Cancer Gene Therapy (2002) 9, 407 413 D 2002 Nature Publishing Group All rights reserved 0929-1903 / 02 $25.

.00 www.nature.com / cgt

Adenovirus-E1A gene therapy enhances the in vivo sensitivity of Ewings sarcoma to VP-16
Rong-Rong Zhou,1 Shu-Fang Jia,1 Zhichao Zhou,1 Yunfang Wang,2 Corazon D Bucana,2 and Eugenie S Kleinerman1
Division of Pediatrics; and 2Department of Cancer Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA.
This study determined the effect of Ad - E1A gene therapy in vivo. TC71 cells ( 2106 ) injected subcutaneously into nude mice resulted in tumor development ( 1 3 mm ) 6 days later. Animals were then treated with Ad - E1A or Ad -  - gal ( 5109 plaque - forming units ) by intratumoral injection twice weekly for 2 weeks. Animals received 8 mg / kg VP - 16 given by intraperitoneal injection daily for 5 days following the first week of treatment with Ad - E1A or Ad -  - gal. Control animals received no therapy or VP - 16 only after tumor cells were injected. When tumors exceeded 22 cm, the mice were sacrificed and the tumors underwent histologic and immunohistochemical analysis. Tumors from mice treated with Ad - E1A plus VP - 16 were 9.6 - fold smaller than those treated with VP - 16 alone and 6.3 - fold smaller than those treated with Ad - E1A alone. HER2 / neu p185 protein expression decreased in all tumors that received Ad - E1A therapy. TUNEL fluorescence staining revealed more apoptosis in the tumors from animals treated with Ad E1A plus VP - 16 than in those from animals treated with Ad - E1A alone, Ad -  - gal plus VP - 16, or VP - 16 alone. These data demonstrated that Ad - E1A gene therapy down - regulated HER2 / neu expression, increased tumor cell apoptosis induced by VP - 16, and enhanced tumor cell sensitivity to VP - 16. Ad - E1A may have potential in the treatment of relapsed drug - resistant Ewings sarcoma. Cancer Gene Therapy ( 2002 ) 9, 407 413 DOI: 10.1038 / sj / cgt / 7700449 Keywords: Ewings sarcoma; Ad - E1A; gene therapy; VP - 16
1

wings sarcoma is the second most common primary malignant bone tumor in children and young adults and has a high potential for metastasizing to the lungs, bones, and bone marrow. Most patients with Ewings sarcoma die from lung and bone metastases. The overall 5- year survival rate is 41.2%.1,2 Moreover, the prognosis is poor for patients who have had a relapse and for patients with large primary tumors or metastatic disease at presentation. Therefore, new strategies are needed to improve the survival rates. The HER2/neu oncogene encodes a 185 - kDa human epidermal growth factor receptor-2 transmembrane protein ( p185 ) with intrinsic tyrosine kinase activity. Overexpression of HER2 /neu was found in approximately 30% of human breast and ovarian cancers.3,4 Enhanced expression of HER2 /neu increased the tumorigenicity and metastatic potential of human ovarian and lung cancer cells. Clinical studies indicated that overexpression of HER2/neu correlated with poor prognosis, shorter patient survival, and chemoresistance.5,6 We previously demonstrated that TC71 human Ewings sarcoma cells overexpress HER2/neu. Thus, HER2/ neu
Received January 29, 2002. Address correspondence and reprint requests to: Dr Eugenie S Kleinerman, Division of Pediatrics, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 87, Houston, TX 77030, USA. E - mail: ekleiner@mdanderson.org

may also play a role in the poor disease- free survival rate associated with multiagent chemotherapy in this disease. The adenovirus type 5 early region 1A (E1A ) gene is a well known transcriptional factor. This gene inhibits HER2 /neu expression in both rodent and human breast cancer and ovarian cancer cells through the HER2 /neu promoter and with the involvement of the HER2 /neu coactivator p300.7 This inhibition abolishes the tumorigenicity and metastatic potential induced by the HER2 /neu oncogene by repressing its expression. Transfer of the E1A gene results in transcriptional repression of HER2/neu via an effect on the HER2 / neu promoter.8 - 10 Transduction of TC71 cells with the E1A gene using an adenoviral vector (Ad -E1A ) suppressed HER2/ neu expression and increased both apoptosis and cell sensitivity to etoposide (VP -16 ) in vitro.11 In this study, we used a replication- deficient adenoviral vector gene delivery system to transduce the E1A gene into human TC71 Ewings sarcoma cells in vivo. We demonstrated that E1A down -regulated HER2/neu expression, inhibited tumor growth, induced tumor apoptosis, and increased tumor sensitivity to VP - 16.
Materials and methods Drug

VP -16 ( Sigma Chemical, St. Louis, MO ) was dissolved in a small volume of dimethyl sulfoxide and then diluted to the

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

408 Research & Development Center, Frederick, MD ). The cell lines used in in vivo experiments were from the third to the tenth passage. The 293 cell line ( American Type Culture Collection, Manassas, VA ), which comprises human embryonic kidney cells, was transduced by sheared fragments of adenovirus type 5 DNA and used as the adenoviral packaging cell line.
Mice
Figure 1 Summary of the experimental protocol. TC71 Ewings sarcoma cells were injected subcutaneously into nude mice ( day 0 ). Six days later, mice were randomly divided into six groups for no treatment or treatment with VP - 16, Ad - E1A, or Ad -  - gal alone or VP - 16 in combination with Ad - E1A or Ad -  - gal.

appropriate concentration with normal saline before being administered to the mice.
Cell lines and culture

Four- to five -week -old specific pathogen -free athymic ( T- cell deficient ) nude mice were purchased from Charles River Breeding Laboratories (Kingston, MA ). The mice were maintained in an animal facility approved by the American Association for Accreditation of Laboratory Animal Care and in accordance with current regulations and standards of the United States Department of Agriculture and Department of Health and Human Services and the National Institutes of Health. Animals were housed for 1 to 2 weeks before any experiments were begun.
Recombinant adenovirus

TC71 human Ewings sarcoma cells, kindly provided by Dr P Pepe ( University of Southern California, Los Angeles, CA ), were cultured in Eagles modified essential medium ( supplemented with 10% heat -inactivated [568C for 30 minutes ] fetal bovine serum, 1 mM sodium pyruvate, 2 minimal essential medium vitamins, 1 nonessential amino acids, and 2 mM glutamine) at 378C at 5% CO2 in a humidified incubator. The cells were free of mycoplasma, as screened by Gen - Probe (San Diego, CA ), and verified to be free of pathogenic marine viruses (NCI - Frederick Cancer

Ad -E1A is an adenovirus type 5 that contains E1A but lacks E1B and E3 (d1324 ). The control vector was Ad -  gal, an adenovirus type 5 based vector lacking E1A, E1B, and E3 but containing  - galactosidase. Both recombinant, replication -deficient adenoviral vectors were prepared by superinfecting 293 cells. The vectors were then purified twice using cesium chloride gradient ultracentrifugation ( Sigma), dialyzed, titrated by plaque assay, and stored at 808C using a standard protocol.12,13

Figure 2 Effect of combination Ad - E1A plus VP - 16 therapy on Ewings sarcoma bearing mice. Groups of mice were subcutaneously injected with 2106 TC71 Ewings sarcoma cells. Six days later, tumor - bearing mice were randomly divided into six groups for no treatment or treatment with VP - 16, Ad - E1A, or Ad -  - gal alone or VP - 16 in combination with Ad - E1A or Ad -  - gal. The tumor volumes were monitored every 4 days with calipers. One month later after the first treatment, tumors from mice treated with Ad - E1A plus VP - 16 were 9.6 - fold smaller than those from mice treated with VP - 16 alone, and 6.3 - fold smaller than those treated with Ad - E1A alone. The size of Ad -  - gal treated tumors was not significantly different from those of the no - treatment group, and the size of Ad -  - gal plus VP - 16 treated tumors was not significantly different from those of the VP - 16 treated group ( data not shown ). One of two representative experiments. ( *P < .01 between tumor size treated with Ad - E1A plus VP 16 and control group ).

Cancer Gene Therapy

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

409
In vivo model

As previously described,14 TC71 Ewings sarcoma cells in mid - log -growth phase were harvested by trypsinization. Single- cell suspensions of 2106 cells in 0.1 mL Hanks balanced salt solution (48C ) were injected into nude mice subcutaneously. Six days later, when tumors could be detected (1 3 mm ), the tumor- bearing mice were then randomly divided into six groups ( five mice per group ) for no treatment or treatment with VP -16, Ad -E1A, or Ad -  gal alone or VP - 16 in combination with Ad -E1A or Ad -  gal. Group 1 mice were untreated controls. Group 2 mice were given intratumoral injections of Ad -  -gal (5109 plaque -forming units [PFU ]) in 50 L PBS twice weekly for 2 weeks. Group 3 mice were injected intratumorally with Ad - E1A (5109 PFU ) in 50 L PBS twice weekly for 2 weeks. Group 4 mice were injected intraperitoneally with 8 mg /kg VP - 16 in 0.2 mL normal saline daily for 5 consecutive days during week 3 (Fig 1). Group 5 mice were injected intratumorally with Ad -  -gal twice weekly during weeks 2 and 3 and received VP -16 during week 3, as described in group 4 (Fig 1 ). Group 6 mice were injected intratumorally with Ad - E1A twice weekly during weeks 2 and 3 and given VP - 16 during week 3, as described in group 4. The tumors were measured every 4 days with a caliper, and their diameters were recorded. Tumor volume p was calculated by the formula  / 6( ab )3, where a and b are the two maximum diameters. The duration of survival was recorded. When each tumor grew bigger than 22 cm, the mice were sacrificed, and tumor tissues were collected for analysis of E1A, HER2 /neu, CD31, and apoptosis expression by reverse transcription polymerase chain reaction ( RT- PCR ), histologic and immunohistochemical analysis, and terminal deoxynucleotidyl

transferase mediated dUTP nick - end labeling (TUNEL ) assay.

RT - PCR

Total RNA was extracted from tumor tissues using Trizol reagent ( Gibco BRL, Grand Island, NY ). Five micrograms of total RNA were reverse transcribed in a 20 L RT reaction. Five micrograms of the cDNA produced were added to a PCR reaction mixture containing 5 L PCR buffer, 0.5 L ( 5 U / l ) Taq DNA polymerase, 1 L ( 10 mM ) dNTP ( dATP, dCTP, dGTP, and dTTP ), and 2.5 L ( 10 nM) each of primers specific to the Ad -E1A intron 1 region (forward primer: 50 -CGGGATCCCCACCATGAGA CATATTATCTGCCACG - 30; reverse primer: 50 -CGGAATT CTTACTCGAGGTCAATCCCTTCCTGCACC - 30 ). Ampli-fication was carried out for 30 cycles in a PTC -200 DNA Engine Poltier Thermal Cycle (MJ Research, Inclin Village, NV ) using the following program: denaturing at 948C for 1 minute, annealing at 608C for 1 minute, and extending the primer at 728C for 1 minute. 18S Primers /Competimers2 (Ambion, Austin, TX ) was used as internal control. The product size was 266 bp. Samples were analyzed on a 2% Tris acetate EDTA agarose gel stained with ethidium bromide. Plasmid E1A DNA was used as a positive control.
Immunohistochemical analysis

Histologic sections were taken from mice bearing TC71 Ewings sarcoma. The sections were subjected to routine pathologic analysis with hematoxylin and eosin staining. Frozen sections fixed with acetone were incubated in 3% H2O2 in methanol for 10 minutes to block endogenous

Figure 3 Ad - E1A plus VP - 16 therapy improved the survival rate in Ewings sarcoma bearing mice. Groups of mice were subcutaneously injected with 2106 TC71 Ewings sarcoma cells. Six days later, tumor - bearing mice were randomly divided into six groups for no treatment or treatment with VP - 16, Ad - E1A, Ad -  - gal, VP - 16 plus Ad - E1A, or VP - 16 plus Ad -  - gal. The tumor volumes were monitored every 4 days with calipers. When the tumor was !22 cm, the mouse was sacrificed. Tumor - bearing mice treated with Ad - E1A plus VP - 16 had a longer survival than those treated with Ad - E1A, VP - 16, Ad -  - gal, or Ad -  - gal plus VP - 16. Log - rank tests show P < .05 between Ad - E1A plus VP - 16 treated group and other groups.

Cancer Gene Therapy

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

410 peroxidase and then incubated in 5% normal horse serum plus 1% normal goat serum in PBS for 20 minutes to block protein. Expression of the CD31 gene on blood vessels and vessel density were detected using rat anti mouse CD31 as the primary antibody ( Pharmingen, San Diego, CA ), and goat anti - rat horseradish peroxidase as the second antibody, incubated with chromogen diaminobenzidine. The expression of HER2 / neu p185 protein was detected by incubating tissue sections using rabbit polyclonal anti -human c -erb -2 oncoprotein (DAKO, Carpinteria, CA ) as the primary antibody and biotinylated goat antibody against rabbit IgG as the second antibody, followed by incubation with avidin biotin peroxidase complex ( Vector Labs, Burlingame, CA ). Staining was then developed in alkaline phosphatase solution ( Biomeda, Foster City, CA ). Gills hematoxylin was used as a counterstain.
TUNEL assay

TUNEL assay was performed to detect apoptotic cells. Frozen sections were fixed with 4% methanol - free formaldehyde solution in PBS for 10 minutes and then washed with PBS three times. The tissue was permeabilized in 20 g /mL proteinase K solution for 10 minutes at room temperature and equilibrated in equilibration buffer for 10 minutes after which the slides were rinsed with PBS three times. The DNA fragments were labeled with fluorescein12 -dUTP in terminal deoxynucleotidyl transferase incubation buffer (Promega, San Diego, CA ) in a humidified chamber ( 378C for 60 minutes ) to avoid exposure to light. The reactions were terminated by transferring the slides to 2 SSC buffer (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0 ) for 15 minutes and washing them in PBS to remove unincorporated fluorescein- 12- dUTP. The slides were then counterstained with 40,6 diamidino- 2- phenylindole ( DAPI; Vector Labs, Burlingame, CA ) to provide a blue background. The green fluorescence of apoptotic cells (fluorescein- 12- dUTP ) can be detected with a fluorescence microscope at 520 nm.
Statistical analysis

Figure 4 Detection of the E1A gene in the tissue of tumor - bearing mice ( one of three representative experiments ). Total RNA ( 5 g ) was extracted from each treatment group. RT - PCR was performed with E1A primers. The pair of primers was derived from within the E1A intron region. The specific PCR product is 266 bp for E1A and 489 bp for 18S primers, as indicated by the arrow. Plasmid E1A DNA ( pE1A ) was used as the positive control. The PCR products were run on 2% agarose gel. Tumors treated with Ad - E1A expressed more E1A compared with controls or those treated with VP - 16 or Ad -  - gal.

was performed to analyze the survival curve. A P value of < .05 was considered statistically significant.
Results Combination therapy with Ad - E1A and VP - 16 inhibited growth of Ewings sarcoma in nude mice

Statistical evaluation for tumor sizes and vessel numbers was performed using the two -tailed Student t test. A P value of < .01 was considered statistically significant. Log -rank test

Our previous data demonstrated that the E1A gene could be transferred into TC71 Ewings sarcoma cells using an adenoviral delivery system. This resulted in the suppression of tumor cell growth in vitro and the enhancement of sensitivity to VP -16.11 To analyze the effects of combination Ad -E1A and VP -16 therapy in vivo, athymic mice that had been injected subcutaneously with 2106 TC71 cells 6 days earlier were treated with VP - 16, Ad - E1A, Ad -  gal, Ad -  - gal + VP -16, or Ad - E1A + VP - 16 or received no treatment. The tumors were measured every 4 days. One month later after first treatment, the tumors in the mice treated with Ad - E1A and VP - 16 were 9.6 -fold smaller than those in mice treated with VP -16 alone, and 6.3 -fold

Figure 5 A: Suppression of HER2 / neu p185 protein expression by Ad - E1A gene transduction in vivo. Representative histologic sections were taken from TC71 tumor - bearing mice. Frozen sections were fixed with acetone. Expression of HER2 / neu p185 protein was detected using a rabbit polyclonal antibody against the HER2 / neu oncogene product as the primary antibody and a biotinylated goat antibody against rabbit IgG as the secondary antibody. The avidin biotin peroxidase complex staining revealed that the expression of HER2 / neu p185 protein was decreased in the tumors treated with Ad - E1A ( A3 ) compared with tumors treated with Ad -  - gal ( A2 ) or control tumors ( A1 ). One representative experiment of three. B: Ad - E1A therapy increased apoptosis induced by VP - 16 therapy in Ewings sarcoma. Tumor samples obtained from mice were fixed with 4% methanol - free formaldehyde solution. The DNA strand breaks were labeled by fluorescein - 12 - UTP to detect apoptotic cells. B1: control; B2: VP - 16; B3: Ad -  - gal; B4: Ad -  - gal + VP - 16; B5: Ad - E1A; B6: Ad - E1A + VP - 16. TUNEL assay revealed the most apoptotic cells in tumors treated with Ad - E1A + VP - 16 ( B6 ). One of three representative experiments. C: Ad - E1A therapy decreased vessel density in Ewings sarcoma. Frozen sections were fixed with acetone. Expression of CD31 on blood vessels was detected using rat anti - mouse CD31 antibody. Vessel numbers were as follows: C1: ( no treatment ), 65.5 4.7; C2: ( treated with VP - 16 ) 48.5 7.3; C3: ( treated with Ad -  - gal ) 58.5 8.4; C4: ( treated with Ad -  - gal + VP - 16 ), 48.5 2.9; C5: ( treated with Ad - E1A ), 40 5.5; and C6: ( treated with Ad - E1A + VP - 16 ) 33.5 5.7. ( P >.05: C1 and C3 ) ( P < .01: C1 and C2, C1 and C4, C1 and C5, C1 and C6, C3 and C5, C4 and C6, C2 and C6 ).

Cancer Gene Therapy

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

411

Cancer Gene Therapy

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

412 smaller than the tumors in mice treated with Ad -E1A alone ( Fig 2 ). The tumor volumes of the mice treated with Ad -  gal did not differ significantly from those tumor volumes of mice that received no treatment ( data not shown). When the tumor size was !22 cm, the mouse was sacrificed. The survival rate of tumor-bearing mice treated with Ad - E1A plus VP -16 was significantly higher than that of mice treated with VP - 16, Ad - E1A, Ad -  -gal, or Ad -  -gal plus VP -16 (Fig 3 ).
Expression of E1A and suppression of HER - 2 / neu p185 in vivo Discussion

To investigate whether the suppression of tumor growth could be linked to the down - regulation of HER - 2/ neu expression by E1A, tumors from each group were analyzed for E1A expression by RT- PCR. As shown in Figure 4, E1A gene expression was detected in Ad -E1A treated and Ad E1A plus VP -16 treated tumor tissue. No E1A gene expression was detected in Ad -  -gal or VP -16 treated tumors. Immunohistochemical staining using a rabbit polyclonal anti -human c- erb - 2 antibody against p185 as the primary antibody revealed that HER2 /neu p185 expression in tumors treated with Ad - E1A alone was lower than in control or Ad -  -gal treated tumors ( Fig 5A ). Decreased HER2 /neu expression was also seen in tumors treated with Ad - E1A plus VP -16 ( data not shown ).
E1A increased VP- 16 induced apoptosis in Ewings sarcoma

Our previous data demonstrated that E1A could induce TC71 cell apoptosis in vitro.11 To examine the effect of E1A on tumor cells in vivo, tumor tissues from animals treated with Ad - E1A, Ad -E1A plus VP -16, Ad -  -gal, Ad -  -gal plus VP - 16, VP -16 alone, or no treatment were collected and analyzed by TUNEL assay. As shown in Figure 5B, apoptotic cells could be identified in Ad - E1A and Ad E1A plus VP -16 treated tumor tissue. Moreover, tumors treated with Ad -E1A plus VP -16 had more apoptotic cells than those treated with Ad -E1A or VP -16 alone, indicating that E1A could enhance VP - 16 induced apoptosis in vivo as well as in vitro.
E1A down - regulated CD31 gene expression in Ewings sarcoma

Angiogenesis, the formation of new blood vessels, is necessary for the growth and metastatic spread of solid tumors. We previous showed that E1A down -regulated VEGF and MMP - 9 expression in TC - 71 cells.32VEGF, an angiogenesis regulatory, has been found to be closely associated with microvessel density, and with the treatment effect.33To examine the effect of E1A on vessel density, tumor tissues treated with Ad - E1A, VP - 16, Ad - E1A plus VP -16, Ad -  - gal, and Ad -  - gal plus VP -16 were analyzed by immunohistochemistry study for CD31 density using rat anti - mouse CD31 as the primary antibody. As shown in Figure 5C, the vessel density was significantly lower in the tumors treated with Ad - E1A plus VP -16 than in those treated with VP -16, Ad -  -gal, or Ad -  - gal plus VP 16 ( P < .01 ).

E1A has been shown to be a tumor suppressor gene in breast carcinoma, ovarian carcinoma, rhabdomyosarcoma, osteosarcoma, melanoma, and nonsmall cell lung carcinoma, both in vitro and in vivo.15 - 20 It also has been known to regulate transcription through interaction with different cellular DNA binding domains.21 E1A can function as a tumor suppressor gene in HER2/ neu- overexpressing cells through repression of HER2 /neu expression at the transcriptional level. E1A does this by targeting a specific DNA element in the HER2 /neu gene promoter.10 Studies have reported that E1A reversed the malignant phenotype of different human tumors, inhibited tumor metastasis by repressing proteinase gene expression, and reduced the metastatic potential of ras transformed rat embryonic cells.22 - 24 Overexpression of the HER2 /neu gene has been correlated with enhanced tumorigenicity, enhanced metastatic potential, poor patient prognosis, and decreased chemosensitivity in many types of cancer, including breast, ovarian, lung, and stomach carcinomas.8,31 Results from our previous studies demonstrated that the HER2 /neu oncogene was overexpressed in three different Ewings sarcoma cell lines.11 We also demonstrated that E1A gene transfer using an adenoviral vector resulted in down -regulation of HER2 / neu expression and increased cellular sensitivity to VP - 16 and doxorubicin but not to cisplatin. This enhanced sensitivity to VP -16 was mediated by a specific increase in topoisomerase II expression.11 The purpose of this study was to determine the effect of E1A gene transfer on tumor growth and VP - 16 sensitivity in Ewings sarcoma in vivo. The results presented here demonstrate that the intratumoral injection of Ad -E1A resulted in expression of the E1A gene in the tumor tissue with down -regulation of HER2/ neu expression ( Figs 4 and 5A ). Tumor sensitivity to VP - 16 was enhanced following transduction with E1A, as demonstrated by increased tumor cell apoptosis, tumor response, and long - term survival (Figs 2, 3, and 5B ). E1A gene therapy alone had some effect, but this was clearly augmented when E1A and VP -16 were used in combination. In addition to an increase in tumor cell apoptosis in vivo, we also demonstrated a significant reduction in tumor vascularity in the animals treated with E1A plus VP - 16 compared with those treated with either therapy alone (Fig 5C ). Intratumoral Ad -  -gal had no effect on tumor apoptosis ( Fig 5B ), tumor vascularity (Fig 5C ), or tumor size (data not shown ). Furthermore, Ad -  -gal did not enhance the efficacy of VP -16 as measured by survival ( Figs 2 and 3), in vivo tumor cell apoptosis (Figs 2, 4, and 5B), and tumor vascularity (Figs 2, 4, and 5C ). It has been reported that E1A can induce sensitivity to both p53- dependent and independent programmed cell death. 25 - 27 The apoptotic function of E1A is accompanied by the processing of caspase- 3 and cleavage of poly ( CADP - ribose ) polymerases.28,29 The mechanism of the E1A -induced apoptosis in this tumor model is not clear at this time. However, based on our previous work, we hypothesize that the enhanced sensitivity to VP - 16 is secondary to E1As ability to up -regulate topoisomerase II expression.11 Further investigations are needed to confirm this.

Cancer Gene Therapy

Adenovirus-E1A gene therapy for Ewings sarcoma R - R Zhou et al

413 In summary, the current study confirms our in vitro findings and supports the development of E1A gene therapy for HER2 /neu -overexpressing Ewings sarcoma. Patients who have a relapse after chemotherapy usually have explosive disease that is not responsive to additional chemotherapy. Clinical trials with E1A gene therapy are currently under way in patients with breast and ovarian cancers.30 The dearth of therapeutic options for patients with recurrent Ewings sarcoma argues for the development of innovative new treatments. Our data suggest that in vivo Ad E1A gene therapy in combination with VP -16 chemotherapy may have potential in the treatment of drug -resistant Ewings sarcoma.
metastases of osteosarcoma and Ewings sarcoma for evaluating new therapeutic strategies. In: Driscoll B, ed. Lung Cancer: Methods and Protocols. Totowa, NJ: The Humana Press. In press. 15. Yu D, Wolf JK, Scanlon M, et al. Enhanced c - erbB - 2 / neu expression in human ovarian cancer cells correlates with more severe malignancy that can be suppressed by E1A. Cancer Res. 1993;53:891 898. 16. Zhang Y, Yu D, Xia W, et al. HER - 2 / neu - targeting cancer therapy via adenovirus - mediated E1A delivery in an animal model. Oncogene. 1995;10:1947 1954. 17. Chang JY, Xia W, Shao R, et al. The tumor suppression activity of E1A in HER - 2 / neu - overexpressing breast cancer. Oncogene. 1997;14:561 568. 18. Chang JY, Xia W, Shao R, et al. Inhibition of intratracheal lung cancer development by systemic delivery of E1A. Oncogene. 1996;13:1405 1412. 19. Frisch SM. Antioncogenic effect of adenovirus E1A in human tumor cells. Proc Natl Acad Sci USA. 1991;88:9077 9081. 20. Frisch SM, Dolter KE. Adenovirus E1a mediated tumor suppression by a c - erbB - 2 / neu - independent mechanism. Cancer Res. 1995;55:5551 5555. 21. Moran E, Mathews M. Multiple functional domains in the adenovirus E1A gene. Cell. 1987;48:177 178. 22. Frisch S, Reich R, Collier I, et al. Adenovirus E1A represses protease gene expression and inhibits metastasis of human tumor cells. Oncogene. 1990;5:75 83. 23. Frisch SM. Antioncogenic effect of adenovirus E1A in human tumor cells. Proc Natl Acad Sci USA. 1991;88:9077 9081. 24. Pozzatti R, McCormick M, Thompson MA, et al. The E1a gene of adenovirus type 2 reduces the metastatic potential of ras - transformed rat embryo cells. Mol Cell Biol. 1988;8: 2984 2988. 25. Lowe SW, Ruley H, Jacks T, et al. p53 - dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell. 1993;74:957 967. 26. Rao L, Debbas M, Sabbatini P, et al. The adenovirus E1A proteins induce apoptosis, which is inhibited by the E1B 19 kDa and Bcl - 2 proteins. Proc Natl Acad Sci USA. 1992;89:7742 7746. 27. Teodoro JG, Shore GC, Branton PE. Adenovirus E1A proteins induce apoptosis by both p53 - dependent and p53 - independent mechanisms. Oncogene. 1995;11:467 474. 28. Putzer B, Stiewe T, Parssanedjad K, et al. E1A is sufficient by itself to induce apoptosis independent of P53 and other adenoviral gene products. Cell Death Differ. 2000;7 177 188. 29. Ueno NT, Bartholomeusz C, Herrmann JL, et al. E1A mediated paclitaxel sensitization in Her2 / neu - overexpressing ovarian cancer SKOV3.ip1 through apoptosis involving the caspase - 3 pathway. Clin Cancer Res. 2000;16:250 259. 30. Hortobagyi GN, Hung MC, Lopez - Berestein G. A phase I multicenter study of E1A gene therapy for patients with metastatic breast cancer and epithelial ovarian cancer that overexpresses HER - 2 / neu or epithelial ovarian cancer. Hum Gene Ther. 1998;9:1775 1798. 31. Weiner DB, Nordberg J, Robinson R, et al. Expression of the neu gene encoded protein ( P185neu ) in human nonsmall cell carcinomas of the lung. Cancer Res. 1990;50:421 425. 32. Zhou Z, Zhou RR, Hung MC, et al. E1A down - regulated VEGF and MMP - 9 Expression in TC - 71 Ewings sarcoma cells. Proceedings of the American Association for Cancer Research, New Orleans, LA. 2001;42:410 Ab# 2210. 33. Toi M, Bando H, Kuroi K. The predictive value of angiogenesis for adjuvant therapy in breast cancer. Breast Cancer. 2000;7:311 314.

References
1. Dorfman HD, Czerniak B. Bone cancers. Cancer. 1995;75: 203 210. 2. Horowitz ME, Malawer MM, Woo SY, et al. Ewings sarcoma family of tumor: Ewings sarcoma of bone and soft tissue and the peripheral primitive neuroectodermal tumors. In: Pizzo PA, Poplack DG, eds. Principles and Practice of Pediatric Oncology. Philadelphia: Lippincott - Raven Publishers; 1997: 831 863. 3. Slamon DJ, Godolphin W, Jones LA, et al. Studies of the HER - 2 / neu proto - oncogene in human breast and ovarian cancer. Science. 1989;44:707 712. 4. Berchuck A, Kamel A, Whitaker R, et al. Overexpression of HER - 2 / neu is associated with poor survival in advanced epithelial ovarian cancer. Cancer Res. 1990;50:4087 4091. 5. Gorlick R, Huvos AG, Heller G, et al. Expression of HER2 / erB - 2 correlates with survival in osteosarcoma. J Clin Oncol. 1999;17:2781 2791. 6. Onde M, Matsuda S, Higuki S, et al. Erb - 2 expression is correlated with poor prognosis for patients with osteosarcoma. Cancer. 1995;7:71 78. 7. Chen H, Hung MC. Involvement of co - activator p300 in the transcriptional regulation of the HER - 2 / neu gene. J Biol Chem. 1997;272:6101 6104. 8. Yu D, Hamada J, Zhang H, et al. Mechanisms of c - erbB2 / neu oncogene - induced metastasis and repression of metastatic properties by adenovirus 5 E1A gene products. Oncogene. 1992;7:2263 2270. 9. Yu DH, Scorsone K, Hung MC. Adenovirus type 5 E1A gene products act as transformation suppressors of the neu oncogene. Mol Cell Biol. 1991;11:1745 1750. 10. Yu D, Suen T, Yan D, et al. Transcriptional repression of the neu protooncogene by the adenovirus 5 E1A gene products. Proc Natl Acad Sci USA. 1990;87:4499 4503. 11. Zhou Z, Jia S - F, Hung MC, et al. E1A sensitizes Her2 / neu overexpressing Ewings sarcoma cells to topoisomerase II targeting anticancer drugs. Cancer Res. 2001;61:3394 3398. 12. Hung MC, Wang SC, Hortobagyi GN. Targeting Her - 2 / neu overexpressing cancer cells with transcriptional repressor genes delivered by liposome. In: Hung L, Hung MC, Wagner E, eds. Cancer Gene Therapy Using Cationic Liposome: Preclinic and Clinic Studies. San Diego: Academic Press; 1999:357 377. 13. Graham FL, Prevec L. Manipulation of adenovirus vector. Gene transfer and expression protocols. In: Murray EJ, ed. Methods in Molecular Biology: Gene Transfer and Expression Protocols, Vol 7. Clifton, NJ: The Humana Press 1991;7: 109 128. 14. Jia S - F, Zhou R - R, Kleinerman ES. Nude mouse lung

Cancer Gene Therapy

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.