptera, Estafilnidos, Bosque Hmedo, trampa de cada

LOS ANDES COMO FUENTE DE ESPECIACIN, UNA EVIDENCIA CON RANAS DE LLUVIA DEL GNERO Pristimantis. Felipe Duarte-Cubides1, Juan M. Daza Universidad de Antioquia, Instituto de Biologa, Grupo Herpetolgico de Antioquia. 1 albetofelipe@gmail.com RESUMEN Los Andes son un sistema montaoso que se extiende 9000 km a lo largo de seis pases Suramericanos, dividindose principalmente en tres regiones con historias biogeogrficas particulares. El levantamiento de la regin del norte de los Andes que comprende Ecuador, Colombia y Venezuela ha sido hipotetizada como una bomba de especies donde su biota posiblemente respondi a medida que la cadena montaosa experimentaba cambios en su altura y en su extensin originando mltiples especies. El objeto de este estudio utiliza el grupo de ranas de lluvia con desarrollo directo conocido como Pristimantis, con el fin de evaluar

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

los patrones de especiacin a lo largo de un gradiente altitudinal y latitudinal en los andes del norte. En total se obtuvieron 254 secuencias correspondientes a dos marcadores del genoma mitocondrial y representando 127 especies. Se realiz un anlisis filogentico por medio de inferencia Bayesiana. Posteriormente se observ el patrn de divergencia y la ubicacin geogrfica de las especies en los ejes latitudinal y altitudinal. Los resultados sugieren que el gnero en su totalidad no respondi a la secuencia de orognesis sur-norte de los Andes, sino que estos eventos geolgicos afectaron solo pequeos grupos de especies. La especiacin de uno de los grupos de vertebrados terrestres ms diversos en el planeta requiere de una estrategia de mltiples hiptesis donde factores geolgicos, ecolgicos y filogenticos generaron la gran diversidad de ranas de lluvia que se encuentra en los Andes del norte. Palabras clave: dispersin, especiacin, orognesis, vicarianza, Pristimantis

ACERCAMIENTO A LA COMPOSICIN DE LA DIETA DE BOLITOGLOSSA HYPACRA (CAUDATA: PLETHODONTIDAE) Carlos Jimenez-Rivillas1,2; Mara Prez1,2; Jos Fang1,2, Nayibe Cala1,3 Universidad de Antioquia. Medelln, Colombia. 1Instituto de Biologa. Facultad de Ciencias Exactas y Naturales.2Grupo Herpetolgico de Antioquia (GHA), Museo de Herpetologa. 3Grupo de ecologa lotica, islas, costas y estuarios (ELICE). carlosjr555@gmail.com. RESUMEN Algunos aspectos de la historia natural de los anfibios, como dieta y reproduccin pueden ser malinterpretados, principalmente por el hbito crptico que presenta la mayora de las especies. Las salamandras, al igual que otros anfibios evidencian limitaciones en la distribucin en el hbitat que los restringe a sitios con alta humedad o cercanos al agua. Fueron observados en campo individuos de Bolitoglossa hypacra durante un muestreo en el pramo del sol (Urrao-Antioquia). Los especmenes se hallaron en diferentes micro-biotopos de Espeletia sp en el

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

transcurso de la jornada, encontrndose mayormente entre las hojas muertas durante el da y en las hojas vivas durante la noche. Se colectaron 20 individuos de la especie, se depositaron en el museo de herpetologa de la Universidad de Antioquia (MHUA), Se disectaron y se extrajeron los estmagos, posteriormente se identificaron y cuantificaron las presas, agrupndose en los diferentes tems encontrados. Los resultados muestran una mayor proporcin de insectos pertenecientes al orden Hymenoptera (10,87%), Coleoptera (23,91%), Acari (26,09%). Se reporta el hallazgo de semillas de Poaceae en gran proporcin (19,57%). Aunque los registros de algunos de estos tems presentan similitudes a los reportados para otras especies cercanamente emparentadas, este tipo de informacin es nueva, lo que proporciona un aporte significativo a la biologa bsica de B. hypacra, puede decirse que el tipo y el tamao de las presas consumidas se explica por las limitaciones morfolgicas y la variacin en el espectro de presas disponibles. A partir de las tems identificados, se discute acerca de la preferencia de la especie por el microhbitat con hojas muertas, lo cual est relacionado a que ste biotopo ofrece el principal refugio a los insectos de pramo. Palabras clave: Bolitoglossa hypacra, Pramo del sol, microbiotopos, Espeletia, dieta. COMPOSICIN DE REPTILES EN UN RELICTO DE SELVA ANDINA EN LA PERIFERIA URBANA DE MANIZALES, CALDAS Elizabeth Snchez Universidad de Caldas. elizabethsancheztoro@gmail.com RESUMEN Entre febrero y junio de 2012, se caracteriz la comunidad de reptiles presentes en Montelen, un relicto de selva andina de 17 hectreas ubicado en la periferia urbana de la ciudad de Manizales, departamento de Caldas, con una altitud de 2250m, precipitacin de 1970 mm y temperatura promedio de 14,5 C; clasificado como suelo de proteccin del municipio, ampliamente afectado por procesos de expansin urbana. Se tomaron datos, con el objetivo de inventariar y conocer la distribucin espacial de los reptiles. Los muestreos se realizaron utilizando la tcnica VES (bsqueda por encuentro visual), los especmenes fueron capturados manualmente. Se utilizaron los ndices de Shannon-Weiner para medir diversidad y de Simpson para establecer dominancia, adems se calcul el xito de captura (nmero de individuos/ Hora) y se represent en una curva de acumulacin de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

especies. Se registraron 384 individuos, distribuidos en cinco familias, ocho gneros y 13 especies. Las familias Dactyloidae y Gymnophthalmidae fueron las mejor representadas con cuatro y tres morfoespecies respectivamente. El gnero Anolis fue el ms representativo con cuatro especies y un total de 178 individuos, siendo las especies Anolis ventrimaculatus y A. tolimensis los taxones ms abundantes del estudio, registrando conjuntamente el 46,4% del total de los individuos encontrados. En cuanto a la distribucin vertical, la comunidad de reptiles present un mayor nmero de individuos ubicados entre 1 y 1,50m del suelo y la distribucin horizontal present variaciones evidenciando agregaciones hacia el centro del bosque durante el da y dispersin hacia los bordes en la noche, este comportamiento se puede interpretar como un mecanismo de defensa frente a perturbaciones crnicas presentes en el lugar como el intenso ruido y el ingreso de personas al bosque. Se evidenci un efecto adverso de la perturbacin sobre la composicin, modificando la dinmica de la comunidad, aumentando la dominancia de pocas especies y disminuyendo la riqueza, alterando la diversidad local. Palabras clave: Comunidad de reptiles, perturbacin de hbitat, selva andina. MAMIFEROS RESIDENTES EN LA UNIVERSIDAD PEDAGOGICA Y TECNOLOGICA DE COLOMBIA Gina Liliana Rojas Lizarazo1, Javier Alvarado Macas2, Alcibiades Escrraga Saavedra3 Grupo Biologa para la Conservacin - Escuela de Ciencias Biolgicas. Universidad Pedaggica y Tecnolgica de Colombia. 1giliroli@yahoo.es, 2 jahualma@hotmail.com, 3alcysaavedra17@gmail.com RESUMEN La riqueza de mamferos de Colombia (471 especies) ubica a nuestro pas como el cuarto a nivel mundial y el tercero en el Neotrpico, despus de Brasil (565 especies). El conocimiento de la mastofauna de las diferentes regiones del pas, permite desarrollar planes y programas de conservacin acertados. En el presente trabajo, se estudi la diversidad de mamferos en el campus de la Universidad Pedaggica y Tecnolgica de Colombia, en la sede central ubicada en el municipio de Tunja, a una altitud de 2700 m. El rea de estudio corresponde a una zona de vida de bosque seco montano bajo, con ecosistemas altamente fragmentados. Se presentan los resultados obtenidos de los muestreos realizados entre mayo de

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

2010 y diciembre de 2011, empleando mtodos directos e indirectos para el levantamiento de la informacin sobre riqueza de especies del rea de estudio. El esfuerzo muestral fue equivalente a un total de 900 horas, utilizando 2 metodologas: 1) Rastreo de indicios (huellas, avistamientos, heces, restos y madrigueras) y 2) Capturas y encuestas.Los mamferos registrados en el campus universitario pertenecen a los rdenes: Carnvora, Didelphimorphia, Rodentia, Soricomorpha y Chiroptera. Hasta la fecha, se reporta la presencia de 11 especies agrupadas en 6 familias. De las especies registradas se encontraron dos especies domsticas de roedores: Ratus ratus y Mus musculus asociadas principalmente al ro de la Vega el cual atraviesa el campus universitario. Los gremios trficos de la mastofauna residente en la UPTC corresponden a carnvoros, frugvoros, insectvoros, nectarvoros y granvoros. Se comenta sobre los registros ms notables y su frecuencia de avistamiento en el campus universitario. Palabras clave: campus universitario, riqueza de mamferos, Tunja.

EVALUACIN DE LA AVIFAUNA EN EL SECTOR DEL PRAMO RABANAL RAQUIRA, BOYAC - Y SU IMPORTANCIA EN LA CONSERVACIN DE ECOSISTEMAS ALTOANDINOS Samuel Rodrguez P1, Lizeth Vega, Yeimy Sanabria, Pablo E. Rodrguez A2. Universidad Pedaggica y Tecnolgica de Colombia. 1,2Grupo de estudios Ornitolgicos de la UPTC.1rp.samuel@hotmail.com. RESUMEN Las aves representan un grupo especial para diagnosticar el estado de la biodiversidad en un rea determinada, donde los bosques y parches continuos conforman el hbitat de muchas especies y constituyen corredores biolgicos de desplazamiento, refugio y sitios de reproduccin de la fauna silvestre. Sin embargo la supervivencia de la avifauna puede ser afectada por la presencia de caminos, ganadera, invasin de especies forneas y transformaciones en el rea de reproduccin. En este trabajo se evalu la composicin y diversidad de aves del pramo de Rabanal en el municipio de Rquira, en zonas intervenidas por factores antropognicos como la ganadera, agricultura y minera. Se realiz un inventario de las aves en el mes de junio mediante observaciones visuales, auditivas y captura con redes de niebla en relictos de bosque altoandino entre los

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

3200 y 3450 m. Se registraron 22 familias con 32 gneros y 38 especies, 46 capturas, 136 por observacin, y 42 por audicin para un total 224. Diglossa humeralis fue la especie con mayor nmero de reportes en captura seguida por Metallura tyrianthina y Eriocnemis vestitus; Chlorospingus canigularis, en el sector ampla su rango de distribucin altitudinal a 3.400 m; aspecto que podra relacionarse con el cambio climtico sobre su distribucin. Se resalta la presencia de Conirostrum rufum y Synallaxis subpudica como especies endmicas de la cordillera oriental del altiplano cundiboyacense. En tanto Conirostrum albifrons que es propio de zonas boscosas denota la importancia de conservar los ecosistemas del bosque altoandino, que en conjunto con el pramo conforman reas de recarga hdrica para la Laguna de Fquene, las Represas de Gachaneca y Teatinos. La informacin aqu presentada es una de las primeras sobre la regin y hace parte de la estrategia dos y tres para la conservacin de la Biodiversidad de los andes planteada por el Instituto de Investigaciones Biolgicas Alexander von Humboldt. Palabras clave: Pramo, conservacin, avifauna, intervencin, corredor biolgico, diversidad.
SIMPOSIO 4. POLTICAS PBLICAS-HERRAMIENTAS DE PLANIFICACIN Y GESTIN: UNIVERSIDADES ESTATALES, UNIVERSIDADES PRIVADAS, GOBERNACIN DE BOYAC, ORGANIZACIONES GUBERNAMENTALES Y NO GUBERNAMENTALES, ORGANIZACIONES CVICAS, ALCALDAS MUNICIPALES

ALTERNATIVAS ANTE EL CONFLICTO ENTRE AUTORIDADES AMBIENTALES Y HABITANTES DE REAS PROTEGIDAS EN PRAMOS COLOMBIANOS Manuela Avellaneda-Torres1, Esperanza Torres, Toms Len Universidad Nacional de Colombia. Sede Bogot. Facultad de Agronoma. 1 lmavellanedat@unal.edu.co RESUMEN Soportes antropolgicos demuestran la ocupacin de personas en pramos colombianos desde hace 10.000 aos. Por otro lado la declaracin de zonas de reserva como Parques Nacionales Naturales (PNN) es relativamente reciente. La ocupacin humana de los pramos colombianos, en donde habitan ms de 500.000 personas, ha generado conflictos entre las normativas ambientales

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

vigentes y los usos productivos del suelo. La presente investigacin tuvo como objetivo la evaluacin de posibles alternativas de conservacin del pramo (utilizado en su mayor parte con cultivos de papa y ganadera), especficamente en la vereda El Bosque (Risaralda), ubicada al interior del PNN Los Nevados. Se aplicaron 13 entrevistas estructuradas, 17 semi-estructuradas y herramientas de diagnstico rural participativo (observacin participante, 3 mapas de vereda y finca, 3 calendarios de actividades agrcolas y 3 diagramas de distribucin de trabajo por gnero) tanto a habitantes de la vereda como a funcionarios estatales. Los resultados mostraron diferencias en la percepcin del problema entre distintos grupos de inters y dos tipos de alternativas de uso: la primera plantea la concesin de servicios ecotursticos en el parque y la compra de tierras por parte de sociedades de economa mixta. La segunda plantea el abandono de las actividades productivas de los agricultores, mediado por procesos educativos o de cumplimiento de las normas ambientales vigentes so pena de enfrentar acciones punitivas por parte del Estado. Como conclusin de este trabajo se propone una tercera alternativa, que parte de la crtica a las dos anteriores e incluye diferentes estrategias de manejo comunitario con tiempo y financiacin institucional pertinente, aplicacin de modelos agroecolgicos, rescate de memoria biocultural y cambios en estructura agraria. Algunas de estas estrategias requieren cambios estructurales en el actual modelo de desarrollo agrario. Palabras clave: pramo, conservacin, ganadera, cultivo de papa.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

RESPUESTA SOCIO-AMBIENTAL DE LA COMUNIDAD DE ARCABUCOBOYAC FRENTE A LA EXPLOTACIN DE MINERIA A CIELO ABIERTO EN EL PRAMO VALLE DE LOS ENSUEOS Nataly Poveda Daz 1, Milena Crdenas Avella2, Camilo Andrs Crdenas3 Universidad Pedaggica y Tecnolgica de Colombia. 1Grupo de investigacin Sistema Biolgica (SISBIO). 2Grupo de investigacin en Manejo Integrado de Ecosistemas y Biodiversidad (XIUA). 3Grupo de investigacin Laboratorio de Cultivo de Tejidos Vegetales (BIOPLASMA). 1napodi@hotmail.com. RESUMEN Planteamiento del problema. La extraccin de materiales para construcciones se debe en gran medida a la actividad antrpica, la cual genera fuertes cambios e impactos sobre el pramo, afectando los servicios ambientales que est presta a la poblacin, como la continua provisin de agua en cantidad y calidad; razn por la cual se debe concientizar a la comunidad local, que actividades econmicas como la minera a cielo abierto, ganadera y agricultura contribuyen a la degradacin de los ecosistemas. Objetivos. General: Identificar la percepcin de la comunidad local para establecer si el componente socio-econmico, (la minera a cielo abierto) hace parte de la problemtica ambiental, en el Pramo Valle de los ensueos Arcabuco-Boyac. Especficos. Evaluar los posibles componentes de la problemtica ambiental y social a travs del m todo de marco lgico.

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA FACULTAD DE CIENCIAS BSICAS ESCUELA DE CIENCIAS BIOLGICAS

GRUPO DE INVESTIGACIN BIOLOGA AMBIENTAL

Identificar las principales problemticas ambientales, segn la percepcin de la comunidad local del municipio de Arcabuco- Boyac. Mtodos. Se realizaron salidas de Campo al Pramo Valle de los Ensueos y cercanas de la cantera La Esperanza, identificando las principales problemticas ambientales en el sector rural del Municipio de Arcabuco-Boyac; posteriormente se realizaron encuestas a la comunidad local con preguntas que permitieron la definicin y valoracin de los principales problemas socio-ambientales que ellos detectan en el municipio; finalmente a travs del mtodo Marco Lgico, tcnica para la conceptualizacin, diseo, ejecucin y evaluacin de proyectos ambientales, se elabor un rbol de causalidad para la formulacin de posibles estrategias de conservacin. Resultados y discusin. La minera y ganadera resultaron ser la base para la formulacin de estrategias para disminuir el efecto de la fragmentacin de comunidades vegetales de Pramo (problema crtico) en el pramo Valle de los ensueos el cual es fuente del recurso hdrico del municipio de Arcabuco-Boyac. Conclusin. Se identific que la fragmentacin de la comunidad vegetal es el principal problema ambiental, en el pramo de los Valle de los Ensueos, siendo la minera a cielo abierto y la ganadera las causas directas. Palabras clave: Fragmentacin vegetal, Socio-ambiental, Pramo, ArcabucoBoyac, Recurso hdrico.