Anda di halaman 1dari 65



The Optimization and Validation of a Polymerase Chain Reaction Protocol

for Fish and Seafood Authenticity based on the Cytochrome b Gene

M.Sc. thesis submitted by:


Digitally signed by Dwiyitno

DN: cn=Dwiyitno, c=ID,

Dwiyitno ou=SefotechNUT,
Date: 2009.04.11 18:47:54

Catholic University of Applied Science (KaHo) Sint Lieven, Belgium

Dublin Institute of Technology, Ireland
Universidade Católica Portuguesa, Portugal
Anhalt University of Applied Sciences, Germany

KaHo-Sint Lieven
School for Engineering
Gebr. Desmetstraat 1
9000 Gent - Belgium

The Optimization and Validation of a Polymerase Chain Reaction Protocol

for Fish and Seafood Authenticity based on the Cytochrome b Gene

M.Sc. thesis submitted by:


Project Coordinator: Prof. Dr. Chris Van Keer

Supervisors: Prof. Dr. Chris Van Keer

Dr. Koen Parmentier

Co-supervisor: Stefan Hoffman, M.Sc.

February 2008
The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


Dwiyitno. The optimization and validation of a polymerase chain reaction protocol for fish
and seafood authenticity based on the cytochrome b gene. (Under direction of Prof. Dr.
Chris Van Keer and Dr. Koen Parmentier; supervised by Stefan Hoffman, M.Sc)

Cytochrome b mtDNA has been widely applied for identification of fish and seafood,
either in fresh or processed products. The successful application of product authentication
based on genomic profiling considerably depends on the primer design which is used to
amplify the targeted DNA fragment. Several primers have been developed specifically to
identify particular groups of fish, crustaceans and molluscs. However, universal primers
for identification of most fish, crustaceans, and molluscs based on the cyt b region have not
been established yet. This study focused on the development of universal primers for fish
and seafood authenticity based on the cyt b gene. Universal primers are essential,
particularly for identification of unrecognizable samples such as fish fillet, surimi and
mixed products. In addition, since DNA quality plays an important contribution on PCR
amplification, investigation on the different DNA isolation methods was carried out.
Firstly, CytBL1 and CytBH primers which have successfully been used to amplify
~357bp of cyt b gene on various fish were optimized to amplify selected fish, crustaceans
and molluscs. Secondly, since this primer couple was not optimum for crustacean, mollusc,
and some fishes, degenerate primers were designed by introducing wobbles. Notably, other
degenerate primers were evaluated to amplify ~410bp of expected fragment. Evaluation of
3 classical DNA extraction methods and a commercial kit was studied to isolate total DNA
of selected samples.
The results showed that the CytBL1 and CytBH failed to amplify crustacean and
mollusc. Likewise, some species of fish failed to be amplified by this primer couple. The
degenerate primers (CytBL1C and CytBHW) are promising to be employed universally for
species identification of crustaceans and molluscs. Other universal primers
(UCYTB151BF/UCYTB271R and UCYTB152BF/UCYTB271R) effectively amplified all
fish, crustaceans, and molluscs tested in this study and thereby can be considered as the
first universal primers applicable for fish and seafood. Sequence analysis proved that all
validated primers effectively generate 356-358bp and 398-411bp of cyt b region. The
similarity index of PCR products against the libraries varied between 92% and 100%. RT-
PCR was applicable to differentiate between selected samples based on their melting points
(Tm). In comparison to the classical methods, the commercial kit offers simplicity
procedure and yielded the better quality of DNA isolate for PCR purposes.

Key words: authenticity, mitochondrial cytochrome b, PCR primers, fish and seafood,
DNA sequencing

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) i

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


This thesis was a part of my master course in Food Science, Technology, and
Nutrition (SEFOTECHnut). It was funded by the European Commission under the
Erasmus Mundus framework. The studies were undertaken in 2006-2008 at Catholic
University of Applied Science (KaHo) Sint Lieven-Belgium as the host university and
partially at Dublin Institute of Technology-Ireland, Universidade Cathólica Portuguesa-
Portugal, and Anhalt University of Applied Sciences-Germany.

Many people took part in my M.Sc studies and without them this thesis would not
exist. I am deeply grateful to both of my advisors, Prof. Dr. Chris Van Keer (KaHo Sint
Lieven) and Dr. Koen Parmentier (ILVO), who have encouraged and mentored me during
this works. Prof. Chris is also the coordinator of SEFOTECHnut, thank you for giving me
opportunity to be part of this master course. This thesis project was carried out at Institute
for Agriculture and Fisheries Research (ILVO), Belgium. I would like to express my
gratitude to Stefan Hoffman M.Sc and his research group (Daphne and Sabrine) for the
invaluable support and supervising me during this research and writing the report. They
have introduced me to many basic theories and practical application in biomolecular work.
I gratefully acknowledge Dr. Kris Cooreman, the Director of ILVO-Fisheries Department,
for the opportunity to work at his laboratory. Thank all colleagues in Ankerstraat 1 for
creating so enjoyable atmosphere to work in. I also thank my reviewers, Prof. Dr. Dirk
Iserentant and Prof. Jan Song (Gent University), for evaluating the manuscript and their
comments during my public defense.

I wish to thank my present employer at Research Center for Marine and Fisheries
Product Processing and Biotechnology-Jakarta (Prof. Dr. Hari Eko Irianto, Prof. Dr.
Sumpeno Putro, Prof. Dr. Endang Sri Heruwati, and Dr. Singgih Wibowo, M.S.), my
former employer (Dr. Ahmad Dimyati, M.S. and Dr. W. Farid Ma’ruf, M.Sc) and all of my
workmates, for their support. My warmest thanks belong to my parents, my parents in law,
Om Samso-Bulik Murni, Wa Ann and her family in De Pinte, for all the support and
understanding. Finally, I deeply thank my beloved wife, Lusi, and my juniors (Rizan and
Fitri) for all their patience and comfort during these years.

Gent-Oostende, February 2008


Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) ii

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


ABSTRACT ..................................................................................................................... i
ACKNOWLEDGEMENTS ............................................................................................. ii
TABLE OF CONTENTS ................................................................................................. iii
LIST OF FIGURES .......................................................................................................... v
LIST OF TABLES ........................................................................................................... vii
I. INTRODUCTION .......................................................................................................... 1
II. REVIEW OF LITERATURE ...................................................................................... 3
2.1. The importance of product authenticity ................................................................ 3
2.2. Analytical methods for product identification ...................................................... 4
2.2.1. Traditional approaches ............................................................................... 5
2.2.2. Protein based methods (Proteomics) .......................................................... 5
2.2.3. DNA based methods (Genomics) ............................................................... 6
2.2.4. Other methods ............................................................................................ 8
2.3. Genomic identification based on mitochondrial DNA ......................................... 8
2.4. Fish and seafood authenticity based on the cytochrome b gene ........................... 11
2.4.1. Specimen and treatment of sample ............................................................. 11
2.4.2. Isolation of DNA ........................................................................................ 12 Tissue digestion ............................................................................. 13 Separating proteins and contaminants ........................................... 14 Precipitation and recovery of DNA ............................................... 15 Commercial kits ............................................................................. 16
2.4.3. Determination of DNA yield and purity ..................................................... 17
2.4.4. Polymerase chain reaction (PCR) ............................................................... 19 Primer design ................................................................................. 20 Components of PCR reaction ........................................................ 22
2.4.5. PCR product analysis ................................................................................. 23 DNA sequencing .......................................................................... 24 Fingerprinting techniques .............................................................. 25 Other techniques ............................................................................ 27

III. OBJECTIVES OF PRESENT STUDY ...................................................................... 28

3.1. Problems .............................................................................................................. 28
3.2. Objectives ............................................................................................................ 28
3.3. Research framework ............................................................................................ 29

IV. MATERIALS AND METHODS ............................................................................... 30

4.1. Construction of reference database of cyt b genes .............................................. 30
4.2. Sample collection and preservation ..................................................................... 30
4.3. Comparison of DNA extraction methods ............................................................ 31
4.3.1. DNA extraction method 1 (Promega) ......................................................... 32
4.3.2. DNA extraction method 2 (Hsieh et al., 2005)............................................ 32
4.3.3. DNA extraction method 3 (Wasko et al., 2003) .......................................... 32
4.3.4. DNA extraction method 4 (Asahida et al., 1996) ........................................ 33

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) iii
The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

4.3.5. Determination of DNA yield ..................................................................... 33 Standard curve .............................................................................. 34 Sample Analysis ........................................................................... 35
4.3.6. Evaluation of DNA purity ......................................................................... 35
4.3.7. PCR assay .................................................................................................. 36
4.3.8. Visualization of PCR product .................................................................... 37
4.4. Optimization and validation of a universal PCR protocol ................................... 37
4.4.1. Primer design ............................................................................................. 37
4.4.2. PCR assay .................................................................................................. 38
4.4.3. Direct sequencing of PCR product ............................................................ 38
4.4.4. Real Time PCR application ....................................................................... 39
4.5. Data analysis ........................................................................................................ 40

V. RESULTS .................................................................................................................... 41
5.1. Comparison of DNA extraction methods ............................................................ 41
5.2. Evaluation and optimization of CytBL1 and CytBH primers ............................. 42
5.3. Validation of degenerate primers based on CytBL1 and CytBH ......................... 44
5.4. Optimization of universal primers based on UCYTB151F and UCYTB270R .... 45
5.4.1. Validation of UCYTB151BF/UCYTB271R primers ................................ 46
5.4.2. Validation of UCYTB152BF/UCYTB271R primers ................................ 48
5.5. PCR product analysis .......................................................................................... 50
5.5.1. Direct sequencing ...................................................................................... 50
5.5.2. Melting temperature profiles ..................................................................... 51

VI. DISCUSSION ............................................................................................................ 53

6.1. Comparison of DNA extraction methods ............................................................ 53
6.2. Optimization and validation of universal primers ............................................... 54
6.3. PCR product analysis .......................................................................................... 56

VII. CONCLUSIONS ....................................................................................................... 58

REFERENCES ................................................................................................................. 59
LIST OF ABBREVIATIONS ........................................................................................... 68
LIST OF WEBSITES ....................................................................................................... 60
APPENDIXES .................................................................................................................. 70

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) iv

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene



Figure 2-1. The application of traceability in fish and seafood product ................................. 4
Figure 2-2. Link between different identification techniques and their tools ........................ 7
Figure 2-3. Illustration of mitochondria in a cell and its genomic map ................................. 10
Figure 2-4. DNA spectra presented by spectrophotometer and spectrofluorometer ................ 18
Figure 2-5. The principle of PCR amplification ..................................................................... 19

III. OBJECTIVES OF PRESENT STUDY ............................................................................ 28

Figure 3-1. The framework of the study ................................................................................. 29


Figure 4-1. Genomic database obtained from NCBI and FishTrace ...................................... 30
Figure 4-2. An example of standard curve for spectrofluorometric measurement .................. 34
Figure 4-3. The application of NanoDrop and its typical data output ..................................... 35
Figure 4-4. Apparatus for PCR application ............................................................................. 36
Figure 4-5. The scheme of targeted fragments generated by the evaluated primers ............... 38
Figure 4-6. Software for sequence chromatogram analysis: ChromasPro and BioEdit .......... 39
Figure 4-7. Typical outputs of RT-PCR: annealing curve and melting curve ......................... 40
Figure 4-8. An example of BLAST analysis obtained via GenBank and FishTrace................ 40

Figure 5-1. Electrophoresis profile of DNA isolates .............................................................. 42
Figure 5-2. Electrophoresis profile of PCR products following different extraction methods
................................................................................................................................ 42
Figure 5-3. Electrophoresis profile of PCR products with CytBL1/CytBH on fish ................. 43
Figure 5-4. Electrophoresis profile of PCR products with CytBL1/CytBH
on crustaceans and molluscs ................................................................................. 43
Figure 5-5. Electrophoresis profile of PCR products at different concentrations of MgCl2 ... 43
Figure 5-6. Electrophoresis profile of PCR products produced by degenerate primers
based on CuyBL1/CytBH on selected samples ................................................... 44
Figure 5-7. Electrophoresis profile of PCR products with CytBL1C/CytBHW on fish .......... 44
Figure 5-8. Electrophoresis profile of PCR products with CytBL1C/CytBHW
on crustaceans ................................................................................................................. 45
Figure 5-9. Electrophoresis profile of PCR products with CytBL1C/CytBHW on molluscs 45

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) v

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Figure 5-10. Electrophoresis profile of PCR products produced by UCYTB151BF

on selected samples ............................................................................................ 45
Figure 5-11. Electrophoresis profile of PCR products produced by UCYTB152BF
on selected samples ............................................................................................ 46
Figure 5-12. Electrophoresis profile of PCR products with UCYTB151BF/UCYTB271R
on fish-A ............................................................................................................. 46
Figure 5-13. Electrophoresis profile of PCR products with UCYTB151BF/UCYTB271R
on fish-B ....................................................................................................................... 47
Figure 5-14. Electrophoresis profile of PCR products with UCYTB151BF/UCYTB271R
on crustaceans ............................................................................................................. 47
Figure 5-15. Electrophoresis profile of PCR products with UCYTB151BF/UCYTB271R
on molluscs .................................................................................................................. 47
Figure 5-16. Electrophoresis profile of PCR products with UCYTB152BF/UCYTB271R
on fish-A ...................................................................................................................... 48
Figure 5-17. Electrophoresis profile of PCR products with UCYTB152BF/UCYTB271R
on fish-B ....................................................................................................................... 48
Figure 5-18. Electrophoresis profile of PCR products with UCYTB152BF/UCYTB271R
on crustaceans ............................................................................................................. 49
Figure 5-19. Electrophoresis profile of PCR products with UCYTB152BF/UCYTB271R
on molluscs .................................................................................................................. 49
Figure 5-20. Variations of melting peak on selected samples ................................................. 52

Figure 6-1. Multiple alignment of evaluated primers with cyt b gene of selected references.. 55

Figure I. List of samples used in this study ......................................................................... 70

Figure III. Electrophoresis profile of gradient tests ............................................................... 72

Figure IV. Sequence chromatogram profiles of PCR products ............................................. 74

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) vi

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene



Table 2-1. Applicable categorical levels of each molecular marker or gene region ............... 10
Table 2-2. Various primer couples used to amplify cyt b region of fish and seafood ............. 21


Table 4-1. Protocol used to prepare the standard curve ......................................................... 34
Table 4-2. Composition of PCR reaction ............................................................................... 36
Table 4-3. Set of primers used in this study ........................................................................... 37
Table 4-4. PCR condition of the different primer sets ........................................................... 38
Table 4-5. Reaction components of RT-PCR amplification ................................................... 39
Table 4-6. The thermal profile of RT-PCR amplification ...................................................... 40

Table 5-1. DNA concentration and purity yielded by different extraction methods ............... 41
Table 5-2. Optimal annealing temperature (ºC) of validated primer couples .......................... 49
Table 5-3. Sequence analysis of selected samples .................................................................. 51
Table 5-4. Variations of melting point and GC content of selected samples .......................... 52

Table II. List of chemicals, solution and equipment ............................................................ 71

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) vii
The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


Authenticity of fish and seafood products is important to implement the labeling

regulation as set by many countries. The EU, for example, regulates traceability of feed
and food ingredients and food sources to protect consumers from fraud and adulteration.
Identification of product authenticity is essential to prevent substitution of commercially
important products with less valuable species (Trotta et al., 2005). In addition, authenticity
is advantageous for either food producers or food inspectors to assure the species included
in the formulations of the products (Pineiro et al., 1999). Recently, traceability is also
becoming a concern in Canada, Japan, Australia, and New Zealand (Loftus, 2005; Food
Quality News, 2006).

Traditionally, identification of fish is carried out based on the available external

characteristics. With concern to the prospect of growing international trade and an
increasing number of potentially marketable species, it is worthwhile to conduct rapid and
accurate analytical methods to distinguish fish and seafood products without using
morphological features. Protein electrophoresis and molecular biological methods are
valuable methodologies for identification of fish and seafood authenticity (Bossier, 1999;
Etienne et al., 1999; Rehbein et al., 1999; Pineiro et al., 1999; Bossier & Cooreman,

Protein electrophoresis is an earlier method developed using either SDS-PAGE,

agarose GE or IEF patterns of water soluble sarcoplasmatic protein. Nevertheless, there are
disadvantages regarding these identification methods. As protein is denatured or altered in
consequent of processing, especially by heating, protein based techniques are only
applicable to fresh/raw products, frozen fillets and mildly treated fish and seafood (Wolf et
al., 2000). In addition, the resulted patterns from these methods can be different depending
on the individual age, length, development stage, or environment condition which in turn
leads to a high degree of intra species variation.

The most prominent techniques for species identification are based on the analysis of
nucleic acids, either nuclear or mitochondrial DNA (Pineiro et al., 1999). The significant
advantage of DNA based methods is their ability to identify not only fresh and frozen, but
also processed, degraded and mixed products. In general, DNA based techniques rely on
polymerase chain reaction (PCR) and PCR product analysis. Fingerprinting techniques, for

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 1

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

instance RFLP, AFLP, RAPD, SSCP, and DGGE/TGGE, have been demonstrated as fast,
cheap and straightforward gene identification (Mackie et al., 2000; Hird et al., 2005).
However, sequencing is known as the most accurate technique to produce a high resolution
genomic identity among examined species (Bartlett & Davidson, 1991; Unseld et al.,

Mitochondrial DNA (mtDNA) has been used world wide for species identification,
including fish and seafood products. Since mtDNA is maternally inherited, the use of this
DNA may reduce the taxonomic uncertainty caused by hybridization which exists in
nDNA (Ward et al., 2005). Specifically, DNA barcodes focus on the 600 bp sequence of
cytochrome oxidase I (COI), while the EU has been developing genomic data base for
commercially important fish based on mitochondrial cytochrome b (cyt b) and nuclear
rhodopsin (Ratnasingham & Hebert, 2007;

Cyt b gene has been widely applied to identify various species of fish and seafood.
Several protocols have been developed specifically to identify particular groups of fish and
seafood, including tunas/family Scombroidae (Bartlett & Davidson, 1991; Rehbein et al.,
1997), caviar (DeSalle & Birstein, 1996), salmonoid (Rehbein et al., 1997), flatfish
(Céspedes et al., 1998), mollusc and arthropods (Meritt et al., 1998), puffer fish (Hsieh et
al., 2003), gadoid/family Gadidae (Aranishi et al., 2005), billfish/family Istiophoridae
(Hsieh et al., 2005; Richardson et al., 2006) and the most recently teleost fish (Sevilla et
al., 2007). However, a universal protocol, particularly universal primers based on cyt b
gene for identification of the majority of fish, crustaceans, and molluscs, has not been
established yet.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 2

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


2.1. The importance of product authenticity

Traceability is increasingly recognized as a standard management tool across the

agri-food industry, mainly due to recent trends on food crises as well as the consequent
demands for global transparency within the food chain (Loftus, 2005). Studies in the U.S.
fish market showed that due to the highly demand and popularity, at least 77% of red
snapper were commonly mislabeled or substituted with the less valuable species (Marco et
al., 2004). Similarly, the expensive category of grouper (genera Epinephelus and
Mycoteroperca) are frequently misidentified as nile perch (Lates niloticus) or the wreck
fish (Polyprion americanus), which is closely related and can not be identified when their
morphological features disappeared (Trotta et al., 2005). This mislabeling, misbranding,
and economic adulteration are illegal practices and consequently to gain financially
consumer fraud.

From the viewpoint of food safety, authenticity could protect public from poisoning
incidents due to ingestion of toxic products. Quality assurance has become the top priority
of meat retailers and producers due to the Bovine Spongiform Encephalopathy (BSE)
crisis. BSE almost caused the collapse of beef industry in England and the rest of Europe,
when their beef was banned in many countries (Hanluain, 2001; Necidová et al., 2002).
Serious food poisoning incidents due to ingestion of toxic puffer fish or toxic dried fish
fillets have been reported in Taiwan (Hwang et al., 1995; Hsieh et al., 2002, Cheng et al.,
2003). This is due to the difficulty for manufacturers and consumers to distinguish
morphological similarities between Lagocephalus lunaris and L. gloveri. Additionally,
Takifugu oblongus is often abused as the material for dried fish fillet. With respect to the
fact that awareness on GMO’s food arises all over the world, it becomes essential to
establish consumer protection from GMO jeopardy (Reg. No.1829/2003).

For traceability along the food (supply) chain, particularly for meat and meat
products, several aspects, such as information of animal species, origin, age, composition
and production system are important (Schwagele, 2005). Regulation (EC) 2065/2001 for
example, emphasizes that traceability of fish product requires information concerning
species identity, geographical origin, and method of production (wild or farmed, organic or
intensive). Figure 2-1 shows the illustration of DNA application on the traceability of

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 3

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

seafood product. Hence, for large scale biodiversity monitoring purposes, it is worthwhile
to develop a rapid and accurate identification tool. Interestingly, deoxyribonucleic acid
(DNA) based technology can overcome the difficulties of tracing animal identity and
animal by-products shown by conventional tagging and labelling systems (Hayes et al.,

RFID movement monitoring Barcode label tracking

(Growing stage) (Processing & distribution)

RFID & DNA identity Harvest DNA identity Retail

Hatchery sampling sampling sampling

Figure 2-1. The application of traceability in fish and seafood product

(Re-illustrated based on Loftus & Laronde, 2005; Thompson et al., 2005)

2.2. Analytical methods for product identification

A key feature of any traceability system has to be able to clearly identify that to be
traced. Ideally, the product identifier should: (a) uniquely identify the unit or batch, (b)
retain identity throughout the product life-cycle, (c) not hinder its host, and should be (d)
secured (fraud proof) and (e) permanent, (f) simple to read and capture identifying data
(Loftus, 2005). Accordingly, there is no single identification system likely to meet all of
these requirements.

Generally, two types of product identifier can be distinguished, i.e. external

identifiers and internal/biometric identifiers that are an integral part of the animal or
product. External types include either manual methods such as paper labels, ink brands
(tattoos), and ear tags, or electronic methods such as Radio Frequency Identification
(RFID) tags and injectable microchips (Loftus & Laronde, 2005; Thompson et al., 2005).
The advantage of these approaches is their ability to encode different types of information
and the relative ease of reading the data, particularly from electronic identifiers. On the
other hand, biometric labelling systems incorporate biological data and therefore cannot
easily be faked, altered or appropriated. The technologies include DNA profiling, retinal
scanning and nose printing (Loftus & Laronde, 2005).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 4

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

2.2.1. Traditional approaches

The quality of food products can be determined by combining sensory analysis with
specific microbiological and chemical tests (Suvanich et al., 2000). However, sensory
profiles between the closely-related species are difficult to be characterized by a consumer
panel even if a trained. Recently, an integration of electronic tongues and noses is used to
describe the identification and classification based on flavor and aroma and other
measurements of quality (Deisingh et al., 2004; Gomez et al., 2007). The techniques rely
on the information obtained from the multi-sensor arrays as principal components analysis
and artificial neural networks.

The chemical composition and nutritive value such as moisture, crude protein, ash,
and fat can significantly distinguish the different species of certain fish and seafood (Hong,
1991; Celik et al., 2004). A study conducted on crabs by Tureli et al. (2000) for example,
revealed that the ratio of crude protein, dry matter, and crude ash in the meat of male crabs
was higher in swimmer crabs (Portunus pelagicus) than in blue crabs (Callinectes
sapidus). A different study revealed that significant differences existed in the protein
contents of claw and body meat between those two species (Gokoolu & Yerlikaya, 2003).
Since fatty acid composition is practically a reflection of the diet, its profile can be used to
discriminate wild from cultivated fish (Martinez et al., 2003; Moretti et al., 2003).
Nonetheless, composition and nutritive value may differ depending on region, habitat, sex,
age, stages of life or sexual cycles, seasonal factors, and diet (Tsai et al., 1984; Reddy et
al., 1991).

2.2.2. Protein based methods (Proteomics)

Proteomics emerged in the beginning of the 1990s due to the need for new protein
analysis methods. The proteome is defined as the entire protein complement expressed by a
cell type of an organism (Wilkins et al., 1996). Proteome research focuses on the structural
and functional analysis of the proteome and the interaction of proteins. This includes the
isolation, identification and characterization of all proteins expressed by the organism’s
genome. Proteome analysis could lead the way to explain the function of an organism
dynamically rather than statically. This is important since the protein compositions and
concentrations change from cell type to cell type, even within sub-cellular compartments.
Moreover, they differ between various stages of development (Ferguson et al., 1995).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 5

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Proteins (enzymes, myoglobin, etc.) have been widely used as species markers.
Applicable techniques include separation of water-soluble proteins by starch,
polyacrylamide or agarose gel electrophoresis, IEF, and two-dimensional (2D)
electrophoresis (O’Farrell, 1975; Pineiro et al., 1999; Martinez et al., 2005 & 2007).
Highly resolved water-soluble protein patterns can be used to differentiate genetically
close-related species. Interestingly, the limit of detection of gel electrophoretical methods
varies between 0.1% and 1% (Xie, 2003). Notably, proteomics can be used to differentiate
species, breeds, and varieties by their specific protein pattern.

One and 2D protein electrophoresis are the most frequently used techniques for
proteome research, while peptide mass fingerprinting analysis by MALDI-TOF mass
spectrometry has become the most powerful techniques for proteome analysis (Boucherie
et al., 1995; Xie, 2003). Immunological techniques, like ELISA, performed on the solid
surface of microwell plates are using suitable target proteins for analysis. A qualitative
detection of animal species is possible and the limit of detection depends upon their
content in meat products, for instance in pork 61%; poultry and beef 62%; sheep 65%
(Schwagele, 2005).

Other protein separation and quantification techniques include liquid chromatography

(LC/HPLC) and capillary electrophoresis (López, 2007). Nevertheless, electrophoresis has
some drawback to identify processed products. Variation in factors, such as temperature,
pasteurization, and processing parameters, affect the results (Rehbein, 1990; Barlett et al.,
1993; Xie, 2003). In addition, immunological methods may generate cross-reaction among
protein from closely related species (Wolf et al., 2000; Necidová et al., 2002).

2.2.3. DNA based methods (Genomics)

The field of genomics utilizes a variety of technologies to study the information

content of cells. The genome research generally refers to sequencing the total genomic
DNA of an organism and mapping all genes within these sequences (Brooker, 1999). In
contrast to the proteome, genomic research focuses on the structural and functional
analysis of the gene as well as their recombination. This includes the isolation,
identification and characterization, either physical or genomic mapping, of the entire
genome (Johnson & Browman, 2007). Historically, the term “genome” was emerging in
1970s with the introduction of techniques for manipulating DNA (recombinant) and
reading its sequence (Watson & Berry, 2003).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 6

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

DNA-based techniques have been demonstrated as fast, cheap and straightforward

gene identification (Mackie et al., 1999; Weder et al., 2001). Using DNA has many
advantages as it is unique to the individual and creates a means of permanent identification
throughout the life cycle of the animals. DNA traceability infrastructure could also be used
to check for the presence of a particular genetic modification (Loftus, 2005). In some
European markets, a routine program of verification sampling and DNA analysis/matching
is used to monitor the ability of a supply chain to provide traceable products. The
significant advantage of DNA-based methods is the applicability for identification of not
only fresh and frozen products, but also processed, degraded and mixtures, which are not
well achieved by protein-based method. Figure 2-2 reveals the link between different
identification techniques and their tools (Dupont et al., 2007).

Metagenomics Community

Species Sequencing Barcoding

Genomics DNA

Transcriptomics mRNA ESTs Microarrays

Proteomics Protein 1D & 2D Gel Electrophoresis

Figure 2-2. Link between different identification techniques and their tools
(Dupont et al., 2007) ESTs: expressed sequence tags

In industrial scale, DNA based traceability has been applied on fresh beef in the UK
and Ireland since the late 1990s (Hanluain, 2001). Recently, DNA barcoding has globally
gained much attention. Founded in 2004 at University of Guelph (Ontario), Barcode of
Life Data System (BOLD) establishes an integrated platform for species identification
based on DNA profile. The concept of DNA barcoding has been applied on North
American bird species (Hebert et al., 2004), Australian fish (Ward et al., 2005), and a
variety of other invertebrate (Barrett & Hebert, 2005; Smith et al., 2005). Development of
DNA barcoding systems will make large-scale applications of DNA traceability
increasingly cost effective and feasible.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 7

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

2.2.4. Other methods

Visible and Near-Infrared (VIS/NIR) spectroscopy has been used to detect
adulteration in many high-value foods. VIS/NIR spectroscopy is an affordable, powerful,
and objective tool that requires minimal sample preparation and can creates fast results. In
addition, it does not require highly trained people to operate the instrument and interpret
the results. Few biological compounds absorb light in the visible region (380 – 700 nm),
which is usually function-related absorption (Pasquini, 2003). In contrast, biochemical
compounds such as DNA and RNA absorb light in the near ultraviolet range, though
absorption is unrelated to function. Absorption in the near-infrared region (780-2500 nm)
arises from vibration motion of hydrogen molecules (Gayo, 2006).

VIS/NIR technology has been used to determine the authenticity of olive oil that was
adulterated by other vegetable oils (Tay et al., 2002) and adulterated honey by sugar
solutions (Kelly et al., 2004). In fishery products, VIS/NIR spectroscopy has been used to
detect economic adulteration of Atlantic blue and blue swimmer crab meat which is
adulterated with surimi-based imitation crab meat (Gayo, 2006). Similarly, nuclear
magnetic resonance (NMR) can be used to obtain lipid fingerprints. By using this
technique, Martinez et al. (2003) revealed some nutraceutical fish oil capsules were
incorrectly labeled concerning the species and the lipid content.
The variations of isotopic abundances, such as hydrogen, carbon, nitrogen, and
oxygen, are of particular interest for food authentication studies. Since the variation of
isotopic abundance in animals is mainly due to the origin, nature of the feed, and animal’s
metabolism, it can be used both for origin assignment and to detect adulteration. The
isotope ratio of C and N has been used to examine the authentication in wild and farmed
Atlantic salmon (Dempson & Power, 2004) and European sea bass/Dicentrarchus labrax
(Sweeting et al., 2007).

2.3. Genomic identification based on mitochondrial DNA

Mitochondria are essential organelles in the cytoplasm since they serve many
important functions for the cell especially oxidative ATP-production, degradation of fatty
acids, and modulation of intracellular calcium homeostasis. They also play a major role in
cell signaling and apoptosis, as well as in biosynthesis (e.g. heme-groups, nucleotides, and
amino acids) and degradation (e.g. urea cycle) of metabolites (Kleinsmith & Kish, 1995).
ATP production is regulated in the citric acid cycle, also known as Krebs cycle. This is the
final common pathway for different metabolites such as carbohydrates, fatty acids and

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 8

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

amino acids. The compounds with a high redox-potential (reduced nicotinamide-adenine-

dinucleotide/NADH) and reduced flavin-adenine-dinucleotide (FADH2) are generated in
this cycle. The products are later delivered to the respiratory chain of the mitochondrion in
order to generate ATP.

Mitochondria are comprised of two membrane systems: intra (inner) and extra (outer)
membranes. In the center of the mitochondrion and between the membranes there are two
aqueous compartments: the matrix and the inter-membrane space (Kleinsmith & Kish,
1995). The two membrane systems contain carrier proteins and channels that regulate the
exchange of substrates between the compartments. The inner membrane is typically rich in
proteins in which the high molecular weight multi-protein-complexes of the respiratory
chain are located at the inner mitochondrial membrane. The total number of different
proteins or polypeptides making up a mitochondrion is estimated to be around 1000
(Kleinsmith & Kish, 1995).

Basically, a genetic profile or molecular identity can be provided from either nuclear
(nDNA) or mitochondrial genome (mtDNA). MtDNA has been successfully used as a
biological marker (Avise et al., 1987; Esposti et al., 1993; Lin et al., 2005) and has many
1. MtDNA is unique as it is maternally inherited in most species. This means that only the
mtDNA of the oocyte is transmitted to the offspring. Exceptions with paternal leakage
exist in mice and double uniparental inheritance in sea mussels (Mytilidae), freshwater
mussel (Unionidae) and clam (Veneridae) (Hoeh et al., 1991; Burzynski et al., 2006).
2. MtDNA has a high mutation rate since it is vulnerable due to its compact structure,
lack of histone protection, insufficient repair mechanisms and exposure to reactive
oxygen species generated along the respiratory chain. This vulnerability results in the
higher mutation rate than the nuclear DNA (Zeviani et al., 1998).
3. The high copy number of mtDNA facilitates a successful analysis of degraded or very
limited amount of raw material (Watson & Berry, 2003).
4. Integrated genomic database of mtDNA has been established by various institutions,
such as NCBI, BOLD, CBOL’s, FISH-BOL, and Fishtrace.

MtDNA is a small circular molecule (Figure 2-3), generally between 14 and 18 kb

with exception in certain individual, such as sea scallop (family Pectenidae) which
contains up to +35 kb (Snyder et al., 1987). Typically, mtDNA is composed of 37 genes
coding for 22 tRNAs, 2 rRNAs (12S and 16S) and 13 mRNAs coding for proteins. The

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 9

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

mitochondrial genome is arranged very efficiently as it lacks introns and has small
intergenic spacers where the reading frames sometimes overlap. The control region is the
primary non-coding region, and is responsible for the regulation of heavy (H) and light (L)
strand transcription and of H-strand replication (Kleinsmith & Kish, 1995).

Control region
12SrRNA Cyt b
Mitochondria 16SrRNA
Nucleus ND5
22 tRNA genes
12 protein-coding regions



Figure 2-3. Illustration of mitochondria in a cell (left) and its genomic map (right)

Table 2-1. Applicable categorical levels of each molecular marker or gene region
Kingdom Phylum Class Order Family Genus Species
A. Nuclear DNA
1. SSU (16-18S) +++++++++++++++++++++++++++------
2. LSU (23-28S) ++++++++++++++++++-------
3. 5.8S +++++++++++++++++++++------
4. IGS +++++
5. ITS +++++++++++
6. Rhodopsin*)

B. Mitochondrial DNA
1. Ribosomal RNA
- 12SrRNA +++++++++++++++++++------
- 16SrRNA +++++++++++++-----
2. Protein
3. Coding genes
- ND1 -------++++++++++++++++++
- ND2 -------++++++++++++++++++
- COI**) -------++++++++++++++++++
- COII -------++++++++++++++++++
- Cyt b*) -------++++++++++++++++++
4. Control region +++++
The bold lines indicate as mostly applicable categorical levels for each molecular marker or gene
region, while the dot lines indicate less frequently applicable
*) **)
: FishTrace; : Barcodinglife

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 10

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Analysis of mtDNA is commonly accomplished by sequencing or fingerprinting

techniques of particular coding regions. Ribosomal RNA (12SrRNA and 16SrRNA),
cytochrome oxidase, cytochrome b, and D-loop or control region are commonly employed
for species identification (Passarino et al., 2002; Scander & Halanych, 2003; Watanabe et
al., 2004; Barlaan et al., 2005; Trotta et al., 2005; Goldenberg et al., 2007). Table 2-1
describes the applicable categorical levels of each molecular marker or gene region for
species identification (Hwang & Kim, 1999; FishTrace; Barcodinglife). In recent time,
mtDNA has been widely used for species identification of fish and seafood products which
are mostly focused on COI and cyt b regions (Ward et al., 2005; Ratnasingham & Hebert,
2007; Roe & Sperling 2007; Sevilla et al., 2007).

2.4. Fish and seafood authenticity based on the cytochrome b gene

Cytochrome b is one of the cytochromes involved in the electron transport in

respiratory chain of mitochondria. Located between tRNA-Glu and tRNA-Thr, cyt b
contains eight transmembrane helices connected by intra membrane or extra membrane
domains. The combination of cyt b gene and other genes in genomic DNA encodes for
cytochrome c oxidoreductase, which is a complex enzyme in oxidative phosphorylation
(Kleinsmith & Kish, 1995). Cyt b gene as a phylogenetic probe is widely used because it is
easier to align a protein-coding sequence that has evolved over the period than to align
either mitochondrial rDNA or noncoding sequences (Irwin et al., 1991). Kocher et al.
(1989) have shown that some highly conserved regions on the mitochondrial cyt b gene are
suitable for species identification in most vertebrate species.

The wide use in phylogenetic study has resulted cyt b as a universal marker. So far,
cyt b has been the most prevalent source of sequence data in fish (Bartlett & Davidson,
1991; DeSalle & Birstein, 1996; Rehbein et al., 1997; Céspedes et al., 1998; Hsieh et al.,
2007; Sevilla et al., 2007). However, the successful application of genomic based
traceability heavily depends on DNA sampling and DNA analysis. Generally, DNA based
identification mainly relies on the application of PCR to generate desired fragment of
specific region of DNA template.

2.4.1. Specimen and treatment of sample

DNA isolation is one of the important parts in PCR application since it is used as
template for PCR amplification. The DNA sampling method should provide high-quality

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 11

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

and high-quantity DNA useful to accommodate the targeted region. Basically, DNA isolate
can be obtained from any biological material. Technically, DNA sampling must be low-
cost, relatively easy to perform and produce samples in a format suitable for laboratory
analysis (Loftus & Laronde, 2005). However, non-destructive DNA isolation is desirable,
especially when working with live samples, or with threatened or endangered species,
where sacrificing the animals is unaffordable (Wasko et al., 2003).

There have been a number of innovations in DNA sampling specimen conservation.

Muscle tissue (mostly white muscle) represents the most common used sources of fish
DNA. Meanwhile, egg, liver and blood are used when the individuals are too small to be
effectively sampled by muscle (Barlett & Davidson, 1992; Martinez et al., 1998; Watanabe
et al., 2004). Moreover, sampling strategy for non-destructive DNA isolation can be
achieved from fish fins or scales (Wasko et al., 2003). Lysis buffer may be used for long
periods of delay before the specimen is extracted. The most used lysis buffer for specimen
preservation contains Tris-HCl, NaCl, EDTA, and SDS (TNES) either with or without urea
(4 to 8 M). In addition, formaldehyde has been recognized for fixing and preserving
biological specimens, especially for museum collection. These preserving materials have
been used to store fin and scale samples of fish for years with good DNA quality (Asahida
et al., 1996; Schander & Halanych, 2003).

2.4.2. Isolation of DNA

The isolation of highly-quality DNA is the major step for various molecular-biology
techniques. Low amount of DNA with the presence of PCR inhibitors are common factors
to compromise the PCR amplification (Weder, 2002; Di Pinto et al., 2007). Proteins,
RNAs, lipids, polysaccharides, and other leftover cellular constituents, are frequently
present in the DNA, particularly when isolated by classical methods. During PCR
amplification, these contaminants may interfere with restriction enzymes, ligases, and
thermostable DNA polymerase (Merente et al., 1998).

Rationally, DNA isolation procedures should aim to solubilize cellular components

and simultaneously inactivate any intracellular nucleases to conserve biologically active
DNA. Most isolation procedures combine the use of one or more agents, such as organic
solvents, detergents, N-lauryl sarcocyl, chaotropic salts, urea, etc. Occasionally, β-
mercaptoethanol is added for protein denaturation (Merente et al., 1998). Recently,

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 12

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

numerous commercial kits are available for isolation of total DNA. The use of commercial
kit permits production of higher quality DNA isolate. Tissue digestion

In general, DNA isolation employs a buffer containing one or more detergents, for
instance SDS, NP-40 or Triton X-100. These detergents are used to break down the cell
wall lipoprotein. Its anion-binding property permits detergent to precipitate some
negatively charged compounds such as proteins and polysaccharides. TNES is the most
used buffer for cell digestion. Several studies used 500-600 μl of TNES consisting of 10-
200 mM Tris HCl pH 7.5-8.0, 125mM NaCl, 10-100mM EDTA, and 0.5-1% SDS to
extract 50-100 mg of fish tissue, fin and scale (DeSalle et al., 1993; Asahida et al., 1996;
Hsieh et al., 2003). SDS as detergent breaks apart fatty membranes of the cells while NaCl
(source of salt and metal ion) is intended to increase the osmotic pressure outside the cell
and help break apart the membranes. Concentrated salt solution changes the polarity of the
solution where DNA dissolves in, whereas fats, carbohydrates and proteins do not.

Since DNase is dependent on Mg2+ and Ca2+, the presence of EDTA (at least 2mM)
in lysis buffer is critical to chelate these cations and thereby prevents the degradation of
high molecular weight DNA (Merente et al., 1998). In addition, buffers maintain the
solution in alcaline pH to retain DNA in aqueous phase. The presence of SDS, EDTA,
metal ions and certain pH range is critical for the activity of enzymes involved in the DNA
extraction (Deshpande et al., 2001). Occasionally, 4-8 M urea is involved to breakdown
hard tissues such as fins and scales (Asahida et al., 1996; Hsieh et al., 2003).

Alternatively, guanidinium thiocyanate is often used for DNA extraction as it has

strong chaotropic properties (Botwell, 1987). Introduced by Chomczynki and Sacchi
(1987), it is used as protein denaturant, acting as RNase inhibitor, and protecting cellular
transcripts from degradation during tissue extraction. Nevertheless, since guanidinium
thiocyanate is categorized as harmful chemical, working with this method needs extra
protective equipment, such as goggles, fume hood, and proper gloves.

CTAB (cetyltrimethyl ammonium bromide) is frequently applied as surfactant in

DNA extraction. It is used for tissue digestion, together with β-mercaptoethanol and
polyvinylpyrolidone (PVP), followed by phenol-chloroform extraction. Originally, this
method is developed for extraction of polysaccharide-contaminated samples, essentially
plant tissue (Doyle & Doyle, 1987; Tel-Zur et al., 1999). PVP or activated charcoal or a

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 13

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

combination of both is often used in order to remove polyphenolics from further extraction
steps. This method is, besides laborious, limited by the use of hazardous reagents.

Konat et al. (1990) described a method that embeds the nuclei in agarose in order to
protect the DNA from mechanical shearing during isolation. In this procedure, Proteinase
K in the presence of SDS is used to remove proteins and lipid from the embedded DNA.
The limitation of this method is that it is only suitable for suspension cells, neither for
adherent cells nor tissues. The requirement of numerous buffer changes also makes this
method laborious and time consuming (Merente et al., 1998). Separating proteins and contaminants

Proteinase K and RNase are two important enzymes involved in DNA extraction.
Proteinase K is essential to remove protein from the embedded DNA while RNase is
important to disrupt RNA that could interfere in the downstream applications. Proteinase K
is an endolytic protease that cleaves peptide bonds at the carboxylic sides of aliphatic,
aromatic or hydrophobic amino acids. Proteinase K is active in the presence of metal ions,
SDS, urea, chelating agents (e.g. EDTA), sulfhydryl reagents and trypsin or chymotrypsin
inhibitors. In spite of stable over a wide pH range (4-12.5), Proteinase K autolysis occurs
increasingly at alkaline pH. The optimum temperature for proteinase K is 55-65°C
(Merante et al., 1998). In contrast, most other enzymes (e.g. DNase, RNase) are denatured
under this condition. Therefore, the combination of Proteinase K and detergent buffer in
elevated temperature are essential for the inactivation of endogenous nuclease.
Commercially, proteinase K is produced by fungus Tritirachium album (Ebeling et al.,

Ribonuclease (RNase) is an endonuclease that cleaves the 3’ end of cytosine (C) and
uracil (U) residues. It is commonly used in molecular biology applications such as the
removal of contaminating RNA from DNA preparations (Lee et al., 1996). RNases are
ubiquitous in the environment as they are present in many biological materials. For
example, the pancreas is rich in RNase (>1 mg/g tissue) and is the source for most
commercially produced RNase. A study reported that RNase increases its activity in the
presence of approximately 2 M urea (Deshpande et al., 2001). Since the optimum
temperature of RNase is 37-45ºC, it must be applied separately from Proteinase K.
Likewise, Proteinase K rapidly inactivates nucleases including RNase. Once cellular

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 14

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

proteins and lipids are separated, contaminating RNA can be degraded by DNase-free
RNase followed by a chloroform extraction to remove the RNase.

Studies revealed that concentration of Proteinase K used for DNA extraction varies
depending on the kind of sample, time and temperature of incubation, and the presence of
RNase. A concentration of 50ng proteinase K per μl lysis solution was used to extract 50-
100mg of total DNA from fish tissue and fish fin with no addition of RNase, carried out at
37-42ºC incubation for overnight (8-16 hours) (Asahida et al., 1996). Wasko et al. (2003)
examined 75ng/μl proteinase for 100-300mg of fish fin and scales at 42ºC for 10 hours
followed by the same concentration of RNase (42ºC for 1 hour) while Hsieh et al. (2003)
worked with 400ng/μl on fish tissue without RNase. In addition, Imai et al. (2004)
employed relatively high concentration of Proteinase (4000ng/μl) for digesting crab (genus
Scyla) samples at 55ºC for 3 hours followed by 1000ng/μl RNase at 37ºC for 30 minutes. Precipitation and recovery of DNA

In many classical DNA extraction procedures, organic solvents, mainly phenol and
chloroform, are used to remove contaminants. For this purpose, phenol must be used in
alkalic conditions (pH ≥ 7.5) otherwise the isolated DNA will remain in organic phase
and interface (Blin & Stafford, 1976). In practice, a phenol: chloroform mixture,
commonly added by isoamyl alcohol (P:C:I=25:24:1), at equal volume as lysis buffer are
added to DNA extract to form a biphasic mixture (Asahida et al., 1996; Hsieh et al., 2003;
Wasko et al., 2003). Isoamyl alcohol is important to prevent the mixture from foaming.
Through a centrifugation at high speed (>10.000 rpm for 5-10 minutes), proteins and lipids
will separate into the organic phase while the DNA, and other contaminants such as salts
and sugars, remain in the aqueous phase. This is sometimes repeated depending on the
requirements of the downstream processes, and then followed by extraction with
chloroform: isoamyl alcohol (C:I=24:1) to remove the residual phenol.

The aqueous phase containing DNA is concentrated by double volume of absolute

ethanol to precipitate the DNA. The polarity of DNA renders insoluble in ethanol which is
relatively less polar. The DNA precipitation is due to the interaction between ethanol and
water resulting in less capability to dissolve the DNA. Isopropanol can be used instead of
ethanol. In spite of the higher precipitation efficiency than ethanol, isopropanol is less
volatile and therefore needs more time to dry the isolated DNA. By centrifugation, the
DNA is concentrated and forms a white or transparent pellet. The next step is purification

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 15

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

using 70%-80% ethanol to remove salts present in the pellet. After air dried, purified DNA
is re-suspended in TE (Tris-HCl and EDTA) buffer.

Phenol-chloroform based extraction is proven to produce high yield of DNA with

relatively good quality for PCR and downstream applications (Asahida et al., 1996; Wasko
et al 2003). However, beside relatively laborious due to numerous changes of phenol and
chloroform, this precipitation method has drawback as phenol and chloroform are
hazardous and inconvenient materials. Thereby, extra caution is critical in order to handle
the problems. Commercial kits

Many companies have developed commercial kits for total DNA extraction and
purification. The protocols that are available commercially for example Wizard DNA
Extraction kit and Wizard Magnetic DNA Purification for Food (Promega; Milan, Italy),
DNeasy Tissue kit and QIAamp DNA mini kit (Qiagen; Hilden, Germany), Chelex (BioRad;
Marne la Coquette, France), ABI PRISM 6100 Nucleic Acid Prep Station (Applied
Biosystems Inc.), and genomic DNA purification kit (BioNobile; Turku, Finland).

Based on the type, commercial kits can be classified in three categories i.e. manual
commercial kit, manual automated, and fully automated (Mattocks, 2007). Factors
governing the choice of kit are the speed of extraction, cost, reliability, sample
requirement, sample tracking, storage requirement, and the quality of isolated DNA. Most
of manual commercial kits work based on liquid-liquid phase extraction. The difference
with classical procedures is the use of ready-to-use reagents (lysis buffer, precipitation
reagents/washing buffer, and elution buffer) which minimize the work and time of
preparation. Moreover, commercial kits allow convenient work as they commonly offer
simpler procedures to provide purer DNA with safer reagents, importantly in avoiding the
use of phenol-chloroform.

In comparison to manual commercial kits, manually automated one has the

advantages of the use of liquid-solid phase, instead of liquid-liquid phase extraction. Silica
based column and magnetic beads are two important solid phases used to embed and bind
the DNA. Column based methods generally rely on the use of lysis solution, binding
buffer, washing buffer and elution buffer. After digestion with lysis solution, guanidinium
thiocyanate is commonly used as chaotropic salt to bind the DNA. Bound DNA is purified
by washing with buffer containing ethanol (Bio-Nobile, 2007). A special silica-glass

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 16

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

column then binds the DNA prior to its elution using a low salt buffer. This protocol
eliminates the need of organic solvent extraction, DNA precipitation, and minimizes
centrifugation (Roche, 2003).

The DNA-bead interaction is based upon the specific affinity of the ligand on the
surface of the beads. The beads can be coated with binding elements such as primary or
secondary biotinylated antibody, streptavidin and protein (A or G). Streptavidin beads
attach via a DNA linker simplifying bead removal by cleavage with DNase (BioNobile,
2007). Streptavidin magnetic beads present in different sizes (50 nm-3 µm in diameter
depending on the type of sample: cells, nucleic acids, or proteins) allow to minimize non-
specific binding of nucleic acid or protein to help prevent bead aggregation. Since the
separation of the beads from the aqueous phase occurs with a magnet, centrifugation is not
required. These kits may obtain DNA in less than one hour.

It has been shown that DNA analysis by a fully automated extraction, BioRobot EZ1
DNA Tissue kit (Qiagen Corporation, Valencia, CA) and MultiProbe II Plus EX (Perkin
Elmer, USA) for instance, proves time saving and reduces the risk of possible
contamination (Pizzamiglio et al., 2006). The automation of the process allows minimizing
manual interactions by means of robotic liquid handling, integrated shaking, heating, and
vacuum filtration.

2.4.3. Determination of DNA yield and purity

Several methods have been established for determination of DNA quantity and
quality, such as spectrophotometric methods, radioactive labeling, and fluorimetric
methods. Traditionally, spectrophotometry (UV-Vis) and spectrofluorometry are
techniques commonly used for quantifying DNA due to their simplicity and less cost.
Spectrophotometry technique measures DNA based on the determination of absorbance at
260 nm, the maximum absorbance of nitrogenous bases under UV light (Figure 2-4). On
the other hand, spectrofluorometry relies on the fluorescent signal created by fluorescent
dye-dsDNA binding at 480nm (excitation) and 520nm (emission). A number of reagents
are used as fluorescent dye including ethidium bromide (EtBr), cyanine, Hoechst-33258,
protamine, and hypocrellin A (Zhu et al., 1997).

Both spectrophotometry and spectrofluorometry have advantages and disadvantages.

It has been shown that spectrophotometry is the cheapest way to quantify DNA
concentration and also simple as it can be acquired without the use of reference/DNA

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 17

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

standard. Since the concentration of pure dsDNA is 50μg/ml (when A260=1.0),

concentration of unknown DNA can be formulated as follows (Merante et al., 1998):

DNA (μg/ml) = A260 x l (light path in cm) x dilution factor x 50

The major disadvantages of the spectrophotometric method are the contribution of

nucleotides and single-stranded DNA to the signal, and the inability to distinguish between
DNA and RNA. Conversely, fluorometric method has higher sensitivity since it only
measures dsDNA embedded by fluorescent dye. Generally, the detection limit by classical
spectrophotometer is around 5 μg/ml dsDNA aliquot, while by spectrofluorometer it is
10ng/ml (Paul & Myers, 1982; Zhu et al., 1997). Certain dyes even demonstrate the
detection limit as low as 25pg/ml (Invitrogen, 2007). Fluorometric method is suitable for
selective targets, dsDNA, ssDNA or RNA, with less interference. Nevertheless, the use of
this method is restricted by the relatively high cost of fluorescent reagents.

A UV-vis spectrophotometer allows measuring DNA quality/purity based on the ratio

of absorbance at 260 and 280nm (A260/280). Theoretically, contaminating protein absorbs
UV light at +280nm whereas phenol at +270nm. Contaminated DNA with any of these
molecules expresses increasing absorbance at 280nm. The A260/280 ratio between 1.8 and
2.0 suggests minimal contamination (Smith, 1998). Lower values indicate protein
contamination, higher values RNA contamination.

dsDNA Ex:480nm
260 nm

0.3 ssDNA

200 225 250 275 300 320 500 600 700

Wavelength (nm) Wavelength (nm)

Figure 2-4. Characteristic spectrum of DNA obtained by spectrophotometer (left) and

spectrofluorometer (right)

Gel electrophoresis can also be used to evaluate DNA purity as well as to estimate
DNA concentration. By loading onto a 0.8-1.5% agarose gel, DNA fragments can be
separated by electrophoretic charge based on their lengths (molecular weight). The
intensity of the bands correlates to the DNA concentration. More recently, there has been

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 18

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

increasing interest in the use of alternative techniques of DNA quantification such as

quantitative PCR, hybridization, pulse-field gel electrophoresis (PFGE), and threshold
assay. These techniques are proven to be useful due to a lower detection limit and their
robustness (Mehta & Keer, 2007).

2.4.4. Polymerase chain reaction

The study of product authenticity based on genomic profiling has been rapidly
developed and improved with the progress of molecular biological tools, in particular
polymerase chain reaction (PCR). Invented in 1983 by Kary Mullis at the Cetus
Corporation, it offers a simple process to massively enrich a targeted fragment of DNA
(Watson & Berry, 2003). PCR is an in vitro DNA amplification that involves a repeated
cycling process of defined stages, termed denaturation, annealing, and extension. The
reagents required for the PCR include DNA polymerase, each of four nucleotides (dNTPs),
a primer couple, magnesium source, buffer solution and DNA template (Rapley, 1998).
Rationally, when DNA is heated in excess of 94-95ºC for at least 60 seconds, the
double strands come apart to produce two single strands (Rapley, 1998; Watson & Berry,
2003). This process is called denaturation, which allows the primers to bind to the DNA
template (annealing), whose sequences are complementary to the primers. In the next stage
the temperature is reduced to 35-60ºC for 30-120 seconds. Subsequently, the polymerase
makes a complementary copy of the template DNA started from each primer, thereby
creating a double strand of the target region. Known as extension, this step usually takes
place at 72ºC for 60-180 seconds. In the next cycle, the dsDNA produced from the
previous cycle becomes new template to produce a double new dsDNA (Figure 2-5).

1st Cycle 2nd Cycle, etc...




DNA template Separate 2 DNA Add DNA Separate 2 DNA Add DNA
strands, add primer polymerase strands, add primer polymerase

Figure 2-5. The principle of PCR amplification

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 19

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Recently, real time PCR (RT-PCR) has been widely applied for DNA amplification
due to its robustness, simplicity, and sensitivity (Weder et al., 2001; Hsieh et al., 2007).
RT-PCR allows both qualitative and quantitative analysis. This technique incorporates the
amplification and fluorescent detection by a single instrument in a single tube with data
recorded online. Hence, the use of gel electrophoresis to assess the targeted product can be
Real-time and traditional PCR methods have been developed into a key technology
for identification of foods, including fish and seafood products. Specific DNA sequences
of fish and seafood have been generated through PCR amplification by designing site-
specific primers, such as tuna/family Scombroidae (Bartlett & Davidson, 1991; Rehbein et
al., 1997; Richardson et al., 2006), caviar (DeSalle & Birstein, 1996; Rehbein et al., 1997),
salmonoid (Rehbein et al., 1997), flatfish (Céspedes et al., 1998), mollusc and arthropods
(Meritt et al., 1998), puffer fish (Cheng et al., 2003; Hsieh et al., 2003), gadoid/family
Gadidae (Aranishi et al., 2005), billfish/family Istiophoridae (Hsieh et al., 2005;
Richardson et al., 2006) and teleost fish (Sevilla et al., 2007). Primer design

Since annealing is started from the primer, it becomes a critical part in PCR
amplification. Primers are designed to recognize the targeted region. The primers used in
the PCR are designed based on existing sequences of close similarities or evolutionary
conserved sequences. Many online sequences can be obtained from genetic databases, such
as GenBank, EMBL, BOLD, MitoFish, and CBOL’s. Specifically, sequences of fish and
seafood are available via FISH-BOL and FishTrace. Amino acid sequence information
may also be used to design PCR primers (Rapley, 1998). Besides from GenBank, amino
acid sequences can be provided from Mascot, PeptideMass, ExPASy, and so on.

There are some considerations in designing primers. Generally, the primers should
have a matched “GC” content of 40-60% and must not have the potential to form primer-
dimers or hairpin beacons (Rapley, 1998). Table 2-2 describes a number of primers used
for the amplification of the cyt b region in fish and seafood products. Typically, 15-30 base
primers anneal efficiently if the PCR enzyme is Taq Polymerase, however this number
may change for enzymes with greater heat stability (Roche, 2006). Shorter primers (less
than 15 bases) anneal very effectively but they may not be specific enough. In contrast,
longer primers recognize targets specifically but tend to anneal with lower efficiency.
Priming efficiency can be increased by a G or C, or CG or GC at the 3' ends. Design of 3

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 20

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

or more C or G at the (3') ends should be avoided since it may promote mispriming at G or
C-rich sequences due to stability of annealing (Qiagen, 2005). Primer pairs are designed
with matched melting temperature (Tm). The difference of 5oC or more leads to reduce the
amplification (Rychlik et al., 1990). Tm and optimum annealing temperature (Ta,Opt) can be
estimated as follows:

Tm (ºC) = 2 x (number of [A+T]) + 4 x (number of [G+C])

Ta,Opt (ºC) = 0.3 x(Tm of primer) + 0.7 x(Tm of product) – 25

Table 2-2. Various primer couples used to amplify cyt b region of fish and seafood

Name of Size Target species and
Sequence (5’-3’) Fragment
primer (mers) Source of reference
H15149 30 (Kocher et al., 1989)
Cyt BH 25 (Bartlett & Davidson, 1991)
Cyt BL1 CCATCCAACATCTCAGCATGATGAAA 26 Salmon, mackerel, hering, cod
Cyt BH CCCCTCAAAATGATATTTGTCCTCA 25 (Bartlett & Davidson, 1992)

FB349 GTCGAATGAATCTGAGGAGGCTT 23 Tuna, bonito, mackerel

FB496 CCRATTGGGTTGTTTGACCCTGTTTC 26 (Rehbein et al., 1995)
59-3 AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA 34 Cod, herring, sardine, tuna,
GCTGGTACCTCTACAAAGAAACATGAAACA 123 bonito (Rehbein et al., 1997)
59-4 30
CytB2 25 (Céspedes et al., 1998)
UCYTB272R GCRAANAGRAARTACCAYTC 20 Mollusc and arthropods
TR-14F GGAAAACCCATCCAATCCTA 20 Gadoid/family Gadidae
TR-571R 20 (Aranishi et al., 2005)
L-CYTBF GCTATRCACTAYACMTCRGAC 21 Billfish/family Istiophoridae
CB3-3 26 (Richardson et al., 2006)
Teleost fish
CytBI-3R 23
Wobbles: Y: T/C; M: A/C; R: G/A; K: T/G; W: A/T; S: C/G; H: A/C/T; V: A/C/G; D: A/G/T;
B: C/G/T; N: A/C/G/T

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 21

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Not only for specific amplification, but primers are also important for post-PCR
application, such as direct sequencing and fingerprinting analysis. In some cases, a
degenerate primer is useful to overcome the limited sequence information of such
species/families (Knoth et al., 1988). By introducing alternative bases (wobbles) as inosine
at a particular position, degenerate primers are advantageous for amplification of wide
range of families (Crick, 1966). A number of computer software are currently available to
aid in primer design, for instance DNAsoftware, PrimerDesign, EMBL, PremierBiosoft,
and OligoDesign. Components of PCR reaction

During PCR amplification an enzyme is used to carry out the extension of the
fragment. Historically, DNA polymerase-I was used for this purpose. However, because it
is heat labile, fresh enzyme was required during each cycle which made the technique
laborious and costly (Rapley, 1998). The introduction of thermostable DNA polymerase
transformed PCR technique to allow full automation. The first introduced thermostable
DNA polymerase was isolated from the bacterium Thermophylus aquaticus, namely Taq
DNA polymerase which has optimum temperature of 72ºC (Eckert & Kunkel, 1990). The
higher thermal stability, the more useful is the enzyme, especially for amplifying GC-rich
regions where a high denaturation temperature is required. Several thermostable DNA
polymerases are produced from the different sources, such as Thermococcus litoralis,
Thermotoga maritime, and Thermus thermophilus (Rapley, 1998).

Magnesium (Mg2+) is another important element in the PCR amplification. It is not

only required to form a complex with the dNTPs which is critical for incorporation in the
extension step of the PCR cycle but it also affects the specificity of the primer-template
interaction and the denaturation of the dsDNA (Rapley, 1998). Insufficient Mg2+ results in
low yields while an excess of it creates nonspecific products. Generally, a concentration of
1-4 mM MgCl2 is used, depending on the DNA template and the primers.

The pH of the PCR reaction is an essential factor since changes in pH will affect the
amplification efficiency, in particular of long fragments (Cheng et al., 1994). In order to
maintain the pH at 8.3, at room temperature, a buffer/salt containing 50 mM KCl and 10
mM Tris-HCl is used. The PCR efficiency may also be reduced by contaminants present in
the template or caused by improper handling.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 22

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Essentially, application of RT-PCR requires fluorescent dye to detect amplified

product. There are two classes of fluorescent assays in RT-PCR, known as sequence-
independent and sequence-specific probe. Sequence-independent assays rely on
fluorophores, SYBR Green I for instance, that binds to entire dsDNA molecule instead of
oligonucleotide. Conversely, sequence-specific assay rely on oligonucleotide probes that
hybridize to their complementary sequence in the targeted products. Fluorescent
Resonance Energy Transfer (FRET) and HyProbe are examples of sequence-specific
probes (Roche, 2006).

2.4.5. PCR product analysis

Traditional PCR requires post-run visualization to assess the targeted fragment

(amplified product). Generally, DNA strands are able to be separated and visualized by the
application of polyacrylamide-GE, agarose-GE, or pulse field-GE (Smith, 1998).
Confirmation of the targeted PCR product is normally performed by using GE. Agarose-
GE separates a wide range of DNA fragments (0.1-40 kb), which is preferable to
polyacrylamide-GE (5-400bp). An agarose concentration of 0.3-3% (w/v) in TAE buffer
1x is commonly used to separate DNA fragments. The longer the fragment the lower the
concentration of agarose required.

A set of apparatus is needed to carry out the electrophoresis. Recently, the submarine
gel system is universally used for agarose-GE (Smith, 1998). In this system, the prepared
agarose gel on a supporting plate is submerged into a chamber containing electrophoresis
buffer (TAE 1x). The wells are created in the agarose gel with the aid of a comb inserted
into the cooling agarose. Into these wells, samples which have been mixed with a loading
dye are loaded. Electrophoresis is carried out for certain period, varying considerably from
30 minutes to hours, depending on the size of the gel, gel concentration, and electrical
charge. The DNA fragment migrates from the negative charge to the positive charge.

An intercalating dye is included in the electrophoresis to visualize DNA fragments.

The dye intercalates the stacked bases of dsDNA to produce fluorescence when illuminated
under UV light (254-300 nm). A particular concentration of dye can be mixed within the
gel, running buffer or combination of both. EtBr (3,8-diamino-6-ethyl-5-phenyl-
phenanthridium bromide) was commonly used for DNA staining. However, EtBr is known
as powerful mutagenic and potential carcinogen. Recently, lower mutagenic dyes such as

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 23

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

SybrSafe, SybrGreen, SybrGold (Molecular Probes®) and GelRed, GelGreen (Biotium Inc.)
are established commercially, despite their costs are higher than EtBr.

A successful PCR amplification results a strong band of targeted amplified product

with faint bands of residual nucleotides and primers. Side bands or non amplifiable band
indicates that amplification is not optimal. Overload of DNA will result in smear-bands
while excessive salt will lead to necking bands (Smith, 1998). Since GE only assesses
targeted fragment, it does not give species/product specific information. Further analysis is
required to assess the amplified products, particularly based on the nucleotide profiles.
Direct sequencing and fingerprinting techniques are commonly used for analyzing PCR
product. DNA sequencing

DNA sequencing is the most informative and precise technique for species
identification. DNA sequencing is a modification of DNA replication, which differs from
normal replication in the inclusion of dideoxynucleotides (ddNTPs) instead of dNTPs
(Sanger et al., 1977). The different between ddNTP and dNTP is the lack of a 3’-OH
group. When ddNTP is incorporated into DNA, the synthesis is terminated, the process
known as termination sequencing. Sequencing is carried out in four reactions, each of
which contains all four dNTPs but only one of ddNTP. Thus, the reaction products are four
nested sets of fragments which are terminated according to the ddNTP included in the

Historically, sequencing involves cloning the DNA into a suitable vector to create
DNA in a format that can be used for sequencing. There are two categories of cloning
vectors, known as single-stranded and double-stranded vectors. Plasmid of a bacterium,
such as E. coli, is the most used double-stranded vector for DNA cloning. On the other
hand, a single-stranded vector can be obtained from viruses or bacteriophages (Rapley,
1998). Recently, PCR products can be used as a sequence template. This technique, called
direct sequencing, eliminates the cloning stage and thereby significantly saves time and
materials. The disadvantages of direct sequencing are the limited fragment size (1000-
2000bp) and the need of PCR products purification. Purity and sufficient concentration of
amplified product becomes the most critical factor for the efficiency and reliability of the
sequencing method (Rapley, 1998).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 24

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

In order to visualize the sequence, a detectable label is incorporated into the

sequenced strands. There are three types of labels used to visualize the sequence:
radioactive, four-color fluorescent, and one-color fluorescent. Radioactive based labeling
35 32 33
uses isotope of S, P or P to be incorporated to the ddNTP. The extended DNA is
visualized after electrophoresis by drying the gel and subsequently exposed it into a film
sensitive to radioactivity. 35S is the most used isotope as it exposes low energy β-emission
with reasonable half-life (87.4d) (Spencer, 1998). Recently, the trend of sequencing is
moving toward automated-sequencing system based on fluorescennce. Fluorescent
sequencing relies on excitation of fluorescent-labeled DNA strands when exposed to laser
light. The major advantage of this technique is that the sequence information can be
collected directly while the gel is running (Spencer, 1998). Applied Biosystems/ABI
(Perkin Elmer Corp), Amersham Pharmacia Biotech, and Li-Cor Biosciences are among
recognized manufacturers of automated sequencer.

For species differentiation, the sequence of DNA template is compared to

references/libraries. The index of similarity between two or more sequences is used to
analyze the most likely identification by using BLAST (Basic Local Alignment Search
Tool). Sequencing enables species identification without reference material if the generated
sequence is available in the database. The database can be created manually or obtained
online. The most recognized online DNA databases are GenBank and EMBL, while
Fishtrace specifically constructs sequence databases of commercially important fish based
on cyt b and nuclear rhodopsin. Nonetheless, not all sequences of the species are available
in several online DNA databases.

Direct sequencing has been successfully used to identify tuna species (Bartlett &
Davidson, 1991), adulterated dried mullet (Hsieh et al., 2003), specimens of tuna and
billfish larvae (Richardson et al., 2006) and teleost specimen (Sevilla et al., 2007) based on
the cyt b gene. Sequencing was also employed to identify Australian fish species for DNA
barcoding purposes based on COI region (Ward et al., 2005). Fingerprinting techniques

The main drawback for large-scale implementation of sequence-based identification

is cost requirement. Alternatively, several methods have been developed for species
identification. These techniques, known as fingerprinting, include Denaturing/
Temperature Gradient Gel Electrophoresis (DGGE/TGGE), Single Strand Conformation

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 25

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Polymorphism (SSCP), Restriction Fragment Length Polymorphism (RFLP), Amplified

Fragment Length Polymorphism (AFLP), and Random Amplified Polymorphic DNA
(RAPD) (Rapley, 1998; Spencer, 1998; Brooker, 1999; Mackie et al., 1999; Hird et al.,
2005). By using these methods, the phylogenic information can be obtained more
economically and rapidly (Hwang & Kim, 1999).

DGGE employs the use of a polyacrylamide gel with a gradient of denaturant to

separate the targeted DNA based on its stability against the denaturant. DNA fragments
rich in “GC” will be more stable and remain double-stranded until reaching higher
denaturant concentrations (Rapley, 1998). A mixture of ureum-formamide is used as
denaturants in the DGGE technique. Denatured DNA molecules become effectively larger
and slow down or stop in the gel and thereafter DNA fragments of different sequences can
be separated. The system is very sensitive to detect a single mutation in several hundreds
of base pairs of DNA (Smith, 1998). Similarly, TGGE is generated based on the gradient
temperature (Rapley, 1998).

PCR-RFLP is the most widely used method for identifying different fish (Hsieh et
al., 2003). This technique relies on the use of restriction enzymes which cleave dsDNA at
defined base pairs to generate species specific DNA fragments. Differences of base pair
between species can be detected by choosing a restriction enzyme which cuts the DNA at
particular sites. Endonucleases such as AluI, EcoRI, HaeIII, HindIII, SmaI, etc, are
commonly used for restriction analysis of amplified PCR products (Rapley, 1998). The
EcoRI, an enzyme produced by E. coli RY13 for example, recognizes every site consisting
“GAATTC”. After digestion for several hours at 37°C, the resulting fragments are
separated by electrophoresis in an agarose gel containing fluorescent dye. The advantage of
this method is that it is suitable for some functional genes which are not resolved by
DGGE analyses (Brooker, 1999). RFLP may also overcome problems with degenerate
primers that can plague some DGGE methods. PCR-RFLP enables to identify a single
point mutation since a restriction site would change the restriction pattern and a clear
identification becomes possible (Brooker, 1999). PCR-AFLP/RFLP analysis of the cyt b
gene has been used for identification of fish species (Ram et al., 1996; Cespedes et al.,
1998; Hsieh et al., 2003).

In SSCP, dsDNA is denatured by denaturing solution containing formamide,

bromphenol blue, and xylene cyanol in NaOH to form ssDNA. The ssDNA is then folded
such that complementary sections are bound together. Differences in the three dimensional

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 26

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

structure caused by alterations in base pair sequences of the single strand lead to differ the
electrophoretic mobility, which are visualized by silver staining. In comparison to other
fingerprinting techniques, SSCP is relatively cheap and fast to perform. Differentiation of
canned tuna and bonito has been achieved by this method (Rehbein et al., 1995). In
addition, the RAPD technique uses a short and not specific primer to generate unique band
patterns of amplified DNA (Mamuris et al., 1999). However, the use of SSCP and RAPD
techniques is limited by the necessity of reference material (Rehbein et al., 1995). Other techniques

There are relatively new technologies which work in the similar way as finger
printing. Denaturing HPLC (PCR-DHPLC) employs an HPLC column rather than
acrylamide gel for separating PCR products (Barlaan et al., 2005. Separation of amplified
products is according to the elution of partially melted DNA bases. Since typically GC-rich
DNA denaturizes at higher temperature, it leads to the reduction of dsDNA and therefore
the elution of the sample will be faster. This technique was originally developed for
mutation analysis (Frueh & Noyer, 2003).

Not only it is able to generate targeted DNA fragment, RT-PCR also offers some
advantages in comparison to classical PCR. Online information, chiefly the amplification
curve and melting points, can be provided while PCR is running. Since melting point (Tm)
is basically sequence dependent, it permits to discriminate between different PCR
fragments. RT-PCR has been satisfactorily used to identify fish fillet from grouper, tuna
fishes, and commonly substitute species (Lopez & Pardo, 2005; Trotta et al., 2005).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 27

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


3.1. Problems
Primer design plays an important role in the PCR amplification and contributes
significantly to the downstream applications of product identification. The previous
literature reviewed various primers have been developed specifically to amplify specific
groups of fish and seafood products. However, several fish identities are not resolved by
existing primers, for instance Microstomus kitt, Scopthalmus maximus, Hyperoplus
lanceolatus and Ammodytes tobianus (Hoffman, personal communication). In addition,
studies on the genomic identification of elasmobranches, crustaceans and molluscs based
on cyt b gene are very limited. The studies on the identification of crustacean and
molluscan taxa focusing on cyt b were described by Meritt et al. (1998) and Nguyen et al.
(2002), while the studies on the identification of elasmobranches were focused on shark
(Martin & Palumbi, 1993; Heist & Gold 1999; Briscoe et al., 2005).

With regard to the fact that there is no universal primer couple available for the
majority of fish, crustaceans and molluscs at present time, it is essential to provide and
validate it. Universal primers are valuable for identification of samples that are
unrecognizable by morphological characters such as filleted products, surimi and other
processed/mixed products. It is also advantageous for identification of a wider range of
species or species that are not resolved by existing primers.

3.2. Objectives
The main goal of this study is to develop standardized universal primers for species
identification of fish and seafood (teleost fish, elasmobranches, crustaceans and molluscs)
by polymerase chain reaction base on cyt b mitochondrial DNA. Furthermore, since DNA
quality, primers suitability and amplification condition are among the crucial factors in the
success of PCR amplification, this research aims to:
a. evaluate the different DNA extraction methods,
b. optimize the existing primers for cyt b gene amplification suitable for fish, mollusc and
crustaceans. Adapted primers were designed based on the evaluation of existing
primers, and

c. provide the optimal PCR protocol of the validated primers.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 28

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

3.3. Research framework

Sample collection

Unknown biological Morphological identification

references (if available)

Sequence database Comparison of DNA

DNA isolation
extraction methods
- Evaluation of existing
- Designing the PCR/RT-PCR DNA quantity
degenerate primers amplification and purity
- Validation of universal

PCR product analysis

Sequencing RT-PCR analysis

- Evaluation of targeted fragments - Evaluation of melting points (Tm)

- Index of similarity (BLAST) - Identification of dissimilarity

: Focus of the study

Figure 3-1. Framework of present study

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 29

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


4.1. Construction of reference database of cyt b gene

Genomic data bases of cyt b of various fish and seafood were collected via NCBI and
FishTrace (Figure 4-1). In NCBI, cyt-b database is categorized in ‘Nucleotide’ group on
menu ‘Search’. Species of to be searched fish/seafood must be entered, for example:
‘Gadus morhua cytochrome b’, then ‘Go’ must be clicked. The available database
(sequence) must be displayed in ‘FASTA’ to perform the sequences as fasta format. The
fasta format sequence is then copied to ‘Notepad’ in order to be able to integrate it into
bioinformatics applications. The format of entry files is ‘>gb nr|species name|reference
number|cytb|data origin (NCBI or FishTrace)’. Meanwhile, FishTrace’s data base can be
searched by either scientific name or common name. The cyt-b sequence is classified in
‘Genetics’ group. The detail sequence, furthermore, must also be copied as FASTA format
as explained previously. The provided sequences were used in designing the primers and
evaluating the sequence results.

Figure 4-1. Genomic database obtained from NCBI (left) and FishTrace (right)

4.2. Sample collection and preservation

Selected samples (finfish, molluscs and crustaceans) were obtained from either the
North Sea or selected fish markets in Belgium. Fresh samples were identified by means of
morphological features. Gutted and eviscerated samples were filleted prior to extraction.
Three to six specimens of 14 species of fish, 7 species of crustaceans, and 6 species of
molluscs were used for this work. Specification of the samples is described as follows:

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 30

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

a. Fish:
- Round fish: cod (Gadus morhua), faneca (Trisopterus luscus), tuna (Thunnus sp.),
and grey gurnard (Eutrigla gurnardus).
- Flat fish: common sole (Solea solea), lemon sole (Microstomus kitt), and tarbot
(Scophthalmus maximus).
- Elasmobranches: thornback ray (Raja clavata) and smooth skate (Malacoraja senta).
- Sand lances (smelt): small sandeel (Ammodytes tobianus), great sandeel (Hyperoplus
lanceolatus), and 3 unknown smelt fish (US1, US2, and US3).
b. Crustacean:
- Brown shrimp (Crangon crangon), giant tiger shrimp (Penaeus monodon), king
shrimp (P. Latisulcatus), giant river shrimp (Macrobranchium rosenbergii), deep-sea
shrimp (Solenocera sp), and 2 unknown shrimp (990 and 991).
c. Mollusc:
- Blue mussel (Mytilus edulis), green mussel (Perna canaliculus), illex squid (Illex
argentinus), and 3 unknown mussels (T1, 120 and 2251)

The reason for choosing these species was that some of them have previously been
well studied, such as G. morhua, Thunnus sp, and S. solea (Bartlett & Davidson, 1991;
Rehbein et al., 1997; Céspedes et al., 1998; Richardson et al., 2006). Other species are
known difficult to be identified by existing primers, for instance M. kitt, S. maximus, A.
tobianus, H. lanceolatus, C. crangon and M. edulis.

4.3. Comparison of DNA extraction methods

A commercial kit (Wizard DNA Extraction kit-Promega) and 3 classical methods

based on TNES-Urea Phenol-Chloroform were evaluated to isolate the total DNA of 4
selected samples (S. solea, T. luscus, C. crangon, and M. edulis). These classical methods
have been widely used to extract DNA either from fish tissue, fin, scales, or food products
(Asahida, et al., 1996, Wasko et al., 2003; Hsieh et al., 2005). The best method, resulting
in the best DNA quantity and purity for PCR application was then used in the further
application. The chemicals, reagents and solutions used for this work are described in
Appendix II (see page 70).

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 31

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

4.3.1. DNA extraction method 1 (Promega)

Isolation of DNA was performed based on the manufacturer’s instruction (Promega,

2002). 120 μl of a 0.5M EDTA solution pH 8.0 was added to 600 μl of Nuclei Lysis
Solution (NLS) in a 1.5 ml Eppendorf tube. Approximately 100 mg of tissue was added
into each tube followed by 17.5 μl of 20 mg/ml Proteinase K. The tubes were then
vortexed gently for 20 second and incubated overnight at 55ºC. Subsequently, 3 μl of 4
mg/ml RNase were added to the nuclear lysate and mixed gently prior to incubation at
37ºC for 30 minutes.

The DNA was extracted by adding 200 μl of Protein Precipitation Solution (PPS).
The tubes were then vortexed vigorously at high speed and followed by a centrifugation at
14.000 rpm for 10 minutes. Supernatant was transferred to a new tube containing 600 μl of
isopropanol (IPA). After being chilled at -20ºC for 1 hour, the DNA was precipitated at
14.000 rpm for 10 minutes. The DNA pellet was washed with 600 μl of 70% ethanol, air
dried and resuspended in 100 μl TE buffer.

4.3.2. DNA extraction method 2 (Hsieh et al., 2005)

In a 1.5 ml Eppendorf tube, approximately 100 mg of tissue was crushed with 600
μl TNES buffer (1% SDS). 15 μl of 20 mg/ml Proteinase K was added to each tube
followed by overnight incubation at 55ºC. The DNA isolation was performed by 600 μl of
phenol:chloroform:isoamyl alcohol (25:24:1). Rotation at 14.000 rpm for 10 minutes
separated the undissolved materials. The top layer was transferred to a new tube followed
by another extraction with 600 μl of phenol:chloroform (24:1). The DNA was precipitated
in 3M NaOAc pH 5.3 and two volumes of absolute ethanol. After being cooled at -20ºC for
1 hour, the tubes were centrifuged at 14.000 rpm for 10 minutes. The DNA pellet was
washed in 600 μl of 70% ethanol, air dried and resuspended in 100 μl of TE buffer.

4.3.3. DNA extraction method 3 (Wasko et al., 2003)

Approximately 100 mg of fresh tissue was grounded in a 15 ml falcon tube with 4 ml

of TNES-Urea buffer (0.5% SDS; 4 M urea). 15 μl of 20mg/ml RNase was added to the
tube prior to an hour of incubation at 42ºC. After incubation, 75 μl of 4 mg/ml Proteinase
K was added to each tube followed by incubation at 42ºC for 10 hours.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 32

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

The DNA was extracted with 4 ml of phenol:chloroform:isoamyl alcohol (25:24:1).

After being inverted for 30 seconds, the tubes were rotated at 14.000 rpm for 10 minutes.
The top layer was transferred to a new tube. The DNA was precipitated in 1M NaCl and
two volumes of absolute ethanol. Centrifugation at 14.000 rpm for 10 minutes was done to
recover DNA. The DNA pellet was briefly washed in 70% ethanol, air dried and
resuspended in TE buffer and incubated at 65ºC for 1 hour.

4.3.4. DNA extraction method 4 (Asahida et al., 1996)

Approximately 100 mg of tissue was transferred into a 1.5 ml Eppendorf tube. 600 μl
of TNES-Urea buffer (6 M urea; 1% SDS) was used as the digestion buffer. 2μl of 20
mg/ml Proteinase K was added to the tube for protein digestion and the mixture then
incubated overnight at 37ºC. After this period, 3 μl of RNase was added to the tubes to and
the tubes were maintained at 37ºC for 30 minutes.

The DNA was isolated by adding 600 μl of phenol:chloroform:isoamyl alcohol

(25:24:1) to the tube. After being inverted for 20 seconds, it was rotated at 14.000 rpm for
10 minutes. The top aqueous layer was transferred to a new tube followed by the second
extraction by adding 600 μl chloroform:isoamyl alcohol (24:1). After the centrifugation,
the top layer was transferred again to a new tube.

DNA precipitation was done by adding 1/10 volume of NaOAc 3M, pH 5.3 and 2
volume of 99% ethanol. After being gently inverted, the tube was stored at -20ºC for 1
hour prior to be rotated at 14.000 rpm for 10 minutes. The DNA pellet was washed in 70%
ethanol followed by air drying. The DNA was resuspended in 100 μl of TE buffer,
incubated at 65ºC for 1 hour and ready for downstream applications.

4.3.5. Determination of DNA yield

The DNA concentration was determined by spectrofluorometry. Relative fluorescence

was measured by using a Shimadzu Fluorospectrophotometer (RF1501). The
spectrofluorometric method was performed using Picogreen dye specifically for dsDNA
(Invitrogen) and measured at 480nm excitation and 520nm emission.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 33

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene Standard curve

2 μg/ml of Lambda DNA (Invitrogen) was used as working solution to create a
standard curve. A seven-point standard curve (0; 5; 10; 15; 20; 25 and 30 ng/μl) was
prepared by diluting the working solution in the same way as the experimental sample
(Table 4-1). After incubation for 5 minutes at room temperature and protected from light,
samples were measured. The fluorescence values were used to generate the standard curve
(Figure 4-2) of relative fluorescence versus the DNA concentration of the samples as

y = ax + b, where “y” is DNA concentration while “x” is relative fluorescence (RF)

Table 4-1. Protocol used to prepare the standard curve

DNA Conc. 2 μg/ml λDNA TE-buffer 1X PicoGreen® dsDNA Total Volume

(ng/ml) Stock (μL) (μL) Reagent (μL) (μL)
0 (blank) 0 1998 2 2000
5 5 1993 2 2000
10 10 1988 2 2000
15 15 1983 2 2000
20 20 1978 2 2000
25 25 1973 2 2000
30 30 1968 2 2000


Y = 20.592X + 9.1132
R2 = 0.9993
Relative Fluoroscence




Ex : 480nm Em : 520nm

0 5 10 15 20 25 30 35
DNA (ng/ml)

Figure 4-2. An example of standard curve for spectrofluoromric measurement

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 34

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene Sample Analysis

One μl of experimental DNA solution was diluted in 1997 μl TE buffer 1X to a final
volume of 1998 μl in a disposable cuvette (ROTH; Art.8128). 2 μl of PicoGreen® dsDNA
quantitation reagent was added to each sample and the samples were then incubated for 2
to 5 minutes at room temperature. The relative fluorescence was measured by using
instrument parameters that correspond with those used for generating the standard curve.
The DNA concentration of the sample was calculated from the DNA standard curve
through the following formula:
DNA (ng/μl) = [(RF-b)/a] x 2; where RF is relative fluorescence

4.3.6. Evaluation of DNA purity

The DNA purity was estimated by spectrophotometry. A NanoDrop ND-1000

spectrophotometer (Isogen) was used to calculate the ratio of absorbance at 260 and 280
nm. The analysis was carried out according to the manufacturer’s instruction (NanoDrop,
2007). 1 μl sample was pipetted onto the lower pedestal/the receiving fiber (Figure 4-3).
The integrated software measures the DNA concentration and the ratio of A260/280.

Sampling arm
measurement upper
pedestal measurement

(a) (b) (c) (d)

Figure 4-3. The application of NanoDrop (a-c) and its typical data output (d)

In order to evaluate DNA integrity, including degraded DNA and contaminants, the
DNA isolates were checked by agarose GE. 1% agarose (Promega) was prepared in 1X
TAE buffer with Gel Red staining dye (Molecular Probes). For a 20x10 cm2 gel, 1 g of
agarose was diluted in 67 ml of TAE buffer 1.5X and 33 ml of GelRed in a 500 ml
Erlenmeyer flask. The mixture was heated in a microwave for +5 minutes until the agarose
was completely dissolved. After cooling down for a few minutes, the gel was poured into
the gel mold with casting comb in place. The gel was allowed to cast for 15-20 minutes,
placed in the chamber of Midicell® Primo EC-330 (Thermo) (Figure 4-4). The reservoir
was filled with 1X TAE buffer until the buffer just covered the gel. 5 μl of samples were
prepared and to each of them was added one drop of blue-orange loading dye (Promega). A

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 35

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Smart Ladder 1800 (Eurogentec) was used as a 1 kb DNA marker. The gel was
electrophoresed for 1 h at 66 V until the orange dye reached approximately 3/4 of the gel.
DNA fragments were visualized on a Consort UV transilluminator at 254 nm and captured
by Edas-290 digital camera (Kodak).

A. Thermal cycler B. Electrophoresis chamber C. UV illuminator

Figure 4-4. Apparatus for PCR applications

4.3.7. PCR assay

A PCR assay was employed to evaluate the efficiency of DNA isolate to amplify the
targeted fragment. The CytBL1/CytBH primer couple was used to generate ~357bp of the
cyt b gene. The reaction was performed in a final volume of 20μl. 10μl of Jump Start RED
Taq Ready Mix (Sigma P-0982) was used to obtain 10mM Tris-HCl pH 8.3, 50mM KCl,
2mM MgCl2, 0.2mM of each dNTP, and 0.03U/μl Taq DNA polymerase. 2 μl of each
primer (10mM) and serial dilution (5 and 20 ng/20μl) of DNA templates were added
following the instruction as described in Table 4-2. Amplification was carried out in a
PCRexpress thermal cycler (Hybaid). The PCR conditions included initiation (94oC for 5
min), 35 cycles of amplification (94oC for 30 sec; 50oC for 30 sec; 72oC for 1 min) and
final extension (72oC for 5 min).

Table 4-2. Composition of PCR reaction

Reagent Volume (μl)
2x JumpStart REDTaq ReadyMix 10 μl 1x
Forward primer (10 mM) 2 μl 1 μM
Reverse primer (10 mM) 2 μl 1 μM
DNA template variable 5 and 20 ng
PCR H2O variable -
Total volume 20 μl -

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 36

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

4.3.8. Visualization of PCR product

Amplified PCR products were analyzed by gel electrophoresis on 2% (w/v) agarose

(Promega). The preparation of the gel and visualization of the result was as described in
Section 4.3.6. (see page 35). 5 μl aliquot of amplified products was loaded on the gel
together with a 100 bp 1700 DNA ladder (Eurogentec) as the marker.

4.4. Optimization and validation of a universal PCR protocol

4.4.1. Primer design

At first, the primer couple of CytBL1/CytBH was evaluated and optimized to

amplify the selected samples. This primer couple has widely been used to amplify ~357bp
of the cyt b of various species (Kocher et al., 1989; Bartlett & Davidson, 1991 & 1992;
Céspedes et al., 1998; Richardson et al., 2006). Since this primer was not optimal for
crustacean, mollusc, and some fishes, degenerate primers were designed by introducing
some wobbles. The primers were designed by means of Oligo software following a number
of rules for primer design (Qiagen, 2005; Roche, 2006).
Alternatively, other universal primers (UCYTB) were also validated to amplify
~410bp of the cyt b gene. The primers were designed based on those described by Meritt et
al. (1998). Table 4-3 describes the properties of the primers used in this study. In addition,
the scheme of targeted fragments created by the validated primers is drawn in Figure 4-5.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 37

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

(5’) 427 827/830/833 (3’)

2 &,6 9 - 12
~ 357bp
~ 410bp
1, 3, 4, 5 7&8
(3’) 70 421/424 (5’)
Figure 4-5. The scheme of targeted fragments generated by the evaluated primers

4.4.2. PCR assay

The PCR reaction was performed in a final volume of 20 μl as described in Section

4.3.7. (see page 36). The PCR conditions were adjusted depending on the set of primers as
described in Table 4-4.

Table 4-4. PCR condition of the different primer sets

Primer PCR condition
Initiation 94oC; 5 minutes; 1 x
Denaturation 94oC; 30 seconds
Annealing 45-60oC; 30 seconds 35 cycles
Extension 72oC; 1 minute
Final extension 72oC; 5 minutes; 1 x
Initiation 94oC; 4 minutes; 1 x
Denaturation 94oC; 1 minute
Annealing 45-60oC; 1 minute 35 cycles
Extension 72oC; 2 minute
Final extension 72oC; 5 minutes; 1 x

Amplified PCR products were analyzed by gel electrophoresis on 2% (w/v) agarose

(Promega). The preparation of the gel and visualization of the result was as described in
Section 4.3.6. (see page 35). 5 μl aliquot of amplified products was loaded onto the gel
together with a 100 bp 1700 DNA ladder (Eurogentec) as the marker.

4.4.3. Direct sequencing of PCR product

Direct sequencing was attempted to confirm whether the designed/validated primers

amplify the targeted fragments. Sequence analysis was carried out using a 4 color dye (Big
Dye, Applied Biosystems) and performed in an ABI 3730xl DNA analyzer at AGOWA
GmbH Berlin, Germany. Prior to the sequencing, PCR products were purified using the
High Pure PCR Product Purification Kit (Roche Applied Sci. Mannheim, Germany)
according to the manufacturer’s instructions.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 38

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Sequence chromatograms were viewed and evaluated by using ChromasPro and

BioEdit software (Figure 4-6). Both forward and reverse sequences were edited by
trimming out the ambiguous bases. The selected sequences were then assembled to analyze
the overlapping bases.

Figure 4-6. Software for sequence analysis: ChromasPro (left) and BioEdit (right)

4.4.4. Real Time PCR application

Prior to the RT-PCR amplification, all reagents (2x QuantiTect SYBR Green RT-
PCR Master Mix and primers) were thawn. The master mix was prepared to a final volume
of 20 μl according to the manufacturer’s instructions (Table 4-5). Into each microplate
well, 15 ul of the mix solution were filled. 5 μl of DNA template (final concentration of
10ng/20μl) was added to each well, except the blank. The microplate was centrifuged for 3
min at 3000 rpm (Sigma 3-18K; Sartorius). The RT-PCR amplification was carried out in a
LightCycler® 480 (Roche) at the conditions as described in Table 4-6. The melting curve
was determined from the thermal profile observed for 30 seconds after elongation (60-90ºC
with ramp rate 2.2-4.4ºC/s). The melting points (Tm) generated from the melting curve
(Figure 4-7) were used to discriminate between closely-related species.

Table 4-5. Reaction components of RT-PCR amplification

Component Volume/reaction Final concentration
SYBR Green RT-PCR Master Mix 2x 10μl 1x
Forward and reverse primer 10μM 1μl 0.5μM
DNA template 5μl 10ng
PCR grade H2O 3μl To make final volume
Final volume 20 μl 1 x Reaction Mix

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 39

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Table 4-6. Thermal profile of RT-PCR amplification

Step Time Remark
Initial activation 10 min 95 Ramp rate 4.4ºC/s
Denaturation 10 sec 95 Ramp rate 4.4ºC/s
Depends on the melting temperature
Annealing 10-20 sec 45-60
Ramp rate 2.2ºC/s
Elongation 30 sec 72 Ramp rate 4.4ºC/s
Depends on the length of the
Cycle number 30-40 cycles
targeted fragment

Figure 4-7. Typical results of RT-PCR: annealing curve (left) and melting curve (right)

4.5. Data analysis

The similarity index of selected samples based on sequence profile was compared to
the references/libraries obtained via GenBank and FishTrace by using BLAST analysis
(Figure 4-8).

Figure 4-8. An example of BLAST analysis obtained via GenBank (left) and FishTrace

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 40

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


Despite yielding lower DNA concentration, the commercial kit produced better
quality of DNA isolate compared to the classical methods, performed by higher efficiency
in PCR amplification. In addition, commercial kits offer simpler procedure and avoid the
use of harmful reagents in comparison to classical methods. In the classical methods
evaluated in this study, 4 M urea in combination with 0.5% SDS (Wasko et al., 2003) or
1% SDS without urea (Hsieh et al., 2005) proved to be the optimal lysis solution for fish
and seafood products.

Typically, the CytBL1/CytBH primer couple worked effectively on most fish (except
S. maximus, M. kitt, and sand lances/smelt fish). In contrast, these primers showed low
efficiency in amplifying crustacean and molluscs. Adjustment of Mg2+ concentration did
not affect significantly on annealing efficiency of C. crangon and M. edulis. Meanwhile,
the degenerate primer couple CytBL1C/CytBHW effectively amplified most molluscs and
crustaceans, except C. crangon and I. argentinus. This primer couple is promising to be
employed universally for species identification of crustaceans and moluscan taxa. In
addition, UCYTB151BF/UCYTB271R and UCYTB152BF/ UCYTB271R were successful
to amplify all fish, crustacean and mollusc examined in this study. Hence, these primers
can be considered as the first universal primers applicable for fish, crustaceans, and
molluscs. However, further trials on a wider variety of species, including species with
unusual mtDNA character such as Pectenidae, are necessary to ascertain whether these
primers are universally effective to amplify the majority of fish and seafood products.

Sequence analysis proved that all validated primer couples were successful in
amplifying the expected DNA fragments (~357bp and ~410bp) of cyt b region. BLAST
analysis performed similarity indexes against the libraries of 15 selected samples varying
between 92% and 100%. Sequencing was also successful to differentiate the 3 unknown
sand lances/smelt fish and 2 unknown shrimps. Additionally, RT-PCR was applicable to
differentiate between tuna and cod, 2 ray fish (R. clavata and M. senta), 2 crustaceans (P.
monodon and P. latisulcatus), and 2 mussels (M. edulis and Perna canaliculus), but failed
to discriminate among smelt fish. In order to increase the RT-PCR sensitivity,
amplification using HRM Mix is suggested.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 59

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 60

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


Aranishi, F., Okimoto, T., and Izumi, S. 2005. Identification of gadoid species (Pisces,
Gadidae) by PCR-RFLP analysis. J Appl Genet. Vol.46(1):69-73.
Asahida, T., Kobayashi, T., Saitoh, K., and Nakayama, I. 1996. Tissue preservation and
total DNA extraction from fish stored at ambient temperature using buffers
containing high concentration of urea. Fish Sci. Vol.62:727–730.
Avise, J.C., Arnold, J., Ball R. M., Bermingham, E., Lamb, T., Neigel, J.E., Reeb, C.A.,
and Saunders, N.C. 1987. Intraspecific phylogeography: the mitochondrial DNA
bridge between population genetics and systematics. Annu Rev Ecol Syst.
Barlaan, E.A., Sugimori, M., Furukawa, S., and Takeuchi, K. 2005. Profiling and
monitoring of microbial population by denaturing high-performance liquid
chromatography. J Microb Meth. Vol.61:399-412.
Bartlett, S.E. and Davidson, W.S. 1991. Identification of Thunnus tuna species by the
polymerase chain reaction and direct sequence analysis of their mitochondrial
cytochrome b genes. J Fish Aquat Sci. Vol.48: 309-317.
Barrett, R.D.H. and Hebert, P.D.N. 2005. Identifying spiders through DNA barcodes.
Canadian J Zool. Vol.83:481–491.
Bio-Nobile. 2005. QuickPickTM SML gDNA: genomic DNA purification kit. Instruction
for use. Bio-Nobile Oy, Turku-Finland. pp.1-28.
Blin, N. and Stafford, D.N. 1976. A general method for isolation of high molecular weight
from eukaryotes. Nucleic Acid Res. Vol.3:2303-2308.
Bossier, P. 1999. Authentication of seafood products by DNA patterns. J Food Sci. Vol.64
Bossier, P. and Cooreman, K. 2000. A databank able to be used for identifying and
authenticating commercial flatfish (Pleuronectiformes) products at the species level
using isoelectric focusing of native muscle proteins. Int J Food Sci Tech.Vol.35:563-
Botwell, D.D.L. 1987. Rapid isolation of eurokaryotic DNA. Anal Biochem. Vol.162:463-
Boucherie, H., Dujardin, G., Kermorgant, M., Monribot, C., Slonimski, P., and Perrot, M.
1995. Two-dimensional protein map of Saccharomyces cerevisiae: construction of a
gene-protein index. Yeast. Vol.11: 601-613 .
Briscoe, D.A., Stow, A., and Hussey, S. 2005. Trial dna testing of shark products imported
into and exported from Australia to detect the presence of great white shark. Final
Report to the Department of the Environment and Heritage. 29pp.
Brooker, R.J. 1999. Genetics: Analysis and Principles. Benjamin/Cumnings, an imprint of
Addison Wesley Longmen, Inc. pp. 1-772.
Burzynski, A., Zbawicka, M., Skibinski, D.O.F., and Wenne, R. 2006. Doubly uniparental
inheritance is associated with high polymorphism for pearranged and recombinant
control region haplotypes in baltic Mytilus trossulus. Genetics. Vol.174:1081–1094.
Chomczynki, P. and Sacchi, N. 1987. Single step method of RNA isolation by guanidinium
thiocyanate –phenol-chloroform extraction. Anal Biochem. Vol.162:156-159.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 61

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Celik, M., Tureli, C., Yanar, Y., Edem, U., and Kucukgulmez, A. 2004. Fatty acid
composition of the blue crab (Callinectes sapidus) in the north eastern
Mediterranean. Food Chem. Vol. 88: 271-273.
Céspedes, A., Garcia, T., Carrera, E., Gonzalez, I., Sanz, B., Hernandez, P.E., and Martin,
R. 1998. Identification of flatfish species using polymerase chain reaction (PCR)
amplification and restriction analysis of the cytochrome b gene. J Food Sci. Vol.63:
Cheng, T.Y., Shiaua, C.Y., Noguchia, T., Weib, C.I., and Hwang, D.F. 2003. Identification
of puffer fish species by native isoelectric focusing technique. Food Chem. Vol. 83:
Cheng, S., Cheng, S.Y., Gravitt, P., and Respess. 1994. Long PCR. Nature. Vol.369:684-
Crick, F. 1966. Codon-anticodon pairing: the wobble hypothesis. J Mol Biol. Vol.19(2):
Deisingh, A.K., Stone, D.C., and Thompson, M. 2004. Applications of electronic noses
and tongues in food analysis. Int J Food Sci Tech. Vol. 39: 587–604.
Dempson, J. B. and Power, M. 2004. Use of stable isotopes to distinguish farmed from
wild Atlantic salmon, Salmo salar. Ecol Freshwater Fish. Vol.13:176-184.
DeSalle, R. and Birstein, V. 1996. PCR identification of black caviar. Nature.
Deshpande, R.A., Kumar, A.R., Khan, M.I., and Shankar, V. 2001. Ribonuclease Rs from
Rhizopus stolonifer: lowering of optimum temperature in the presence of urea.
Biochimica et Biophysica Acta (BBA) - Prot Struc Mol Enzym. Vol.1545: 13-19.
Di Pinto, A., Forte, V.T., Guastadisegni, V.C., Martino, C., Schena, F.P., and Tantillo, G.
2007. A comparison of DNA extraction methods for food analysis. Food Control.
Doyle, J.J. and Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochem Bull. Vol.19: 11-15.
Dupont, S., Wilson, K., Obst, M., Sköld, H., Nakano, H., and Thorndyke, M.C. 2007.
Marine ecological genomics: when genomics meets marine ecology. Mar Ecol Prog
Ser. Vol. 332: 257–273.
Ebeling, W., Hennrich, N., Klockow, M., Metz, H., Orth, H.D., and Lang, H. 1974.
Proteinase K from Tritirachium album. Limber Eur J Biochem. Vol.47: 91-97.
Eckert, K.A. and Kunkel, T.A. 1990. High fidelity DNA synthesis by the Thermus
aquaticus DNA polymerase. Nucleic Acid Res. Vol.18: 3739-3744.
Esposti, D.M., De Vries, S., Crimi, M., Ghelli, A., Patarnello, T., and Meyer, A. 1993.
Mitochondrial cytochrome b: evolution and structure of the protein. Biochem Biophys
Acta. Vol.1143:243–271
Etienne, M., Jørôme, M., Fleurence, J., Rehbein, H., Kundiger, R., Yman, I.M., Ferm, M.,
Craig, A., Mackie, I., Jessen, F., Smelt, A., and Luten, J. 1999. A standardized
method of identification of raw and heat-processed fish by urea isoelectric focusing:
A collaborative study. Electrophoresis. Vol.20:1923-1933.
FDA. 1995. FDA Consumer – Investigators’ Reports: “Seafood maker fined for
misbranding.” U.S. Food and Drug Administration. FDA Consumer. Vol.29(9). Accessed on September 5th, 2007.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 62

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Ferguson, A., Taggart, J.B., Prodohl, P.A., McMeel, O., Thompson, C., Stone, C.,
McGinnity, P., and Hynes, R.A. 1995. The application of molecular markers to the
study and conservation of fish populations, with special reference to Salmo. J Fish
Biol. Vol.47(Suppl. A):103-126.
Floyd, R., Abebe, E., Papert, A., and Blaxter, M. 2002. Molecular barcodes for soil
nematode identification. Mol Ecol. Vol.11: 839-850
Food Quality News. 2006. DNA technique developed for meat traceability.
traceability-contamination. Accessed on September 11st, 2007.
Frueh, F.W. and Noyer-Weidner, M. 2003. The use of denaturing high-performance liquid
chromatography (DHPLC) for the analysis of genetic variation: impact for
diagnostics and pharmacogenetics. Clin Chem Lab Med. Vol.41:452-461.
Gayo, J. 2006. Species Authenticity and Detection of Economic Adulteration of Atlantic
Blue Crab Meat Using VIS/NIR Spectroscopy. PhD Disertation. North Carolina
State University.
Goldenberg, O., Herrmann, S., Marjoram, G., Noyer-Weidner, M., Hong, G., Bereswil S.,
and Gobel, U.B. 2007. Molecular monitoring of the intestinal flora by denaturing
high-performance liquid chromatography. J Microbiol Meth. Vol.61:95-105.
Gokoolu, N. and Yerlikaya, P. 2003. Determination of proximate composition and mineral
contents of blue crab (Callinectes sapidus) and swim crab (Portunus pelagicus)
caught off the Gulf of Antalya. Food Chem. Vol. 80:495-498.
Gόmez, A.H., Wang, J., Hu, G., and Pereira, A.G. 2007. Discrimination of storage shelf-
life for mandarin by electronic nose technique. LWT. Vol.40: 681–689
Hanluain, D. 2001. Moo tech fingerprints mad cows. Wired News, November 6, 2001.,1286,48005,00.html. Accessed on October 14th,
Hayes, B., Sonesson, A.K., and Gjerde, B. 2005. Evaluation of three strategies using
DNA markers for traceability in aquaculture species. Aquaculture. Vol.250:70– 81.
Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., and Francis, C.M. 2004. Identification of
birds through DNA barcodes. PLoS Biol. Vol.2:1657–1663.
Heist, EJ. and Gold, J.R. 1999. Genetic identification of sharks in the U.S. Atlantic large
coastal shark fishery. Fish Bull. Vol.97:53–61.
Hird, H.J., Hold, G.L., Chisholm. J., Reece, P., Russell, V.J., Brown, J., Goodier, R., and
MacArthur, R. 2005. Development of a method for the quantification of haddock
(Melanogrammus aeglefinus) in commercial products using real-time PCR. Eur Food
Res Technol. Vol.220:633–637
Hoeh, W.R., Blakley, K.H. and Brown, W.M. 1991. Heteroplasmy suggests limited
biparental inheritance of Mytilus mitochondrial DNA. Science. Vol.251(5000):1488-
Hofmann, G.E. and Place, S.P. 2007. Genomics-enabled research in marine ecology:
challenges, risks and pay-offs. Mar Ecol Prog Ser. Vol. 332: 249–255.
Hong, G.P. 1991. A Technology Analysis of the U.S. Atlantic Blue Crab (Callinectes
sapidus) Processing Industry. Ph.D. Dissertation, Virginia Institute of Technology
and State University.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 63

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Hsieh, Y.W., Hwang, P.A., Pan, H.H., Chen, J.B., and Hwang, D.F. 2003. Identification of
tetrodotoxin and fish species in an adulterated dried mullet roe implicated in food
poisoning. J Food Sci. Vol. 68(1): 142-146.
Hsieh, H.S., Chai, T.J., and Wang, D.F. 2005. Rapid PCR-RFLP method for the
identification of 5 billfish species. J Food Sci. Vol.70: 246-249.
Hwang, U.W. and Kim, W. 1999. General properties and phylogenetic utilities of nuclear
ribosomal DNA and mitochondrial DNA commonly used in molecular systematics.
Mini-Review. Korean J Parasit. Vol. 37 (4): 215-228.
Imai, H., Cheng, J.H., Hamasaki, K., and Numachi, K.I. 2004. Identification of four mud
crab species (genus Scylla) using ITS-1 and 16S rDNA markers. Aquat Living
Resour. Vol.17:31–34.
Invitrogen. 2007. Quant-iT™ PicoGreen ® dsDNA Reagent and Kits. Accessed on September 20th,
Irwin, D.M., Kocher, T.D., and Wilson, A.C. 1991. Evolution of the cytochrome b gene in
mammals. J Mol Evol. Vol.32: 128-144.
Johnson, S.C. and Browman, H.I. 2007. Introducing genomics, proteomics and
metabolomics in marine ecology: Introduction. Mar Ecol Prog Ser. Vol. 332: 249–
Kelly, J.F.D., Downey, G., and Fouratier, V. 2004. Initial study of honey adulteration by
sugar solutions using mid-infrared (MIR) spectroscopy and chemometrics. J Agric
Food Chem. Vol. 52:33-39.
Kleinsmith, L.J. and Kish, V.M. 1995. Principles of Cell and Molecular Biology. 2nd ed.
Harper Collins College Publ. pp. 1-810.
Klose, J. and Kobalz, U. 1995. Two-dimensional electrophoresis of proteins: an updated
protocol and implications for a functional analysis of the genome. Electrophoresis.
Vol.16: 1034-1059.
Konat, G., Gantt, G., Laszkiewicz, I., and Hogan, E.L. 1990. Rapid isolation of genomic
DNA from animal tissue. Exp Cell Res. Vol.190: 294-296.
Knoth, K., Roberds, S., Poteet, D., and Tamkun, M. 1988. Higly degenerate ionosine
containing primers specifically amplify rare cDNA using the polymerase chain
reaction. Nucleic Acids Res. Vol. 16(22):10932.
Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S., Paabom S., Villablanca, F.X.,
Wilson, A.C. 1989. Dynamics of mitochondrial DNA evolution in animals:
Amplification and sequencing with conserved primers. Proc Natl Acad Sci.
Križman, M., Jakše, J., Baričevič, D., Javornik, B., and Prošek, M. 2006. Robust CTAB-
activated charcoal protocol for plant DNA extraction. Acta Agric Slovenica.
Kvist, L. 2000. Phylogeny and phylogeography of European Parids. Thesis. University of
Oulu. Accessed on October
8th, 2007.
Lai, Y.W., Kemsley, E.K., and Wilson, R.H. 1995. Quantitative analysis of potential
adulterants of extra virgin oil using infrared spectroscopy. Food Chem. Vol. 53: 95-

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 64

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

La Berge, G.S., Shelton, R.J., and Danielson, P.B. 2003. Forensic utility of mitochondrial
DNA analysis based on Denaturing High-Performance Liquid Chromatography.
Forensic Sci. Vol.44 (3):281-288.
Lee, Y.C., Lee, B.J., Hwang, D.S., and Kang, H.S. 1996. Purification and characterization
of mitochondrial ribonuclease P from Aspergillus nidulans. Eur J Biochem.
Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, and Wittwer C. 2004.
Genotyping of single-nucleotide polymorphisms by high-resolution melting of small
amplicons. Clin Chem. Vol.50(7):1156-64.
Lin, W.F., Shiau, C.Y., and Hwang, D.F. 2005. Identification of four Thunnus tuna species
using mitochondrial cytochrome b gene sequence and PCR-RFLP Analysis. J Food
Drug Anal. Vol.13(4):382-387.
Loftus, R. and Laronde, P. 2005. Food control and legislation farm to fork traceability
through DNA technology.
farmtofork.htm. Accessed on September 26th, 2007.
Loftus, R. 2005. Traceability of biotech-derived animals: application of DNA technology.
Rev Sci Tech Off Int Epiz. Vol. 24(1): 231-242.
Lopez, I. and Pardo, M.A. 2006. Application of Relative Quantification TaqMan Real-
Time Polymerase Chain Reaction technology for the identification and quantification
of Thunnus alalunga and Thunnus albacares. J Agric Food Chem. Vol.53:4554-
López, J. 2007. Applications of proteomics in marine ecology. Mar Ecol Prog Ser. Vol.
332: 275–279.
Mackie, I., Craig, A., Etienne, M., Jerome, M., Fleurence, J., Jessen, F., Smelt, A., Kruijt
A., Yman, A.M., Ferm, M., Martinez, I., Perez-Martin, R., Pineiro, C., Rehbein, H.,
and Kundiger, R. 2000. Species identification of smoked and gravad fish products by
sodium dodecylsulphate polyacrylamide gel electrophoresis, urea isoelectric focusing
and native isoelectric focusing: A collaborative study. Food Chem. Vol.71:1–7.
Marko, P.B., Lee, S.C., Rice, A.M., Gramling, J.M., Fitzhenry, T.M., McAlister, J.S.,
Harper, G.R., and Moran, A.L. 2004. Mislabelling of a depleted reef fish. Nature.
Vol.430: 309-310.
Mamuris, Z., Stamatis, C., and Triantaphyllidis, C. 1999. Intraspecific genetic variation of
striped red mullet (Mullus surmuletus L.) in the Mediterranean Sea assessed by
allozyme and random amplified polymorphic DNA (RAPD) analysis. Heredity.
Martin, A. P. and Palumbi, S. R. 1993. Protein evolution in different cellular environments:
cytochrome b in sharks and mammals. Mol Biol Evol. Vol.10(4):873-891
Martinez, I., Optun, O.I., Overrein, I., Evjemo, J.O., Gribbestad, I., and Aursand, M. 2003.
Authentication and confirmation of product claims. Proceedings of the 1st Joint
Trans-Atlantic Fisheries Technology Conference. 10-14th June, 2003. Reykjavik,
Martinez, I., James, D., and Loréal, H. 2005. Application of modern analytical techniques
to ensure seafood safety and authenticity. Fish Tech Paper. Food and Agriculture
Organization of the United Nations (FAO). Rome. pp. 1-73.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 65

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Martinez, I, Slizyte, R., and Dauksas, E. 2007. High resolution two-dimensional

electrophoresis as a tool to differentiate wild from farmed cod (Gadus morhua) and
to assess the protein composition of klipfish. Food Chem. Vol.102:504–510.
Mattocks, C. 2007. Automated DNA extraction survey. National Reference Genetic
Laboratory (Wessex). Accessed on
November 9th, 2007.
McGrath, D., King, P.A. and Gosling, E.M. 1988. Evidence for the direct settlement of
Mytilus edulis larvae on adult mussel beds. Mar Ecol Prog Ser. Vol.47:103-106.
Mehta, S. and Keer, J.T. 2007. Performance characteristics of host-cell DNA quantification
methods. BioProcess Int. Vol.5(9):44-58.
Merente, F., Raha, S., and Ling, M. 1998. Isolation of total cellular DNA from tissue and
cultured cells. In Molecular Biomethods Handbook (Rapley, R. and Walker, J.M.
eds). Human Press Inc. New Jersey. pp. 9-16.
Meritt, T.J.S., Shi, L., Chase, M.C., Rex. M.A., Etter, R.J., and Quattro, J.M. 1998.
Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Mol
Mar Biol Biotechnol. Vol.7(1): 7–11.
Meyer, A. 1994. Shortcomings of the cytochrome b gene as a molecular marker. TREE.
Moretti, V.M., Turchini, G.M., Bellagamba, F., and Caprino, F. 2003. Traceability issues
in fishery and aquaculture products. Veterinar Res Comm. Vol.27(1):497–505.
NanoDrop. 2007. PicoGreen® Assay for dsDNA. Protocol for NanoDrop®ND-3-300
Necidová, L., Renčová, E., and Svoboda, I. 2002. Counter immuno-electrophoresis: a
simple method for the detection of species-specific muscle proteins in heat-processed
products. Vet Med Czech. Vol.47(5): 143–147
Nguyen, T.T.T., Murphy, N.P., and Austin, C.M. 2002. Amplification of multiple copies of
mitochondrial Cytochrome b gene fragments in the Australian freshwater crayfish,
Cherax destructor Clark (Parastacidae; Decapoda). Short Communications. Animal
Genetics. Vol.33(4):304-308.
Nielsen, M.L., Bennett, K.L., Larsen, B., Moniatte, M., and Mann. M. 2002. Peptide end
sequencing by orthogonal MALDI tandem mass spectrometry. J Proteome Res.
Vol.1: 63-71.
O’Farrell, P.H. 1975. High resolution two-dimensional electrophoresis of proteins. J Bio
Chem. Vol.250:4007–4021.
Pasquini, C. 2003. Near Infrared Spectroscopy: fundamental, practical aspect, and
analytical application. J Brazil Chem Soc. Vol.14(2):198-219.
Passarino, G., Cavalleri G.L., Lin, A.A., Cavali-Sforza, L.L., Borresen-Dale, A.L., and
Underhill P.A. 2002. Different genetic component in the Norwegian population
revealed by the analysis of mtDNA and Y chromosome polymorphism. Eur J Human
Gen. Vol.10:521-529.
Patterson, R.M. and Whittaker, R.G. 1984. Improved species identification of raw meat by
double sandwich enzyme linked immunosorbent assay. J Sci Food Agric.
Paul, J.H. and Myers, B. 1982. Fluorometric determination of DNA in aquatic
microorganisms by use of Hoechst 33258. Appl Env Microbiol. Vol.43(6):1393-

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 66

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Pineiro, C., Barros-Velasquez, J., Perez-Martin, R.I., Martinez, I., Jacobsen, T., Rehbein,
H., Kündiger, R., Mendes, R., Etienne, M., Jerome, M., Craig, A., Mackie, I.M., and
Jessen, F. 1999. Development of a SDS-PAGE reference method for the analysis and
identification of fish species in raw and heat-processed samples: A collaborative
study. Electrophoresis. Vol.20:1425–1432.
Pizzamiglio, M., Marino, A., Portera, G., My, D., Bellino, C., and Garofano, L. 2006.
Robotic DNA extraction system as a new way to process sweat traces rapidly and
efficiently. Int Congress Series. Vol.1288:598-600
Promega. 2002. Wizard genomic DNA purificarion kit. Technical Manual No.050.
Promega corporation, Madison,WI-USA. pp.1-15.
Qiagen. 2005. QuantiTect® SYBR® Green RT-PCR Handbook: For quantitative, real-
time, one-step RT-PCR. pp. 1-44. Accessed on September 4th,
Ram, J.L., Ram, M.L., and Baidoun, F.F. 1996. Authentication of canned tuna and bonito
by sequence and restriction site analysis of polymerase chain reaction products of
mitochondrial DNA. J Agric Food Chem. Vol.44:2460-2467.
Rapley, R. 1998. Polymerase chain reaction. In Molecular Biomethods Handbook (Rapley,
R. and Walker, J.M. eds). Human Press Inc. New Jersey. pp. 305-326.
Ratnasingham, S. and Hebert, P.D.N. 2007. BOLD: The Barcode of Life Data System. Mol
Ecol Notes. doi: 10.1111/j.1471-8286.2006.01678.x
Reddy, N.R., Flick, G.J., Argnosa, G.C., and Young, R.W. 1991. Composition and
pesticide and herbicide residue analysis of fresh and 40-year-old pasteurized blue
crab (Callinectes sapidus) meat. J Food Protect. Vol.54(4):298-301.
Rehbein, H. 1990. Electrophoretic techniques for species identification of fishery products.
Z Lebensm Unters Forsch. Vol.191:1-10.
Rehbein, H., Mackie, I.M., Pryde, S., Gonzales-Sotelo, C., Medinac, I., Perez-Martin, R.,
Quinteiro, J., Rey-Mendezd, M. 1997. Fish species identification in canned tuna by
PCR-SSCP: validation by a collaborative study and investigation of intra-species
variability of the DNA-patterns. Food Chem. Vol.64:263-268.
Rehbein, H., Mackie, I.M., Pryde, S., Gonzales-Sotelo, C., Medina, I., Perez-Martin, R.,
Quinteiro, J., and Rey-Mendez, M. 1999. Fish species identification in canned tuna
by PCR-SSCP: validation by a collaborative study and investigation of intra-species
variability of the DNA-patterns. Food Chem. Vol.64:263–268.
Regulation (EC) No.178/2002 of The European council on the establishing the European
Food Safety Authority and laying down procedures in matters of food safety. 28
January 2002. Off J Eur Comm. L 31/1.
Regulation (EC) No.1829/2003. Genetically modified food and feed.
eur-lex/pri/en/oj/dat/2003/l_268/l_26820031018en00010023.pdf. Accessed on July
14th, 2007.
Richardson, D.E., Vanwye, J.D., Exum, A.M., Cowen, R.K., and Crawford, D.L. 2006.
High-throughput species identification: from DNA isolation to bioinformatics. Mol
Ecol Notes. doi: 10.1111/j.1471-8286.2006.01620.x
Roche. 2005. High pure PCR product purification kit. Roche Diag. GmbH, Mannheim-
Germany. pp.1-17.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 67

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Roche. 2006. PCR application manual. 3rd ed. Eds: Degen, H.J, Deufel, A., Eisel, D.,
Grunewald-Janho, S., and Keesey, J. Roche Diag. GmbH, Mannheim-Germany.
Roche. 2007. LightCycler® 480: High Resolution Melting Master Version March 2007. Accessed on September 11st, 2007. 24pp.
Roe, A.D. and Sperling, F.A.H. 2007. Patterns of evolution of mitochondrial cytochrome c
oxidase I and II DNA and implications for DNA barcoding. Mol Phylogenetics Evol.
Vol. 44(1): 325-345.
Rychlik, W., Spencer, W.J., and Rhoads, R.E. 1990. Optimization of the annealing
temperature for DNA amplification in vitro. Nucleic Acids Res. Vol.18(21): 6409–
Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain-terminating
inhibitors. Proc Natl Acad Sci USA. Vol. 74(12):5463-5467.
Schander, C. and Halanych, K.M. 2003. DNA, PCR and formalinized animal tissue - a
short review and protocols. Org Divers Evol. Vol3:195-205.
Sevilla, R.G., Diez, A., Noren, M., Mouchel, O., Jerome, M., Verrez-Bagnis, V., Van Pelt,
H., Favre-Krey, L., Krey, G., Fishtrace, and Bautista, M. 2007. Primers and
polymerase chain reaction conditions for DNA barcoding teleost fish based on
mitochondrial cytochrome b and nuclear rhodopsin genes. Mol Ecol Notes.
Shoutern, E. 1975. Detection of specific sequences among DNA fragments separated by
gel electrophoresis. J Mol Biol. Vol.98:503-517.
Skibinski, D.O.F., Ahmad, M., and Beardmore, J.A. 1978. Genetic evidence for naturally
occurring hybrids between Mytilus edulis and Mytilus galloprovincialis. Evolution.
Vol.32(2): 354-364.
Smith, D.R. 1998. Gel electrophoresis. In Molecular Biomethods Handbook (Rapley, R.
and Walker, J.M. eds). Human Press Inc. New Jersey. pp. 17-34.
Smith, M.A., Fisher, B.L., and Hebert, P.D.N. 2005. DNA barcoding for effective
biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar.
Biol Sci. Vol.360: 1825–1834.
Spencer, C. 1998. DNA sequencing. In Molecular Biomethods Handbook (Rapley, R., and
Walker, J.M., eds). Human Press Inc. New Jersey. pp. 90-95.
Snyder, M., Fraser, A.R., La Roche, J., Gartner-Kepkay, K.E., and Zouros, E. 1987.
Atypical mitochondrial DNA from the deep-sea scallop Placopecten magellanicus.
Proc Nati Acad Sci. USA. Vol. 84:7595-7599.
Suvanich, V., Marshall, D.L., Jahncke, M.L. 2000. Microbiological and color quality
changes of channel catfish frame mince during chilled and frozen storage. J Food Sci.
Schwagele, F. 2005. Traceability from a European perspective. Meat Sci. Vol.71:164–173.
Sweeting, C.J., Barry, J., Barnes, C., Polunin, N.V.C., Jennings, S. 2007. Effects of body
size and environment on diet-tissue δ15N fractionation in fishes. J Exp Marine Biol
Ecol. Vol.340(1):1-10.
Tay, A., Singh, R.K., Krishnan, S.S., and Gore, J.P. 2002. Authentication of olive oil
adulterated with vegetable oils using Fourier Transform Infrared spectroscopy,
Lebens.- Wiss Technol. Vol.35:99-103.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 68

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Tel-Zur, N., Abbo, S., Myslabodski, D., and Mizrahi, Y. 1999. Modified CTAB Procedure
for DNA Isolation from Epiphytic Cacti of the Genera Hylocereus and Selenicereus
(Cactaceae). Plant Mol Biol Reporter. Vol.17: 249–254.
Thompson, M., Sylvia, G., and Morrissey, M.T. 2005. Seafood traceability in the United
States: current trends, system design, and potential applications. Compreh Rev Food
Sci Food Safety. Vol.1:1-6.
Tillmann, M.A.A. and West, S. 2004. Identification of genetically modified soybean seeds
resistant to glyphosate. Sci Agric. (Piracicaba, Braz.). Vol.61 (3):336-341.
Trotta, M., Schonhuth, S., Pepe, T., Cortesi, M.L., Puyet, A., and Bautista, J.M. 2005.
Multiplex PCR method for use in Real-Time PCR for identification of fish fillets
from grouper (Epinephelus and Mycteroperca species) and common substitute
species. J Agric Food Chem. Vol. 53: 2039-2045.
Tsai, D.E., Chen, H.C., and Tsai, C.F. 1984. Total lipid and cholesterol content in the blue
crab, Callinectes sapidus. Compar Biochem Physiol. Vol.78B(1): 27-31.
Tureli, C., Celik, M., and Erdem, U. 2000. Comparison of meat composition and yield of
blue crab (Callinectes sapidus) and sand crab (Portunus pelagicus) caught in
Iskenderun Bay, North-East Mediterranean. Turkish J Veter Animal Sci. Vol. 24:195-
Unseld, M., Beyermann, B., Brandt, P., and Hiesel, R. 1995. Identification of the species
origin of highly processed meat products by mitochondrial DNA sequences. PCR
Meth Applic. Vol.4: 241-243.
Wasko, A.P., Martins, C., Oliveira, C., and Foresti, F. 2003. Non-destructive genetic
sampling in fish. An improved method for DNA extraction from fish fins and scales.
Hereditas. Vol.138: 161–165.
Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R., Hebert, P.D.N. 2005. DNA barcoding
Australia’s fish species. Biol Sci. Vol.360: 1847–1857.
Watanabe, S., Minegishi, Y., Yoshinaga, T., Aoyama, J., and Tsukamoto, K. 2004. A quick
method for species identification of Japanese eel (Anguilla japonica) using Real-
Time PCR: An onboard application for use during sampling surveys. Mar Biotechnol.
Watson, J.D. and Berry, A. 2003. DNA: The secret of life. Alfred a Knopf. New York. pp.
Weber, K. and Osborn, M. 1969. The reliability of molecular weight determinations by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J Biol Chem. Vol.244:
Weder, J.K.P. 2002. Species Identification of beans, peas and other legumes by RAPD-
PCR after DNA isolation using membrane columns. Lebensm-Wiss u-Technol.
Wilkins, M.R., Ou, K., Appel, R.D., Sanchez, J.C., Yan, J.X., Golaz, O., Farnsworth, V.,
Cartier, P., Hochstrasser, D.F., Williams, K.L., and Gooley, A.A . 1996. Rapid
protein identification using N-Terminal “Sequence Tag” and amino acid analysis.
Biochem Biophysic Res Com. Vol.221(3):609-613.
Wilson, A.C., Cann, R.L., Carr, S.M., George, M., Gyllensten, U.B., Helm-Bychowski,
K.M., Higuchi, R.G., Palumbi, S.R., Prager, E.M., Sage, R.D., and Stoneking, M.
1985. Mitochondrial DNA and two perspectives on evolutionary genetics. Biol J Linn
Soc. Vol.26: 375-400.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 69

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

Wolf, C., Burgener, M., Hubner, P., and Luthy, J. 2000. PCR-RFLP Analysis of
Mitochondrial DNA: Differentiation of fish species. Lebensm-Wiss u-Technol.
Xie, J. 2003. Establishment of a two-dimensional electrophoresis map of human
mitochondrial proteins. Dissertation. Universität Berlin.
dissertationen/xie-jing-2003-12-15/HTML/front.html#front. Accessed on September
21st, 2007.
Zeviani, M., Tiramti, V., and Piantadosi, C. 1998. Mitochondrial disorders. Medicine.
Vol.77: 59-72.
Zhu, Q.Z., Li, F., Guo, S.Q., Xu, J.G., and Li, W.Y. 1997. Application of a novel
fluorescence probe in the determination of nucleic acids. Analyst. Vol.122: 937–940.

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 70

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

AFLP: Amplified Fragment Length Polymorphism
ATP: Adenosine Triphosphate
BLAST: Basic Local Alignment Search Tool
BOLD: Barcode of Life Data System
COI: Cytochrome oxidase Sub Unit I
CTAB: Cetyltrimethyl Ammonium Bromide
Cyt b: Cytochrome b
ddNTP’s: Dideoxynucleotides
DGGE: Denaturing Gradient Gel Electrophoresis
ELISA: Enzyme-Linked ImmunoSorbent Assay
EMBL: European Molecular Biology Laboratory
FADH2 : Reduced Flavin-Adenine-Dinucleotide
FISH-BOL: Fish Barcode of Life Initiative
GE: Gel Electrophoresis
IEF: Isoelectric Focusing
MALDI-TOF-MS: Matrix Assisted Laser Desorption/Ionization–Time of Flight–Mass
NCBI: National Center for Biotechnology Information
mtDNA: Mitochondrial DNA
NADH: Reduced Nicotinamide-Adenine-Dinucleotide
nDNA: Nuclear DNA
NMR: Nuclear Magnetic Resonance
PCR: Polymerase Chain Reaction
PFGE: Pulse-Field Gel Electrophoresis
RAPD: Random Amplified Polymorphic DNA
RFID: Radio Frequency Identification
RFLP: Restriction Fragment Length Polymorphism
RT-PCR: Real Time Polymerase Chain Reaction
SDS-PAGE: Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
SSCP: Single Strand Conformation Polymorphism
TGGE: Temperature Gradient Gel Electrophoresis

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 71

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene


EMBL (EMBL-bank):
NCBI (GenBank):

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 72

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

APPENDIX I. List of samples used in this study

1. Thunnus sp 2. Eutrigla gurnardus

3. Gadus morhua 4. Trisopterus luscus

5. Solea solea 6. Microstomus kitt 7. Raja clavata 8. Malacoraja senta

9. Ammodytes tobianus

10. Hyperoplus lanceolatus 11. Unknown smelts

P. monodon M. rosenbergii

13. Illex argentinus

P. latisulcatus C. crangon
12. Crustaceans

M. edulis Mussel-T1 Mussel-120 Mussel-2251

14. Perna canalicullus 15. Sea mussels

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 70

The optimization & validation of a PCR protocol for fish & seafood authenticity based on the cyt b gene

APPENDIX II. List of chemicals, solutions, and equipment

Table II-A. List of chemicals and reagents

Chemical Company Ordering number
Ethanol p.a. Merck 8.18760.2500
EDTA-Na2 dihydrate BDH 443885J
Tris Base Promega A5135
Nuclei Lysis Solution Promega A7943
Proteinase K recombinant PCR Roche 3115879
RNAase Roche 10109169001
Protein Precipitation Solution Promega A7953
Isopropanol p.a. Serva 39559.02
NaOH p.a. BDH 102525P
HCl 37% Merck 1.00317.2501
PCR-H2O18.2 MΩ cm Sartorius Arium

Table II-B. List of solutions

93g EDTA-Na2 dihydrate (Mw: 372.2)
Add 350ml PCR-H2O, add 10N NaOH until pH 8.0
EDTA 0.5M pH 8.0
Add PCR-H2O until 500ml and sterilize for 20 minute at 121°C
(1 bar)
Add 40g NaOH with 100ml PCR-H2O 500ml and sterilize for
NaOH 10N 20 minute at 121°C (1 bar)
30.29g Tris Base (MM: 121.14) with 150ml PCR-H2O in a
Tris-HCl 1M, pH 7.4 250ml volumetric flask. Add HCl 37% until pH 7.4, add with
H2O until 250ml and sterilize for 20 minute at 121°C (1 bar)
TE-buffer 1X Mix 10ml Tris-HCl 1M, pH 7.4 and 2ml EDTA 0.5M, pH 8.0
10mM Tris-HCl, pH 7.4 then add with PCR-H2O until 1 lt. Sterilize for 20 minute at
1mM EDTA, pH 8.0 121°C (1 bar).
Weigh 100mg RNase A in 25ml PCR-H2O in a 25 ml
RNAse Solution 4mg/ml volumetric flask
Weigh 20mg Proteinase K in a 1.5ml microcentrifuge tube.
Proteinase K solution 20 mg/ml Add 1 ml sterilized PCR water and vortex
10 mM Tris HCl pH 7.5, 125mM NaCl, 10mM EDTA, 0.5 or
TNES buffer with 0.5 or 1% SDS
1% SDS
Urea 4 or 6 M 48.05 or 72.08g in 200ml TNES buffer

Table II-C. List of equipment

Equipment Specification Company
Plastic tubes 1.5-2.5 ml ROTH
Micro centrifuge Sigma 1-14 Sigma
Filter/fin tip 10 – 1,000 μl Molecular BioProducts
Analytical balance - Sartorius, Mettler
Water bath 20-110ºC Memmert
Vortex Mini vortexer-TM1 Techmatic

Dwiyitno – MSc Thesis in Food Science, Technology & Nutrition (SefotechNUT) 71