Anda di halaman 1dari 2

(1,25)1 - (UEM/2011) Sobre a membrana plasmtica, assinale e some o que for correto.

01) A parede celular um revestimento externo da membrana plasmtica e est relacionada sustentao das clulas de vegetais, de algas, de fungos e de bactrias. 02) Durante o transporte passivo, a clula transporta substncias contra o gradiente de concentrao, o que envolve gasto de energia e consumo de ATP. 04) Microvilosidades so modificaes da membrana plasmtica, encontradas nas clulas do tecido de revestimento interno do intestino, que aumentam a superfcie de absoro. 08) A troca gasosa realizada nas brnquias de um peixe um exemplo de difuso simples, processo que ocorre diretamente pela bicamada lipdica da membrana, sem gasto de energia. 16) Ciclose o processo de entrada e de movimento de partculas slidas no citoplasma, realizado pelas expanses citoplasmticas.

(1,25)2 - (UNIOESTE) Em uma das fitas de DNA de uma espcie de vrus encontram-se 90 Adeninas e 130 Citosinas. Sabendo-se ainda que nesta fita ocorre um total de 200 bases prinas e 200 bases pirimidinas, assinale a alternativa correta.

A. Na dupla fita de DNA ocorrem 180 Adeninas. B. Na dupla fita de DNA ocorrem 140 Guaninas. C. Na fita complementar ocorrem 300 bases pricas e 100 bases pirimdicas. D. Na fita complementar ocorrem 70 Adeninas e 110 Citosinas. E. No possvel determinar a composio de bases nitrogenadas da fita complementar . (1,0)3 - (FGV-SP) Fagocitose : A. englobamento de partculas slidas grandes pela clula. B. englobamento de partculas lquidas pela clula. C. processo de formao de membranas. D. um tipo de exocitose. E. um mecanismo de difuso por membranas (1,0)4 - As molculas de glicose atravessam a membrana celular das clulas intestinais, combinadas com molculas de protenas transportadoras denominadas permeases. Esse processo denominado: A. transporte de massa. B. difuso facilitada. C. endocitose. D. transporte ativo. E. osmose.

(1,0)5 - (UNIFOR) Atravs da membrana viva que separa o meio intracelular do meio extracelular, ocorrem os seguintes transportes: I. Molculas de gua passam do meio menos concentrado para o meio mais concentrado. II. Molculas de O2 e de CO2 entram ou saem da clula, obedecendo ao gradiente de concentrao. III. ons K+ e ons Na+ movimentam-se contra o gradiente de concentrao, fazendo com que a concentrao de K+ seja maior no interior da clula e a de Na+ seja maior no meio extracelular. Os movimento I, II e III devem-se, respectivamente, : A. Osmose, difuso, transporte ativo. B. Osmose, difuso, difuso facilitada. C. Osmose, osmose, difuso facilitada. D. Difuso, difuso facilitada, transporte ativo. E. Difuso, transporte ativo, transporte ativo. (1,25)6 - Cite pelo menos 3 diferenas entre; A. Clula procaritica e clula eucaritica B. Clula animal e clula vegetal (1,25)7 - Considere a molcula de RNA abaixo, RESPONDA: AUGCUAGACCCCGGGUUAUACCCGGCGAACGGCAAC Qual a molcula de DNA que deu origem a molcula de RNA vista a cima? (indique a fita molde) (1,0)8 Define-se citoesqueleto como: A. Conjunto de fibras e tbulos com diferentes dimetros, formado por celulose e que d suporte s vrias estruturas celulares. B. Conjunto de fibras e tbulos de protenas que d sustentao s clulas e permite sua movimentao. C. Membrana externa formada por celulose e que d suporte membrana plasmtica, permitindo movimentos amebides. D. Feixes de actina, miosina e queratina que promovem o estrangulamento da clula no processo de diviso celular. E. Clios fundidos e dispostos em lamelas as quais fazem o suporte de indivduos unicelulares. (2.0)9 Construa um quadro demonstrativo sobre os cidos nuclicos utilizando os conhecimentos adquiridos durante as aulas de Biologia: A) Quadro demonstrativo: DNA Tipo de Pentose Bases Nitrogenadas B) Cite um nucleotdeo energtico que os seres vivos utilizam diariamente como principal fonte de energia para executar, por exemplo, movimentos e aes para a manuteno da vida como respirao e batimentos cardacos. Cite tambm em qual organela esse nucleotdeo produzido. RNA