Anda di halaman 1dari 12

MADRID / JUNIO 09. LOGSE / BIOLOGIA / GENETICA / OPCIN B / ACTIVIDAD 4 OPCIN B 3.

- Referente a la expresin del material hereditario: a) Represente mediante un esquema rotulado El Dogma Central de la Biologa Molecular actualizado (0,5 puntos). b) Explique brevemente las tres etapas del proceso de la transcripcin en procariontes (0,75 puntos). c) El siguiente esquema representa un ARN transcrito primario procedente de un fragmento de un gen, correspondiente a una clula eucariota. 5Exn Intrn Exn Intrn 3 Explique brevemente el proceso de maduracin de este ARN transcrito primario hasta obtener su ARNm maduro (0,75 puntos). a)

b) Iniciacin El ADN posee en distintos lugares los llamados centros promotores cuyo funcin es indicar cmo se inicia la transcripcin y en cul de las dos hebras. Estn constituidos por determinadas secuencias de bases (TATA). La ARN polimerasa reconoce el centro promotor se une a l y hace que la doble hlice de ADN se abra para permitir que quede expuesta la secuencia de bases del ADN molde que va a ser transcrita. Elongacin Es la adicin de los sucesivos ribonucletidos para formar el ARN. La ARN-polimerasa lee la cadena de ADN en sentido 3 5 mientras que el sentido de sntesis del ARN es 5 3. Se van aadiendo nucletidos uno a uno en el extremo 3de la cadena en crecimiento. Es decir la enzima selecciona el ribonucletido trifosfato cuya base es complementaria con la de la cadena de ADN molde, y lo une mediante enlace ester al OH situado en posicin 3de la cadena en crecimiento desprendindose un grupo pirofosfato (PPi) . En eucariontes tras la unin de los 30 primeros ribonucletidos se aade en el extremo 5 una caperuza formada por metil-guanosil-fosfato, que protege este extremo del ataque de las nucleasas, y en la traduccin ser una seal de reconocimiento de iniciacin de la lectura.

Terminacin Existen seales de terminacin que indican el fin de la transcripcin. Esto implica el cierre de la burbuja formada en el ADN y la separacin de la ARN-polimerasa, y del ARN transcrito. En procariontes la seal de terminacin es una secuencia palindrmica (tiene la misma lectura de izquierda a derecha y de derecha a izquierda) formada por G y C seguidas de varias T que origina al final del ARN un bucle u horquilla por autocomplementariedad de las bases G y C. Esto favorece su separacin del ADN. c) A veces los ARNm transcritos no se pueden traducir directamente sino que requieren un proceso previo de procesamiento o maduracin postranscripcional.. En eucariontes cada gen consta de varios fragmentos denominados intrones y exones intercalados unos con otros. Los intrones son secuencias de bases ms o menos largas que se transcriben pero que no se traducen, es decir, no codifican una secuencia de aa. Los exones son secuencias que se transcriben y se traducen, es decir, tienen informacin para formar una cadena polipeptdica. El transcrito primario est formado por intrones y exones. Su maduracin consiste en eliminar los intrones y unir los exones mediante un mecanismo que se denominaempalme o splicing. El empalme requiere la enzima ribonucleoprotena pequea nuclear RNPpn. - Comienza cuando las secuencias intrnicas forman unos bucles que provocan el acercamientode los extremos de los exones. - A continuacin se cortan los intrones - Se unen los exones En este momento el ARNm est preparado para salir del ncleo. Los intrones no existen en procariontes y no se sabe el papel que cumplen en eucariontes. Si se sabe que un mismo gen puede madurar de diferentes maneras dependiendo de cmo se eliminen los intrones MADRID / JUNIO 09. LOGSE / BIOLOGIA / GENETICA / OPCIN B / ACTIVIDAD 3 OPCIN B 3.- Con referencia a distintos procesos biolgicos: a) Para replicarse en clulas eucariticas, un virus de ARN monocatenario (similar al del VIH) debe integrarse en el genoma de la clula husped, que es ADN bicatenario. Explique las distintas etapas del proceso de replicacin (1,5 puntos). b) Si en otro Planeta hubiera un ADN constituido por 6 nucletidos distintos, existieran 216 aminocidos esenciales y el cdigo gentico estuviera constituido por tripletes, sera posible que existiera un mecanismo de traduccin igual al de la Tierra? Razone la respuesta (0,5 puntos).

a)Las fases de la replicacin son; iniciacin, elongacin y terminacin 1. Iniciacin: Consiste en el desenrrollamiento y apertura de la doble hlice. Comienza en una regin del ADN llamada punto de iniciacin donde abundan las secuencias de bases GATC. El punto de iniciacin es reconocido por protenas especficas que se unen a l. Enzimas helicasas rompen los enlaces de hidrgeno que unen bases complementarias, abriendo la doble hlice. Cuando la doble hlice se abre se produce desenrrollamiento en esa zona, lo que provoca superenrrollamientos en las zonas vecinas. Las enzimas girasas y topoisomerasas evita esas tensiones. Despus las protenas de unin a cadena simple (SSB) se unen a las hebras individuales e impiden que se vuelvan a enrollar. Alrededor del origen de replicacin se ha formado una burbuja de replicacin o replicn en la que hay 2 zonas con forma de Y, denominadas horquillas de replicacin, donde se van a sintetizar las nuevas hebras de ADN. La burbuja de replicacin se va extendiendo a lo largo del cromosoma en los dos sentidos, por este motivo la replicacin es bidireccional 2. Elongacin Es la fase en la que se sintetiza una nueva hebra de ADN sobre cada hebra (molde) de la doble hlice original. Adems de las enzimas que participan en la iniciacin en la elongacin intervienen ADN polimerasas. Hay varios tipos que se nombran I, II y III. Sus funciones son: - Actividad polimerasa: Reconocen la hebra molde, seleccionan el desoxirribonucletido cuya base es complementaria con la de la hebra molde, y lo unen. Las nuevas cadenas se sintetizan por unin de nucletidos trifosfato, la energa para el enlace se obtiene de la hidrlisis de los dos grupos fosfato del nucletido entrante. - Actividad exonucleasa: elimina nucletidos cuyas bases estn mal apareadas, asi como fragmentos de ARN. Las ADN polimerasas no pueden iniciar de cero la sntesis de la nueva cadena; necesitan un fragmento de 10 nucletidos de ARN denominado cebador o primer con el extremo 3 libre al que aadir los nuevos nucletidos. El cebador se sintetiza por una enzima ARN polimerasa denominada primasa. La ADN polimerasa recorre las hebras molde en sentido 3 5 y va uniendo los nuevos nucletidos en el extremo 3(sentido de la hebra en formacin 5 3). Como la replicacin slo ocurre en un sentido y las 2 cadenas de ADN son antiparalelas, se planteaba cmo se efectuara la replicacin en los dos brazos de la horquilla. La solucin la aport Okazaki al encontrar que una cadena, la que se sintetiza en sentido 5 3, lo hace de forma continua como una sola unidad. A esta hebra se le denomina conductora o lider. Mientras que la otra (3 5) se forma de manera discontinua como una serie de fragmentos sintetizados cada uno en el sentido 5 3 que despus se unen formando la cadena retardada o retrasada. Cada uno de los fragmentos requiere un cebador de ARN sintetizado por la primasa cada ciertos intervalos. La ADN polimerasa va eliminando el cebador y

sustituyndolo por ADN. Por ltimo una ADN ligasa une los fragmentos obtenidos. 3. Terminacin Cuando se llega a la secuencia de terminacin o TerC las nuevas dobles hlices terminan de formarse y se separan b) En el cdigo gentico humano tenemos 4

nucletidos y 20 aa; las 4 nucletidos forman tripletes y por tanto son 64 tripletes distintos, correspondiendo varios tripletes a cada aa a excepcin de la metionina. En el supuesto planeta tiene 6 nucletidos y 216 aa. Si los nucletido se agrupan en tripletes serrn 63 es decir 216. Por tanto a cada aa le correspondera un triplete , pero no habra triplete de terminacin o stop. Por tanto la traduccin NO sera como en la tierra porque a cada aa slo le correspondera un triplete y No habria tripletes de terminacin. MADRID / SEPTIEMBRE 07. LOGSE / BIOLOGIA / GENETICA / OPCIN A / ACTIVIDAD 4 OPCIN A 4.- Referente a la expresin de la informacin hereditaria: a) Defina el proceso de transcripcin e indique las etapas del mismo (0,5 puntos). b) Cite el nombre de la enzima implicada en este proceso. Cmo se denominan las secuencias del ADN donde se une esta enzima para el comienzo de la transcripcin? (0,5 puntos). c) Asocie a los procesos de transcripcin y traduccin los siguientes trminos: ARNm/ ARNt/ ARN polimerasa/ribosoma/codn/ aminocido/sitioP/ anticodn/ procesamiento o maduracin/sitio A/intrn (1punto). a) Como el ADN se encuentra en el ncleo y las protenas se sintetizan en el citoplasma, result evidente que tena que existir un intermediario entre los genes del ncleo y los ribosomas donde se sintetizan las protenas. El intermediario es el ARNm que transporta la informacin de los genes a las protenas. Para esto es necesario que se sintetice ARNm a partir de un molde de ADN. La trascripcin es la sntesis de ARNm a partir de un molde de ADN. Las estapas son: iniciacin, elongacin, terminacin y maduracin (slo en clulas eucaritotas)

b)Hay varias ,tomoisomerasas, helicasas, pero la mas importante es la ARN polimerasa- La ARN polimerasa se une a un centro promotor que cuya funcin es indicar cmo se inicia la transcripcin y en cul de las dos hebras. Estn constituidos por determinadas secuencias de bases (TATA). c)ARNm: Es una copia complementaria de una porcin de una cadena de ADN que servir de pauta para la sntesis de una protena. Asociado a la transpcin ARNt: acta como transportador de aa hasta los ribosomas, durante la sntesis protica. Asociado a la traduccin ARNpolimerasa: Enzima que cataliza la sntesis de ARN- Asociado a la transcripcin Ribosoma: Orgnulo citoplastico asociado a la traduccin Codn: Triplete de nucletidos en el ARNm que tiene en correspondiente con un aa segn el codigo gentico- Asociado a la traduccin Aminocido: monmero constituyente de las protenas. Asociado a la traduccin Sitio P: Lugar en el ribosoma donde se localiza el ARNt que lleva el polipptido en formacin. Asociado a la traduccin Anitcodon: Triplete de nucleotidos en el ARNt que es complementario del codon de ARNm. Asociado a la traduccin Procesamiento o madurcacin: ltima fase de la ranscripcin en clulas eucariotas. Asociado a la transcripcin Sitio A: Lugar en el ribosoma donde se una el ARNt que lleva asociado un aa que se va a unir a la cadena polipeptdica en formacin. Asociado a la traduccin Intrn: Fragmento de nucletidos en el ARNm de clulas eucariotas que no va a ser traducido a aa y por tanto es eliminado en el proceso de maduracin del ARNm durante la transcripcin MADRID / SEPTIEMBRE 05. LOGSE / BIOLOGIA / GENETICA / OPCIN A / ACTIVIDAD 4 OPCIN A 4. Referente al cdigo gentico y mutacin: A partir de la siguiente secuencia de bases de un fragmento de un gen 5 TAT ATA CAA TTT 3 3 ATA TAT GTT AAA 5 a) Indique cul ser la secuencia de ARNm correspondiente a la cadena inferior de este fragmento, indicando su polaridad (0,5 puntos). b) Ayudndose de la tabla del cdigo gentico escriba la secuencia de aminocidos del polipptido codificado por ese fragmento de gen indicando los extremo carboxilo y amino (0,5 puntos). c) Si en el ADN se produjese una sustitucin del par C-G por el par TA, indique como se altera el ARNm y la cadena polipeptdica (0,5 puntos) d) Explique qu significa que el cdigo gentico es degenerado (0,5 puntos).

RESPUESTA: a) La transcripcin es la primera fase de la sntesis proteica. El proceso consiste en la sntesis de un ARNm, tomando como molde una de las dos cadenas del ADN y est catalizado por las ARN-polimerasas. Estas enzimas se desplazan a lo largo de la cadena de ADN leyndola en sentido 3-5, mientras que el sentido de sntesis del ARN es 5-3. Para poder averiguar la secuencia del ARNm transcrito a partir de la secuencia de ADN indicada en la figura hay que tener en cuenta: 1. La ley de complementaridad de bases. 2. El sentido de sntesis de las ARN polimerasas. 3. La timina es exclusiva del ADN y el uracilo del ARN. Por lo tanto, la secuencia del ARNm transcrita a partir de la secuencia de ADN de la figura ser la siguiente: ADN 5 TAT ATA CAA TTT 3 3 ATA TAT GTT AAA 5 ARNm 5 UAU AUA CAA UUU 3 b) La traduccin es la segunda fase del proceso de sntesis proteica. En esta etapa se traduce en protenas la informacin gentica transferida desde el ADN al ARNm durante la transcripcin. Los aminocidos dispersos en el citoplasma deben unirse para formar los polipptidos segn una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm. Para poder averiguar la secuencia de aminocidos a partir de la secuencia de ARNm transcrito de la figura hay que tener en cuenta: - el cdigo gentico, - la translocacin del ribosoma para la lectura del ARNm implica el desplazamiento del ribosoma a lo largo del ARNm en sentido 53, - el grupo carboxilo del aminocido iniciador se une al grupo amino del segundo aminocido y, por tanto, el primer aminocido presenta el grupo amino libre y el ltimo el grupo carboxilo como terminal. ARNm 5 UAU AUA CAA UUU 3 Secuencia de NH3- Tir - Ile Gln Fen COOH Aminocidos

c) Un gen es un segmento de ADN con la informacin necesaria para la sntesis de una cadena polipeptdica. La secuencia de nucletidos de ese gen es especfica para cada cadena polipeptdica. Cualquier cambio en la secuencia de nucletidos de un gen conduce a alteraciones o cambios en la molcula que codifica. Las mutaciones moleculares, tambin denominadas puntuales, son las que afectan a la secuencia de nucletidos. La sustitucin del par G-C por el par A-T dara lugar a la formacin del codn AAA que codifica para el lisina. La secuencia polipptidica cambia siendo la siguiente: NH3- Tir - Ile Lys Fen COOH d) El cdigo gentico es degenerado, es decir, al estar compuesto por 64 codones, varios tripletes codifican para un mismo aminocido. Casi todos ellos tienen en comn los dos primeros nucletidos, ofreciendo la variabilidad en el tercero. MADRID / SEPTIEMBRE 04. LOGSE / BIOLOGA / GENTICA / OPCIN A / CUESTIN 4 OPCIN A 4. En relacin con la informacin gentica y sus alteraciones: a) Si un polipptido tiene 450 aminocidos, indique cuntos ribonucletidos tendr el fragmento del ARNm que codifica esos aminocidos. Razone la respuesta (0,5 puntos). b) 5 GUU-UCC-GCA-UGG3 , son cuatro codones de una molcula de ARNm. c) Suponga que un fragmento de ADN que codifica un polipptido se reproduce una mutacin puntual que afecta a un par de bases. Debido a ello, cuando la clula sintetice de nuevo el polipptido, a ste le podra haber ocurrido uno de los cuatro hechos siguientes: 1. Que se codifique el mismo aminocido que el sintetizado antes de la mutacin. 2. La sustitucin de un aminocido por otro distinto. 3. Que el nuevo polipptido sintetizado sea ms corto. 4. Que el nuevo polipptido sintetizado sea ms largo. Basndose en sus conocimientos del cdigo gentico, explique el por qu cada uno de estos resultados. (1puntos). Solucin: a) Un codn es cada grupo de tres nucletidos del ARN mensajero que codifica para una aminocido y, durante, la traduccin, se corresponde con un anticodn del ARN transferente poseedor de tres nucletidos cuyas bases nitrogenadas son complementarias del codn. Por tanto, su un polipptido tiene 450 aminocidos, el fragmento de ARN que lo codifica poseer 450 x 3 = 1350 ribonuclotidos. b) Efectivamente puesto que el uracilo es exclusivo del ARN.

c) Caso 1. Como el cdigo gentico es degenerado, el triplete puede sustituirse por otro que codifique el mismo aminocido, de modo que la mutacin no afectara al enzima y sera una mutacin silenciosa o nula. Caso 2: El triplete originado por mutacin codifica otro aminocido. Caso 3: La mutacin puntual origina un triplete de terminacin de modo que el gen codificar un polipptido ms corto. Caso 4: La mutacin afecta al triplete de terminacin codificando otro aminocido. MADRID / SEPTIEMBRE 03. LOGSE / BIOLOGA / GENTICA / OPCIN A / N 4 OPCIN A 4. En relacin con la expresin gnica: a) Explique en que consiste el proceso de traduccin y cite en qu estructuras de la clula se produce. (0,5 puntos) b) Indique el papel que desempean en este proceso los sitios A y P del ribosoma y la enzima aminoacilARNt-sintetasa. (0,75 puntos) c) Indique como se denomina el triplete de bases que en el ARNm codifica para una aminocido especfico, cmo se denomina el triplete de bases complementarias en el ARNt e indique cul sera el triplete de bases del ARNt si su complementario para el aminocido valina en el ARNm es GUA. (0,75 puntos) Solucin: a) La traduccin es la segunda fase del proceso de sntesis proteica, tiene lugar en el citoplasma celular, donde se encuentran los ribosomas. En esta etapa se traduce en protenas la informacin gentica transferida desde el ADN al ARNm durante la transcripcin. Los aminocidos dispersos en el citoplasma deben unirse para formar los polipptidos segn una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm. b y c) La activacin de los aminocidos en una fase previa a la traduccin que se lleva a cabo en presencia de la enzima aminoacil-ARNt-sintetasa y de ATP y consiste en la unin de el ARNt y su aminocido especfico dando lugar a un aminoacil-ARNt liberndose AMP, Ppi y quedando libre la enzima, que vuelve a actuar. La unin del aminocido al ARNt se produce en el extremo de la cadena de ste donde estn los tres nucletidos fijos (adenina, guanina, citosina). La iniciacin es la primera etapa de la traduccin y en ella el ARNm se une a la subunidad menor de los ribosomas. A stos se asocia el aminoacil-ARNt gracias a que el lazo de ARNt opuesto al punto de fijacin del aminocido (lazo anticodn) posee tres bases, denominadas anticodn, complementarias de un triplete o codn del ARNm. A este grupo de molculas de une la subunidad ribosmica mayor, formndose el complejo de iniciacin. Este complejo ribosomal posee dos sitios de unin. El centro denominado peptidil (P), donde

se sita el primer aminoacil- ARNt, y el centro aminoacil (A) o aceptor de nuevos aminoacil-ARNt. Por ltimo, si el codn del ARNm para valina es GUA, el anticodn presente en el ARNt especfico para este aminocidos ser CAU. MADRID / SEPTIEMBRE 00. LOGSE / BIOLOGIA / GENETICA / OPCION A / EJERCICIO 4 OPCION A 4. La siguiente secuencia nucleotdica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: 3 TACAATTCCCGGGCAACACAC 5 a) Escriba la secuencia de bases del ARN mensajero que se puede sintetizar e indique su polaridad (0,5 puntos). b) Cul es el nmero mximo de aminocidos que puede codificar este fragmento (0,5 puntos). c) Qu caractersticas del cdigo gentico ha utilizado para determinar el nmero de aminocidos? (0,5 puntos). d) Si se detectara una variante de la cepa que produjera un polipptido de cinco aminocidos, cmo pudo producirse la variante? (0,5 puntos). Solucin: a) La transcripcin: es la primera fase de la sntesis proteica. El proceso consiste en la sntesis de un ARNm, tomando como molde una de las dos cadenas del ADN y est catalizado por las ARN-polimerasas. Estas enzimas se desplazan a lo largo de la cadena de ADN leyndola en sentido 3-5, mientras que el sentido de sntesis del ARN es 5-3. Para poder averiguar la secuencia de las dos hebras de ADN del que proviene el ARN de la figura hay que tener en cuenta: 1. La ley de complementaridad de bases. 2. El sentido de sntesis de las ARN polimerasas. 3. La timina es exclusiva del ADN y el uracilo del ARN. Por lo tanto, la secuencia del ARNm transcrita a partir de la secuencia de ADN de la figura ser la siguiente: ADN 3 TACAATTCCCGGGCAACACAC 5 ARNm 5 AUGUUAAGGGCCCGUUGUGUG 3 b y c) La clave gentica establece la relacin que hay entre la secuencia de nucletidos de los genes y la secuencia de aminocidos de las protenas, es decir, la relacin existente entre la estructura primaria de ambos tipos de biomolculas. Para descifrar el cdigo gentico se utiliz como hiptesis de trabajo que tres bases (un codn) codificaban un aminocido, ya que el nmero de secuencias posibles formadas por tres nucletidos es 43 = 64, nmero ms que suficiente para codificar los 20 aminocidos proteicos. Si los codones se formasen con dos letras, el nmero de secuencias posibles sera 4 2= 16 y, por tanto, no sera un nmero suficiente para codificar los 20 aminocidos. Adems hay que tener en cuenta una caracterstica general del cdigo gentico que consiste en que la lectura es sin comas o sin solapamiento.

Partiendo de lo anteriormente expuesto, el nmero mximo de aminocidos que puede codificar el fragmento del enunciado es 7. 5 AU G/UUA/AGG/GCC/CGU/UGU/GUG 3 d) Un gen es un segmento de ADN con la informacin necesaria para la sntesis de una cadena polipeptdica. La secuencia de nucletidos de ese gen es especfica para cada cadena polipeptdica. Cualquier cambio en la secuencia de nucletidos de un gen conduce a alteraciones o cambios en la molcula que codifica. Las mutaciones moleculares, tambin denominadas puntuales, son las que afectan a la secuencia de nucletidos. Las mutaciones puntuales pueden producirse por: a) Sustitucin de nucletidos o bases: es decir, por ejemplo, donde exista un nucletido de adenina, se instala uno de timina. b) Prdida de nucletidos. c) Insercin de nuevos nucletidos. Por ejemplo, en el caso de una mutacin por sustitucin de bases al slo afectar a uno de los nucletidos, es un nico triplete el que se ve afectado. Como el cdigo gentico es degenerado, el triplete puede sustituirse por otro que codifique el mismo aminocido, de modo que la mutacin no afectara al enzima y sera una mutacin silenciosa o nula. Sin embargo, si se detectase una variante de la cepa que produjese un polipptido de cinco aminocidos se debera a que la mutacin puntual dara lugar a un codn de terminacin.. MADRID / SEPTIEMBRE 99. LOGSE / BIOLOGA / GENTICA / OPCIN A / N 3 3.- La transcripcin y la traduccin son procesos fundamentales en la clula eucariota. a) Defina y distinga entre ambos procesos e indique en qu parte de la clula se produce cada uno de ellos (1 punto). b) Nombre los tipos de ARN que intervienen en la traduccin e indique la funcin de cada uno de ellos. (1 punto). Solucin: a) La transcripcin: es la primera fase de la sntesis proteica o expresin del material gentico. El proceso consiste en la sntesis de ARN, tomando como molde una de las dos cadenas del ADN. El proceso est catalizado por el enzima ARN-polimerasa-ADN dependiente o transcriptasa, y se inicia con la desespiralizacin parcial de la doble hebra de ADN que se va a transcribir. La trancripcin en eucariotas tiene lugar en el ncleo celular. En procariotas, al no exisitir ncleo, sta fase tiene lugar en el citoplasma donde se encuentra ubicado el nucleoide o material gentico. La traduccin: es la segunda sfase del proceso de sntesis proteica. En esta etapa se traduce en protenas la informacin gentica transferida desde el ADN al ARNm durante la transcripcin. Los aminocidos dispersos en el citoplasma deben unirse para formar los polipptidos segn una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm.

La traduccin en eucariotas tiene lugar en el citoplasma celular y en el retculo endoplsmico rugoso: El ARNm procedente del ncleo abandona ste a travs de los poros nucleares, dirigindose a los ribosomas. En procariotas, transcripcin y traduccin son procesos simultneos. b) El ARN es uno de los dos tipos de cidos nucleicos que existen. Est formado por una sla cadena de nucletidos. En las clulas eucariotas se encuentra en el citoplasma y en orgnulos como las mitocondrias, cloroplastos y ribosomas. Se han descrito tres tipos de ARN con caractersticas estructurales y funcionales que les distinguen, pero todos tienen en comn que proceden del ADN (por un proceso de sntesis denominado transcripcin) y de modo general, todos participan en el proceso de sntesis proteica dirigido por el ADN. Los tres tipos son: - ARN ribosmico (ARNr): Es de elevado peso molecular, se encuentra asociado a las protenas en los ribosomas de cuya masa constitye hasta el 60 %. Su funcin durante la biosntesis de protenas consiste en crear, junto a los protenas ribosmicas, el ambiente molecular adecuado para que se instale el ARNm y los aminocidos que participan en la sntesis proteica. desoxirribonucletidos, se sintetiza durante la transcripcin en el ncleo, y en menor cantidad en las mitocondrias y cloroplastos. Su funcin consiste en copiar y transmitir el mensaje gentico, almacenado en la secuencia de nucletidos del ADN, hasta los ribosomas, que representan el lugar donde la informacin se traduce como secuencia de aminocidos de una protena. - ARN transferente (ARNt): Existen diferentes tipos, todos son molculas relativamente pequeas formadas por 70-90 nucletidos. Hay, al menos un ARNt por aminocido presente en las protenas. Posee una estructura secundaria caracterstica de hoja de trbol que presenta tres lazos. La funcin de cada uno de los ARNt es la de transportar un aminocido especfico desde el citoplasma al ribosoma. Este proceso se basa en cada uno de los diferentes tipos de ARNt posee en uno de sus lazos una regin denominada anticodn, compuesta por tres nucletidos especficos que son complementarios de algunos tripletes del ARNm que representan el denominado codn. Por otro lado, la secuencia que se encuentra en los extremos 5y 3 (principio y final de la cadena) termina siempre en los tres nucletidos CCA-3 que es lugar donde se une un determinado aminocido en el citoplasama. MADRID / SEPTIEMBRE 98. LOGSE / BIOLOGA / GENTICA / OPCIN A / N 3 3.- Observe el esquema siguiente: a) Cmo se denomina cada una de las etapas del mismo?. (1 punto). b) Indique cules de estas etapas se producen normalmente en la clula eucaritica, indicando dnde se produce cada una de ellas. (1 punto). Observaciones: Esta cuestin pertenece al bloque de contenidos n. 5: La base qumica de la herencia: gentica molecular, y para resolverla tenemos que recordar los conceptos relacionados con la replicacin, transcripcin y traduccin de la informacin gentica. Solucin:

Los cidos nucleicos son los portadores de la informacin biolgica de un ser vivo, es decir, de cmo son todas las molculas que constituyen el individuo y de cundo se han de producir. Esta informacin se transmite de generacin en generacin a travs del ADN, por lo que ste es el portador de la informacin gentica. a) La capacidad de las clulas de mantener el elevado grado de orden dentro del universo catico, deriva de la informacin gentica que se expresa, mantiene, replica y a veces mejora mediante cuatro procesos genticos bsicos: sntesis proteica, reparacin del ADN, replicacin del ADN y recombinacin gentica. Estos procesos que producen y mantienen las protenas y los cidos nucleicos de una clula, son unidimensionales: en cada uno de ellos, la informacin de una secuencia lineal de nucletidos se utiliza para producir o alterar otra cadena lineal de nuclotidos (una molcula de ADN o ARN) o una cdena lineal de aminocidos (una molcula proteica). Las etapas del esquema se denominan de la siguiente manera: 1.- Replicacin. 2.- Transcripcin. 3.- Transcripcin inversa. 4.- Traduccin. b) En la clula eucaritica tienen lugar los siguiente procesos o etapas: replicacin, transcripcin y traduccin de la informacin gentica. La replicacin del ADN en eucariotas tiene lugar en el ncleo celular. La transcripcin, o mecanismo de sntesis de ARN a partir de una ADN que es utilizado como molde, es un proceso que se realiza tambin en el ncleo celular. La traduccin o sntesis proteica, es un proceso que tiene lugar en los ribosomas del citoplasma de las clulas eucariotas.