Anda di halaman 1dari 155

ISSN 1726-4634

VOLUMEN 28 Nmero 4 Octubre - diciembre 2011

revista peruana de medicina experimental y salud pblica

LIMA, PER

Alberto Tejada Noriega Enrique Jacoby Martnez

Percy Minaya Len Nora Reyes Puma

Kirla Echegaray Alfaro

Manuel Espinoza Silva

El consentimiento informado, tal cual lo conocemos guarda relacin con el contexto de las comunidades indgenas? Dr. Omar Trujillo, CENSI/INS

Javier Vargas Herrera

REVISTA PERUANA DE MEDICINA EXPERIMENTAL Y SALUD PBLICA


Volumen 28 Nmero 4 Octubre Diciembre 2011
Director Zuo Burstein Alva Editor General Csar Cabezas Snchez
Instituto Nacional de Salud

INSTITUTO NACIONAL DE SALUD

Instituto Nacional de Salud

Universidad Nacional Mayor de San Marcos

Editor Invitado Alberto Perales Cabrera

Hospital Nacional Hiplito Unanue

Editor Cientfico Alonso Soto Tarazona

Editor Adjunto Charles Huaman Saldaa


Instituto Nacional de Salud

Instituto Nacional de Salud

Editor Adjunto Pedro Cabrera Julca

Rosario Belleza Zamora


Instituto Nacional de Salud

Alfredo Guilln Oneeglio

Comit Editor

Universidad Nacional Federico Villarreal

J. Jaime Miranda

Universidad Peruana Cayetano Heredia

Zila Patricia Caballero opo Instituto Nacional de Salud Rufino Cabrera Champe Walter H. Curioso
Direccin General de Epidemiologa - MINSA Universidad Peruana Cayetano Heredia

Csar Gutirrez Villafuerte Claudio F. Lanata

Universidad Nacional Mayor de San Marcos Instituto de Investigacin Nutricional

Oswaldo Salaverry Garca


Instituto Nacional de Salud

Lely Solari Zerpa

Instituto Nacional de Salud

Percy Mayta-Tristn

Universidad Peruana de Ciencias Aplicadas

Vctor Javier Surez Moreno


Instituto Nacional de Salud

Fabin Fiestas Saldarriaga

Universidad Peruana Cayetano Heredia

Edward Mezones Holgun


Instituto Nacional de Salud

Javier Vargas Herrera

Universidad Nacional Mayor de San Marcos

Consejo Consultivo
Jorge Alarcn Villaverde Werner Apt Baruch
Universidad de Chile Santiago, Chile Universidad Nacional Mayor de San Marcos Lima, Per

Eduardo Gotuzzo Herencia Humberto Guerra Allison Roger Guerra-Garca

Universidad Peruana Cayetano Heredia Lima, Per. Universidad Nacional Cayetano Heredia Lima, Per. Academia Peruana de Ciencias Lima, Per.

Paulo Marchiori Buss,

Fundacin Oswaldo Cruz (Fiocruz), Ro de Janeiro, Brasil.

Wilmer Marquio Quezada David A. Moore

Organizacin Panamericana de la Salud Managua, Nicaragua Imperial College of London London, England

Javier Arias-Stella

Academia Nacional de Medicina Lima, Per

Federico Augustovski Alessandro Bartoloni


Universita di Firenze Firenze, Italia

Universidad de Buenos Aires Buenos Aires, Argentina

Heinner Guio Chunga


Instituto Nacional de Salud Lima, Per

Sergio Muoz Navarro Csar Nquira Velarde Oscar Pamo Reyna

Pan American Health Organization Washington DC, USA. Universidad Nacional Mayor de San Marcos Lima, Per. Universidad Peruana Cayetano Heredia Lima, Per.

Luis Haro Garca

Universidad Nacional Autnoma de Mxico Mxico DF, Mxico

William Checkley

Johns Hopkins University Baltimore, Maryland, USA

Daniel Haro Haro

Academia Peruana de Ciruga Lima, Per.

Heriberto Fernndez

Universidad Austral de Chile Valdivia, Chile

Jan Helge Solbakk

University of Oslo, University of Bergen Noruega

Bertha Pareja Pareja

Universidad Nacional Mayor de San Marcos Lima, Per.

Diego Gracia Guilln Hctor H. Garca

Universidad Complutense de Madrid Madrid, Espaa Instituto Nacional de Ciencias Neurolgicas Lima, Per

Gilberto Henostroza Haro Adrin V. Hernndez


Cleveland Clinic Ohio, USA.

Universidad Peruana Cayetano Heredia Lima, Per.

Sergio Recuenco Cabrera

Center for Disease Control and Prevention, Atlanta, USA

Alfonso J. Rodrguez-Morales
Universidad Central de Venezuela Caracas, Venezuela

Patricia J. Garca

Universidad Peruana Cayetano Heredia Lima, Per.

Jay Kaufmann

Mcgill University Montreal, Quebec, Canada

Trenton K. Ruebush

U.S. Agency for International Development, Washington DC, USA.

Uriel Garca Cceres Robert H. Gilman Roger Glass

Academia Nacional de Medicina Lima, Per Johns Hopkins University Baltimore, Maryland, USA. National Institutes of Health Bethesda, Maryland, USA.

Michael Knipper

Justus Liebig University Giessen Giessen, Germany

Enrique Schisterman Sonya Shin

National Institutes of Health Bethesda, Maryland, USA. Harvard University Boston, Massachusetts, USA.

V. Alberto Laguna-Torres

United States Naval Medical Research Center Detachment, Lima, Per

Alejandro Llanos-Cuentas Yury V. Lartsev

Universidad Peruana Cayetano Heredia Lima, Per. Universidad Estatal Mdica de Samara, Samara, Rusia.

Anbal Velsquez Valdivia

Universidad Nacional Mayor de San Marcos Lima, Per.

Gustavo Gonzles Rengifo

Universidad Peruana Cayetano Heredia Lima, Per.

Armando Yarlequ Chocas

Universidad Nacional Mayor de San Marcos Lima, Per

Coordinacin Administrativa Med. Javier Vargas Herrera


Instituto Nacional de Salud

Distribucin Graciela Rengifo Garca


Instituto Nacional de Salud

Instituto Nacional de Salud

Asistente Editorial Bertha Huarez Sosa

Correccin de Estilo Daniel Crdenas Rojas


Instituto Nacional de Salud

La Revista Peruana de Medicina Experimental y Salud Pblica (Rev Peru Med Exp Salud Publica) es el rgano oficial de difusin cientfica del Instituto Nacional de Salud (INS), Lima, Per; es una publicacin de periodicidad trimestral y tiene como objetivo la publicacin de la produccin cientfica en el contexto biomdico social, especialmente los aportes prcticos con el fin de contribuir a mejorar la situacin de salud del pas y de la regin, adems, propicia el intercambio con entidades similares en el Per y en el extranjero, a fin de promover el avance y la aplicacin de la investigacin y la experiencia cientfica en salud. La Revista recibe contribuciones inditas como artculos originales, de revisin, originales breves, reportes de caso, galeras fotogrficas o cartas al editor, las cuales son revisadas por expertos (pares) nacionales como extranjeros que han publicado investigaciones similares previamente, estos opinan en forma annima sobre la calidad y validez de sus resultados, el nmero de revisores depende del tipo de artculo, solo se publican aquellos artculos con comentarios favorables y que han resuelto las observaciones enviadas. El tiempo de revisin demora en la mayora de los casos entre dos a cuatro meses segn la celeridad de los revisores y autores. La Revista no se hace responsable de las opiniones vertidas por los autores de los artculos publicados. Todos los derechos quedan reservados por el Instituto Nacional de Salud. Cualquier publicacin, difusin o distribucin de la informacin presentada queda autorizada siempre y cuando se cite la fuente de origen. La Revista Peruana de Medicina Experimental y Salud Pblica est indizada o resumida en: Academic Search Complete: AGORA: DOAJ: EMBASE: HINARI: IMBIOMED: LATINDEX : LILACS: LIPECS: MedicLatina: MEDLINE: OARE: RedALyC: REPIDISCA: SISBIB-UNMSM: SciELO Per: SciELO Salud Pblica: SCOPUS: Grupo EBSCO Access to Global Online Research in Agriculture Directory of Open Access Journal Excerpta Medica Database / Elsevier B.V. Health Internet Network Access to Research Initiative ndice Mexicano de Revistas Biomdicas Latinoamericanas IndexCopernicus: Index Copernicus International. Sistema Regional de Informacin en Lnea para Revistas Cientficas en Amrica Latina, El Caribe, Espaa y Portugal. Literatura Latinoamericana en Ciencias de la Salud Literatura Peruana en Ciencias de la Salud Grupo EBSCO Index Medicus / U.S. National Library of Medicine Online Access to Research in the Environment Red de revistas Cientficas de Amrica Latina y El Caribe, Espaa y Portugal Red Panamericana de Informacin en Salud Ambiental Sistema de Bibliotecas Online de la Universidad Nacional Mayor de San Marcos Scientific Electronic Library Online Scientific Electronic Library Online Salud Publica - Bireme, Brasil. Database of Abstracts and Citations for Scholarly Journal Articles.

Se distribuye gratuitamente y por canje, adems, est disponible a texto completo en: http://www.ins.gob.pe/rpmesp Copyright 2011 INS-PER Depsito Legal 2000-2856 ISSN Versin impresa: ISSN Versin electrnica: 1726-4634 1726-4642

Traduccin: Lely Solari, Sergio Recuenco Apoyo secretarial: Olga Otarola Luna Diseo y diagramacin: Segundo E. Moreno Pacheco Tiraje: 3000 ejemplares Impreso en Punto y Grafa s.a.c. Diciembre 2011

Investigar para proteger la salud


Direccin: Instituto Nacional de Salud Cpac Yupanqui 1400. Lima 11, Per. Telfono: (511) 617-6200 anexo 2122 Correo electrnico: revmedex@ins.gob.pe Pgina web: www.ins.gob.pe/rpmesp

Rev Peru Med Exp Salud Publica. 2011;28(4):575-77.

CONTENIDO / CONTENTS
VOLUMEN 28 NMERO 4 OCTUBRE DICIEMBRE 2011 VOLUME 28 NUMBER 4 OCTOBER DECEMBER 2011
Editorial / Editorial tica, biotica y medicina. Ethics, bioethics and medicine

Alberto Perales..................................................................................................................................................578

Artculos de Investigacin / Research Papers Estrs, ansiedad y depresin en magistrados de Lima, Per. Stress, anxiety and depression in magistrates from Lima, Peru.

Alberto Perales, Hctor Chue, Alberto Padilla, Lorenzo Barahona .................................................................. 581

Victoria Marca, Oscar Acosta, Mario Cornejo-Olivas, Olimpio Ortega, Doris Huerta, Pilar Mazzetti. ............. 589

Polimorfismo gentico de la apolipoprotena E en una poblacin peruana. Genetic polymorphism of apolipoprotein E in a peruvian population.

Jorge Rey de Castro, Edmundo Rosales-Mayor............................................................................................... 595

Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneashipopneas del sueo. Clinical and polysomnographyc differences between obese and non-obese patients with obstructive sleep apnea-hypopnea syndrome.

Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. Enteroviral central nervous system infections in children treated at a hospital in Lima, Peru
Ivn O. Espinoza, Theresa J. Ochoa, Susan Mosquito, Francesca Barletta, Roger Hernndez, Mara del Pilar Medina, Mara Luisa Stiglich, Claudia Ugarte, Daniel Guilln...........................................................602

Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. Children hospitalized with Influenza pneumonia AH1N1/2009 pandemic in the INSN.
Edwin Miranda-Choque, Carlos Ramrez, Jorge Candela-Herrera, Javier Daz, Ana Fernndez, Lenka Kolevic, Eddy R. Segura, Sonia Farfn-Ramos. ................................................................................................ 610

Wilfredo Flores-Paredes....................................................................................................................................617

Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per. To inadequate indication of blood transfusion in a reference hospital in Lima, Peru.

Ana Castaeda-Guarderas, Guillermo Beltrn-Ale, Renzo Casma-Bustamante, Paulo Ruiz-Grosso, Germn Mlaga.................................................................................................................................................623

Registro de pacientes con accidente cerebro vascular en un hospital pblico del Per, 2000-2009. Registry of patients with stroke stated in a public hospital of Peru, 2000-2009.

Fausto Garmendia, Rosa Pando, Gerardo Ronceros . ..................................................................................... 628

Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia. Effect of sacha inchi oil (Plukenetia volbilis L) on the lipid profile of patients with hyperlipoproteinemia.

575

Rev Peru Med Exp Salud Publica. 2011;28(4):575-77.

Asencio Quintana-Gonzales, Rosa Sotomayor-Espichan, Mara Martnez-Romero, Csar Kuroki-Garca...... 633

Lesiones medulares no traumticas: etiologa, demografa y clnica. Non-traumatic spinal cord injury: etiology, demography and clinics.

Carmen Morales, Nstor Falcn, Henry Hernndez, Carla Frnandez............................................................. 639

Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. Dog bite accidents in a children hospital at Lima, Peru. Retrospective study from 1995-2009. Uso de medicamentos en adultos mayores no institucionalizados. Use of medication in elderly people dont institutionalized

Martn Regueiro, Nicols Mendy, Martn Cas, Hugo Osvaldo Farina, Pablo Nagel...................................... 643

Revisin / Review

Susan Mosquito, Joaquim Ruiz, Jos Luis Bauer, Theresa J. Ochoa............................................................... 648

Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea. Molecular mechanisms of antibiotic resistance in Escherichia coli associated diarrhea

Simposio: tica, biotica y medicina / Symposium: Ethics, bioethics and medicine


Jorge Alberto lvarez-Daz................................................................................................................................657

Retos de la biotica en la medicina del siglo XXI. Challenges of bioethics in twenty-first century medicine. tica e investigacin. Ethics and investigation.

Salomn Zavala, Julio Alfaro-Mantilla. ...............................................................................................................664

Alfonso Mendoza F............................................................................................................................................670

tica y medicina: la experiencia del Colegio Mdico del Per. Ethics and medicine: the experience of the medical association of Peru.

Seccin Especial / Special Section


Ludovic Reveiz, Carla Saenz, Renato T. Murasaki, Luis G. Cuervo, Luciano Ramalho. ................................... 676

Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. Progress and challenges of clinical trials registration in Latin America and the Caribbeans.

Personalidades Destacadas de la Salud Pblica en el Per / Great Personalities of Public Health in Peru

Pablo Zumaeta..................................................................................................................................................682

El amauta Pedro Ortiz Cabanillas (1933-2011). The amauta Pedro Ortiz Cabanillas (1933-2011).

Galera Fotogrfica / Picture Gallery


Rito Zerpa, Vilma Bjar, Roberto Rojas.............................................................................................................685

Agentes de infecciones por hongos dimrficos y Cryptococcus neoformans Agents by dimorphic fungi and Cryptococcus neoformans infections

576

Rev Peru Med Exp Salud Publica. 2011;28(4):575-77.

Cartas al editor / Letters to editor


Wilfredo Gutirrez..............................................................................................................................................688

La vacuna contra el virus del papiloma humano: algunas precisiones. The human papillomavirus vaccine: some precisions.

Investigacin de excelencia en altura: a cincuenta aos de la fundacin del Instituto de Investigaciones de la Altura de la Universidad Peruana Cayetano Heredia. Excellence research in altitude: fifty years after the foundation of the Instituto de Investigaciones de la Altura of the Universidad Peruana Cayetano Heredia

Gustavo F. Gonzales, Roger Guerra-Garca.....................................................................................................689

lvaro Taype-Rondn, Yasmn Lajo-Aurazo, Rodrigo Gutirrez-Brown, Natalia Zamalloa-Masas, Michelle Saldaa-Gonzales...............................................................................................................................691

Aporte de las sociedades estudiantiles en la publicacin cientfica en Scielo-Per, 2009 2010. Societies of medical Students Contribution In The Scientific Production In Scielo-Peru, 2009-2010

Luis Figueroa.....................................................................................................................................................692

Existe un espacio para la investigacin durante el residentado mdico en Per? Is there a place for research in health services in the graduate medical education from Peru? Migracin de mdicos peruanos a Espaa, 2005-2009. Peruvian physician migration to Spain, 2005-2009.

Diego A. Bernardini-Zambrini, Jos Francisco Garca Gutierrez, Percy Mayta-Tristn. .................................... 694

Wilfredo Gutirrez..............................................................................................................................................695

Poliomielitis paraltica causada por la vacuna oral Sabin: tiempo de cambiar de vacuna? Paralytic poliomyelitis caused by the oral Sabin vaccine: time for a vaccine change? Subregistro de trastornos depresivos. Under reporting of deppresive disorders

Paulo Ruiz-Grosso, Jorge Osada, Wolfgang Hoppe, Bruno Pedraz, Johann Vega-Dienstmaier...................... 697

Juan Antonio Glvez-Buccollini, Fabin Fiestas................................................................................................ 698

Necesidad de evaluar las guas clnicas peruanas de tratamiento para trastornos mentales. The need for evaluating the peruvian clinical guidelines for treatment of mental disorders

Revisin por Pares / Peer Review Relacin de revisores del ao 2011 / List of reviewers 2011................................................................. 700

ndices del Volumen 28 / Volume 28 Index ndice de materias / Issues index. . ............................................................................................................705 ndice de autores / Author index. ...............................................................................................................715

Normas para la presentacin de artculos / Instructions for manuscripts presentation Instrucciones para los autores / Instructions for authors........................................................................ 720

577

Rev Peru Med Exp Salud Publica. 2011; 28(4):578-80.

EDITORIAL

TICA, BIOTICA Y MEDICINA


ETHICS, BIOETHICS AND MEDICINE
Alberto Perales1,2,a
El vasto campo que el ttulo plantea, resulta imposible cubrirlo con propiedad en el corto espacio de un editorial. Por ello, y en concordancia con el Simposio que presentamos, comentaremos solo tres aspectos que, a nuestro juicio, requieren de mayor reflexin en el pas: 1) Los conceptos de tica y Biotica y su relacin con la Medicina; 2) Su relacin con la investigacin cientfica en Medicina y 3) Su relacin con la prctica profesional evidenciada en la experiencia del Colegio Mdico del Per. Sobre la tica y Biotica y su relacin con la Medicina; en el liminar del libro Biotica para la sustentabilidad, Ral Roa Kouri, diplomtico e intelectual cubano, apunta, con acierto, que en el periodo comprendido entre la Cumbre de la Tierra, realizada en Ro de Janeiro, Brasil (1992) hasta la reunin sobre Desarrollo Sostenible, Cumbre de Johannesburgo, Sudfrica (2002), la habitabilidad del mundo se haba deteriorado. Por ello, el Secretario General de las Naciones Unidas, Kofi Annan, seal: Debemos enfrentar la molesta verdad, que el modelo al que estamos acostumbrados ha sido muy fructfero para unos pocos, pero negativo para la mayora. Un camino hacia la prosperidad que devasta el medio ambiente y deja a la mayora de la humanidad en la miseria ser muy pronto un callejn sin salida para todos. En efecto, seala Roa: De Ro a Johannesburgo, las emisiones de dixido de carbono se haban incrementado en 0,9 % (solo en los EE.UU. haban crecido el 18 %); el nmero de hambrientos es superior a los 800 millones; hay, segn la UNESCO, 854 millones de adultos analfabetos; 1200 millones de personas viven en extrema pobreza; 2400 millones carecen de condiciones sanitarias elementales; cuarenata millones son seropositivos o estn enfermos de SIDA; dos millones mueren al ao de tuberculosis; un milln a causa de la malaria; once millones de nios morirn este ao por causas evitables, mientras que la brecha de los ingresos entre pases ricos y los pobres pasaron de 37 veces en 1960 a 74 veces en 2002 (1). De subsumirse tales denuncias en una sola categora, admitiramos que convergen en problemas ticos o bioticos? Como sabemos, el vocablo tica, derivado de la raz griega thos (costumbre), habla, como apuntaba Aristteles, de un quehacer prctico, adquirido por fuerza del hbito (2). La tica (o buenas costumbres) la aprende y practica el ser humano hasta convertirla en rasgo de su personalidad (su manera de ser). Desde esta perspectiva, se vincula ntimamente con la influencia del entorno familiar, educacional y sociocultural sobre el substrato gentico de cada individuo para su desarrollo como persona moral (3). Tales conductas morales, esenciales para la convivencia humana y perfeccionadas en el decurso de los siglos (de la especie), constituyen, en mi concepto, mecanismos sociales de defensa que permiten a los colectivos mantener niveles de entendimiento constructivo que se oponen a las tendencias humanas auto y heterodestructivas. La Biotica por su lado, constituye an un concepto en desarrollo (4) que surge por necesidad sentida de la humanidad y se expande rpidamente con urgencia aplicativa a la solucin de mltiples problemas en diferentes campos de la vida y actividad humanas.
Instituto de tica en Salud, Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Per. Academia Nacional de Medicina. Lima, Per. a Mdico psiquiatra, Doctor en Medicina
1 2

Recibido: 11-10-11

Aprobado: 12-10-11

578

Rev Peru Med Exp Salud Publica. 2011; 28(4):578-80.

tica, biotica y medicina

En efecto, cuando Potter publica su primer libro Bioethics: Bridge to the Future, lo hace preocupado por la sobrevivencia de la humanidad y la necesidad de que todos los seres humanos, luego de tomar conciencia del peligro, organicen su conducta para no seguir destruyendo su hbitat: la Tierra. Potter habla en tal sentido de la paradoja del ser humano, de haber producido enorme conocimiento sin haber creado una ciencia que lo ayude a manejar bien ese conocimiento. A eso lo llama sabidura, especificando que el nuevo conocimiento que se logre (por medio de la investigacin cientfica) no tendr el valor deseable si no es usado para bien del hombre y de su medio (5); es decir, con una finalidad social, como dira Emanuel (6). Sin embargo, debemos remarcar que Potter nunca vincul substantivamente a la Medicina con su concepto de Biotica, ms bien s, a la Biologa. Por la misma poca, la prctica mdica, tanto clnica como de investigacin, vena siendo afectada por el acelerado desarrollo tecnolgico y enfrentando serios y nuevos problemas ticos en su quehacer diario. En tales circunstancias, la Biotica llen justamente un vaco de marco tericoprctico que la tica Mdica no haba logrado satisfacer. La avidez con que tal nueva ruta fue tomada produjo un explosivo crecimiento de estudios y aplicaciones en las ciencias, no solo mdicas sino de la salud, que inadvertidamente opacaron la propuesta original de Van Rensselaer Potter. Por ello, Otero, bioeticista venezolano, ha sealado en un documentado artculo, su deseo de reivindicar el original aporte de este autor, preguntndose sobre las razones que han llevado a muchos profesionales a creer que Biotica es solo aquella aplicada al campo de la Medicina (7), a la que apropiadamente se debiera denominar Biotica Mdica. En 1978, Potter publica su segundo libro, Global Bioethics, en el cual ampla el significado de su concepto. Exige al hombre respeto y solidaridad, no solo con su entorno inmediato sino con la biosfera, en lo que llama Biotica global, una disciplina que establece como vnculo entre la Biologa, Ecologa, Medicina y los valores humanos, a fin de lograr la sobrevivencia de la humanidad, de todos los seres vivos y de la naturaleza en general, reclamando la obligacin moral que tiene el hombre con sus descendientes (las prximas generaciones de seres humanos, an virtuales) que habrn de venir a poblar la Tierra en el futuro y que debieran recibir un hbitat adecuadamente cuidado que les permita sobrevivir. Es recin en este libro que incluye un captulo que denomina Dilemas en Biotica Mdica, aunque el centro de su tesis se apoya fundamentalmente en la Biologa (bios) y el diverso conocimiento humanista para formar una nueva ciencia

que cree un sistema de prioridades ambientales y de salud que permitan la supervivencia de la humanidad (8). En el presente Simposio, respecto a los problemas ticos y bioticos que enfrentar la medicina en el presente siglo, contaremos con el acucioso trabajo de Jorge Alberto lvarez, destacado bioeticista mexicano, ganador del premio de Biotica 2009, quien realiza un anlisis del tema desde una perspectiva histrica sealando tres grandes retos para nuestro presente siglo: a) los problemas no resueltos de justicia, equidad y pobreza; b) los planteados por la introduccin de nuevas tecnologas con el paradigma de la nanomedicina; y, c) los vinculados al avance de las neurociencias en el paradigma de la neurotica. Sobre la relacin de la tica, Biotica con la investigacin en seres humanos; la ciencia, por su misma metodologa, es un continuo ejercicio de observacin e interpretacin de la realidad, en dinmica de ensayo y error que permite una progresiva correccin de sus resultados y aspira a logros predictibles; sin embargo, la generacin de conocimiento, convertida en fuente de poder, viene haciendo cada vez ms difcil su manejo. Tal riesgo se multiplica infinidad de veces cuando el conocimiento es susceptible de ser convertido en mercanca de venta comercial. Al respecto, De Siqueira comenta agudamente que: Hay una interaccin entre la investigacin y el poder. Esa nueva ciencia lleva a un conocimiento annimo..El nuevo saber es depositado en los bancos de datos y empleado segn las decisiones de los que sujetan el poder La investigacin, por otra parte, es conducida por instituciones tecno-burocrticas. La tecnociencia va produciendo conocimientos que, sin ser objeto de reflexin crtica, se transforman en reglas impuestas a la sociedad.Las conquistas de la ciencia se expresan por la tecnologa. que es completamente ajena al juicio moral y evoluciona segn la variable econmica que produce su aplicacin (9). As, el riesgo de que el conocimiento sea utilizado con muy diferentes fines a los que motivaron su origen, se viene incrementado. Recientemente se han hecho pblicas otras serias denuncias, como las planteadas por Vctor Penchaszadeh, quien seala que las corporaciones estn trasladando buena parte de sus ensayos clnicos a pases en desarrollo, donde las investigaciones son ms baratas, existe menor tradicin de respeto a la autonoma individual, sus poblaciones estn ms necesitadas de atencin mdica y las regulaciones estatales son dbiles; que los temas ms investigados son aquellos que afectan a los sectores de mayores recursos ignorando enfermedades que causan gran sufrimiento y muerte en los pases pobres (malaria y tuberculosis,

579

Rev Peru Med Exp Salud Publica. 2011; 28(4):578-80.

Perales A

por ejemplo) y en poblaciones pobres de los pases ricos (tuberculosis); y que las investigaciones `safari se viene repitiendo, modalidad en la cual investigadores de pases desarrollados disean y ejecutan estudios en pases del tercer mundo, donde la nica participacin de sus poblaciones es aportar informacin y muestras de sangre que sern analizadas en y para beneficio del primer mundo (10). Todo esto viene ocurriendo a pesar de las diversas normas internacionales de control tico como los requisitos promulgados por la Unin Europea, del Consejo de Europa: Convencin sobre Biomedicina (1996); la Conferencia Internacional de Armonizacin: Lineamientos para la buena prctica clnica 1996, y las publicadas por CIOMS, OMS, AMA (Declaracin de Helsinki en sus varias revisiones), La Declaracin Universal sobre Biotica y Derechos Humanos (2005) de la UNESCO y las Consideraciones ticas en los ensayos de prevencin de HIV biomdicos de UNAIDS (2007) Al respecto, con la experiencia y prudencia que los caracteriza, los doctores Salomn Zavala y Julio Alfaro, eticistas peruanos, especifican en su trabajo los problemas ticos y bioticos con los cuales debe lidiar la investigacin cientfica en el campo de la Medicina en el Per. Y sobre la tica institucional y profesional, primero debemos sealar a la tica institucional como el Conjunto de aspiraciones morales, normas, costumbres, creencias y otros, que dan forma a la cultura organizacional de una institucin. En la actualidad, los problemas ticos en el ejercicio de la profesin mdica y en el sistema de atencin de salud han devenido prioridades evidentes. La organizacin que por mandato estatutario debe velar por el comportamiento tico de los mdicos, de acuerdo con los postulados de su Cdigo de tica y Deontologa es, en nuestro pas, el Colegio Mdico del Per. El Presidente de su Comit de Vigilancia tica y Deontolgica, Dr. Alfonso Mendoza, destacado psiquiatra peruano, nos informa, cualitativa y cuantitativamente la experiencia del Consejo Nacional y de sus 27 Consejos Regionales, en el periodo de 1999 a la fecha. Por ltimo, en un vigoroso ensayo, Pellegrino, luego de examinar las posibles vas de convergencia entre la Filosofa y la Medicina, plantea tres posibilidades:

a) como Filosofa y Medicina; b) como Filosofa en la Medicina; y, c) como Filosofa de la Medicina. Concluye sealando que la ltima sera potencialmente la ms rica, tanto por constituir una disciplina definible como por contener temas especficos en su interior. Asimismo, vaticina que de poder evitar los peligros intelectuales que este tipo de convergencias plantea, tanto los profesionales que practican la medicina, como los que reflexionan y se sirven de ella, pueden lograr una comprensin ms profunda de su naturaleza y propsito, as como de la esencia y fines de la profesin y del hombre en si (10). Deseara que todos los vinculados al tema, profesionales de la salud, autoridades estatales y poblacin en general, comprendamos que la nica forma de enfrentar con xito los problemas ticos y bioticos que en este campo nos amenazan, ser aumentando la solidaridad y el dilogo entre nosotros y conjugando esfuerzos en busca de un bien comn, presente y futuro, para la supervivencia de la humanidad y el bienestar de los seres humanos que vendrn a poblar la Tierra.

REFERENCIAS BIBLIOGRFICAS
1. Roa R. Liminar. En: Acosta J (editor). BIOTICA para la sustentabilidad. La Habana: Acuario; 2002. p. xi-xiii. 2. Ortiz P. Educacin y formacin de la personalidad. Lima: Fondo Editorial UCH; 2008. 3. Perales A. Aportes a la historia de la biotica: Comentarios al trabajo de James A. Drane. An Fac Med. 2001;62(4):362-4. 4. Potter Van R. Bioethics: Bridge to the Future. Englewood Cliffs, NJ: Prentice-Hall; 1971. 5. Emanuel E. What makes clinical research ethical? Seven ethical requirements. En: Pellegrini A, Macklin R (editors). Research on Human Subjects: International Experience. Santiago de Chile: Regional Program on Bioethics PAHO/ WHO; 1999. p. 33-44. 6. Otero LD. Biotica: el concepto relegado. Interciencia. 2009;34(1):71-6. 7. Potter Van R. Global Bioethics. Michigan: Michigan State University Press; 1988. 8. De Siqueira E. El principio de responsabilidad de Hans Jonas. En: Acosta J (editor). BIOTICA para la sustentabilidad. La Habana: Acuario; 2002. p. 87-123. 9. Penchaszadeh VB. tica de las investigaciones biomdicas en un mundo globalizado. En: Acosta J (editor). BIOTICA para la sustentabilidad. La Habana: Acuario; 2002. p. 439-53. 10. Pellegrino ED. Philosophy of Medicine: problematic and potential. J Med Philos. 1976;1(1):5-31.

580

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

ARTCULO ORIGINAL

ESTRS, ANSIEDAD Y DEPRESIN EN MAGISTRADOS DE LIMA, PER


Alberto Perales1,2,a, Hctor Chue3,b, Alberto Padilla4,c, Lorenzo Barahona5,d
RESUMEN Objetivos. Determinar los niveles de estrs general y laboral, depresin y ansiedad en magistrados (jueces y fiscales) del Distrito Judicial de Lima, Per. Materiales y mtodos. Estudio transversal y descriptivo. De una poblacin de 1137 magistrados del Poder Judicial y del Ministerio Pblico del Distrito Jurisdiccional de Lima se tom una muestra aleatoria estratificada donde cada institucin constituy un estrato. La muestra estuvo conformada por 287 magistrados: 138 fiscales y 149 jueces. Se aplic un cuestionario compuesto por cuatro instrumentos para determinar los niveles de estrs general y laboral, ansiedad y depresin, previo consentimiento informado. Resultados. El estrs general estuvo presente en el 18,5 % de los magistrados, el estrs laboral en 33,7 %, ansiedad en 12,5 % y depresin en 15,0 %. Estas tres condiciones estuvieron presentes en el 6,6 % de los magistrados, y al menos una estuvo presente en el 25,9 %. El estrs general estaba asociado con la depresin (OR: 4,9; IC95 % 1,6-15,1) y ansiedad (OR: 8,5; IC95 % 2,5-28,6) en el modelo de regresin logstica. Conclusiones. Un porcentaje significativo de magistrados del Distrito Judicial de Lima presentan altos niveles de estrs, ansiedad y depresin; un cuarto de los encuestados presentan, al menos, una de estas condiciones. Se recomienda que los programas de intervencin y prevencin se dirijan al manejo del estrs, ansiedad y depresin en conjunto, dada su alta asociacin. Palabras clave: Sistema de justicia; Poder judicial; Estrs laboral; Depresin; Ansiedad; Salud mental (fuente: DeCS BIREME).

STRESS, ANXIETY AND DEPRESSION IN MAGISTRATES FROM LIMA, PERU


ABSTRACT Objective. To measure the general and work related stress, depression and anxiety in Magistrates (Judges and District Attorneys) of Lima Judicial District. Material and methods. We carried out a transversal and descriptive study. A population of 1137 magistrates from the Lima Jurisdictional District of the Judicial System, was randomly sampled by a strata representing every agency of the Judicial System. The final sample included 287 magistrates: 138 District Attorneys and 149 Judges. After informed consent, a questionnaire composed by four previously validated instruments was applied to measure general and work related stress, anxiety and depression. Results. General stress was present in 18.5 % of the participants; work related stress 33.7 %; anxiety 12.5 %, and depression 15 %. All three conditions were present in 6.6 % of the participants and at least one in 25.9 %. General stress was associated to depression (OR: 4.9; IC95 % 1.6-15.1) and anxiety (OR: 8.5; IC95 % 2.5-28.6) by logistic regression. Conclusion. Lima Judicial Districts Magistrates present a triad composed by high levels of labor stress, anxiety and depression. A quarter of the participants present at least one of those conditions. In that perspective, it is recommended that intervention and preventive programs address stress, anxiety and depression simultaneously, given their strong association. Key words. Justice administration system; Judicial power; Burnout, professional; Depression; Anxiety; Mental health (source: MeSH NLM).

INTRODUCCIN
En el campo laboral, es conocido que el estrs produce daos en la salud con su consecuente impacto negativo en la productividad de los trabajadores (1). En el rea de
1

la magistratura peruana, desde diciembre de 2005 hasta agosto de 2008, Perales A. y Chue H., realizaron un estudio preliminar en una muestra conformada por 109 magistrados, participantes del proceso de evaluacin y ratificacin del Consejo Nacional de la Magistratura

Instituto de tica en Salud, Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Per. Academia Nacional de Medicina. Lima, Per. 3 PSICOSALUD SAC. Lima, Per. 4 Facultad de Salud Pblica y Administracin, Universidad Peruana Cayetano Heredia. Lima, Per. 5 Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Per. a Mdico Psiquiatra, Doctor en Medicina, Diplomado en tica y Deontologa en Salud; b Mdico Psiquiatra; c Estadstico, postgrado en demografa y salud pblica; d Mdico Psiquiatra, Magister en Medicina
2

Recibido: 12-04-11

Aprobado: 07-12-11

581

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Perales A et al.

(CNM); de ellos, el 62 % inform experiencias subjetivas de elevado estrs y, en el aspecto fsico, el 61 % inform padecer de diversas enfermedades mdicas (hipertensin arterial, trastornos digestivos, sobrepeso y otras). As mismo, la prevalencia de vida para trastornos de ansiedad fue del 27 y 35 % para trastornos depresivos (2). Este escenario tan preocupante motiv al CNM, en concordancia con el Poder Judicial (PJ) y el Ministerio Pblico (MP), a evaluar el problema con la finalidad de determinar su importancia y proponer, de ser necesario, un programa de intervencin preventivo y correctivo que proteja la salud integral de los magistrados para que cumplan con sus funciones en las mejores condiciones. Sin embargo, la investigacin cientfica en magistrados es prcticamente inexistente en el pas. En tanto, en el mbito internacional, Brerner (3), realiz un estudio en magistrados de Estados Unidos, en el que evalu el impacto de un programa que identifica estrs ocupacional, tensin personal y fuentes de afrontamiento; encontr que el estrs ocupacional se manifiesta como tensin fsica y mental, sintomatologa que podra reducirse de ofrecer al juez una fuente de soporte social, tal como un mentor o gua. Luego de un periodo de cinco meses, en la que se designaron jueces especialmente capacitados para dar soporte social a los magistrados recientemente nombrados, los resultados sealaron, inicialmente, un bajo puntaje de estrs y de tensin, y elevado puntaje en habilidades de afronte. Concluyeron as, que el soporte social dado por los mentores debera ser considerado en la formacin tradicional de los jueces. Novaes y Sacramento realizaron en Brasil un estudio sobre estrs ocupacional, fuentes de estrs y estrategias de afrontamiento en jueces laborales. El 71 % de los jueces present sntomas significativos de estrs, con afectacin de su calidad de vida, particularmente en las reas afectiva y de salud general. La mayor fuente de estrs es el nmero excesivo de procesos a juzgar; la estrategia de afronte ms usada fue conversar con el o la cnyuge, o con una persona a quien estimara de forma particular. Los sntomas de estrs ms frecuentes fueron la sensacin de agotamiento, cansancio y tensin muscular; pero solo una minora mencion el uso de terapia, el deporte o tcnicas de relajacin. Se concluy que los jueces laborales tenan una percepcin de su profesin similar a la de los trabajadores de minas o pilotos de avin. Por ello, los autores plantean una especial atencin preventiva y de aprendizaje de estrategias de afrontamiento al estrs (4). Estos resultados son compartidos por Pereira da Silva, que identific factores que desencadenan el estrs en 930 magistrados del Tribunal de Justicia del Estado de Minas Gerais, Brasil. Sus resultados sealan que la

percepcin de estrs estuvo influenciada por los cambios sociales, el avance tecnolgico y la globalizacin, que contribuyen y favorecen la acumulacin de trabajo judicial (5). Hunter, al evaluar el estrs judicial y establecer estresores para asociarlos con el desempeo laboral, encuentra una relacin significativa entre el incremento de los sntomas de Burnout (agotamiento extremo fsico y mental) y el incremento de los sntomas del estrs (6). Por otro lado, el avance tecnolgico se ha convertido en un estresor para los magistrados. Salanova menciona que: Internet, la telefona mvil, el tele-trabajo y la sociedad de la informacin, son cada vez ms familiares, constituyndose en estresores tecnolgicos que afectan tanto la vida privada como pblica; aadiendo un riesgo ms a la carga mental de los magistrados como sobrecarga informativa (7). La Psiquiatra actual postula una relacin entre estrs y depresin (8) y entre estrs y ansiedad (9). Por todo ello, y dada la falta de informacin sobre este tema en el Per, el objetivo principal del presente trabajo es determinar los niveles de estrs general y laboral, de ansiedad y de depresin en magistrados (jueces y fiscales) de una muestra representativa del Distrito Judicial de Lima.

MATERIALES Y MTODOS
Se realiz un estudio observacional y descriptivo, cuyo universo estuvo constituido por los magistrados del Distrito Judicial de Lima, que se encontraban en actividad en el momento de la investigacin (abril, 2009), considerando entre ellos a los del magistrados del Ministerio Pblico y del Poder Judicial. La poblacin total comprendi 1137 magistrados, siendo 635 del Ministerio Pblico y 502 del Poder Judicial. El tamao de la muestra fue determinado considerando un nivel de confianza del 95 %, un margen de error relativo del 10 %, con una proporcin de estrs general del 50 %, con una correccin para poblaciones finitas. La muestra estuvo constituida por 287 magistrados (138 del Ministerio Pblico y 149 del Poder Judicial), los cuales constituyen el 25 % del total de magistrados del mbito mencionado. Se emple un muestreo estratificado (el Ministerio Pblico y el Poder Judicial constituyeron un estrato cada uno), sistemtico y aleatorio, independiente en cada estrato, con una asignacin proporcional al nmero de magistrados de cada institucin. El marco de muestreo para la seleccin de los magistrados estuvo constituido por la relacin de magistrados de cada institucin, proporcionadas por el CNM.

582

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Estrs, ansiedad y depresin

Se asegur el anonimato de los informantes, empleando un cdigo individual que permiti relacionar los resultados obtenidos. Asimismo, previo al estudio, se solicit el consentimiento informado a cada participante. El estudio cont con la aprobacin del CNM. INSTRUMENTOS Se emple un cuestionario autoadministrado y estructurado de cinco partes, cada una permita la evaluacin de un aspecto especfico del estudio: datos generales, estrs general, depresin, ansiedad y estrs laboral en magistrados. Cada seccin fue elaborada segn las siguientes consideraciones: Breve cuestionario sobre el estrs general (10). Consta de trece tems que tienen un puntaje de 0 a 4 que discriminan el nivel de estrs; de acuerdo con sus instrucciones, el punto de corte para identificar a personas que no manejan adecuadamente el estrs es 15. Escala de autoevaluacin de la depresin de Zung (11). Consta de veinte tems y discrimina sntomas de depresin (punto de corte: 50). Validada en el Per por Novara et al (12). Escala de automedicin de la ansiedad de Zung (13,14). Consta de veinte tems y discrimina sntomas de ansiedad (punto de corte: 50), se us la versin validada al espaol. Cuestionario de factores de estrs laboral para magistrados. Cuestionario construido ad hoc para el presente estudio por Perales A, Chue H, Padilla A y Barahona L, en el 2008. Esta seccin fue construida en base a temas identificados en una sesin dirigida en la que participaron 35 magistrados, como parte de las actividades preparatorias de la investigacin y prueba de instrumentos. En dicha sesin se identificaron quince problemas que se transformaron en preguntas. Cada una de ellas consta, a su vez, de cuatro opciones de respuesta (1= raramente a 4 = siempre). Mediante la aplicacin del anlisis de componentes principales, se determinaron cuatro componentes que explicaban el 61,9 % de la varianza total de los datos. Tales dimensiones fueron: a) Los aspectos relacionados con el ambiente laboral (organizacin, carga procesal, personal y apoyo logstico, infraestructura institucional y relaciones interpersonales). b) La presin social a la que estn sometidos los magistrados, por parte de la opinin pblica y los abogados litigantes.

c) Los factores relacionados con la superacin profesional y la estabilidad en el cargo, destacando la fuerte presin que experimentan los magistrados por el proceso de evaluacin y ratificacin a cargo del Consejo Nacional de la Magistratura; el esfuerzo que les demanda los estudios (posgrado y otros) necesarios para avanzar acadmica y profesionalmente, as como para adquirir nuevos conocimientos para resolver la complejidad de los casos. d) El trato que reciben de parte de sus superiores. En una sesin posterior el cuestionario fue aplicado a otro grupo de magistrados con cuyas respuestas se construy una base de datos y se hizo el anlisis de consistencia interna empleando el coeficiente alfa de Cronbach, que fue de 0,863. La escala permita una calificacin de 15 a 60 puntos; al realizar la distribucin de los valores obtenidos en el piloto, decidimos colocar como punto de corte 33 puntos, pues sobre dicho valor se encontraba un tercio de la poblacin participante; a este grupo lo calificamos como posibles portadores de estrs laboral. La evaluacin de los magistrados se realiz en dos momentos. En el primero, un grupo de enfermeras midi el peso, estatura y presin arterial de cada magistrado con instrumentos calibrados de uso mdico. En segundo lugar, los magistrados procedieron a llenar los cuestionarios. Luego se realiz el anlisis de la informacin. PROCESAMIENTO DE LOS DATOS Para la determinacin de los niveles de estrs, de ansiedad y de depresin se sumaron los puntajes obtenidos en cada una de las preguntas de las secciones correspondientes de la encuesta para luego, siguiendo las recomendaciones de los autores de los respectivos instrumentos, clasificarlos en dos niveles, normal y alto, en cada uno de ellos. Se hicieron estimaciones puntuales y de intervalos al 95 % de confianza para las variables de estrs general y laboral, depresin y ansiedad. Se contrastaron hiptesis mediante las pruebas t de Student para las variables de intervalo, y chi cuadrado y odds ratios para las variables categricas. Tambin se aplic un modelo de regresin logstica para evaluar el efecto de diferentes covariables en las variables fundamentales de la salud mental en relacin al estrs general. En todos los casos se consider un nivel de significancia mximo del 5 %. Los anlisis fueron realizados con el paquete estadstico SPSS versin 15.

583

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Perales A et al.

RESULTADOS
CARACTERSTICAS GENERALES DE LA POBLACIN De los 287 magistrados entrevistados, el 53 % eran varones; el 25 % era menor de 40 aos y 50 % entre 50 a ms aos. Con relacin al estado civil, 68 % era casado, 20 %, soltero y 18 % corresponda a la categora otros (viudos, divorciados o convivientes). En cuanto al periodo de antigedad como magistrado, 34 % tena 10 o ms aos, 35 % entre 5 y 9 aos, y 31 % menos de 5 aos. Con relacin al cargo, en el Ministerio Pblico, 58,7 % corresponda a fiscal provincial adjunto, 26,1 % a fiscal provincial y 15,2 % a fiscal superior, supremo y adjunto supremo. En el Poder Judicial, 18,8 % a juez de paz letrado, 68,5 % a juez especializado y 12,7 % a vocal superior. Durante la evaluacin mdica, se determin que el 62,2 % tena sobrepeso, aunque esta condicin era mayor en los magistrados del Poder Judicial (66,7 %) que en el Ministerio Pblico (56,9 %). Mientras, la prevalencia de presin arterial elevada fue de 20,2 %; aunque difiri segn la institucin donde labora el Magistrado, siendo menor en el Ministerio Pblico (13 %) que en el Poder Judicial (26,8 %). ESTRS GENERAL Y LABORAL La prevalencia de estrs general encontrada fue de 18,5 % (IC95%: 13,9 a 23,0 %) en el nivel alto; aunque la prevalencia fue mayor en el Ministerio Pblico (19,6 %) que en el Poder Judicial (17,4 %) y mayor en el sexo masculino (23 %) que en el femenino (14,5 %). La prevalencia de estrs laboral se determin en 33,7 %; aunque esta fue mayor en varones (43,9 %), y en magistrados entre 5 a 10 aos de servicio (43,3 %); las dems caractersticas se observan en la Tabla 1.

Estrs

8,1 2,4 6,6 2,9 1,4 3,1

1,4

Depresin

Ansiedad

Figura 1. Porcentajes de estrs general, depresin y ansiedad en magistrados de Lima.

ANSIEDAD Y DEPRESIN La prevalencia de ansiedad fue de 12,5 % (IC 95 %: 8,7 a 16,4 %); menor en el sexo masculino (11,9 %) que en el femenino (13,2 %). La prevalencia de depresin fue de 15,0 % (IC 95 %: 10,8 a 19,1 %): menor en el sexo masculino (12,6 %) que en el femenino (17,1 %). Al calcular el riesgo en relacin al nivel de estrs laboral, se identific que un mayor nivel de estrs laboral est relacionado con un mayor nivel de depresin (OR: 4,87; IC 95 %: 1,57-15,09). ASOCIACIN DE VARIABLES La ansiedad, depresin y estrs general, estuvieron presentes en el 6,6 % de los magistrados encuestados; mientras que el 25,9 % tenan al menos una de estas condiciones. Se aprecia una asociacin entre el nivel de estrs general y los niveles de ansiedad (p <0,001) y depresin (p <0,001). En el anlisis bivariado el estrs general se asoci con un riesgo 12,3 veces mayor de tener depresin (IC: 5,92 25,52), mientras la ansiedad lo estuvo en 13,0 veces (IC: 5,98 28,4). Al realizar el

Tabla 1. Niveles de estrs general, estrs laboral, depresin y ansiedad, segn sexo, edad y aos de magistrado
Caractersticas TOTAL Sexo Masculino Femenino Edad <40 40 a <50 50 a ms Aos de magistrado <5 5 a <10 10 a ms Estrs general (%) 18,5 23,0 14,5 14,9 20,6 17,1 20,0 23,2 11,0 Estrs laboral (%) 33,7 43,9 25,5 21,7 42,5 30,8 30,8 43,3 25,8 Depresin (%) 15,0 12,6 17,1 14,9 12,5 18,4 16,5 15,8 13,2 Ansiedad (%) 12,5 11,9 13,2 10,4 11,8 15,8 10,6 15,8 12,1

584

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Estrs, ansiedad y depresin

Tabla 2. Asociacin entre estrs general condiciones en magistrados de Lima, Per.


Variables OR crudo (IC 95 %) 13,03 (5,98 28,42) 1,76 ( 0,96 3,22) OR ajustado (IC 95 %) 4,87 (1,57-15,09) 8,48 (2,52-28,60)

y otras

aumentar en la medida que el sujeto considere que la situacin supere sus posibilidades de control. Finalmente, Valds y De Flores (18) sealan: el estrs es una activacin autonmica y neuroendocrina, de naturaleza displacentera, que implica un fracaso adaptativo con cognicin de indefensin e inhibicin inmunolgica y conductual. El saberse indefensos es la vivencia del sujeto de no poder hacer nada ante el peligro y debe rendirse ante l. La inhibicin inmunolgica reduce los mecanismos biolgicos de defensa aumentado el riesgo a sufrir enfermedades, particularmente aquellas a las que se tenga una predisposicin gentica. Desde el punto de vista clnico, cada persona tiene un umbral de percepcin del estrs que depende de diversos factores, como son: su estado fsico; su experiencia personal y condicionamientos previos; la calidad e intensidad de los estresores; su grado de distorsin de la situacin estresante; la eficacia de sus mecanismos de respuesta (fisiolgicos y psicolgicos); su locus de control (es decir, si para el manejo del estrs el sujeto depende fundamentalmente de la ayuda de otros -locus externo- o si est convencido que puede manejarlo solo -locus interno-); y su soporte social (la ayuda real y el soporte afectivo disponibles). Todo ello se resume en la siguiente frmula: estrsvulnerabilidad-enfermedad, lo que significa que, si bien el estrs es parte de la vida normal, el exceso constituye una amenaza para la salud del sujeto, pues, de ceder sus resistencias, particularmente en sus puntos vulnerables (predisposiciones genticas), se desencadenar la enfermedad en el momento que sus mecanismos de adaptacin resulten insuficientes. La literatura internacional destaca la importancia del estrs en enfermedades fsicas, sospechando mecanismos inflamatorios (19). En el campo de la salud mental, algunos autores lo consideran como paso previo a la enfermedad psiquitrica y, otros, como un trastorno especfico (1,20). El estrs laboral, que est presente en 33,7 % de los magistrados, se explica por cuatro factores que podran tener una explicacin independiente: a) Los relacionados con el ambiente laboral, particularmente vinculados a la alta carga procesal con apoyo logstico insuficiente, que los obliga a un constante esfuerzo de alcance de metas presionados por lmites de tiempo; b) La presin social ejercida por la opinin pblica y los abogados litigantes, ante los cuales, en muchos casos, se sienten sin poder de accin; c) Las tensiones vinculadas con la superacin profesional y la estabilidad en el cargo, pues la presin que sienten respecto al proceso de

p 0,006 0,001

Depresin 12,29 (5,92 25,52) Ansiedad Sexo Sobrepeso 0,72 ( 0,37 1,41)

0,40 ( 0,16 - 1,01) 0,052 3,28 ( 1,26 - 8,53) 0,015

anlisis multivariado, ajustado con sobrepeso y sexo, el OR para depresin fue de 4,9 (1,6-15,1) y de ansiedad de 8,5 (2,5-28,6). Los valores ajustados para sobrepeso y sexo estn en la Tabla 2.

DISCUSIN
En medicina, el estrs corresponde al estado de tensin fsica y psicolgica que sufren los seres vivos en su proceso de adaptacin al medio que los rodea. Los factores que lo generan se denominan estresores, y el entorno en el cual aparecen, situacin estresante. El estrs ha sido estudiado bajo diferentes modelos explicativos. Hans Selye, propulsor del primero de ellos y creador del concepto que lo condujo a formular su teora general de adaptacin (15), plantea en esta en tres fases: alarma, resistencia y agotamiento. La teora de Selye considera que todo ser vivo existe en continuo estrs pues la vida constituye un permanente esfuerzo de adaptacin; es decir, vivir es adaptarse a las exigencias del ambiente utilizando los mecanismos fisiolgicos que el organismo proporciona. A estos mecanismos fisiolgicos deben aadirse los de orden psicolgico, derivados de lo que, en general, denominamos salud mental. En 1974, Selye resumi su teora, explicndola como una respuesta general inespecfica, que puede ser originada por eventos psicolgicos y reducida por varias tcnicas teraputicas (16). Lazarus y Folkman (17) aadieron al modelo una interesante variable. Propusieron que la intensidad de esta depende del significado que el sujeto asigne al estresor, sin que necesariamente refleje con exactitud lo que en la realidad ocurre. Una persona puede interpretar una situacin como amenazante (estrs) sin que en realidad sea as; es decir, el sujeto puede distorsionar lo que percibe. Desde esta perspectiva, los autores citados lo definen as: El estrs es una reaccin particular entre el individuo y su entorno, evaluada por aqul como amenazante o desbordante de sus recursos poniendo en peligro su bienestar. Es decir, que el nivel de estrs

585

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Perales A et al.

evaluacin y ratificacin del Consejo Nacional de la Magistratura es muy alta, donde no aprobar, implica cese en sus labores y un futuro incierto. La bsqueda de nueva ubicacin laboral, problema serio en un pas en desarrollo, especialmente si ya se tiene una carga familiar y un cmodo nivel de vida, exigir nueva carga de estrs y esfuerzos de adaptacin; d) El trato que reciben de parte de sus superiores, en el cual la queja de los magistrados se vincula con una percepcin de poco reconocimiento institucional al mrito de sus esfuerzos y a una ausencia de mecanismos de soporte emocional en momentos difciles. Al respecto, Novaes y Sacramento, aunque con diferente metodologa, encuentran en jueces laboralistas alta percepcin de estrs, con un puntaje promedio de ocho en una escala decimal, y que los estresores ms frecuentes se vinculan con sobrecarga de trabajo e interferencia con su vida familiar (4). Mientras que Resnick, Myatt y Marotta encuentran que los estresores que afectan a los jueces se vinculan con el exceso de casos con severos lmites de tiempo, aislamiento social, falta de privacidad y el peso emocional de tener que decidir el destino de otros (21). Y Tsai y Chan encuentran riesgo de burn out (sndrome de agotamiento) por estrs ocupacional en magistrados de Taiwan (22), mientras que Rogers et al., en un estudio de 104 jueces canadienses encuestados annimamente, as como 48 de sus esposas, vincularon los factores de estrs a establecer sentencias, asignar nios a custodia, tomar decisiones y al proceso del juicio especialmente con relacin a los jurados (23). En el Per, lamentablemente, no existe otra estimacin de estrs laboral en magistrados con la cual pudiramos comparar nuestros resultados. La nica comparacin posible sera con estrs laboral en poblacin general adulta de Lima Metropolitana. Por ello, aunque con todas las limitaciones que impone el uso de diferentes metodologas y poblaciones de estudio, sealamos que el Estudio Epidemiolgico de Salud Mental, realizado en Lima en el 2002 (24), encontr entre los estresores vinculados al trabajo o al estudio (en otras palabras ocupacional) una prevalencia del 26 %. Insistimos en que, aunque los datos no son estrictamente comparables por las razones ya expuestas, el 33,7 % de prevalencia de estrs laboral hallado en nuestro estudio aparece como un valor que requiere atencin pues es mayor que en la poblacin general. Entre las condiciones mdicas identificadas, si suponemos que todos los pacientes con presin arterial elevada en una sola toma tenan el diagnstico de hipertensin arterial; la prevalencia de la hipertensin estara dentro de los lmites sealados por el Informe sobre Factores de Riesgo de las Enfermedades

Cardiovasculares en el Per, 2006 (Estudio Tornasol) (25) para poblacin general. Pero, llama la atencin la alta prevalencia de sobrepeso (62,2 %), en especial en el Poder Judicial (66,7 %). De otro lado, la prevalencia de ansiedad encontrada fue de 12,5 %. El valor de referencia ms aproximado para esta estimacin es 7,3 % correspondiente a poblacin general de Lima, informada en la Encuesta de Salud Mental de Lima Metropolitana (24). Nuevamente debemos sealar, como en el caso del estrs antes comentado, que aunque los datos no son estrictamente comparables por razones metodolgicas, las diferencias apuntan a un hallazgo importante. Se destaca, adems, que aquellos magistrados que practican actividades recreativas muestran menores niveles de ansiedad en comparacin con los que no las practican, ello destaca el efecto protector contra la ansiedad (p= 0,001) de estas actividades. Del mismo modo, el nivel de depresin en nuestro estudio fue de 15,0 %. En el estudio metropolitano ya mencionado, encontraron una prevalencia de 6,6 % para episodios depresivos (24). Reiteramos la limitacin metodolgica comparativa ya explicada. Tambin respecto al nivel de depresin se observ el efecto protector de las actividades recreativas (p= 0,001), tal como actualmente se acepta en teraputica psiquitrica. Al respecto Neto Magalhes y Frana, encuentran una reduccin de 21 % en el nivel de estrs en estudiantes sometidos a un programa de ejercicios fsicos de resistencia en comparacin con el grupo control que no lo practic (26); por lo que las actividades fsicas seran de gran ayuda teraputica. Por ltimo, recordemos que en psiquiatra es frecuente observar el fenmeno de comorbilidad (27). El hallazgo de la asociacin del estrs general, ansiedad y depresin sugiere que estos tres factores se refuerzan y, probablemente, incrementen as su potencial patognico. Surge as, como hiptesis generada por nuestro estudio, que actuando estas variables en conjunto constituiran un factor de riesgo para la salud de los magistrados, particularmente de aquellos que por vulnerabilidad gentica o psicolgica, resulten ms sensibles a su influencia. En tal perspectiva, un programa preventivo o correctivo, debera dirigirse a atender estas entidades y no solo a una de forma independiente, como suele ocurrir, por ejemplo, con los actuales programas antiestrs. Deseamos sealar la necesidad de uniformar metodologas en estudios sobre estrs en magistrados, a fin de posibilitar estudios comparativos de resultados; la falta de investigacin en este campo en el Per

586

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Estrs, ansiedad y depresin

es evidente, y nos limita para mejorar nuestras recomendaciones. El no disponer de escalas validadas para la evaluacin de estrs o estrs laboral, limitan la precisin de los datos; en nuestro caso, empleamos una escala de Burnout diseada para personas sometidas a trabajos muy exigentes, que podran tolerar mejor el estrs; por ello las diferencias entre la prevalencia de estrs laboral y el estrs general en nuestro estudio. Por ltimo, el diseo del estudio no permite afirmar con precisin las correlaciones mostradas, lo cual se muestra en los amplios intervalos de confianza mostrados. En conclusin, en la poblacin estudiada, el estrs laboral, ansiedad y depresin estn presentes en una proporcin moderada de magistrados; estando alguna de ellas presente en un cuarto de la poblacin encuestada. Por tanto, se recomienda que los programas de intervencin y prevencin de trastornos en salud mental se dirijan al manejo del estrs, ansiedad y depresin en conjunto, dada su alta asociacin.

2. Perales A. Estudio de los niveles de estrs que afectan a la salud integral de los magistrados en la labor jurisdiccional y fiscal. Informe Final. Lima: Proyecto de Mejoramiento de los Servicios de Justicia; 2010 . 3. Brerner CF. Impact of a Mentoring Program on occupational stress, personal strain and coping resources of newly appointed U.S. Magistrate Judges [Tesis doctoral]. Des Moines, Iowa, EEUU: Drake University, School of Education; 2002. 4. Novaes Lipp M, Sacramento Tanganelli M. Stress e Qualidade de Vida em Magistrados da Justia do Trabalho: Diferenas entre Homens e Mulheres. Revista Psicologia Reflexo e Crtica. 2002;15(3):537-48. 5. Pereira J. Factores desencadeantes de estresse nos magistrados: o caso de Minas Gerais [Tesis de Maestra en Promocin de la Salud]. Sao Paulo, Brasil: Universidade de Franca; 2005. 6. Hunter TL. The relationship between judicial stress and job performance [Tesis doctoral]. California, EEUU: Alliant International University; 2007. 7. Salanova M. Trabajando con tecnologas y afrontando el tecnoestrs: el rol de las creencias de eficacia. Revista de Psicologa del Trabajo y de las Organizaciones. 2003;19(3):225-46. 8. Akiskal H. Mood Disorders: Introduction and Overview. En: Kaplan H, Sadock B (Eds). Textbook of Psychiatry. 6th edition. Vol. 1. Baltimore: Williams & Wilkins; 1995. 9. Xu K, Ernst M, Goldman D. Imaging genomics applied to anxiety,stress response, and resiliency. Neuroinformatics. 2006;4(1):51-64. 10. Ehrenreich John H. The relief worker burnout questionnaire. Mental Health Workers without Borders; 2001. 11. Zung WWK. A self-rating depression scale. Arch Gen Psychiatry. 1965;(12):63-70. 12. Novara J, Sotillo C, Warthon D. Estandarizacin y correlacin de las escalas de Beck, Hamilton y Zung para depresin en poblacin de Lima Metropolitana. Lima: Instituto Nacional de Salud Mental; 1985. 13. Zung WWK. A rating Instrument for anxiety disorders. Psychosomatics. 1971;12(6):371-9. 14. Lusilla MP, Snchez A, Sanz C, Lpez J. Validacin estructural de la escala heteroevaluada de ansiedad de Zung (XXVIII Congreso de la Sociedad Espaola de Psiquiatra). Anales de Psiquiatra. 1990;6(Sup 1):39. 15. Selye H. The Stress of life. New York: McGraw-Hill; 1956. 16. Selye H. Stress without distress. Philadelphia: J. B. Lippincott Co.; 1974. 17. Lazaruz RS, Folkman S. Estrs y procesos cognitivos. Barcelona: Ediciones Martnez Roca S.A; 1986. 18. Valds M, De Flores T. Psicobiologa del estrs. Barcelona: Ediciones Martnez Roca S.A.; 1990. 19. Black PH. The inflammatory consequences of psychologic stress: Relationship to insulin resistance, obesity, atherosclerosis and diabetes mellitus, type II. Med Hypotheses. 2006;67:879-91. 20. Rahe R. Stress and Psychiatry. En: Kaplan H, Sadock B. Comprehensive Textbook of Psychiatry. Baltimore: Williams & Wilkins; 1995.

AGRADECIMIENTOS
A los Drs. Maximiliano Crdenas Daz y Edmundo Pelez Bardales, expresidentes del Consejo Nacional de la Magistratura, por su constante apoyo y facilidades brindadas a la realizacin de este trabajo.

Contribuciones de autora
APer: concepcin del estudio, obtencin del financiamiento, diseo, construccin de instrumento interpretacin de resultados y redaccin del trabajo. APad: construccin de instrumento, anlisis e interpretacin de datos y en la revisin del informe final. HC y LB: aplicacin de encuestas, recoleccin de datos, revisin del informe final y obtencin del financiamiento.

Conflictos de inters
Los autores declaran que haber tenido relacin contractual con el Consejo Nacional de la Magistratura para la realizacin de la presente investigacin.

Fuentes de financiamiento
Financiado por el Proyecto de Mejoramiento de los Servicios de Justicia, teniendo como institucin participante al Consejo Nacional de la Magistratura (Contrato N. 026-2008/CI).

REFERENCIAS BIBLIOGRFCAS
1. King M, Stanley G y Burrows G. Stress. Theory and Practice. Sydney: Grune and Stratton Inc.; 1987.

587

Rev Peru Med Exp Salud Publica. 2011; 28(4):581-88.

Perales A et al.

21. Resnick A, Myatt K A, Marotta P V. Surviving bench stress. Family Court Review. 2011;49(3):610-7. 22. Feng-Jen T, Chang-Chuan C. Occupational stress and burnout of judges and procurators. Int Arch Occup Environ Health. 2010;83(2):133-42. 23. Rogers JM, Freeman SJ, LeSage P. The occupational stress of judges. Can J Psychiatry. 1991;36(5):317-22. 24. Instituto Nacional de Salud Mental. Estudio Epidemiolgico Metropolitano en Salud Mental, 2002. Informe General. Anales de Salud Mental. 2002;XVIII(1-2):1-197. 25. Segura L, Agusti R, Parodi J; Estudio TORNASOL. Factores de Riesgo de las Enfermedades Cardiovasculares en el Per. Rev Peru Cardiol. 2006;XXXII(2):82-128.

26. Neto Magalhes AM, Frana NM. Efeitos de um programa de exerccios resistidos sobre o estresse mental em estudantes do Ensino Mdio. R Bras Ci E Mov. 2003;11(4):33-6. 27. Popkin MK. Consultation-Liaison Psychiatry. En: Kaplan H & Sadock B. Textbook of Psychiatry. Baltimore: Williams & Wilkins; 1995.

Correspondencia: Alberto Perales Direccin: Av. Javier Prado Oeste 445 Of. 101, Lima 27, Per. Telfono: (511) 4764939. Correo electrnico: perales.alberto@gmail.com

Suscrbase en forma electrnica y gratuita a los contenidos de la Revista Peruana de Medicina Experimental y Salud Pblica, ingrese a www.ins.gob.pe, seleccione el cono de la revista y envenos sus datos.

588

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

ARTCULO ORIGINAL

POLIMORFISMO GENTICO DE LA APOLIPOPROTENA E EN UNA POBLACIN PERUANA


Victoria Marca1,a, Oscar Acosta2,b, Mario Cornejo-Olivas1,3,c, Olimpio Ortega1,b, Doris Huerta2,4,d, Pilar Mazzetti1,4,e
RESUMEN Objetivos. Determinar las frecuencias genotpicas y allicas del gen APOE en una muestra poblacional peruana. Materiales y mtodos. Estudio transversal analtico en 189 trabajadores voluntarios, aparentemente sanos, del Instituto Nacional de Ciencias Neurolgicas en Lima, Per, divididos en cinco grupos segn departamento de origen y ascendencia en dos generaciones. El ADN genmico fue amplificado mediante PCR-RFLP. Se realiz la deteccin de los fragmentos resultantes por electroforesis en gel de poliacrilamida al 12 %. Resultados. El alelo 3 es el ms frecuente en todos los grupos (93,9 %), con bajas frecuencias de los alelos 4 (5 %) y 2 (1,1 %). El anlisis de heterocigosidad (H) en cada grupo muestra una diversidad intermedia entre 10 y 20 %. Las diversidades genticas poblacional (Ht) e intrapoblacional (Hs), son 14,4 y 14,3 % respectivamente, sugiriendo proximidad gentica entre los grupos estudiados para el polimorfismo ApoE. Conclusiones. Las frecuencias allicas del gen ApoE encontradas muestra que el alelo 3 tiene una de las frecuencias ms altas y, el alelo 4, una de las ms bajas respecto a otros grupos poblacionales del mundo, con posibles implicancias en el riesgo para enfermedades neurolgicas, cardiovasculares y otras en nuestro pas. Palabras clave: Alelos; Apolipoprotenas E; Frecuencia de los genes (fuente: DeCS BIREME).

GENETIC POLYMORPHISM OF APOLIPOPROTEIN E IN A PERUVIAN POPULATION


ABSTRACT Objectives. To determine the allelic and genotypic frequencies of the APOE gene in a sample of a population group in Peru. Materials and methods. Cross-sectional analytic study in 189 apparently healthy volunteers, workers of the Instituto Nacional de Ciencias Neurolgicas in Lima, Per, divided into 5 groups by birth department and two generations ancestry. Genomic DNA was amplified using PCR-RFLP. The resulting fragments were detected by 12 % polyacrylamide gel electrophoresis. Results. The 3 allele is the most frequent in all the groups (93.9 %), with low 4 (5 %) and 2 (1.1 %) allele frequencies. The analysis of heterozygosity (H) for each group displays intermediate diversity between 10 and 20%. Population genetic diversity (Ht) and diversity within populations (Hs) are 14.43 % and 14.31% respectively, suggesting genetic proximity between the studied groups for the ApoE polymorphism. Conclusions. Allele frequencies of the ApoE gene found show that allele 3 has one of the highest frequencies and 4 allele one of the lowest compared to other population groups in the world, with possible implications in the risk of neurological, cardiovascular and other diseases in our country. Key words: Alleles; Apolipoproteins E; Gene frequency (source: MeSH NLM).

INTRODUCCIN
La apolipoprotena E (ApoE) es una glicoprotena de 34 kDa y 229 aminocidos que se encuentra formando parte de los quilomicrones, lipoprotenas de muy baja densidad (VLDL) y lipoprotenas de alta densidad (HDL), participa en el transporte y el metabolismo de lpidos plasmticos al actuar como ligando de

las lipoprotenas de baja densidad (LDL) y de los receptores de ApoE (1,2). El gen de la apolipoprotena E en el humano est localizado en el cromosoma 19 y la variacin gentica en este locus est determinada por tres alelos: 2, 3 y 4, cuya combinacin genera seis genotipos, siendo el alelo 3 el ms frecuente en todas las poblaciones mientras que el 4 es el alelo considerado ancestral, presente en primates como

Servicio de Neurogentica, Instituto Nacional de Ciencias Neurolgicas. Lima, Per. Centro de Investigacin de Bioqumica y Nutricin, Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Per. 3 Washington Universtity International Fogarty Scholars Program. Lima, Per. 4 Facultad de Medicina Humana, Universidad Nacional Mayor de San Marcos. Lima, Per. a Ingeniera Qumica; b Bilogo, genetista; c Mdico neurlogo; d Bilogo, Magster en Bioqumica; e Mdico neurlogo, Magster en Gestin Pblica
1 2

Recibido: 27-07-11

Aprobado: 26-10-11

589

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

Marca V et al.

homocigotos E4/E4 y en seres humanos en los que por mutacin aparecen posteriormente los alelos E2 y E3 (3,4). Las diferencias en los residuos 112 y 158 de la secuencia aminoacdica -determinada por la transicin citosina/timina en la secuencia del gen y el consiguiente intercambio entre una arginina y la cistena- son la base para la formacin de las tres isoformas proteicas: 2 (Cys112, Cys158), 3 (Cys112, Arg158) y 4 (Arg112, Arg158) (5). Diversos estudios clnicos y epidemiolgicos han aportado evidencias sobre la relacin entre los alelos y los genotipos de la ApoE con diferentes condiciones patolgicas, principalmente del metabolismo de los lpidos, enfermedades cardiovasculares y neurolgicas, entre otras (5,6). La presencia de, por lo menos, un alelo 4 se considera un factor de riesgo para la enfermedad de Alzheimer y otras demencias (7). El locus ApoE es polimrfico y muestra una variacin allica que va del 0 al 20 % para el E2; 60 al 90 % para el E3 (el ms frecuente) y 10 al 20 % para el E4 en diferentes poblaciones humanas, con algunas excepciones (7,8). Dado que la poblacin peruana es de origen multitnico y presenta un alto grado de mestizaje, y que no existe informacin sobre la prevalencia de polimorfismos de ApoE en esta poblacin, se realiz un estudio para determinar las frecuencias genotpicas y allicas del gen APOE en una muestra poblacional peruana.

amplificndose una secuencia de 227 pb, empleando cebadores (primers) especficos que flanquean al gen: 5 TCCAAGGAGCTGCAGGCGGCGCA 3 y 5 ACAGAATTCGCCCCGGCCTGGTACACTGCCA 3 con las siguientes condiciones: 94 C por 3 min, 30 ciclos (94 C por 30 min para la denaturacin, 65 C por 30 min para el alineamiento y 70 C por 1,5 min para la extensin) y, finalmente, 70 C por 10 min (9). Los productos amplificados fueron digeridos con la enzima HhaI por cuatro horas, sometidos a electroforesis en geles de poliacrilamida al 12 % y teidos con nitrato de plata, generndose bandas caractersticas para cada genotipo: 2/2 (91, 83, y 35 pb), 3/3 (91, 48 y 35 bp), 4/4 (72, 48 y 35 bp), 2/3 (91, 83, 48 y 35 pb), 2/ 4 (91,83, 72, 48 y 35 pb) y 3/4 (91, 72, 48 y 35 pb). Las frecuencias genotpicas y allicas fueron obtenidas por conteo directo. Se aplic el test exacto (10) para evaluar las frecuencias observadas segn lo esperado bajo la hiptesis del equilibrio de Hardy-Weinberg. Se realiz un anlisis de diversidad gentica: H (heterocigosidad para cada grupo poblacional), Ht (diversidad gentica en la poblacin total), Hs (diversidad gentica promedio intrapoblacional) y Gst (diferenciacin gentica entre poblaciones respecto a la diversidad gentica total) segn lo descrito por Nei et al. (11). Para comparar las frecuencias allicas de la ApoE en nuestra poblacin (n=189) con las informadas en otras poblaciones del mundo, se us la prueba X2 o el test exacto de Fisher segn corresponda ( = 0,05) considerando las categoras presencia y ausencia del alelo 4. Para el anlisis estadstico se us el paquete SPSS versin 15.0 y el programa de libre acceso Arlequn v3.11 para gentica poblacional (cmpg.unibe. ch/software/ arlequin3/) (12).

MATERIALES Y MTODOS
Se realiz un estudio transversal analtico. Se calcul el tamao de muestra para proporciones con una frecuencia esperada de 7,4 % (mestizos mexicanos) para el alelo E4 (8) y un 13 % por posibles prdidas o fallas tcnicas. Para el anlisis molecular se incluyeron 189 muestras de ADN de individuos voluntarios, aparentemente sanos, residentes en Lima, de un total de 750 trabajadores del Instituto Nacional de Ciencias Neurolgicas que siguen evaluaciones mdicas de rutina por ser trabajadores de salud; todos ellos sin relacin de parentesco, con informacin de su origen segn departamento y ascendencia hasta dos generaciones (tanto el participante como sus padres y cuatro abuelos eran nacidos en el departamento considerado de origen). Todos los participantes firmaron el consentimiento informado aprobado por el Comit de tica Institucional. Para la evaluacin gentica, el ADN genmico fue extrado de muestras de epitelio bucal, utilizando buffer de lisis y shock trmico (100 C) y ulterior resuspensin en Tris EDTA. Se determinaron los diferentes genotipos del ApoE mediante la tcnica PCR-RFLP

RESULTADOS
El grupo estudiado est constituido por 66 varones (34,9 %) y 123 mujeres (65,1 %), con edades entre 18 y 80 aos (43,2 13,1), diez personas (5,3 %) tuvieron 60 o ms aos. Los participantes fueron categorizados en grupos segn origen por departamento de nacimiento y ascendencia en las dos ltimas generaciones; se encuentran representados cinco departamentos de nuestro pas de las tres reas geogrficas: 121 personas de la costa (Lima y La Libertad), 58 de la sierra (Ayacucho y Junn) y diez de la selva (Loreto). La distribucin de las frecuencias genotpicas y allicas del gen APOE encontrada en los cinco grupos se describen en Tabla 1. Las distribuciones genotpicas observadas en los grupos, son concordantes con lo esperado bajo la hiptesis de

590

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

ApoE en una poblacin peruana

Tabla 1. Frecuencias genotpicas y allicas del polimorfismo ApoE en los grupos peruanos.
Frecuencias genotpicasa 2/3 Ayacucho Junn La Libertad Lima Loreto TOTAL
a b

Grupos

N 37 21 24 97 10 189 0,027 0,042 0,021 0,021

Equilibrio Hardy-Weinbergb 4/4 0,010 0,005 p DE 1 1 1 0,190 0,001 1 -

Frecuencias allicasc 2 0,014 0,000 0,021 0,031 0,000 0,011 3 0,932 0,952 0,896 0,933 0,900 0,939 4 0,054 0,048 0,083 0,036 0,100 0,050

3/3 0,865 0,905 0,792 0,918 0,800 0,884

3/4 0,108 0,095 0,166 0,052 0,200 0,090

No se encontraron genotipos 2/2 o 2/4. Las distribuciones genotpicas observadas en los grupos son concordantes con lo esperado bajo la hiptesis de equilibrio de Hardy-Weinberg (p > 0,05) .c La comparacin de las frecuencias allicas -considerando las categoras presencia y ausencia del alelo 4- entre todos los posibles pares de grupos, no muestran diferencias significativas (p > 0,05,segn X2 o test exacto de Fisher). DE: Desviacin estndar.

equilibrio de Hardy-Weinberg (p > 0,05), segn test exacto de Guo y Thompson. El genotipo 3/3 es el ms frecuente en todos los grupos, representando el 88,4 % del total. Los genotipos 2/2 y 2/4 no se encontraron en ninguno de los grupos, y el genotipo 4/4 alcanza solo un 0,5 % de total de individuos estudiados. El alelo 3 es el ms frecuente en todos los grupos (93,9 %), seguido del 4 (5 %) y del 2 (1,1 %), sin diferencias significativas (p>0,05) al comparar las frecuencias allicas entre pares de grupos. La evaluacin de la diversidad gentica en cada grupo (heterocigosidad H) nos muestra que el grupo de La Libertad es el ms diverso (19,4 %) para el polimorfismo ApoE, siendo el grupo de Junn el menos diverso (9,3 %). Tomados los cinco grupos como una poblacin nica para evaluar su diversidad gentica (Ht), el valor es 14,4 %, muy similar a la diversidad gentica promedio intrapoblacional (HS=14,3 %). La diferenciacin gentica entre Tabla 2. Anlisis de la diversidad gentica del polimorfismo ApoE en los grupos peruanos.
Procedencia Provincias Ayacucho Junn La Libertad Lima Loreto Total Ht Hs Gst ( %)
a b

los cinco grupos (Gst) es menor al 1 %, lo que indica similitud entre ellos, como se ve en la Tabla 2. En la Tabla 3 se comparan las frecuencias allicas del gen ApoE en la poblacin de estudio con las descritas para otras poblaciones del mundo, encontrndose diferencias significativas (p < 0,05) con la mayora de poblaciones al comparar el alelo 4.

DISCUSIN
El gen ApoE ha sido estudiado en muchas poblaciones, pues la presencia de al menos un alelo 4 est considerado como factor asociado o de riesgo en enfermedades neurodegenerativas y cardiovasculares, entre otras enfermedades (13-15). La composicin tnica de la poblacin peruana es compleja, con importante mestizaje, conformada por poblaciones originarias diversas con componente ulterior europeo, africano y asitico. No hemos encontrado trabajos previos de la distribucin del polimorfismo de este gen en nuestro medio. Respecto a la distribucin de genotipos en los cinco grupos, el 3/3 es el ms frecuente; encontramos una baja frecuencia de 4/4, solo presente en Lima y no encontramos 2/2 y 2/4 en ninguno de los grupos. Estos resultados concuerdan con lo observado en otras poblaciones amerindias nativas y mestizas (16,17) y sigue la tendencia observada para la distribucin de los genotipos ApoE en el mundo, es decir: 3/3 > 3/4 > 2/3 (8,18). Respecto a la distribucin de alelos, el 3 es el ms frecuente en los cinco grupos (93,9 %), siendo una de las frecuencias ms altas en el mundo mientras que el alelo 2 es el menos frecuente (1,1 %) (Tabla 3). Considerando la alta frecuencia de 3 y la baja frecuencia de 2 en

N 37 21 24 97 10

Diversidad gentica (Heterocigosidad, H) 0,129 0,093 0,194 0,128 0,189 0,144 0,143 0,810

Ht: diversidad gentica en la poblacin total. Hs: diversidad gentica promedio intrapoblacional. c Gst ( %): porcentaje de diferenciacin gentica entre grupos.

591

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

Marca V et al.

Tabla 3. Comparacin de las frecuencias allicas del gen ApoE en una poblacin peruana (n=189) con otras poblaciones.
Poblacin Amrica Per, 5 grupos Brasil, Wai Wai Brasil, Xavante Brasil, San Jos Chile, Santiago Colombia, Bogot Ecuador, Cayapas Mxico, mestizos Cuba Costa Rica USA, Pennsylvania frica Benin, Bariba Marruecos, Rabat Nigeria, nativos Sudfrica, Wentworth Uganda, nativos Europa Dinamarca, centenarios Finlandia Francia, Pars Alemania, Munster Hungra Irlanda, nativos Noruega Polonia Portugal, Lisboa Espaa, Barcelona Suiza, Ginebra R, Unido, Nottinghamshire Asia China India, Koch Japn, Shibata Corea, Chonju Taiwn Irn, sur Oceana Australia, nativos Australia, Tasmania
a

N 189 58 62 58 187 44 91 278 506 420 886 50 168 781 110 70 177 970 478 182 102 672 798 170 232 478 1888 118 3679 125 1126 50 286 198 64 51

2 0,011 0,020 0,000 0,040 0,070 0,080 0,000 0,032 0,070 0,030 0,070 0,110 0,050 0,064 0,190 0,157 0,127 0,057 0,085 0,096 0,064 0,052 0,058 0,076 0,073 0,071 0,070 0,123 0,076 0,032 0,046 0,040 0,075 0,063 0,000 0,147

Frecuencias allicas 3

pa <0,001 0,191 0,013 <0,001 0,514 <0,001 0,145 <0,001 0,514 <0,001 0,003 0,003 <0,001 <0,001 <0,001 0,011 <0,001 <0,001 0,010 0,033 <0,001 <0,001 0,005 0,030 0,003 <0,001 <0,001 0,140 <0,001 <0,001 0,991 0,082 0,988 <0,001 0,022

Referencia Este estudio


(16) (16) (8) (20) (21) (23) (22) (8) (8) (24)

0,939 0,510 0,980 0,840 0,740 0,852 0,720 0,894 0,800 0,910 0,820 0,750 0,840 0,684 0,540 0,593 0,774 0,770 0,800 0,805 0,838 0,790 0,744 0,818 0,830 0,820 0,820 0,729 0,855 0,968 0,849 0,910 0,846 0,886 0,740 0,735

0,050 0,470 0,020 0,120 0,190 0,068 0,280 0,074 0,130 0,060 0,110 0,140 0,110 0,252 0,270 0,250 0,099 0,180 0,110 0,099 0,098 0,150 0,198 0,106 0,090 0,100 0,110 0,148 0,069 0,000 0,105 0,050 0,079 0,051 0,260 0,118

(8) (8) (8) (8) (8)

(8) (25) (25) (8) (8) (25) (8) (8) (25) (25) (8) (8)

(26) (8) (8) (8) (8) (27)

(8) (8)

Valor de significancia despus de comparar las frecuencias allicas, considerando presencia y ausencia del alelo 4- de una poblacin peruana con otras poblaciones del mundo.

nuestra muestra, al igual que en nativos de Sudamrica, ello podra orientar a una historia evolutiva en comn tal y como han propuesto otros investigadores (8,16,18,19). Encontramos una frecuencia de 5 % para el alelo 4, similar a poblaciones de Asia y la India; aunque mucho menor si la comparamos con poblaciones de Africa y Oceana (8,16). Ello probablemente este en relacin con la ancestralidad del alelo 4. Los alelos 2 y 3 se encuentran cada vez ms representados en las diferentes poblaciones humanas en la medida en que acceden a alimentacin de mejor calidad y constantemente disponible (4,8).

La diversidad gentica en esta poblacin peruana (Ht), y la diversidad gentica promedio intrapoblacional (Hs) son 14,43 % y 14,31 % respectivamente, valores menores a los descritos en poblaciones de frica (47 y 44 %), Europa (35 y 34 %), Asia (27 y 26 %), Norteamrica (30 y 29 %), Sudamrica (37 y 34 %) y Oceana (49 y 44 %) (8); todo ello sugiere una diversidad relativamente baja en esta poblacin peruana para el polimorfismo ApoE. La diferenciacin gentica entre los cinco grupos (Gst) es tan solo del 0,81 %, considerada baja comparado con las poblaciones sudamericanas y de Oceana (7,9 y 9,1 % respectivamente) e inclusive por

592

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

ApoE en una poblacin peruana

debajo de poblaciones africanas, europeas, asiticas, norteamericanas y de la India con valores entre 1,2 y 4,6 % (8), lo cual sugiere similitud o proximidad gentica entre los grupos estudiados. Las frecuencias allicas del gen ApoE encontradas en nuestro estudio, siguen la tendencia observada en otras poblaciones y pases, es decir: 3 > 4 > 2 (8,18). La frecuencia del alelo 3 es de 93,9 %, una de las ms altas descritas; solo los xavante en el Brasil (98 %) y la regin de Koch en la India (96,8 %) tienen una frecuencia algo mayor (8,16). Al analizar la frecuencia del alelo 4 por categoras y su presencia y ausencia en esta poblacin peruana, comparada con las del continente americano, no encontramos diferencias con los xavante de Brasil, una poblacin colombiana y mestizos de Mxico y Costa Rica. Por el contrario, encontramos diferencias (p < 0,05) con los nativos wai wai y mestizos de Brasil, una poblacin chilena, nativos cayapa de Ecuador, una poblacin cubana y norteamericanos de Pensilvania (8, 16, 20-22). Cuando se compara la presencia del alelo 4 en esta poblacin peruana con la de otros continentes (Tabla 3), se observan diferencias con poblaciones de frica, Europa y Oceana (23-27). Con respecto a las poblaciones asiticas, las frecuencias allicas son diferentes a la de India y Japn; no encontramos diferencias con China, Corea, Taiwan e Irn. El alelo 4 tiene una de las frecuencias ms bajas respecto a la reportadas en otras regiones del mundo, lo cual puede tener implicancias en el riesgo de enfermedades como el Alzheimer, que es el tipo de demencia ms frecuente en nuestro pas (28). Las diferencias tnicas observadas significan que cada grupo poblacional debe conocer sus propias caractersticas genticas para respaldar las decisiones de salud pblica. Un estudio alemn sobre extraccin de ADN en tejido seo de cinco momias de la costa peruana, que analiza el gen APOE, encontr los tres alelos representados, aunque por el tamao de la muestra no se puede inferir distribucin de frecuencias (29). El grupo estudiado es relativamente pequeo y no incluye personas de todas las etnias que forman parte de nuestro pas, limitando la representatividad de la muestra para la poblacin peruana, pues solo se ha incluido a personas de cinco departamentos de las tres regiones del pas, sin relacin de parentesco y con permanencia familiar en el lugar de origen por dos generaciones. Si bien faltan incluir personas de otros lugares, los ndices de diversidad gentica indican similaridad para el polimorfismo ApoE

estudiado. Otra limitante es la ausencia de descarte sistemtica de deterioro cognitivo u otras condiciones neurolgicas asociadas al alelo 4 de ApoE en las evaluaciones de salud de rutina. En futuros trabajos se requiere una muestra mucho mayor, que incluya todos los departamentos y grupos tnicos del pas. En conclusin, el genotipo 3/3 y el alelo 3 son los ms frecuentes, y los alelos E4 y E2 son poco frecuentes en la poblacin estudiada. Esta caracterstica se observa tambin en cada uno de los cinco grupos determinados por el lugar de nacimiento. En comparacin a otras regiones del mundo el alelo E3 tiene una de las frecuencias ms altas y el alelo E4 una de las ms bajas. Los resultados de esta muestra poblacional peruana contribuyen a un mejor conocimiento de la variabilidad geogrfica y tnica del gen APOE en el mundo (3, 30). Este estudio nos aproxima a la distribucin del polimorfismo del gen APOE en poblacin peruana, y puede aportar informacin til para estudios de asociacin gentica con diversas enfermedades, su interaccin con otros genes y factores ambientales en nuestro medio.

AGRADECIMIENTOS
Al bilogo Ral Tito, por su apoyo logstico. A los Drs. Silvia Montano (NAMRU-6, Lima) y Joe Zunt (UW, Seattle), coordinadores del Programa Fogarty en el Per por su apoyo en la formacin de investigadores. Al Dr. Ignacio F. Mata por la revisin crtica del informe final.

Contribucin de autora

VM, OA, MCO, OO, DH y PM participaron en la concepcin del estudio, recoleccin de resultados, anlisis e interpretacin de datos, redaccin del manuscrito, revisin crtica del artculo y la aprobacin de la versin final a publicar. PM y MCO contribuyeron en recoleccin de datos y diseo del estudio, VM y OO contribuyeron en el procesamiento de las muestras, OA y DH contribuyeron en la creacin de la base de datos y el anlisis estadstico para gentica de poblaciones.

Fuentes de financiamiento

Este trabajo ha recibido el apoyo del National Institutes of Health Fogarty International Clinical Research Fellows Program at Vanderbilt University (R24 TW007988) y el Instituto Nacional de Ciencias Neurolgicas.

Conflictos de inters

Los autores declaran no tener conflictos de inters en la publicacin de este artculo.

593

Rev Peru Med Exp Salud Publica. 2011; 28(4):589-94.

Marca V et al.

REFERENCIAS BIBLIOGRFICAS
1. Mahley RW. Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. 1988;240(4852):622-30. 2. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, et al. ApoE promotes the proteolytic degradation of Abeta. Neuron. 2008;58(5):681-93. 3. Fullerton SM, Clark AG, Weiss KM, Nickerson DA, Taylor SL, Stengard JH, et al. Apolipoprotein E variation at the sequence haplotype level: implications for the origin and maintenance of a major human polymorphism. Am J Hum Genet. 2000;67(4):881-900. 4. Corbo RM, Scacchi R. Apolipoprotein E (APOE) allele distribution in the world. Is APOE*4 a thrifty allele? Ann Hum Genet. 1999;63(Pt 4):301-10. 5. Smith JD. Apolipoprotein E4: an allele associated with many diseases. Ann Med. 2000;32(2):118-27. 6. Bennet AM, Di Angelantonio E, Ye Z, Wensley F, Dahlin A, Ahlbom A, et al. Association of apolipoprotein E genotypes with lipid levels and coronary risk. JAMA. 2007;298(11):1300-11. 7. St George-Hyslop PH, Petit A. Molecular biology and genetics of Alzheimers disease. C R Biol. 2005;328(2):11930. 8. Singh PP, Singh M, Mastana SS. APOE distribution in world populations with new data from India and the UK. Ann Hum Biol. 2006;33(3):279-308. 9. Hixson JE, Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res. 1990;31(3):545-8. 10. Guo SW, Thompson EA. Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics. 1992;48(2):361-72. 11. Nei M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA. 1973;70(12):3321-3. 12. Excoffier L, Laval G, Schneider S. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online. 2005;1:47-50. 13. Verghese PB, Castellano JM, Holtzman DM. Apolipoprotein E in Alzheimers disease and other neurological disorders. Lancet Neurol. 2011;10(3):241-52. 14. Payami H, Kaye J, Heston LL, Bird TD, Schellenberg GD. Apolipoprotein E genotype and Alzheimers disease. Lancet. 1993;342(8873):738. 15. Cattin L, Fisicaro M, Tonizzo M, Valenti M, Danek GM, Fonda M, et al. Polymorphism of the apolipoprotein E gene and early carotid atherosclerosis defined by ultrasonography in asymptomatic adults. Arterioscler Thromb Vasc Biol. 1997;17(1):91-4. 16. de Andrade FM, Coimbra CE, Jr., Santos RV, Goicoechea A, Carnese FR, Salzano FM, et al. High heterogeneity of apolipoprotein E gene frequencies in South American Indians. Ann Hum Biol. 2000;27(1):29-34. 17. Demarchi DA, Salzano FM, Altuna ME, Fiegenbaum M, Hill K, Hurtado AM, et al. APOE polymorphism distribution among Native Americans and related populations. Ann Hum Biol. 2005;32(3):351-65. 18. Aceves D, Ruiz B, Nuno P, Roman S, Zepeda E, Panduro A. Heterogeneity of apolipoprotein E polymorphism in different Mexican populations. Hum Biol. 2006;78(1):65-75.

19. Cavalli-Sforza LL, Menozzi P, Piazza A. The history and geography of human genes. Princeton, NJ: Princeton University; 1994. 1088 p. 20. Quiroga P, Calvo C, Albala C, Urquidi J, Santos JL, Perez H, et al. Apolipoprotein E polymorphism in elderly Chilean people with Alzheimers disease. Neuroepidemiology. 1999;18(1):48-52. 21. Jacquier M, Arango D, Villareal E, Torres O, Serrano ML, Cruts M, et al. APOE epsilon4 and Alzheimers disease: positive association in a Colombian clinical series and review of the Latin-American studies. Arq Neuropsiquiatr. 2001;59(1):11-7. 22. Gamboa R, Vargas-Alarcon G, Medina-Urrutia A, Cardoso-Saldana G, Hernandez-Pacheco G, ZamoraGonzalez J, et al. Influence of the apolipoprotein E polymorphism on plasma lipoproteins in a Mexican population. Hum Biol. 2001;73(6):835-43. 23. Scacchi R, Corbo RM, Rickards O, Mantuano E, Guevara A, De Stefano GF. Apolipoprotein B and E genetic polymorphisms in the Cayapa Indians of Ecuador. Hum Biol. 1997;69(3):375-82. 24. Ganguli M, Chandra V, Kamboh MI, Johnston JM, Dodge HH, Thelma BK, et al. Apolipoprotein E polymorphism and Alzheimer disease: The Indo-US Cross-National Dementia Study. Arch Neurol. 2000;57(6):824-30. 25. Haddy N, De Bacquer D, Chemaly MM, Maurice M, Ehnholm C, Evans A, et al. The importance of plasma apolipoprotein E concentration in addition to its common polymorphism on inter-individual variation in lipid levels: results from Apo Europe. Eur J Hum Genet. 2002;10(12):841-50. 26. Hu P, Qin YH, Jing CX, Lu L, Hu B, Du PF. Does the geographical gradient of ApoE4 allele exist in China? A systemic comparison among multiple Chinese populations. Mol Biol Rep. 2011;38(1):489-94. 27. Bazrgar M, Karimi M, Fathzadeh M, Senemar S, Peiravian F, Shojaee A, et al. Apolipoprotein E polymorphism in Southern Iran: E4 allele in the lowest reported amounts. Mol Biol Rep. 2008;35(4):495-9. 28. Custodio N, Montesinos R, Escobar J, Bendez L. Prevalencia de demencia en una poblacin urbana de Lima-Per: estudio puerta a puerta. An Fac med. 2008;69(4):233-8. 29. Wiechmann I. Molecular genetic analysis of the polymorphic apolipoprotein E in modern and ancient human DNA samples. Anthropol Anz. 2000;58(1):93-8. 30. Eisenberg DT, Kuzawa CW, Hayes MG. Worldwide allele frequencies of the human apolipoprotein E gene: climate, local adaptations, and evolutionary history. Am J Phys Anthropol. 2010;143(1):100-11.

Correspondencia: Mara Victoria Marca Ysabel Direccin: Jr. Ancash 1271, Lima 1, Per. Telfono: (511) 4117779 Correo electrnico: peru.neurogenetica@gmail.com

594

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

ARTCULO ORIGINAL

DIFERENCIAS CLNICAS Y POLISOMNOGRFICAS ENTRE OBESOS Y NO OBESOS CON SNDROME DE APNEAS-HIPOPNEAS DEL SUEO
Jorge Rey de Castro1,2,3,a, Edmundo Rosales-Mayor2,4,b
RESUMEN Objetivos. Describir las diferencias clnicas y polisomnogrficas en pacientes obesos y no obesos con diagnstico del sndrome de apneas-hipopneas del sueo (SAHS). Materiales y mtodos. A los pacientes incluidos se les realiz un examen fsico, se aplic la escala de somnolencia de Epworth (ESE) y adems se les realiz una polisomnografa. Se consider obeso si el ndice de masa corporal (IMC) era mayor o igual a 30 kg/m2. Resultados. Se analizaron 408 pacientes con SAHS, de estos, 119 (47 %) fueron obesos. El SAHS fue leve en 101 (25 %), moderado en 91 (22 %) y severo en 216 (53 %). No hubo diferencias por sexo, edad y puntaje ESE al compararse obesos con no obesos. La diferencias del permetro cervical y presencia de somnolencia segn ESE fue significativamente mayor en obesos. Estos tuvieron mayor comorbilidad en trminos de dislipidemia, hipertensin arterial y enfermedad coronaria. De las variables polisomnogrficas, los ndices de eventos respiratorios fueron mayores en obesos, asimismo fueron peores los valores de saturacin de oxgeno. No hubo diferencias en el resto de variables. El anlisis de regresin mostr asociacin entre la obesidad y la severidad del SAHS. Conclusiones. El SAHS no es una enfermedad limitada a la poblacin obesa, aunque esta ltima tienen mayor comorbilidad y formas ms severas de enfermedad. Palabras clave: Apnea del sueo obstructiva; Obesidad; Transtornos por excesiva somnolencia; Polisomnografa; Per (fuente: DeCS BIREME).

CLINICAL AND POLYSOMNOGRAPHYC DIFFERENCES BETWEEN OBESE AND NON-OBESE PATIENTS WITH OBSTRUCTIVE SLEEP APNEA-HYPOPNEA SYNDROME
ABSTRACT Objectives. To describe the clinical and polysomnographyc differences between obese and non- obese patients with obstructive sleep apnea-hypopnea (OSAH) syndrome. Materials and methods. A physical examination, the Epworth Sleepiness Scale (ESS) and a polysomnography were performed to all included patients. Obesity was defined as a body mass index (BMI) of 30 kg/m2. Results. 408 patients with OSAH were analyzed, out of these, 119 (47 %) were obese. OSAH was mild in 101 (25 %), moderate in 91 (22 %) and severe in 216 (53 %). There were no age, sex and EES score differences between obese and non-obese patients. Cervical perimeter and sleepiness prevalence according to the ESS were significant higher in obese population. Obese patients had higher comorbidity related to dyslipidemia, high blood pressure and coronary disease. With respect to the polysomnographyc variables, the indexes of respiratory events and the levels of oxygen saturation were worse in obese patients. There were no differences in the other variables. The regression analysis showed association between obesity and OSAH severity. Conclusions. OSAH is a clinical condition not limited to obese population, although this group has a higher comorbidity and OSAH severity. Key words: Sleep apnea, obstructive; Obesity; Disorders of excessive somnolence; Polisomnography, Peru (source: MeSH NLM).

CENTRES-Clnica Anglo Americana. Lima, Per. Grupo de Investigacin en Sueo. Lima, Per. 3 Universidad Peruana Cayetano Heredia. Lima, Per. 4 Instituto Clnic del Trax, Hospital Clnic de Barcelona. Barcelona, Espaa. a Mdico Neumlogo y Trastornos Respiratorios del Sueo, Magister en Medicina; b Mdico Cirujano, Magister en Medicina, Mster en sueo: fisiologa y medicina
1 2

Recibido: 08-08-11

Aprobado: 12-10-11

595

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Rey de Castro J & Rosales-Mayor E

INTRODUCCIN
Los trastornos respiratorios del sueo constituyen un grupo frecuente de enfermedades en la prctica mdica. La clasificacin, propuesta por la American Academy of Sleep Medicine (AASM), de estas enfermedades, incluye al sndrome de apneas-hipopneas del sueo (SAHS), sndrome de apnea central, sndrome de hipoventilacin con hipoxemia y una miscelnea (1). En cuanto al SAHS, estudios epidemiolgicos de prevalencia importantes han determinado cifras que fluctan entre 2 a 6 % en poblacin general, mientras que en poblacin de 70 a 100 aos una prevalencia entre 15 a 26 % (2-4). La enfermedad es causada por eventos obstructivos parciales o totales de la va area alta durante el dormir, que llevan a una desaturacin de oxgeno intermitente, despertares electroencefalogrficos, fragmentacin del sueo, somnolencia diurna, cambios neurocognitivos y mala calidad de vida (5). Los sntomas ms frecuentes son ronquido intenso, pausas respiratorias durante el sueo con respiracin asfixiante y somnolencia diurna. Existe amplia documentacin sobre que el SAHS es un factor de riesgo de hipertensin arterial, enfermedad cardio y cerebro vascular, accidentes de trnsito durante la conduccin debido a somnolencia y muerte causada tanto por infarto de miocardio como accidente cerebro vascular (6).

de ingresar a la entrevista mdica, los pacientes firmaron el consentimiento informado y luego respondieron la escala de somnolencia de Epworth - versin peruana modificada (ESE-VPM) (9). La entrevista mdica y el examen fsico fue realizado por un especialista en medicina del sueo (JRC). Entre los 15 a 30 das posteriores a la consulta se practic una polisomnografa (PSG) supervisada, para ello se us el equipo Easy II de la Cadwell Inc. y EB Neuro B.E. Light. El arreglo polisomnogrfico empleado fue: EEG (C3-A2, C4-A1, 01-A2, 02-A1), electro oculograma (EOG) bilateral, electromiografa del mentn, flujo oronasal con thermistor, cnula nasal de presin (dispositivo PTAF de Pro-Tech), micrfono de ronquido en el rea pretraqueal, bandas de esfuerzo torcico y abdominal, oximetra de pulso, electrocardiograma en derivacin II, electromiografa de msculos tibiales anteriores en ambas extremidades y posicin corporal. De acuerdo con la clasificacin de la denominada American Sleep Disorders Association (ASDA) esta prueba de monitoreo corresponde a estudio de nivel I (10). Para los efectos de la clasificacin de los estadios del sueo se emple la descripcin original de Rechtschaffen y Kales (11). Se excluyeron pacientes con diagnstico previo de SAHS que usaban modalidades teraputicas tales como prtesis de avance mandibular o CPAP, pacientes operados de uvulopalatofaringoplasta, otra enfermedad asociada al sueo por historia clnica o polisomnografa, con trastornos del ciclo circadiano, con durmientes diurnos y cualquier condicin fsica (enfermedades neuromusculares, deformacin de caja torcica, alteraciones anatmicas de la va area derivada de accidentes o intervenciones quirrgicas) o psicolgica (depresin mayor, psicosis, trastorno bipolar o trastorno obsesivo compulsivo) que causara sesgos en los resultados. DEFINICIONES La apnea fue definida como cese completo o casi completo (mayor o igual al 90 %) de la seal del termistor y la cnula nasal con una duracin igual o mayor de diez segundos acompaada de una desaturacin mayor al 3 % o despertar (arousal) respiratorio de acuerdo con los criterios de la ASDA (12). La hipopnea fue definida como una reduccin discernible (mayor o igual al 50 %) de la seal del termistor, o de la cnula nasal igual o mayor de diez segundos acompaada de una desaturacin mayor del 3 % o arousal respiratorio. Los episodios respiratorios fueron obstructivos si se acompaaban de esfuerzo traco-abdominal, centrales si estaba ausente y mixtos cuando coexistan ambos, comenzando por el componente de tipo central y finalizando con el

Est reconocido que la obesidad es el factor de riesgo ms importante para desarrollar SAHS en poblacin adulta de la edad media de la vida, el incremento moderado del peso corporal aumenta el riesgo y est documentada la relacin aritmtica entre el incremento o disminucin del peso y la variacin respectiva del ndice de apnea hipopnea (IAH) (7). De otro lado, el incremento de la obesidad acelera la progresin de la enfermedad (8). Los cambios de estilo de vida y la dieta con bajo contenido calrico constituyen el tratamiento de primera lnea en pacientes con SAHS leve (7). El objetivo de esta investigacin es describir las diferencias del comportamiento clnico y polisomnogrfico en pacientes obesos y no obesos con diagnstico documentado de SAHS.

MATERIALES Y MTODOS
La poblacin reclutada para el estudio forma parte de la cohorte del Centro de Trastornos Respiratorios del Sueo (CENTRES) de la Clnica Anglo Americana en Lima-Per, todas las variables fueron registradas prospectivamente en una base de datos del programa Access versin 11 (Microsoft Corp, Redmond, Washington, EEUU). Antes

596

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Sndrome de apneas-hipopneas del sueo en no obesos

obstructivo. Los esfuerzos respiratorios asociados a microdespertares (ERAM) tambin llamados RERAS se definieron de acuerdo con los criterios de la AASM (13). El IAH fue calculado sumando las apneas e hipopneas y dividiendo entre el nmero total de horas de sueo. El ndice de disturbio respiratorio (IDR) fue calculado por la sumatoria de apneas, hipopneas y ERAM dividiendo entre el nmero total de horas de sueo. El nadir de la saturacin nocturna de oxgeno o desaturacin mxima (DesatMax) como el valor mnimo de oximetra de pulso alcanzado durante el sueo. Tiempo porcentual de sueo con saturacin de oxgeno por debajo de 90 % (T90), definido como el cociente entre el tiempo en minutos con valores de saturacin bajo 90 % dividido entre el tiempo total en minutos de sueo y luego multiplicado por 100. Toda la calificacin de los estadios de sueo y eventos respiratorios se realizaron en forma manual. Se estableci la categora hipertensin arterial (HTA) de acuerdo con los criterios del sptimo reporte de la Joint National Committee si la presin arterial sistlica era 140 mmHg o la presin arterial diastlica 90 mmHg o si el paciente acuda a la consulta empleando al menos un medicamento para controlar la hipertensin (14). La dislipidemia fue definida de acuerdo con las pautas de Fredrickson et al. (15) y la insuficiencia cardiaca de acuerdo con la clasificacin funcional de la Asociacin Cardiolgica de Nueva York (16). Enfermedad coronaria como historia de angina o infarto al miocardio o colocacin de por lo menos un stent coronario o ciruga de puentes aorto-coronarios. Los estudios de PSG fueron de noche partida (PSGNP) y noche completa (PSG-NC). En PSG-NP se indic titulacin del CPAP (Continuous Positive Airway Pressure o presin positiva continua en la va area) en la segunda parte del estudio si el paciente cumpla con uno de los siguientes criterios: IAH 20 o ms por hora o 40 eventos obstructivos en dos horas o eventos obstructivos con desaturacin asociada con arritmias malignas (fenmeno R sobre T, taquicardia ventricular polimrfica o sostenida y fibrilacin ventricular). Si el paciente no cumpla los criterios sealados se continuaba el registro nocturno sin interrupciones, por lo que este tipo de polisomnografa se calific como PSGNC. Basndonos en las publicaciones de Sanders (17) y Khawaja (18), los pacientes sometidos a una PSG-NP o PSG-NC fueron analizados de forma conjunta. En el presente estudio el diagnstico de SAHS fue establecido de acuerdo con los criterios de la AASM si IAH fue 5 por hora de sueo (1). El SAHS fue leve si el IAH fue de 5 a 14, moderado si de 15 a 29 y severo si IAH 30.

Se utiliz una balanza y un tallmetro calibrados para calcular el ndice de masa corporal (IMC) en unidades de kg/m2. Un IMC 30 kg/m2 se consider como obesidad y un IMC < 30 kg/m2 como no obesidad. Empleamos la tcnica propuesta por Lohman (19) para la medicin del permetro cervical (PC). ESCALA DE SOMNOLENCIA DE EPWORTH La escala de somnolencia Epworth es una herramienta que evala la somnolencia de manera subjetiva, fue diseada por Murray W. Johns (20) en 1991. Consiste en un breve cuestionario que pregunta por la probabilidad de quedarse dormido en ocho distintas situaciones de la vida cotidiana. Se emple una validacin cultural peruana de la escala y una versin peruana modificada del mismo instrumento para poblacin que no conduce vehculos, denominada ESE-VPM (9). ANLISIS ESTADSTICO Se emple el programa informtico Stata 10.0 (STATA Corp, College Station, Texas, EEUU) para el anlisis estadstico. La informacin fue analizada como N (porcentual) en las variables categricas y con la media desviacin estndar en las variables continuas. Se calcul el chi cuadrado para comparar variables categricas. Para la comparacin de dos medias se emple la prueba t de Student. En la comparacin de las medias de ms de dos muestras se realiz anlisis de varianza (ANOVA). La correlacin de Pearson fue empleada para calcular el grado de asociacin. Se realiz un anlisis de regresin lineal mltiple considerando el IAH como variable dependiente y como variable independiente la presencia o no de obesidad. Se estableci previamente que otras variables independientes fueran la edad, sexo, PC, ESD y la presencia de comorbilidades (HTA, enfermedad coronaria, insuficiencia cardiaca o dislipidemia). Se consider significativo un valor de p < 0,05. El Comit de Biotica Institucional de la Clnica Anglo Americana autoriz la implementacin del presente estudio.

RESULTADOS
Durante el perodo de evaluacin entre julio de 1995 y noviembre de 2010 se registr en la base de datos, una poblacin inicial de 651 pacientes de los cuales 100 (15 %) fueron mujeres. Fueron excluidos 137 casos. Con ello quedaron 514 casos, 106 sin SAHS y 408 con SAHS. Esta ltima muestra constituy el universo de la poblacin que ingres al anlisis (Figura 1).

597

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Rey de Castro J & Rosales-Mayor E

Excluidos (n=137): MPM/SPI Menores de 18 aos Apnea central con patrn Cheyne Stokes Sndrome obesidad-hipoventilacin SRVAS Portadores de CPAP Sndrome sobreposicin (SAHS + EPOC) Narcolepsia Acondroplasia Hipoventilacin central congnita No informacin sobre IMC 70 23 8 8 7 5 2 2 2 1 9

Poblacin inicial N = 651

Elegibles n = 514

No SAHS n = 106

SAHS n = 408 Figura 1. Flujograma de participantes en el estudio.


SRVAS: sndrome de resistencia va area superior. MPM: mioclonas peridicas de los miembros. SPI: sndrome de piernas de inquietas. SAHS: sndrome de apnea-hipopneas del sueo. EPOC: enfermedad pulmonar obstructiva crnica. CPAP: presin positiva continua en va area. IMC: ndice de masa corporal.

Treinta y ocho (9 %) fueron de sexo femenino, la edad promedio fue de 49,4 12,1 aos, y el IMC promedio fue de 30,3 4,6 kg/m2. El SAHS fue leve en 101 (25 %), moderado en 91 (22 %) y severo en 216 (53 %). Ciento diecinueve pacientes tenan obesidad (47 %). La comparacin de variables clnica y polisomnogrficas entre pacientes con obesidad frente a sin obesidad se muestran en la Tabla 1. Las formas severas de SAHS fueron ms frecuentes en pacientes con obesidad (68 % frente a 40 %; p<0,001). El anlisis de correlacin de Pearson del IMC con las siguientes variables: PC, ESE-VPM, ndice de despertares, IAH, DesatMax y T90; tanto en la poblacin de no obesos y en obesos se muestran en la Tabla 2. Los resultados del anlisis de regresin lineal mltiple se muestran en la Tabla 3.

Tabla 1. Comparacin de variables clnicas polisomnogrficas en pacientes con y sin obesidad.


Obesos Sexo femenino Edad (aos) Permetro cervical Escala somnolencia Epworth (ESE) Excesiva somnolencia diurna (ESE>10) Dislipidemia Hipertensin arterial Enfermedad coronaria Insuficiencia cardiaca Latencia de sueo (min) Latencia de sueo REM (min) ndice de despertares ndice de apnea hipopnea (IAH) IAH en REM IAH en No-REM IAH en posicin lateral IAH en posicin supina ndice de ERAM ndice de disturbio respiratorio Desaturacin mxima T90 7,9 % 48,9 11,2 44,6 3,9 11,1 5,5 52,1 % 39,5 % 71,6 % 8,9 % 1,1 % 9,9 14,9 106,2 54,6 51,9 28,8 48,7 29,1 42,9 24,4 47,7 31,7 39,5 32,8 59,5 28,6 4,9 6,6 38,9 23,5 79,6 8,9 15,9 20,0 No obesos 10,6 % 49,8 12,8 40,3 3,3 10,0 5,0 41,3 % 20,2 % 37,2 % 3,7 % 0,0 % 10,2 17,7 107,1 61,6 42,2 25,1 28,2 20,2 27,2 23,1 27,4 21,2 19,3 20,2 42,0 25,2 5,6 6,5 29,2 17,9 84,6 6,4 5,0 10,4 p

0,357 0,462 <0,001 0,053 0,029 <0,001 <0,001 0,027 0,129 0,843 0,896 <0,001 <0,001 <0,001 <0,001 <0,001 <0,001 0,449 <0,001 <0,001 <0,001

DISCUSIN
La obesidad es el principal factor de riesgo de SAHS en la poblacin adulta (2). De acuerdo con la literatura mdica, aproximadamente dos terceras partes de los pacientes con SAHS tiene obesidad (21) mientras que la prevalencia de SAHS en obesos mrbidos es de 50 % (22). La hiptesis planteada estriba en que particularmente los pacientes con obesidad central tienen acumulacin de tejido graso en la lengua, cara posterior-lateral de

Los valores se presentan como porcentaje o media desviacin estndar. ERAM: eventos respiratorios asociados a microdespertares. T90: tiempo porcentual de sueo con saturacin de oxgeno debajo de 90 %. REM: rapid eye moviment.

598

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Sndrome de apneas-hipopneas del sueo en no obesos

Tabla 2. Anlisis de correlacin de Pearson con algunas variables en paciente con y sin obesidad.
No obesos Permetro cervical Escala de somnolencia de Epworth ndice de despertares ndice de Apnea Hipopnea Desaturacin mxima Tiempo porcentual de sueo con saturacin de oxgeno por debajo de 90 % 0,571 (p<0,001) -0,035 (p=0,621) 0,168 (p=0,014) 0,269 (p<0,001) -0,241 (p<0,001) 0,189 (p=0,005) Obesos 0,553 (p<0,001) 0,179 (p=0,016) 0,162 (p=0,029) 0,377 (p<0,001) -0,135 (p=0,067) 0,312 (p<0,001) Todos 0,694 (p<0,001) 0,139 (p=0,006) 0,236 (p<0,001) 0,497 (p<0,001) -0,341 (p<0,001) 0,425 (p<0,001)

Tabla 3. Anlisis de regresin lineal mltiple para ndice apnea-hipopnea


Variables Coeficiente (IC 95 %) independientes Edad Sexo (varn) Obesidad (IMC30 kg/m2) Excesiva somnolencia diurna (ESE>10) Permetro cervical Comorbilidades* -0,2 3,7 10,3 5,3 1,9 4,0 (-0,4 - 0,1) (-7,0 - 14,4) (4,4 - 16,3) (0,4 - 10,1) (1,0 - 2,8) (-1,5 - 9,5) EE 0,105 5,444 3,007 2,449 p 0,105 0,500 0,001 0,031

0,445 <0,001 2,803 0,153

Valores que se muestran: R de Pearson (valor p).

EE: error estndar. IC: intervalo de confianza. IMC: ndice de masa corporal. ESE: escala de somnolencia de Epworth. * Presencia de hipertensin arterial, dislipidemia, insuficiencia cardiaca o enfermedad coronaria

la faringe y paladar blando. Ello conduce a la prdida del tono muscular, disminucin del rea de seccin de la faringe aumentando la presin extraluminal y, finalmente, colapso de la va area superior (VAS) (23). De otro lado, la disminucin del volumen pulmonar altera las propiedades elsticas del pulmn lo cual agrava la propensin al colapso en la VAS (24). Sin embargo, los pacientes sin obesidad no tienen estas caractersticas antropomrficas y como ya ha sido sealado el SAHS no es exclusivo de obesos (25-26). Sakakibara et al. (27) describieron las anormalidades cefalomtricas en pacientes japoneses no obesos y obesos con SAHS, encontrando que estas eran similares a las descritas en pacientes caucsicos. En los obesos el incremento de los tejidos blandos de la VAS cumplen un papel importante en la patognesis del sndrome mientras que en no obesos la estructura sea sera el factor dominante del SAHS. Li et al. (28) describieron la estructura sea crneo-facial en asiticos, la informacin obtenida sugiere que esta caracterstica anatmica sera un factor de riesgo para desarrollar SAHS en esta poblacin. En todos los pacientes incluidos en el estudio predomin el sexo masculino y las formas severas de SAHS. Estos resultados corresponden a una poblacin sesgada en la medida que el anlisis fue realizado a partir de enfermos evaluados selectivamente en un laboratorio de sueo. No hubo diferencias por sexo, edad y puntaje promedio de la ESE-VPM al compararse obesos con no obesos. La diferencias del PC y presencia de ESD fue significativamente mayor en obesos. Estos tuvieron mayor comorbilidad en trminos de dislipidemia, hipertensin arterial y enfermedad coronaria (7).

Las latencias del sueo y latencias REM fueron similares en los dos grupos y el valor del ndice arousal fue mayor en obesos. Con relacin a los eventos respiratorios propiamente dichos, el IAH en REM y NoREM, IAH posicin supina y lateral e IAH de todo el estudio fue mayor en los obesos. No hubo diferencias en el ndice ERAM. Anlogamente el comportamiento de la saturacin del oxgeno de la hemoglobina tuvo valores de DestMax y T90 ms severos en obesos. En el anlisis de regresin se encontr asociacin de forma independiente entre la presencia de obesidad con la severidad del SAHS segn el IAH. La publicacin de Chierakul et al. (29), realizada en Bangkok, compara las caractersticas de los pacientes con SAHS sin y con obesidad. Las conclusiones destacan la funcin que cumple la estructura sea en no obesos y, de otro lado, la mayor severidad en prcticamente todas las variables polisomnogrficas cuantificadas en el grupo obesos. Si bien es cierto que en nuestra poblacin no se emplearon medidas antropomtricas, fue destacable la severidad de los resultados obtenidos por medio del monitoreo del sueo en obesos como el ndice de arousal, IAH, DesatMax y T90. Estos resultados han sido descritos previamente por Sakakira (27), Davies (30) y sus respectivos colaboradores. La ausencia en la cuantificacin de variables antropomtricas de los grupos estudiados y el sesgo de seleccin en pacientes evaluados en laboratorio del sueo fueron las principales limitaciones del presente estudio. El componente subjetivo de la herramienta utilizada (ESE-VPM), inherente a este tipo de cuestionarios constituy tambin otra limitacin del estudio. Finalmente, no es posible hacer inferencias con

599

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Rey de Castro J & Rosales-Mayor E

otras poblaciones ya que la muestra pertenece a una poblacin clnica no probabilstica. En conclusin, se confirma que el SAHS no es una enfermedad limitada a la poblacin obesa y que los obesos tienen mayor comorbilidad con formas ms severas de enfermedad a juzgar por las variables polisomnogrficas mencionadas.

10. Ferber R, Millman R, Coppola M, Fleetham J, Murray CF, Iber C, et al. Portable recording in the assessment of obstructive sleep apnea. ASDA standards of practice. Sleep. 1994;17(4):378-92. 11. Rechtschaffen A, Kales AA. A manual of standardized terminology techniques and scoring system for sleep stages of human subjects. NIH Publication N 204. Washington, DC: Government Printing Office; 1968. 12. American Sleep Disorders Association. EEG arousals: scoring rules and examples: a preliminary report from the Sleep Disorders Atlas Task Force of the American Sleep Disorders Association. Sleep. 1992;15(2):173-84. 13. Iber C, American Academy of Sleep Medicine. The AASM manual for the scoring of sleep and associated events: rules, terminology and technical specifications. Westchester, IL: American Academy of Sleep Medicine; 2007. 14. Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA, Izzo JL, Jr, et al. Seventh report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension. 2003;42(6):1206-52. 15. Fredrickson DS, Levy RI, Lees RS. Fat transport in lipoproteins--an integrated approach to mechanisms and disorders. N Engl J Med. 1967;276(1):34-42. 16. Dolgin M (editor). Nomenclature and criteria for diagnosis of diseases of the heart and great vessels. 9th ed. Boston, MA: Little, Brown; 1994. 17. Sanders MH, Black J, Costantino JP, Kern N, Studnicki K, Coates J. Diagnosis of sleep-disordered breathing by half-night polysomnography. Am Rev Respir Dis. 1991;144(6):1256-61. 18. Khawaja IS, Olson EJ, van der Walt C, Bukartyk J, Somers V, Dierkhising R, et al. Diagnostic accuracy of split-night polysomnograms. J Clin Sleep Med. 2010;6(4):357-62. 19. Lohman TG, Roche AF, Martorell R. Anthropometric standardization reference manual. Champaign: Human Kinetics; 1988. 20. Johns MW. A new method for measuring daytime sleepiness: the Epworth sleepiness scale. Sleep. 1991;14(6):540-5. 21. Carter R, 3rd, Watenpaugh DE. Obesity and obstructive sleep apnea: Or is it OSA and obesity? Pathophysiology. 2008;15(2):71-7. 22. Resta O, Foschino-Barbaro MP, Legari G, Talamo S, Bonfitto P, Palumbo A, et al. Sleep-related breathing disorders, loud snoring and excessive daytime sleepiness in obese subjects. Int J Obes Relat Metab Disord. 2001;25(5):669-75. 23. Rabec C, de Lucas Ramos P, Veale D. Respiratory complications of obesity. Arch Bronconeumol. 2011;47(5):252-61. 24. Crummy F, Piper AJ, Naughton MT. Obesity and the lung: 2. Obesity and sleep-disordered breathing. Thorax. 2008;63(8):738-46. 25. Guilleminault C, Stoohs R, Kim YD, Chervin R, Black J, Clerk A. Upper airway sleep-disordered breathing in women. Ann Intern Med. 1995;122(7):493-501. 26. Redline S, Kump K, Tishler PV, Browner I, Ferrette V. Gender differences in sleep disordered breathing in a

Contribuciones de autora

JRC y ERM participaron en la concepcin del estudio, recoleccin de resultados, anlisis e interpretacin de datos, redaccin del manuscrito, revisin crtica del artculo y la aprobacin de la versin final a publicar. JRC contribuy en el aporte de pacientes y material de estudio.

Fuentes de financiamiento
Autofinanciado.

Conflictos de inters

JRC es Director Cientfico de AGA S.A. en Per. ERM declara no tener conflicto de inters.

REFERENCIAS BIBLIOGRFICAS
1. American Academy of Sleep Medicine. The international classification of sleep disorders: diagnostic and coding manual. 2nd ed. Westchester, IL: American Academy of Sleep Medicine; 2005. 2. Young T, Palta M, Dempsey J, Skatrud J, Weber S, Badr S. The occurrence of sleep-disordered breathing among middle-aged adults. N Engl J Med. 1993;328(17):1230-5. 3. Duran J, Esnaola S, Rubio R, Iztueta A. Obstructive sleep apnea-hypopnea and related clinical features in a population-based sample of subjects aged 30 to 70 yr. Am J Respir Crit Care Med. 2001;163(3 Pt 1):685-9. 4. Duran J, Esnaola S, Rubio R, De la Torre G. Obstructive sleep apnoea-hypopnoea in the elderly. A population-based study in the general population aged 71-100. European Respiratory J. 2000;16(Sup/31):167S. 5. Grupo Espaol de Sueo. Consenso nacional sobre Sndrome de Apneas-Hipopneas del Sueo. Arch Bronconeumol. 2005;41(Supl 4):1-110. 6. Rey de Castro J. Sndrome de Apneas Hipopneas del Sueo. Asesino silencioso? Revisin de la literatura. Rev Med Hered. 2007;18(4):222-7. 7. Tuomilehto HP, Seppa JM, Partinen MM, Peltonen M, Gylling H, Tuomilehto JO, et al. Lifestyle intervention with weight reduction: first-line treatment in mild obstructive sleep apnea. Am J Respir Crit Care Med. 2009;179(4):320-7. 8. Young T, Skatrud J, Peppard PE. Risk factors for obstructive sleep apnea in adults. JAMA. 2004;291(16):2013-6. 9. Rosales-Mayor E, Rey de Castro J, Huayanay L, Zagaceta K. Validation and modification of the Epworth Sleepiness Scale in Peruvian population. Sleep Breath. 2011 Jan 30. [Epub ahead of print]

600

Rev Peru Med Exp Salud Publica. 2011;28(4):595-601.

Sndrome de apneas-hipopneas del sueo en no obesos

community-based sample. Am J Respir Crit Care Med. 1994;149(3 Pt 1):722-6. 27. Sakakibara H, Tong M, Matsushita K, Hirata M, Konishi Y, Suetsugu S. Cephalometric abnormalities in non-obese and obese patients with obstructive sleep apnoea. Eur Respir J. 1999;13(2):403-10. 28. Li KK, Kushida C, Powell NB, Riley RW, Guilleminault C. Obstructive sleep apnea syndrome: a comparison between Far-East Asian and white men. Laryngoscope. 2000;110(10 Pt 1):1689-93. 29. Chierakul N, Chaipattarapol C, Ruttanaumpawan P, Nana A, Naruman C, Tangchityongsiva S. Comparison of clinical and polysomnographic characteristics of non-obese and obese patients with obstructive sleep apnea. J Med Assoc Thai. 2007;90 (Suppl 2):48-53.

30. Davies RJ, Stradling JR. The relationship between neck circumference, radiographic pharyngeal anatomy, and the obstructive sleep apnoea syndrome. Eur Respir J. 1990;3(5):509-14.

Correspondencia: Jorge Rey de Castro. Direccin: Av. Alfredo Salazar 314, San Isidro, Lima 27, Per. Telefax (511) 2219013 Correo electrnico: jorgerey@rcp.net.pe.

TARIKI-DENGUE IgM

ELISA de CAPTURA IgM DENGUE


INSTITUTO NACIONAL DE SALUD LIMA - PER

Pronto disponible en el Per.


Kit para la determinacin de anticuerpos IgM anti Dengue, desarrollado y producido por el Instituto Nacional de Salud. INS/MINSA
601

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

artCULO ORIGINAL

INFECCIONES DEL SISTEMA NERVIOSO CENTRAL POR ENTEROVIRUS EN NIOS ATENDIDOS EN UN HOSPITAL DE LIMA, PER
Ivn O. Espinoza1,2,a , Theresa J. Ochoa1,3,4,b, Susan Mosquito1,c, Francesca Barletta1,d, Roger Hernndez1,2,4,b, Mara del Pilar Medina1,5,a, Mara Luisa Stiglich1,6,a, Claudia Ugarte1,2,e, Daniel Guilln1,2,a
RESUMEN Objetivos. Determinar la frecuencia y las caractersticas clnicas de las infecciones del sistema nervioso central por enterovirus en nios atendidos en el Hospital Nacional Cayetano Heredia de Lima, Per. Materiales y mtodos. Se realiz un estudio prospectivo y descriptivo desde abril 2008 hasta marzo 2010. Se enrolaron pacientes de un mes a 14 aos con diagnstico clnico de encefalitis o meningitis aspticas. Se investig la presencia de enterovirus, virus herpes simple 1 (VHS-1), virus herpes simple 2 (VHS-2) y virus varicela-zoster (VZV) mediante reaccin en cadena de polimerasa (PCR). Resultados. Se enrolaron 97 pacientes de los cuales 69 % presentaron encefalitis aguda y 31 % meningitis aguda. Se identific enterovirus en 52,6 % del total de infecciones agudas no bacterianas del sistema nervioso central; encontrndose en 83,3 % de las meningitis y en 38,8 % de las encefalitis. No hubo casos de infeccin por VHS-1, VHS-2 ni VZV. Las infecciones por enterovirus alcanzaron el 82,9 % en los meses clidos de noviembre a enero y el 28,6 % en los meses fros de mayo a julio. Conclusiones. Los enterovirus fueron los principales agentes etiolgicos en las encefalitis y meningitis aspticas agudas en pacientes peditricos de Lima, Per. Los enterovirus tienen un comportamiento epidemiolgico estacional con un claro aumento del nmero de casos en los meses de verano. Resulta til tener disponible un mtodo de diagnstico rpido, como una ayuda para el manejo de las infecciones agudas del sistema nervioso. Palabras clave: Enterovirus; Meningitis; Encefalitis; Reaccin en cadena de la polimerasa; Encefalopatas; Crisis epilpticas; Nio (fuente: DeCS BIREME).

ENTEROVIRAL CENTRAL NERVOUS SYSTEM INFECTIONS IN CHILDREN TREATED AT A HOSPITAL IN LIMA, PERU
ABSTRACT Objectives. To determine the frequency and clinical features of central nervous system infections caused by enterovirus in children treated at the Hospital Nacional Cayetano Heredia in Lima, Peru. Materials and methods. A prospective, descriptive study was performed from April 2008 to March 2010. Patients aged 1 month 14 years with clinical diagnosis of encephalitis or aseptic meningitis were included. We investigated the presence of enterovirus, herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2) and varicella-zoster virus (VZV) by polymerase chain reaction (PCR). Results. 97 patients were included, out of which 69 % had acute encephalitis and 31 % acute meningitis. Enteroviruses were identified in 52,6% of all acute non-bacterial central nervous system infections; corresponding to 83,3 % of meningitis and 38,8 % of encephalitis. There were no cases of infection due to HSV-1, HSV-2 or VZV. Enterovirus infections reached 82,9 % in the warm months (November-January) and 28,6 % in the colder months (May-July). Conclusions. Enteroviruses are the principal etiologic agents in acute aseptic meningitis and encephalitis in pediatric patients in Lima, Peru. Enteroviruses have a seasonal epidemiological pattern with a clear increase in the number of cases during the summer months. It is useful to have this rapid diagnostic method available as an aid in the management of acute central nervous system infections. Key words: Enterovirus; Meningitis; Encephalitis; Polymerase chain reaction; Brain diseases; Epilepsy; Child (source: MeSH NLM).

Universidad Peruana Cayetano Heredia. Lima, Per. Hospital Nacional Cayetano Heredia. Lima, Per. 3 University of Texas School of Public Health, Houston. Texas, Estados Unidos de Amrica. 4 Grupo Peruano de Investigacin en Neumococo (GPIN). Lima, Per. 5 Instituto Nacional Materno Perinatal. Lima, Per. 6 Hospital Nacional Docente Madre Nio San Bartolom. Lima, Per. a Mdico neurlogo pediatra; b Mdico infectlogo pediatra; c Microbilogo; d Bilogo molecular; e Mdico pediatra
1 2

Recibido: 14-07-11

Aprobado: 26-10-11

602

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Infecciones del SNC por enterovirus

INTRODUCCIN
Las infecciones virales del sistema nervioso central (SNC) son ms frecuentes que las infecciones bacterianas (1,2). En los ltimos aos esta diferencia se ha acentuado debido a las crecientes coberturas de inmunizacin contra Haemophilus influenzae tipo b y Streptococcus pneumoniae (3-5). Los enterovirus representan en muchos pases la principal causa de infecciones agudas del SNC en porcentajes que varan entre el 24 y el 95 % segn el rea geogrfica (1,2,6-8) y, usualmente, tienen una presentacin epidmica y estacional al igual que los arbovirus y los virus respiratorios (9). La mortalidad y la morbilidad, a largo plazo, de las infecciones virales del SNC, dependen de la edad del paciente, su estado inmunolgico, la virulencia del agente y la seriedad del cuadro (10). Generalmente, la evolucin es benigna; sin embargo, las infecciones por virus herpes simple (VHS), la encefalitis equina venezolana, el virus de la rabia y algunos enterovirus, pueden ocasionar la muerte o secuelas a largo plazo como trastornos del lenguaje, memoria, aprendizaje y conducta, epilepsia, parlisis cerebral, desrdenes del movimiento y retardo mental. Estas entidades representan una importante carga econmica y social para las familias, la sociedad y los sistemas de salud (10,11). La reaccin en cadena de polimerasa (PCR) es el mtodo diagnstico de eleccin por su alta sensibilidad y especificidad, no obstante, en pases en desarrollo no se usa en forma rutinaria. Las pruebas inmunolgicas y los cultivos virales son pruebas poco sensibles y de resultados tardos, por lo que no son tiles para decidir el uso o no de antibiticos o antivirales al momento del ingreso del paciente (9,12,13). Desde el punto de vista de salud pblica es muy importante determinar el comportamiento epidemiolgico de las infecciones virales del SNC. A nivel individual, precisar la etiologa de la infeccin neurolgica sirve para la toma de decisiones con respecto al tratamiento, prevencin y profilaxis adecuadas. Contribuye a establecer de mejor manera el pronstico y puede evitar el uso de antibiticos, antivirales, exmenes auxiliares, procedimientos y estancias hospitalarias prolongadas innecesarias (1,14). En el Per no se cuenta con estudios epidemiolgicos de las infecciones virales del SNC en nios y los datos provenientes de otros pases difieren mucho en sus resultados y no necesariamente pueden extrapolarse a nuestra realidad epidemiolgica. Por este motivo, se desarroll el presente estudio con la finalidad de

determinar la frecuencia y las caractersticas clnicas de las infecciones agudas del SNC por enterovirus detectados por la tcnica de PCR en lquido cefalorraqudeo (LCR), en nios de un mes a 14 aos de edad, atendidos en el Hospital Nacional Cayetano Heredia (HNCH) de Lima, Per.

MATERIALES Y MTODOS
PACIENTES El presente trabajo es una investigacin prospectiva y descriptiva. Se realiz una vigilancia activa y diaria que inicialmente identificaba a todos los pacientes con sospecha de infeccin aguda del SNC de cualquier etiologa. Ingresaron al estudio todos los pacientes con sntomas y signos sugerentes de infeccin aguda del SNC que acudieron al HNCH entre el 1 de abril de 2008 al 31 de marzo de 2010 y que cumplieron los siguientes criterios de inclusin: 1) edad comprendida entre 1 mes y 14 aos; 2) tiempo de enfermedad menor o igual a siete das; 3) diagnstico clnico de infeccin aguda del SNC y 4) muestra de LCR de por lo menos un mililitro obtenida por una puncin lumbar no traumtica. Se excluyeron a los pacientes con: 1) infeccin bacteriana o tuberculosa del SNC demostrada por coloracin de Gram, coloracin Ziehl-Neelsen, coaglutinaciones o cultivo de LCR; 2) encefalopata atribuible a eventos metablicos, txicos o hidroelectrolticos; 3) portadores de sistemas de derivacin de LCR o 4) infeccin del SNC secundaria a traumatismos craneoenceflicos o procedimientos neuroquirrgicos. Se estableci el diagnstico clnico de encefalitis en los pacientes con alteracin del nivel de conciencia, disfuncin cognitiva, cambios conductuales, anormalidades neurolgicas focales o crisis epilpticas, sin hallazgos de laboratorio que sugieran irritacin menngea (recuento leucocitario en LCR 10 cel/mm3). El diagnstico clnico de meningitis se determin por la presencia de pleocitosis (recuento leucocitario en LCR > 10 cel/mm3) con o sin rigidez de nuca, signos menngeos o disfuncin enceflica. Los pacientes que cumplieron los criterios de seleccin recibieron la atencin mdica rutinaria en los servicios de Emergencia Peditrica, Unidad de Cuidados Intensivos y Hospitalizacin de Pediatra. El grupo investigador en coordinacin con los mdicos tratantes, pidi la autorizacin a los familiares para la realizacin de las pruebas de PCR en el LCR y la recoleccin de datos demogrficos, clnicos y de laboratorio de los nios incluidos.

603

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Espinoza IO et al.

ANLISIS DE LABORATORIO En las muestras de LCR se investig la presencia de enterovirus, VHS-1, VHS-2 y virus varicela zoster (VZV) mediante PCR. Estos estudios se realizaron en el Laboratorio de Biologa Molecular del Instituto de Medicina Tropical (IMT) Alexander Von Humboldt de la Universidad Peruana Cayetano Heredia. Se guard una muestra de LCR en refrigeracin a -70 C en el criobanco del IMT. Para la extraccin de cidos nucleicos se utiliz el High Pure Viral Nucleic Acid Kit (Roche Diagnostics, Alemania) para la extraccin y purificacin del ADN viral (herpesvirus) y ARN viral (enterovirus). A partir de 200 L de LCR se obtuvieron 50 L de cidos nucleicos virales, los cuales fueron almacenados a -70 C hasta su posterior anlisis. La sntesis de cDNA se realiz con el Transcriptor First Strand cDNA Sntesis Kit (Roche Diagnostics, Alemania). A partir de 7 L de ARN se obtuvieron 20 L de cDNA. El cDNA se almacen a -20 C hasta su posterior anlisis. Para la deteccin de HSV-1, HSV-2 y VZV a partir del ADN viral extrado, se utiliz un PCR a tiempo real usando el Lightcycler HSV 1/2 Detection Kit (Roche Diagnostics, Alemania) el cual incluye controles positivos y negativos. Para la deteccin de enterovirus se utiliz un PCR convencional, utilizando los primers o cebadores (Forward 5-3 CGGCCCCTGAATGCGGCTAA y Reverse GAAACACGGACACCCAAAGT) previamente descritos y validados, que permiten la identificacin de todos los enterovirus (coxsackievirus, echovirus, poliovirus) y rinovirus (15). Se utiliz el sistema FastStart taq DNA polymerase (Roche Diagnostics, Alemania). Las condiciones del PCR fueron desnaturalizacin inicial de tres minutos a 96 C, 45 ciclos de 45 segundos a 94 C, 45 segundos a 50 C, 45 segundos a 72 C y una extensin final de siete minutos a 72 C. ANLISIS DE DATOS Las informacin obtenida se registr en una base de datos del programa Excel 2007. Para el anlisis, los pacientes se clasificaron segn la edad como lactantes (1 a 24 meses), preescolares (2 a 5 aos) y escolares (6 a 14 aos). El anlisis de los datos se realiz con el programa estadstico STATA versin 11.0. Para las variables discretas y nominales se utiliz la prueba de chi cuadrado de Pearson con la correccin de Yates cuando fue necesario. Para las variables continuas de distribucin normal se presenta las medias y desviaciones estndares (SD) y se utiliz la prueba t de Student. Para

las variables continuas de distribucin no normal se presenta las medianas y los rangos intercuartiles (RIQ) y se aplic la prueba de suma de rangos de Wilcoxon. Se consider significativo un valor p menor de 0,05. ASPECTOS TICOS El estudio fue aprobado por los comits de tica en investigacin del Hospital Nacional Cayetano Heredia, de la Universidad Peruana Cayetano Heredia y del Instituto Nacional de Salud. Los pacientes fueron enrolados previa firma del consentimiento informado por los padres y el asentimiento informado en los pacientes mayores de 8 aos sin encefalopata severa. Las fichas de recoleccin de datos, los consentimientos y asentimientos informados, as como las bases de datos informticas estn archivadas en el Servicio de Neurologa Peditrica del HNCH.

RESULTADOS
Durante el perodo del estudio se hospitalizaron en el HNCH a 112 nios con infecciones agudas del SNC. De estos, cinco pacientes tuvieron punciones lumbares frustras o traumticas, siete pacientes tuvieron diagnstico de meningoencefalitis bacteriana aguda, dos pacientes tuvieron ventriculitis por infeccin de sistema de derivacin ventrculo peritoneal y un paciente que no ingres al estudio tuvo un resultado positivo para VHS en un laboratorio particular. Finalmente, ingresaron al estudio 97 pacientes que cumplieron con los criterios de seleccin de infecciones agudas no bacterianas del SNC. De ellos, 59 fueron de sexo masculino (60,8 %). El 29,9 % procedan del distrito de San Martn de Porres de Lima. La edad mediana (RIQ) fue 21,7 (11,3-68,6) meses. El grupo etario ms frecuente fue el de los lactantes con 51 pacientes (52,6 % del total), seguido de los preescolares con 25 pacientes (25,8 %) y, finalmente, los escolares con 21 pacientes (21,7 %). Segn el tipo de infeccin aguda, hubo 67 casos de encefalitis aguda (69 %) y 30 casos de meningitis aguda (31 %). Ningn caso fue positivo para HSV-1, HSV-2 y VZV. Del total de pacientes, 51 (52,6 %) resultaron positivos para enterovirus. Hubo diferencias en cuanto al rol de los enterovirus como causa de las meningitis y encefalitis agudas. En el caso de las encefalitis el 38,8 % fueron positivas para enterovirus (26 pacientes), mientras que en el caso de las meningitis 83,3 % fueron positivas para enterovirus. Esta diferencia fue significativa con un p<0,001. Las frecuencias por edad, de infeccin aguda del SNC por enterovirus se muestran en la Figura 1.

604

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Infecciones del SNC por enterovirus

100 90 80

16 14
Nmero de pacientes
Encefalitis Lactantes Meningitis Preescolares Total Escolares

12 10 8 6 4 2 0
Abr May Jun Jul Ago Set Oct Nov Dic Ene Feb Mar

Pacientes %

70 60 50 40 30 20 10 0

Total

Total de infecciones

Enterovirus

Figura 1. Porcentaje de enterovirus en las infecciones agudas del SNC por grupo de edad.

Figura 2. Distribucin mensual de las infecciones agudas por enterovirus.

Durante el periodo del estudio se observ una distribucin estacional de las infecciones por enterovirus. En los meses clidos, de noviembre a enero, los enterovirus fueron responsables del 82,9 % de todas las infecciones agudas del SNC, mientras que en los meses fros, de mayo a julio, las infecciones por enterovirus fueron responsables solo del 28,6 % de las infecciones agudas del SNC, como se ve en la Figura 2. En las barras se describe el total de infecciones agudas del SNC no bacterianas, entre abril de 2008 a marzo de 2010. En el caso de las infecciones causadas por enterovirus el 58,8 % ocurrieron en lactantes, como se ve en la Tabla 1. No hubo diferencia significativa entre las medianas de las edades para los pacientes con infecciones ocasionadas o no ocasionadas por enterovirus (p=0,76). Tampoco hubo diferencia entre las medianas de las edades segn tipo de infeccin (p=0,35).

El tiempo de enfermedad tuvo una mediana de tres das (RIQ: 2-4) en los casos de encefalitis y una mediana de cuatro das (RIQ: 3-6) en los pacientes con meningitis. No hubo diferencia significativa en el tiempo de enfermedad segn tipo de infeccin o etiologa. La duracin promedio de los sntomas neurolgicos fue de 25,4 26,7 horas en los pacientes con encefalitis y de 47,1 37,9 horas en el caso de las meningitis (p = 0,007). En la evaluacin de la etiologa con respecto al tiempo de enfermedad, las infecciones por enterovirus tuvieron mayor duracin de sntomas neurolgicos que las infecciones por otros agentes pero esta diferencia no fue significativa. En cuanto a las caractersticas clnicas, tanto las encefalitis como las meningitis presentaron como sntomas principales comunes la fiebre, la somnolencia, la irritabilidad y los vmitos (Tabla 2). Las crisis convulsivas fueron un sntoma frecuente en los pacientes con encefalitis (62,7 %) mientras que en los pacientes con meningitis su frecuencia fue menor

Tabla 1. Caractersticas generales de pacientes con infecciones agudas del SNC segn tipo de infeccin clnica y etiologa.
Encefalitis EV N ( %) Grupo de Lactante edad Preescolar Escolar Edad en meses (mediana y RIQ) Enfermedad en das (mediana y RIQ) Sntomas neurolgicos en horas (media SD) Masculino 17 (65,4) 19 (73,1) 3 (11,5) 4 (15,4) 16,7 (7,8-49,1) 3 (2 - 4) 26,6 22,5 No-EV N ( %) 27 (65,9) 19 (46,3) 14 (34,2) 8 (19,5) 31,8 (12,3-68,6) 3 (2 - 4) 24,7 29,4 0,22 0,87 0,77 0,07 0,97 p EV N ( %) 12 (48,0) 11 (44,0) 6 (24,0) 8 (32,0) 47,2 (11,3-87,9) 4 (3 - 6) 48,8 40,5 Meningitis No-EV N ( %) 3 (60,0) 2 (40,0) 2 (40,0) 1 (20,0) 28,6 (15,5-35,4) 4 (2 - 5) 38,4 21,5 0,68 0,59 0,43 0,69 1,00 p EV N ( %) 29 (56,9) 30 (58,8) 9 (17,7) 12 (23,5) 17,4 (7,8-72,2) 3 (2 - 4) 37,5 34,2 Total No-EV N ( %) 30 (65,2) 21 (45,7) 16 (34,8) 9 (19,6) 30,2 (12,3-68,6) 4 (2 - 6) 26,2 28,7 0,76 0,07 0,08 0,17 0,40 p

EV = enterovirus, No-EV = no enterovirus, LCR = lquido cefalorraqudeo.

605

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Espinoza IO et al.

(46,7 %; p = 0,183). Entre los principales signos, la fiebre, la irritabilidad y la hiperreflexia estuvieron en ambos tipos de infecciones. La rigidez de nuca fue ms frecuente en los casos de meningitis aguda (43,3 %) y menos en los casos de encefalitis (6,0 %) siendo esta diferencia significativa (p < 0,001). La tos fue ms frecuente en las infecciones no producidas por enterovirus mientras que el compromiso de conciencia como signo clnico fue ms frecuente en los pacientes con encefalitis por enterovirus. La temperatura promedio al momento del ingreso fue de 37,7 1,0 C y no hubo diferencia en cuanto al tipo de infeccin o la etiologa. En la puncin lumbar, tanto en las encefalitis como en las meningitis se observ un incremento de la presin intracraneal, la presin de apertura media fue de 20,4 8,8 cm H2O y no hubo diferencias segn el tipo de infeccin o segn la etiologa ocasionada por enterovirus u otros agentes. En cuanto a los anlisis citolgicos y bioqumicos del lquido cefalorraqudeo, la mediana (RIQ) del recuento leucocitario para las encefalitis fue de 0 (0-2) cel/mm3 y para las meningitis fue de 83,5 (34-200) cel/mm 3 ( p < 0,001). En cuanto al tipo leucocitario, los mononucleares tuvieron un porcentaje promedio para las

encefalitis de 91,5 22,6 % y 67,7 24,4 % para las meningitis (p <0,001). No hubo diferencia en el recuento leucocitario ni tampoco en el tipo de leucocitos predominantes en las meningitis o encefalitis producidas por enterovirus u otros agentes. En cuanto a la glucosa en LCR, las encefalitis tuvieron una concentracin media de 58,0 17,9 mg/dL y las meningitis tuvieron 53,4 13,1 mg/dL, siendo estos valores estadsticamente similares. Sin embargo, cuando se analiz los niveles de glucosa para las infecciones ocasionadas por enterovirus y las no ocasionadas por dichos agentes, se encontr que las encefalitis por enterovirus tuvieron una concentracin de glucosa en LCR de 52,8 11,9 mg/dL mientras que las encefalitis no ocasionadas por enterovirus tuvieron 61,2 20,3 mg/dL, siendo esta diferencia significativa (p = 0,04). En el caso de las meningitis, no hubo diferencia en cuanto al nivel de glucosa en LCR de las infecciones por enterovirus o por otros agentes. En cuanto a la glucosa srica, tampoco hubo diferencia entre los valores de glicemia segn tipo de infeccin o etiologa. Los niveles de protenas en LCR para las meningitis tuvieron un valor mediano de 45,5 mg/dL (RIQ: 32-65 mg/dL). Estos valores fueron significativamente mayores

Tabla 2. Principales sntomas, signos y caractersticas del LCR de pacientes con infecciones agudas del SNC segn tipo de infeccin clnica y etiologa.
EV (N=26) Encefalitis No-EV (N=41) 36(87,8) 23(56,1) 20(48,8) 16(39,0) 22(53,7) 16(39,0) 16(39,0) 21(53,9) 27(65,9) 17(41,5) 11(26,8) 2(4,9) 19,8 9,8 0 (0-3) 87,4 26,7 24 (18-33) 61,2 20,3 85(93-114) EV (N=25) Meningitis No-EV (N=5) 5(100,0) 3(60,0) 4(80,0) 4(57,1) 4(80,0) 3(60,0) 3(60,0) 3(60,0) 3(60,0) 3(60,0) 1(20,0) 2(40,0) 20,5 11,7 83 (25-102) 74,0 23,0 45 (36-65) 57,2 23,3 115(115-118) EV (N=51) 47(92,2) 30(58,8) 34(66,7) 29(56,9) 26(51,0) 19(37,3) 11(21,6) 28(56,0) 20(39,2) 27(52,9) 27(52,9) 13(25,5) 20,9 7,8 16 (0-84) 76,0 26,0 32 (22-54) 52,7 11,2 99(86-113) Total No-EV (N=46) 41(89,1) 26(56,5) 24(52,2) 19(41,3) 26(56,5) 19(41,3) 19(41,3) 24(54,6) 30(65,2) 20(43,5) 12(26,1) 4(8,70) 19,9 9,9 1 (0-8) 84,8 26,2 25,5 (18-41) 60,8 20,4 97(84-115)

p 0,70 0,16 0,10 0,07 0,13 0,11 0,18 0,76 0,20 0,50 0,03 0,64 0,80 0,25 0,04 0,76 0,04

p NA 0,64 0,64 1,00 1,00 1,00 0,10 1,00 0,30 1,00 0,34 1,00 0,91 0,64 0,53 0,91 0,69 0,07

P 0,61 0,82 0,15 0,13 0,59 0,68 0,04 0,89 0,01 0,35 0,01 0,04 0,62 0,01 0,20 0,13 0,02 0,97

Sntomas* Fiebre Convulsiones Somnolencia Irritabilidad Vmitos Cefalea Tos Signos* Fiebre Irritabilidad Hiperreflexia Somnolencia Rigidez de nuca LCR* Presin (H2O)** Leucocitos % de LMN* Protenas* Glucosa Sangre Glicemia*

22(84,6) 19(73,1) 18(69,2) 16(61,5) 9(34,6) 5(19,2) 6(23,1) 13(50,0) 13(50,0) 13(50,0) 14(53,9) 2(7,7) 20,5 8,7 0 (0-1) 100 0,0 24 (15-41) 52,8 11,9 82(93-110)

25(100,0) 11(44,0) 16(64,0) 13(54,2) 17(68,0) 14(56,0) 5(20,0) 15(62,5) 7(28,0) 14(56,0) 13(52,0) 11(44,0) 21,3 7,0 84 (39-200) 66,4 24,9 46 (32-57) 52,6 10,6

0,98 88(102-112)

EV = enterovirus, No-EV = no enterovirus, LCR = lquido cefalorraqudeo, LMN = linfomononucleares, NA = No aplicable. * Los valores entre ( ) para signos y sntomas son los porcentajes; y para LCR y sangre, son los rangos intercuartiles. ** Media desviacin estandar.

606

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Infecciones del SNC por enterovirus

a los de las encefalitis que tuvieron una mediana de 24 mg/dL (RIQ: 16-36 mg/dL; p <0,001). Las encefalitis y las meningitis ocasionadas por enterovirus, tuvieron valores de protenas similares a las infecciones no ocasionadas por enterovirus.

DISCUSIN
En la presente investigacin se demostr la infeccin por enterovirus en el 83,3 % de las meningitis agudas aspticas y en el 38,8 % de las encefalitis agudas. De manera global, se identific a enterovirus en el 52,6 % del total de infecciones agudas no bacterianas del SNC. Este rol etiolgico predominante es similar al descrito en estudios realizados en otras partes del mundo. En los Estados Unidos, por ejemplo, se informa que los enterovirus ocasionan entre el 75 y 95 % de todos los casos de meningitis agudas (16-18). Por otro lado, en Espaa, en una serie hospitalaria de casos que acudieron con sospecha de infeccin del SNC, los enterovirus fueron responsables del 62,7 % de los casos de meningitis asptica (2). Los informes de otros pases latinoamericanos tienen resultados dismiles; por ejemplo, en Venezuela entre 1995 y 1997 se encontraron como causas ms frecuentes de encefalitis al virus de encefalitis equina venezolana en 42 %, seguido de VHS en 33 % y el virus Epstein-Barr en 15 % pero no se realiz la bsqueda de enterovirus (19). En una serie hospitalaria de 22 pacientes con meningitis aguda realizada en Valparaiso, Chile entre 1997 y 1998, los enterovirus detectados por PCR o cultivos virales, fueron responsables del 95 % de las meningitis aspticas (6). En Argentina el programa de vigilancia pasiva de meningitis y encefalitis virales encontr, entre 1991 y 1998, a los enterovirus como responsables del 28,8 % de las meningitis agudas y del 3 % de las encefalitis (8). Estos porcentajes mucho menores pueden explicarse, en parte, por la naturaleza no sistemtica del programa de vigilancia. Las diferencias entre los informes de distintos pases pueden tambin deberse al uso de diferentes definiciones operacionales, serotipos investigados distintos, sensibilidad y especificidad de las pruebas utilizadas, primers y tcnicas diferentes de PCR y, obviamente, a diferencias epidemiolgicas reales originadas por la existencia de factores climticos, microbiolgicos y de coberturas de inmunizacin propios de cada pas. El Hospital Nacional Cayetano Heredia se encuentra en el distrito de San Martn de Porres, ubicado al norte de la ciudad de Lima. Su rea de influencia comprende los distritos de San Juan de Lurigancho, Comas, Independencia, Rmac, Los Olivos, Puente

Piedra y Carabayllo. Estos distritos estn compuestos mayoritariamente de viviendas en rea urbana y urbanomarginal de nivel socioeconomico medio y bajo (20). No conocemos si la prevalencia de enterovirus es la misma en otros niveles socioeconmicos de Lima o del resto del pas; sin embargo, creemos que debe ser similar, sobre todo en su distribucin estacional. Existen dos patrones de presentacin epidemiolgica de las infecciones virales agudas del SNC. El primero corresponde a los virus que se presentan en forma espordica durante todos el ao, como por ejemplo los herpesvirus; el segundo corresponde a los virus que se presentan en forma epidmica con un aumento del nmero de casos durante determinada poca del ao. Las infecciones agudas del SNC por enterovirus siguen este ltimo patrn epidmico (21). Si bien son necesarios estudios multicntricos y ms prolongados para establecer el verdadero canal endmico de las infecciones por enterovirus, se ha observado en nuestro estudio una clara estacionalidad de las meningitis y encefalitis por estos agentes. Este patrn epidmico durante los meses clidos es bien conocido y puede verse en los informes de otros pases (8,16-18,22). Es probable que el predominio de infecciones distintas a enterovirus en los meses fros del ao se deba a virus respiratorios como ocurre en otros pases (21,22) pero es necesario realizar investigaciones etiolgicas al respecto. En cuanto a la presentacin clnica, es importante resaltar que los sntomas y signos de los pacientes con meningitis o encefalitis agudas por enterovirus no permiten diferenciarlos de los pacientes con infecciones por otros virus e incluso por bacterias. La clnica puede servir para establecer el diagnstico de meningitis y encefalitis agudas pero no para precisar la etiologa. En nuestra serie, en el caso de las encefalitis, las convulsiones fueron un signo clave para su diagnstico, mientras que en el caso de las meningitis fue muy frecuente encontrar rigidez de nuca (43,3 %) en un porcentaje similar al descrito para las meningoencefalitis bacterianas (23). Estos datos son congruentes con la fisiopatologa y son parte de la semiologa clsica de estas entidades. En cuanto a la sintomatologa especfica, segn etiologa, la mayor frecuencia de tos en las infecciones no ocasionadas por enterovirus podra indicar una participacin importante de los virus respiratorios en este grupo. La somnolencia, frecuente en las infecciones agudas del SNC y especficamente en las encefalitis por enterovirus, podra explicarse por la afeccin ms difusa que ocasionan estos agentes en el encfalo (21). Las manifestaciones clnicas de las infecciones neurolgicas por enterovirus son al inicio inespecficas y consisten en cefalea, fiebre y posteriormente nuseas

607

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Espinoza IO et al.

y vmitos. En estadios avanzados de la enfermedad se agregan somnolencia, ataxia y signos piramidales. Si bien ninguno de los pacientes del estudio falleci, en casos graves el compromiso de conciencia progresa hasta el coma y se puede presentar afeccin de nervios craneales y deterioro del patrn respiratorio por lesin de tronco enceflico, pudiendo ocurrir la muerte (21). El estudio de LCR tampoco mostr particularidades para las infecciones producidas por enterovirus, excepto por los valores de glucosa en el LCR de los pacientes con encefalitis aguda que fue significativamente menor que el de pacientes con encefalitis no producidas por enterovirus, a pesar de valores similares de glicemia. Si bien la hipoglicorraquia y el predominio de polimorfonucleares son frecuentes en las encefalitis y meningitis por enterovirus, estas caractersticas son inespecficas y no permiten establecer con certeza un determinado agente etiolgico (21). En cuanto a los mtodos diagnsticos, la serologa y sobre todo la elevacin en cuatro veces de los ttulos de anticuerpos para enterovirus, tampoco ayudan en el momento de la atencin inicial del paciente con una infeccin aguda del SNC. Las pruebas de PCR en LCR para la deteccin de enterovirus y herpesvirus resultan positivas desde los primeros das de la infeccin por estos agentes y tienen elevada sensibilidad (86 - 100 %) y especificidad (92 - 100 %) (24). Por este motivo, esta tcnica se ha convertido en el mtodo de eleccin para la deteccin de enterovirus y herpesvirus en los pacientes con infecciones agudas del SNC. La tcnica de PCR mltiple para todos los enterovirus de importancia en humanos favorece su realizacin. Si bien es una tcnica costosa, este disminuye cuando se analizan varias muestras simultneas por lo que sera importante el establecimiento de un programa local de vigilancia sistemtica de las meningitis y encefalitis por enterovirus que permita identificar rpidamente a los enterovirus como los causantes de enfermedad para as disminuir los costos y riesgos asociados al uso innecesario de antibiticos o aciclovir (21). Este estudio tiene algunas limitaciones, en primer lugar, el nmero de muestras no fue lo suficientemente grande para poder definir con mayor precisin la prevalencia de enterovirus por grupo de edad y forma clnica. Sin embargo, es el primer estudio a nivel nacional que determina la prevalencia global de estos patgenos en las encefalitis y meningitis aspticas en pediatra. En segundo lugar, no se realizaron tcnicas de PCR adicionales para determinar el tipo especfico de enterovirus, ya que solo se determin la familia utilizando el PCR pan-enterovirus. En tercer lugar, aunque no fue un objetivo del estudio, hubiera sido interesante determinar las otras etiologas virales en las muestras estudiadas (virus respiratorios, virus EpsteinBarr, citomegalovirus, arbovirus, etc).

En conclusin, los enterovirus son los principales agentes etiolgicos de las meningitis agudas aspticas (83,3 %) y una de las principales causas de encefalitis (38,8 %) en pacientes peditricos en Lima. A nivel local, los enterovirus tienen un comportamiento estacional con un claro aumento del nmero de casos en los meses clidos (de noviembre a enero). En base a este estudio y por la alta prevalencia de este patgeno, se recomienda establecer un sistema de vigilancia local permanente que sirva de herramienta til para la toma de decisiones al momento de abordar un paciente con sospecha de infeccin aguda del SNC.

AGRADECIMIENTOS
Agradecemos al personal mdico del Servicio de Emergencia Peditrica del HNCH que colabor en la ejecucin de este estudio, al INS por las sugerencias en el desarrollo del estudio y manuscrito y a los padres y pacientes por su valiosa participacin.

Contribuciones de autora
IOE, TJO, DG y RH participaron en la concepcin y diseo del trabajo, obtencin de resultados, anlisis de datos, redaccin y revisin crtica del manuscrito, y aprobacin de su versin final. TJO realiz adems la asesora administrativa, y RH en la asesora estadstica. SM, FB y CU participaron de la obtencin de resultados, redaccin del manuscrito, y aprobacin de su versin final. MPM y MLS participaron en la recoleccin de datos, revisin crtica del manuscrito, aprobacin de su versin final, y facilitaron la coordinacin para el acceso a las historias clnicas de los pacientes.

Fuentes de financiamiento
Este estudio fue financiado por el Instituto Nacional de Salud (INS) a travs del VIII Concurso Nacional de Proyectos de Investigacin con Impacto en Salud Pblica del Per, 2007; otorgado al Dr. Ivn Espinoza.

Conflictos de inters
Los autores declaran no tener conflictos de inters.

REFERENCIAS BIBLIOGRFICAS
1. Losh DP. Central Nervous System Infections. Clinics in Family Practice. 2004;6(1):1-17. 2. Mintegui S, Snchez J, Benito J, Vsquez M, Rubio G, Capap S, et al. Tratamiento extrahospitalario de los nios con meningitis viral. An Pediatr (Barcelona). 2000;52(5):430-34. 3. Beaman MH, Wesselingh SL. Acute community-acquired meningitis and encephalitis. Med J Aust. 2002;176(8):389-96.

608

Rev Peru Med Exp Salud Publica. 2011;28(4):602-9.

Infecciones del SNC por enterovirus

4. Adams WG, Deaver KA, Cochi SL, Plikaytis BD, Zell ER, Broome CV, et al. Decline of childhood Haemophilus influenzae type b (Hib) disease in the Hib vaccine era. JAMA. 1993;269(2):221-6. 5. Whitney CG, Farley MM, Hadler J, Harrison LH, Bennett NM, Lynfield R, et al. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N Engl J Med. 2003;348(18):1737-46. 6. Soler CHM, Vergara FR, Silva VM, Collao FX, Navarrete BE. Deteccin de enterovirus mediante transcripcin reversa y reaccin de polimerasa en cadena en lquido cefalorraqudeo de nios con meningitis asptica. Rev Chil Infect. 2001;18(3):175-81. 7. Romero J, Newland J. Viral Meningitis and Encephalitis: Traditional and Emerging Viral Agents. Semin Pediatr Infect Dis. 2003;14(2):72-82. 8. Cisterna DM, Palacios G, Rivero K, Girard D, Lema C, Freire MC. Epidemiologa de los enterovirus asociados a enfermedades neurolgicas. Medicina (Buenos Aires). 2007;67(2):113-9. 9. Whitley RJ, Kimberlin DW. Viral encephalitis. Pediatr Rev. 1999;20(6):192-8. 10. Chaudhuri A, Kennedy PG. Diagnosis and treatment of viral encephalitis. Postgrad Med J. 2002;78(924):575-83. 11. Steiner I, Budka H, Chaudhuri A, Koskiniemi M, Sainio K, Salonen O, et al. Viral encephalitis: a review of diagnostic methods and guidelines for management. Eur J Neurol. 2005;12(5):331-43. 12. Thomson RB Jr, Bertram H. Laboratory diagnosis of central nervous system infections. Infect Dis Clin North Am. 2001;15(4):1047-71. 13. Boos J, Esiri MM. Diagnostic evaluation. In: Boos J, Esiri MM (editors). Viral encephalitis in humans. Washington, DC: ASM Press; 2003. p. 21-30. 14. Kolski H, Ford-Jones EL, Richardson S, Petric M, Nelson S, Jamieson F, et al. Etiology of acute childhood encephalitis at The Hospital for Sick Children, Toronto, 1994-1995. Clin Infect Dis. 1998;26(2):398-409. 15. Kares S, Lonnrot M, Vuorinen P, Oikarinen S, Taurianen S, Hyoty H. Real-time PCR for rapid diagnosis of entero - and rhinovirus infections using LightCycler. J Clin Virol. 2004;29(2):99-104.

16. Centers for Disease Control and Prevention (CDC). Summary of notifiable diseases, United States, 1993. MMWR Morb Mortal Wkly Rep. 1994;42(53):22. 17. Khetsuriani N, Lamonte-Fowlkes A, Oberst S, Pallansch MA. Enterovirus surveillance--United States, 1970-2005. MMWR Surveill Summ. 2006;55(8):1-20. 18. Centers for Disease Control and Prevention (CDC). Enterovirus surveillance--United States, 2002-2004. MMWR Morb Mortal Wkly Rep. 2006;55(6):153-6. 19. Valero N, Henriquez R, Hernandez C, Pomeda O, Romero M, Urdaneta F, et al. Agentes virales en pacientes con procesos infecciosos del sistema nervioso central. Invest Clin. 2001;42(4):255-67. 20. Instituto Nacional de Estadstica e Informtica. Censos Nacionales 2007: XI de Poblacin y VI de Vivienda. Sistema de Consulta de Cuadros Estadsticos [pgina de internet]. Lima: INEI; 2007. [Fecha de acceso: 28 de setiembre del 2011]; Disponible en: http://desa.inei.gob.pe/censos2007/ tabulados/. 21. Boos J, Esiri MM. Influenza virus, enteroviruses, and other epidemic viruses. In: Boos J, Esiri MM (editors). Viral encephalitis in humans. Washington, DC: ASM Press; 2003. p. 143-62. 22. Koskiniemi M, Korppi M, Mustonen K, Rantala H, Muttilainen M, Herrgard E, et al. Epidemiology of encephalitis in children. A prospective multicentre study. Eur J Pediatr. 1997;156(7):541-5. 23. Gustin R. Meningitis bacterianas en nios. Instituto de Salud del Nio, Lima-Per, 1997-2002. Paediatrica. 2005;7(1):12-7. 24. Romero JR. Reverse-transcription polymerase chain reaction detection of the enteroviruses. Arch Pathol Lab Med. 1999;123(12):1161-9.

Correspondencia: Ivn Espinoza Direccin: Av. Honorio Delgado N. 262, Urbanizacin Ingeniera. San Martn de Porres, Lima 33, Per. Telfono: (511) 01-4820402. Correo electrnico: ivespinoza@gmail.com.

Consulte la versin electrnica de la Revista Peruana de Medicina Experimental y Salud Pblica en

www.pubmed.gov

609

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

artculo original

Nios Hospitalizados con Neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per
Edwin Miranda-Choque1,a, Carlos Ramrez1,a, Jorge Candela-Herrera1,b, Javier Daz 1,b, Ana Fernndez1,b, Lenka Kolevic1,b, Eddy R. Segura2,3,c, Sonia Farfn-Ramos4,d
Resumen Objetivos. Determinar las caractersticas clnicas y demogrficas de la neumona por el virus de influenza AH1N1/2009 pandmico en un hospital de referencia de Per. Materiales y mtodos. Se realiz un estudio serie de casos en nios hospitalizados por neumona por influenza AH1N1/2009 pandmico en un hospital de referencia. Revisamos las historias clnicas entre los meses de junio a septiembre 2009. Todos los casos tuvieron confirmacin virolgica. Resultados. Se encontr 74 casos de neumona por el virus de Influenza AH1N1/2009 pandmico (NVIp), de los cuales 50 tuvieron el diagnstico de neumona adquirida en la comunidad viral (NACv) y 24 con neumona nosocomial viral (NNv) de los cuales 16 requirieron ventilacin mecnica. Fallecieron 12, todos ellos con antecedentes de comorbilidad. Los casos NNv presentaron asociacin estadstica con mortalidad. En los casos NACv, los menores de 6 aos representaron 72 % (36/50). La mediana de tiempo de enfermedad fue de 5 das. Los sntomas ms frecuentes fueron fiebre, tos, rinorrea. Recibieron oseltamivir el 82 %. En la radiografa de trax el 48 % de los casos present infiltrado en parches y el 44 % infiltrado intersticial en la radiografa de trax. La protena C reactiva (PCR) mayor a 10mg/L tuvo una asociacin significativa con insuficiencia respiratoria (p <0,05). Conclusiones. Encontramos casos NNv quienes tuvieron mayor mortalidad, tambin los que presentaron el PCR elevado y los que presentaron condicin preexistente. Palabras clave: Subtipo H1N1 del virus de la influenza A; Virus de la influenza; Neumona; Nio (fuente: DeCS BIREME).

Children Hospitalized with Influenza Pneumonia AH1N1/2009 Pandemic in the INSN


ABSTRACT ObjectiveTo determine the clinical and demographic characteristics of pneumonia with influenza virus AH1N1/2009 pandemic at the National Institute of Child. Methods. Retrospective case series in children hospitalized for influenza pneumonia pandemic AH1N1/2009 in a pediatric hospital. Reviewed the medical records between the months of June to September 2009. All cases had virological confirmation, we describe the clinical characteristics and conditions of severity. Results. A total of 74 children of pneumonia with influenza virus AH1N1/2009 pandemic (NVIp), of those 50 were community acquire pneumonia viral (NACv) and 24 pneumonia nosocomial viral (NNv), 16 required mechanical ventilation. 12 died, all had preexisting factors. NN cases showed statistical association with mortality. The most frequent factors were malnutrition, respiratory infections, congenital heart disease and neurological deficits In NACv cases the children under 6 years accounted for 72% (36/50). The median disease duration was 5 days. The most frequent symptoms were fever, cough, runny nose. Received oseltamivir 82%. The chest radiograph 48% of cases showed patchy infiltrates and 44% interstitial infiltrate on chest radiograph. Protein c reactive (CRP) more than 10mg / L was significantly associated with respiratory failure (p <0.05). Conclusions. Cases of NN found who had more mortality, even those who had the highest PCR and those with preexisting condition. Key words: Influenza A Virus, H1N1 Subtype; Orthomyxoviridae; Pneumonia; Child (source: MeSH NLM).

Servicio de Infectologa, Instituto Nacional de Salud del Nio. Lima, Per. Facultad de Salud Pblica y Administracin, Universidad Peruana Cayetano Heredia. Lima, Per. 3 Escuela de Medicina, Univesidad Peruana de Ciencias Aplicadas. Lima, Per. 4 Hospital de Emergencias Peditricas. Lima, Per. a Mdico Infectlogo; b Mdico Pediatra; c Mdico Epidemilogo Clnico; d Enfermera, especialista en Enfermera Peditrica, Magister en Salud Pblica y Comunitaria, Magister en Administracin de Salud
1 2

Recibido: 03-06-11

Aprobado: 26-10-11

610

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Neumona por influenza en nios

Introduccin
La pandemia producida por virus de influenza AH1N1/2009 pandmico, declarado as por la Organizacin Mundial de la Salud (OMS) (1), fue ocasionada por este agente que present una nueva variante viral por recombinacin gentica con elementos porcinos, aviarios y humanos (2). Este virus amenazaba con ocasionar un serio problema de salud pblica con consecuencias sanitarias, sociales y econmicas a nivel sudamericano (3). Los primeros casos ocurrieron a mediados de abril del 2009 al sur de EEUU y en Oxaca Mxico (4-7), extendindose posteriormente a nivel mundial (8). Instituciones internacionales (OMS) y nacionales elaboraron medidas frente a la pandemia (9-12), como el uso de oseltamivir a los casos confirmados o fuertemente sospechosos con presentacin clnica severa o progresiva, y a los grupos de alto riesgo como nios menores de 5 aos y adultos mayores. La Direccin General de Epidemiologia (DGE) del Ministerio de Salud (MINSA) inform el primer caso en Lima, de un viajero proveniente de New York el 09 de mayo de 2009 (13). El primer caso peditrico reportado por el Instituto Nacional de Salud del Nio (INSN) fue el 17 de mayo de 2009, de un adolescente de 16 aos, atendido por consultorio externo mientras que el primer caso hospitalizado fue el 27 de mayo, de un nio de 11 meses. Estudios iniciales en nios hospitalizados por el virus de influenza AH1N1/2009 reportaron mayor tasa de hospitalizaciones que los casos hospitalizados por influenza estacional (14). Los casos pueden ser desde asintomticos u oligosintomticos hasta llegar a casos severos como neumonas con insuficiencia respiratoria. Estas manifestaciones incluyen tos, alza trmica, cefalea, malestar general, artralgias, mialgias, rinorrea, dolor de garganta, disnea, roncantes, sibilantes crepitantes, sntomas gastrointestinales como diarrea o vmitos; cursando con complicaciones neurolgicas (convulsiones y encefalitis), complicaciones hematolgicas (pancitopenia) (15,16) as como empeoramiento de enfermedades crnicas como asma y neumona bacteriana (17). Se plantea que el espectro clnico de la infeccin por el virus de influenza AH1N1/2009 pandmica tiene relacin con el reordenamiento gentico inicial hasta su posterior estabilidad gentica, adems con la etnicidad y el estado inmunolgico del husped (17,18). El presente estudio tiene como objetivo determinar las caractersticas clnicas y demogrficas de la neumona asociada al virus de influenza AH1N1/2009 pandmica en el INSN.

Materiales y Mtodos
Diseo de estudio Realizamos un estudio de serie de casos. Se identific los casos hospitalizados con diagnstico de neumona registrados en la Oficina General de Epidemiologia del INSN entre los meses de junio y septiembre de 2009. Se incluy a pacientes con diagnstico viral confirmado por transcriptasa reversa de la reaccin en cadena de polimerasa en tiempo real (tr-PCR-TR) realizado en el Instituto Nacional de Salud (INS) del Per. Se excluy aquellos que no presentaron sintomatologa aguda, infiltrado pulmonar, as como cinco casos por tener historias clnicas incompletas. Se defini como caso de neumona por el virus de influenza AH1N1/2009 pandmico (NVIp) aquellos pacientes con sntomas respiratorios agudos como tos, disnea, dolor de garganta, con alza trmica mayor o igual de 38 C o antecedente de fiebre; se clasific como neumona adquirida en la comunidad viral (NACv) si la trasmisin ocurri en la comunidad y acudieron por consultorio o por emergencia y como neumona nosocomial viral (NNv) si la enfermedad se desarroll despus de 72 horas del ingreso al hospital. Se recolect informacin a travs de una ficha de datos elaborada por los autores. En los casos de NACv se registr variables al ingreso de la hospitalizacin como edad, sexo, tiempo de enfermedad, hipoxemia, estado nutricional, antecedente de asma o sindrome de obstruccin bronquial, contacto a sintomticos respiratorios, comorbilidades. Asimismo, datos de exmenes auxiliares como hemograma completo, bioqumica sangunea y radiografas de trax. En los casos NNv la informacin se bas en la historia clnica, resultado de la activa vigilancia epidemiolgica del INSN. La causa de muerte se defini de la siguiente manera: A) Directa: atribuida principalmente al virus de influenza AH1N1/2009 pandmico. B) Relacionada: la causa principal de muerte es otra enfermedad diferente al de la influenza AH1N1/2009 pandmico; sin embargo, esta agrav el estado de salud. C) Coincidente: la causa de muerte es otra enfermedad diferente del virus de influenza AH1N1/2009 pandmico. La causa de muerte se determin por junta mdica, la cual estuvo conformada por dos mdicos infectlogos pediatras, tres epidemilogos, dos intensivistas pediatras, un genetista, un radilogo y un neumlogo pediatra. El estudio fue aprobado por la unidad de capacitacin e investigacin del INSN.

611

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Miranda-Choque E et al.

Total de hospitalizados por infeccin respiratoria (Poblacin accesible) N:432

solo en los casos NACv, asociacin para insuficiencia respiratoria. Se consider como diferencia significativa un valor de p <0,05.

Resultados
Sospecha de neumona por nvAH1N1/09p. N:192

Neumona confirmada nvAH1N1/09 p. N:74 Sala infectologia aislado N:25 Otras salas N: 25 Fallecidos Recuperados N:5 N:45 Fallecidos UCI: 4 Otras Salas: 3

Entre junio y septiembre de 2009 se hospitalizaron 432 pacientes con diagnstico de infeccin respiratoria aguda. Se encontr 192 casos de neumona, de los cuales 74 pacientes presentaron NVIp (50 casos NACv y 24 casos NNv) (Figura 1). La Figura 2 representa de la distribucin de los casos NACv y NNv segn semana epidemiolgica.
UCI N:8

Extrahospitalizados N:50

Intrahospitalizados N:24

Neumona adquirida en la comunidad por el virus de Influenza AH1N1/2009 pandmico (NACv). El 64 % (32/50) recibi antibiticos antes de la hospitalizacin. Requirieron de oxigeno 16 (32 %), requirieron ventilador mecnico 8 (16 %), recibieron oseltamivir 41 (82 %). La mediana de tiempo de enfermedad antes de llegar al hospital fue de 5 das (rango 1 a 10 das). El promedio de das de hospitalizacin fue de 10 das (rango de Tabla 1. Caractersticas de los pacientes hospitalizados con neumona por el virus de influenza AH1N1/2009 pandmico en el INSN, Lima-Per, junio-septiembre 2009.
CARACTERSTICAS Todos los casos Hombres (Sexo) Edad (aos) Mediana Rango Grupo etario < 2 aos 2-5 aos 6-18 aos Procedencia Lima Comorbilidad Ninguno Asma/SOBA Dficit neurolgico crnico Desnutricin aguda Desnutricin crnica Infeccin respiratoria previa VIH Sd. Down/Klinefelter Cardiopata congnita Pancitopenia/neutropenia NACv N (%) 50 24 (48) 2 0,1-15 24 (48) 12 (24) 14 (28) 46 (92) 11 (22) 16 (32) 13 (26) 8 (16) 8 (16) 7 (14) 2 (4) 2 (4) 2 (4) 1 (2) NNv N (%) 24 14 (58) 7 0,1-17 5 (21) 3 (13) 16 (67) 13 (54) ----2 (8) 3 (13) 5 (21) 8 (33) 6 (25) ----1 (8) 4 (17) 3 (13) TOTAL 74 38 (51) 2,5 0,1-17 29 (39) 15 (20) 30 (41) 59 (80) 11 (15) 18 (24) 16 (22) 13 (18) 16 (22) 13 (18) 2 (3) 3 (4) 6 (8) 4 (5)

Otras salas N:16

Recuperados N:14

Figura 1. Flujograma de seleccin de participantes en el estudio.

Anlisis Estadstico Por medio de software estadstico STATA versin 10, se identific la media, mediana y porcentajes. En el anlisis bivariado se consider insuficiencia respiratoria. Para las variables discretas se realiz el chi cuadrado, prueba exacta de Fisher. Se us regresin logstica mediante modelos anidados para identificar los factores que afectan el riesgo de muerte con las variables ms representativas. Adems se explor,
14 NACv NNv

Casos de neumona NV AH1N1/2009p

12 10 8 6 4 2 0 25 26 27 28 29 30 31 32 33 34 35 36 37

Semana epidemiolgica Figura 2. Nmero de hospitalizados con neumona por el virus AH1N1/2009 pandmico segn la semana de inicio de sntomas, INSN, Per. Jun.-Set. 2009.
NACv: Neumona adquirida en la comunidad viral. NNv: Neumona nosocomial viral.

NACv: Neumona adquirida en la comunidad viral. NNv: Neumona nosocomial viral.

612

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Neumona por influenza en nios

3 a 30 das). Al preguntarle a la responsable del cuidado del paciente, si existi otros integrantes de la familia con tos, el 64 % (32/50) respondi afirmativamente, siendo 4 la mediana de nmero de integrantes de familia por caso. En relacin a exmenes auxiliares, el 48 % present leucocitosis, 34 % linfopenia, 14% present leucopenia y el 10 % trombocitosis. Se encontr PCR mayor a 10mg/L en 13 pacientes. Con respecto a la radiografa de trax, el 48 % (24/50) present infiltrado en parches y el 44 % (22/50) infiltrado intersticial. Las complicaciones que se encontraron fueron neumona complicada con absceso o derrame pleural (cuatro casos), pancitopenia (dos casos), encefalitis viral (un caso) y otitis media aguda (un caso). En el anlisis de regresin logstica se encontr que el PCR mayor a 10 mg/L estaba asociado con insuficiencia respiratoria hallndose un OR de 4,2 (IC:1,5-6,8, p=0,001). Siendo la insuficiencia respiratoria cuatro veces ms frecuentes con la PCR mayor de 10 mg/L en los nios con PCR menor. No se encontr asociacin con el antecedente de asma o el uso de oseltamivir (Tabla 3). Neumona Nosocomial por el virus de Influenza AH1N1/2009 pandmico (NNv) De los 24 casos de NNv, ocho casos se encontraban en la Unidad de Cuidados Intensivos y los 16 restantes se encontraron hospitalizados en salas de medicina, cardiologa, neumologa, nefrologa y neurologa.

Los mayores de 6 aos representa la mayora de los casos con el 67 % (16/24). Las comorbilidades ms frecuentes fueron desnutricin crnica e infecciones respiratorias previas, cardiopata congnita y dficit neurolgico crnico. Ocho casos estuvieron en ventilador mecnico. Los casos fallecidos fueron siete (mortalidad de 29 %) y presentaron como antecedente pancitopenia (2), cardiopata congnita (3) lupus eritematoso sistmico (LES) (1) y dermatomiositis (1). Fallecidos en los casos de Neumona por el virus de Influenza AH1N1/2009 pandmico. Con respecto a los doce casos fallecidos, cinco fueron NACv y 7 fueron NNv (Tabla 4). Mediante el anlisis de regresin logstica se encontr que ser un caso NNv es riesgo de fallecer por Neumona asociado al virus de influenza AH1N1/2009 pandmico con un OR de 4,7 (IC: 1,1-20,1, p=0,02) (Tabla 3). No se encontr asociacin entre el uso de oseltamivir, antecedente de asma/soba o los valores de PCR.

Discusin
El impacto de la pandemia del virus de influenza AH1N1/2009 pandmico en el INSN, se ha traducido en un incremento del nmero de casos entre la semana 28 a la semana 35, con mayor actividad en la semana 29,

Tabla 2. Signos y sntomas clnicos en nios hospitalizados con NACv, Lima-Per, Junio-Setiembre 2009.
Signos y sntomas Fiebre Tos Rinorrrea Subcrepitantes Sibilancias Roncates Expectoracin Odinofagia Astenia Crepitantes Vmitos Diarrea Mialgia Cefalea Dolor abdominal Valores (%) 45 (90) 43 (86) 30 (60) 25 (50) 24 (48) 23 (46) 22 (44) 17 (34) 17 (34) 16 (32) 14 (28) 14 (28) 5 (10) 4 (8) 4 (8)

Tabla 3. Resultados de anlisis de regresin logstica de indicadores pronstico de severidad, nios hospitalizados con neumona por el virus de influenza AH1N1/09 pandmico, Lima-Per, junio septiembre 2009. Odds ratio (IC 95 %)
Total de casos * Ser caso NNv Desnutricin PCR10mg/L Antecedente asma Uso de oseltamivir Solo casos ambulatorios ** PCR10mg/L Antecedente de SOBA/ Asma Tiempo enfermedad 2 das Uso de oseltamivir

p 0,032 0,428 0,105 0,721 0,054 0,002 0,245 0,444 0,361

4,7 (1,1 20,1) 1,7 (0,4 7,2) 3,5 (0,7 16,3) 0,1 (0,1 1,0) 0,8 (0,2 3,4) 4,2 (1,5 6,8) 2,2 (0,6 8,2) 1,6 (1,0 4,3) 2,4 (0,3 17,1)

* Anlisis de regresin logstica, se consideraron todos los casos: NACv y NNv. ** Anlisis de regresin logstica de casos NACv. NACv: Neumona adquirida en la comunidad viral. NNv: Neumona nosocomial viral.

613

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Miranda-Choque E et al.

datos que coinciden con estudios de vigilancia nacional en el Per (13). Es importante sealar que el 32 % (24/74) de los casos confirmados son nios con el antecedente de hospitalizacin previa, lo cual los hace ms susceptibles de infeccin como lo sugieren otros estudios (19,20). La informacin brindada de la vigilancia nacional de los casos de influenza por el virus AH1N1/2009 pandmico en nios por grupos etarios, indica que a medida que se incrementa la edad se incrementan el nmero de casos (13), a diferencia de los nios que requirieron hospitalizacin (como en nuestro estudio) el comportamiento es inverso, los casos de NACv son ms frecuentes en los menores de 2 aos y despus desciende la frecuencia a medida que aumenta la edad, informacin parecida a otros estudios (21-24). Sin embargo en los casos NNv los mayores de 6 aos son ms frecuentes. Se evidenci que los casos NACv en el momento de su ingreso por emergencia, la presencia de hipoxemia en el 32 % (16/50), siendo este porcentaje variable en otros estudios (21-23). Informacin importante para la implementacin de medidas en la atencin en los diferentes niveles de atencin. En nuestro estudio la variable uso del antiviral oseltamivir, es un dato no precisado, al no conocerse

el tiempo exacto del inicio de ingesta del medicamento; sin embargo, sera interesante analizar la relacin con estudios ms amplio; ltimos reportes no demuestran el efecto deseado en la eliminacin del virus (25). En los casos NACv los sntomas gastrointestinales como diarrea o vmitos, mencionados como importantes en la presentacin clnica segn la gua de la OMS y directiva sanitaria del MINSA, es adecuada si consideramos que lo presentaron el 28 % (14/50) de los casos de NACv y tres de los cinco que llegaron a morir; sin embargo, no fue posible demostrar la asociacin significativa, probablemente porque la muestra es insuficiente. Determinar el tipo de muerte por el virus de influenza AH1N1/2009 pandmico fue controversial. Los fallecidos con numerales 1, 5 y 8 (Tabla 4) se consideraron coincidentes por presentar signos y sntomas de infeccin respiratoria mnima, pero los dos primeros casos fallecieron por falla heptica con complicaciones metablicas y por infarto cardiaco en el tercero. De los informes de Microbiologa de los hemocultivos que se tomaron a todos los casos ambulatorios previo uso de antibiticos en emergencia, se aisl solamente un caso con Estreptococo pneumoniae. Esto confirmara la coinfeccin de una bacteria y el virus de

Tabla 4. Pacientes fallecidos con neumona por el virus de influenza AH1N1/2009 pandmico en el INSN, Lima-Per, junio septiembre 2009.
N. 1 2 3 4 5 6 7 8 9 10 11 12 Edad 11 aos 2 aos 4 aos 7 meses 10 aos 2 meses 5 meses 13 aos 14 aos 14 aos 2 aos 2 aos Sexo M M F F M F F F F M M M Condicin preexistente Pancitopenia, falla heptica Hidrocefalia, reflujo gstrico Mielomeningocele, PCI*** Microcefalia, agenesia cuerpo calloso Pancitopenia, falla Heptica Cardiopata congnita, NAV** Cardiopata congnita, displasia Broncopulmonar Cardiopata congnita Lupus eritematoso sistmico Dermatomiositis Sndrome klinefelter Sndrome de down, cardiopata congnita Das hospital 11 9 13 10 5 26 7 19 10 14 11 24 Trasmisin Nosocomial Ambulatorio Ambulatorio Ambulatorio Nosocomial Nosocomial Nosocomial Nosocomial Nosocomial Nosocomial Ambulatorio Ambulatorio Diagnstico Falla multiorgnica Neumona viral Neumona viral Neumona viral Falla multiorgnica Falla multiorgnica Falla multiorgnica Infarto de miocardio Neumona viral Falla multiorgnica Neumona viral NAV** Causa de muerte* Coincidente Directa Directa Directa Coincidente Relacionada Relacionada Coincidente Directa Directa Directa Relacionada

* Causa de muerte: A) Directa: atribuida principalmente al virus de influenza AH1N1/2009 pandmico. B) Relacionada: la causa principal de muerte es otra enfermedad diferente al de la influenza AH1N1/2009 pandmico; sin embargo, esta agrav el estado de salud. C) Coincidente: la causa de muerte es otra enfermedad diferente del virus de influenza AH1N1/2009 pandmico. ** NAV: neumona asociada a ventilador. ***PCI: parlisis cerebral Infantil.

614

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Neumona por influenza en nios

la influenza AH1N1/09 pandmica en el desarrollo de neumona (26). No se tiene datos de coinfeccin de la NIVp con otros virus en el INSN, considerando que en vigilancia en otras instituciones evidencian la circulacin de otros virus (27), siendo este dato importante para la deteccin oportuna de brotes, vigilancia de la circulacin de virus respiratorios y severidad de los casos, por lo que sugerimos considerar al INSN centro de vigilancia nacional de infecciones respiratorias. Estos datos pueden ayudar en la atencin ante otra eventual situacin de brote de infeccin viral respiratoria. Se sugiere considerar la vacunacin a los hospitalizados en pediatra por tener un riesgo elevado de fallecer. Creemos que si existe un brote de infeccin respiratoria viral en la comunidad, esta sera mayor a nivel hospitalario en servicios que atienden nios por ser trasmitida entre pacientes, familiar acompaante y personal de salud, por lo que sugerimos reforzar las medidas de prevencin y control de infecciones nosocomiales, como la higienizacin de las manos (lavado de manos y uso de alcohol gel), y tomar precauciones de aislamientos. En conclusin, la mayora de los casos de nios con neumona por el virus de influenza AH1N1/2009 pandmico se presentaron entre junio y septiembre de 2009. El 32 % de los casos fueron NNv. El grupo etario ms numeroso en los casos NACv son los menores de seis aos y en los casos NNv son los mayores de cinco aos. Recibieron oseltamivir el 82 % de los pacientes. El 48 % de los casos present infiltrado en parches y el 44 % infiltrado intersticial en la radiografa de trax. Los fallecidos fueron ms en los casos NNv. El incremento de los valores del PCR se asoci a los casos de insuficiencia respiratoria. La principal limitacin de la presente investigacin fue utilizar fuentes secundarias para el recojo de informacin.

versin del manuscrito, JC-H particip en la concepcin y diseo del trabajo, interpretacin de datos, y redaccin de la primera versin del manuscrito, JD particip en la concepcin y diseo del trabajo, interpretacin de datos, y redaccin de la primera versin del manuscrito, AF particip en la concepcin y diseo del trabajo, LK particip en la concepcin y diseo del trabajo, ES particip en el diseo del trabajo, anlisis, interpretacin de datos y redaccin del manuscrito, SF-R particip en el diseo, anlisis, interpretacin de datos y redaccin del manuscrito. Todos los autores revisaron en forma crtica versiones preliminares del manuscrito y aprobaron la versin final del trabajo.

Fuentes de financiamiento

Este trabajo ha sido financiado por la unidad de capacitacin del Instituto Nacional de Salud del Nio (INSN).

Conflictos de inters

Los autores declaran no tener conflictos de inters en la publicacin de este artculo.

Descargo de Responsabilidad

Las opiniones y afirmaciones contenidas aqu son propias de los autores y no deben interpretarse como posicin oficial o que reflejan la opinin del INSN.

Referencias Bibliogrficas
1. Chan M. World now at start of 2009 influenza pandemic. Geneva: WHO; 2009. 2. Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ, et al. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med. 2009;360(25):2605-15. 3. Laguna-Torres VA, Benavides JG. Infection and death from influenza A H1N1 virus in Mexico. Lancet. 2009;374(9707):2032-3. 4. Childs RA, Palma AS, Wharton S, Matrosovich T, Liu Y, Chai W, et al. Receptor-binding specificity of pandemic influenza A (H1N1) 2009 virus determined by carbohydrate microarray. Nat Biotechnol. 2009;27(9):797-9. 5. Bermejo-Martin JF, Kelvin DJ, Eiros JM, Castrodeza J, Ortiz de Lejarazu R. Macrolides for the treatment of severe respiratory illness caused by novel H1N1 swine influenza viral strains. J Infect Dev Ctries. 2009;3(3):159-61. 6. Sherman SE, Foster J, Vaid S. Emergency Use Authority and 2009 H1N1 influenza. Biosecur Bioterror. 2009;7(3):245-50. 7. Centers for Disease Control and Prevention (CDC). Update: novel influenza A (H1N1) virus infection - Mexico, March-May, 2009. MMWR Morb Mortal Wkly Rep. 2009;58(21):585-9. 8. Scalera NM, Mossad SB. The first pandemic of the 21st century: a review of the 2009 pandemic variant influenza A (H1N1) virus. Postgrad Med. 2009;121(5):43-7.

Agradecimientos
A la Dra. Trinidad Del Pino Greco por la lectura de las radiografas de Trax, a los residentes de pediatra, internos, enfermeras, personal tcnico del Servicio de Infectologa del INSN.

Contribuciones de autora

EM-CH particip en la concepcin y diseo del trabajo, anlisis e interpretacin de datos, redaccin de la primera versin del manuscrito, redaccin de la versin final del manuscrito, CR particip en el anlisis e interpretacin de datos y redaccin de la primera

615

Rev Peru Med Exp Salud Publica. 2011;28(4):610-16.

Miranda-Choque E et al.

9. World Health Organization. Pandemic influenza preparedness and response. A WHO guidance document. Geneva: WHO; 2009. 10. World Health Organization. WHO Global Influenza Preparedness Plan 2005. Annex 1: Recommendations for non-pharmaceutical public health measures. Geneva: WHO; 2005. 11. Ministerio de Salu del Per. Plan Nacional de Preparacin y Respuesta ante Potencial Pandemia de Influenza. Lima: MINSA; 2005. 12. Mayo Hd. Guia practica clinica para el diagnostico y tratamiento de Infuenza por el virus A H1N1. Guia Tecnica. Lima: MINSA; 2009. 13. Munayco CV, Gomez J, Laguna-Torres VA, Arrasco J, Kochel TJ, Fiestas V, et al. Epidemiological and transmissibility analysis of influenza A(H1N1)v in a southern hemisphere setting: Peru. Euro Surveill. 2009;14(32). 14. Libster R, Bugna J, Coviello S, Hijano DR, Dunaiewsky M, Reynoso N, et al. Pediatric hospitalizations associated with 2009 pandemic influenza A (H1N1) in Argentina. N Engl J Med. 2010;362(1):45-55. 15. Centers for Disease Control and Prevention (CDC). Neurologic complications associated with novel influenza A (H1N1) virus infection in children - Dallas, Texas, May 2009. MMWR Morb Mortal Wkly Rep. 2009;58(28):773-8. 16. ORiordan S, Barton M, Yau Y, Read SE, Allen U, Tran D. Risk factors and outcomes among children admitted to hospital with pandemic H1N1 influenza. CMAJ. 2010;182(1):39-44. 17. Zarychanski R, Stuart TL, Kumar A, Doucette S, Elliott L, Kettner J, et al. Correlates of severe disease in patients with 2009 pandemic influenza (H1N1) virus infection. CMAJ. 2010;182(3):257-64. 18. Yu H, Zhang GH, Hua RH, Zhang Q, Liu TQ, Liao M, et al. Isolation and genetic analysis of human origin H1N1 and H3N2 influenza viruses from pigs in China. Biochem Biophys Res Commun. 2007;356(1):91-6. 19. Perez-Padilla R, de la Rosa-Zamboni D, Ponce de Leon S, Hernandez M, Quinones-Falconi F, Bautista E, et al. Pneumonia and respiratory failure from swineorigin influenza A (H1N1) in Mexico. N Engl J Med. 2009;361(7):680-9.

20. Wicker S, Rabenau HF, Bickel M, Wolf T, Brodt R, Brandt C, et al. [Novel influenza H1N1/2009: virus transmission among health care worker]. Dtsch Med Wochenschr. 2009;134(48):2443-6. 21. Lister P, Reynolds F, Parslow R, Chan A, Cooper M, Plunkett A, et al. Swine-origin influenza virus H1N1, seasonal influenza virus, and critical illness in children. Lancet. 2009;374(9690):605-7. 22. Fraser C, Donnelly CA, Cauchemez S, Hanage WP, Van Kerkhove MD, Hollingsworth TD, et al. Pandemic potential of a strain of influenza A (H1N1): early findings. Science. 2009;324(5934):1557-61. 23. Louie JK, Acosta M, Winter K, Jean C, Gavali S, Schechter R, et al. Factors associated with death or hospitalization due to pandemic 2009 influenza A(H1N1) infection in California. JAMA. 2009;302(17):1896-902. 24. Muhammad Ismail HI, Tan KK, Lee YL, Pau WS, Razali KA, Mohamed T, et al. Characteristics of children hospitalized for pandemic (H1N1) 2009, Malaysia. Emerg Infect Dis. 2011;17(4):708-10. 25. Ling LM, Chow AL, Lye DC, Tan AS, Krishnan P, Cui L, et al. Effects of early oseltamivir therapy on viral shedding in 2009 pandemic influenza A (H1N1) virus infection. Clin Infect Dis. 2010;50(7):963-9. 26. Centers for Disease Control and Prevention (CDC). Bacterial coinfections in lung tissue specimens from fatal cases of 2009 pandemic influenza A (H1N1) - United States, May-August 2009. MMWR Morb Mortal Wkly Rep. 2009;58(38):1071-4. 27. Laguna-Torres VA, Gomez J, Aguilar PV, Ampuero JS, Munayco C, Ocana V, et al. Changes in the viral distribution pattern after the appearance of the novel influenza A H1N1 (pH1N1) virus in influenza-like illness patients in Peru. PLoS One. 2010;5(7):e11719.

Correspondencia: Edwin Miranda Choque Direccin: Av. Pachacutec 910, Lima 11, Per. Telfono: (511) 994645290 Correo electrnico: emirandach@hotmail.com

Visite los contenidos de la revista en:

www.ins.gob.pe/rpmesp

616

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

artculo original

prescripcin inadecuada de transfusin sangunea en un Hospital de Referencia DE Lima, Per


Wilfredo Flores-Paredes1,a
RESUMEN Objetivos. Determinar la frecuencia y los criterios clnicos asociados a la prescripcin inadecuada de hemocomponentes. Materiales y mtodos. Estudio transversal realizado entre junio y octubre de 2002. Se revis las historias mdicas y los exmenes de laboratorio de los pacientes que recibieron transfusiones sanguneas. Para valorar las indicaciones de transfusin como adecuadas o inadecuadas se emple una gua de transfusin elaborada en base a consensos publicados. Resultados. Se evaluaron 311 indicaciones de transfusin. El porcentaje global de prescripcin inadecuada fue de 33.8 %. Los glbulos rojos (GR) se usaron inadecuadamente en 25 %, el plasma fresco congelado en 59 %, las plaquetas en 13 % y el crioprecipitado en 88 %. En Ciruga, una de cada dos indicaciones fue inadecuada mientras que en los servicios de Medicina, UCI y Emergencia, una de cada tres lo fue. El plasma fresco congelado fue el componente peor utilizado. Conclusiones. Existe una elevada frecuencia de prescripcin inadecuada de hemocomponentes en la poblacin de estudio. La identificacin de los criterios clnicos especficos de indicacin inapropiada de transfusin puede ayudar a disear estrategias para el uso racional. Palabras clave: Transfusin de componentes sanguneos; Seguro social; Guas de prctica mdica (fuente: DeCS BIREME).

to inadequate indication of blood transfusion in a Reference Hospital in Lima, Peru


ABSTRACT Objectives. To determine frequency and clinical criteria associated to the inadequate indication of blood products. Materials and methods. A cross-sectional study was performed between June and October 2002. Clinical charts and the laboratory tests from patients receiving blood transfusions were examined. A blood transfusion guideline was elaborated based on published consensus, and used to determine whether the indications for blood products transfusion was adequate or inadequate. Results. A total of 311 blood transfusions were evaluated. The global prevalence of inappropriate indication was of 33.8 %. Red blood cells (RBC) were used inappropriately in 25 %, fresh frozen plasma (FFP) in 59 %, platelets in 13 % and cryoprecipitate in 88 %. From surgery related transfusions half of the indications were inadequate. In internal medicine, ICU and emergency related transfusions, approximately one third of the indications were inadequate. The FFP is the worst used blood product. Conclusions. We found a high frequency of inadequate blood transfusion. The identification of the specific clinical criteria used in inadequate indications transfusions will help in designing a better educational strategy towards a more rational use of the blood products. Key words: Blood component transfusion; Social security; Practice guidelines (source: MeSH NLM).

INTRODUCCIN
Los beneficios de la transfusin sangunea son reales y de su uso puede depender la vida del paciente; sin embargo, no est libre de riesgos, aunque ha adquirido un gran desarrollo y seguridad, an no es posible proporcionar un componente sanguneo con riesgo cero (1). Entre los efectos adversos ms conocidos de la transfusin sangunea se encuentran las reacciones febriles no hemolticas, hemlisis inmune, aloinmunizacin, enfermedad de injerto contra husped, inmunomodulacin e infecciones. En el uso de los hemocomponentes es necesario un anlisis riesgo/
1 a

beneficio para el paciente, por lo que cada indicacin requiere una valoracin profunda que garantice un mejor aprovechamiento y xito de la hemoterapia (2). Un problema presente en la prctica de la transfusin corriente es la elevada proporcin de transfusiones que son catalogadas como innecesarias. En los Estados Unidos de Norteamrica se informan tasas de 57 % en transfusin inapropiadas de glbulos, de 71 % en plasma fresco congelado y hasta el 26 % en concentrados plaquetarios (3-5). Metz et al. (6), en una auditora realizada a un hospital de Australia, identificaron que las tasas inapropiadas de transfusin de GR fueron

Departamento de Patologa Clnica, Hospital Nacional Guillermo Almenara Irigoyen, EsSalud. Lima, Per. Mdico Patlogo Clnico, Magster en Epidemiologa

Recibido: 10-05-11

Aprobado: 24-08-11

617

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

Flores-Paredes W

de 16 %, de plaquetas en 13 %, y de PFC en 24 %. En Ontario Canad (7), se hall que 55,3 % de las unidades de GR tuvieron un uso innecesario. Otro estudio en Canad (8), hall que el 45 % de las transfusiones de PFC fueron inapropiadas. Mientras que en Francia (9) una auditora juzg que el 23 % de las prescripciones de PFC fueron inapropiadas. Durante el ao 2001 fueron transfundidos ms de 65 000 componentes sanguneos en el Hospital Nacional Edgardo Rebagliati Martins, hospital de referencia del seguro social de Per. El objetivo de la presente investigacin fue conocer la frecuencia de inadecuada prescripcin de los componentes sanguneos as como conocer los criterios clnicos especficos de estas indicaciones innecesarias.

o crioprecipitado, en un perodo de 24 horas (de medianoche a medianoche siguiente). Solo se consider una indicacin por tipo de hemocomponente. Esto se bas en la premisa de que el hemocomponente transfundido durante el perodo de 24 horas constituye un evento de transfusin que tendra el mismo criterio de indicacin (10). GUA DE TRANSFUSIN DE COMPONENTES DE LA SANGRE Esta gua, elaborada en el Departamento de Patologa Clnica del Hospital Rebagliati, seala los criterios de indicacin inadecuada para cada hemocomponente. Estos criterios se tomaron de normas y guas internacionales: Parmetros prcticos para la transfusin de glbulos rojos del Colegio Americano de Patlogos (11), Guas prcticas para la terapia con componentes sanguneos de la Sociedad Americana de Anestesiologa (3), Guas para la transfusin de glbulos rojos y plasma en adultos de la Sociedad Canadiense de Medicina (12), Terapia de transfusin de la Asociacin Americana de Bancos de Sangre (13), Transfusin de plaquetas en pacientes con cncer de la Sociedad Americana de Oncologa Clnica (14) as como otros artculos de revisin (10,15-18). La Tabla 1 resume algunos criterios inadecuados considerados en la gua elaborada. Para considerar que el perfil de coagulacin estaba alterado, deba tener un tiempo de protrombina (TP) o un tiempo de tromboplastina parcial (TTP), antes de la heTabla 1. Indicaciones inadecuadas de transfusin sangunea segn protocolo del Hospital Rebagliati 2002.
Situacin Transfusin de glbulos rojos en anemia aguda Transfusin de glbulos rojos en profilaxis prequirrgica Transfusin de plasma fresco congelado Criterio inadecuado de transfusin Con Hb > 10 g/dL Como expansor de la volemia Profilaxis prequirrgica con Hb > 10 g/dL Expansor de la volemia Hipoalbuminemia Fundir edemas nicamente perfil de coagulacin alterado (sin sangrado ni previo a procedimiento invasivo o quirrgico) PTI (excepto en hemorragia que pone en peligro la vida) PTT y trombocitopenia inducida por heparina (excepto en hemorragia que pone en peligro la vida) Disfuncin plaquetaria debido a uremia.

MATERIALES Y MTODOS
Estudio transversal descriptivo, realizado en el Hospital Nacional Edgardo Rebagliati Martins, Lima, Per. Este hospital cuenta con 1492 camas de hospitalizacin y con casi todas las especialidades mdicas y quirrgicas. La poblacin de estudio lo conformaron pacientes mayores de 14 aos que recibieron alguna transfusin sangunea durante los meses de junio a octubre de 2002. Se excluyeron a los pacientes con anemia hemoltica congnita (talasemias) o adquirida, que fueron transfundidos con glbulos rojos, ya que requieren criterios de indicacin muy especficos. En la presente investigacin se consideraron cuatro servicios: Medicina (Med), Unidad de Cuidados Intensivos (UCI), Ciruga Hospitalizacin (Cir-Hosp), Ciruga Sala de Operaciones (Cir-SOP) y Emergencia (Emg). En el periodo entre junio a octubre de 2002, se prescribieron aproximadamente 9000 unidades por 3000 indicaciones de transfusin. Considerando que la proporcin esperada de transfusin inadecuada era del 50 %, con una precisin del 6 % y un intervalo de confianza del 95 %, el tamao de muestra era de 260. Se le aument un 10 % por problemas en la recoleccin de datos, debiendo revisar 286 indicaciones de transfusin. El muestreo fue estratificado proporcional al tamao del estrato segn el informe estadstico de los hemocomponentes transfundidos el ao 2001. El mtodo de seleccin dentro de cada estrato fue el aleatorio simple. El estudio fue aprobado por el comit de tica hospitalario. Indicacin de transfusin sangunea Consideramos como evento de transfusin de un hemocomponente si el paciente reciba glbulos rojos (GR), plasma fresco congelado (PFC), concentrado plaquetario

Transfusin de plaquetas en escenario clnico y oncohematolgico

PTI: prpura trombocitopnica idioptica; PTT: prpura trombtica trombocitopnica

618

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

Prescripcin inadecuada de transfusin

motransfusin, de 1,5 a ms veces el valor del control normal. Los valores de control del laboratorio del hospital para el TP y TTP fueron 12 2 segundos y 38 6 segundos respectivamente. Valoracin de la indicacin de transfusin Se revisaron las historias clnicas de los pacientes transfundidos con algn hemocomponente para ver su estado clnico y sus resultados de exmenes de laboratorio. Luego de contrastar esta informacin con la Gua de transfusin elaborada se procedi a valorar el criterio clnico aplicado como adecuado o inadecuado. Anlisis estadstico Los datos se ingresaron al programa EpiInfo (versin 6.04; CDC, Atlanta, GA). Se aplic estadstica descriptiva, mostrando los datos con frecuencias y porcentajes; obteniendo las prevalencias de transfusin inadecuada segn servicio de hospitalizacin y tipo de hemocomponente.

Criterios inadecuados usados en la indicacin de GR La administracin de GR bajo la indicacin de hemorragia perioperatoria < 25 % de la volemia fue la prescripcin con mayor frecuencia de mal uso, todos ellos en sala de operaciones (diez casos). Asimismo, se encontr siete indicaciones inadecuadas de administracin de GR en anemia aguda con Hb >10 g/dL (tres en Cir-SOP, dos en UCI, uno en Med y uno en Cir-Hosp) y siete por anemia aguda o hemorragia perioperatoria con Hb entre 6 y 10g/dL sin factores de riesgo de hipoxia tisular (tres en Med, tres en Emg y uno en Cir-Hosp). Con relacin a casos de anemia crnica, se encontraron cuatro indicaciones inadecuadas de transfusin en pacientes con Hb entre 5 y 8 g/dL sin sntomas de hipoxia (servicio de Medicina y Emergencia, dos casos cada uno), y una indicacin en un paciente con Hb> 8 g/dL (Cir-Hosp). Tambin se hall cuatro prescripciones inadecuadas en casos de profilaxis prequirrgica con Hb entre 8 y 10 g/dL, no justificadas ni por el tipo de ciruga ni por factores asociados a hipoxia tisular (dos en Med, uno en UCI, uno en Cir-Hosp). Criterios inadecuados usados en la indicacin de PFC El criterio inadecuado utilizado con mayor frecuencia fue el sangrado leve sin perfil alterado (nueve en Cir-SOP, dos en Emg y dos en UCI) seguido de hipoalbuminemia mas edema (seis en Med, cuatro en Cir-Hosp) y perfil alterado sin sangrado ni ciruga prxima (tres en Emg, dos en Med, dos en UCI y dos en Cir-Hosp). Tambin se encontr ocho prescripciones inadecuadas por la indicacin de transfusin en prequirrgico sin perfil alterado (tres en Emg, dos en Med, dos en CirHosp y uno en UCI) y ocho por uso en pacientes que presentaban solamente edemas (seis en Med, uno en UCI, uno en Cir-Hosp).

RESULTADOS
Se evaluaron 311 indicaciones de transfusiones de hemocomponentes (917 unidades para 241 pacientes) con lo que se cubri el tamao de muestra requerido. Se incluyeron 132 indicaciones de GR, 100 de PFC, 54 de plaquetas, y 25 de crioprecipitado. Se encontr prescripciones inadecuadas en 121 de ellas (38,9%). Los GR se usaron inadecuadamente en 25 % (33/132), el PFC en 59 % (59/100), las plaquetas en 13 % (7/54) y el crioprecipitado en 88 % (22/25). En el servicio de medicina, el 36,8 % (32/87) de las indicaciones de transfusin fueron inadecuadas, en ciruga el 50,5 % (46/91), en las UCI el 33,7 % (29/86) y en emergencia el 29,8 % (14/47). En la Tabla 2 se aprecia el porcentaje de prescripcin inadecuada segn servicio y hemocomponente.

Tabla 2. Valoracin de la indicacin de transfusin segn servicio y hemocomponente.


Servicio Medicina Ciruga UCI Emergencia Glbulos rojos Adecuada Inadecuada N (%) N (%) 24 (75) 8 (25) 34 (67) 17 (33) 22 (88) 3 (12) 19 (79) 5 (21) Plasma fresco congelado Adecuada Inadecuada N (%) N (%) 7 (27) 19 (73) 8 (25) 24 (75) 21 (72) 8 (28) 5 (38) 8 (62) Plaquetas Adecuada Inadecuada N (%) N (%) 24 (86) 4 (14) 3 (60) 2 (40) 11 (92) 1 (8) 9 (100) -Crioprecipitado Adecuada Inadecuada N (%) N (%) -1 (100) -3 (100) 3 (15) 17 (85) -1 (100)

N (%), nmero de indicaciones de transfusin.

619

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

Flores-Paredes W

Otras indicaciones inadecuadas fueron: postquirrgico sin perfil alterado (cinco en Cir-Hosp, uno en UCI), hipoalbuminemia solamente (dos en Med), hepatopata grave ms perfil alterado sin sangrado previo a procedimiento invasivo (uno en Med), transfusin masiva < 1,5 volemias de recambio (uno en Cir-SOP) y expansor de la volemia (uno en UCI). Fue constante observar, en todos los servicios, que una leve prolongacin de los tiempos de coagulacin sin llegar al umbral conocido fue considerada como perfil alterado. Criterios inadecuados usados en la indicacin de plaquetas Las plaquetas fueron el hemocomponente mejor utilizado. Las especialidades de oncologa y hematologa son las que ms usaron los concentrados plaquetarios. Se encontr dos prescripciones inadecuadas por trombocitopenia crnica, severa y estable sin sntomas y sin tratamiento activo en el Servicio de Medicina. Otras indicaciones inadecuadas fueron: paciente con sepsis y recuento plaquetario >43 000/l (uno en UCI), procedimiento invasivo mayor con recuento plaquetario >50 000/l (un caso en Medicina por colocacin de un catter central), hemorragia activa con recuento plaquetario >50 000/l (uno en Cir-SOP) y prpura trombocitopnica idioptica (uno en Med). Criterios usados en la indicacin de crioprecipitado El crioprecipitado se us fundamentalmente en las UCI, en el escenario postoperatorio de cirugas mayores; a estos pacientes se les transfundi incorrectamente crioprecipitado debido a un perfil alterado, incluso solo debido a una leve prolongacin del TP o TTP o tambin en forma emprica bajo la suposicin de una deficiencia de factores de coagulacin y de fibringeno debido a la ciruga. Las indicaciones inadecuadas ms frecuentes se resumen en la Tabla 3. Tabla 3. Transfusin de hemocomponentes. Indicaciones inadecuadas ms frecuentes (Hospital Rebagliati 2002).
Indicacin segn tipo Glbulos Rojos (n=132) Hemorragia perioperatoria < 25% de la volemia Plasma fresco congelado (n=100) Sangrado leve sin perfil alterado Hipoalbuminemia + edema N (%) 10 (7,6) 13 (13,0) 10 (10,0)

DISCUSIN
La alta proporcin (38,9 %) de indicacin inadecuada de transfusin que se encontr en el Hospital Rebagliati guarda similitud con otras publicaciones. As, en 14 Hospitales de Australia (19), se encontr transfusiones inapropiadas de 33 % para las plaquetas, 37 % para el PFC y 62 % para el crioprecipitado. En un hospital general de Venezuela (20) la prevalencia de uso inapropiado de productos sanguneos fue de 48,7 %; segn servicios, el uso inapropiado fue: 28 % medicina, 64 % ciruga, 44 % emergencia y 53 % obstetricia. Hebert et al. (17) encontraron que la tasa de mortalidad global fue significativamente ms baja en el grupo de pacientes con estrategia restrictiva de transfusin (Hb de 7 a 9 g/dL) en comparacin con una liberal (Hb de 10 a 12 g/dL). Este fue el primer estudio que sugiri que no hay beneficio en mantener un nivel de hemoglobina mayor de 10 g/dL en pacientes crticamente enfermos. French et al. (21) afirman que la publicacin de estos resultados mejor la prctica transfusional en las UCI de Australia donde la tasa de transfusin inapropiada de GR fue de solo el 3 %. Goodnough et al. (22) sealan que un nivel de Hb de 8 g/dL parece ser el umbral apropiado para la transfusin en pacientes quirrgicos sin factores de riesgo para isquemia, mientras que el umbral de 10 g/dL podra estar justificado para pacientes considerados en alto riesgo. Cortina y Lpez de Roux (16) sealan que la prctica de la anestesia quirrgica ha sido guiada por el supuesto que un valor de Hb < de 10 g/dL es una indicacin para transfusin. Actualmente, se seala que en lugar de corregir un valor de laboratorio, debern tomarse en consideracin mltiples factores como la duracin de la anemia, extensin de la ciruga, probabilidad de una prdida masiva de sangre, as como otras condiciones coexistentes (deterioro de la funcin respiratoria, gasto cardiaco inadecuado, isquemia miocrdica o cerebrovascular y enfermedad vascular perifrica). Si una persona est sana y no existen factores de riesgo adicionales asociados a la naturaleza de la ciruga, los niveles de Hb iguales a 8 g/dL, o incluso menores, sern bien tolerados si el paciente est bien controlado (16). En el caso de los pacientes testigos de Jehov que se someten a una ciruga mayor se evidenci que con un nivel de Hb tan bajo como 7 u 8 g/dL son fisiolgicamente bien tolerados (23,24). Los criterios de profilaxis prequirrgica con puntos de corte de 8 y 10 g/dL de Hb no estn sealados en ninguno de los consensos referidos. En la presente investigacin se consideran estos umbrales como una propuesta (15,23-25).

Perfil alterado sin sangrado y sin ciruga prxima 9 (9,0) Crioprecipitado (n=25) Postquirrgico + perfil normal + fibrinogenemia 9 (36,0)

620

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

Prescripcin inadecuada de transfusin

En sala de operaciones se vio la mayor cantidad de prescripciones inadecuadas de GR, todas ellas por hemorragias perioperatorias < 25 % de la volemia. Se observ que hemorragias entre 300 y 700 mL fueron condicionantes para iniciar la transfusin. Asimismo, se identificaron casos de transfusin conjunta de GR y PFC con sangrados de 300 a 500 mL. En los pacientes que se sometern a ciruga es esencial que se les ofrezca un tratamiento alternativo al uso de sangre alognica como son la hemodilucin intraoperatoria y el almacenaje preoperatorio de sangre autloga. En el hospital son muy escasos los pacientes que se benefician con estas terapias ms seguras. El plasma fresco congelado fue el producto sanguneo peor usado en la prctica transfusional del Hospital Rebagliati. Es necesario conocer la definicin correcta de perfil de coagulacin alterado (TTP o TP es > a 1,5 veces el valor de control normal). Adems de presentar un perfil alterado, es necesario otra condicin adicional. En las salas de operaciones, el uso innecesario de PFC se dio en sangrados leves que oscilaban entre 200 y 800 mL. Como se sabe, en condiciones de resucitacin isovolmica es necesario una prdida 1,5 volemias (alrededor de 6 a 7 litros de sangrado) para que recin se desarrolle una coagulopata dilucional. Cabe tener en cuenta tambin que una de las causas de la prolongacin del TTP es la coleccin incorrecta de la muestra sangunea debida, sobre todo, a una venipuntura traumtica (26). En las UCI a los pacientes en su periodo posquirrgico inmediato de ciruga mayor se les indic PFC sin los resultados laboratoriales del TP o TTP, es decir, la indicacin fue emprica. El consenso seala que si el TP o TTP no pueden ser obtenidos en el tiempo requerido, los pacientes pueden beneficiarse de la transfusin emprica con PFC. Aunque un anlisis detenido del historial de perfiles de coagulacin anteriores a la ciruga, el volumen de sangrado operatorio y del contexto clnico global del paciente, nos indicaba claramente que se pudo racionalizar un tanto su uso. Estos mismos pacientes en su postquirrgico inmediato, muchas veces recibieron en forma conjunta GR, PFC, plaquetas y crioprecipitado (transfusiones empricas), mayormente dos o tres de estos componentes, teniendo como objetivo el mantener una hemostasia adecuada en el paciente. Conviene decir que el uso de los componentes debe ser analizado independientemente unos de otros. En la mayor parte de estas indicaciones conjuntas no todos los hemocomponentes usados estaban justificados. Se debe considerar que una gran proporcin de las indicaciones inadecuadas evaluadas en este estudio se debi a que los mdicos exageraron al tomar precauciones.

En los pases desarrollados, el inters en los procesos de mejoramiento para guiar la decisin de transfusin se ha incrementado en la ltimas dos dcadas, no solo porque una transfusin inapropiada conlleva riesgos mdicos, sino tambin debido a que una transfusin inapropiada es costosa.(2) La elevada frecuencia de prescripcin inadecuada de hemocomponentes en el Hospital Rebagliati crea la necesidad de reducirlas empleando estrategias como programas de educacin continua, publicacin de guas prcticas, presentacin de casos y auditorias mdicas. La identificacin de los criterios especficos de indicacin inapropiada orienta a disear un mejor programa educativo hacia el personal mdico. Garca et al.(27) en un hospital de Espaa demostraron que el conocimiento de las guas de transfusin por parte del personal mdico mejora el uso de componentes sanguneos; as, observaron un incremento significativo de rdenes de transfusin apropiadas de 74 a 87 %. En otro estudio Tuckfield et al. (28) demuestran que con una monitorizacin prospectiva de solicitudes de hemocomponentes se puede reducir las tasas de transfusin inadecuada. Como limitaciones del estudio, mencionaremos que la presente investigacin se realiz en un hospital de la seguridad social en un corto periodo y se consider solamente cuatro servicios de hospitalizacin, por lo que los resultados no se pueden extrapolar a otras instituciones. Asimismo, al ser un trabajo descriptivo en base a historias clnicas, no se puede tener la certeza que la informacin registrada haya sido la indicada. Tampoco se obtuvieron igual nmero de indicaciones para los cuatro hemocomponentes evaluados, especialmente con el crioprecipitado, del cual se tuvo 25 indicaciones, por lo que las comparaciones no deben ser literales. A pesar de publicaciones ms recientes (2004 2011) sobre el tema de transfusin de hemocomponentes, los lineamientos prcticos de la gua utilizada en la presente investigacin permanecen vigentes. En conclusin, existe una considerable proporcin de indicacin inadecuada de transfusin sangunea en el Hospital Rebagliati. Entre las causas ms importantes de este sobreuso de hemocomponentes estn el desconocimiento de los lineamientos de transfusin y tambin debido a que los clnicos exageran en tomar precauciones. La identificacin de los criterios clnicos especficos de indicacin inapropiada orienta a disear una mejor estrategia educativa hacia un uso ms racional de la sangre.

Fuentes de financiamiento
Autofinanciado.

621

Rev Peru Med Exp Salud Publica. 2011;28(4):617-22.

Flores-Paredes W

Conflictos de inters

El autor declara no tener conflictos de inters en la publicacin de este artculo.

16. Cortina-Rosales L, Lpez de Roux M. Utilizacin de la Sangre y sus componentes celulares. Rev Cubana Hematol Inmunol Hemoter. 2000;16(2):78-89. 17. Hbert PC, Wells G, Blajchman MA, Marshall J, Martin C, Pagliarello G, et al. A multicenter, randomized, controlled clinical trial of transfusion requirements in critical care. Transfusion Requirements in Critical Care Investigators, Canadian Critical Care Trials Group. N Engl J Med. 1999;340(6):409-17. Erratum in: N Engl J Med 1999; 340(13):1056. 18. Wandt H, Ehninger G, Gallmeier WM. New strategies for prophylactic platelet transfusion in patients with hematologic diseases. Oncologist. 2001;6(5):446-50. 19. Schofield WN, Rubin GL, Dean MG. Appropriateness of platelet, fresh plasma and cryoprecipitate transfusion in New South Wales public Hospitals. MJA. 2003;178:117-21. 20. Marti-Carvajal AJ, Munoz-Navarro SR, Pena-Marti GE, Comunian G. An audit of appropriate use of blood products in adult patients in a Venezuelan general university Hospital. Int J Qual Health Care. 1999;11(5):391-5. 21. French CJ, Bellomo R, Finfer SR, Lipman J, Chapman M, Boyce NW. Appropriateness of red blood cell transfusion in Australasian intensive care practice. Med J Aust. 2002;177(10):548-51. 22. Goodnough L, Bracher M, Kanter M, Aubuchon J. Transfusion Medicine: Blood Transfusion. N Engl J Med. 1999;340:438-47. 23. Spence RK, Carson JA, Poses R, McCoy S, Pello M, Alexander J, et al. Elective surgery without transfusion: influence of preoperative hemoglobin level and blood loss on mortality. Am J Surg. 1990;159(3):320-4. 24. Kitchen CS. Are transfusions overrated? Surgical outcome of Jehovahs Witnesses. Am J Med. 1993;94(2):117-9. 25. Carson JL, Duff A, Berlin JA, Lawrence VA, Poses RM, Huber EC, et al. Perioperative blood transfusion and postoperative mortality. JAMA. 1998;279(3):199-205. 26. Triplett DA. Coagulation and bleeding disorders: Review and update. Clinical Chemistry. 2000;46(8 Pt 2):1260-9. 27. Garca Gala JM, Rodrguez Vicente P, Bernal del Castillo T, Martnez Revuelta E, Corte Buelga JR, Rodrguez Luengo J, et al. Adequacy of blood component transfusion according to previously established criteria. Sangre (Barc). 1996;41(1):19-23. 28. Tuckfield A, Haeusler MN, Grigg AP, Metz J. Reduction of inappropriate use of blood products by prospective monitoring of transfusion request forms. Med J Aust. 1997;167(9):473-6.

REFERENCIAS BIBLIOGRFICAS
1. Corwin HL. Blood transfusion: first, do no harm! Chest. 1999;116(5):1149-50. 2. Isbister JP. Risk Management in Transfusion Medicine. Transfusion Medicine Reviews. 1996;10(3):183-202. 3. Practice Guidelines for blood component therapy: A report by the American Society of Anesthesiologists Task Force on Blood Component Therapy. Anesthesiology. 1996;84(3):732-47. 4. Mintz D. Transfusion therapy: clinical principles and practice. 1st. Ed. Bethesda, MD: American Association of Blood Banks; 1999. 5. Toy P. Guiding the Decision to Transfuse. Arch Pathol Lab Med. 1999;123(7):592-4. 6. Metz J, McGrath KM, Copperchini ML, Haeusler M, Haysom HE, Gibson PR, et al. Appropriateness of transfusions of red cells, platelets and fresh frozen plasma. An audit in a tertiary care teaching Hospital. Med J Aust. 1995;162(11):572-7. 7. Ghali WA, Palepu A, Paterson WG. Evaluation of red blood cell transfusion practices with the use of preset criteria. CMAJ. 1994;150(9):1449-54. 8. Luk C, Eckert KM, Barr RM, Chin-Yee IH. Prospective audit of the use of fresh-frozen plasma, based on Canadian Medical Association transfusion guidelines. CMAJ. 2002;166(12):1539-40. 9. Beloeil H, Brosseau M, Benhamou D. Transfusion of fresh frozen plasma (FFP): audit of prescriptions. Ann Fr Anesth Reanim. 2001;20(8):686-92. 10. Corwin HL, Parsonnet KC, Gettinger A. RBC transfusion in the ICU. Is there a reason? Chest. 1995;108(3):767-71. 11. Simon TL, Alverson DC, AuBuchon J, Cooper ES, DeChristopher PJ, Glenn GC, et al. Practice parameter for the use of red blood cell transfusions: developed by the Red Blood Cell Administration Practice Guideline Development Task Force of the College of American Pathologists. Arch Pathol Lab Med. 1998;122(2):130-8. 12. Gatien G. Guideling for red blood cell and plasma transfusion for adults and children. CMAJ. 1997;156(11):S1-S24. 13. American Association of Blood Banks. Technical Manual. Glenbrook Road 13ed. Bethesda: Maryland: American Association of Blood Banks; 1999. 14. Schiffer CA, Anderson KC, Bennett CL, Bernstein S, Elting LS, Goldsmith M, et al. Platelet Transfusion for Patients with Cancer: Clinical Practice Guidelines of the American Society of Clinical Oncology. J Clin Oncol. 2001;19(5):1519-38. 15. Corts-Buelvas A, Rovetto P, Percira F, Gmez A, Granados M. Medicina transfusional: componentes sanguneos usuales y especiales. Bogot: Asociacin Colombiana de Facultades de Medicina; 2008.

Correspondencia: Wilfredo Flores Paredes Direccin: Av. Brasil 1320 Dpto. F, Lima 13, Per. Telfono: (511) 3242983 anexo 4161 Correo electrnico: wido2@hotmail.com

622

Rev Peru Med Exp Salud Publica. 2011;28(4):623-27.

original breVE

REGISTRO DE PACIENTES CON ACCIDENTE CEREBRO VASCULAR EN UN HOSPITAL PBLICO DEL PER, 2000-2009
Ana Castaeda-Guarderas1,a, Guillermo Beltrn-Ale1,a, Renzo Casma-Bustamante1,a, Paulo Ruiz-Grosso1,2,a, Germn Mlaga1,3,4,b
RESUMEN Estudio que describe las caractersticas de los registros de pacientes con accidente cerebro vascular (ACV), como diagnstico causante de hospitalizacin en el Hospital Nacional Cayetano Heredia entre los aos 2000 - 2009. Se obtuvieron 2225 registros de pacientes mayores de 18 aos, con ACV. De acuerdo con la CIE-10, 1071 tenan el diagnstico de ACV isqumico, 554 ACV hemorrgico, 183 hemorragia subaracnoidea, 49 isqumico hemorrgico, 10 crisis isqumica transitorias y en 358 no fue posible especificar el tipo. Se registraron 352 muertes (19,6 %), la mayora en los primeros tres das. La razn hombre/mujer fue 1,09; la edad promedio 64,1 17,2 aos y la mediana del tiempo de hospitalizacin fue de nueve das. Las condiciones asociadas ms frecuentes fueron hipertensin arterial, fibrilacin auricular y diabetes mellitus tipo 2. La mortalidad descrita es la ms alta informada en nuestro medio, es constante en todos los grupos de edad y mayor en mujeres. Palabras clave: Accidente cerebrovascular; Epidemiologa; Hospitalizacin (fuente: DeCS BIREME).

REGISTRY OF PATIENTS WITH STROKE STATED IN A PUBLIC HOSPITAL OF PERU, 2000-2009


ABSTRACT We performed a descriptive study taking on account the characteristics of the registries of the patients hospitalized at the Hospital Nacional Cayetano Heredia between the years 2000 and 2009 with stroke as hospitalization diagnosis. 2225 records were obtained from patients older than 18, with stroke. According to ICD-10, 1071 had diagnosis of ischemic stroke, 554 were hemorrhagic, 183 were subarachnoid hemorrhage, 49 were ischemic plus hemorrhagic, 10 were transient ischemic attack (TIA) and in 358 we were unable to specify the type of stroke. 352 deaths were recorded (19.6 %), most of them during the first 3 days. The male / female ratio was 1.09, the mean age 64.1 17.2 years and the median length of hospital stay was 9 days. The most common associated conditions were high blood pressure, atrial fibrillation and type 2 diabetes mellitus. The mortality found is the highest reported in our country, constant in all age groups and higher in women. Key words: Stroke; Epidemiology; Hospitalization (source: MeSH NLM).

INTRODUCCIN
El accidente cerebro vascular (ACV) es una causa comn de muerte y discapacidad, lo cual ocasiona enormes gastos que son asumidos, en la mayor parte, por pases de ingresos medios y bajos, puesto que en ellos se identifican dos terceras partes de estos casos (1,2). El Ministerio de Salud del Per (MINSA) notific un aumento de la mortalidad por ACV entre los aos 2000 y 2006 (3). Sin embargo, en el pas se han realizado

pocos estudios, los cuales cuentan con pocos pacientes, y difieren entre ellos y de los grandes estudios epidemiolgicos internacionales. El trabajo ms grande fue realizado en un hospital del seguro social el ao 2000 (4-6). El objetivo del presente trabajo fue describir las caractersticas relacionadas con el diagnstico de ACV, la mortalidad y las particularidades de las variables asociadas, en los registros de pacientes internados en un hospital pblico de Per en un perodo de 10 aos.

Conocimiento y Evidencia (CONEVID), Universidad Peruana Cayetano Heredia. Lima, Per. Grupo de Trabajo en Salud Mental, Universidad Peruana Cayetano Heredia. Lima, Per. 3 Centro de Excelencia en Enfermedades Crnicas (CRONICAS), Universidad Peruana Cayetano Heredia. Lima, Per. 4 Departamento de Medicina, Universidad Peruana Cayetano Heredia. Lima, Per. a Mdico Cirujano; b Mdico Internista, Magster en Medicina
1 2

Recibido: 09-06-11

Aprobado: 12-10-11

623

Rev Peru Med Exp Salud Publica. 2011;28(4):623-27.

Castaeda-Guarderas A et al.

EL ESTUDIO
Se estudi los registros de pacientes internados en el Hospital Nacional Cayetano Heredia (HNCH) a quienes, al drseles el alta, se les registr con el diagnstico de ACV, entre los aos 2000 - 2009. La informacin fue obtenida del Departamento de Estadstica e Informtica del HNCH, correspondiente a los registros de pacientes mayores de 18 aos con diagnstico de ACV como causante de la hospitalizacin y clasificados en subtipos, de acuerdo con la Clasificacin Internacional de Enfermedades CIE 9 o CIE 10. Los cdigos corresponden a los diagnsticos definitivos asignados por el mdico tratante al momento de salir de alta el paciente, opinin basada en el estudio de imgenes y otras pruebas realizadas. La informacin obtenida corresponde a los egresados desde el 1 de enero de 2000 al 31 de diciembre de 2009 (7). Se excluyeron los registros de pacientes con diagnstico de traumatismos que pudiesen haber causado el ACV, trombosis del seno venoso cerebral, secuela de ACV y en los que no figurase otro diagnstico compatible con un nuevo episodio de ACV. Estos registros fueron tabulados en una ficha de recoleccin de datos donde, adems del diagnstico, se incluyeron las condiciones asociadas como la edad, el sexo, la fecha de egreso, el tiempo de hospitalizacin y la condicin de egreso (fallecido o no). No fue posible recolectar las caractersticas clnicas y funcionales de la poblacin debido a que el hospital no contaba con un archivo fsico que permitiera esta bsqueda de manera confiable y completa. Esta informacin fue registrada en una hoja de clculo en el programa Excel 2007 y luego transferida al programa estadstico STATA 10.0 para su anlisis. Los pacientes fueron divididos en seis grupos: ACV isqumico (ACV-i) registro en el que se especifica que el tipo de ACV era isqumico y no se consigna que hubiese tenido un componente hemorrgico; ACV hemorrgico

(ACV-h) registro en el que se especifica que el tipo de ACV era hemorrgico y no se consigna que hubiese tenido un componente isqumico; ACV isqumicohemorrgico (ACV-ih) registro en el que se consigna tanto el diagnstico de ACV-i como el de ACV-h; hemorragia subaracnoidea (HSA); crisis isqumica transitoria (CIT), y ACV no especificado (ACV-ne) el cual es un registro con tipo de ACV no compatible con los descritos y en el cual no se pudo precisar el diagnstico. De las variables cualitativas como sexo, edad, condicin de egreso, tiempo de hospitalizacin y condiciones asociadas, se realiz un anlisis univariado con distribucin de frecuencias; mientras que en las variables cuantitativas fue con medidas de tendencia central y de dispersin. Particularmente, con la variable edad los pacientes fueron agrupados por conveniencia en grupos de edad (menores de 40 aos, 40 a 59 aos, 60 a 79 aos y de 80 aos a ms). HALLAZGOS Se hallaron 2314 registros de pacientes que cumplieron con los criterios de inclusin en el perodo establecido. De estos, se excluyeron a 54 pacientes por ser menores de 18 aos, 16 diagnsticos por ser de etiologa traumtica, cinco por ser trombosis de senos venosos, once por ser diagnsticos de secuela de ACV y no un nuevo evento, y tres por haber sido incorrectamente registrados. Finalmente, 2225 registros de pacientes ingresaron a nuestro estudio. La distribucin de los registros segn el tipo de ACV, razn hombre/mujer, edad promedio, tiempo de hospitalizacin y mortalidad, pueden ser apreciadas en la Tabla 1. La forma de ACV ms frecuente fue la de ACV isqumico, que se presento en el 48,1 % de los casos, seguido por la forma de ACV-h con el 24,9 %. Proporcionalmente, la forma de ACV que presenta mayor mortalidad fue la hemorrgica con 31,8 % de los casos. Tambin se observa que en el ACV-h se encontr una mayor proporcin de varones/mujeres (1,19).

Tabla 1. Caractersticas generales de pacientes con diagnstico de ACV en un hospital pblico de Per, entre 2000 a 2009.
N ( %) General ACV-i ACV-h ACV-ne HSA ACV-ih CIT 2225 (100) 1071(48,1) 554 (24,9) 358 (16,1) 183 (8,2) 49 (2,2) 10 (0,5) Razn hombre/mujer 1,09 1,08 1,19 1,08 0,93 0,88 2,33 Edad promedio DE (aos) 64,1 16,9 65,5 16,5 63,1 16,4 65,7 14,7 54,3 20,7 68,8 14,5 62,7 25,4 Tiempo hospitalizacin* 7 10 (1 - 229) 9 (1 - 245) 8 (1 - 142) 8 (1 - 203) 44,5 (1 - 54) 6,5 (1 - 16) Mortalidad n ( %) 434 (19.5) 146 (13,6) 176 (31,8) 74 (20,7) 32 (17,5) 5 (10,2) 1 (10)

* Mediana (Mnimo-Mximo en das) ACV: accidente cerebro vascular, (i): isqumico, (h): hemorrgico, (ne): no especificado, (ih): isqumico hemorrgico. HSA: hemorragia subaracnoidea. CIT: crisis isqumica transitoria.

624

Rev Peru Med Exp Salud Publica. 2011;28(4):623-27.

Registro hospitalario de ACV

45 40 35

40 35

Porcentaje

30 25 20 15 10 5 0 <40 ACV-i 40 - 60 ACV-h 60 - 80 ACV-ne >80 HSA

Porcentaje

30 25 20 15 10 5 0 ACV -i ACV -h ACV -ne Femenino HSA ACV -ih Masculino CIT

Figura 1. Porcentaje de Tipos de ACV segn grupo de edad.

Figura 2. Porcentaje de mortalidad de acuerdo a sexo y tipo de ACV.


ACV: accidente cerebro vascular, (i): isqumico, (h): hemorrgico, (ne): no especificado, (ih): isqumico hemorrgico. HSA: hemorragia subaracnoidea. CIT: crisis isqumica transitoria.

ACV: accidente cerebro vascular, (i): isqumico, (h): hemorrgico, (ne): no especificado. HSA: hemorragia subaracnoidea

El promedio de hospitalizacin fue de 7 das; en la variante ACV-ih se encontr un mayor tiempo de hospitalizacin, con un promedio de 44,5 das (rango; 1-54). El mayor nmero de muertes ocurri dentro de los primeros 3 das. El grupo de edad donde se hall mayor mortalidad fue el de menores de 40 aos, a expensas de la forma de ACV-h, como se ve en la Figura 1; se hall mayor mortalidad en mujeres en todas las formas de ACV (Figura 2). La condicin asociada como factor de riesgo ms importante para desarrollar ACV fue hipertensin arterial (47,7 % de todos los casos), siendo discretamente ms frecuente en la forma de ACV-i. En segundo lugar se encuentra la fibrilacin auricular con 12,9 % de los casos, siendo ms frecuente en el grupo de ACV-i en el 16,9 %. En tercer lugar diabetes mellitus con 10,9 % de los casos y ms frecuente en el grupo de ACV-i con el 14,7 % de los casos como se ve en la Tabla 2. La condicin infecciosa asociada ms comn en los pacientes con ACV fue la neumona, que representa Tabla 2. Condiciones asociadas segn subtipo de ACV.

globalizada en sus variantes el 15,6 %, la que ocurri con mayor frecuencia en pacientes con ACV-h (21,2 %). Con relacin a las complicaciones no infecciosas, la ms frecuente fue la hipertensin endocraneana con 5 %, seguida de ICC en el 4,4 %, en tercer lugar insuficiencia respiratoria en el 3,9 %.

DISCUSIN
Los resultados muestran que en 10 aos se tuvo 2225 casos de ACV. La mortalidad hospitalaria general fue de 19,6 %. De los ltimos cinco estudios nacionales solo dos describen la mortalidad y, en el ms grande de estos, Deza et al. (8) informan una mortalidad de 9,8 % de los pacientes hospitalizados en el servicio de neurologa de un Hospital del Seguro Social del Per durante 10 aos. La diferencia quiz se deba a que en el referido estudio, no se tomaron en cuenta pacientes que estuvieron en la emergencia y, como vimos, que la mayor cantidad de muertes ocurre

Condiciones asociadas compatibles con factores de riesgo Condiciones asociadas ms comunes compatibles con complicaciones infecciosas Condiciones asociadas no especificas

HTA Diabetes mellitus tipo 2 Fibrilacin auricular Dislipidemia Neumona no especificada Neumona adquirida comunidad Neumona Intrahospitalaria o aspirativa ITU Falla renal no especificada Insuficiencia respiratoria ICC Hipertensin Endocraneana Falla renal aguda Falla renal crnica

General ( %) 47,7 10,9 12,9 1,8 3,1 1,8 10,7 5,9 0,2 3,9 4,4 5,0 0,9 2,9

ACV-i ( %) 53,5 14,7 16,9 2,4 2,9 1,8 10 7,2 0,2 2,9 5,5 3,3 0,8 3,3

ACV-h ( %) 47,1 7,1 8,8 1,6 2,4 3,1 15,7 3,9 0,4 6,1 2,7 7,8 2,2 1,9

ACV-ne ( %) 48,9 10,9 12,3 1,7 5,3 0,6 7,3 8,4 0,3 4,8 5,6 3,6 0,3 3,6

HSA ( %) 15,3 3,3 3,8 0 2,2 0,6 3,3 0,6 0 2,7 1,6 10,9 0,6 2,2

ACV-hi ( %) 42,9 2,1 8,2 0 2,1 4,1 18,4 6,1 0 2,1 0 2,0 6,1 0

ACV: accidente cerebro vascular, (i): isqumico, (h): hemorrgico, (ne): no especificado, (ih): isqumico hemorrgico. HSA: hemorragia subaracnoidea.

625

Rev Peru Med Exp Salud Publica. 2011;28(4):623-27.

Castaeda-Guarderas A et al.

en los primeros das, estas muertes pudieran no haber sido registradas. Con relacin a otros estudios internacionales (EE.UU. (9) y Argentina (10)) nuestra mortalidad es mayor, pero, puede ser que la comparacin no sea definitiva, pues en el estudio estadounidense se incluy a pacientes con diagnstico de CIT (casi el 25 % de la muestra) y en el estudio argentino solo evaluaron pacientes con ACV-i que, en general, tiene una menor mortalidad. La falta de una unidad especializada en ACV en el hospital o la falta de implementacin de protocolos de administracin de terapia tromboltica, pudieran explicar perfectamente estos resultados. Sin embargo, si tomamos en cuenta el informe de la AHA( 11) el cual menciona una mortalidad de 18,4 %, o el 22,9 % de mortalidad a 30 das informado en un estudio epidemiolgico de Amrica Latina y el Caribe (12), los resultados presentados no son muy distintos. Llama la atencin el discreto aumento de los casos de ACV a lo largo de los 10 aos estudiados, hecho que sorprende si se tiene en consideracin las sospechas de incremento de enfermedades crnicas en nuestro medio. Un hallazgo inesperado fue la mayor mortalidad en el grupo de menores de 40 aos dentro del grupo de ACV-h (Figura 1), sin embargo, as no fuera significativa la mortalidad general y por tipos de ACV se mantiene constante dentro de todos los grupos de edad. Este patrn es diferente al que describen Fonarow et al. (9) en EE.UU., en donde conforme la edad aumenta, se incrementa el riesgo de muerte intrahospitalaria independientemente del tipo de ACV. Este comportamiento no haba sido descrito previamente en nuestro medio ni en Latinoamrica y no se puede plantear una nica explicacin; sin embargo, antes de asimilarlo, se debera impulsar el diseo de un estudio que proporcione informacin necesaria y razonable que ratifique o deseche este hallazgo, pues se podran postular una serie de de factores como una mayor gravedad del ACV en pacientes jvenes, mayor nmero de registros de ACV como causa de muerte en pacientes jvenes, el tiempo que demora el paciente en llegar al hospital y la capacidad resolutiva del hospital, entre otros. As mismo, se hall que la mortalidad fue mayor en las mujeres y en ACV-h (Figura 2), no obstante a nivel internacional, esta asociacin: sexo y mortalidad no ha sido descrita (13-17). La razn hombre/mujer cercana a 1 (1,09) es similar a lo descrito en estudios realizados en EE.UU. (0,89), Reino Unido (1,2-1,4) y Argentina (1,35) (9,10,18). En base a este

resultado nuestra poblacin se comportara de acuerdo con lo descrito por la AHA (11), la cual afirma que la incidencia de ACV es mayor en varones; sin embargo, difiere de estudios nacionales, los que a su vez son discordantes, pues Deza et al. (8) informaron una marcada diferencia de 2,21, mientras que Astorga et al. (19) mostraron una razn de 0,45; esto probablemente se deba a una mayor atencin al hombre o a la mujer en los hospitales donde se realizaron los estudios, o a que se trat de muestras no probabilsticas. En los estudios contemplados en la revisin sistemtica de Latinoamrica(20) se inform una proporcin de ACV-h mayor que la descrita en EE.UU. (9) y Europa (18). Incluso, dentro del estudio americano, hay mayor proporcin de ACV-h en hispanos que en la poblacin general, al igual que cuando se compar argentinos blancos con nativos en Buenos Aires. Para los fines del anlisis se excluy a los pacientes con HSA como se suele realizar en otros estudios, resultando una proporcin de ACV-h de 33,1 %, dato similar a los estudios latinoamericanos pero mayor que los pases desarrollados y los estudios nacionales previos. Esta diferencia podra estar relacionada con factores genticos, a diferentes factores de riesgo y otros no totalmente esclarecidos. En lo que respecta al tiempo de hospitalizacin, se observa que el 50 % de los pacientes estudiados permanece, por lo menos, nueve das; dentro de ellos, la mitad de los pacientes con ACV-i se queda por lo menos diez das. Este tiempo de hospitalizacin es mayor que el descrito en estudios norteamericanos (9) y sudamericanos, como el ReNACer de Argentina (10). Estudios previamente realizados en nuestro pas no han estudiado esta variable (8,19,21). Probablemente el mayor tiempo de hospitalizacin hallado est relacionado con la falta de recursos de la poblacin atendida en el HNCH, lo cual retrasa la realizacin de pruebas de apoyo diagnstico y seguimiento necesarias para esclarecer la etiologa del evento, lo que prolonga su estada. La principal fortaleza del presente estudio es que se ha recogido el mayor nmero de atenciones de pacientes con ACV en un hospital del MINSA, de donde se puede obtener caractersticas generales de la poblacin as como informacin epidemiolgica relevante para futuras investigaciones. Sin embargo, dado que nuestra fuente de informacin es un registro de egresos, el estudio cuenta con limitaciones como la falta de informacin del mtodo diagnstico, que un mismo paciente se haya registrado ms de una vez y que se presenta un alto porcentaje alto de registros (16,1 %) sin especificacin del subtipo de ACV, situacin que tambin fue descrita en el estudio epidemiolgico de Latinoamrica y el Caribe (12) los que podran tener, incluso, diagnsticos alternos al ACV.

626

Rev Peru Med Exp Salud Publica. 2011;28(4):623-27.

Registro hospitalario de ACV

Basados en los resultados obtenidos se recomienda mejorar el sistema de registro del HNCH, as como realizar estudios prospectivos que permitan esclarecer por qu la estancia hospitalaria es tan prolongada; verificar si en efecto la mortalidad es tan alta como la reportada, si esta no vara entre grupos de edad y si es mayor en el sexo femenino; obtener informacin sobre la calidad de vida de pacientes afectados con ACV, su diversa morbilidad y mortalidad y, sobre todo, establecer las medidas e intervenciones que permitan reducir la mortalidad hospitalaria, mejorar la funcionalidad, su calidad de vida, prevenir nuevos eventos y, en general, mejorar los resultados de la evolucin de estos pacientes.

9. Fonarow GC, Reeves MJ, Smith EE, Saver JL, Zhao X, Olson DW, et al. Characteristics, performance measures, and in-hospital outcomes of the first one million stroke and transient ischemic attack admissions in get with the guidelines-stroke. Circ Cardiovasc Qual Outcomes. 2010;3(3):291-302. 10. Sposato LA, Esnaola MM, Zamora R, Zurru MC, Fustinoni O, Saposnik G. Quality of ischemic stroke care in emerging countries: the Argentinian National Stroke Registry (ReNACer). Stroke. 2008;39:3036-41. 11. Goldstein LB, Bushnell CD, Adams RJ, et al. Guidelines for the primary prevention of stroke: a guideline for healthcare professionals from the American Heart Association/ American Stroke Association. Stroke. 2011;42(2):517-84. 12. Lavados P, Fernandez J, Medina M, Legetic B. Stroke epidemiology, prevention, and management strategies ar a regional level: Latin America and the Caribbean. Lancet Neurol. 2007;6(4):362-72. 13. Vaartjes I, Reitsma JB, Berger-van Sijl M, Bots ML. Gender differences in mortality after hospital admission for stroke. Cerebrovasc Dis. 2009;28(6):564-71. 14. Ayala C, Croft JB, Greenlund KJ, Keenan NL, Donehoo RS, Malarcher AM, et al. Sex differences in US mortality rates for stroke and stroke subtypes by race/ethnicity and age, 1995-1998. Stroke. 2002;33(5):1197-201. 15. Di Carlo A, Lamassa M, Baldereschi M, Pracucci G, Basile AM, Wolfe CD, et al. Sex differences in the clinical presentation, resource use, and 3-month outcome of acute stroke in Europe: data from a multicenter multinational hospital-based registry. Stroke. 2003;34(5):1114-9. 16. Sheikh K, Bullock CM. Effect of measurement on sex difference in stroke mortality. Stroke. 2007;38(3):1085-7. 17. Holroyd-Leduc JM, Kapral MK, Austin PC, Tu JV. Sex differences and similarities in the management and outcome of stroke patients. Stroke. 2000;31(3):1833-7. 18. Bhatnagar P, Scarborough P, Smeeton NC, Allender S. The incidence of all stroke and stroke subtype in the United Kingdom, 1985 to 2008: a systematic review. BMC Public Health. 2010;10:539. 19. Astorga Castillo JL. Aspectos clinico epidemiolgicos de la enfermedad cerebrovascular. Servicio de emergencia del Hospital Arzobispo Loayza. Tesis para optar el ttulo de mdico especialista en medicina de emergencias y desastres. Facultad de Medicina, Universidad Nacional Mayor de San Marcos. 2005. 20. Saposnik G, Del Brutto OH; Iberoamerican Society of Cerebrovascular Diseases. Stroke in South America: a systematic review of incidence, prevalence, and stroke subtypes. Stroke. 2003;34(9):2103-7. 21. ODonnell M, Liu L, Zhang H, Chin SL, Rao-Melacini P, Rangarajan S, et al. Risk factors for ischaemic and intracerebral haemorrhagic stroke in 22 countries (the INTERSTROKE study): a case-control study. Lancet. 2010;376(9735):112-23. Correspondencia: Germn Mlaga Rodrguez Direccin: Calle Chavn 159 CC Monterrico. Surco. Lima 33. Per. Telfono: (511)-3445356 Correo electrnico: german.malaga@upch.pe

Contribuciones de autora

Todos los autores participaron de la concepcin y diseo, recoleccin, anlisis, revisin crtica del manuscrito, y de la aprobacin de versin final. PRG realiz la asesora estadstica. GM brind el material de estudio.

Conflictos de inters

Los autores declaran no tener conflictos de inters.

Fuentes de financiamiento
Autofinanciado.

REFERENCIAS BIBLIOGRFICAS
1. Bonita R, Mendis S, Truelsen T, Bogousslavsky J, Toole J, Yatsu F. The global stroke initiative. Lancet Neurol. 2004;3:391-3. 2. Menken M, Munsat TL, Toole JF. The global burden of disease study: implications for neurology. Arch Neurol. 2000;57:418-20. 3. Oficina General de Estadstica e Informtica. Ministerio de Salud. Principales causas de mortalidad por sexo. Lima: INEI; 2006. 4. Jaillard AS, Hommel M, Mazetti P. Prevalence of stroke at high altitude (3380 m) in Cuzco, a town of Peru. A population-based study. Stroke 1995;26:562-8. 5. Neira Sanchez ER, Seclen Santiesteban S. Estudio retrospectivo de la ocurrencia de accidente cerebrovascular en pacientes diabticos. Rev Med Hered. 2000;11(2):54-61. 6. Crdova Ruiz ME. Factores de riesgo modificables para un primer evento de enfermedad vascular cerebral isqumica, en el Hospital Alberto Sabogal Sologuren, en el periodo enero 2002 diciembre 2002. Tesis para optar el ttulo de mdico especialista en neurologa. Lima Per: Facultad de Medicina, Universidad Nacional Mayor de San Marcos. 2005. 7. Hospital Nacional Cayetano Heredia. Oficina de Epidemiologa y Salud Ambiental. Lima: HNCH; c2011. 8. Deza L AR, Barrera J. Historia Natural de la Enfermedad Vascular Cerebral en el Per Estudio intrahospitalario de 1517 pacientes. Rev NeuroPsiquiat. 2001;64(2):105-32.

627

Rev Peru Med Exp Salud Publica. 2011;28(4):628-32.

original breVE

EFECTO DEL ACEITE DE SACHA INCHI (Plukenetia volbilis L) SOBRE EL PERFIL LIPDICO EN PACIENTES CON HIPERLIPOPROTEINEMIA
Fausto Garmendia1,2,a, Rosa Pando1,3,b, Gerardo Ronceros1,3,c
RESUMEN El presente es un trabajo experimental piloto, abierto, para conocer el efecto, dosis efectiva y efectos secundarios del aceite de sacha inchi (Plukenetia volbilis L) en el perfil lipdico de pacientes con hipercolesterolemia; para ello, se incluy a 24 pacientes de 35 a 75 aos, en quienes se determin los valores sanguneos de colesterol total (CT), HDL, triglicridos (Tg), glucosa, cidos grasos no esterificados (AGNE) e insulina Se aleatoriz a los participantes para recibir 5 mL o 10 mL de una suspensin conteniendo 2gr/5ml de aceite de sacha inchi, durante cuatro meses. La ingesta del aceite produjo cada en los valores promedio del CT, y AGNE con elevacin del c-HDL en ambos grupos. La dosis de 10 mL se asoci a mayores niveles de insulina en el grupo aleatorizado a recibir 10 ml. El aceite de sacha inchi parece tener efectos benficos sobre el perfil lipdico en pacientes con dislipidemia, requirindose la evaluacin de su eficacia y seguridad en ensayos clnicos aleatorizados. Palabras clave: Hiperlipoproteinemias; Hipercolesterolemia; Plukenetia volbilis L. (fuente: DeCS BIREME).

EFFECT OF SACHA INCHI OIL (Plukenetia volbilis L) ON THE LIPID PROFILE OF PATIENTS WITH HYPERLIPOPROTEINEMIA
ABSTRACT

We performed a pilot, experimental, open study in order to know the effect, effective dosage and secondary effects of sacha inchis (Plukenetia volbilis L) oil on the lipid profiles of patients with hypercholesterolemia. We included 24 patients of ages 35 to 75, to whom we measured total cholesterol (TC), HDL, triglycerides (Tg), glucose (G), nonesterified fatty acids (NEFA) and insulin (I) levels in blood, then we randomized them to receive sacha inchi oil orally 5 ml or 10 ml of a suspension of sacha inchi oil (2gr/5ml) for four months. The oil intake produced a decrease in the mean values of TC, and NEFA, and a rise in HDL in both subgroups. The subgroup receiving 10 ml was associated to an increase in the insulin levels. Sacha inchi oil appears to have beneficial effects on the lipid profile of patients with dyslipidemia, but their efficacy and security should be evaluated in randomized clinical trials. Key words: Hyperlipoproteinemias; Hypercholesterolemia; Plukenetia volubilis L. (source: MesH NLM).

INTRODUCCIN
En los ltimos aos se ha demostrado que la inclusin en la alimentacin de semillas de diferentes plantas como las nueces, man, almendras, pecanas y productos similares tiene un efecto beneficioso sobre el perfil lipdico sanguneo (1,2) que se atribuye a su alto contenido en cidos grasos poliinsaturados. El sacha inchi (Plukenetia volbilis L) es un arbusto que crece en forma silvestre en la selva peruana, de cuyas semillas, se extrae un aceite rico en cidos poliinsaturados omega-3 y omega-6 (3,4). En una investigacin, Bays et al. mostraron que estos ltimos modifican favorablemente el perfil lipdico (5). Si bien es cierto existen evidencias sobre el efecto beneficioso del aceite de sacha inchi (6), no se cuenta con mucha informacin, razn por la cual se decidi efectuar este estudio piloto en un grupo relativamente pequeo de pacientes, suficiente como para conocer el efecto hipolipemiante, dosis y efectos secundarios.

Instituto de Investigaciones Clnicas, Universidad Nacional Mayor de San Marcos. Lima, Per. Academia Nacional de Medicina. Lima, Per. Hospital Nacional Dos de Mayo. Lima, Per. a Mdico, Doctor en Medicina; b Mdico Cirujano; c Mdico, Magister en Bioqumica * El informe preliminar del estudio se present en el VI Congreso Internacional de la Asociacin Peruana de Estudio de la Obesidad y Ateroesclerosis, Lima, julio 2010.
1 2 3

Recibido: 05-08-11

Aprobado: 07-12-11

628

Rev Peru Med Exp Salud Publica. 2011;28(4):628-32.

Sacha inchi sobre perfil lipdico

EL ESTUDIO
Se efectu un trabajo piloto de tipo experimental y abierto donde se incluy a 24 pacientes con hipercolesterolemia, de tipo IIa o de tipo IIb, segn la clasificacin de Frederickson (7). Estos pacientes fueron voluntarios y fueron reclutados de la consulta externa del Hospital Nacional Dos de Mayo. No se incluyeron pacientes diabticos, con obesidad mrbida, enfermedad heptica, renal, ni tiroidea o con tratamiento hipolipemiante, por lo menos dos meses antes del estudio. Mediante una lista aleatoria se formaron dos grupos de pacientes. Al primero (Grupo A), compuesto por doce pacientes, se le administr 5 mL de aceite de sacha inchi; al segundo (Grupo B), compuesto tambin de doce pacientes, se les dio 10 mL de aceite de sacha inchi por va oral, antes del almuerzo. El aceite contena 2 g de cidos grasos omega-3 por cada 5mL (proporcionado por Laboratorios Hersil S.A.). El control de la ingesta se realiz de forma mensual, al verificar la ingesta del aceite proporcionado segn los grupos. En condiciones de ayuno de doce horas, se determin el nivel sanguneo de colesterol total (CT), colesterol HDL, triglicridos (Tg), glucosa (G) y, por mtodos enzimticos, el de insulina (I) por quimioluminiscencia y el de cidos grasos no esterificados (AGNE) por cromatografa de alta resolucin (HLP). Adems, se calcul las fracciones VLDL y LDL por el mtodo de Friedewald. El colesterol no-HDL se calcul por sustraccin del colesterol HDL al CT; se ha calculado el ndice HOMA (homeostasis model assessment) para medir el grado de sensibilidad a la insulina mediante la frmula G Mol x I/22,5 de Mattews et al. (8). Luego de uno, dos y cuatro meses de tratamiento continuo, los pacientes fueron sometidos a los mismos exmenes. Se calcularon las diferencias porcentuales y de promedios en los resultados de la analtica obtenida, comparndolos con los resultados basales y entre ambos grupos; para ello, se emple la prueba t de Student, la prueba exacta de Fisher y la prueba U-Mann Whitney, segn corresponda, en el programa estadstico SPSS v 17. Todos los pacientes recibieron consejera alimenticia e indicaciones para limitar la ingesta de grasas insaturadas; adems, se les indic que su participacin era voluntaria y podan retirarse de la investigacin si lo solicitaban; luego de explicar los objetivos del estudio, los que aceptaron ingresar al estudio firmaron el consentimiento informado. El protocolo de la investigacin y el consentimiento informado de los pacientes cont con la aprobacin del Comit de tica del Hospital Nacional Dos de Mayo.

Tabla 1. Caractersticas de la muestra.


Grupo A Grupo B p Edad, aos 52,8 8,01 54,0 11,9 0,932* Sexo, H/M (%) 3/12 (25,0) 7/12 (58,3) 0,107** IMC 28,3 3,51 25,7 2,90 0,045* Circunferencia 93,7 9,59 95,5 7,98 0,551* abdominal (cm) Hipercolesterolemia IIa 3/12 4/12 (H/M) Presin arterial 119,0 13,2 118,0 11,1 0,713* sistlica (mm Hg) Presin arterial 74,9 9,77 74,3 7,62 0,977* diastlica (mm Hg) Hipertensin arterial 1/12 1/12 Tabaquismo 2/12 2/12
* Valor p obtenido aplicando la prueba U-Mann Whitney. **Prueba exacta de Fisher H/M: hombres/mujeres; IMC: ndice de masa corporal

HALLAZGOS Se incluy a 24 pacientes, diez varones y catorce mujeres, con hipercolesterolemia, 7 de tipo IIa y 17 de tipo IIb de la clasificacin de Frederickson, la edad de los pacientes estaba en el rango de 35 a 75 (promedio 53,4 9,9) aos, con un IMC de 26,9 3,38, circunferencia abdominal en mujeres de 94,0 9,8, y en varones de 95,4 7,3 cm; se identific adems dos pacientes con hipertensin arterial (8,3 %). La comparacin de ambos grupos se muestra en la Tabla 1, donde no se aprecia diferencia en las caractersticas generales de la muestra incluida excepto una ligera diferencia en el IMC. Al analizar los marcadores bioqumicos, tampoco se encontr diferencias en los valores basales. En el anlisis de muestras pareadas, se aprecia una significativa disminucin de las concentraciones de CT, LDL, VLDL, no-HDL, Tg y AGNE con la dosis de 5 mL de aceite (Tabla 2), al mismo tiempo que una elevacin muy importante del colesterol HDL. No hubo cambio en las concentraciones de glucosa, insulina ni el ndice HOMA. Con la dosis de 10 mL de aceite, s hubo disminucin significativa del CT, LDL, No-HDL y AGNE e incremento de HDL, a los cuatro meses de tratamiento (Tabla 2); no se encontr disminucin de significativa de Tg ni de la fraccin VLDL y, por otro lado, hubo una elevacin leve pero significativa de glucosa, insulina y el ndice HOMA. Al cuarto mes de tratamiento, la mayora de los promedios de los marcadores bioqumicos fueron ms altos que al segundo mes de tratamiento; sin embargo, las diferencias no fueron significativas y se encontraban en valores aun ms bajos que las cifras basales, excepto

629

Rev Peru Med Exp Salud Publica. 2011;28(4):628-32.

Garmendia F et al.

Tabla 2. Efecto segn dosis de aceite de sacha inchi durante cuatro meses de tratamiento, en el anlisis de muestras pareadas.
Marcador Colesterol total (mg/dL) HDL (mg/dL) LDL (mg/dL) VLDL (mg/dL) No-HDL (mg/dL) Triglicridos (mg/dL) Glucosa (mg/dL) Insulina (uUI/mL) ndice HOMA de sensibilidad a la insulina cidos grasos no esterificados (ng/dL) Grupo A B A B A B A B A B A B A B A B A B A B Basal 258,17,7 262,311,9 44,32,8 45,22,8 184,010,9 180,511,6 41,3 5,3 41,0 5,3 213,7 6,9 217,2 11,4 236,037,7 233,930,0 88,62,5 81,42,57 10,80,9 10,30,8 2,40,2 2,10,2 24,92,1 28,41,9 Medicin 1.er mes 2.do mes 226,06,6 c 211,77,2 c 237,210,2 a 219,710,6 c 45,43,3 50,52,8 c 46,93,2 49,92,9 143,5 6,4 b 128,86,1 c 157,2 8,2 133,28,6 c 37,65,2 31,44,2 c 38,24,1 34,44,9 161,28,2 c 180,66,0 c 190,28,9 b 169,710,3 c 203,228,0 177,427,5 c 185,419,6 188,827,3 87,72,6 85,83,9 87,53,7 89,12,3 a 11,21,1 11,80,6 12,10,8 11,01,1 2,410,2 2,520,2 2,410,3 2,700,2 a 22,41,7 18,11,90 b 24,61,7 a 21,51,8 c 4.to mes 225,78,1 b 242,814,3 a 54,22,9 b 50,52,5 a 136,57,7 b 149,08,2 a 36,43,8 34,96,3 171,58,3 c 191,712,7 b 196,021,5 246,339,1 94,44,5 90,23,0 b 13,81,5 13,71,1 a 3,010,3 3,140,3 a 17,91,5 c 18,82,1 b

Grupo A: 5 mL de sacha inchi. Grupo B: 10 mL de sacha inchi. Valores p al comparar el mes indicado con el basal en cada grupo: a p < 0,05; b p < 0,01; c p < 0,001

el colesterol HDL, que sigui aumentando, y los AGNE siguieron disminuyendo. Las concentraciones promedio del CT, LDL, HDL, c-No HDL, Tg, VLDL y AGNE durante los cuatro meses de tratamiento, no mostraron variaciones significativas con las dosis recibidas (Tabla 3). Tampoco existieron variaciones con relacin a la I, G y HOMA. Igualmente, no se encontraron variaciones en el peso, cintura abdominal o presin arterial en ambos grupos, al compararlos con sus valores basales (datos no mostrados en tablas).

DISCUSIN
Las dislipoproteinemias son alteraciones del metabolismo intermediario que constituyen factores de

riesgo de eventos cardiovasculares como el infarto del miocardio o los accidentes cerebrovasculares, y constituyen una de las causas ms importantes de morbimortalidad en el Per, para cuyo tratamiento se utilizan diversos procedimientos teraputicos que se inician con prcticas higinico-dietticas como la dieta y la actividad fsica, y se contina con la utilizacin de diversos grupos de frmacos como las estatinas, fibratos y bloqueadores de la absorcin intestinal de lpidos, que tienen diferente mecanismo de accin y que son de gran utilidad por haber demostrado que disminuyen la prevalencia de eventos cardiovasculares (9,10); sin embargo, estos medicamentos no estn exentos de efectos adversos y son de costo elevado para una poblacin importante de pacientes de nuestro medio quienes, adems, deben consumirlos en forma permanente.

Tabla 3. Variaciones porcentuales de las fracciones lipdicas con relacin a las cifras basales.
5 mL de sacha inchi 1 mes 2 mes 4 mes - 12,0 - 17,4 - 12,6 - 19,6 - 29,4 - 25,2 - 8,7 - 22,8 -10,5 - 15,1 - 24,2 - 20,7 - 11,0 - 23,3 - 13,5 - 7,7 - 22,6 - 25,1 + 2,8 + 17,9 + 30,0 10 mL de sacha inchi 1 mes 2 mes 4 mes - 9,3 - 15,2 - 7,8 - 9,9 - 23,8 - 17,2 - 7,74 - 16,8 - 2,0 - 11,4 - 20,9 - 12,2 - 10,2 - 8,0 + 21,6 - 16,1 - 16,4 - 28,4 + 3,5 + 14,4 + 16,7 1 mes 0,35 0,22 0,59 0,36 0,60 0,35 0,70 p* 2 mes 0,53 0,53 0,98 0,52 0,77 0,19 0,88 4 mes 0,32 0,36 0,91 0,20 0,39 0,74 0,34

Colesterol Total LDL VLDL No-HDL Trigliceridos AGNE HDL

AGNE: cidos grasos no esterificados. * Estadstico de la diferencia del valor obtenido por dosis (5 mL frente a 10 mL) segn mes de tratamiento.

630

Rev Peru Med Exp Salud Publica. 2011;28(4):628-32.

Sacha inchi sobre perfil lipdico

El Per es un pas con una gran biodiversidad, con especies vegetales que poseen efectos medicinales como la quina (quinina), la ua de gato, etc. En los ltimos aos se ha publicitado los efectos beneficiosos del sacha inchi (Plukenetia volibulis L), arbusto que crece en la selva amaznica, conocido desde la poca de los Incas, tiene un fruto parecido al man o la almendra, con gran contenido proteico y oleaginoso, cuyo anlisis bromatolgico muestra que las semillas contienen 51 % de aceite de alto grado de insaturacin (90,3 %); 80,7 % son cidos grasos poliinsaturados (linolnico 43,8 %, linoleico 36,9 %), monoinsaturados 9,6 % (oleico) y 9,1 % saturados (3,4) El aceite de pescado y los aceites vegetales que contienen cidos grasos insaturados tambin han demostrado tener un efecto hipolipemiante (11). En este estudiose ha empleado una suspensin de aceite de sacha inchi estandarizado con una concentracin de 2 g de aceite poliinsaturados omega 3 por cada 5 mL, se entiende que a ms de otros componentes que este aceite natural debe contener, los resultados permiten concluir que este compuesto, administrado durante cuatro meses, tuvo el efecto de disminuir significativamente las concentraciones de CT, LDL, colesterol No-HDL, triglicridos, VLDL y AGNE que, precisamente, son las fracciones atergenas de la sangre y, por el contrario, se observ una elevacin muy significativa del colesterol HDL, que alcanz al 30 % del valor inicial, lo cual es proporcionalmente mayor que la alcanzada por la simvastatina en el estudio 4S (9). Consideramos que este un hallazgo importante, puesto que ningn hipolipemiante, (excepto el cido nicotnico (12) a dosis altas que produce efectos secundarios no tolerados por los pacientes y el anacetrapib, compuesto an en estudio (13)), tiene efecto de elevar el colesterol HDL. Habida cuenta que est demostrado que niveles bajos de colesterol HDL constituyen un factor independiente de riesgo cardiovascular (14). De all que resulte interesante que un compuesto natural sin aparentes efectos txicos (15) pueda contribuir a elevar el colesterol HDL. A los cidos grasos poliinsaturados omega-3 se les atribuye diversos efectos, tales como disminuir el riesgo de arritmias, efectos antitrombticos, mejora de la funcin endotelial, antiinflamatorio, disminucin de la presin arterial, disminucin de la concentracin de triglicridos y antiateroesclertico. La disminucin de los triglicridos es uno de sus mayores efectos, pero no disminuyen el colesterol LDL en la misma proporcin (2,16), lo que nos lleva a considerar que el aceite de sacha inchi tiene acciones diferentes al aceite de pescado, al de otros vegetales y a la administracin de preparados farmacuticos que solo contienen cidos grasos poliinsaturados omega 3.

El hecho que con la dosis de 10 mL (4g de cidos grasos omega-3) no se haya conseguido una mayor respuesta en el anlisis por muestras pareadas y no en la comparacin directa de los promedios, podra explicarse como lo que ocurre con la administracin de las estatinas, fibratos, ezetimiba, etc, que una vez alcanzada una dosis mxima no se obtiene un efecto mayor (9,10,17) . En los pacientes que recibieron 10 mL de sacha inchi (4 g de omega-3), se observ un incremento de insulina y del ndice HOMA, lo cual podra interpretarse como un efecto de resistencia a la insulina que se explicara, en parte, por un efecto de saturacin de los receptores de insulina por exceso de cidos grasos no saturados como fuera notificado por Randle et al. 18), aunque por el tamao de la muestra sera conveniente ampliar las investigaciones. Solo el 16,6 % de los pacientes refiri el sabor intenso de la suspensin administrada la cual fue ms notoria para quienes recibieron la dosis de 10 mL; solo un paciente se retiro del estudio Se debe destacar que no se observaron otros eventos adversos Se puede concluir que el aceite de sacha inchi, en la suspensin administrada a la dosis de 2 g de omega-3, mostr el efecto de disminuir las concentraciones de las fracciones atergenas de la sangre y, al mismo tiempo, de incrementar los niveles de HDL-c en sujetos con hiperlipoproteinemia, por lo que podra constituir una alternativa efectiva que, hasta el momento, ha demostrado ser segura para el tratamiento de las dislipoproteinemias, para lo cual se requiere de ensayos clnicos aleatorizados y controlados para evaluar apropiadamente la eficacia y seguridad del aceite de sacha inchi para el tratamiento de dislipidemias.

AGRADECIMIENTOS
A Laboratorios Hersil S.A. por haber proporcionado la suspensin del aceite sacha inchi utilizada en este trabajo.

Contribuciones de autora

FG, RP, GR participaron de la concepcin y diseo del trabajo, en la recoleccin y obtencin de resultados, en el anlisis e interpretacin de datos, revisin crtica del documento y aprobacin de su versin final. Adems, FG realiz la redaccin inicial del manuscrito y obtencin del financiamiento; RP facilit la captacin de pacientes.

Fuentes de financiamiento

Recibimos la suspensin del aceite sacha inchi de los Laboratorios Hersil S.A. El trabajo fue realizado adems

631

Rev Peru Med Exp Salud Publica. 2011;28(4):628-32.

Garmendia F et al.

con el aporte del Fondo de Desarrollo Universitario 2009 y 2010 de la Universidad Nacional Mayor de San Marcos.

Conflictos de inters

11. Kris-Etherton PM, Harris WS, Appel LJ; American Heart Association. Nutrition Committee. Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Circulation. 2002;106(21):2747-57. 12. Canner PL, Berge KG, Wenger NK, Stamler J, Friedman L, Prineas RJ, et al. Fifteen year mortality in Coronary Drug Project patients: long-term benefit with niacin. J Am Coll Cardiol. 1986;8(6):1245-55. 13. Cannon CP, Shah S, Dansky HM, Davidson M, Brinton EA, Gotto AM, et al. Safety of anacetrapib in patients with or at high risk for coronary heart disease. N Engl J Med. 2010;363(25):2406-15. 14. Assmann G, Schulte H. Relation of high-density lipoprotein cholesterol and triglycerides to incidence of atherosclerotic coronary artery disease (the PROCAM experience). Prospective Cardiovascular Mnster study. Am J Cardiol. 1992;70(7):733-7. 15. Gorriti A, Arroyo J, Quispe F, Cisneros B, Condorhuamn M, Almora Y, et al. Toxicidad oral a 60 das del aceite de sacha inchi (Plukenetia volubilis L) y linaza (Linum usitatissimum L.) y determinacin de la dosis letal 50 en roedores. Rev Peru Med Exp Salud Publica. 2010;27(3):352-60. 16. Dall T, Bays H. Addressing lipid treatment targets beyond cholesterol: a role for prescription omega-3 fatty acid therapy. South Med J.2009;102(4):390-6. 17. Garmendia F, Brown AS, Reiber I, Adams PC. Attaining United States and European guideline LDL-cholesterol levels with simvastatin in patients with coronary heart disease (the GOALLS study). Curr Med Res Opin. 2000;16(3):208-19. 18. Randle PJ, Garland PB, Hales CN, Newsholme EA. The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet. 1963;1(7285):785-9.

Los autores manifiestan no tener conflictos de inters relacionados a la publicacin de este trabajo

REFERENCIAS BIBLIOGRFICAS
1. Sabat J, Oda K, Ros E. Nut consumption and blood lipid levels: a pooled analysis of 25 intervention trials. Arch Intern Med. 2010; 170(9):821-7. 2. Tapsell LC, Gillen LJ, Patch CS, Batterham M, Owen A, Bar M, et al. Including walnuts in a low-fat/modifiedfat diet improves HDL cholesterol-to-total cholesterol ratios in patients with type 2 diabetes. Diabetes Care. 2004;27(12):2777-83. 3. Pascual G, Meja M. Extraccin y caracterizacin de aceite de sacha inchi (Plukenetia Volubilis L). Anales Cientficos UNALM. 2000;42:143-57. 4. Guilln MD, Ruiz A, Cabo N, Chirinos R, Pascual G. Characterization of sacha inchi (Plukenetia volubilis L) oil by FTIR spectroscopy and 1H NMR. Comparison with linseed oil. J Am Oil Chemts Society. 2003;80(8):755-62. 5. Bays HE, Tighe AP, Sadovsky R, Davidson MH. Prescription omega-3 fatty acids and their lipid effects: Physiologic mechanisms of action and clinical implications. Expert Rev Cardiovasc Ther.2008;6(3):391-409. 6. Huamn J, Chvez K, Castaeda E, Carranza S, Chvez T, Beltrn Y, et al. Efecto de la Plukenetia volubilis Linneo (sacha inchi) en la trigliceridemia posprandial. An Fac med. 2008;69(4):263-6. 7. Herbert PN, Assmann G, Gotto AM Jr, Fredrickson DS. Familial lipoprotein deficiency: Abetalipoproteinemia, hypobetalipoproteinemia, and Tangier disease. In: Stanbury JB, Wyngaarden JB, Fredrickson DS, Goldstein JL, Brown MS (eds). The Metabolic Basis of Inherited Disease. 5th ed. New York: McGraw-Hill; 1983. p. 594. 8. Matthews D, Hosker J, Rudenski A, Naylor B, Treacher D, Turner R. Homeostasis model assessment: insulin resistance and B-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologa. 1985;28(7):412-9. 9. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet. 1994;344(8934):1383-9. 10. Frick MH, Elo O, Haapa K, Heinonen OP, Heinsalmi P, Helo P, et al. Helsinki Heart Study: primary-prevention trial with gemfibrozil in middle-aged men with dyslipidemia. Safety of treatment, changes in risk factors, and incidence of coronary heart disease. N Engl J Med. 1987;317(20):1237-45.

Correspondencia: Fausto Garmendia Lorena Direccin: Paseo de la Repblica N. 3691-401B, San Isidro, Lima 27, Per Telfono: (51) 998673812 Correo electrnico: faustogarmendia@yahoo.com

632

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

original breve

LESIONES MEDULARES NO TRAUMTICAS: ETIOLOGA, DEMOGRAFA Y CLNICA


Asencio Quintana-Gonzales1,a, Rosa Sotomayor-Espichan2,a, Mara Martnez-Romero2,a, Csar Kuroki-Garca3,a
RESUMEN Se realiz un estudio retrospectivo y descriptivo en 210 pacientes hospitalizados con lesin medular del Instituto Nacional de Rehabilitacin (INR), Callao-Per (2000-2006) para conocer la etiologa, caractersticas clnicas y socio-demogrficas de los pacientes con lesiones medulares no traumticas (LMNT). Se encontr una prevalencia de 27 % para LMNT siendo la edad promedio al inicio de la lesin 32,0 aos; siendo varones el 50,5 %, y el 41,9 % tuvieron educacin secundara, el nivel de pobreza alcanz el 90,5 %. Predomin la etiologa infecciosa (viral y bacteriana) en 37,6 %, con un 11,9 % de infeccin por HTLVI. No obstante ser el INR un centro de referencia, nuestros resultados son preliminares, siendo necesario realizar mayores estudios para proponer estrategias de prevencin y control, dado el alto costo del tratamiento integral de rehabilitacin en estos pacientes. Palabras clave: Lesiones de la mdula espinal; Prevalencia; Etiologa (fuente: DeCS BIREME).

NONTRAUMATIC SPINAL CORD INJURY: ETIOLOGY, DEMOGRAPHY AND CLINICS


ABSTRACT We performed a retrospective and descriptive cross-sectional; study in 210 hospitalized patients with spinal cord injury at the National Institute of Rehabilitation (INR), Callao, Peru from 2000-2006. The goal was to describe etiology, and clinical and socio-demographic characteristics of non traumatic spinal cord injuries (LMNT). We found a prevalence of 27 % for LMNT, average age at onset of 32.0 years, male gender 50.5 %, and secondary education completed in 41.9 %, poverty 90.5 %. The infectious etiology (viral and bacterial) was predominant in 37.6 %, with 11.9 infected with HTLVI. Although the INR is a reference center, the findings cant be generalized because it isnt a representative sample of the Peruvian population, further studies are necessary to propose strategies for prevention and control, considering the high cost of integral rehabilitation treatment in these patients. Key words: Spinal cord injuries; Prevalence; Etiology (source: MeSH NLM).

INTRODUCCION
La lesin medular es una de las afecciones ms graves y discapacitantes por las grandes limitaciones y complicaciones que se derivan de ella, constituyendo un serio problema de salud pblica. El portador de una lesin medular presenta prdida de funcin motora de diferentes niveles y grados de extensin, disminucin o prdida de sensibilidad, disfuncin vesical, intestinal y sexual; as como severas consecuencias psquicas,

sociales y econmicas debido a su situacin de discapacidad permanente e irreversible. No hay buenos registros sobre la incidencia de las lesiones medulares no traumticas (LMNT) debido a problemas en las definiciones, datos epidemiolgicos escasos y atencin de estos pacientes por diferentes especialidades. As, la esclerosis mltiple es catalogada como lesin medular por algunos autores y excluida por otros; se vienen registrando como causas de LMNT

1 2 3 a

Direccin Ejecutiva de Investigacin, Docencia y Rehabilitacin Integral en Funciones Motoras, Instituto Nacional de Rehabilitacin. Callao, Per. Departamento de Investigacin, Docencia y Rehabilitacin Integral en Lesiones Medulares, Instituto Nacional de Rehabilitacin. Callao, Per. Departamento de Investigacin, Docencia y Rehabilitacin Integral en Unidad Motora y Dolor, Instituto Nacional de Rehabilitacin. Callao, Per. Mdico Rehabilitador

Recibido: 12-08-11

Aprobado: 09-11-11

633

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

Quintana-Gonzales A et al.

enfermedades crnicas progresivas como esclerosis mltiple, espondilosis cervical y esclerosis lateral amiotrfica. De las LMNT en el University of Rochester Medical Center, el 45 % fueron causadas por tumores (primarios y metastsicos), otras causas incluyeron insuficiencia vascular, osteomielitis, hernia del ncleo pulposo y cambios degenerativos que causaron compresin del cordn espinal (1). En Espaa se encontr como causas mdicas el 18,5 % (2). En Bangladesh (India) el mal de Pott alcanz el 28 %, los tumores 21 % y la mielitis transversa 9 % (3). En un estudio sobre frecuencia de daos trazadores (es decir, deficiencia o enfermedad que se usa para medir la situacin de discapacidad en la poblacin y la capacidad operativa del establecimiento en relacin al tratamiento rehabilitador) en pacientes hospitalizados en el Instituto Nacional de Rehabilitacin (INR) entre enero y diciembre de 2004, utilizando el Clasificador Internacional de Enfermedades versin 10, se inform traumatismo de la mdula espinal en 68,5 % y otras enfermedades de la mdula espinal (no traumticas) en 31,5 %, de las cuales el 26,8 % correspondi a causas infecciosas, 24,4 % enfermedades del desarrollo, 22,0 % degenerativas, 12,2 % neoplsicas, 9,8 % vasculares y otras 4,9 % (4). Clnicamente las enfermedades de la mdula espinal suelen cursar con dolor, alteracin motora, sensitiva y esfinteriana. Estas manifestaciones se combinan de forma diferente segn el sndrome clnico, dependiendo del tipo y nivel de lesin. La estrategia diagnstica est en funcin de la forma de presentacin; ante un sndrome medular agudo debe sospecharse alteracin compresiva, traumtica, inflamatoria o vascular, y practicarse estudios complementarios urgentes como la resonancia magntica (RMN) que ofrece mayor informacin en compresiones medulares, mielitis y enfermedades vasculares y el estudio del lquido cefalorraqudeo es til en las enfermedades inflamatorias e infecciosas (5). Habitualmente, los aspectos sociodemogrficos relacionados a la LMNT como grado de instruccin, procedencia, ocupacin, situacin socioeconmica, etc. no son informados, de ah la trascendencia del presente estudio que nos permite conocer estos aspectos importantes para la inclusin socio-laboral de la persona con LMNT. El objetivo del estudio fue conocer la etiologa, caractersticas clnicas y socio-demogrficas de los pacientes hospitalizados de un servicio del INR con el diagnstico de LMNT durante el perodo 20002006.

EL ESTUDIO
Se realiz un estudio descriptivo y retrospectivo en pacientes hospitalizados con LMNT en un servicio del INR entre los aos 2000-2006. Se incluyeron pacientes nuevos con diagnstico de LMNT en base al CIE-10, segn el informe mdico del hospital de procedencia, con etiologa consignada y corroborada con RMN, exmenes de laboratorio bacteriolgico y viral, estudio radiogrfico o respuesta al tratamiento. Se utiliz el registro de ingresos del sistema de informacin en discapacidad del instituto (INR-DIS) del cual se obtuvo el listado de historias clnicas de los pacientes que constituyeron la poblacin de estudio, a travs de la Oficina de Estadstica e Informtica del INR. De los 248 pacientes con LMNT identificados durante el perodo de estudio, 210 cumplieron con los criterios mencionados y los datos completos. Fueron excluidos del estudio pacientes que no contaron con informe mdico, reingresos hospitalarios e historias clnicas incompletas. Se obtuvo informacin de las historias clnicas estandarizadas mediante una ficha de recoleccin de datos elaborada para el estudio, que incluy: datos de filiacin (sexo, lugar de procedencia, grado de instruccin, estado civil, ocupacin, estabilidad de empleo), nivel socioeconmico (Mtodo de la Lnea de Pobreza), datos de la enfermedad actual (edad, lugar y fecha de inicio de la lesin), etiologa (infecciosa, neoplsica, del desarrollo, vascular, degenerativa, metablica, idioptica, iatrognica, neurolgica) (6), caractersticas clnicas de la lesin segn la clasificacin ASIA para nivel (cervical, dorsal, lumbar y sacro) y tipo (A: ausencia completa de funcin sensitiva o motora; B: lesin incompleta, hay sensibilidad pero no control motor; C: sensibilidad y funcin motora conservada, pero la musculatura es no funcional; D: los msculos son funcionales en un 75 %; E: la sensibilidad y fuerza presentan una recuperacin casi total) (7) y tono muscular al ingreso. Para el anlisis de los datos se utilizaron porcentajes, medidas de tendencia central y tablas de doble entrada para relacionar variables. Los datos se procesaron con el programa SPSS versin 18. Para realizar el estudio se cont con la aprobacin de la Oficina de Apoyo a la Investigacin y Docencia Especializada y del Comit de Investigacin Institucional. HALLAZGOS La prevalencia de LMNT para el perodo de estudio en los pacientes hospitalizados fue del 27 %. En la Tabla 1 se

634

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

Lesiones medulares no traumticas

Tabla 1. Caractersticas demogrficas segn etiologa no traumtica en pacientes hospitalizados del INR (2000-2006).
Caractersticas Sexo Masculino Femenino Estado civil Soltero Casado Otro Regin geogrfica Costa Sierra Selva Grado de instruccin Sin instruccin Primaria Secundaria Superior Ocupacin Ama de casa Estudiante Trabajador Otros Nivel socioeconmico Pobre extremo Pobre no extremo No pobre Infecciosa 36 (45,6) 43 (54,4) 28 (35,4) 25 (31,6) 26 (33,0) 68 (86,1) 10 (12,7) 1 ( 1,2) 19 (24,1) 42 (53,2) 18 (22,7) 15 (19,0) 20 (25,3) 38 (48,1) 6 ( 7,6) 45 (57,0) 27 (34,2) 7 ( 8,8) Degenerativa 25 (75,8) 8 (24,2) 7 (21,2) 22 (66,6) 4 (12,2) 29 (87,9) 4 (12,1) 13 (39,4) 8 (24,2) 12(36,4) 4 (12,1) 1 ( 3,0) 20 (60,6) 8 (24,3) 15 (45,5) 13 (39,4) 5 (15,1) Neoplsica 11 (37,9) 18 (62,1) 14 (48,3) 6 (20,7) 9 (31,0) 24 (82,8) 4 (13,8) 1 ( 3,4) 2 ( 6,9) 5 (17,3) 11 (37,9) 11 (37,9) 7 (24,1) 7 (24,1) 14 (48,3) 1 ( 3,5) 16 (55,2) 11 (37,9) 2 ( 6,9) Del desarrollo 14 (70,0) 6 (30,0) 5 (25,0) 1 ( 5,0) 14 (70,0) 17 (85,5) 3 (15,0) 1 ( 5,0) 8 (40,0) 9 (45,0) 2 (10,0) 18 (90,0) 2 (10,0) 10 (50,0) 7 (35,0) 3 (15,0) Otros 20 (40,8) 29 (59,2) 17 (34,7) 22 (44,9) 10 (20,4) 44 (89,8) 5 (10,2) 1 ( 8,3) 8 (16,3) 18 (36,8) 22 (38,6) 10 (20,4) 7 (14,3) 27 (55,1) 2 (10,2) 26 (53,1) 20 (40,8) 3 ( 6,1) TOTAL 106 (50,5) 104 (49,5) 71 (33,8) 76 (36,2) 63 (30,0) 182 (86,7) 26 (12,4) 2 ( 0,9) 4 ( 1,9) 53 (25,2) 88 (41,9) 65 (31,0) 36 (17,1) 53 (25,2) 99 (47,2) 22 (10,5) 112 (53,4) 78 (37,1) 20 ( 9,5)

Nota: los valores entre ( ) representan los porcentajes.

muestran las caractersticas generales de los pacientes. No hubo predominio segn sexo ni estado civil, el 61,9 % estaban en Lima cuando iniciaron su enfermedad, y 24,8 % en el resto de la costa. El 35,7 % tena empleo estable (33,3 % independiente y 66,7 % dependiente), 11,4 % eventual y 52,9 % no trabajaba. La gran mayora de los pacientes fueron pobres segn la clasificacin del INEI (53,4 % pobres extremos y 37,1 % pobres no extremos). El 37,6 % de los pacientes con LMNT presentaron etiologa infecciosa (24,3 % virales y 13,3 % bacterianas); entre ellas, la mielitis transversa viral y HTLV I alcanzaron 11,9 y 11,0 % respectivamente; y en las bacterianas el 11 % estuvo asociado a tuberculosis. En la etiologa degenerativa predominaron la estenosis espinal y hernia del ncleo pulposo con 14 %. En la etiologa neoplsica no hubo predominio de ninguna enfermedad. En las del desarrollo, el total estuvo constituido por espina bfida-mielomeningocele. En las vasculares predominaron las malformaciones arteriovenosas con 94,7 %. En las idiopticas la siringomielia alcanz el 5,2 %; como se ve en la Tabla 2. Respecto a las caractersticas clnicas 66,2 % de los pacientes tuvieron 40 aos o menos al inicio de la lesin, 64,3 % de las lesiones fueron a nivel torcico, el

24,8 % fueron lesiones medulares completas (del tipo A segn la clasificacin ASIA), y de las incompletas la ms frecuente fue del tipo C (sensibilidad y funcin motora conservada, pero la musculatura es no funcional) en un 38,6 % . El 79,0 % tuvieron tono muscular espstico y el 21,0 % flcido; como est descrito en la Tabla 3. Se observ que el 54,4 % de los pacientes con etiologa infecciosa y 62,1 % con etiologa neoplsica fueron de sexo femenino mientras que 75,8 % con etiologa degenerativa fueron de sexo masculino; el inicio de la lesin para las diferentes etiologas fue predominantemente en la costa; solo el 1,9 % no tena ningn grado de instruccin. En las diferentes etiologas predomin el grupo de trabajadores segn OIT y dentro de ellos los pacientes con trabajo dependiente en todas las etiologas. En el estudio, entre los trabajadores predominaron los pacientes con trabajo dependiente en todas las etiologas. Asimismo el nivel socioeconmico de pobreza (pobre extremo y pobre no extremo) fue el mayor con 91,2 % para la etiologa infecciosa, 84,9 % etiologa degenerativa y 93,1 % etiologa neoplsica. El 68,4 % de los pacientes con etiologa infecciosa y el 72,4 % neoplsica iniciaron la lesin antes de los 41 aos. Al analizar la etiologa en relacin a los resultados clnicos se encontr que 74,7 % de los pacientes con

635

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

Quintana-Gonzales A et al.

Tabla 2. Etiologa de las LMNT en pacientes hospitalizados del INR (2000-2006).


Etiologa Viral Mielitis transversa HTLV 1 Otras Bacterianas Mal de Pott Mielitis-TBC Meningoencefalomielitis Otras Degenerativas Estenosis espinal HNP Otras Neoplsicas Schwanoma Ependimoma Neurinoma Neurofibroma Meningioma Otras Del desarrollo Espina bifida - mielomeningocele Vascular Malformacin arterio venosa Otros Idiopticas Siringomielia Idioptica Otras Quiste Aracnoiditis Otras TOTAL N 51 25 23 3 28 14 9 2 3 33 16 14 3 29 6 5 3 3 2 10 20 20 19 17 2 12 11 1 18 5 2 11 210 (%) (24,3) (11,9) (11,0) (1,4) (13,3) (6,7) (4,3) (1,0) (1,4) (15,7) (7,6) (6,7) (1,4) (13,8) (2,9) (2,4) (1,4) (1,4) (1,0) (4,8) (9,5) (9,5) (9,0) (8,1) (1,0) (5,7) (5,2) (0,5) (8,6) (2,4) (1,0) (5,2) (100,0)

etiologa infecciosa tuvieron nivel de lesin torcico, 54,5 % con etiologa degenerativa eran cervicales y 58,6 % con etiologa neoplsica tuvieron nivel de lesin torcico. En las lesiones incompletas, referente a etiologa se observ 81,0 % infecciosas, 75,8 % degenerativas y 72,4 % neoplsicas. Clnicamente el tono muscular espstico fue el ms frecuente, asocindose a etiologa infecciosa 93,7 %, degenerativa 75,8 % y neoplsica 79,3 %.

DISCUSIN
Los datos epidemiolgicos respecto a la lesin medular en su mayora, se refieren a la etiologa traumtica siendo muy difcil la recoleccin de estos datos en las no traumticas ya que son tratadas por diferentes especialidades. El haber encontrado 27 % de prevalencia de LMNT en nuestra institucin es comparable con los resultados descritos en Per con 29,5 % (8), en Bangladesh con el 28,0 % (3); cifras diferentes a las descritas en Espaa, donde alcanz el 32,3 % (9) y Mxico donde alcanz el 15,4 % (10). En el estudio, respecto a la edad, el grupo de 40 aos o menos fue el ms frecuente constituyendo el 66,2 % con una media de 31,7 aos, etapa altamente productiva de la vida, semejante a lo descrito en Espaa (38,4 aos) (9) y menor a otros pases como EE.UU. con una edad promedio de 61,2 aos (11), Australia con 61 aos (12) e Italia con 55 aos (13). Asimismo, no se encontr diferencia en cuanto a sexo, como se informa en otros pases donde predomina el sexo masculino como Mxico que registra 65,2 % (10), Italia 63,3 % (13) y Espaa 55,4 % (9).

Tabla 3. Caractersticas clnicas segn etiologa no traumtica en pacientes hospitalizados del INR (2000-2006)
Caractersticas Edad al inicio de lesin 0 a <41 41 80 Nivel de lesin al ingreso C2 C8 T1 T12 L1 L5 S1 S5 Tipo de lesin al ingreso* A B C D Tono muscular al ingreso Espstico Flcido Infecciosa 54 (68,4) 25 (31,6) 12 (15,2) 59 (74,7) 8 (10,1) 0 (0,0) 15 (19,0) 9 (11,4) 29 (36,7) 26 (32,9) 74 (93,7) 5 ( 6,3) Etiologa no traumtica Degenerativa Neoplsica Del desarrollo 6 (18,2) 27 (81,8) 18 (54,5) 11 (33,4) 4 (12,1) 0 (0,0) 8 (24,2) 3 (9,1) 12 (36,4) 10 (30,3) 25 (75,8) 8 (24,2) 21 (72,4) 8 (27,6) 12 (41,4) 17 (58,6) 0 (0,0) 0 (0,0) 8 (27,6) 2 (6,9) 14 (48,3) 5 (17,2) 23 (79,3) 6 (20,7) 20 (100,0) 0 ( (0,0) 0 (0,0) 11 (55,0) 7 (35,0) 2 (15,0) 10 (50,0) 2 (10,0) 4 (20,0) 4 (20,0) 1 (5,0) 19 (95,0) Otros 38(77,5) 11(22,5) 11(22,4) 37(75,5) 1 (2,1) 0 (0,0) 11(22,4) 8 (16,3) 22(44,9) 8 (16,4) 43(87,8) 6(12,2) TOTAL 139 (66,2) 71 (33,8) 53 (25,2) 135 (64,3) 20 (9,5) 2 (1,0) 52 (24,8) 24 (11,4) 81 (38,6) 53 (25,2) 166 (79,0) 44 (21,0)

* Clasificacin ASIA: A) Lesin medular completa; B) Lesin incompleta, solo preservacin de sensibilidad; C) sensibilidad y funcin motora conservada, pero no funcional; D) La mayora de msculos son funcionales.

636

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

Lesiones medulares no traumticas

El grado de instruccin que predomin en el presente estudio fue secundario (41,9 %) y nivel superior (32,8 %); solo encontramos un estudio realizado en Mxico donde el 78,9 % (10) tuvo grado de instruccin inferior al universitario. Para el presente trabajo se utiliz la clasificacin OIT y se agregaron dos grupos no incluidos: estudiantes y amas de casa. Los trabajadores representaron el 47,2 %, llamando la atencin el predominio de dependientes en todas las etiologas de LMNT, as como la elevada frecuencia de estudiantes (25,2 %) y amas de casa (17,1 %). El alto nivel de pobreza encontrado (90,5 %) implica una seria problemtica social por lo cual este tratamiento integral, que por su naturaleza es costoso, viene siendo ampliamente subvencionado por el Estado. Esto agregado a las caractersticas geogrficas de nuestro pas hace an ms difcil la accesibilidad a este nico centro a nivel nacional. De los 210 casos estudiados se observ el predominio de las infecciones virales (24,3 %) observndose una relacin inversa a lo informado por Espaa (3,7 %) (14) por lo que sera conveniente realizar estudios posteriores al respecto. Referente a las infecciones bacterianas por M. tuberculosis es importante mencionar lo descrito en Espaa (29,6 %), en relacin a lo hallado en nuestro estudio en que casi toda la etiologa bacteriana fue por tuberculosis. Los hallazgos de este estudio se diferencian de lo descrito para infecciosas por EE.UU. (3,0 %) (11) y Australia (3 %) (12) donde no consignaron etiologa precisa. El estudio corrobora que la etiologa infecciosa en nuestro pas estara asociada con la condicin socioeconmica de pobreza hallada en el 90,5 % y que afecta una poblacin en edad altamente productiva, lo que hace evidente la diferencia con los hallazgos de pases desarrollados. La etiologa degenerativa hallada en el estudio (15,7 %), es similar a Italia (18,6 %) (13) y Australia (17,9 %) (12). La neoplsica (13,8 %), es inferior a lo encontrado en Italia (25 %) (13). Los hallazgos de la investigacin estaran relacionados con la distribucin epidemiolgica de pases con problemas de pobreza. Aunque existen estudios que informan etiologas especificas como tuberculoma, hematomielia no traumtica y sarcoidosis en mdula espinal (15-18), el presente estuvo dirigido a encontrar causas generales de LMNT. Para los investigadores era importante asociar la etiologa con las variables sociodemogrficas teniendo

en cuenta las caractersticas de la poblacin que atendemos y ms an no habindose encontrado mayores informes. Las etiologas infecciosa y neoplsica predominaron en el grupo de mujeres hasta 40 aos, la degenerativa en varones mayores de 40 aos. En estado civil y etiologa solo observamos mayor frecuencia de casados en las degenerativas. Asimismo, respecto al grado de instruccin y etiologa, los resultados fueron dispares. Al comparar las LMNT y nivel de lesin torxico de nuestro estudio (64,3 %), con lo descrito por otros pases se evidenci gran diferencia con Mxico (11,1 %) (10) y Bangladesh (25,0 %) (3). En los niveles cervicales, Mxico inform un 14,0 %, a diferencia del presente estudio con 25,2 %. El hallazgo de 75,2 % de los pacientes con lesin incompleta (B, C, D) y de etiologa predominantemente infecciosa implica la necesidad de una intervencin primaria oportuna. Este resultado es similar a Mxico (69,6 %) y Australia (88,0 %). Dentro de las lesiones incompletas el tipo C fue el ms frecuente. Asimismo predomin el tono muscular espstico. El estudio tuvo algunas limitaciones, dado que se realiz en una muestra no representativa de la poblacin de Per, no es posible realizar una extrapolacin de los datos y, al ser necesaria la prevencin respecto a la etiologa, existe la inquietud de los investigadores de realizar un estudio de mayor magnitud o multicntrico. En conclusin, identificamos que las causas de LMNT son mayormente infecciosas, en personas en edad productiva, con grado de instruccin medio-superior, la mayora desocupados, en situacin de pobreza y con caractersticas clnicas de lesiones incompletas, con todas las implicancias que origina la secuela de una lesin medular.

Contribuciones de autora
AQG particip en la concepcin y diseo del trabajo, recoleccin/obtencin de resultados, anlisis e interpretacin de datos, redaccin y revisin del manuscrito, aprobacin de versin final, obtencin de financiamiento. RSE y MMR participaron en la concepcin y diseo del trabajo, recoleccin/obtencin de resultados, anlisis e interpretacin de datos, redaccin y revisin del manuscrito, aprobacin de versin final. CKG particip en recoleccin/obtencin de resultados, revisin del manuscrito y aprobacin de la versin final.

Conflictos de inters
Los autores declaran no tener ningn conflicto de inters.

637

Rev Peru Med Exp Salud Publica. 2011;28(4):633-38.

Quintana-Gonzales A et al.

Fuentes de financiamiento
Este trabajo fue financiado por el Instituto Nacional de Rehabilitacin

10. Prez R, Martn del Campo S, Renn S, Durn S. Aspectos epidemiolgicos de la lesin medular de la poblacin del Centro Nacional de Rehabilitacin. Revista Mexicana de Medicina Fsica y Rehabilitacin. 2008;20:7482. 11. Citterio A, Franceschini M, Spizzichino L, Reggio A, Rossi B, Stampacchia G. Nontraumatic spinal cord injury: an italian survey. Arch Phys Med Rehabil. 2004 85(9):14837. 12. McKinley WO, Seel RT, Hardman JT. Nontraumatic spinal cord injury: incidence, epidemiology, and functional outcome. Arch Phys Med Rehabil. 1999;80(6):619-23. 13. New PW, Rawicki HB, Bailey MJ. Nontraumatic spinal cord injury: demographic characteristics and complications. Arch Phys Med Rehabil. 2002;83(7):996-1001. 14. Morillo-Leco G, Alcaraz-Rousselet MA, Daz-Borrego P, Senz-Ramrez L, Artime C, Labarta-Bertol C. Caractersticas clnicas de la lesin medular de causa infecciosa. Rev Neurol. 2005;41(4):205-8. 15. Kalita J, Mistra UK. Intramedullary cervical tuberculoma. Spinal Cord. 1999;37(4):297-8. 16. Karavelis A, Foroglou G, Petsanas A, Zarampoukas T. Spinal cord dysfunction caused by non-traumatic hematomyelia. Spinal Cord. 1996;34(5):268-71. 17. Ku A, Lachmann E, Tunkel R, Nagler W. Neurosarcoidosis of the conus medullaris and cauda equina presenting as paraparesis: case report and literatura review. Paraplegia. 1996;34(2):116-20. 18. Saleh S, Saw C, Marzouk K, Sharma O. Sarcoidosis of the spinal cord: literature review and report of eight cases. J Natl Med Assoc. 2006;98(6):965-76.

REFERENCIAS BIBLIOGRFICAS
1. Gibson CJ. Overview of spinal cord injury. Phys Med Rehabil Clin N Am. 1992;3(4):699-709. 2. Mazaira J, Labanda F, Romero J, Garca ME, Gambarruta C, Snchez A, et al. Epidemiologa de la lesin medular y otros aspectos. Rehabilitacin (Madr). 1998;32:365-72. 3. Hoque MF, Grangeon C, Reed K. Spinal cord lesions in Bangladesh: an epidemiological study 1994 - 1995. Spinal Cord. 1999;37(12):858-61. 4. Instituto Nacional de Rehabilitacin, Departamento de Investigacin, Docencia y Rehabilitacin Integral en Lesiones Medulares. Daos Trazadores. Bellavista, Callao: Instituto Nacional de Rehabilitacin; 2004. 5. Mart Mass JF, Martnez Zabaleta M. Enfermedades no degenerativas de la mdula espinal: concepto, clasificacin sindrmica, manifestaciones clnicas y estrategia diagnstica. Medicine. 2003;8(99):5321-6. 6. Taricco MA. Etiologia das Lesoes Medulares. En: Greve JM, Casalis ME, Barros TE, editores. Diagnstico e Tratamento da Lesao da Medula Espinal. Sao Paulo: Editorial Roca; 2001. 7. Ditunno JF, Young WS, ed. International Standards for Neurological and Functional Classification of Spinal Cord Injury revised 1992. Buffalo: ASIA/ IMSOP; 1992. 8. Vasquez J. Estudio de prevalencia de lesiones medulares en el Instituto Nacional de Rehabilitacin 1999-2002 [Tesis para optar el grado de Magister en Medicina]. Lima, Per. Universidad Peruana Cayetano Heredia. 2007. 9. Garca AM, Mndez JL, Bataller EB, Snchez J, Miranda G, lvarez C. Epidemiologa de la lesin medular en la provincia de Las Palmas. Rehabilitacin (Madr). 2003;37(2):86-92.

Correspondencia: Asencio Quintana Gonzales Direccin: Edmundo Pini 382. San Martin de Porres. Lima, Per. Telfono: (51) 995055829 Correo electrnico: asencioqg@hotmail.com

Consulte la versin electrnica de la Revista Peruana de Medicina Experimental y Salud Pblica en

www.scopus.com

638

Rev Peru Med Exp Salud Publica. 2011;28(4):639-42.

original breve

Accidentes por mordedura canina, CASOS REGISTRADOS en un hospital de nios DE Lima, Per 1995 2009
Carmen Morales1,a, Nstor Falcn1,b, Henry Hernndez1,2,b, Carla Frnandez1,a
RESUMEN Entre 1995 a 2009 se registraron 206 hospitalizaciones en el Instituto Nacional de Salud del Nio debido a accidentes por mordedura canina. La mediana de edad de los pacientes fue cuatro aos y para los das de hospitalizacin tres. El 61,7 % fueron varones. Los accidentes ocurrieron en el domicilio de una tercera persona (39,3 %), en va pblica (33,5 %) y en el domicilio del agredido (27,2 %). El 66,5 % de los episodios fueron precedidos por un estmulo del nio y el 88,8 % causado por animales reconocidos por los lesionados. El 34,0 % reconoci la raza del animal (52,9 % animales cruzados). El 79,1 % fueron lesiones mltiples y la regin anatmica ms afectada fueron la cabeza y cuello (79,1 %). Se registraron complicaciones en un 20,4 % y secuelas estticas en el 94,7 %. Las mordeduras caninas afectan la salud fsica de los nios. Palabras clave: Accidentes; Perros; Nio; Vacunas antirrbicas (fuente: DeCS BIREME).

Dog bite accidents in a children hospital at Lima, Peru. Retrospective Study from 1995 - 2009
ABSTRACT From 1995 to 2009, 206 cases of dog bites were recorded among hospitalized patients at the Children National Health of, Lima-Peru. The median of age was 4 years, and for hospitalization time was 3 days. Most patients were males (61.7 %). The bites occurred in the house of a third person (39.3 %), on the street (33.5 %), or in the victims house (27.2 %). A 66.5 % of the bites were provoked and 88.8 % were from animals known to the victim. The dog breed was recognized in 34 % (52.9 % were mongrel dogs). Multiple lesions were identified in 79.1 %, and the most frequently bitten areas were head and neck (79.1 %). Complications were reported in 20.4 % and aesthetic sequelae in 94.7 %. Key words: Accidents; Dogs; Child; Rabies vaccines (source: MesH NLM).

INTRODUCCIN
Los accidentes por mordedura canina en personas representan un importante problema de salud pblica, tanto por la lesin producida, como por el impacto emocional en las vctimas, las secuelas estticas, la transmisin de enfermedades, las complicaciones secundarias (infecciones bacterianas) y el costo que incurre para la comunidad y el estado (1,2). En el caso de los nios, ellos se exponen a estos accidentes debido a que comparten espacios comunes con estos animales (3) y porque a su edad, no interpretan eficientemente las seales previas de amenaza, como gruidos o ladridos que pueden conducir a una agresin (4).
a *
1 2

El comportamiento de los perros es el resultado de la combinacin de aspectos como su gentica, trato, entrenamiento y socializacin, aunque existen algunas razas potencialmente ms peligrosas. As, en Estados Unidos, los perros de raza rottweiler y pitbull son causantes de alrededor del 60 % de las fatalidades debido a accidentes por mordedura (5). La implementacin de una legislacin para prohibir la crianza de perros de razas peligrosas en muchos pases no se ha investigado con profundidad, a excepcin de un estudio realizado en el Reino Unido en 1990 que describi que tales polticas no tuvieron el impacto esperado (6).

Grupo de Salud Pblica Veterinaria, Facultad de Veterinaria y Zootecnia, Universidad Peruana Cayetano Heredia. Lima, Per. Oficina de Epidemiologia, Instituto Nacional de Salud del Nio. Lima, Per. Medico Veterinario Zootecnista; b Mdico Veterinario. Este estudio fue presentado como tesis para optar el titulo profesional de Mdico Veterinario Zootecnista en la Facultad de Veterinaria y Zootecnia de la Universidad Peruana Cayetano Heredia en 2010.

Recibido: 05-04-11

Aprobado: 14-09-11

639

Rev Peru Med Exp Salud Publica. 2011;28(4):639-42.

Morales C et al.

Aunque es imposible prevenir todas las mordeduras de perros, estas pueden reducirse en nmero (7). Adems, que una evaluacin rpida y un tratamiento oportuno pueden prevenir las complicaciones de la herida (8) y minimizar el estrs postraumtico que suele sobrevenir despus del evento (9). En el Per, la informacin acerca de accidentes por mordedura en nios no se encuentra sistematizada. Por ello, el objetivo del estudio fue determinar las caractersticas clnico-epidemiolgicas de los casos hospitalizados de accidentes por mordedura en un hospital de nios en el periodo de 1995 2009, en la ciudad de Lima, Per.

informacin: datos generales del paciente agredido (sexo, grupo de edad, procedencia, tiempo de estancia hospitalaria), variables del entorno (lugar y circunstancia del accidente), del animal agresor (raza, condicin de tenencia y propiedad) y las relacionadas a la lesin (nmero, tipo de exposicin, profundidad, ubicacin anatmica, tratamientos, secuelas y complicaciones). La informacin obtenida fue transferida a una base de datos en el programa Microsoft Excel y se utiliz el programa SPSS 15.0 para su anlisis utilizando estadstica descriptiva. Las variables cuantitativas, edad del paciente y tiempo de hospitalizacin, se resumieron utilizando la mediana como medidas de tendencia central. El resto de resultados se muestran en tablas de frecuencias. La Oficina Ejecutiva de Apoyo a la Investigacin y Docencia Especializada del INSN autoriz la presente investigacin (cdigo E-12/09). HALLAZGOS Para el presente estudio, se incluy al total de nios (206) hospitalizados por mordedura canina durante el periodo 1995 - 2009. La distribucin de los accidentados segn edad fue: 56,8 % (117) menores de cuatro aos, 31,1 % (64) de cinco a nueve aos y 12,1 % (25) mayores de diez aos, siendo la mediana de edad de cuatro aos. El 61,7 % (127) fueron varones y 38,3 % (79) mujeres. El 83 % (171) procedieron de zona urbana, 9,7 % (20) de zona semiurbana y 7,3 % (15) de zona rural. El tiempo de hospitalizacin fue de un da para el 30,6 % (63) de los accidentados, 43,2 % (89) entre dos y siete das, 23,8 % (49) entre 8 a 30 das y 2,4 % (5) fueron hospitalizados ms de un mes, con una mediana de tres das. El 39,3 % (81) de accidentes se present en el domicilio de una tercera persona; 33,5 % (69) en la va pblica y 27,2 % (56) en el domicilio del agredido. En el grupo de nios menores de cuatro aos predominaron los accidentes en casa de un tercero, mientras que en el grupo de diez a catorce aos la mayora de casos se produjeron en la va pblica (Tabla 1). El 66,5 % (137) de los accidentes fueron precedidos por un estmulo del nio (evento provocado) y 33,5 % (69) fueron ataques intempestivos del animal (evento sorpresivo). Los accidentes sorpresivos fueron ms frecuentes en la va pblica, mientras que los provocados ocurrieron en la casa de un tercero (Tabla 1). El 88,8 % (183) fueron causados por animales reconocidos por los lesionados. Se registr la raza del animal en el 34 % (70) de los accidentes. De ellos, el 52,9 % (37) correspondi a razas cruzadas y la diferencia a razas definidas (pitbull, rottweiler y bxer, entre otras).

EL ESTUDIO
Estudio observacional, descriptivo retrospectivo que se realiz en el Instituto Nacional de Salud del Nio (INSN), ubicado en el distrito de Brea, Lima Per, entre los meses agosto de 2009 y marzo de 2010. El cual se bas en la recoleccin de informacin de accidentes por mordedura canina en el periodo 1995 - 2009. La bsqueda de informacin incluy la revisin de la base de datos virtual de la Oficina de Epidemiologa del INSN, los registros de historias clnicas (epicrisis e historias completas) y las placas radiogrficas de los pacientes hospitalizados durante el periodo de estudio. La informacin relacionada con el evento de la mordedura se registra como parte del protocolo de atencin al paciente (registro de atencin por mordedura canina reporte de casos). Para la recoleccin de informacin se elabor una ficha de datos. Dicho documento inclua la siguiente

Tabla 1. Distribucin de los casos de mordedura canina segn edad y circunstancia del accidente en relacin al lugar del evento, Instituto Nacional de Salud del Nio (1995 2009).
Lugar del accidente TOTAL Va Domicilio Domicilio pblica de tercero del agredido N ( %) N ( %) N ( %) N ( %) 37 (18,0) 15 (7,3) 4 (1,9) 7 (3,4) 49 (23,8) 56 (27,2) 117 (56,8) 64 (31,1) 25 (12,1) 69 (33,5) 137 (66,5) 206 (100)

Edad 0 a 4 aos 31 (15,0) 49 (23,8) 5 a 9 aos 24 (11,7) 25 (12,1) 10 a 14 aos 14 (6,8) 7 (3,4) Circunstancia del accidente Sorpresivo 48 (23,3) 14 (6,8) Provocado 21 (10,2) 67 (32,5) TOTAL 69 (33,5) 81 (39,3)

640

Rev Peru Med Exp Salud Publica. 2011;28(4):639-42.

Mordedura canina en nios

El 20,9 % (43) de lesiones fueron nicas y 79,1 % (163) fueron mltiples. Se registr en total 327 lesiones, siendo la regin de cabeza y cuello la ms afectada (Tabla 2). El 92,7 % (191) de los accidentados sufrieron lesiones profundas y la exposicin fue considerada grave en el 97,6 % (201) de los casos. Al 78,6 % (162) se le administr el esquema preventivo de vacunacin antirrbica (vacunar hasta el quinto da posmordedura), al 8,7 % (18) el esquema reducido y 12,6 % (26) no requirieron vacunacin. El 96,1 % (198) de los casos recibieron tratamiento antibitico siendo la penicilina (oxacilina) ms cido clavulnico los usados con mayor frecuencia. El 20,4 % (42) de pacientes present complicaciones como infecciones bacterianas, necrosis, problemas genitourinarios (amputacin traumtica del miembro debido a la mordedura, disuria, postitis, retencin urinaria, edema de la zona afectada, necrosis posterior Tabla 2. Ubicaciones anatmicas de las mordeduras caninas en pacientes hospitalizados en el Instituto Nacional de Salud del Nio. Perodo 1995 2009, Lima, Per.
Ubicacin Cabeza y cuello Cara (frente y mejillas) Labio Nariz Crneo Globo ocular Oreja Lagrimal Cuello Lengua (y paladar blando) Miembro superior Brazo Antebrazo Hombro Dedos de la mano Mano Codo Miembro inferior Pierna Muslo Pie Rodilla Genitales/Regin anal Genitales Glteo Regin anal Trax Abdomen TOTAL N 126 40 18 17 12 12 9 5 2 11 11 5 5 5 1 17 5 3 1 10 4 1 5 2 327 ( %) (38,5) (12,2) (5,6) (5,2) (3,7) (3,7) (2,8) (1,5) (0,6) (3,4) (3,4) (1,5) (1,5) (1,5) (0,3) (5,2) (1,5) (0,9) (0,3) (3,1) (1,2) (0,3) (1,5) (0,6) (100,0)

a la ciruga) como consecuencia de la mordedura. El 94,7 % (195) tuvieron secuelas del tipo fsico. De ellos, las cicatrices en la zona de lesin se present en el 96,4 % (188) de los casos, amputaciones en el 2,6 % (5) y en el 1 % (2) de los pacientes presentaron ambas complicaciones.

DISCUSIN
La casustica mostrada representara solo una parte de estos accidentes que se habran producido en nios durante el periodo de estudio. Se estima que solo el 25 % de agresiones se registran, ello se debe a la gravedad de la lesin producida (10). El que los varones sean los ms afectados se debera a que ellos suelen compartir espacios en comn y realizan actividades ms bruscas o temerarias con los animales, lo que podra ser el desencadenante de una agresin canina (4, 11, 12). La edad ms afectada fue hasta los cuatro aos, lo que estara asociado al desconocimiento de las conductas que pueden provocar al animal, la incapacidad de advertir a tiempo las actitudes amenazantes, el poseer menos coordinacin y fuerza muscular y porque no son capaces de defenderse con sus extremidades durante un ataque. Las agresiones causadas por un animal conocido se deberan a que los nios no consideran a estos como peligrosos y tratan de jugar con ellos, provocando la agresin. Generalmente ocurren en domicilios (hogar propio o el de un familiar o amigo) y en menores bajo custodia de los padres, quienes no advierten la presencia de estas mascotas como un peligro. En contraste, en la va pblica, las personas tienden a evitar el contacto con animales desconocidos o sin dueo, por lo que los accidentes suelen ser sorpresivos. Estos son ms frecuentes en nios mayores a diez aos, quienes por su edad tienen ms probabilidad de encontrarse fuera del hogar (va pblica) especialmente en horas de juego. Aunque existe un subregistro acerca de la raza del animal involucrado en accidentes por mordedura, ello no resultara relevante si se considera que la agresividad mostrada por los animales surge principalmente por la tenencia irresponsable de sus dueos (13). La ubicacin anatmica afectada mayormente fue la regin de la cabeza y cuello. La importancia de ellas radica en el riesgo de presentarse fracturas ocultas de huesos craneales y por que las lesiones localizadas en el rostro son desfigurantes y psicolgicamente peor aceptadas (14). La mayor parte de mordeduras fueron de tipo profundo y grave, requiriendo tratamiento o alguna intervencin quirrgica. El predominio de lesiones

641

Rev Peru Med Exp Salud Publica. 2011;28(4):639-42.

Morales C et al.

mltiple estara relacionado con la limitada capacidad de defensa por parte de la vctima durante la agresin, resultando como consecuencia una alta frecuencia de pacientes con cicatrices como secuela fsica. La administracin de antibitico como tratamiento se ha justificado por considerar que toda herida causada por mordedura estara contaminada por la flora polimicrobiana que se encuentra en la cavidad oral del can. En atencin a la Norma tcnica de salud para la prevencin y control de rabia humana en el Per (2007) y debido a que la mayora de agresiones fueron producidas por animales conocidos sin signos de rabia, la aplicacin de la vacunacin antirrbica preventiva (hasta el da cinco posmordedura) fue el esquema ms utilizado (15). En conclusin, las caractersticas epidemiolgicas y clnicas de los accidentes por mordeduras caninas las convierten en un problema de salud pblica que afectan la salud fsica y psicolgica de los nios, por lo que se requiere la atencin, especialmente preventiva, de las autoridades de salud. Contribuciones de autora HH, CM y NF participaron en la concepcin y diseo del trabajo. HH y CM participaron en la recoleccin/ obtencin de resultados, NF y CF participaron en el anlisis e interpretacin de datos, CM, NF y CF participaron en la redaccin del manuscrito. NF particip en la asesora estadstica y anlisis de datos. CM y CF participaron en la obtencin del financiamiento. Todos los autores revisaron en forma crtica versiones preliminares del manuscrito y aprobaron la versin final del trabajo.

REFERENCIAS BIBLIOGRFICAS
1. Glausiuss G, Ascione I, Sehabiague G. Mordeduras por animales en la edad peditrica. Arch Pediatr Urug. 2000;71:24-30. 2. AVMA American Veterinary Medical Association. A community approach to dog bite prevention. JAVMA. 2001;218(11):1732-49. 3. Navia M. Mordedura de perro en cara. Arch Argent Pediatr. 2005;103(5):396-400. 4. Lema F. Mordedura de perro, comportamiento y agresin. Arch. Argent. Pediatr.2005;103(5):387-8. 5. Sacks J, Sinclair L, Glichrist J, Colab G, Lockwood R. Breeds of dogs involved in fatal human attacks in the United States between 1979 and 1998. JAVMA. 2000:217(6):836-40. 6. Daniels D, Rovane B, Ritzi B, ONeil J. Analysis of nonfatal dog bites in children. J Trauma. 2009;66(3 Suppl):S17-22. 7. Feldman K, Trent R, Jay M. Epidemiology of hospitalizations resulting from dog bites in California, 19911998. Am J Public Health. 2004;94(11):1940-1. 8. Abuabara A. A review of facial injuries due to dog bites. Med Oral Patol Oral Cir Bucal. 2006;11:348-50. 9. Gomes F, Malago W, Cardeal1 D, Bor-Seng-Shu E, Ferreira de Andrade A, Jacobsen M. Craniocerebral injuries from dog bites. Arq Neuropsiquiatr 2008;66(2B):397-9. 10. Mndez R, Gmez M, Somoza I, Liras J, Pais E, Vela D. Mordeduras de perro. Anlisis de 654 casos en 10 aos. An Esp Pediatr. 2002;56:425-9. 11. Zanini F, Padinger P, Elissondo M, Perez H. Epidemiologa de las lesiones por mordedura de perro en Tierra del Fuego, Argentina. Medicina (B. Aires). 2008;68:1-5 12. Hernndez D. Mordedura de perro: enfoque epidemiolgico de las lesiones causadas por mordedura de perro. Revista de Enfermedades Infecciosas de Pediatra. 2009;23(89):13-20. 13. Schvartzman S, Pacn M. Lesiones por mordedura de perros en nios. Arch Argent Pediatr. 2005;103(5):389-95. 14. lvez F. Infecciones por mordeduras y heridas punzantes. En: Asociacin Espaola de Pediatra. Protocolos Diagnstico Teraputicos de la AEP: Infectologa Peditrica. Madrid: AEP; 2008. p. 161-71. 15. Lpez R. Reemergencia de la rabia en el Per. Rev Peru Med Exp Salud Publica. 2007;24(1):3-4. Correspondencia: Nstor Falcn Prez Direccin: Av. Honorio Delgado 430, Lima 31, Per. Telfono: (511) 3190000 anexo 3001 / 996533579 Correo electrnico: nestor.falcon@upch.pe

Fuentes de financiamiento

Beca Estimulo Brbara Ann Kotowski De Tejada. Cdigo SIDISI N. 55930. Direccin Universitaria de Investigacin, Ciencia y Tecnologa Universidad Peruana Cayetano Heredia.

Conflictos de inters

Los autores declaran no tener conflictos de inters en la publicacin de este artculo.

642

Rev Peru Med Exp Salud Publica. 2011;28(4):643-47.

original breve

USO DE MEDICAMENTOS EN ADULTOS MAYORES NO INSTITUCIONALIZADOS


Martn Regueiro1,2,a, Nicols Mendy1,b, Martn Cas1,3,c, Hugo Osvaldo Farina1,d, Pablo Nagel1,e
RESUMEN El uso inadecuado de medicamentos en el adulto mayor representa un problema de salud pblica en constante progresin. Realizamos un estudio de utilizacin de medicamentos de tipo transversal, empleando una encuesta autoadministrada para evaluar el uso de medicamentos y la prescripcin inadecuada en adultos mayores ambulatorios de la ciudad de La Plata, Argentina, en 2009. El total de personas encuestadas fue de 215. El promedio de medicamentos usados por persona fue 3,19 2,02, la polimedicacin estuvo presente en 24,1 % de los sujetos. Recibieron medicamentos potencialmente inapropiados (MPI) el 25,5 %, 31,9 % y 30,0 % de los pacientes, segn los criterios Beers, lista PRISCUS, y criterios STOPP, respectivamente. Esta investigacin constat que la prescripcin potencialmente inapropiada es frecuente y que existe una necesidad creciente de contar con un listado de medicamentos potencialmente inapropiados, adecuada a cada realidad, que contemple aquellas situaciones donde el tratamiento es subptimo. Palabras clave: Adulto mayor; Prescripciones de medicamentos; Utilizacin de medicamentos (fuente: DeCS BIREME).

USE OF MEDICATION IN ELDERLY PEOPLE DONT INSTITUTIONALIZED


ABSTRACT Misuse of drugs in the elderly is a rampant public health problem. We conducted a cross-sectional study using a selfadministered survey to assess drug use and inadedequate prescription among noninstotunilazed elderly patients in the city of La Plata, Argentina in 2009. The total number of respondents was 215. The average number of drugs used per person was 3.19 2.02, polypharmacy was present in 24.1 % of subjects. Potentially inappropriate medications (MPI) were given in 25.5 %, 31.9 % and 30.0 % of the patients, according to Beers criteria, Priscus list, and STOPP criteria, respectively. This research found that potentially inappropriate prescribing is common and there is a growing need for a list of potentially inappropriate medications, as appropriate to each situation, that considers situations where treatment is suboptimal. Key words: Elderly; Drug prescriptions; Drug utilization (source: MeSH NLM).

INTRODUCCIN
El uso inadecuado de medicamentos en el adulto mayor representa un problema de salud pblica en constante progresin. La expectativa de vida y la dinmica de crecimiento poblacional hace que los adultos mayores constituyan un grupo con caractersticas independientes, con un aumento en el nmero de comorbilidades, medicamentos y, en la consulta, a mltiples prescriptores (1). El aumento del nmero de frmacos usados implica un potencial riesgo de reacciones adversas (2), condicionado por cambios asociados con el envejecimiento, ya sean farmacocinticos o farmacodinmicos.
1 2

Los medicamentos son la herramienta teraputica ms empleada para aliviar los sntomas, mejorar el estado funcional y la calidad de vida en el adulto mayor, y as la confianza depositada en ellos por pacientes y mdicos, est sobredimensionada. En este contexto surge la prescripcin inadecuada de frmacos. Se considera como polimedicacin al uso de cuatro o ms medicamentos. Sin embargo, esta definicin no considera si las enfermedades basales requieren o no medicacin, si la indicacin es adecuada o si tiene eficacia demostrada. Existen herramientas para evaluar la calidad de prescripcin en el adulto mayor, como los criterios de

Ctedra de Farmacologa Aplicada, Facultad de Ciencias Mdicas, Universidad Nacional de La Plata. Buenos Aires, Argentina. Servicio de Geriatra, Hospital Durand. Buenos Aires, Argentina. 3 rea de Farmacologa, Federacin Mdica de la Provincia de Buenos Aires. Buenos Aires, Argentina. a Mdico Internista y Geriatra; b Mdico Ginecologo; c Mdico, Mster en Farmacoepidemiologa; d Mdico Internista, Doctor en Medicina; e Mdico Cirujano

Recibido: 19-04-11

Aprobado: 12-10-11

643

Rev Peru Med Exp Salud Publica. 2011;28(4):643-47.

Regueiro M et al.

Beers. Estos fueron desarrollados en 1991 por Beers et al.; y modificados en 1997 y en 2003 (3). Incluye dos tablas, una de 48 grupos de medicamentos inapropiados independientemente del diagnstico y la otra considera 20 grupos de medicamentos inapropiados en determinados diagnsticos. Otra alternativa son los criterios STOPP-START asumido por la European Union Geriatric Medicine Society. Incluyen los criterios START (Screening Tool to Alert Doctors to the Right Treatment) y los criterios STOPP (Screening Tool of Older Persons Prescriptions), con 22 y 65 criterios respectivamente, recogiendo los errores ms comunes de tratamiento, incluyendo tambin la omisin de prescripcin (4). En 2010 se public la lista PRISCUS que consta de 83 medicamentos seleccionados del mercado alemn. Esta presenta como ventaja adicional la propuesta de medicacin alternativa ms segura para cada medicamento (5). Existen pocos estudios sobre el uso de medicamentos en adultos mayores en Argentina y se refieren a pacientes dentro de algn sistema de seguro social (6) o institucionalizados (7), en el cual se aplicaron los criterios de Beers. As, este trabajo busca describir las caractersticas asociadas a la prescripcin y aplicar diferentes criterios de prescripcin inadecuada en el adulto mayor no institucionalizado.

Tabla 1. Datos demogrficos de la poblacin encuestada.


Variable Edad Promedio (aos) Sexo Con cobertura por obra social Estudios Primario Secundario Terciario Universitario Total 71,5 128 27 46 31 37 Mujeres 70,9 101 93 19 31 27 24 Hombres 72,7 40 35 8 15 4 13

La estadstica descriptiva se realiz para datos cuantitativos y cualitativos demogrficos, de comorbilidades y de medicamentos. Se aplicaron los programas EpiInfo versin 3.5.1 y Statistix 8.0. HALLAZGOS El total de personas encuestadas fue 215, de ellas se excluyeron 74 encuestas correspondientes a personas menores de 65 aos, quedando finalmente 141 personas (Tabla 1). La media de edad fue 71,4 5,3 aos con un rango de 65 a 88 aos, 71,6 % de sexo femenino, 90,7 % con seguro social y 26,0 % con nivel de instruccin universitaria. Usaron 3,2 2,0 medicamentos por persona, en promedio 3,1 en mujeres y 3,5 en hombres. En la Figura 1 se observa que el uso de frmacos aumenta con la edad en las mujeres, mientras que disminuye en los hombres. En promedio, tuvieron 2,9 1,8 comorbilidades. Las enfermedades fueron, predominantemente, cardiovasculares, siendo hipertensin y cardiopata isqumica, las ms frecuentes. Los pacientes empleaban
Tendencia en mujeres 5 4 3 2 1 0 65 70 75 80 85 90 Tendencia en hombres Tendencia Total

EL ESTUDIO
Se realiz un estudio de uso de medicamentos, transversal y descriptivo. El estudio fue ejecutado en sujetos asistentes al Programa de Educacin Permanente de Adultos Mayores (PEPAM), dependiente de la Universidad Nacional de La Plata, Ciudad de La Plata, Provincia de Buenos Aires, Argentina. Se encuest a la totalidad de las personas que asistieron a la inscripcin de los cursos entre los das 23 y 27 de febrero de 2009. Se excluyeron personas menores de 65 aos y se consideraron solo aquellas encuestas que recopilaron datos de edad, sexo e informacin de medicamentos. La encuesta diseada para el estudio fue autoadministrada e incluy medicamentos empleados, comorbilidades, factores de riesgo cardiovascular, hbitos txicos y datos demogrficos. Para evaluar la prescripcin inadecuada se usaron los criterios de Beers de 2002 (3), la lista PRISCUS y los criterios STOPP.

Edad Figura 1. Edad frente a nmero de medicamentos en mujeres y en hombres.

644

Rev Peru Med Exp Salud Publica. 2011;28(4):643-47.

Uso de medicamentos en adultos mayores

25 20

Porcentaje

15 10

Un 61,4 % de las mujeres hipertensas estaba bajo tratamiento, siendo los medicamentos ms empleados losartn y enalapril en iguales proporciones. El 27,0 % consuma dos medicamentos y un 12,0 % se encontraba sin tratamiento. Los diabticos representaron el 8,5 %, donde el 73,0 % estaban tratados con hipoglucemiantes orales o insulina y el 9,1 % con antiagregacin. El 17,0 % de los pacientes tenan insuficiencia cardaca y, de ellos, el 29,2 % estaba en tratamiento con inhibidores de la convertasa de angiotensina (IECA) o antagonistas de los receptores de angiotensina II (ARA II). El 17,0 % de los encuestados referan insomnio, siendo un 91,7 % a mujeres. La mitad estaba en tratamiento y de ellos el 90 % utilizaba benzodiacepinas. El 8,5 % (IC 95 % 4,5-14,4) de la poblacin usaba multivitamnicos o suplementos nutricionales, el 21,0 % de una marca comercial. Un 10 % de los encuestados con depresin estaban con tratamiento, usaban benzodiacepinas en un 60 % y multivitamnicos en cerca de un 30 %. USO DE MEDICAMENTOS INAPROPIADOS POTENCIALMENTE

5 0

Figura 2. Porcentaje de medicamentos ms usados en adultos mayores no institucionalizados, Ciudad de La Plata, Argentina 2009.

119 frmacos, siendo la ms usada la aspirina, seguido por levotiroxina, enalapril, atenolol y losartn, como se ve en la Figura 2. USO DE MEDICAMENTOS DE LA POBLACIN EN ESTUDIO La polimedicacin estuvo presente en el 24,1 %, con un promedio de 3,2 medicamento por persona, como se ve en la Tabla 2. Los hipertensos representaron un 51,0 % de la poblacin, siendo ms prevalente entre los hombres (70,0 %). El 53,6 % de estos estaba tratado con un medicamento, siendo el ms usado el atenolol (39,3 %), seguido por enalapril y losartn. El 28,6 % empleba dos antihipertensivos y el 10,7 % ninguno. Del total, 96 pacientes tenan un riesgo 6 % a diez aos para desarrollar enfermedad cardiovascular, y 35,4 % reciba tratamiento de antiagregacin plaquetaria. Tabla 2. Comorbilidades, medicamentos y polimedicacin.
Mujeres N ( %) Comorbilidades y factores de riesgo Hipertensin arterial 44 (43,5) Arritmias 20 (19,8) Insuficiencia cardaca 16 (15,8) Hipotiroidismo 15 (14,8) Diabetes mellitus 6 (5,9) Tabaquismo 9 (8,9) Cardiopata isqumica 2 (1,9) Promedio de medicamento 3,1 por persona Polimedicacin ( %) 4 o ms medicamentos 24 (23,7) 5 o ms medicamentos 18 (17,8) 10 o ms medicamentos 2 (1,9) TOTAL 101 (100) Variable Hombres N ( %) 28 5 8 0 6 0 2 3,4 (70,0 (12,5) (20,0) 0 (15,0) 0 (5,0) N Total ( %) (51,0) (17,7) (17,0) (10,6) (8,5) (6,3) (2,8)

As pir Le in vo tiro a en xina ala ate pril no lo lol sim sarta n va alp stati raz na o clo na lam am zepa lod m ipi hid ca na roc lci o lor o vit tiazi am da am ina io D ato dar rva ona s ibu tatin pro a lor fen az o me epa tfo m r om min ep a raz ol

El uso de medicamentos que debieran ser evitados, por infectivos o tener un riesgo innecesariamente alto, segn los criterios de Beers, se observ en el 25,5 % (n=36). Los errores ms frecuentes fueron: utilizacin de benzodiacepinas en dosis altas (52,8 %) seguido por el uso inadecuado de antiarrtmicos (13,9 %), (Tabla 3). El 25,5 %(n=36) de la poblacin usaba benzodiacepinas crnicamente. La benzodiacepina ms utilizada fue clonazepam, seguido por alprazolam y lorazepam. Al aplicar la Lista PRISCUS, se identific el uso de medicamentos potencialmente inapropiados en 45 (31,9 %) personas. El evento ms frecuente fue el uso de alprazolam independiente de la dosis (33 % de estos errores); siendo usada en 12 (8,6 %) personas. Aplicando los criterios STOPP se encontraron 30 pacientes con errores de prescripcin, siendo los ms frecuentes: uso de inhibidores de la bomba de protones en lcera pptica durante ms de ocho semanas, bloqueantes clcicos en pacientes constipados, aspirina en dosis superiores a 150 mg/da, uso prolongado de AINE (mayor a tres meses) para dolor articular leve en artrosis y benzodiacepinas en pacientes propensos a cadas (una o ms cadas en los ltimos tres meses).

72 25 24 15 12 9 4 3,2

10 (25,0) 34 (24,1) 6 (15,0) 24 (17,0) 0 0 2 (1,4) 40 (100) 141 (100)

645

Rev Peru Med Exp Salud Publica. 2011;28(4):643-47.

Regueiro M et al.

Tabla 3. Medicamentos de uso potencialmente inapropiado.


Variable Errores segn Beers Independiente de diagnstico Dependiente de diagnstico Errores segn PRISCUS Errores segn STOPP-START STOPP START Total N 36 3 45 30 68 (%)* (25,5) ( 2,1) (31,9) (21,3) (48,2)

diabticos el porcentaje asciende al 90 %. Si bien la antiagregacin en prevencin primaria es controvertida, no ocurre lo mismo con la prevencin secundaria, donde existen beneficios bien establecidos. Solo el 28,6 % de los tratados con bifosfonatos por osteoporosis sealaron que reciban calcio, a pesar de ser una combinacin de primera lnea. La subpoblacin que consuma suplementos vitamnicos (10 %) reciba glucosaaminoglicanos con una frecuencia 21 veces mayor que el resto de la poblacin. El uso de levotiroxina en el 17,7 % de los pacientes (n=25) fue mucho mayor que la prevalencia de uso del 1,1 %, referida en el estudio de Brasil (8). Aunque solo 15 pacientes tenan antecedentes de hipotiroidismo, esta tendencia coincide con el uso de este medicamento en la Argentina (11). Los valores de MPI (25,5 %) segn los criterios de Beers, son superiores a los encontrados en estudios realizados en pacientes ambulatorios en USA (12) (10,6 %) o en Per en pacientes ambulatorios (12,4 %) (9). Sin embargo, coinciden con los observados en un metanlisis de once trabajos que evidenci el uso de MPI en un 21,3 % de ambulatorios y 40 % en residentes geritricos (13). En estudios que evaluaron los criterios STOPP-START se encontraron datos semejantes a nuestro estudio. En este trabajo los errores STOPP fueron de un 21,3 %, similar a lo descrito en Irlanda de 21,4 % (14) pero menor a lo que sealan en Espaa de 54 % (15) vinculable a caractersticas poblacionales diferentes. No se encontraron trabajos que aplicaran la lista PRISCUS en forma comparativa. Una debilidad del presente trabajo se ve en el alto nmero de pacientes que debieron ser excluidos por la edad o no tener sus datos completos; aunque esto no invalidara los resultados, s afectara su generalizacin. Tambin este tipo de encuesta tiene el riesgo de sesgo de memoria. Adems, la utilidad de las listas de medicamentos inapropiados en nuestro medio es controversial, pues posiblemente estn desactualizadas o muchos de los frmacos incluidos no son usados en Argentina. As, el 33,3 % de los frmacos de la lista de Beers y el 30,1 % de la Lista PRISCUS no se encuentra en el mercado argentino. Hay que tener en cuenta que estas dos listas solo coinciden en 28 principios activos y sumados tienen 94 diferencias. Deberan incluirse algunos medicamentos comercializados en Argentina pero no autorizados en EMEA o FDA pero s por ANMAT (agencia reguladora de medicamentos de Argentina); dentro de ellos se pueden mencionar la rosiglitazona, tioridazina y

* Representa el porcentaje de pacientes con errores de prescripcin sobre el total de 141 pacientes.

DISCUSIN
El presente trabajo constat un uso amplio de medicamentos en una poblacin adulta mayor con actividades avanzadas de la vida diaria conservadas. El nmero de frmacos utilizados fue alto considerando que la lista de medicamentos esenciales de la OMS para las enfermedades prevalentes incluye 315 (en 2003). Se utiliz en promedio 3,2 medicamentos/persona, cifra similar a otros trabajos de Amrica Latina, como en Brasil (2,8 medicamentos/paciente) (8) o en Per (3,2 medicamentos/ paciente) (9). Las mujeres utilizaban ms medicamentos, al igual que lo observado en un trabajo de metodologa y caractersticas demogrficas semejantes (10). Un tercio de la poblacin estudiada usaba cuatro o ms medicamentos. Al evaluar los que usaban ms medicamentos no se evidenci que aumentara de forma paralela con la edad, permaneciendo en el mismo promedio a pesar de lo esperado. El antihipertensivo ms prescrito en hombres fue el atenolol a pesar que para el tratamiento de la hipertensin en el anciano se recomiendan diurticos tiazdicos, IECA o bloqueantes clcicos. En estudios de Brasil, igual que en nuestra poblacin, los medicamentos ms usados fueron para enfermedades cardiovasculares los diurticos o los IECA (8). Los hipertensos no reciban tratamiento en un 11,1 % y los que sealaban tener insuficiencia cardaca no reciban un IECA en un 70,8 %. Un 27 % de los diabticos declaraba no recibir tratamiento a pesar de los evidentes beneficios de la teraputica. Un 70 % de los diabticos con insuficiencia cardaca no reciban tratamiento con IECA o ARA II. De la poblacin con indicaciones para antiagregacin, qued sin tratamiento un 65 % y en el subgrupo de

646

Rev Peru Med Exp Salud Publica. 2011;28(4):643-47.

Uso de medicamentos en adultos mayores

dextorpropoxifeno (aumento del riesgo cardiovascular). Otros medicamentos tambin riesgosos en el anciano incluyen: trimebutina (efectos antimuscarnicos); tacrina (riesgo de hepatotoxicidad); aminoglucsidos (riesgo de nefrotoxicidad y ototoxicidad). En conclusin, se observa un amplio uso de medicamentos potencialmente inapropiados, con las tres listas empleadas, comparables a los datos obtenidos en otros estudios. Las teraputicas orientadas hacia la prevencin primaria y secundaria fueron las que implicaron mayores riesgos de fallas en la prescripcin, incluyendo la falta de tratamiento oportuno cuando est indicado. Los criterios STOPP evidenciaron errores de prescripcin ms frecuentemente que las otras herramientas. Aun as, la aplicacin de estas listas hizo evidente la variacin de la oferta de medicamentos entre pases. Estos hechos expresan la necesidad de desarrollar un listado de medicamentos, que contemple la evaluacin de las causas jerarquizando aquellas situaciones donde el tratamiento es subptimo y que refleje a todos los MPI en cada pas o al menos en regiones con pases con mercados semejantes como podra ser Amrica Latina.

4. Gallagher P, Ryan C, Byrne S, Kennedy J, OMahony D. STOPP (Screening Tool of Older Persons Prescriptions) and START (Screening Tool to Alert doctors to Right Treatment). Consensus validation. Int J Clin Pharmacol Ther. 2008;46(2):72-83. 5. Holt H, Schmiedl S, Thrmann P. Potentially Inappropriate Medications in the Elderly: The PRISCUS List. Dtsch Arztebl Int. 2010;107:31-32. 6. Cervellino JC, Corazza SB, Bignone IM, Fligman MD, Figueroa S, Roldn R, et al. Transferring the financial risks of pharmaceutical benefits from a large health care provider in Argentina to a consortium of pharmaceutical companies. Rev Panam Salud Publica. 2003;13(4):203-13. 7. Marin GH, Cas M, Homar C, Ylarri E, Pena D, Trebucq H. Utilizacin de Medicamentos en Ancianos Institucionalizados en una Ciudad de la Provincia de Buenos Aires, Argentina. Lat Am J Pharm. 2010;29(4):495-503. 8. Flores VB, Benvegn LA. Perfil de utilizao de medicamentos em idosos da zona urbana de Santa Rosa, Rio Grande do Sul, Brasil. Cad Sade Pblica, 2008;24(6):1439-46. 9. Osconoa T. Uso inadecuado de medicamentos en adultos mayores. An Fac med. 2005;66(1):43-52. 10. Queiroz Ribeiro A, Rozenfeld S. Inqurito sobre uso de medicamentos por idosos aposentados, Belo Horizonte,MG. Rev Sade Pblica. 2008;42(4):724-32. 11. Higa VM, Correa Salde V, Ravetti S. Prescripcin y Dispensacin de Medicamentos para el Hipotiroidismo en la Ciudad de Crdoba, Argentina. Lat Am J Pharm. 2010;29(6):976-83. 12. Chin MH, Wang LC, Jin L, et al. Appropriateness of medication selection for older persons in an urban academic emergency department. Academic Emergency Medicine. 1999;6:1232-42. 13. Liu GG, Christensen DB. The continuing challenge of inappropriate prescribing in the elderly: an update of the evidence. J Am Pharm Assoc. 2002;42:847-57. 14. Ryan C, OMahony D, Kennedy J, Weedle P, Byrne S. Potentially inappropriate prescribing in an Irish elderly population in primary care. Br J Clin Pharmacol. 2009;68(6):936-94. 15. Montero Errasquin B, Sanchez Cuervo M, Sanchez Castellano M, Delgado Silveira E, Bermejo Vicedo T, CruzJentoft AJ. Inappropriate prescription in geriatric outpatients: A comparison of two instruments. J Nutr Health Aging. 2008;12:585.

Contribuciones de autora

MR, NM y MC participaron en la concepcin y diseo del estudio; MR, NM y PN contribuyeron en la recoleccin y obtencin de los resultados; el anlisis e interpretacin de los datos fue realizado por MR, MC y OHF; MR y MC participaron en la redaccin del manuscrito y aportaron material de estudio. Todos los autores revisaron en forma crtica las versiones preliminares del manuscrito y aprobaron la versin final del trabajo.

Conflictos de inters

Los autores declaran no tener conflicto de inters.

A cargo de los autores y de la Ctedra de Farmacologa Aplicada de la Facultad Ciencias Mdicas de Universidad Nacional de La Plata.

Fuentes de financiamiento

REFERENCIAS BIBLIOGRFICAS
1. Williams P, Rush DR. Geriatric polypharmacy. Hospital Practice. 1986; 21:109-120. 2. Routledge PA, OMahony MS, Woodhouse KW. Adverse drug reactions in elderly patients. Br J Clin Pharmacol. 2004;57(2):121-6. 3. Fick DM, Cooper JW, Wade WE, Waller JL, Maclean JR, Beers MH. Updating the Beers criteria for potentially inappropriate medication use in older adults: results of a US consensus panel of experts. Arch Intern Med 2003;163:2716-24. Correspondencia: Martn Regueiro Direccin: Italia 476- Cipolletti. Ro Negro, Argentina. Telfono: 54-0299-15464-2000 Fax: 54-221-4391-368 Correo electrnico: regueiromartin@gmail.com

647

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

revisin

MECANISMOS MOLECULARES DE RESISTENCIA ANTIBITICA EN Escherichia coli asociadas a diarrea


Susan Mosquito1,2,a, Joaquim Ruiz3,4,5,b, Jos Luis Bauer2,c, Theresa J. Ochoa1,6,7,d
Resumen La resistencia antibitica es un problema emergente a nivel mundial presente en diversas bacterias, en especial en la Escherichia coli, que tiene altos porcentajes de resistencia hacia ampicilina, trimetoprim-sulfametoxazol, tetraciclina, cloramfenicol y cido nalidxico, lo que supone grandes complicaciones en el tratamiento antibitico cuando este es requerido. Este aumento de resistencia antibitica se debe a la adquisicin de diferentes mecanismos moleculares de resistencia mediante mutaciones puntuales a nivel cromosmico o transferencia horizontal de material gentico entre especies relacionadas o diferentes, facilitada por algunos elementos genticos tales como los integrones. Esta revisin discute los efectos de los mecanismos moleculares de resistencia ms comunes en E.coli: inactivacin enzimtica, alteraciones en el sitio blanco y alteraciones de la permeabilidad. El conocer los mecanismos de resistencia implicados, como lo recomienda la Organizacin Mundial de la Salud, permitir optimizar la vigilancia de resistencia y las polticas de control y uso de antibiticos a nivel nacional. Palabras clave: Resistencia bacteriana a antibiticos; Agentes antibacterianos; Escherichia coli (fuente: DeCS BIREME).

MOLECULAR MECHANISMS OF ANTIBIOTIC RESISTANCE IN Escherichia coli- ASSOCIATED DIARRHEA


Abstract Antibiotic resistance is an emerging problem worldwide present in many bacteria, specially in Escherichia coli, which has high percentages of resistance to ampicilline, thrimethoprim-sulfamethoxazole, tetracycline, chloramphenicol and nalidixic acid, which implies important complications in antibiotic treatment when required. The increasing antibiotic resistance is due to the acquisition of different molecular mechanisms of resistance through point chromosomal mutations and /or horizontal transfer of genetic material between related or different species facilitated by some genetic elements such as integrons. This review discusses the effects of the most common molecular mechanisms of antibiotic resistance in E. coli: enzymatic inactivation, changes in the target site and permeability disturbances. Getting to know the mechanisms of resistance which are involved, as the World Health Organization recommends, will allow us to improve the surveillance of the antibiotic resistance, the control policies and the antibiotic utilization at a national level. Key words: Drug resistance, bacterial; Anti-bacterial agents; Escherichia coli (source: MeSH NLM).

Introduccin
La resistencia antibitica es un fenmeno biolgico natural debido a las mutaciones y a la gran capacidad de las bacterias de transferir horizontalmente su material gentico, existiendo una clara correlacin entre el uso de antibiticos y la resistencia bacteriana (1). Se constituye as en un problema a nivel mundial que supone mayor
1 2 3 4 5 6 7 a

sufrimiento humano, prdida en la productividad y mortalidad. La relacin antibitico-bacteria se ve alterada por otros mltiples factores como la farmacocintica de la droga, la dosis, la duracin del tratamiento, el tamao de inculo bacteriano, etc., por lo que para optimizar el uso de estos frmacos, se realizan supervisiones peridicas de la resistencia como parte transcendental de la poltica de control de la resistencia antibitica (1,2).

Instituto de Medicina Tropical Alexander von Humbold, Universidad Peruana Cayetano Heredia. Lima, Per. Facultad de Ciencias y Filosofa Alberto Cazorla Talleri, Universidad Peruana Cayetano Heredia. Lima, Per. Centre de Recerca en Salut Internacional de Barcelona, Hospital Clinic, Universitat de Barcelona. Barcelona, Espaa. Institut dinvestigacions Biomdiques August Pi i Sunyer. Barcelona, Espaa. Centro de Investigacin Biomdica en Red de Epidemiologa y Salud Pblica. Barcelona, Espaa. School of Public Health, University of Texas. Texas, EE.UU. Facultad de Medicina Alberto Hurtado, Universidad Peruana Cayetano Heredia. Lima, Per. Biloga, MSc. en Microbiologa; b Bilogo, PhD en Biologa; c Microbilogo, PhD en Ciencias con mencin en Microbiologa; Infectlogo

Mdico, Pediatra

Recibido: 13-07-11

Aprobado: 09-11-11

648

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Resistencia antibitica en E.coli

Segn la OMS (Organizacin Mundial de la Salud), existen principalmente dos mtodos de supervisin de resistencia: in vivo (fracasos teraputicos) o in vitro (estudios en el laboratorio, en tubos de ensayo). Dentro de los mtodos in vitro, estn los fenotpicos (Kirby-Bauer o concentracin mnima inhibitoria) y los moleculares cuando se hacen pruebas genticas. La vigilancia molecular, se basa en la identificacin de genes que codifican los mecanismos de resistencia en las bacterias y que representan el futuro de la vigilancia de resistencia antibitica. Estos genes surgen ante el uso de un antibitico especfico, sin embargo, pueden generar tambin resistencia cruzada, afectando otros antibiticos de la misma clase o con el mismo mecanismo de accin, incluso a compuestos de familias diferentes (1). Asimismo, en numerosas ocasiones genes de resistencia a diferentes antimicrobianos se encuentran asociados en una misma estructura gentica (integrones) (3), lo que da lugar al fenmeno de coseleccin de resistencia (mantenimiento en la bacteria de genes capaces de conferir resistencia a un antimicrobiano, mediante el uso de un agente antimicrobiano no emparentado). De esta manera conocer el bagaje de genes de resistencia contribuye a tomar mejores polticas de uso antibitico que intenten controlar la diseminacin de estos genes. En el Per, la vigilancia de resistencia se realiza de manera in vitro mediante mtodos fenotpicos, donde se determina la sensibilidad o resistencia antibitica, siendo muy pocos los estudios de investigacin realizados para la bsqueda de genes de resistencia antibitica y aun menos los dirigidos hacia enteropatgenos especficamente. Dentro de los pocos estudios realizados en el pas, se muestra por ejemplo la diseminacin de las beta-lactamasas de espectro extendido (BLEE) tipo CTX-M en Escherichia coli aisladas de nios sanos menores de cuatro aos (4). Para la mayora de episodios diarreicos asociados con las E. coli diarrognicas, no es recomendado el tratamiento antibitico debido a que el uso excesivo de antibiticos est relacionado con el aumento de resistencia y, en el caso especfico de la E. coli O157 relacionado con el desarrollo del sndrome urmico-hemoltico (SUH) (5). Sin embargo, en casos especficos como la diarrea del viajero causada por E. coli enterotoxignica (ECET), su uso es recomendado (6). Por otro lado, el estudio de los mecanismos moleculares de resistencia en E. coli comensales, propias de la flora intestinal, es importante debido a que estas bacterias estaran actuando como reservorio de los genes de resistencia antibitica distribuidos en la comunidad (7) siendo un reflejo de la exposicin comunitaria a los antibiticos.

Dada la creciente resistencia antibitica en E. coli y su impacto actual a nivel mundial, as como el creciente nmero de publicaciones sobre resistencia antibitica a nivel nacional, consideramos de importancia revisar los principales mecanismos moleculares de resistencia en las E. coli con la finalidad de proporcionar a los microbilogos, bilogos, mdicos, epidemilogos y dems personas del rea biomdica, informacin actualizada y resumida sobre estos mecanismos para poder as conocer e interpretar mejor este problema en la literatura mdica.

Mecanismos moleculares de resistencia A antibiticos


El fenotipo de resistencia antibitica es perceptible gracias a la presencia de uno o ms mecanismos moleculares de resistencia antibitica en la bacteria. Dentro de los tipos de mecanismos moleculares de resistencia destacan por su relevancia: inactivacin enzimtica, alteraciones en el sitio blanco y alteraciones de la permeabilidad (8). Las enterobacterias a nivel mundial presentan alta resistencia hacia ampicilina (beta-lactmico), trimetoprim-sulfametoxazol, tetraciclina, cloramfenicol y cido nalidxico por lo que se debe determinar la prevalencia de los diferentes genes relacionados a nivel molecular, como se ve en la Tabla 1. ANTIBITICOS BETA-LACTMICOS La ampicilina es un beta-lactmico de espectro moderado, cuyo mecanismo de accin se da al interferir en las ltimas fases de la sntesis del peptidoglicano, componente necesario en la formacin de la pared bacteriana. Uno de los principales mecanismos de resistencia hacia beta-lactmicos es la hidrlisis enzimtica, que es debida a la presencia de enzimas llamadas beta-lactamasas que se caracterizan por hidrolizar el enlace amida del ncleo beta-lactmico, inactivando de esta manera el antibitico antes de que genere cualquier efecto. Estas enzimas constituyen una amplia familia que segn la clasificacin de Bush 2010 (9), se dividen en los grupos 1, 2 y 3, que a su vez estn divididos en 16 subgrupos. El nmero de betalactamasas actualmente descrito es sumamente elevado, incrementndose de manera continua (10). Dentro de las ms de 890 beta-lactamasas que actualmente se han caracterizado, las familias ms comunes dentro de las enterobacterias son: blaTEM, blaSHV, blaOXA-1 y blaCARB. Las dos primeras pertenecientes al grupo 2b, es decir son penicilasas, inhibidas por el cido clavulnico y que en algunos casos tambin tienen

649

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Mosquito S et al.

Tabla 1. Principales mecanismos de resistencia antibitica estudiados en E. coli


Familia de antibiticos Mecanismo de accin Interfiere en las ltimas fases de la sntesis del peptidoglicano, componente necesario en la formacin de la pared bacteriana Mecanismos de resistencia Genes implicados

Betalactmicos

Betalactamasas: enzimas que se caracterizan por hidrolizar Genes que codifican betalactamasas: blaTEM, el enlace amida del ncleo blaSHV, blaCARB, blaOXA, blaCTX-M y blaGES. betalactmico, inactivando de esta manera el antibitico

Quinolonas

Mutaciones puntuales que Mutaciones a nivel de gyrA (gen que codifica una generan el cambio de aminosubunidad de la ADN girasa) y parC (gen que cidos en la enzima blanco del codifica una subunidad de la topoisomerasa IV). antibitico AcrAB-like (sistemas presente en diferentes Inhibe la accin de las Sistemas de expulsin enterobacterias) topoisomerasas y de la ADN Familia de genes qnr (A, B, C, D S) que codifican girasa bacterianas protenas Qnr que impiden estericamente la Presencia de genes plasmdi- unin del antibitico al blanco. cos de resistencia antibitica Gen que codifica la variante cr de la acetiltransferasa 6 (AAC (6)-Ib-cr), capaz de acetilar fluoroquinolonas Se unen al ribosoma Presencia de bombas de eflujo Genes tetA y tetB que codifican sistemas de bacteriano, inhibiendo la especficas para tetraciclinas eflujo sntesis de de protenas Inactivacin enzimtica por Gen cat que codifica a la enzima cloramfenicol Inhibidor de la biosntesis acetilacin acetiltranferasa de las protenas, previene la elongacin de la cadena de pptidos al unirse al centro Exportadores especficos de Genes floR y cmlA de la peptidiltranferasa del cloramfenicol ribosoma 70S

Tetraciclinas Cloramfenicol

Inhibe la sntesis de la enzima dihidropteroato sintasa (sulfametoxazol) y de la en- Presencia de genes que Trimetoprim Genes sul1 y sul2 (sulfametoxazol) y genes dfr zima dihidrofolato reductasa codifican formas mutantes de -Sulfametoxazol (trimetoprim) (trimetoprim), las cuales son la enzima blanco enzimas necesarias en la ruta del cido flico.

accin contra cefalosporinas de tercera generacin. En el caso de blaOXA-1, pertenece al grupo 2d donde estn las penicilasas que se caracterizan por la hidrlisis de cloxacilina (oxacilina); por su parte blaCARB pertenece al grupo 2c, el cual se caracteriza por tener penicilasas con accin hidroltica contra carbenicilina (9). La clasificacin de las betalactamasas se resume en la Tabla 2. En los ltimos aos se ha descrito la creciente importancia clnica en enterobacterias de la familia CTX-M (11), un grupo de betalactamasas de espectro extendido que afecta la actividad de cefalosporinas de tercera y cuarta generacin. Un ejemplo de la emergencia de estas betalactamasas CTX-M es un estudio realizado en 32 cepas de E. coli BLEE resistentes a cefalosporinas aisladas de pacientes peditricos hospitalizados en Tnez, se inform una frecuencia del 97 % de blaCTX-M-15 (12).

Otro grupo de betalactamasas descritas por primera vez en Pseudomonas aeruginosa y descritas actualmente en E. coli son las blaGES (13) que se caracterizan por hidrolizar a la ceftazidima (14). En el caso de E. coli esta enzima ha sido relacionada con el integrn clase 3, clase menos frecuente respecto a la clase 1 y la clase 2 (13). Un estudio en Suecia en E. coli comensales resistentes a ampicilina aisladas de 128 nios menores de un ao, muestran que blaTEM (27/32) es predominante sobre blaSHV (5/32) y blaOXA (1/32) (15). En el caso de las E.coli diarrognicas los estudios de beta-lactamasas son escasos, sin embargo, un estudio realizado en Uruguay determin la presencia de la beta-lactamasa TEM-116, identificada como una beta-lactamasa de espectro extendido en trece cepas de E. coli Enteropatgena (16). Otro estudio reciente (17) en cepas

650

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Resistencia antibitica en E.coli

Tabla 2. Clasificacin de las betalactamasas.


Clase Grupo Bushmolecular Jacoby (2009) (subclase) 1 1e 2a 2b C C A A Substratos preferidos Cefalosporinas Cefalosporinas Penicilinas Penicilinas, cefalosporinas Cefalosporinas de espectro extendido y monobactmicos Penicilinas Cefalosporinas de espectro extendido y monobactmicos Carbenicilinas Carbenicilinas, cefepime Cloxacilina Cefalosporinas de espectro extendido Carbapenems Cefalosporinas de espectro extendido Carbapenems Inhibidos por: AC1 No No S S EDTA No No No No Mejor hidrlisis de cefalosporinas que de benzylpenicilina Hidrlisis incrementada hacia cefatazidima y otros oximinobeta-lactmicos Mejor hidrlisis de benzilpenicilina que de cefalosporinas Hidrlisis similar de bencilpenicilinas y de cefalosporinas Hidrlisis incrementada hacia cefatazidima y otros oximinobeta-lactmicos (cefotaxima, ceftazidima, ceftriaxona, cefepime) Resistencia a cido clavulnico, sulfabactam y tazobactam Hidrlisis incrementada hacia oximino-beta-lactmicos combinados con resistencia a AC, sulfabactam y tazobactam Hidrlisis incrementada de la carbenicilina Hidrlisis incrementada de la carbenicilina, cefepime y cefpirome Hidrlisis incrementada de la cloxacilina o de la oxacilina Hidrlisis de cloxacilina o oxacilina y oximino-beta-lactmicos Hidrlisis de cloxacilina o oxacilina y carbapenems Hidrlisis de cefalosporinas. Inhibido por cido clavulnico pero no por aztreonam Hidrlisis incrementada de carbapenems, oximino-beta-lactmicos, cefamicinas Hidrlisis de espectro extendido incluyendo carbapenems pero no monobactams Hidrlisis preferente de carbapenems Principales Caractersticas Enzimas representativas AmpC, P99, ACT-1, CYM-2, FOX-1, MIR-1. GC1, CMY-37 PC1 TEM-1, TEM-2, SHV-1

2be

No

TEM-3, SHV-2, CTX-M-15, PER-1, VEB-1 TEM-30, SHV-10 TEM-50 PSE-1, CARB-3 RTG-4 OXA-1, OXA-10 OXA-11, OXA-15 OXA-23, OXA-48 CepA KPC-2, IMI-1, SME-1 IMP-1, VIM-1, CrA, IND-1 L1, CAU-1, GOB-1, FEZ-1 CphA, Sfh-1

2br 2ber 2c 2ce 2d 2de 2df 2e 2f

A A A A D D D A A

No No S S Variable Variable Variable S Variable No

No No No No No No No No No

3a

B (B1) B (B3)

Carbapenems

3b

B (B2)

Carbapenems

No

Adaptado de : Bush y Jacoby; 2010 (8). 1 AC: cido clavulnico

de E. coli peruanas aisladas de nios menores de dos aos confirma que blaTEM es predominante en la poblacin (30,5 %), respecto al resto de las betalactamasas estudiadas: blaSHV (4,5 %), blaCARB (1,9 %) y blaOXA (5,8 %). ANTIBITICOS QUINOLONAS El mecanismo de accin de las quinolonas es la inhibicin de la accin de las topoisomerasas tipo II (ADN girasa y topoisomerasa IV). En bacterias

Gram-negativas la ADN girasa, es el blanco principal mientras que la topoisomerasa IV actuara como diana secundaria. La ADN girasa es una enzima compuesta por cuatro subunidades dos tipo A y dos tipo B codificadas por gyrA y gyrB respectivamente, y que es la encargada de catalizar el superenrrollamiento negativo del ADN. En el caso de la topoisomerasa IV, blanco principal en el caso de las Gram positivas, se trata tambin de una enzima con cuatro subunidades codificadas por parC y parE, homlogas a gyrA y gyrB respectivamente.

651

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Mosquito S et al.

Entre los mecanismos moleculares de resistencia a estos antibiticos se encuentran las alteraciones en los blancos de quinolonas, las bombas de expulsin activa y la transferencia de genes de resistencia plasmdicos (18). El mecanismo mayormente descrito es el primero, donde mediante una mutacin puntual, hay un cambio en el codn 83 y se codifica otro aminocido de manera que se modifica la enzima blanco, con lo que se logra una alta resistencia a quinolonas como el cido nalidxico. La alta resistencia hacia fluoroquinolonas, tales como la ciprofloxacina, se relaciona con ms de una mutacin a nivel de gyrA (normalmente adems de la posicin 83 se afecta la posicin 87) o con mutaciones adems en gyrA a nivel de otros genes como parC (codones 80 o 84 de manera usual). A lo largo de los aos se han informado las posiciones en donde ocurren las mutaciones y los cambios de aminocidos que conlleva cada mutacin (18), que estn resumidas en la Tabla 3. En un estudio reciente de E. coli aisladas de heces de pacientes hospitalizados en EE.UU., 353 cepas mostraron sensibilidad disminuida hacia fluoroquinolonas, teniendo el 85 % una o ms mutaciones a nivel de gyrA y 46 % una o ms mutaciones a nivel de parC (19). Otro tipo de mecanismos de resistencia a quinolonas es el relacionado con la transferencia de genes mediante plsmidos, como es el caso de los genes qnr que codifican a la familia de las protenas Qnr (QnrA, QnrB, QnrS, QnrC y QnrD) que se unen a la ADN girasa (gyrA y gyrB) y a la topoisomerasa IV (parC y parE) disminuyendo la accin de las quinolonas. El aumento de la resistencia a esta familia de antibiticos se puede relacionar con Tabla 3. Mutaciones descritas en las subunidades GyrA y GyrB en cepas quinolona resistentes en E.coli.
Codn1/Gen gyrA 512 672 81 822 83 84 87 1062 gyrB 426 447 parC 78 80 84 parE 445 Aminocido silvestre Ala Ala Gly Asp Ser Ala Asp Gln Asp Lys Gly Ser Glu Leu
(18)

el aumento de CIM (concentracin mnima inhibitoria) hacia diferentes quinolonas en E.coli, por lo que se habla de una susceptibilidad disminuida. Dado que en los ltimos aos se han descrito numeroso genes qnr, se ha efectuado una propuesta de nomenclatura (20) y se ha dispuesto una pgina web para recoger aquellos genes descritos hasta la fecha y los que surjan en un futuro (21). La resistencia a fluoroquinolonas, especficamente a ciprofloxacino y norfloxacino, se ha relacionado con la variante cr de la acetiltransferasa 6 (AAC (6)-Ibcr), que debido a la presencia de dos cambios de aminocidos en los codones 102 y 179, es capaz de acetilar no solo aminoglcosidos (AAC (6)-Ib), sino tambin algunas fluoroquinolonas (22). La diseminacin de esta acetiltranferasa ha sido descrita en cepas de E. coli aisladas de heces de pacientes hospitalizados en Uruguay (23) y en cepas de E. coli comensales aisladas de nios menores de cuatro aos en Per y Bolivia (7). Clsicamente, el rol de las bombas de expulsin ha sido considerado como accesorio y, en general, de baja relevancia, no obstante, se ha comprobado que, para el caso de cido nalidxico las bombas de expulsin s cumplen una funcin importante en el nivel basal de resistencia a este antimicrobiano (24). Un ejemplo de este tipo de mecanismo descrito en Escherichia coli (25) es el gen QepA, que codifica una bomba de expulsin para fluoroquinolonas hidroflicas tales como norfloxacino, ciprofloxacino y enrofloxacino (23). Este gen ha sido descrito en cepas E. coli BLEE de Mxico en una frecuencia de 1,7 % (26). ANTIBITICOS TETRACICLINAS Las tetraciclinas son una familia de antibiticos cuyo mecanismo de accin es unirse a la parte 16S, de la subunidad 30S del ribosoma bacteriano, de manera que se inhibe la sntesis de protenas al evitar la unin del aminoacil-tRNA en la posicin A del ribosoma (27). La tetraciclina se ha utilizado durante dcadas no solo en el tratamiento a humanos sino tambin en el tratamiento veterinario y como factor de crecimiento en aves (28). El mecanismo de resistencia ms comn hacia este antibitico es mediante sistemas de eflujo, los que Gram negativos son codificados por los genes tetA, tetB, tetC, tetD, tetE, tetI y tetY, todos ellos previamente informados en E. coli. Sin embargo, existen otros mecanismos de resistencia como proteccin ribosomal y accin enzimtica sobre las tetraciclinas codificados por diferentes genes (27,29), que estn mostrados en la Tabla 4. Un estudio llevado a cabo en cepas de E. coli comensales aisladas de infantes (Suecia), muestra que tetB y tetA fueron los genes de resistencia a tetraciclinas

Mutaciones descritas Val Ser Cys, Asp Gly Leu, Trp, Ala, Val Pro, Val Asn, Gly, Val, Tyr, His Arg, His Asn Glu Asp Ile, Arg Lys, Val, Gly His

Adaptado de: Ruiz J. 2003 . 1 Las mutaciones en otros codones, como en el codn 93 han sido descritas, pero su papel en el desarrollo de resistencia no est claro. 2 Solo descritas en mutantes in vitro

652

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Resistencia antibitica en E.coli

Tabla 4. Genes que codifican los diferentes mecanismos de resistencia a las tetraciclinas.
Genes/ mecanismo de resistencia antibitica Bombas de eflujo tet (A), tet (B), tet (C), tet (D), tet (E), tet (G), tet (H), tet (I), tet (J), tet (Z),tet (K), tet (L), tet (V), tet (Y) tet (30)1, tet (31)1 otr (B)2, tcr32 tetP (A)3 Proteccin ribosomal tet (M), tet (O), tet (S), tet (W), tet (Q), tet (T) otr (A) tetP (B)3, te2 Modificacin enzimtica tet (X) Mecanismos no descritos tet (U), otr (C)
Adaptado de: Chopra 2001 (27). Primeros genes con nomenclatura de nmeros (29). 2 Genes que segn la nomenclatura de Levy no cambiaron de nombre. 3 Genes que siempre se encuentran juntos, por lo que se cuentan como un solo gen.
1

de exportadores especficos para cloramfenicol y florfenicol (su derivado), relacionados con genes como cmlA y floR (30); descritos en la Tabla 5. En el caso de bacterias enteropatognicas, en un estudio realizado en Mozambique en Shigella (n= 57) y Salmonella (n= 6) se determin que los mecanismos de resistencia a cloramfenicol se relacionaron con la presencia de CAT (89 y 67 %), cmlA (2 y 33 %) y floR (0 y 83 %) respectivamente (31). En general, el informe de los genes de resistencia a cloramfenicol relacionados con exportadores especficos cmlA y floR, es poco frecuente en relacin al informe de cat. El gen floR se ha descrito en cepas de E. coli O26 provenientes de animales (32), sin embargo otros estudios donde se ha buscado este gen en STEC de origen humano y animal, no se han descrito (33). En el caso de Per, el estudio de Mosquito et al., mostr que el gen cat es el mecanismo ms frecuente en los tres grupos: cepas diarreognicas de E coli (DEC) causantes de diarrea, DEC control y comensales. Mientras que floR (30 %) y cmlA (10 %) estuvieron mayormente presentes en el grupo comensal (17). TRIMETROPIM SULFAMETOXAZOL Desde 1935, las sulfonamidas han sido extensamente usadas en medicina humana y veterinaria, lo que gener rpidamente una alta resistencia antibitica, por ello se empez a utilizar de manera combinada con diaminopirimidinas como es el caso del trimetropim. El Tabla 5. Mecanismos de resistencia a cloramfenicol descritos en E. coli.
Grupo Gen Plsmido/ transposon/ cromosoma Tn9, R429 pSa pNR79: Tn2424 pHSH2 N. acceso en base de datos

ms prevalentes, 51 y 49 % respectivamente en un total de 37 cepas (28). Lo cual es importante debido a que las tetraciclinas no se utilizan en nios, sin embargo, estos genes fueron aislados de bacterias de la flora intestinal que estn sirviendo de reservorio de resistencia antibitica. En el estudio de Mosquito et al. (17), en un total de 106 cepas de E. coli peruanas tetraciclina resistentes se observ que tetA estuvo presente en el 26,4 % de las cepas, mientras que tetB estuvo presente en el 17,9 % de las cepas. ANTIBITICO CLORAMFENICOL El cloramfenicol es utilizado en el tratamiento de humanos y animales, al ser un antimicrobiano de amplio espectro con accin sobre bacterias Gram positivas, bacterias Gram negativas, clamidias, micoplasmas y Rickettsias. Su mecanismo de accin es un fuerte y especfico inhibidor de la biosntesis de las protenas, al prevenir la elongacin de la cadena de pptidos unindose de manera reversible al centro de la peptidiltranferasa del ribosoma 70S (30). Dentro de los mecanismos de resistencia a cloramfenicol, el ms frecuente es el de la inactivacin enzimtica por acetilacin mediante los diferentes tipos cloramfenicol acetiltransferasas (CAT) descritos. Estas CAT se dividen en dos tipos: tipo A y tipo B por sus diferencias en sus secuencias de aminocidos. Adems la resistencia a cloramfenicol puede estar mediada por sistemas

Cloramfenicol transferasas (CAT) tipo A A-1 A-2 B-2 B-3 catI catII catB2 catB3 V00622 X53796 AF047479 AY259086

Cloramfenicol transferasas (CAT) tipo B

Exportadores especficos para cloramfenicol/florfenicol E-1 E-2 E-3 cmlA5 cml Flo floR
1

R751 (Tn2000) R26 Plasmid


1

AF205943 M22614 AF252855 AF231986 AJ518835

Plasmid1 pMBSF1
(30)

floR

Adaptado de: Schwarz 2004 . No est disponible el nombre del plsmido

653

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Mosquito S et al.

mecanismo de accin de las sulfonamidas es inhibiendo la sntesis de la dihidropteroato sintasa enzima clave en la ruta del cido flico. Mientras que en el caso del trimetropim este acta inhibiendo la enzima dihidrofolato reductasa (dfr), otra enzima importante en la sntesis de cido flico (34,35). Los mecanismos de resistencia a sulfonamidas y a trimetropim mayormente descritos son los relacionados con la adquisicin de genes mutantes mediante elementos mviles. En el caso del sulfonamidas se han descrito los genes sul1, sul2 y sul3 relacionados con integrones y que codifican formas mutantes de la enzima dihidropteroato sintasa que no pueden ser inhibidas por el antibitico. Lo mismo sucede en el caso del trimetropim, se han descritos mltiples genes dfr que generan resistencia antibitica (34,35,36). En un estudio realizado en Australia, donde se aislaron E coli comensales a partir de muestras de heces de adultos sanos se determin la presencia de los genes sul1, sul2 y sul3; as como de dfrA1, dfrA5, dfrA7, dfrA12 y dfrA17, estos genes de resistencia principalmente relacionados con integrones tipo 1 y 2 (37). En nuestro pas, en un estudio con cepas de E coli aisladas de nios, las DEC-diarrea presentaron mayor resistencia a trimetropim-sulfametoxazol (SXT) (79 %) respecto a las DEC- control (65 %) y a las comensales (60 %) (p<0,05). En cuanto a mecanismos de resistencia, los genes sul1 (41 %) y dfrA1 (48 %), relacionados con trimetropimsulfametoxazol, fueron ms frecuentes en el grupo DEC-diarrea respecto a los otros grupos (p<0,05) (17). INTEGRONES Los integrones son piezas genticas capaces de captar genes que codifican determinantes de resistencia antibitica u otras funciones. Los integrones estn compuestos por tres elementos necesarios para la insercin y expresin de genes exgenos: un fragmento que codifica una integrasa (intI), una secuencia attI a la que se unen los genes en casetes que codifican diferentes mecanismos de resistencia y dentro de la intI, en el extremo 3, una secuencia promotora (Pc) a partir de la cual se transcriben los casetes de resistencia integrados (3,38), que se puede apreciar en la Figura 1. Existen dos tipos de integrones: el grupo I o tambin llamado integrones mviles relacionados con los casetes de resistencia antibitica y el grupo II o superintegrones presentes, a diferencia de los primeros, a nivel cromosmico y no relacionados con la resistencia antibitica salvo algunas excepciones. El grupo I, de nuestro inters, a su vez se divide en tres clases: integrones clase 1, clase 2 y clase 3
intl

Regin Variable Pc P2 attl Pint qacE1 Sul1

Figura 1. Los integrones estn compuestos por tres elementos necesarios para la insercin y la expresin de genes exgenos: el fragmento que codifica una integrasa (intI) y su promotor (Pint); la secuencia attI; y dentro de la intI, en el extremo 3, una o ms secuencias promotoras (Pc, P2).

respectivamente, diferenciados debido a las variaciones en sus secuencias de integrasas. Entre estos tipos de integrones, el ms frecuentemente descrito es el integrn I (Int1), relacionado con resistencia antibitica en Gram negativos y que a la fecha tiene ms de 100 diferentes arreglos de casetes de resistencia informados (3). El gen de la de la integrasa (Int1) se caracteriza por tener una estructura tpica constituida por: una regin conservada en el extremo 5 donde se ubican intI y attI, una seccin media donde se insertan al azar los genes en casete y un extremo 3 caracterizado por la presencia de qacED1, gen que codifica una protena transportadora relacionada con la resistencia a sales de amonio cuaternario y por la presencia de sul1, gen anteriormente descrito relacionado con la resistencia a sulfonamidas. Sin embargo, se han descrito Int1 atpicos donde no hay sul1. En cuanto al nmero de genes de resistencia en la regin variable, lo habitual es entre tres y cuatro, pero lo mximo encontrado han sido nueve genes de resistencia (39). Debido a la relacin directa entre la presencia de integrones y los genes de resistencia hacia diferentes familias antibiticas, durante los ltimos aos numerosos estudios en enterobacterias han informado su prevalencia. En el caso de E coli comensales, se describi la multidrogorresistencia en siete cepas, cinco de ellas presentaban integrn tipo 1 (37). En el Per, la presencia de integrones clase 1 clsicos, se describi en nueve de veinte cepas SXT resistentes aisladas a partir de heces de nios sanos (34). En el caso de E.coli diarrognicas, un estudio realizado en Senegal donde se buscaron los tres tipos de

654

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Resistencia antibitica en E.coli

integrones en EIEC (n=10) y EAEC (n=25), se determin la presencia de integrn 1 en 4 EIEC y 15 EAEC, estas cepas en todos los casos menos uno fueron resistentes a cinco o ms familias diferentes de antibiticos, ante esta alta resistencia antibitica, los posibles tratamientos antibiticos se limitaban a cefalosporinas de tercera generacin y a fluoroquinolonas (40). En el estudio peruano de mecanismos de resistencia en 154 cepas de E coli, se encontr que la integrasa ms comn fue integrasa 1 (9,1 %) respecto a integrasa 2 (6,4 %) (17).

Conflictos de inters

Los autores declaran no tener conflictos de inters.

Fuentes de financiamiento

Este trabajo fue financiado por la Agencia Espaola de Cooperacin Internacional (AECID), Espaa, Proyecto: Mejora en la Infraestructura de la UPCH (Lima, Per) para la realizacin de Estudios Integrales (Sociales y Moleculares) relacionados con las Enfermedades Diarreicas (D/019499/08 y D/024648/09).

Conclusiones
Los mecanismos de resistencia antibitica en E. coli hacia ampicilina, trimetropim-sulfametoxazol, tetraciclina, cloramfenicol y cido nalidxico son mltiples y son continuamente descritos. Estos mecanismos se adquieren mediante mutaciones puntuales a nivel cromosmico o transferencia horizontal de material gentico entre especies relacionadas o diferentes facilitada por algunos elementos mviles tales como los integrones. Esta transferencia horizontal permite que los mecanismos se trasladen entre diferentes enteropatgenos y que se diseminen rpidamente a nivel mundial. Para cada familia de antibiticos existe ms de un mecanismo de resistencia antibitica descrito, como en el caso de la quinolonas que presentan mutaciones cromosmicas, protenas que impiden la unin del antibitico y las recientemente descritas bombas de eflujo especficas. En general, los tipos de mecanismos moleculares de resistencia ms comunes se encuentran: inactivacin enzimtica, alteraciones en el sitio blanco y alteraciones de la permeabilidad. El control molecular de la resistencia antibitica es parte transcendental de la poltica de control de la vigilancia antibitica como lo recomienda la OMS. Este mecanismo representa el futuro de la vigilancia de resistencia, debido a que si bien los mecanismos de resistencia surgen ante el uso de un antibitico especfico, generan tambin resistencia cruzada hacia otros antibiticos de la misma clase o con el mismo mecanismo de accin y e incluso a compuestos de familias diferentes. Por lo que son pieza clave para las polticas de control y uso de antibiticos a nivel nacional.

Referencias BIBLIOGRFICAS
1. Estrategia mundial de la OMS para contener la resistencia a los antimicrobianos. Rev Panam Salud Publica. 2001;10:284-93. 2. Andersson DI, Hughes D. Antibiotic resistance and its cost: is it possible to reverse resistance?. Nat Rev Microbiol. 2010,8(4):260-71. 3. Di Conza JA, Gutkind GO. Integrons: gene collectors. Rev Argent Microbiol. 2010;42:63-78. 4. Pallecchi L, Malossi M, Mantella A, Gotuzzo E, Trigoso C, Bartoloni A, et al. Detection of CTX-M-type betalactamase genes in fecal Escherichia coli isolates from healthy children in Bolivia and Peru. Antimicrob Agents Chemother. 2004;48:4556-61. 5. Smith KE, Wilker PR, Reiter PL, Hedican EB, Bender JB, Hedberg CW. Antibiotic Treatment of Escherichia coli O157 Infection and the Risk of Hemolytic Uremic Syndrome, Minnesota. Pediatr Infect Dis J. 2011. [Epub ahead of print]. 6. Kass B. Travellers diarrhoea. Aust Fam Physician. 2005;34:243-7. 7. Bartoloni A, Pallecchi L, Fiorelli C, Di Maggio T, Fernandez C, Villagran AL, et al. Increasing resistance in commensal Escherichia coli, Bolivia and Peru. Emerg Infect Dis. 2008;14:338-40. 8. Tenover FC. Mechanisms of antimicrobial resistance in bacteria. Am J Med. 2006;119:S3-10; discussion S62-70. 9. Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob Agents Chemother. 2009;54(3):969-76. 10. Lahey Clinic. -Lactamase Classification and Amino Acid Sequences for TEM, SHV and OXA Extended-Spectrum and Inhibitor Resistant Enzymes. Burlington, MA: Lahey Clinic Foundation; 2011. 11. Pallecchi L, Bartoloni A, Fiorelli C, Mantella A, Di Maggio T, Gamboa H, et al. Rapid dissemination and diversity of CTX-M extended-spectrum beta-lactamase genes in commensal Escherichia coli isolates from healthy children from low-resource settings in Latin America. Antimicrob Agents Chemother. 2007;51:2720-5. 12. Rjiba S, Mercuri PS, Power P, Kechrid A. Emergence and dominance of CTX-M-15 extended spectrum betalactamase among Escherichia coli isolates from children. Microb Drug Resist. 2011;17(2):135-40. 13. Poirel L, Carattoli A, Bernabeu S, Bruderer T, Frei R, Nordmann P. A novel IncQ plasmid type harbouring a class 3 integron from Escherichia coli. J Antimicrob Chemother. 2010;65(8):1594-8.

Contribuciones de autora

SM, JR y TJO participaron en la concepcin y diseo del trabajo, en la revisin crtica del manuscrito y en la aprobacin de su versin final; adems, SM realiz la redaccin y TJO la obtencin de financiamiento. JLB particip en la revisin crtica del manuscrito y en la aprobacin de la versin final.

655

Rev Peru Med Exp Salud Publica. 2011;28(4):648-56.

Mosquito S et al.

14. Lee SH, Jeong SH. Nomenclature of GES-type extendedspectrum beta-lactamases. Antimicrob Agents Chemother. 2005;49(5):2148. 15. Karami N, Hannoun C, Adlerberth I, Wold AE. Colonization dynamics of ampicillin-resistant Escherichia coli in the infantile colonic microbiota. J Antimicrob Chemother. 2008;62:703-8. 16. Vignoli R, Varela G, Mota MI, Cordeiro NF, Power P, Ingold E, et al. Enteropathogenic Escherichia coli strains carrying genes encoding the PER-2 and TEM-116 extended-spectrum beta-lactamases isolated from children with diarrhea in Uruguay. J Clin Microbiol. 2005;43:2940-3. 17. Mosquito SG, Pons MJ, Maves R, Saenz Y, Mercado E, Vargas M, et al. Prevalence of Extended Spectrum Beta-Lactamases in Escherichia coli strains isolated from Peruvian infants. 20th European Congress of Clinical Microbiology and Infectious Diseases (ECCMID). Vienna, Austria. April, 10-13, 2010. 18. Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother. 2003;51:1109-17. 19. Lautenbach E, Metlay JP, Mao X, Han X, Fishman NO, Bilker WB. The prevalence of fluoroquinolone resistance mechanisms in colonizing Escherichia coli isolates recovered from hospitalized patients. Clin Infect Dis. 2010;51:2805. 20. Jacoby G, Cattoir V, Hooper D, Martnez-Martnez L , Nordmann P, Pascual A, et al. Qnr gene nomenclature. Antimicrob Agents Chemother. 2008;52:2297-9. 21. Lahey Clinic. qnr Numbering and sequencing. Burlington, MA: Lahey Clinic Foundation; 2011. 22. Cattoir V, Nordmann P. Plasmid-mediated quinolone resistance in gram-negative bacterial species: an update. Curr Med Chem. 2009;16:1028-46. 23. Cordeiro NF, Robino L, Medina J, Seija V, Bado I, Garcia V, et al. Ciprofloxacin-resistant enterobacteria harboring the aac (6)-Ib-cr variant isolated from feces of inpatients in an intensive care unit in Uruguay. Antimicrob Agents Chemother. 2008;52:806-7. 24. Saenz Y, Ruiz J, Zarazaga M, Teixid M, Torres C, Vila J. Effect of the efflux pump inhibitor Phe-Arg--naphthylamide on the MIC values of the quinolones, tetracycline and chloramphenicol, in Escherichia coli isolates of different origin. J Antimicrob Chemother. 2004;53:544-5. 25. Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, Kato H, et al. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother. 2007;51(9):3354-60. 26. Silva-Sanchez J, Barrios H, Reyna-Flores F, BelloDiaz M, Sanchez-Perez A, Rojas T, et al. Prevalence and Characterization of Plasmid-Mediated Quinolone Resistance Genes in Extended-Spectrum -LactamaseProducing Enterobacteriaceae Isolates in Mexico. Microb Drug Resist. 2011. [Epub ahead of print]. 27. Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;65:232-60. 28. Karami N, Nowrouzian F, Adlerberth I, Wold AE. Tetracycline resistance in Escherichia coli and persistence in the infantile colonic microbiota. Antimicrob Agents Chemother. 2006;50:156-61.

29. Levy SB, McMurry LM, Barbosa TM, Burdett V, Courvalin P, Hillen W, et al. Nomenclature for new tetracycline resistance determinants. Antimicrob Agents Chemother. 1999;43:1523-4. 30. Schwarz S, Kehrenberg C, Doublet B, Cloeckaert A. Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol Rev. 2004;28:519-42. 31. Mandomando I, Jaintilal D, Pons MJ, Valls X, Espasa M, Mensa L, et al. Antimicrobial susceptibility and mechanisms of resistance in Shigella and Salmonella isolates from children under five years of age with diarrhea in rural Mozambique. Antimicrob Agents Chemother. 2009;53:2450-4. 32. Srinivasan V, Gillespie BE, Nguyen LT, Headrick SI, Murinda SE, Oliver SP. Characterization of antimicrobial resistance patterns and class 1 integrons in Escherichia coli O26 isolated from humans and animals. Int J Antimicrob Agents. 2007;29:254-62. 33. Srinivasan V, Nguyen LT, Headrick SI, Murinda SE, Oliver SP. Antimicrobial resistance patterns of Shiga toxinproducing Escherichia coli O157:H7 and O157:H7- from different origins. Microb Drug Resist. 2007;13:44-51. 34. Ho PL, Wong RC, Chow KH, Que TL. Distribution of integron-associated trimethoprim-sulfamethoxazole resistance determinants among Escherichia coli from humans and food-producing animals. Lett Appl Microbiol. 2009;49:627-34. 35. Infante B, Grape M, Larsson M, Kristiansson C, Pallecchi L, Rossolini GM, et al. Acquired sulphonamide resistance genes in faecal Escherichia coli from healthy children in Bolivia and Peru. Int J Antimicrob Agents. 2005;25:308-12. 36. Dahmen S, Mansour W, Boujaafar N, Arlet G, Bouallegue O. Distribution of cotrimoxazole resistance genes associated with class 1 integrons in clinical isolates of Enterobacteriaceae in a university hospital in Tunisia. Microb Drug Resist. 2010;16:43-7. 37. Bailey JK, Pinyon JL, Anantham S, Hall RM. Commensal Escherichia coli of healthy humans: a reservoir for antibioticresistance determinants. J Med Microbiol. 2010;59:1331-9. 38. Sabate M, Guillem P. Estructura y funcin de los integrones. Enfer Infecc Microbiol Clin. 2002;20:341-5. 39. Naas T, Mikami Y, Imai T, Poirel L, Nordmann P. Characterization of In53, a class 1 plasmid- and composite transposon-located integron of Escherichia coli which carries an unusual array of gene cassettes. J Bacteriol. 2001;183(1):235-49. 40. Gassama A, Aidara-Kane A, Chainier D, Denis F, Ploy MC. Integron-associated antibiotic resistance in enteroaggregative and enteroinvasive Escherichia coli. Microb Drug Resist. 2004;10:27-30.

Correspondencia: Theresa Jean Ochoa Direccin: Av. Honorio Delgado 430, San Martn de Porras, Lima 33, Per Telfono: (511) 482 3903 Correo electrnico: theresa.J.ochoa@uth.tmc.edu; theresa. ochoa@upch.pe

656

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

simposio: tica biotica y medicina

RETOS DE LA BIOTICA EN LA MEDICINA DEL SIGLO XXI


Jorge Alberto lvarez-Daz1,a

RESUMEN Para plantear posibles retos de la biotica en la medicina del siglo XXI es necesario considerar que existieron algunos retos en el pasado (en el origen de esa nueva disciplina llamada biotica); que los retos se han ido modificando con el avance cientfico, biomdico y humanstico; considerando que los retos que pueden plantearse para el futuro sern, de diferentes maneras, resultado de este devenir histrico. Se plantean como grandes retos: los problemas no resueltos de justicia, equidad y pobreza; los retos que plantea la introduccin de nuevas tecnologas con el paradigma de la nanomedicina y los retos que plantea el avance de las neurociencias con el paradigma de la neurotica. Palabras clave: Biotica; Nanomedicina; Medicina; tica mdica (fuente: DeCS BIREME).

CHALLENGES OF BIOETHICS IN TWENTY-FIRST CENTURY MEDICINE


ABSTRACT In order to propose possible challenges of bioethics in the twenty-first century medicine, it is necessary to consider that there were some past challenges (at the origin of this new discipline called bioethics), that the challenges have been modified with scientific, biomedical and humanistic breakthroughs, considering at the same time that challenges that may arise in the future will be, in different ways, a result of this historical evolution. The major challenges would be in the future: the unsolved problems of justice, equity and poverty; the challenges posed by the introduction of new technologies with the nanomedicine paradigm; and finally, the challenges driven by breakthroughs in neurosciences with the neuroethics paradigm. Key words: Bioethics; Nanomedicine; Medicine; Ethics, medical (source: MeSH NLM).

En la Medicina del siglo XXI la biotica tiene que enfrentar mltiples retos los cuales no es posible conocer, del mismo modo, tampoco se puede advertir las soluciones que pueden proponerse; por ello, si se quiere plantear una aproximacin razonable hacia el futuro, se debe pensar que dichos retos sern el resultado de una evolucin histrica.

continuidad). As pues, llama la atencin que tras casi dos milenios y medio de prctica mdica, la tica diese un giro diferente. Para la atencin mdica bast todo ese tiempo con la tica Mdica, que en poca moderna tom la forma de deontologa mdica; sin embargo, a partir del nacimiento de la Biotica es claro que un cdigo deontolgico no es (ni puede ser) suficiente para afrontar los retos de la prctica mdica contempornea.

MEDICINA Y TICA MDICA: PREMBULO PARA LA BIOTICA


La Medicina se practica desde la prehistoria, y su reflexin tica clsica (la tica Mdica) permaneci prcticamente sin cambios desde los orgenes de la medicina occidental hasta el nacimiento de la Biotica. Esto ocurre a principios de la dcada de 1970, tras la publicacin de un par de trabajos escritos por Van Rensselaer Potter (1,2), considerado como el Padre de la Biotica (aunque el trmino apareci en alemn en 1927 en un trabajo de Fritz Jahr (3), pero no tuvo

PASADO DE LA BIOTICA EN LA MEDICINA: EL SORPRENDENTE AVANCE DE LAS CIENCIAS BIOMDICAS Y EL NACIMIENTO DE LA BIOTICA CON EL PRINCIPIALISMO
A decir de Diego Gracia, el nacimiento de la Biotica surge por, al menos, cuatro factores principales que se enuncian brevemente (4). El primer factor sera el desarrollo espectacular de la Biologa, ciencia que tuvo el mayor desarrollo en la

1 a

Departamento de Atencin a la Salud, Universidad Autnoma Metropolitana Unidad Xochimilco. Mxico DF, Mxico. Mdico, sexlogo clnico, especialista, magster y doctor en biotica

Recibido: 29-07-11

Aprobado: 26-10-11

657

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

lvarez-Diaz J

segunda mitad del siglo XX. En la primera mitad del citado siglo la fsica se desarroll de forma exuberante, culminando en la tragedia de la bomba atmica. Esto permiti tomar algunas medidas para no hacer en Biologa todo lo que tcnicamente era posible. Esto significaba que se planteaba la pregunta tica por antonomasia, qu debo hacer?. El segundo factor fue la toma de conciencia de los riesgos de la investigacin cientfica; existen numerosas publicaciones al respecto que pueden consultarse para ampliar detalles de casos paradigmticos (Tuskegee, Willowbrook, etc.). El tercer factor fue la aplicacin de la tecnologa en la atencin sanitaria, que modific los extremos de la vida humana. Primero se modific el final de la vida: hacia la dcada de 1960 llega la ventilacin mecnica, la modificacin de los criterios de muerte, la era de los transplantes, etc. Posteriormente, se modifica el inicio de la vida: aparece la anticoncepcin (disociando, por vez primera en la historia, el placer sexual de la reproduccin; lo que fue un verdadero escndalo en algunos crculos religiosos). Hacia finales de la dcada de 1970 se modifica, de forma ms drstica, el inicio de la vida humana, al llegar las tcnicas de reproduccin humana asistida (TRHA), como la fecundacin in vitro, y las nuevas posibilidades de parentalidad que se abran (como la gestacin subrogada). Con todas estas novedades, las intervenciones de los profesionales sanitarios cobraban dimensiones nuevas. El cuarto factor fue la emancipacin de los pacientes: estos se liberan cada vez ms de esa condicin, convirtindose paulatinamente en agentes pues demandan informacin, intervienen en su propio tratamiento, etc. Es una poca en que busca la liberad y se consolidan varios movimientos libertarios: la liberacin femenina, la liberacin animal de Peter Singer, la teologa de la liberacin y la liberacin de los pacientes. El paciente requiere de libertad para decidir sobre lo que se har (o no) sobre su propio cuerpo. Esto cristaliza en las cartas de derechos de los pacientes, donde el papel del consentimiento informado es crucial. En el surgimiento de la Biotica, el principialismo (o principlismo) fue la fundamentacin biotica predominante. Los cuatro puntos de surgimiento de la biotica, as como el principialismo, han tenido una recepcin y evolucin propia en los pases latinoamericanos. Han llegado de diferentes maneras, y en cada lugar se han combinado con la realidad local. Esto hace que el desarrollo posterior a este nacimiento sea variable en estos pases. Las explicaciones de este proceso han sido varias, pudiendo citarse las de Gracia (5), Jos Alberto Mainetti (6), y Jess

Llano Escobar (7). Todas interesantes y de algn modo complementarias, siendo altamente recomendable su lectura para comprender la recepcin y el desarrollo de la biotica en contextos locales.

PRESENTE DE LA BIOTICA EN LA MEDICINA: CRTICA Y ALTERNATIVAS AL PRINCIPIALISMO EN BIOTICA ANTE LOS AVANCES REALES Y POTENCIALES DE LAS CIENCIAS BIOMDICAS
El cambio que experiment la Medicina tuvo una interesante repercusin: repensar los fines de la Medicina misma. El mdico ya no puede estar siempre, contra todo y contra todos por la vida puesto que todos somos seres mortales; hay que aceptar que la Medicina tiene lmites y que siempre los tendr. Asumir que el mdico tiene que luchar a toda costa por la vida del paciente (encarnizamiento teraputico o distanasia), lo hizo caer en serios problemas ticos. Si los fines han cambiado, cules son? El instituto Hastings Center propone cuatro: prevencin de enfermedades y lesiones y promocin y conservacin de la salud; alivio del dolor y el sufrimiento causado por males; atencin y curacin de los enfermos y cuidados a los incurables; y evitar la muerte prematura y bsqueda de una muerte tranquila (8). Esto hizo que se estudiara una base tica para sustentar estos nuevos fines, ms cerca de la condicin real de la atencin sanitaria. El principialismo fue mostrando cada vez ms debilidades y recibiendo ms crticas. Con los nuevos fines de la Medicina, la nueva tica (la Biotica) requera de una slida fundamentacin. Esto no ocurri por mero academicismo, era una verdadera necesidad por varias razones. Primero, porque la fundamentacin es imprescindible cuando se quiere asegurar que un acto es tico o no. Segundo, porque sin ella es imposible discutir seriamente los problemas ticos planteados por la Medicina. Tercero, porque desde la fundamentacin se proponen procesos y procedimientos para sugerir respuestas a los problemas morales (una fundamentacin sin un procedimiento es inoperante, y un procedimiento sin fundamentacin es una combinacin de ambigedad y frivolidad). Despus del principialismo han surgido muchas otras alternativas, las cuales se han ido planteando como respuesta ante la realidad clnica, siempre cambiante. Sin embargo, hay que aclarar que la fundamentacin ltima de cualquier modelo terico es imposible de elaborar. De acuerdo con el Trilema de Mnchhausen (ampliamente discutido por Hans Albert (9)) solamente hay tres posibilidades de hacer una fundamentacin: mediante una regresin infinita (A se justifica por B,

658

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

Biotica en el siglo XXI

B se justifica por C, C se justifica por D, etc., hasta el infinito; regressus ad infinitum), mediante un crculo lgico (A se justifica por B, B se justifica por C, y C se justifica por A; petitio principii), o bien mediante un corte en el razonamiento (A se justifica por B, B se justifica por C, y C ya no se justifica porque se considera que es evidente, de sentido comn, un postulado o axioma de la razn; esto no deja de ser arbitrario). De las tres formas de hacerlo, la tercera es la ms razonable. Esto es as y no puede ser de otro modo, no con la razn humana y el conocimiento actual. Kurt Gdel demuestra matemticamente mediante los teoremas de la incompletud de los sistemas formales que un sistema formal no puede ser al mismo tiempo completo y coherente. Esto es, si el sistema es coherente, entonces es incompleto; si el sistema es completo, entonces es incoherente. Gdel demuestra que todo sistema terico coherente creado por la razn humana tiene que partir necesariamente de axiomas indemostrables, razonables pero no demostrados. La razn no puede dar razn de s misma. En Filosofa, esto representa el paso de la modernidad a la postmodernidad. Esto es esencial, porque es cierto tanto para los sistemas formales como las Matemticas, como para todo sistema creado por la razn humana, como la tica. En otras palabras, esto es aplicable a todo el conocimiento que pretenda ser coherente (todo este simposio en su conjunto y no solamente este trabajo, para ser coherente ser, necesariamente, incompleto). Norman Daniels las divide las posibles fundamentaciones de la biotica en tres familias (10): quienes consideran que para resolver un problema moral la fundamentacin carece de inters (llamados ecuatoriales, como los principialistas); b) los antitericos, quienes consideran que para la resolucin de los problemas morales es imposible fundamentar (llamados meridionales, como los casuistas y contextualistas); y los tericos, quienes consideran que para resolver un problema moral s se puede fundamentar (llamados septentrionales). Dentro de los tericos habra dos grupos: quienes creen que no es posible el dilogo y los acuerdos entre tradiciones morales diferentes (como los comunitaristas), y quienes creen que s es posible, ya sea mediante una fundamentacin material (de contenidos, que diga qu hacer y qu no hacer, como el paradigma de la moralidad comn), o mediante una fundamentacin formal. Dentro de estos ltimos estaran dos grupos: quienes consideran que lo universal de la moralidad es su estructura, a travs de un canon moral (como algunas ticas fenomenolgicas), y quienes consideran que lo fundamental es el procedimiento (como algunas ticas discursivas).

Todo esto deja grandes enseanzas para la prctica. Gracia ha sugerido, con razn, que los problemas ticos al inicio de la vida humana suelen tener como punto de convergencia el estatus del embrin. As mismo, que los problemas ticos al final de la vida humana convergen en los criterios y definicin de muerte. Con el ejemplo concreto del estatus del embrin pueden decirse muchas cosas. Una primera sera que no est claro cmo definir qu es un embrin humano aun desde la mera biologa (11). Otra segunda es que pueden hacerse varias consideraciones filosficas sobre el embrin de acuerdo con posturas personalistas y sus alternativas gradualistas. Quien se empecine en demostrar que el embrin es una persona (12) conseguir tal vez un sistema completo, pero incoherente (de ah las crticas abundantes que tiene el personalismo al postular e intentar demostrar que el embrin es una persona). Por ello, las alternativas de sistemas incompletos resultan coherentes (como las posturas gradualistas (13), proponiendo que la cualidad de persona surge en algn momento posterior a la fecundacin, difcil de precisar). Todas estas reflexiones son fundamentales para la bsqueda de respuestas posibles a los problemas ticos que plantea la Medicina: actualmente no es posible confiar en la pura razn humana y creer que existe una respuesta nica para un problema. Afirmaciones como la interrupcin voluntaria del embarazo no es tica son puramente dogmticas. Si se dicen desde el dogma de la fe, se comprende, si se dicen desde la tica, no es una afirmacin admisible dentro del horizonte cientfico y filosfico actual. De ah la imperiosa necesidad de la conformacin de comits de tica, no solamente para la investigacin clnica, sino tambin para la prctica clnica. Solamente a travs de la deliberacin moral que puede conseguirse en el seno de los comits pueden, eventualmente, proponerse respuestas prudentes, esto es, tomar decisiones razonables en condiciones de incertidumbre.

FUTURO DE LA BIOTICA EN LA MEDICINA: RETOS DE LA BIOTICA EN LA MEDICINA DEL SIGLO XXI


Con los antecedentes citados pueden plantearse al menos tres grandes grupos de retos para la Biotica en la medicina del siglo XXI. Un primer grupo de retos tienen que ver con el desarrollo que ha tenido hasta la fecha la Medicina y la Biotica y son aquellos relacionados con la justicia, la equidad y la pobreza (adems, parecen ser el punto donde convergen muchos otros problemas). Un segundo grupo tiene que ver con la incorporacin creciente de tecnologas al campo mdico, planteados

659

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

lvarez-Diaz J

de forma paradigmtica por la nanomedicina. Un tercer grupo seran aquellos que pueden llegar a modificar la fundamentacin misma de la Biotica como producto del desarrollo de las ciencias biomdicas, aqu la representacin paradigmtica sera la neurotica. No cabe duda que los problemas ticos que la medicina plantea a la biotica apelan a la justicia, la equidad, y la pobreza. Se ha escrito mucho acerca de la adaptacin de la biotica a la realidad latinoamericana, algunas propuestas son una biotica de intervencin (14) o una biotica de proteccin (15). Esto puede comprenderse porque problemas fundamentales de justicia no han sido resueltos. No se trata de pasar a una biopoltica foucaultiana (siempre atractiva); hay un momento que sin duda es poltico, pero hay un momento propia y especficamente tico. En este hay que discernir sobre cuestiones que ataen a la distribucin de recursos escasos en la atencin sanitaria. La creacin de sistemas de salud con un acceso pblico y universal dista de ser la constante para Latinoamrica. As, la salud para todos parece reducirse cada vez ms a salud para quienes tienen acceso, interpretndose de mltiples formas la posibilidad de este acceso: geogrfico, econmico, poltico, etc. Actualmente, no existe un acceso equitativo de toda la poblacin a satisfactores tales como el agua o la alimentacin. Si se habla en trminos biojurdicos de un derecho a la salud, cmo no plantear solucionar necesidades previas como el acceso al agua potable y a la alimentacin? La desnutricin sigue siendo un problema en varios pases de la regin es posible hablar entonces de satisfacer el derecho a la salud solamente en trminos puramente biomdicos? Acceso a diagnsticos y tratamientos solamente? desde luego que no. Los determinantes sociales de la salud cada vez toman mayor importancia y los programas de postgrado en medicina social o en salud colectiva son todava pocos en la regin. Esto plantea los grandes retos estructurales que hay que enfrentar, ya que todo esto implica un sistema poltico, de distribucin de la riqueza, etc., que no favorece a quienes tienen menos. Un ejemplo concreto seran las TRHA. Actualmente se sabe que un 80 % de la poblacin infrtil en el mundo se encuentra en pases menos desarrollados, como los latinoamericanos. Tambin es conocido que es ms estigmatizante la infertilidad en los pases menos desarrollados. Si esto es as, por qu no se les atiende? Por un problema de distribucin de recursos escasos, que hace que el trato no sea equitativo tanto a nivel mundial como a nivel regional (para la OPS la infertilidad no representa una prioridad en los programas de salud sexual y reproductiva). Se trata entonces de un problema

de justicia, de acceso a los servicios y tratamientos en materia de infertilidad (16). Adems de problemas no resueltos por la Biotica existen otros de naturaleza diferente. Se mencion a la nanomedicina como un ejemplo paradigmtico de la aplicacin de nuevas tecnologas en la atencin sanitaria. La nanomedicina es una disciplina muy reciente. La primera cita en la base de datos PubMed que incluye esta palabra es de 1999 y es extraordinariamente raro encontrar alguna referencia previa. Aunque un ao antes se public el primer estudio detallado del diseo tcnico de un nanorobot mdico en una revista arbitrada e indexada, la bibliometra muestra que la nanomedicina es casi una hija del siglo XXI. La nanomedicina puede definirse como la aplicacin de la nanociencia en beneficio del paciente (17) y como la aplicacin mdica de la nanotecnologa (18); correspondera a un tipo particular de aplicaciones de la nanobiotecnologa en la atencin sanitaria (19). Existen definiciones de organismos nacionales (como los National Institutes of Health de EE.UU. (20)) o supranacionales (como la European Science Foundation (21) o la Comunidad Europea a travs de la European Technology Platform on NanoMedicine (22)). Sin embargo, no hay una definicin internacional uniforme (23). Si la introduccin de la tecnologa en la atencin sanitaria dio origen a la Biotica, por qu la nanotecnologa generara nuevos problemas? Porque el desarrollo de la tecnologa en la nanoescala puede modificar algo fundamental para la tica mdica tradicional (paternalista) y la contempornea biotica (cuya relacin clnica reposa en el consentimiento informado). Siguiendo los argumentos dados para las innovaciones disruptivas y las sostenidas que da la nanomedicina, la tendencia sera cada vez ms hacia: una horizontalizacin de la relacin clnica, un mayor autocuidado (responsabilizndose ms los pacientes de s mismos), y una menor atencin en grandes centros sanitarios (las pruebas de diagnstico y supervisin podran estar accesibles en el propio domicilio, transformando la funcin de los profesionales sanitarios cada vez ms hacia asesores tcnicos). Esto modificara el todava modelo vertical de relacin clnica, el cuidado sobre todo por parte de personal sanitario, y la atencin en grandes centros sanitarios. La teora del consentimiento informado tiene ya suficientes crticas respecto a qu y cunto informar, la dificultad en la comprensin del paciente de la compleja informacin tcnica (24), etc. De este modo, resulta ms complicada la transmisin de informacin relacionada con las aplicaciones de la nanotecnologa en la nanomedicina (25), tales como el concepto de riesgo (26) (ya de por s difcil de comprender por el lego), aspectos nanotoxicolgicos (27), etc.

660

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

Biotica en el siglo XXI

Por otra parte, se ha propuesto que aplicaciones nanotecnolgicas pueden ayudar a conseguir los objetivos del milenio de Naciones Unidas en pases menos desarrollados (28); solucionara problemas relacionados con agua, energa, agricultura y salud (29). Incluso se ha dicho que la nanotecnologa tiene una importancia indispensable para revivir econmica y cientficamente a pases emergentes (30); una visin nanoentusiasta, que ha recibido crticas serias (31). La historia ensea que el desarrollo industrial y tecnolgico no ha impactado tan positivamente ni tan rpidamente como se deseara (32), tampoco en medicina (33) (la nanomedicina no sera una excepcin). En la actualidad, el acceso a la tecnologa disponible en atencin sanitaria no es equitativo (34) (una vez ms el problema fundamental de la justicia). Qu duda cabe que la nanotecnologa puede ofrecer soluciones, pero tal vez no sean las ptimas para pases emergentes, ya que, al menos inicialmente, su aplicacin resultara muy costosa, tanto que puede volverse imposible su aplicacin prctica (35). Para finalizar este segundo grupo de retos hay que acotar que podra llegar a tener repercusiones en las cuestiones de fundamentacin. Existe toda una rama conocida hoy como nanotica, encargada de los aspectos ticos de la nanotecnologa. Una propuesta actual correspondera a la posible reunin de aspectos aportados por la biotica y otros ms por la nanotica, para la construccin de una nanobiotica (36). El tercer grupo de retos incluira aquellos que pueden llegar a modificar la fundamentacin misma de la biotica como resultado del desarrollo de las ciencias biomdicas. La representacin paradigmtica es la neurotica. Esta disciplina puede entenderse en un sentido doble: como la tica de la neurociencia o como la neurociencia de la tica. No se trata de un juego de palabras, se trata de una diferencia crucial. En el primer sentido del trmino, la neurotica no planteara nada esencialmente novedoso, se tratara de la tica de la investigacin y de la tica clnica en el campo de las neurociencias, cuyo avance ha sido espectacular en las ltimas dcadas. Sin embargo, en el segundo sentido del trmino, la neurotica pretende ser una verdadera revolucin al intentar rastrear las bases neurobiolgicas del comportamiento tico. Esto es, en trminos reduccionistas y simplistas, buscar los centros cerebrales que dictan y regulan el comportamiento tico. La neurotica (entendida en su segunda forma) plantea muchos retos novedosos que no es posible exponer y discutir aqu, baste entonces sealar algunos. Hay quienes consideran que conociendo las bases cerebrales de la conducta se podra determinar cmo conducirse moralmente; si esto fuera as, considerando todos los

seres humanos como Homo sapiens con el mismo funcionamiento cerebral en esencia, hay quienes sugieren que desde las bases cerebrales puede plantearse una tica universal (eso solucionara el problema de la existencia de las mltiples fundamentaciones). La mente se reduce al cerebro? El reto es enorme. La lucha contra el reduccionismo biolgico parece difuminarse en estos temas. Muchos suponen que la conducta moral ha ido modelndose por la evolucin; si esto es as, resultara que los seres humanos contaran con intuiciones morales que les llevan a formular razonamientos sobre la conducta moral. De este modo, habra algo as como una neurologa de la moral (37), destacando estructuras para la toma de decisiones en general (que incluiran la amgdala y la corteza prefrontal (38)) y las decisiones morales en particular (en la corteza prefrontal (39) y orbitofrontal (40)). Esto hace que se proponga cmo es el funcionamiento de los juicios morales en el cerebro (41), as como los centros de conocimiento moral (42), todo un cerebro moral (43). Los problemas saltan por todos lados. Si se trata de proponer una tica universal, resulta que los neuroentusiastas nunca proponen cul sera el contenido concreto de esa tica, es decir, no llegan a proponer qu es lo que el ser humano debe (o no debe) hacer. Pero hay ms. Integrando esta informacin (y muchas propuestas ms) se dice que cuando existieron las sociedades de cazadores y recolectores se estara gestando la estructura del encfalo actual. Se tratara de comunidades muy pequeas en donde la gente necesitara defenderse mutuamente para sobrevivir (Darwin puro y duro). Esto hara que la cohesin del grupo pequeo se basara en vnculos emocionales; por ello, lo que afectara a los seres humanos, moralmente hablando, correspondera a lo que afecte a los allegados; esto explicara porqu el rechazo al diferente, entre otras cosas. Se tratara de cdigos morales, como un mero mecanismo de adaptacin al medio. Si a partir de esto se intentan extraer normas de una tica universal, seran propuestas como obra de tal modo que puedas favorecer a los cercanos y alejar a los lejanos por el peligro de la agresin. Es posible que los seres humanos cuenten con tal tipo de cdigos; pero deben actuar solamente conforme a ellos? Por poner un ejemplo: todos los seres humanos cuentan con bases enceflicas (adems de hormonales y psicosociales) para el deseo sexual. Si se dejan llevar solamente por este mero deseo, con el argumento de que est inscrito en la neurobiologa, llevaran a comportamientos verdaderamente morales? Tambin existen bases neurolgicas de la alimentacin, la evacuacin de excretas, etc., pero en todos estos comportamientos parece estar claro que se requiere algo ms que la mera Neurobiologa. Tal

661

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

lvarez-Diaz J

vez por eso los neuroentusiastas nunca dicen cules son los contenidos que proponen para esa pretendida tica universal. Habra que resaltar que el entorno de cazadores y recolectores ya no es tal y que el entorno actual de aproximadamente 6 200 000 000 de habitantes en el mundo no puede referirse a un entorno tan previo en el tiempo. Las declaraciones de derechos humanos no hablan de los cercanos, de la tribu, ni siquiera del pas, involucran a todos y cada uno de los seres humanos. Esto podra llevar tambin a otros niveles como el poltico. Se ha propuesto que hay bases cerebrales para juicios utilitaristas (44), o que la orientacin poltica tiene una base neurolgica (45). Habra entonces algn tipo de correlato entre la tica y la poltica a nivel neurolgico? (46) Parece atractivo pensar que si se planteara una tica universal, esta tendra algn tipo de relevancia en el orden poltico. Es decir, habra una base neurobiolgica para la justicia? Por aqu empez todo esto de los retos de la biotica en la medicina del siglo XXI (al menos los retos que se proponen aqu). Los seres humanos se hacen preguntas; de otra forma no habran surgido la ciencia y la filosofa. Ms que una serie de conclusiones o un estructurado eplogo, parece ser que lo que s se puede afirmar a todas luces, es que los retos que se seguirn planteando a la biotica desde el desarrollo de la medicina del siglo XXI sern cada vez ms complejos. Por ello, hay que seguir con la investigacin, no solamente biomdica, sino tambin humanstica, donde la biotica tiene un lugar esencial.

8. Hastings Center. Los fines de la medicina (Cuadernos de la Fundaci Vctor Grfols i Lucas N 11). Barcelona: Fundaci Vctor Grfols i Lucas; 2004. 9. Albert H. Treatise on Critical Reason. Princeton: Princeton University Press; 1985, p. 13. (Original publicado en 1968 como Traktat ber kritische Vernunft). 10. Daniels N. Justice and justification: Reflective equilibrium in theory and practice. New York: Cambridge University Press; 1996, p. 333-52. 11. Findlay JK, Gear ML, Illingworth PJ, Junk SM, Kay G, Mackerras AH, et al. Human embryo: a biological definition. Hum Reprod. 2007;22(4):905-11. 12. Nez de Castro I. De la dignidad del embrin. Reflexiones en torno a la vida humana naciente. Madrid: Universidad Pontificia Comillas; 2008. 13. lvarez-Daz JA. El estatus del embrin humano desde el gradualismo. Gac Med Mex. 2007;143(3):267-77. 14. Garrafa V, Porto D. Intervention bioethics: a proposal for peripheral countries in a context of power and injustice. Bioethics. 2003;17(5-6):399-416. 15. Schramm FR, Braz M. Bioethics of protection: a proposal for the moral problems of developing countries? J Int Bioethique. 2008;19(1-2):73-86, 196. 16. lvarez-Daz JA. El derecho a la salud y el acceso a las tcnicas de reproduccin humana asistida (TRHA). En: La medicina social en Mxico. Mxico, DF: ALAMES Regin Mxico A. C., ENAH - Cuerpo Acadmico Diversidad biosocial contempornea, PromeP y Ediciones y Grficos En; 2010. p. 35-44 17. Hunziker P. Nanomedicine: The application of the nanosciences to the benefit of the patient. Eur J Nanomed. 2008;1(1):2. 18. Freitas RA Jr. Nanomedicine, Volume I: Basic capabilities. Georgetown, Texas: Landes Bioscience; 1999. 19. Jain KK. Nanomedicine: application of nanobiotechnology in medical practice. Med Princ Pract. 2008;17(2):89-101. 20. National Institutes of Health. National Institute of Health roadmap for medical research: Nanomedicine. Bethesda, Maryland: HIH; 2006. 21. European Science Foundation. Nanomedicine. An ESF European Medical Research Councils (EMRC) Forward Look report. Strasbourg: European Science Foundation; 2005. 22. European Commission. European Technology Platform on NanoMedicine Nanotechnology for Health. Vision paper. Luxembourg: Office for Official Publications of the European Communities; 2005. 23. Webster TJ. Nanomedicine: Whats in a definition? Int J Nanomedicine. 2006;1(2):115-116. 24. Simn Lorda P. El consentimiento informado. Historia, teora y prctica. Madrid: Triacastela; 2000. 25. Asveld L. Informed consent in fields of medical and technological practice: An explorative comparison. Techn. 2006;10(1):18-34. 26. Priest SH. Risk communication for nanobiotechnology: To whom, about what, and why? J Law Med Ethics. 2009;37(4):759-769. 27. Shrader-Frechette K. Nanotoxicology and ethical conditions for informed consent. Nanoethics. 2007;1(1):47-56.

REFERENCIAS BIBLIOGRFICAS
1. Potter VR. Bioethics, the science of survival. Perspect Biol Med 1970;14:127-153. 2. Potter VR. Bioethics: Bridge to the future. Englewood Cliffs, New Jersey: Prentice Hall; 1971. 3. Jahr F. Bio-Ethik. Eine umschau ber die ethichen beziehung des menschen zu tier und pflanze. Kosmos. 1927;24(2):21-32. 4. Gracia D. Origen, fundamentacin y mtodo de la biotica. En: Martnez Martnez JA, de Abajo FJ (Coord.). La biotica en la educacin secundaria. Madrid: Ministerio de Educacin y Ciencia; 2007, p. 9-50. 5. Gracia D. El contexto histrico de la biotica hispanoamericana. En: Pessini L, de Barchifontaine CP, Lolas F (coordinadores). Perspectivas de la biotica en Iberoamrica. Santiago de Chile: Programa de Biotica de OPS/OMS; 2007. p. 21-36. 6. Mainetti JA, Prez ML. Los discursos de la biotica en Amrica Latina. En: Pessini L, de Barchifontaine CP, Lolas F (coordinadores). Perspectivas de la biotica en Iberoamrica. Santiago de Chile: Programa de Biotica de OPS/OMS; 2007. p. 37-44. 7. Llano Escobar A. La biotica en Amrica Latina y el Caribe. Revista Selecciones de Biotica. 2007;12:16-25.

662

Rev Peru Med Exp Salud Publica. 2011;28(4):657-63.

Biotica en el siglo XXI

28. Salamanca-Buentello F, Persad DL, Court EB, Martin DK, Daar AS, Singer PA. Nanotechnology and the developing world. PLoS Medicine. 2005 May;2(5):e97. 29. Barker TF, Fatehi L, Lesnick MT, Mealey TJ, Raimond RR. Nanotechnology and the poor: Opportunities and risks for developing countries. En: Allhoff F, Lin P. Nanotechnology & society. Current and emerging ethical issues. New York: Springer; 2009. p. 243-263. 30. El Naschie MS. Nanotechnology for the developing world. Chaos, Solitons and Fractals. 2006;30:769-773. 31. Foladori G, Invernizzi N. Nanotechnology for the poor? PLoS Medicine. 2005;2(8):e280. 32. OManthna DP. Nanoethics. Big ethical issues with small technology. London: Continuum; 2009. p. 88. 33. Grupo de Accin sobre Erosin, Tecnologa y Concentracin. Medicina nanolgica. Aplicaciones mdicas de las nanotecnologas: Cul es su impacto en las comunidades marginadas? Ottawa: Etcgroup; 2006. 34. Frost LJ, Reich MR. How do good health technologies get to poor people in poor countries? Cambridge: Harvard University Press; 2008. 35. Schummer J. Impact of nanotechnologies in developing countries. En: Allhoff F, Lin P. Nanotechnology & society. Current and emerging ethical issues. New York: Springer; 2009. p. 291-307. 36. Alvarez-Diaz JA. Clinical nanobioethical problems: A value approach. En: Bawa R. Clinical nanomedicine: From bench to bedside. Boca Raton, Florida: Pan Stanford Publishing Pte Ltd; (en prensa). 37. Dolan RJ. On the neurology of morals. Nat Neurosci. 1999;2(11):927-929. 38. Bechara A, Damasio H, Damasio AR, Lee GP. Different contributions of the human amygdala and ventromedial prefrontal cortex to decision-making. J Neurosci. 1999;19(13):5473-5481.

39. Anderson SW, Bechara A, Damasio H, Tranel D, Damasio AR. Impairment of social and moral behavior related to early damage in human prefrontal cortex. Nat Neurosci. 1999;2(11):1032-1037. 40. Bechara A, Damasio H, Damasio AR. Emotion, decision making and the orbitofrontal cortex. Cereb Cortex. 2000;10(3):295-307. 41. Greene J, Haidt J. How (and where) does moral judgment work? Trends Cogn Sci. 2002;6(12):517-523. 42. Casebeer WD. Moral cognition and its neural constituents. Nat Rev Neurosci. 2003;4(10):841-846. 43. Loye D. The moral brain. Brain Mind. 2002;3:133-150. 44. Koenigs M, Young L, Adolphs R, Tranel D, Cushman F, Hauser M, et al. Damage to the prefrontal cortex increases utilitarian moral judgments. Nature. 2007;446(7138):908911. 45. Kanai R, Feilden T, Firth C, Rees G. Political orientations are correlated with brain structure in young adults. Curr Biol. 2011;21(8):677-680. 46. Cortina A. Neurotica: Las bases cerebrales de una tica universal con relevancia poltica? Isegora. 2010;42(1):129148.

Correspondencia: Jorge Alberto lvarez-Daz Direccin: Edificio A, 2. Piso. rea de Postgrados en Ciencias Biolgicas y de la Salud. Calzada del Hueso 1100, Col. Villa Quietud, Del. Coyoacn. CP 04960. Mxico DF, Mxico. Correo electrnico: bioetica_reproductiva@hotmail.com

www.scielosp.org

663

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

simposio: tica biotica y medicina

TICA E INVESTIGACIN
Salomn Zavala1,2,a, Julio Alfaro-Mantilla1,3,b

RESUMEN Los autores hacen una evaluacin crtica de los aspectos ticos de la investigacin en base a su experiencia como docentes universitarios y como miembros de Comits de tica en Investigacin. Invitan a la discusin de temas que consideran polmicos. Comienzan mencionando el rol regulador de las Normas ticas Internaciones y Locales y de los Comits de tica en Investigacin. Comentan la postura de bioeticistas sudamericanos respecto del llamado doble estndar tico y sobre la liberalizacin del uso del placebo. Critican el perjuicio que ocasiona a los pacientes de bajos recursos el sistema de patentes as como la falta de inters en el desarrollo de nuevos medicamentos para tratar enfermedades raras o propias de pases pobres, y la excesiva extensin de los Consentimientos Informados. Terminan opinando acerca de la distribucin de los ensayos clnicos entre los investigadores, los problemas que afectan a los Comits de tica en Investigacin y sobre algunos contenidos del Reglamento de Ensayos Clnicos del Instituto Nacional de Salud. Palabras clave: Biotica; tica mdica; Derechos humanos (fuente: Decs BIREME).

ETHICS AND INVESTIGATION


ABSTRACT The authors make a critical evaluation of the ethical aspects of research based on their experience as university teachers and members of Ethics Committees. They invite to the discussion on topics that they consider polemic. They begin by mentioning the regulatory role of the International and Local Ethical Norms and of the Ethics Committees. They comment on the position of South American bioethicists regarding the so-called ethical double standard and on the liberalization of the use of the placebo. They criticize the damage that the system of patents causes on low- resources patients, as well as the lack of interest in the development of new medications to treat neglected diseases or those diseases which are only prevalent in poor countries, and the excessive length of the Informed Consents. They finish giving their opinion about the distribution of the clinical trials among the researchers, the problems that affect the Ethics Committees and some contents of the Regulation of Clinical Trials of the National Institute of Health. Key words: Bioethics; Ethics medical; Human rights (source: MeSH NLM).

Vinculados desde hace un buen nmero de aos a la docencia universitaria, a la investigacin como ejecutores o asesores y a la vigilancia tica a travs de comits de tica de investigacin, nos permitimos realizar una serie de reflexiones que, si motivan discusiones, controversias, desacuerdos o nuevos enfoques, habrn cumplido sus objetivos.

INVESTIGACIN EN SERES HUMANOS


Desde que Albert Neisser, el investigador alemn que descubri el gonococo, fue juzgado y sancionado en 1898 por haber inyectado suero de enfermos sifilticos a otros pacientes y a prostitutas, sin su consentimiento
3 a
1 2

ni conocimiento, ello como parte de investigaciones orientadas a la prevencin de la sfilis, se han conocido mltiples casos de faltas graves a la tica en investigacin, algunas de ellas con ribetes de escndalo tales como el conocido estudio de Tuskegee (1) o el ms reciente caso de Guatemala (2). En este ltimo, mdicos de los Servicios de Salud de los Estados Unidos infectaron con sfilis y gonorrea a presos, soldados y pacientes de hospitales psiquitricos, sin su consentimiento, con el fin de estudiar el efecto de la penicilina en el tratamiento y la prevencin de esta enfermedad. La inminente publicacin de ese estudio ha provocado que el Gobierno de Estados Unidos pida perdn a Guatemala, pas en el que se realiz el experimento entre los aos 1946 y 1948.

Instituto de tica en Salud, Universidad Nacional Mayor de San Marcos. Lima, Per. Comit de tica de Investigacin, Asociacin PRISMA. Lima, Per. Comit de tica en Investigacin del Hospital Edgardo Rebagliati Martins. Lima, Per. Mdico Internista; b Mdico Neurlogo

Recibido: 08-11-11

Aprobado: 23-11-11

664

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

tica e investigacin

El desarrollo de las normas ticas y jurdicas universales, entre ellas el Cdigo de Nuremberg, la Declaracin de Helsinki, el Informe Belmont y la Declaracin Universal sobre Biotica y Derechos Humanos de la UNESCO aspiran a limitar y controlar los abusos en la utilizacin de las ciencias y las tecnologas asociadas a las biotecnologas, limitar las tendencias invasivas del mercado, e impulsar y proteger los derechos fundamentales de las personas. Al respecto, los principios ticos generales que rigen la investigacin en seres humanos, de acuerdo con la Council for International Organizations of Medical Sciences (CIOMS), son tres: a) El respeto absoluto por las personas, fundamentalmente referida a la autonoma del sujeto quien debe decidir libremente su participacin, y aun si ha decidido participar, pueda decidir su retiro del estudio si as lo cree conveniente; y la proteccin de las personas vulnerables, es decir, con autonoma limitada, a quienes se les debe ofrecer las seguridades del caso; b) Beneficencia, referida a la obligacin tica de maximizar los beneficios y disminuir la probabilidad de dao, es decir que una investigacin no sea nunca maleficente; y, c) Justicia, particularmente la que considera la distribucin equitativa de los riesgos y beneficios del estudio entre todos los participantes (3). Con la misma finalidad se establecieron los comits de tica en investigacin (CEI), definidos como Un grupo multidisciplinario e independiente de profesionales de la salud, as como de otros campos del conocimiento, y miembros de la comunidad, que tiene por objetivo contribuir a salvaguardar la dignidad, los derechos y el bienestar de los participantes actuales y potenciales de la investigacin, asegurando que los beneficios e inconvenientes de la investigacin sean distribuidos equitativamente entre los grupos y clases de la sociedad, y resguardando la relevancia y correccin cientfica del protocolo de investigacin que se somete a su consideracin (4). En Per, el Ministerio de Salud a travs del Instituto Nacional de Salud (INS) es el ente regulador de los ensayos clnicos.

exitosamente, sin objeciones ticas y con ventajas para pacientes, instituciones e investigadores; aunque hay quienes sostienen que la extensin de los ensayos clnicos a los pases en desarrollo se debe a que en estos las regulaciones son ms laxas y el costo de la investigacin es menor (5). A la industria farmacutica se le atribuyen, en algunos casos, maniobras destinadas a incrementar sus ganancias extendiendo la vigencia de sus patentes y acelerando la conclusin de investigaciones para conseguir la aprobacin de medicamentos que, despus se comprueba, no tienen la eficacia atribuida y producen efectos adversos que obligan a suspender su comercializacin (6). En recientes eventos realizados en nuestro pas, los expertos en Biotica, Juan Carlos Tealdi, y Volnei Garrafa (7-10) llamaron la atencin y denunciaron la poltica de los Institutos de Salud de los Estados Unidos y de la U.S. Food and Drug Administration (FDA), acusndolos de crear el llamado doble estndar, una tica para los pases ricos y otra para los pases pobres, refirindose a investigaciones realizadas en algunos pases en desarrollo en pacientes con VIH, y de haber impulsado la liberalizacin del uso del placebo. El sistema de patentes, aceptado sin objeciones en empresas de negocios, en el caso de la industria farmacutica impide que millones de personas de bajos recursos puedan beneficiarse de nuevos medicamentos para aliviar sus males, sin poder disponer de los llamados genricos, de mucho menor costo. Esta situacin no tiene coherencia con frases tales como la que inicia la Declaracin de Helsinski: La ciencia debe estar al servicio de la humanidad, por lo que de algn modo tendr que cambiar en el futuro. Tiene sentido que el sacrificio de los pacientes que participan en los ensayos clnicos y el esfuerzo de los miembros de los comits de tica, que actan por altruismo, sirva primariamente para incrementar los ingresos de los accionistas de las empresas farmacuticas? PRIORIDADES DE INVESTIGACIN Quin establece las prioridades sobre el tipo de drogas o en que rea de accin se debe investigar? Si se sigue la mentalidad de un inversionista, es lgico y legtimo que la prioridad est dada por los probables rditos que la droga, si es exitosa, rendir. Esto depender, entre otras variables, de la frecuencia y tiempo de uso. Una droga que tenga alta frecuencia de uso y se administre por tiempo prolongado, como puede ser un frmaco para tratar la hipertensin arterial, enfermedad que como sabemos, salvo rarsimas excepciones, se

PROBLEMAS BIOTICOS ACTUALES EN INVESTIGACIN CIENTFICA


VNCULO CON LA INDUSTRIA FARMACUTICA La necesidad de acortar la duracin de los estudios de investigacin sobre medicamentos, aunada al alto nivel cientfico alcanzado por los profesionales de muchos pases del tercer mundo, el Per entre ellos, ha permitido el desarrollo de ensayos clnicos multicntricos que actualmente se llevan a cabo

665

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

Zavala S & Alfaro-Mantilla J

controla pero no se cura, prometer mayor rdito econmico. Esto ha dado lugar a que las enfermedades crnicas no trasmisibles sean las que generen mayor inters para la bsqueda de frmacos en investigacin. Medicamentos hurfanos y enfermedades raras. Se llama as a medicamentos para enfermedades raras, cuya poca frecuencia en la poblacin general hace que no sean de inters para la industria farmacutica. El bajo nmero de pacientes a los que se dirigir el frmaco, representa una dificultad, primero a nivel de desarrollo (por ser poco numeroso el grupo de pacientes en los que se podr estudiar la eficacia del frmaco), y tambin por la baja rentabilidad que conllevar la inversin. Por tanto, las autoridades sanitarias asumen que es preciso proteger su desarrollo e incentivarlo con fondos pblicos, ya que estos pacientes, aunque escasos, tienen el mismo derecho a la salud que otros con enfermedades ms comunes. Estos medicamentos que necesitan una especial atencin para desarrollarse se denominan medicamentos hurfanos, porque han de cuidarse como si fuesen nios sin padres (11). Se afirma que hay unas 5000 enfermedades raras, generalmente debidas a alteraciones genticas para cuyo tratamiento no existen frmacos. Esto dio lugar en los EE.UU. en 1983, a la llamada Orphan Drug Act (12), para tratar de corregir esta deficiencia. As, por ejemplo, se plante una reduccin de impuestos del 50 %, para la inversin en este tipo de investigacin. Se sabe

tambin que Japn, Australia y la Unin Europea estn elaborando un reglamento para estos incentivos. Sin embargo, hay otras enfermedades, nada raras o infrecuentes, para las cuales no hay estudios farmacolgicos pese a su urgente necesidad de atencin. Preguntmonos, por ejemplo, cunto tiempo hace que no tenemos un nuevo frmaco para el tratamiento de la tuberculosis? Como este vaco no puede quedar sin cobertura de manera indefinida tenemos ms preguntas: Quin debe cubrirlo, los gobiernos, las universidades, o se debe estimular o crear mecanismos como el planteado por el Orphan Drug Act? Extensin del consentimiento informado. Cuntas veces hemos escuchado a miembros de los CEI comentar lo difcil que se les hace revisar consentimientos informados de los protocolos de ensayos clnicos, de 25 a 30 pginas de extensin, y preguntarse si el participante realmente lee y entiende todo su contenido o calcular cunto tiempo le tomar al investigador explicarles todo el contenido a cada uno de ellos? Nos parece que la extensin responde, en gran parte, a la necesidad de cubrir los posibles conflictos o reclamos que pudieran surgir, por ello estimamos que son los asesores legales los que tienen importante participacin en su diseo Se podr encontrar un punto medio de equilibrio?

Tabla 1. Modelo de consentimiento informado para investigacin clnica.


Investigador responsable Ttulo del protocolo Ttulo del acta del consentimiento Se me ha solicitado participar en un estudio de investigacin que est estudiando ..(describir brevemente en trminos corrientes los procedimientos en los cuales el sujeto est de acuerdo) YO ENTIENDO QUE: A) Los posibles riesgos de este procedimiento incluyen ( se confecciona una lista de los riesgos conocidos o de los efectos colaterales; si no hay tales riesgos, esto debe establecerse). Los tratamientos alternativos incluyen ( confeccionar una lista de tratamientos alternativos y describir brevemente las ventajas y desventajas de cada uno: si no existieran, esto debe establecerse) B) Los posibles beneficios que tendr en este estudio son: (enumerarlos; si no hay beneficios, esto debe establecerse). C) Cualquier pregunta que yo quisiera hacer en relacin a mi participacin en este estudio deber ser contestada por (deber hacerse una lista de nombres y cargos de personas que debern responder a las preguntas). D) Yo podr retirarme de este estudio en cualquier momento sin dar razones ni tampoco sin que esto me perjudique. E) Los resultados de este estudio pueden ser publicados, pero mi nombre o identidad no ser revelada y mis datos clnicos y experimentales permanecern en forma confidencial, a menos que mi identidad sea solicitada por ley. F) Mi consentimiento est dado voluntariamente sin que haya sido forzado u obligado. G) En el caso que sea daado fsicamente como resultado del estudio, la atencin y el tratamiento mdico sern proporcionados en esta institucin. Fecha Paciente o responsable legal Investigador o mdico responsable

666

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

tica e investigacin

Un ejemplo que puede ser til para la comprensin del lector, es el que encontramos en el libro tica clnica de la Universidad de Chile, pgina 163d, de C. Quintana y M. Lavados (13) que citamos en la Tabla 1. Una alternativa podra ser agregar un resumen del documento de consentimiento informado en el que se exprese con toda claridad: que es una investigacin, que como toda investigacin implica riesgos aunque sean mnimos, que su participacin es voluntaria y en qu consiste su participacin. Esto es lo que los participantes debieran necesariamente comprender y recordar. Lo dems del documento lo podran consultar, leer y releer tanto como quieran. Nmero de protocolos por investigador. Existe un nmero lmite de protocolos que un mismo investigador puede tener en un momento dado? Aqu existen varias situaciones: a) El investigador tiene varios protocolos, pero solo uno o dos pacientes por cada uno; o b) El investigador tiene varios protocolos y un buen nmero de participantes por cada uno de ellos. Desde luego que, mientras ms estudios estn a cargo de un investigador, mayor ser el riesgo de que cometa algn descuido o error. Sin embargo, un investigador experimentado con muchos estudios en su haber genera ms confianza que un novato con un solo estudio. Por lo tanto el nmero de estudios no puede ser el nico criterio. Las insinuaciones de democratizar la investigacin, es decir repartir equitativamente? los ensayos clnicos entre los mdicos interesados, aparte de ser un absurdo, hace pensar que las crticas que se hacen a los investigadores que llevan muchos estudios tiene otras motivaciones. Controlar que los investigadores no descuiden su trabajo asistencial es tarea de sus jefes y autoridades y ese control debe ser naturalmente muy estricto. Por qu un investigador es requerido para hacer varios estudios a la vez? Esto generalmente se debe a razones como el prestigio personal, confianza ganada en investigaciones previas, contar con un buen nmero de investigadores secundarios y con una buena organizacin de apoyo y auxiliares, trabajar en un servicio con alta demanda de los pacientes requeridos, etc. Al margen de las razones o explicaciones mencionadas, creemos que quien debe establecer el lmite de protocolos a realizar en un mismo periodo, es el propio investigador, basado en su sentido de responsabilidad y tica profesional. Los CEI estn facultados para poner un lmite considerando cada caso particular. Comits de tica en investigacin. En la actualidad, segn la relacin que publica el INS en su pgina

web (14), en el Per existen 30 CEI aprobados. De estos, doce pertenecen a hospitales pblicos, ocho a institutos nacionales como: Instituto de Salud del Nio, Instituto Nacional de Enfermedades Neoplsicas, Instituto Nacional de Oftalmologa, Instituto Nacional de Rehabilitacin, Instituto de Ciencias Neurolgicas. Instituto Materno Perinatal e Instituto de Salud Mental; seis a organismos no gubernamentales (ONG): Instituto de Investigacin Nutricional, PRISMA, IMPACTA, VIA LIBRE, Piura y el NAMRU-6; y 4 pertenecen a universidades: Nacional Mayor de San Marcos (UNMSM), Peruana Cayetano Heredia, San Martin de Porres y el Instituto D. A. Carrin de la UNMSM. Compensacin a los miembros de los CEI. Un problema que rara vez se toca respecto a los CEI es qu tipo de compensacin deben recibir sus miembros por su participacin? En algunos hospitales, a los miembros del CEI se les asigna horas laborales que apenas alcanzan a cubrir su participacin en las sesiones, mas no se les reconoce el tiempo que dedican a la lectura de los protocolos, la bsqueda de informacin relacionada y la elaboracin de su informe. Estipendio a los miembros de los comits. Nuestra propuesta es que la autoridad regulatoria establezca una modalidad de compensacin que sea razonable y uniforme. Los recursos existen puesto que segn el Reglamento de Ensayos Clnicos del INS (15) los comits Pueden cobrar una tarifa para cubrir sus costos operativos, aunque, por ahora, y por lo menos en algunos Comits, tenemos informacin directa de que el dinero recaudado no est llegando a su destino. La modalidad de dieta por asistencia a las sesiones tendra la ventaja de contribuir a asegurar el qurum. En los CEI privados tenemos informacin que en solo dos de ellos se asigna a los miembros un estipendio, ms simblico que real, por el tiempo que dura su intervencin. Tal vez por concepto de lucro cesante, siendo el presidente quien recibe una mayor cantidad en proporcin a su dedicacin. Si tomamos en cuenta el tiempo dedicado, los conocimientos requeridos y la responsabilidad implcita, este tema debera discutirse en cada comit para ver cmo se resuelve, sin pensar equivocadamente que no es tico recibir una compensacin ya que esta corresponde al tiempo dedicado a la tarea y no por la naturaleza de su opinin. Independencia de los comits. Una de las caractersticas que diferencia a los CEI de los dems comits hospitalarios es que aquellos requieren un alto grado de independencia para poder cumplir

667

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

Zavala S & Alfaro-Mantilla J

con la obligacin de proteger a los sujetos de investigacin. Sin duda, por falta de conocimiento, algunos directivos, cometiendo falta grave, han cambiado abruptamente a los miembros de su comit por no ser de su agrado. El Reglamento de Ensayos Clnicos. En el Reglamento de Ensayos Clnicos del Instituto Nacional de Salud (16) se extraan algunos tems que regulen las obligaciones de las instituciones de investigacin tales como el apoyo a los comits, el respeto a su independencia, la implementacin de los centros de investigacin, el uso de los recursos del overhead y su vinculacin con el INS, etc. Overhead. Las instituciones de investigacin cobran a los patrocinadores de ensayos clnicos un monto equivalente a un porcentaje del presupuesto total del estudio, mal llamado overhead (costos indirectos) por concepto de utilizacin del campo clnico. Uno de los tantos aciertos del Reglamento de Ensayos Clnicos es la Dcima Segunda Disposicin Complementaria: Fondo Intangible para Fines de Investigacin (17) por la cual se dispone que Los fondos provenientes del contrato entre la institucin del sector pblico y el patrocinador sern considerados como fondo intangible para fines de investigacin, actividad que no suele ser prioritaria Se estar cumpliendo? Tesis universitarias. Respecto a las tesis universitarias, los CEI tropiezan con un problema que dificulta su actividad: las tesis, en su gran mayora, tienen fallas metodolgicas que no han sido corregidas por sus asesores o instituciones. Si una investigacin no es metodolgicamente correcta no puede ser tica y, por ende, no debe ser autorizada. Supervisin de ensayos clnicos. El INS exige a los CEI supervisar el desarrollo de los ensayos clnicos. Robert Levine ha argumentado contra la supervisin de rutina por parte de los CEI diciendo lo siguiente: Puede afectar la atmsfera de confianza entre el comit y los investigadores, los procedimientos de monitoreo son indebida o inconvenientemente costosos y convertiran al comit en una fuerza fiscalizadora, cuando su mayor valor es educacional (18). Ninguno de los documentos regulatorios internacionales conocidos ni de publicaciones relacionadas menciona supervisin como una actividad propia de los CEI (19). Hablan de continuing review cuya traduccin literal es revisin continuada, a travs de los informes que los investigadores envan por obligacin con una periodicidad que los comits establecen para cada estudio, por lo menos una vez al ao.

Consideramos que el mayor valor de un CEI es su composicin multiprofesional y variopinta que le permite deliberar considerando todos los puntos de vista y tomar las mejores decisiones. Sus miembros actan motivados por altruismo, una facultad que se les puede agradecer, pero no exigir sin lmites. Cuando es preciso, ejercen su autoridad, que les permite revisar documentos, historias clnicas, visitar los sites (instituciones donde se realiza el ensayo clnico), solicitar informes, entrevistar a pacientes e investigadores, etc., y as cumplir con su obligacin a cabalidad. Por otro lado, los gerentes o directores de los hospitales estn presionados para cumplir con las metas y para aumentar la productividad de sus instituciones y en ese contexto no tienen disposicin para sacrificar horas mdicas por algo que no les interesa directamente. Parece que a nadie le importara establecer el costo de las actividades que realizan los miembros de un comit, considerando el valor de su tiempo en razn de su nivel profesional, a pesar de que sin ese conocimiento no se puede planificar adecuadamente. El resultado podra ser sorprendente.

REDCEI
Los CEI en nuestro medio estn agrupados, por propia iniciativa, en una Institucin denominada REDCEI que no tiene precedentes en otros pases. La finalidad de la REDCEI es establecer un vnculo entre los comits de tica en investigacin que la conforman para compartir conocimientos, experiencias, informacin, opiniones y facilidades para el mejor desempeo de sus funciones. Esta finalidad se ha cumplido exitosamente gracias principalmente al empeo y compromiso de sus coordinadoras, Roxana Lescano y Estela Quiroz. La REDCEI en el Per ha sabido mantener su independencia respecto de la industria farmacutica y de la propia autoridad regulatoria.

REFERENCIAS BIBLIOGRFICAS
1. Brandt AM. Racism and research: the case of the Tuskegee study. En: Emanuel EJ, Crouch RA, Arras JD, Moreno JD, Grady C, editors. Ethical and Regulatory Aspects of Clinical Research. 1ra ed. Baltimore: The Johns Hopkins University Press; 2003. p. 20-4. 2. Stein R. U.S. apologizes for newly revealed syphilis experiments done in Guatemala. Washington Post. USA; Octubre 1, 2010. 3. Council for International Organizations of Medical Sciences (CIOMS), Word Health Organization (WHO). International ethical guidelines for biomedical research involving human subjects. Geneva: CIOMS; 2002.

668

Rev Peru Med Exp Salud Publica. 2011;28(4):664-69.

tica e investigacin

4. Vidal S. Comits de tica de la investigacin. En: Tealdi JC (director). Diccionario Latinoamericano de biotica. Bogot: UNESCO-Universidad Nacional de Colombia; 2008. 5. Donohue JM, Cevasco M. A decade of direct-to-consumer advertising of prescription drugs. N Engl J Med. 2007; 357(7):673-81. 6. Topol EJ. The lost decade of nesiritide. N Engl J Med. 2011;365(1):81-2. 7. Garrafa V. Fortalecimiento de los Comits de tica en Investigacin en el Per. Simposio Internacional del INS. Lima, Per. Instituto Nacional de Salud. 2010. 8. Tealdi JC. Seminario de Biotica y Derechos Humanos. Observatorio de Biotica y Derechos Humanos. Lima, Per. Pontificia Universidad Catlica del Per. 2010. 9. Tealdi JC. Investigacin en Salud. En: UNESCO; Red Latinoamericana y del Caribe de Biotica. Seminario de Biotica y Derechos Humanos. Bogot, Colombia. Universidad Nacional de Colombia. 2008. 10. Garrafa V, Lorenzo C. Helsinki 2008. Una Visin Crtica Latinoamericana. Biotica & Debat (Instituto Borja). 2009;18:5-13. 11. Sommi RW Jr. The story of orphan drugs. Current Health. 1990;16(8):14. 12. U.S. Food and Drug Administration, Department of Health and Human Services. The Orphan Drug Act. Silver Spring, MD: FDA; c2011. 13. Quintana C, Lavados M. tica clnica. Santiago: Universidad de Chile; 1993. 14. Instituto Nacional de Salud del Per. Reglamento de ensayos clnicos. Lima: Instituto Nacional de Salud; 2011.

15. Instituto Nacional de Salud del Per. De los Comits de tica en Investigacin. Captulo VII. En: Instituto Nacional de Salud. Reglamento de Ensayos Clnicos. 1d ed. Lima: Instituto Nacional de Salud; 2010. p. 51-1. 16. Instituto Nacional de Salud del Per. De las Personas y Entidades que participan en la Ejecucin de los Ensayos clnicos. Ttulo IV. En: Instituto Nacional de Salud. Reglamento de Ensayos Clnicos. 1d ed. Lima: Instituto Nacional de Salud; 2010. p. 42-54. 17. Instituto Nacional de Salud del Per. Disposiciones Complementarias. En: Instituto Nacional de Salud. Reglamento de Ensayos Clnicos. 1d ed. Lima: Instituto Nacional de Salud; 2010. p. 82-2. 18. Weijer CH, Shapiro SH, Fuks A, Glass KC, Skrutkowska M. Monitoring clinical research: an obligation unfulfilled. En: Emanuel EJ, Crouch RA, Arras JD, Moreno JD, Grady C, editors. Ethical and Regulatory Aspects of Clinical Research. 1ra ed. Baltimore: The Johns Hopkins University Press; 2003. p. 425-5. 19. Amdur RJ, Bankert EA. Continuing review of research. En: Institutional Review Board. Member Handbook. 1a ed. Massachusett: Jones and Bertlett publishers; 2007. p. 53-5.

Correspondencia: Julio Alfaro-Mantilla Direccin: Avenida Prez Aranbar 1032, Magdalena del Mar. Lima, 17 Telfono: (51) 264-0516/264-2896 Correo electrnico: jucam@amauta.rcp.net.pe

669

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

simposio: tica biotica y medicina

TICA Y MEDICINA: LA EXPERIENCIA DEL COLEGIO MDICO DEL PER


Alfonso Mendoza F1,2,a
RESUMEN En este artculo se muestra la labor del Colegio Mdico del Per en lo referente a los procedimientos tico disciplinarios, pero tambin cmo, ms all del control tico, la Orden ha promovido (va un conjunto de acciones) una atencin de salud tcnicamente competente a la vez que respetuosa de la dignidad y de los derechos fundamentales de la persona. De ese conjunto forman parte el establecimiento del Da del Paciente, el nfasis en el mejoramiento de la calidad y la seguridad en la atencin de los usuarios de los servicios de salud, la iniciativa para prevenir y tratar los eventos adversos, la regulacin y perfeccionamiento de la formacin del mdico tanto en el pre como en el posgrado, y la demanda por la instauracin de un ptimo sistema de salud y de polticas que hagan realidad el derecho a la salud en el marco de los principios de la Biotica. Palabras clave: tica mdica; Mejoramiento de la calidad; Derechos humanos; Biotica (fuente: Decs BIREME).

ETHICS AND MEDICINE: THE EXPERIENCE OF THE PERUVIAN MEDICAL ASSOCIATION


ABSTRACT This article shows the work of the Peruvian Medical Association with respect to ethical disciplinary procedures, but also shows how, beyond the ethical control, the Order has promoted through a set of actions, a technically competent health care that respects the dignity and fundamental human rights. Part of these actions are the establishment of the Patients Day, the emphasis in improving the quality and safety in the care of the users of the health services, the initiative to prevent and treat adverse events, the regulation and improvement of the physicians training both in pre as in postgraduate levels, and the demand for the establishment of an optimal health system and policies that will realize the right to health in the context of the principles of bioethics. Key words: Ethics, medical; Quality improvement; Human rights; Bioethics (source: MeSH NHL).

LA TICA MDICA
La tica Mdica, en una perspectiva ms propiamente deontolgica, alude al conjunto de normas de comportamiento que enmarcan el quehacer de los miembros de la profesin mdica en sus relaciones con quienes demandan sus servicios y de aquellas que se establezcan entre s (1). Tal como sealbamos en un reciente artculo (2) el impresionante desarrollo de la ciencia y de la tecnologa mdica, la tendencia a la superespecializacin y la transformacin de los hospitales en centros de alta tecnologa, a menudo teidos de un sesgo empresarial, han modificado radicalmente la relacin mdicopaciente y la relacin entre la medicina y la sociedad. Tambin han contribuido a estos cambios la toma de conciencia por parte de los pacientes de su derecho a la salud; la introduccin de las leyes del mercado y
1 2

la aplicacin acrtica del modelo industrial con nfasis inadecuado en criterios de productividad antes que de calidad de la atencin.

LAS FUNCIONES DEL COLEGIO MDICO DEL PER


DE SUS FINES La Ley N. 15173 del 16 de octubre de 1964, por la cual se crea el Colegio Mdico del Per (CMP) (3), precisa en su Art. 5., que constituyen fines de la Orden, entre otros, el velar para que el ejercicio profesional se cumpla de acuerdo con las normas deontolgicas contenidas en el Cdigo de tica profesional que el Colegio dicte; propender a mejorar la salud individual y colectiva de los habitantes del pas; contribuir al avance de la ciencia mdica y cooperar

Comit de Vigilancia tica y Deontolgica, Consejo Nacional, Colegio Mdico del Per. Lima, Per. Instituto de tica en Salud, Universidad Nacional Mayor de San Marcos. Lima, Per. a Mdico Psiquiatra, Magister en Ciencias Familiares y Sexolgicas

Recibido: 05-10-11

Aprobado: 23-11-11

670

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

Procesos tico disciplinarios en Per

con los poderes pblicos en la defensa de la salud, procurando que la asistencia facultativa alcance a todo el pas. Desde que, en la prctica, el CMP iniciara su funcionamiento hacia 1969, se ha esmerado en el cumplimiento de sus fines, contribuyendo al mejoramiento de la salud individual y colectiva a travs de diversas acciones. DEL CDIGO DE TICA Y DEONTOLOGA DEL COLEGIO MDICO DEL PER El primer Cdigo de tica del Colegio data del ao 1969, el que, recogiendo los principios y valores que prevalecan entonces, orientaba la conducta de los mdicos hacia la procura del bienestar para los pacientes (principio de beneficencia), pero en el marco de una relacin de corte paternalista, en la que el mdico decida lo que consideraba mejor para el paciente, sin que la opinin de este tuviera la relevancia que tiene hoy. Los radicales cambios experimentados por la Medicina en las ltimas dcadas condujeron a la Orden a la actualizacin del Cdigo primigenio. As, el 5 de octubre del ao 2000, entr en vigencia un segundo Cdigo (4). Este fue, y se trata de un aspecto que merece resaltarse, el resultado de un amplio e intenso debate que se inici cuatro aos antes de su aprobacin y en el que particip no nicamente la profesin mdica sino tambin la sociedad civil, a travs de representantes de instituciones pblicas y privadas relacionadas con la salud. Proceder de otro modo hubiera significado violentar la esencia misma de la tica que, siguiendo a Gracia (5), debe ser civil o secular, pluralista, autnoma y racional. Como fruto de este consenso se incorporaron los principios de la biotica, los derechos de los pacientes, la prohibicin expresa de participar en actos de lesa humanidad, la defensa de la competencia tica del Colegio Mdico sobre cualquier otra jurisdiccin, y la responsabilidad social compartida del mdico, la sociedad y el Estado para garantizar el derecho a la salud de todas las personas. Pero, como el impulso tico no puede quedarse fijado, una nueva revisin hizo posible la dacin del actual Cdigo que, aprobado el 2007 (6), entr en vigencia el ao 2008. El nuevo Cdigo desarrolla ms ampliamente lo concerniente a los derechos de los pacientes y los conceptos de la biotica

cuanto de sus veintisiete consejos regionales, tiene la obligacin de difundir y vigilar el cumplimiento de la Ley, Estatuto, Reglamento, Cdigo de tica y Deontologa y cualquier norma o acuerdo emanado del Consejo Nacional o de los Consejos Regionales en su caso. Si el CVED hallara indicios de transgresin a las normas antedichas, solicitar la apertura del procedimiento tico disciplinario, a cargo del Comit de Asuntos Contenciosos y Procedimientos Disciplinarios (CACYPD). El Reglamento indica el procedimiento a seguir en estos casos, el cual guarda similitud con lo establecido en los procesos judiciales, en salvaguarda de los derechos fundamentales del colegiado: presuncin de inocencia, reserva del procedimiento, resolucin absolutoria o sancionatoria fundamentada y derecho a la doble instancia. En respuesta a estos problemas, el CMP ha venido desarrollando diversas actividades educativas, tanto en Lima como en las diversas regiones del pas, a fin de fortalecer la vigilancia tica, apelando, en primer lugar, a la prevencin, va el mejoramiento de la calidad de la formacin del mdico y de su actualizacin permanente a travs de los procesos de acreditacin de facultades de medicina y de recertificacin profesional (hoy obligatoria por mandato de la Ley del SINEACE), y, en segundo lugar, mediante seminarios, talleres y cursos en los que, de manera prctica e interactiva, se busca capacitar en el mtodo de la deliberacin, segn el modelo de Gracia (7) que permita, partiendo de lo que tcnicamente es posible, deliberar sobre la mejor lnea de accin deseable, articulando el conocimiento mdico, es decir la competencia tcnica, con la reflexin tica y las limitaciones y posibilidades dadas por la ley, todo lo cual contribuir el mejoramiento de la calidad y la seguridad en la atencin de las personas. En el caso especfico del crecimiento desmesurado de las facultades de medicina, el CMP alent la creacin y funcionamiento de la Comisin para la Acreditacin de Facultades o Escuelas de Medicina (CAFME), en busca de la mejora de la calidad y la excelencia acadmica, tanto en el pre como en el posgrado, y fue el primer Colegio Profesional en instaurar el Sistema de Certificacin y Recertificacin Profesional (SISTCERE). Para darle sustento a sus propuestas el CMP propici el ao 2007 una rigurosa investigacin (8) sobre el tema y present una iniciativa legislativa orientada a suspender temporalmente la creacin de nuevas entidades formadoras, demanda que no se concret por la debilidad de las instancias de gobierno encargadas de regular la formacin de recursos humanos.

LA VIGILANCIA TICA Y DEONTOLGICA


EL CONTROL TICO DEONTOLGICO El CMP, a travs de sus comits de vigilancia tica y deontolgica (CVED), tanto del Consejo Nacional

671

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

Mendoza A

LOS PROCEDIMIENTOS TICO DISCIPLINARIOS


Entre los aos 2000 y 2001, el CVED del Consejo Nacional examin aproximadamente 90 denuncias y paralelamente hizo un seguimiento de 74 procesos que se ventilaban en el Poder Judicial y que involucraban a 156 mdicos. Asimismo, en el ao 2001, el Comit de Asuntos Contenciosos y Procedimientos Disciplinarios tramit veintinueve casos, contra siete del ao 2000. De ese total, diez fueron archivados, cuatro terminaron en multa para el denunciado, tres en amonestacin privada, seis en amonestacin pblica, uno en proceso judicial y, por primera vez en la historia de la Orden, uno en expulsin. Hace poco, Vliz (9) realiz una investigacin orientada a conocer las caractersticas de las denuncias contra mdicos presentadas al Comit de Vigilancia tica y Deontolgica del Consejo Regional III Lima. Con tal propsito seleccion, por muestreo al azar, 148 (10 %) de un total de 1500 expedientes correspondientes al lapso entre 1980 y 1999, trabajo que revel una tendencia creciente de las denuncias. El examen de las situaciones antecedentes, vale decir de aquellas que motivaron las denuncias, puso en evidencia que el 40 % de estas estaba ligada con actos mdicos y, por lo tanto, tenan que ver en gran medida, con la relacin mdico paciente; un 27 % con problemas en los que haban intervenido los medios masivos de comunicacin; un 16 % giraba en torno a dificultades de relacin interpersonal entre los miembros de la Orden y un 12 % se asociaba con situaciones en las que el problema haba llegado hasta el nivel policial o judicial. Si lo vemos desde la perspectiva de quin hace la denuncia, apreciamos en la Tabla 1 que, cuando se trata de instituciones o autoridades mdicas, el 55 % de las denuncias -hechas por el Consejo Regional III o por los directores de hospitales- tena que ver con transgresiones a los cdigos o reglamentos, y el 31 % con la relacin mdico-paciente, siendo el 9 % pasibles de sancin penal y un porcentaje menor, 5 %, se relacionaba con transgresiones ligadas a factores econmicos. Pero, cuando quienes denuncian son los pacientes o sus familiares, el 73 % de las situaciones tiene que ver con la relacin mdico-paciente. Si vemos estos problemas desde la perspectiva judicial, vale la pena resear los hallazgos de un estudio transversal, realizado entre mayo y junio de 1999, en los 37 Juzgados de Lima, el cual registr la existencia de 190 mdicos procesados, 59 por homicidio culposo, 14 por lesiones culposas y 4 por exposicin o abandono de personas en peligro, lo que representaba el 1,2 %

de los mdicos que por entonces ejercan en Lima, sin considerar los Juzgados del Ministerio Pblico, los de la regin Callao y del Cono Norte. Este es un indicador valioso que nos revela que algunos mdicos estn siendo directamente denunciados al fuero judicial, siendo de suponer que en dichos casos haya un componente tico que sera necesario evaluar. Volviendo a los casos del Consejo Regional III, cuando los denunciantes son los pacientes o sus familiares la mayor crtica se relaciona con culpa (dao no intencional) y luego con dolo (dao por la realizacin intencional de un acto ilcito), seguidos por falsificacin de documentos o por transgresiones referidas a factores econmicos. Cuando los denunciantes son autoridades mdicas, instituciones u otros mdicos, las denuncias inciden en la transgresin de las normas administrativas que rigen el comportamiento de los mdicos en los establecimientos de salud, principalmente pblicos. Entre los aos 2004 2005, el Consejo Nacional examin 51 casos, provenientes de los Comits correspondientes tanto de Lima como de las regiones. Del total de casos, 13 aproximadamente el 20 %, fueron absueltos; un nmero igual retorn a los Comits para su reevaluacin a causa de sendos recursos de apelacin, y 25 mdicos fueron sancionados, seis de ellos con suspensin del ejercicio profesional (alguno por 15 das, otro por un ao). Tabla 1. Denuncias registradas en el Colegio Mdico del Per, 2004-2005.
N Por transgresiones a reglamentos o cdigos de salud (Incluye 17 por publicaciones inadecuadas) Por transgresiones en relacin directa con pacientes (Incluye 7 por intrusismo) Por transgresiones pasibles de sancin penal Por transgresiones econmicas Por pacientes o sus familiares (45 denunciantes, 48 denuncias) Por transgresiones en relacin directa con pacientes Por transgresiones pasibles de sancin penal Por transgresiones econmicas Sin datos 35 6 6 1 48 (73,0) (12,0) (12,5) (2,0) (100,0) (%)

Por instituciones o autoridades mdicas (54 denuncias)* 32 (59,3)

18 5 3 54

(33,3) (9,3) (5,5) (100,0)

* Algunas denuncias pueden ser clasificadas en ms de una categora, por ello el total de la suma no es igual al total mostrado.

672

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

Procesos tico disciplinarios en Per

En el periodo comprendido entre los aos 2006 2007, el total de procedimientos tico disciplinarios evaluados por el Consejo Nacional lleg a 124 casos. De ellos, 59 (47,6 %) fueron absueltos, disponindose el archivamiento del expediente; 36 (25 %), fueron apelados, y reenviados a los Comits; y 29 (22 %) recibieron sanciones, algunas muy severas, tales como amonestacin pblica y suspensin temporal del ejercicio profesional. En todo el periodo, 61 (34,9 %) casos fueron vistos por el Comit de Vigilancia tica Y Deontolgica, y 114 (65,1 %) por el Comit de Asuntos Contenciosos y Procedimientos Disciplinarios. En la Tabla 2 se resumen las procedencias de las sanciones y sus tipos en ambos periodos. Entre los aos 2008 2009 el total de procedimientos tico disciplinarios lleg a 139, contra 124 del periodo precedente. La mayor parte de los casos provenan del Consejo Regional III, Lima, que lleg a 113 denuncias, mientras que el conjunto de casos procedentes de los consejos regionales lleg a 26. Lo importante a resear es que 75 denuncias tenan que ver directamente con el acto mdico, poniendo en evidencia la crisis en el establecimiento de una adecuada relacin mdico-paciente. Las quejas estaban Tabla 2. Procedimientos tico disciplinarios elevados al Consejo Nacional en apelacin, periodo 2004-2007.
20042005 Los casos provienen de Consejo Regional de Lima Consejos Regionales a nivel nacional De oficio por el Consejo Nacional Tipos de sancin Suspensin del ejercicio profesional Amonestacin Pblica Amonestacin Privada Nota de Extraeza Nueva revisin por apelacin Archivo Instancia de supervisin Comit de Vigilancia tica y Deontolgica Comit de Asuntos Contenciosos y Procedimientos Disciplinarios 15 46 61 6 12 5 2 13 13 12 9 4 4 36 59 18 21 9 6 49 72 37 13 1 95 26 3 132 39 4 20062007 TOTAL

ligadas a supuesta negligencia mdica, a la carencia de consentimiento informado o al incumplimiento en la entrega de la historia clnica cuando era solicitada. En 47 casos las denuncias se referan a problemas de relaciones interpersonales entre los propios mdicos, con acusaciones de auditoras mdicas inadecuadas, abuso de autoridad o empleo de expresiones implicando falta de respeto, injuria o difamacin que atentaban contra el honor personal. En trece casos, el propio CMP haba iniciado denuncia de oficio ante casos de diversa ndole (sobre todo presuntos actos de negligencia mdica) que fueron difundidos por los medios radiales, televisivos o periodsticos. Finalmente, en cuatro casos las denuncias se referan a problemas tales como certificados de defuncin, informes mdicos y pericias mdico-legales considerados inexactos o al otorgamiento indebido de descansos mdicos, entre otras situaciones en las que algunas veces los propios establecimientos de salud podan verse cuestionados. Existe la creencia de que los mdicos se protegen entre s y no sancionan. Los datos presentados revelan que no es as. Tambin es verdad que muchas denuncias no tienen sustento y son archivadas, a pesar de lo cual es probable que ellas sigan incrementndose. Dos factores contribuyen a ello: primero, el propio desarrollo de la medicina que, al hacerse ms intervencionista aumenta la posibilidad de accidentes exploratorios o teraputicos y, segundo, el que los pacientes, fascinados por los avances tecnolgicos, han desarrollado una expectativa casi mgica que los lleva a pensar que cualquier problema mdico puede ser resuelto a entera satisfaccin, lo que no siempre es posible, dado que en medicina (ms que en cualquier otra actividad humana) se est siempre expuesto a lo imprevisible.

EL COLEGIO MDICO DEL PER Y LA BIOTICA: MS ALL DE LA VIGILANCIA TICA


Por todo lo expuesto la regulacin de la conducta profesional mediante la aplicacin de los preceptos deontolgicos es insuficiente. Debemos movernos del enfoque casustico, centrado en la relacin mdicopaciente, hacia una tica de las organizaciones sanitarias, ampliando as nuestra mirada de los complejos problemas sanitarios desde una perspectiva sistmica. Mi tesis es que el CMP, recogiendo lo mejor de la tradicin mdica peruana, ha incidido en todos estos mbitos. Los derechos de los pacientes. En el plano de la tica personal, el CMP, reconociendo el derecho de toda persona a recibir una atencin de calidad, introdujo en su Cdigo, como ya lo hemos referido, un captulo referen-

36

78

114

673

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

Mendoza A

te a los derechos de los pacientes, haciendo suya la Declaracin de Huacachina de 1995, en la que los mdicos de la Asociacin Nacional de Mdicos del Ministerio de Salud (ANMMS) los proclamaron dos aos antes de que tales derechos fueran incorporados en la Ley General de Salud de 1997. El consentimiento informado (principio de autonoma). El reconocimiento de la autodeterminacin de los pacientes encuentra su expresin en la doctrina del consentimiento informado, cuya aplicacin ha sido y es- constantemente alentada por el CMP, junto con la recomendacin de velar por un trato digno y respetuoso con el paciente, razn de ser de nuestra profesin. La calidad y la seguridad en la atencin del paciente (principios de beneficencia y no-maleficencia). El principio de beneficencia ha regido desde siempre el quehacer del mdico. Si bien planteado en el Corpus Hippocraticum, el principio de no-maleficencia, inicialmente ligado al de beneficencia, ha ido adquiriendo cada vez mayor importancia en el mundo actual, al punto que, junto al principio de justicia, tiene un correlato jurdico, de manera tal que si el mdico actuara de modo negligente, imprudente o imperito, y de ello resultara dao a la integridad del paciente, aqul tendr que rendir cuenta no solo a la Orden en el plano tico, sino tambin al Poder Judicial y reparar (en lo posible) el dao causado. El CMP, consciente de su papel en este campo, conform el ao 2008 el Comit Impulsor de la Campaa por la Calidad de la Atencin y Seguridad del Paciente, orientado, entre otros objetivos, a Promover una cultura de seguridad y calidad de la atencin en las organizaciones pblicas y privadas de salud, y un trato digno a los usuarios y pacientes, en el marco del respeto a sus derechos y del ejercicio tico de la profesin mdica. El ao 2010, el Consejo Nacional del CMP acord que dicho comit se convirtiera en un Comit Asesor Permanente y, como parte de sus acciones, se busc sensibilizar a las autoridades polticas en torno al tema, por lo que se suscribi un convenio con el Ministerio de Salud, al mismo tiempo que se desarrollaron diversas estrategias de capacitacin a los profesionales de la salud, especialmente a los mdicos, en lo referente a los aspectos ticos, legales y aquellos inherentes a la mejora continua de la calidad y la seguridad en la atencin sanitaria, tales como ciruga segura, higiene de manos, trato digno al usuario y promocin del derecho a la salud. Pero ello no fue todo; en la bsqueda de la disminucin de riesgos en la atencin de salud, el CMP haciendo uso de su derecho a iniciativa legislativa, propuso

la creacin del Programa de Prevencin y Atencin de Eventos Adversos en los establecimientos de salud (10), con la intencin de minimizar los riesgos y garantizar el derecho de los pacientes a recibir de la propia institucin la atencin mdico-quirrgica que su situacin requiriera y al otorgamiento de la ayuda social que le permita afrontar de modo inmediato los efectos del evento adverso, tanto en los servicios mdicos pblicos como en los privados. El Colegio Mdico del Per y la salud pblica (principio de justicia). Para Gostin (11) si la salud es un valor fundamental, entonces los valores de equidad y justicia social exigen una distribucin justa de las condiciones necesarias para que las personas sean saludables, condiciones que incluyan una variedad de factores educativos, econmicos, sociales y ambientales que son necesarios para una buena salud. En esta lnea, el CMP se ha pronunciado desde un inicio por el establecimiento de un sistema de salud integrado, descentralizado, participativo y financiado; por la universalizacin de la seguridad social y el aseguramiento en salud; por el acceso universal a los medicamentos esenciales; por la mejora de la salud pblica, privilegiando a los sectores secularmente excluidos y cuya pobreza los hace ms vulnerables a todo tipo de enfermedades; por el respeto a los derechos de los pueblos amaznicos y otros grupos tnicos que conforman nuestro pas, y cuyos ecosistemas deben ser preservados, establecindose con ellos un dilogo alturado y respetuoso con miras a lograr soluciones concordadas, entre otros temas que forman parte de la agenda sanitaria (12) del CMP y que encuentran una slida fundamentacin en los principios de la biotica y los derechos fundamentales de la persona.

LA FORMACIN EN BIOTICA Y LA CAPACITACIN DE LOS MDICOS EN TEMAS TICOS Y DEONTOLGICOS


El CMP, entre los aos 1998 1999, promovi la formacin de mdicos en Biotica, contando con el valioso apoyo de la Organizacin Panamericana de Salud (OPS) y de la Universidad Nacional Mayor de San Marcos (UNMSM). El ao 2000, la UNMSM inici el Diplomado en Biotica, el cual dio origen entre los aos 2003 y 2004 a la Maestra Internacional de Biotica, dirigida por el profesor Diego Gracia, en un esfuerzo conjunto de la Universidad Complutense de Madrid, la UNMSM, la OPS y el CMP. Con el mismo propsito, el CMP ha venido realizando diversas actividades, principalmente en provincias, a fin de promover la capacitacin en el campo tico y deontolgico. En la ltima dcada se ha llegado a todas las regiones del pas, habindose efectuado

674

Rev Peru Med Exp Salud Publica. 2011;28(4):670-75.

Procesos tico disciplinarios en Per

ms de doscientos cursillos, seminarios y talleres con participacin de renombrados eticistas peruanos y extranjeros. Zavala (13) en su trabajo Para qu sirve la tica?, nos muestra claramente cmo el Cdigo de tica puede ser de gran utilidad en el anlisis de casos y la toma de decisiones adecuadas en la prctica cotidiana. En los ltimos aos la capacitacin en aspectos tico legales se ha conjugado con aquellos orientados al mejoramiento continuo de la calidad y la seguridad del paciente, incidiendo en la tica de las organizaciones sanitarias.

los derechos humanos, retomando el camino sealado por Daniel A. Carrin, paradigma de filantropa, abnegacin y sacrificio.

REFERENCIAS BIBLIOGRFICAS
1. Lolas, F. Biotica. Santiago de Chile: Editorial Universitaria; 1998. 2. Mendoza A. Fundamentacin de la enseanza de la tica mdica y la biotica clnica. Acta md peruana. 2009;26(2):131-34. 3. Colegio Mdico del Per. Ley de Creacin y Modificacin. Estatuto. Reglamento. Cdigo de tica y Deontologa. Trabajo Mdico, Ley y Resolucin. Ley General de Salud. Lima: Consejo Nacional del CMP; 2008. 4. Colegio Mdico del Per. Cdigo de tica y Deontologa. Lima: Consejo Nacional del CMP; 2000. 5. Gracia D. Planteamiento general de la biotica. En: Couceiro A (editora). Biotica para clnicos. Madrid: ed. Triacastela; 1999. p. 19-35. 6. Colegio Mdico del Per. Cdigo de tica y Deontologa. Lima: Consejo Nacional del CMP; 2007 7. Gracia D. La deliberacin moral. El papel de las metodologas en tica. En: Asociacin de Biotica Fundamental y Clnica (editores). Jornada de Debate sobre Comits Asistenciales de tica. Madrid: Direccin General del Instituto Nacional de Salud; 1999. p. 21-41. 8. Carrasco V, Lozano E, Velsquez E. Anlisis actual y prospectivo de la oferta y demanda de mdicos en el Per 2005-2011. Acta md peruana. 2008;25(1):22-9. 9. Vliz J. Caractersticas de 148 denuncias presentadas al Comit de Vigilancia tica y Deontolgica del Consejo Regional III del Colegio Mdico del Per. Acta md peruana. 2000;20(1):40-7. 10. Castro J, Carrasco V (editores). Memoria Gestin 2008-2009. Lima: CMP; 2010. 11. Gostin L. Teoras de la justicia y responsabilidad social en salud pblica. En: Mlaga H, editor. Salud Pblica. Enfoque Biotico. Caracas: editorial Disinlimed CA; 2005. p. 21-32. 12. Colegio Mdico del Per. Aportes del CMP a la Salud Pblica del pas. En: Castro J, Carrasco V (editores). Memoria Gestin 2008 2009. Lima: CMP; 2010. p. 3044. 13. Zavala S. Para qu sirve la tica? Acta md peruana. 2008;25(1):48-9. 14. Mendoza A. Da del Paciente. Acta md peruana. 2010;27(2):144-7.

EL DA DEL PACIENTE
El 22 de diciembre de 2010, el Ministerio de Salud, mediante Resolucin Ministerial N. 1009, instituy el 13 de agosto de cada ao como el Da del Paciente en el Per. Fue el Decano actual de la Orden, Dr. Ciro Maguia, el gestor de la idea, la cual fue aprobada por el Consejo Nacional en marzo de 2010. A peticin del Decano Nacional tuve el honor de preparar la Exposicin de Motivos correspondiente, para el Proyecto de Ley que fue elevado al Congreso Nacional. Transcribo parte del prrafo final, el que puede leerse como las conclusiones a todo lo expuesto (14). Frente a ello, y como parte del movimiento en favor de la humanizacin de la atencin de salud, que se expresa en un trato digno y la oferta de una asistencia sanitaria segura y de calidad, el CMP propone el establecimiento del Da del Paciente, el 13 de agosto, como un da destinado a suscitar una profunda reflexin tanto en cuidadores como en pacientes sobre el valor de la vida y por extensin de la salud, y sobre el significado de estar enfermos y las responsabilidades que en el cuidado de la salud competen al paciente, los profesionales de la salud, la sociedad y el Estado. Ese da se organizar en todos los establecimientos de salud del pas una serie de actividades asistenciales, tanto de promocin de la salud cuanto de prevencin de la enfermedad, as como jornadas orientadas a proveer informacin en torno a los derechos de los pacientes, y a deliberar sobre el modo cmo cuidadores y pacientes pueden cambiar el sistema de salud insertndolo en el marco de una atencin segura y de calidad y respetuosa de

Correspondencia: Alfonso R. Mendoza Fernndez Direccin: Las Palmeras 305 Dpto. 901, Lima 27, Per Telfono: (511) 4420139 / 999098291 Correo electrnico: alfonsomendozaf@yahoo.com

675

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

seccin especial

AVANCES Y RETOS EN EL REGISTRO DE ENSAYOS CLNICOS EN AMRICA LATINA Y EL CARIBE


Ludovic Reveiz1,a, Carla Saenz1,b, Renato T. Murasaki2,c, Luis G. Cuervo1,d, Luciano Ramalho2,e
RESUMEN Los registros de ensayos clnicos (EC) constituyen una de las mayores fuentes de informacin de investigaciones en intervenciones en salud que se han o se estn llevando a cabo en el mundo. La Organizacin Mundial de la Salud estableci un conjunto mnimo de datos que se deben registrar (20 tems), consensuado a nivel internacional con las partes interesadas, y estableci una red de registros primarios y de registros asociados. Existen actualmente dos registros primarios en las Amricas (Brasil y Cuba) avalados por la OMS, adems del registro ClinicalTrial.Gov (de los Estados Unidos de Norteamrica) que aportan datos a la plataforma internacional de registros de EC de la OMS (ICTRP). Adicionalmente, hay avances importantes en la regin relacionados con las regulaciones, el desarrollo e implementacin de registros nacionales y la adhesin de comits de tica y editores a la iniciativa. Palabras clave: Ensayo clnico; tica; Legislacin como asunto; Sesgo de publicacin (fuente: DeCS BIREME).

PROGRESS AND CHALLENGES OF CLINICAL TRIALS REGISTRATION IN LATIN AMERICA AND THE CARIBBEANS
ABSTRACT Clinical trial registries are one of the main sources of information concerning health research interventions that have been or are being carried out throughout the world. The World Health Organization (WHO) established a minimum data set to be recorded (20 items), which was agreed upon internationally with the stakeholders, and established a network of primary and associated records. In addition to the register ClinicalTrial.Gov (of the United States of America), there are currently two primary registries in the Americas (from Brazil and Cuba) that meet WHO requirements and provide data to WHOs International Clinical Trials Registry Platform (ICTRP). Furthermore, there are important advances in the region related to the regulations, development and implementation of national registries and to the support of the ethics committees and editors to this initiative. Key words: Clinical trial; Ethics; Legislation as topic; Publication bias (source: MeSH NLM).

INTRODUCCIN
El registro prospectivo de los ensayos clnicos (EC) en bases de datos pblicamente accesibles ha venido cobrando especial importancia en la ltima dcada. La Organizacin Mundia al de la Salud (OMS) considera que el registro prospectivo (la informacin se recolecta antes de la incorporacin del primer paciente al estudio) de todos los EC es una responsabilidad cientfica y tica (1). El objetivo de este artculo es mostrar la iniciativa de registros de EC de la Organizacin Panamericana de la Salud/ Organizacin Mundial de la Salud (OPS/OMS)

en Amrica Latina y el Caribe (ALC). En particular, se busca exponer en qu consiste la iniciativa del registro, esbozar el funcionamiento de la plataforma internacional de registros de EC de la OMS (cuyas siglas en ingls son ICTRP), discutir acerca de su importancia y mostrar los avances en la legislacin e implementacin de los registros en los pases de ALC. Por ltimo, promover la implementacin de registros a nivel nacional o regional en las Amricas. Todos los enlaces listados en este artculo pueden visualizarse a travs de la seccin ICTRP de la OMS (www.paho.org/ portalinvestigacion).

Polticas Pblicas e Investigacin en Salud, Sistemas de Salud Basados en Atencin Primaria de la Salud (HSS). Organizacin Panamericana de la Salud. Washington DC, EE.UU. 2 Centro Latinoamericano y del Caribe de Informacin en Ciencias de la Salud, Gestin del Conocimiento y Comunicacin, Organizacin Panamericana de la Salud Sao Paulo, Brasil. a Mdico, Maestra en Epidemiologa; b Doctora en Filosofa; c Licenciado en Ciencias de la Computacin, MBA en E-Commerce, MBA en Gestin de Proyectos; d Mdico, Especialista en Medicina Familiar, Maestra en Epidemiologa; e Profesional en Biblioteconoma

Recibido: 09-08-11

Aprobado: 12-10-11

676

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

Registro de ensayos clnicos en Amrica Latina y el Caribe

ANTECEDENTES DE LA INICIATIVA
Existen registros prospectivos de EC desde hace ms de tres dcadas. Sin embargo, tres procesos propulsaron la importancia actual que se le concede a la iniciativa (2): 1. La creacin del registro Clinicaltrials.gov, hace ms de una dcada, cuando los Institutos Nacionales de Salud de los Estados Unidos de Amrica, mediante la Biblioteca Mdica Nacional, desarrollaron el sitio www.clinicaltrials.gov, en colaboracin con la US Food and Drugs Administration (FDA), y como resultado del Acta de Modernizacin de la FDA de noviembre de 1997 (3). 2. La declaracin del Comit Internacional de Revistas Biomdicas en 2004, que expres que no publicaran EC que no hubieran sido anotados prospectivamente en un registro pblico reconocido internacionalmente (4,5). Esta declaracin fue motivada principalmente por la evidencia acumulada sobre sesgos de publicaciones (es decir que un porcentaje importante de los EC conducidos y terminados, no eran finalmente publicados); al encontrar que los resultados de los estudios publicados podran diferir de los no publicados, lo que introduce un sesgo para la toma de decisiones. Por otra parte, diversos estudios encontraron que una proporcin importante de los desenlaces primarios y secundarios en el informe de los EC publicados variaban al compararlos con los desenlaces planeados en los protocolos aprobados por los comits de tica (4-9). 3. El liderazgo asumido por la OMS para estandarizar las variables mnimas a incluirse en un registro de EC y crear la Plataforma Internacional de Registros (ICTRP) de la OMS (10-11). De acuerdo con la recomendacin de la Cumbre Ministerial sobre investigacin en salud llevada a cabo en Mxico en el 2004 (10), a la resolucin WHA58.34 aprobada durante la 58. Asamblea Mundial de la Salud que exhort al establecimiento de un enlace entre registros de EC, y con la contribucin del Comit Cientfico Asesor de la Organizacin Mundial de la Salud y de varios actores relacionados con la investigacin en salud, la OMS desarroll e implement los estndares internacionales para iniciar el registro en 2006 (11). Estos estndares son un conjunto mnimo de datos que deben proporcionar los patrocinadores o investigadores del estudio. En el 2007 se realiz el lanzamiento del portal de registro de EC de la OMS y de la red de registros alrededor del mundo (12). En 2008, la Declaracin de Helsinki incluy el registro de los EC (13); que recibi el apoyo conjunto de la industria farmacutica (14). En 2009 las autoridades de salud de las Amricas aprobaron

la Poltica de Investigacin para la Salud de la OPS, respaldando el registro de los EC (15).

FUNCIONAMIENTO DE LA PLATAFORMA DE REGISTRO DE EC DE LA OMS


Hoy en da, el usuario, el pblico general, la comunidad cientfica, los comits ticos de investigacin y las autoridades regulatorias, entre otros, realizan bsquedas y obtienen informacin bsica acerca de cada ensayo clnico de forma rpida gracias a que se cuenta con un metaregistro que consolida en forma organizada la informacin de los registros primarios y del registro clinicaltrials.gov. Esto es posible gracias a que, bajo la coordinacin de la OMS, el conjunto mnimo de datos (20 tems) fue consensuado (listado disponible en: http:// www.who.int/ictrp/es/) (11) y se allan el terreno para el establecimiento de la red de registros primarios (14 actualmente) y de registros asociados aportadores de datos. La Figura 1 sintetiza el modelo de la plataforma de registros de la OMS. Como todo proceso nuevo hay terminologa propia, con la que se debe familiarizar tanto el nuevo registro como el registrante o persona encargada de introducir la nueva informacin con respecto a un nuevo estudio clnico que se quiera registrar. Los registros primarios son avalados por la plataforma de la OMS cuando estos cumplen con criterios especficos de contenido, calidad y validez, accesibilidad, identificacin inequvoca, capacidad tcnica, administracin o gobernanza (1,12). La funcin de los registros primarios es facilitar el registro, la bsqueda, la identificacin y la deteccin de mltiples registros del mismo ensayo a nivel mundial. Los registros asociados se relacionan directamente con los registros primarios, de tal manera que estos garantizan que se cumplan los estndares definidos. A pesar de que los registros de asociados cumplen con los mismos criterios que los registros primarios de la OMS, no es necesario que tengan jurisdiccin nacional o regional o el apoyo del gobierno o que sean gestionados por un organismo sin fines de lucro. La base de datos estadounidense clinicaltrials.gov tambin aporta datos sin ser un registro primario. Ha sido gracias a esta coordinacin y colaboracin que se ha logrado recopilar en poco tiempo, los datos de ms de 138 000 EC (hasta julio de 2011) que ya estn pblicamente disponibles (http://bit.ly/ICTRP_OPS).

AVANCES Y ESTRATEGIAS PARA LA IMPLEMENTACIN DE LA INICIATIVA EN LAS AMRICAS


Actualmente, es difcil determinar el nmero total de EC que se conducen a nivel global. La Colaboracin

677

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

Reveiz L et al.

Cochrane ha desarrollado una base de datos de EC publicados (CENTRAL) que incorpora estudios de diversas fuentes (MEDLINE, EMBASE, LILACS, entre otras), incluyendo bsquedas manuales en revistas no indexadas en las principales bases de datos. Hasta julio de 2011, CENTRAL aportaba 651 035 citas e incorporaba cerca de 26 000 referencias de EC al ao. As mismo, el nmero de registros prospectivos avalados internacionalmente ha tenido un crecimiento importante a partir del ao 2005; hasta julio de 2011, la ICTRP contena 138 980 EC con participantes provenientes de 166 pases; alrededor de un tercio de ellos informa estar reclutando actualmente participantes. Del mismo modo, el nmero de registros con participantes provenientes de Amrica Latina y el Caribe ha crecido en forma importante a partir del 2005. A pesar de estos importantes avances, an existe una brecha entre el nmero total de estudios que se conducen, el nmero reflejado en registros internacionalmente aceptados y el nmero de EC cuyos resultados son publicados. Alrededor de uno de cada seis EC aleatorizados publicados (cuya filiacin del autor principal o de contacto proviene de ALC) en el 2010 e indexados en PUBMED o LILACS fue considerado por los patrocinadores o investigadores en un registro internacionalmente aceptado (16).

Tabla 1. Relevancia de la iniciativa de registros nacionales y regionales de EC para la Amrica Latina y el Caribe.
Registro Nacional de EC Repositorio de los EC en cada pas en el idioma local Contribuye a establecer las prioridades en investigacin en salud para el pas Facilita los procesos de las agencias reguladoras de tecnologas sanitarias Contribuye a la transparencia en investigacin Adaptado a las regulaciones locales Visibilidad de la investigacin y capacidades nacionales Registro Regional de EC Integracin de los EC de la regin en idiomas de la regin Adaptado a contexto Deteccin de registros relacionados con un solo ensayo Garanta de estndares de la plataforma de OMS Oportunidad para el registro en pases que no desarrollen su registro propio Minimiza la duplicacin de trabajo, facilita la estandarizacin de trminos y la traduccin tcnica Potencial reduccin de costos de desarrollo, mantenimiento, y operacin
EC: ensayos clnicos.

REGULACIN
Con relacin al nmero de registros, la OMS ha avalado 14 registros primarios en el mundo; de ellos, dos son Registros Primarios en las Amricas (1), el Registro Brasileo (www.ensaiosclinicos.gov.br) (17,18) y el Registro Pblico Cubano de EC (http://registroclinico. sld.cu/) los cuales han sido avalados por la OMS como tal (19,20). Otros pases, como por ejemplo Per (http:// www.ins.gob.pe/registroec/) y Argentina (Base de Consultas acerca de los Estudios en Farmacologa de la Administracin Nacional de Medicamentos, Alimentos y Tecnologa Medica en Argentina ANMAT (http://www. anmat.gov.ar/aplicaciones_net/applications/consultas/ ensayos_clinicos/principal.asp), han desarrollando registros nacionales, sin embargo, estas no forman parte de la red de registros de la OMS. El registro regional LATINREC (www.latinrec.net) (21), desarrollado por acadmicos vinculados con la Colaboracin Cochrane y la Red INCLEN tiene sede en Colombia. Tambin algunas agencias regulatorias como el Instituto Nacional de Vigilancia de Medicamentos y Alimentos (INVIMA) en Colombia proveen informacin acerca de los EC sometidos a evaluacin (22). La iniciativa del registro es un componente clave de la poltica de investigacin para la salud de la OPS que busca realzar los estndares de la investigacin,

fomentar las buenas prcticas, fortalecer la gobernanza de la investigacin y promover el acceso adecuado y oportuno al conocimiento cientfico (15). Algunos pases, como por ejemplo Estados Unidos, Per e India, han regulado el registro de EC, poniendo en evidencia que la manera ms eficaz para asegurar el registro de los EC es a travs de la legislacin (12,23-28). Por ello, la OPS promueve que se reglamente el registro obligatorio de los EC tanto farmacolgicos como no farmacolgicos (15). Los alcances de la iniciativa se ilustran en la Tabla 1.

VINCULACIN DE LA BIOTICA, LOS COMITS DE TICA DE LA INVESTIGACIN Y EL REGISTRO DE LOS ENSAYOS CLNICOS
Con el objetivo de proteger a las personas que participan en investigaciones, toda investigacin que involucra a personas tiene que ser aprobada por un comit de tica independiente, como se estipula en la Declaracin de Helsinki desde 1963, y en las reglamentaciones de muchos pases de las Amricas (13). Los comits de tica tienen la tarea de evaluar si la investigacin sigue los principios ticos del respeto por las personas, beneficencia y justicia. El principio de la beneficencia requiere evitar el dao, minimizar los riesgos y maximizar los beneficios posibles. El registro de los EC puede minimizar los riesgos que ya son conocidos y evitar el dao potencial causado

678

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

Registro de ensayos clnicos en Amrica Latina y el Caribe

por exposiciones innecesarias (1,12); en esa medida, se constituyen en una obligacin tica que se deriva del principio de beneficencia; siendo una tarea propia de los comits de tica requerir el registro pues es consistente con el objetivo de proteger a los participantes en investigaciones. Por estos motivos el Comit de tica de la Investigacin de la OPS (PAHOERC; http://bit. ly/PAHOERC) exige el registro de los EC en registros acreditados por ICTRP/OMS, como condicin para su aprobacin. Varios comits de tica alrededor del mundo (por ejemplo en Australia, Canad, Reino Unido), exigen el registro de los EC previo o en paralelo a la revisin (OMS; http://www.who.int/ictrp/trial_reg/en/index2.html). Si esta buena prctica es adoptada por los comits de tica de las Amricas, se lograr obtener una mayor adherencia a la iniciativa de registro de EC, mediante un sistema ms transparente y beneficioso para los usuarios y productores del conocimiento cientfico. Ms aun, el registro de EC concuerda con las demandas del principio de la justicia, pues el acceso a la informacin permite que las distintas poblaciones y grupos tengan igual oportunidad de participar en investigaciones. En conformidad con el principio del respeto de las personas, tambin facilita a los participantes potenciales el acceso a informacin que puede ser relevante para que su consentimiento a participar en una investigacin sea plenamente informado. Es importante notar que la FDA ha solicitado recientemente que se incluya un nuevo elemento en el consentimiento informado para advertir a los participantes en qu consiste el EC en el que potencialmente participarn, y que este ha sido o ser registrado en clinicaltrials.gov (29).

en revistas biomdicas de ALC (indexadas en PUBMED y LILACS), encontr que apenas 15 % de los estudios fueron registrados (16).

COOPERACIN DE OPS/OMS EN AMRICA LATINA Y EL CARIBE


Existen varias opciones para lograr implementar la iniciativa del registro en aquellos pases interesados en adherirse a ella. Listamos algunos ejemplos (36): Promover que los registros nacionales existentes (por ejemplo en Per y Argentina) se vinculen a la red de registros primarios de la OMS. Desarrollar registros nacionales vinculados a la red de registros primarios de la OMS, como vienen haciendo Brasil o Cuba. Optar por desarrollar registros nacionales que aporten los datos esenciales a un registro regional donde estos seran revisados, certificados (traducidos, de ser necesario) y enviados a la plataforma ICTRP de la OMS. Establecer legislacin que exija a los patrocinadores o investigadores, que registren los EC de forma que aparezca reflejada en un registro primario o la base ICTRP de la OMS. Establecer acuerdos con algn registro existente para que sirva de registro primario regional (por ejemplo como ha hecho el Reino Unido con ISRCTN), cubriendo el costo del registro para cientficos y patrocinadores radicados en el Reino Unido.

REVISTAS BIOMDICAS EN AMRICA LATINA Y EL CARIBE


En septiembre de 2006 BIREME pidi a los editores de revistas biomdicas indexadas en LILACS y SciELO apoyar la iniciativa de registro de EC, solicitando el identificador y el nombre del registro utilizado para cada ensayo clnico como requisito para la publicacin (30). Pese a que hay avances importantes (31-33) y existe el compromiso de numerosas revistas por implementar la iniciativa, con frecuencia se publican EC que no fueron registrados prospectivamente (34); adicionalmente, un nmero significativo de investigadores publican los resultados de sus investigaciones en revistas que no son de la regin (35). El compromiso de los editores de exigir registrar los ensayos es parte de la cadena de pasos que aseguran mayor adherencia por parte de investigadores y patrocinadores a esta iniciativa y a la poltica de investigacin aprobada para la regin de las Amricas(15). Un estudio que evalu la tasa de registro de los EC aleatorizados publicados en el 2010

DESARROLLO DE UNA PLATAFORMA INFORMTICA COMPARTIDA


BIREME/OPS es el Centro Latinoamericano y del Caribe de Informacin en Ciencias de la Salud, integrado en el rea de gestin del conocimiento y comunicacin de la OPS, y ha participado, desde 2007, en las discusiones acerca del desarrollo de una plataforma de registros de EC para la Regin (37). BIREME/OPS, en coordinacin con la Unidad de Promocin y Desarrollo de Investigacin y el rea de Gestin del Conocimiento y Comunicacin de la Sede de la OPS y la Representacin de OPS/OMS en Brasil, ha desarrollado, con apoyo del gobierno de Brasil, a travs del Ministerio de Salud y la Fundacin Oswaldo Cruz (Fiocruz), un software de cdigo libre y abierto, denominado OpenTrials (38), al que se puede acceder sin costo para ser utilizado o adaptado a las necesidades de cada pas u organizacin (por ej. con una interfaz propia, agregando variables, etc.). La plataforma ha sido utilizada, inicialmente, por el Registro Brasileo de EC (http://www.ensaiosclinicos.gov.br/), lanzado

679

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

Reveiz L et al.

en diciembre de 2010. Toda la interfaz de usuario es multilinge (disponible en espaol, ingls y portugus), pudiendo ser traducida a otros idiomas fcilmente. La informacin tcnica acerca de la plataforma est disponible en http://reddes.bvsalud.org/ projects/clinical-trials/, la cual incluye planificacin, documentacin, registro de actividades de desarrollo y mantenimiento del software y sus cdigos fuente. La plataforma OpenTrials sigue los criterios de la ICTRP de la OMS para descripcin e intercambio de los registros de EC, con una extensin en el modelo de datos para permitir el llenado de campos descriptivos en varios idiomas. Adems de ser libre y abierta tiene, como valor agregado, la integracin con servicios Web del thesaurus Descriptores en Ciencias de la Salud (DeCS), disponible en los tres idiomas, as como de la Categora Internacional de Enfermedades (CIE-10) y su traduccin al espaol, disponibles en BIREME/ OPS, en el mbito de la Biblioteca Virtual en Salud. La OPS promueve el desarrollo de un registro primario regional que permita capturar la informacin en los idiomas oficiales de la regin y alimentar la plataforma ICTRP de la OMS; esta iniciativa puede resultar econmica e idnea para los pases que quieran concentrar sus esfuerzos en la adherencia mas no en el desarrollo de registros.

tica en beneficio de las poblaciones y los estndares ticos de la investigacin.

Conflictos de Inters

Los autores declaran no tener ningn conflicto de inters.

Contribuciones de Autora

LR, LGC, CS y RT escribieron el artculo. LR aportaron ideas que aparecen reflejadas en el artculo y aportaron una revisin y sugerencias editoriales.

REFERENCIAS BIBLIOGRFICAS
1. Organizacin Mundial de la Salud. International Clinical Trials Registry Platform (ICTRP). Geneva: WHO; c2011. 2. Krleza-Jeri K, Lemmens T, Reveiz L, Cuervo LG, Bero LA. Prospective registration and results disclosure of clinical trials in the Americas: a roadmap toward transparency. Rev Panam Salud Publica. 2011;30(1):87-96. 3. Clinicaltrials.gov. About clinicaltrials.gov. National Institutes of Health; c2008. Bethesda:

4. De Angelis C, Drazen JM, Frizelle FA, Haud C, Hoey J, Horton R, et al. Clinical trial registration: a statement from the International Committee of Medical Journal Editors. N Engl J Med. 2004;351:1250-1. 5. De Angelis CD, Drazen JM, Frizelle FA, Haug C, Hoey J, Horton R, et al. Is this clinical trial fully registered? A statement from the International Committee of Medical Journal Editors. N Engl J Med. 2005;352(23):2436-8. 6. Chan AW. Bias, spin, and misreporting: time for full access to trial protocols and results. PLoS Med 2008;25;5(11):e230. 7. Chan AW, Hrbjartsson A, Haahr MT, Gtzsche PC, Altman DG. Empirical evidence for selective reporting of outcomes in randomized trials: comparison of protocols to published articles. JAMA. 2004;26;291(20):2457-65. 8. Chan AW, Krlea-Jeric K, Schmid I, Altman DG. Outcome reporting bias in randomized trials funded by the Canadian Institutes of Health Research. CMAJ. 2004;171:735-40. 9. Scharf O, Colevas AD. Adverse event reporting in publications compared with sponsor database for cancer clinical trials. J Clin Oncol. 2006;24:3933-8. 10. World Health Organization. The Mexico Statement on Health Research. Knowledge for better health: strengthening health systems. Geneva: WHO; c2011. 11. World Health Organization. The World Health Organization announces new standards for registration of all human medical research. Geneva: WHO; c2011. 12. Ghersi D, Pang T. From Mexico to Mali: four years in the history of clinical trial registration. J Evid Based Med. 2009;2(1):1-7. doi: 10.1111/j.1756-5391.2009.01014.x. 13. World Medical Association. Declaration of Helsinki Ethical Principles for Medical Research Involving Human Subjects. Ferney-Voltaire: WMA; c2011. 14. EFPIA-PHRMA-IFPMA-JPMA. Joint Position on the Disclosure of Clinical Trial Information via Clinical Trial Registries and Databases. Geneva: IFPMA; 2008.

CONCLUSIN
Existe una gran acogida mundial a la iniciativa de los registros pblicos de EC, propuesta como una manera de reducir el sesgo de publicacin e informe. En un tiempo relativamente corto se han establecido 14 registros primarios y otros registros asociados que han logrado identificar, en forma creciente, ms de 138 980 EC en tres aos; al identificarlos, y aportar un conjunto de datos bsicos, los registros facilitan que estos puedan ser identificados en revisiones de la literatura y as promover el uso adecuado de las evidencias cientficas que informan las decisiones en salud. Tambin resalta las contribuciones a la ciencia, por parte de los patrocinadores e investigadores de la regin adems de aportar elementos para un mejor monitoreo y gobernanza de los sistemas nacionales de investigacin para la salud. Los esfuerzos actuales proponen que se cuente con un registro regional que permita un igual acceso (y en el idioma oficial de cada pas) al registro en la plataforma ICTRP de la OMS tanto para quienes contribuyen desde pases con registros nacionales como para quienes estn en pases que no cuentan con un registro nacional. Se promueve, adems, la adopcin de regulaciones nacionales concordantes con esta iniciativa y la colaboracin de los comits de

680

Rev Peru Med Exp Salud Publica. 2011;28(4):676-81.

Registro de ensayos clnicos en Amrica Latina y el Caribe

15. Pan American Health Organization. Policy on Research for Health. Washington, D.C.: OPS; 2009. 16. Reveiz L, Bonfill X, Glujovsky D, Pinzon CE, AsenjoLobos C, Cortes M, et al. Impact of the trial registration initiative in Latin America and the Caribbeans: a study of randomized controlled trials published in 2010. J Clin Epidemiol. [in press]. 17. Departamento de Cincia e Tecnologia, Secretaria de Cincia, Tecnologia e Insumos Estratgicos, Ministrio da Sade. Registro Brasileiro de Ensaios Clnicos (Rebrac): fortalecimento da gesto de pesquisa clnica no Brasil. Rev Sade Pblica. 2009;43(2):387-8. 18. BIREME/PAHO/WHO. Clinical trials registry advances in Latin America and the Caribbean. Newsletter VHL 086 21/ January/2009. So Paulo: BIREME/PAHO/WHO; 2009. 19. Jimnez Rivero G, Pascual MA, Cobas Rodrguez J, Torres Pombert A, Fors Lpez M, Cachimaille Benavides Y, et al. Desarrollo e implementacin del Registro Pblico Cubano de EC. Rev Cubana Farm. 2010;44 (Suppl 2):1-12. 20. Rivero GJ, Lpez MA, Fors M, Cobas J, Torres A, Cachimaille Y, et al. The Cuban Public Registry of Clinical Trials: primary registry of World Health Organization. J Evid Based Med. 2011;4(3):161-4. doi: 10.1111/j.17565391.2011.01140.x. 21. Reveiz L, Delgado MB, Urrutia G, Ortiz Z, Garcia Dieguez M, Mart-Carvajal A, et al. The Latin American Ongoing Clinical Trial Register (LATINREC). Rev Panam Salud Publica. 2006;19(6):417-22. 22. INVIMA. Registro de protocolos de investigacin clnica aprobados y rechazados por el INVIMA en el ao 2010. Bogot: INVIMA; 2010. 23. Ross JS, Mulvey GK, Hines EM, Nissen SE, Krumholz HM. Trial Publication after Registration in ClinicalTrials.Gov: A Cross-Sectional Analysis. PLoS Med. 2009;6(9):e1000144. 24. Zarin D, Ide N, Tse T. Issues in the Registration of Clinical Trials. JAMA. 2007;297(19):2112-20 25. Tuma RS. New law may be having some effect on publication bias. J Natl Cancer Inst. 2010;102(5):290-2. 26. U.S. Food and Drug Administration. Implementation Chart. Silver Spring: FDA; c2011. 27. Tharyan P. Prospective Registration of Clinical Trials in India: Strategies, Achievements & Challenges. J Evid Based Med. 2009;2(1):19-28.

28. Bian ZX, Wu TX. Legislation for trial registration and data transparency. Trials. 2010;11:64. 29. U.S. Food and Drug Administration. Informed Consent Elements. 21 CFR Part 50 [Docket No. FDA2009N0592] RIN No. 0910AG32. Silver Spring: FDA; c2011. 30. BIREME/PAHO/WHO. Clinical trials should be registered before publication in LILACS and SciELO journals. Newsletter 2006 VHL 059 01/September. So Paulo: BIREME/PAHO/WHO; 2006. 31. Peccin MS. Clinical trial registration: when to and why register. Rev bras fisioter. 2007;11(6):5-6 . 32. Palacios M, Ramirez JH. El registro de EC y el fenmeno de las investigaciones ya que. Colomb Med. 2007;38(1):5. 33. Castro RCF. Registros de ensaios clnicos e as conseqncias para as publicaes cientficas. Medicina. Medicina (Ribeiro Preto). 2009;42(1):31-35. 34. Reveiz L, Corts-Jofr M, Asenjo-Lobos C, Nicita G, Ciapponi A, Garca-Dieguez M, et al. Influence of trial registration on reporting quality of randomized trials: study from highest ranked journals. J Clin Epidemiol. 2010;63(11):1216-22. 35. Perel P, Miranda JJ, Ortiz Z, Casas JP. Relation between the Global Burden of Disease and Randomized Clinical Trials Conducted in Latin America Published in the Five Leading Medical Journals. PLoS ONE. 2008;3(2):e1696. doi:10.1371/journal.pone.0001696 36 Reveiz L, Cuervo LG. Implementacin de la iniciativa de registro de EC*. Rev Col Anest. 2011;39(1):21-26 37. BIREME/PAHO/WHO. Clinical Trials Register Platform for Latin America and the Caribbean. So Paulo: BIREME/ PAHO/WHO; 2007. 38. BIREME/PAHO/WHO. OpenTrials: a multilingual Clinical Trials Registration system. So Paulo: BIREME/PAHO/ WHO; 2009.

Correspondencia: Ludovic Reveiz Direccin: 525 23rd St NW, Washington, DC 20037. EE.UU. Telfono: (+1) 202 9743128 Correo electrnico: reveizl@paho.org

681

Rev Peru Med Exp Salud Publica. 2011;28(4):682-84.

personalidades destacadas

personalidades destacadas de la salud pblica en el Per EL AMAUTA PEDRO ORTIZ CABANILLAS (1933-2011)
THE AMAUTA PEDRO ORTIZ CABANILLAS (1933-2011) Pablo Zumaeta1,2,a

Pedro Ortiz Cabanillas (1933-2011) ...que la nuestra llegue a ser una sociedad solidaria, libre y justa donde cada personalidad goza de su dignidad, autonoma e integridad.

Ha fallecido un mdico y un maestro, cuyos mritos profesionales son difcilmente comparables a los de muchos otros intelectuales que han contribuido con sus esfuerzos para que en nuestro pas se d un cambio social que redunde en una mejor sociedad peruana, con una mejor salud y una mejor educacin que la actual. Sus mritos profesionales, asistenciales y acadmicos son ms numerosos: neurlogo, doctor en Medicina, profesor principal de Neurologa, Psicobiologa, Neurociencias y tica de la Universidad Nacional Mayor de San Marcos (UNMSM), doctorado en ciencias de la educacin por la Universidad Nacional de Educacin Enrique Guzmn y Valle, miembro asociado de la Academia Nacional de Medicina, Fellow del Neurological Centre de la Universidad de Newcastle Upon Tyne y miembro de la Royal Society of Internal Medicine, jefe del Servicio de Neurologa del Hospital Nacional
Academia de Neurociencias del Per. Lima, Per. Facultad de Psicologa, Universidad de Lima. Lima, Per. a Mdico Neurlogo
1 2

Edgardo Rebagliati; profesor invitado de ms de diez universidades, decano del Colegio Mdico del Per, director del Instituto de tica en Salud de la UNMSM, y coordinador de la Maestra en Neurociencias y del Doctorado en Neurociencias de la UNMSM. Public los siguientes libros: El sistema de la personalidad, 1994; La Formacin de la personalidad. Aspectos pedaggicos, 1997; El nivel consciente de la memoria, 1998; Introduccin a la medicina clnica (1996, 1999, 2006, 2009); Lenguaje y habla personal, Introduccin a una Psicobiologa del hombre, 2004, 2010; El nivel consciente de la actividad personal, 2004, tica social, 2007; Educacin y formacin de la personalidad, 2008. Recibi, adems, numerosas distinciones, donde destacan la Medalla al Mrito Extraordinario

Recibido: 11-10-11

Aprobado: 12-10-11

682

Rev Peru Med Exp Salud Publica. 2011;28(4):682-84.

Pedro Ortiz Cabanillas

otorgado por el Colegio Mdico del Per; las Palmas Magisteriales con el grado de Amauta otorgado por el Ministerio de Educacin (2006); la Medalla y Diploma de Honor al Mrito Extraordinario otorgado por la Facultad de Medicina de la UNMSM (2006); la Medalla al Mrito en Salud Carlos Enrique Paz Soldn (2008); entre muchas otras distinciones universitarias, mdicas y cientficas. Fue miembro de ms de diez sociedades profesionales, y fundador y presidente honorario de la Academia de Neurociencias del Per, adems cuenta con numerosos artculos en revistas especializadas. Estaba preparando un par de libros cuando fue, literalmente, sorprendido por una enfermedad muy penosa para l, su familia y todos los que lo admirbamos. Sobre el valor de la contribucin mdica de la obra de Ortiz es imprescindible recalcar que no solo se trata de aportes significativos a la Medicina, sino que se extiende ms all del concepto acostumbrado de salud, de enfermedad, de enfermos y de patognesis (1-3). Esto lo hace proporcionando, en sus libros y artculos, una nueva mirada a diversas ramas de las ciencias biolgicas, de las ciencias humanas y de aquellas que, a veces, se califican de ciencias bisagras como, por ejemplo, la Psicologa. Para Ortiz: La salud y la enfermedad, son dos aspectos contradictorios de la vida misma. Ambas son estados determinados tanto por procesos epigenticos (patogenticos) como por procesos sociocinticos (patocinticos). La salud es toda forma de organizacin informacional neguentrpica del sistema de la sociedad y de las personas, que se define bajo criterios ticos, cientficos y tcnicos, establecidos por la propia sociedad. Como se observa en la cita, sus concepciones no solo describen sino que tambin explican, y lo hacen dentro de un marco terico monista materialista no clsico, cuyas premisas han sido inaceptables para los an existentes enfoques de los idealistas que, paradjicamente, acusaron a Ortiz de biologista cuando la meta de su obra es el perfeccionamiento de la estructura y actividad psquica, dirigido en ltimo trmino a lo moral. Personalmente puedo afirmar lo que alguna vez dijo en el sentido de que l no haba pensado su teora simplemente para que se pudiera hacer una mejor evaluacin y diagnstico neuropsicolgicos sino para mejorar el componente moral de la sociedad peruana. La concepcin de que todo lo que existe en el universo es material es uno de los puntos de partida de la teora informacional de la personalidad (nombre que paulatinamente se est abreviando como TIP) (3). De

all se desprende que toda la materia del universo, en sus aspectos de masa (estructura) y energa (actividad), tiende permanentemente a ordenarse y organizarse (tendencia neguentrpica) as como a desordenarse y a desorganizarse (tendencia entrpica). La informacin es, por lo tanto, una forma especial de neguentropa, con una estructura material cuya actividad reorganiza la materia intraindividual y extraindividual del individuo humano. Las aplicaciones de la teora informacional (3-4) en la Salud Pblica son concretas si es que se toma en cuenta la propuesta de que La enfermedad es todo proceso de desorganizacin entrpica de la sociedad en general, y de las personas en particular, por la que el sistema social tiende a su descomposicin. Es un estado de trastorno, defecto o deterioro real dentro de una sociedad dada En realidad, hay tantas enfermedades como enfermos La enfermedad no es solo un modelo terico, es un estado patolgico real de una sociedad dada ya que es todo un proceso de desorganizacin entrpica (inmoral) de la sociedad El enfermo es una personalidad alterada o perturbada por procesos entrpicos de naturaleza patogentica o patocintica. Se enfatiza que la salud y la enfermedad, son dos aspectos contradictorios de la vida misma - la igualdad de los contrarios - y ambos son estados determinados, como ya se dijo, tanto por procesos de estructuracin y de reestructuracin de la materia existente en los diversos niveles de organizacin del ser humano en el proceso de convertirse en individuo social, en personalidad. La tesis bsica de la TIP es que la base de desarrollo de una personalidad son los tipos de informacin social extraindividual que se codifican como uno de los tipos de informacin intraindividual, la informacin psquica que llega constituir una estructura llamada conciencia. Este concepto es rotundamente diferente al concepto cotidiano de que conciencia es solo darse cuenta. Esta y otras redefiniciones se encuentran dentro del marco terico informacional por lo que ste deber ser ledo con especial atencin y sin entremezclar sus conceptos con aquellos provenientes del lenguaje cotidiano, cognitivo conductual o psicoanaltico. Justamente, con relacin a la definicin de conciencia (5), la contribucin de Ortiz a las estrategias actuales de educacin es considerar al aprendizaje como un proceso de estructuracin gradual de dicha conciencia con sus componentes neurales afectivo, cognitivo y conativo, su posterior procesamiento como percepcin, imaginacin, pensamiento y actuacin, y luego, su correspondiente expresin en los componentes de la personalidad que conocemos como temperamento, intelecto y carcter respectivamente. Ortiz siempre deca que los maestros y los alumnos de pregrado eran los que mejor

683

Rev Peru Med Exp Salud Publica. 2011;28(4):682-84.

Reveiz L et al.

entendan su propuesta. Eso es ciertamente gratificante y esperanzador ya que, para l, un cambio hacia una sociedad ms moral tena que comenzar en el proceso educativo primero familiar y luego dentro de un sistema educativo formal que debera reorganizarse bajo la premisa de no solo se aprende los conocimientos, sino tambin los sentimientos y los valores. Esa sera la base del cambio, lo cual no implica que los adultos no puedan ampliar y reestructurar su conciencia para expresarla en una conducta de respeto a los dems y a s mismo. El estudio de estas estrategias lo llev a escribir su libro sobre tica social dirigida principalmente a los profesionales de la salud y de la educacin. Ortiz manifest en alguna oportunidad que la teora que ide no era para hacer un mejor examen neurolgico o psicolgico, sino a lo que apuntaba esencialmente es a explicar las estrategias que deberan emplearse en la educacin para que el temperamento y el intelecto fueran morales. Esto se refera tanto a todos aquellos que ensean como a los que aprenden y, por supuesto para aquellos que ejercen actividades en la atencin de salud. Su espritu progresista deseaba la aplicacin de su propuesta para llegar a la meta de que nuestra sociedad sea ms solidaria, libre y justa.

Nos queda toda su obra y, por supuesto, la tarea de continuarla y aplicarla en la medida de nuestras posibilidades; ese es el mejor adis y la mejor manera de que siga viviendo entre nosotros.

REFERENCIAS BIBLIOGRFICAS
1. Ortiz P. Introduccin a la Medicina Clnica I: El Examen Mdico Esencial. Lima: Universidad Nacional Mayor de San Marcos; 1996 2. Ortiz P. Introduccin a la Medicina Clnica III: El Examen Neurolgico Integral. Lima: Universidad Nacional Mayor de San Marcos, 1999. 3. Ortiz P. El Sistema de la Personalidad. Lima: Orin; 1994. 4. Ortiz P. La Formacin de la Personalidad. Lima: Dimaso Editores; 1997. 5. Ortiz P. El Nivel Consciente de la Memoria. Lima: Universidad de Lima; 1998.

Correspondencia: Pablo Zumaeta Telfono: (511) 4468876 / 99925545 Correo electrnico: pzumaeta@ulima.edu.pe

TARIKI-DENGUE IgM

ELISA de CAPTURA IgM DENGUE


INSTITUTO NACIONAL DE SALUD LIMA - PER

Pronto disponible en el Per.


Kit para la determinacin de anticuerpos IgM anti Dengue, desarrollado y producido por el Instituto Nacional de Salud. INS/MINSA
684

Rev Peru Med Exp Salud Publica. 2011;28(4):685-87.

galera fotogrfica

AGENTES DE INFECCIONES POR HONGOS DIMORFICOS Y Cryptococcus neoformans


AGENTS BY DIMORPHIC FUNGI AND Cryptococcus neoformans INFECTIONS
Rito Zerpa1,2,a, Vilma Bjar2,b, Roberto Rojas2,c

10 m
Figura 1. Paracoccidioides brasiliensis, microfotografa de secrecin de ganglio, teido con Giemsa. Se observa levaduras azuladas de diferente tamao.

10 m
Figura 3. Paracoccidioides brasiliensis, examen en fresco de cultivo en agar sangre BHI, teido con safranina diluida al 0.1%. Se observa levadura multigemante en timn de barco.

5 m
Figura 2. Paracoccidioides brasiliensis, microfotografa de preparacin en fresco a partir de cultivo en agar sangre BHI a 35 C. Se observa levadura multigemante en timn de barco.

Se presentan microfotografas de hongos dimrficos: Histoplasma capsulatum, Paracoccidiodes brasiliensis, causantes de infecciones mucocutneas o sistmicas en el hombre y algunas especies animales. Asimismo de levaduras: Cryptococcus neoformans, agente etiolgico

de la criptococosis, infeccin subaguda o crnica, principalmente del sistema nervioso central, que ingresa al organismo va inhalatoria y rara vez por va subcutnea, puede atacar el aparato respiratorio, adems del sistema nervioso, piel, mucosa, ganglios linfticos, huesos, etc. El P. brasiliensis, en su fase micelial esporgena, se encuentra en el suelo, fragmentos vegetales, espinas, etc. y en su fase de levadura en tejidos infectados; agente causal de la paracoccidioidomicosis (blastomicosis sudamericana), infeccin crnica, granulomatosa de la piel, mucosas, ganglios y vsceras. El H. capsulatum, en su fase micelial se encuentra principalmente en compuestos nitrogenados: excretas de aves (gallina, lechuza), as como en excremento de murcilagos; en su fase levaduriforme se encuentra en tejidos infectados y es el agente causal de histoplasmosis que afecta principalmente el aparato respiratorio, con resolucin espontnea sin tratamiento en pacientes inmunocompetentes. La histoplasmosis diseminada intensa aparece en ciertos pacientes infectados, lactantes, ancianos y pacientes

Servicio de Microbiologa, Instituto Nacional de Salud del Nio. Lima, Per. Instituto de Medicina Tropical Daniel A. Carrin, Universidad Nacional Mayor de San Marcos. Lima, Per. a Mdico Patlogo Clnico; b Bilogo; c Tecnlogo Mdico
1 2

Recibido: 28-11-11

Aprobado: 07-12-11

685

Rev Peru Med Exp Salud Publica. 2011;28(4):685-87.

Zerpa R et al.

10 m
Figura 4. Paracoccidioides brasiliensis, microfotografa a partir de cultivo en chromo agar. Se observa cinco levaduras en timn de barco Figura 7. Paracoccidioides brasiliensis, fotografa de cultivo en agar Sabouraud glucosado a 35 C. Se observa colonia cerebriforme rodeado de desarrollo de la forma filamentosa.

20 m
Figura 5. Paracoccidioides brasiliensis, microfotografa a partir de secrecin de ganglio. Se observa levadura multigemante en timn de barco. Tincin con metenamina de plata.

3 m
Figura 8. Histoplasma capsulatum, microfotografa a partir de biopsia de ganglio; se observa levaduras con pseudocpsula. Tincn con metanamina de plata.

1 mm
Figura 6. Paracoccidioides brasiliensis, fotografa de cultivo en agar sangre BHI A 35c; se observa colonia cerebriforme.

inmunodeprimidos o con SIDA. El diagnstico de laboratorio de infecciones por hongos dimrficos se realiza con el estudio de las muestras clnicas: examen directo, con KOH al 20 %, calcoflor, Giemsa, Gram, Ziehl Neelsen y en preparaciones histopatolgicas incluyendo PAS y tinciones argnticas (metenamina de plata); el cultivo en medios como el agar sabouraud glucosado,

en agar BHI incubados a dos temperaturas: 25 y 36 C. El H. capsulatum al examen directo, en frotises o cortes histopatolgicos, se observa como nidos de levaduras de 1 a 3 m intracelulares, incluidas en polimorfonucleares o histiocitos y en cultivo en agar Sabouraud colonias de color blanco de aspecto velloso, microscpicamente teidas con azul de lactofenol las macroconidias tuberculadas caractersticas. El P. brasiliensis en el examen en fresco con KOH o coloreadas, en cortes histopatolgicos se observa como levaduras esfricas u ovaladas de 10 a 80um con membrana engrosada y multigemantes (timn de barco); en cultivo en el medio agar BHI a 36 C, se observan colonias cerebriformes. El C. neoformans se presenta en microfotografa de preparacin de LCR de pacientes con meningitis, con la tcnica de tinta china modificada y cultivos en agar Sabouraud glucosado, as como en agar tabaco. En la galera se presentan imgenes especiales de estos hongos, obtenidas de material de pacientes con enfermedades producidas por los agentes mencionados, en el Instituto Nacional de Salud del Nio y los atendidos en el Instituto de Medicina Tropical Daniel A. Carrin de

686

Rev Peru Med Exp Salud Publica. 2011;28(4):685-87.

Galera fotogrfica

10 m
Figura 9. Histoplasma capsulatum, microfotografa a partir de cultivo en agar Sabouraud a temperatura ambiental; se visualiza macroconidias tuberculadas. Tincin con azul de lactofenol.

5 m
Figura 12. Cryptococcus neoformans, microfotografa en muestra de sangre en montaje hmedo. Se observa levadura gemante al centro de un leucocito.

1 mm
Figura 10. Histoplasma capsulatum, fotografa de cultivo en Agar Sabouraud glucosado a 35C. Se observa colonia de la fase levaduriforme en la parte inferior y filamentosa en la parte superior. Figura 13. Cryptococcus neoformans, fotografa de cultivo en Agar tabaco, se observa colonias de color marrn a negro.

la Universidad Nacional Mayor de San Marcos. Estas imgenes, pueden ser de utilidad para el diagnstico microbiolgico en el laboratorio clnico, en la docencia y en la investigacin.

REFERENCIAS BIBLIOGRFICAS
1. Burstein Alva Z. Aspectos clnicos de la Blastomicosis sudamericana (Paracoccidioidomicosis) en el Per. Rev Peru Med Exp Salud Publica. 2002;19(1):43-47. 2. Zerpa R, Huicho L, Guilln A. Modified indian ink preparation for Cryptococcus neoformans in cerebrospinal fluids. J Clin Microbiol. 1996;34(9):2290-91. Correspondencia: Rito Zerpa Larrauri Direccin: Av. Rio Maran 436, Los Olivos. Lima, Per. Telfono: (511) 5286004 Correo electrnico: rzerpa43@yahoo.com

5 m
Figura 11. Cryptococcus neoformans, microfotografa en muestra de LCR con la tcnica de tinta china modificada.

687

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

cartas al editor

LA VACUNA CONTRA EL VIRUS DEL PAPILOMA HUMANO: ALGUNAS PRECISIONES


THE HUMAN PAPILLOMAVIRUS VACCINE: SOME PRECISIONS Wilfredo Gutirrez1,a
Sr. Editor. El cncer de cuello uterino o cncer cervical, representa un grave problema de salud reproductiva en la mujer, especialmente en los pases en desarrollo como el nuestro. Es el tercer cncer en importancia en el mundo y es causa de muerte en ms de 250 000 mujeres al ao, de las cuales, ms del 80 % corresponden a pases en desarrollo (1). En Per, son afectadas alrededor de 5500 mujeres cada ao y, de ellas, fallecen alrededor del 50 % (2). Un estudio realizado en 1999, estim que alrededor del 99 % de los casos de cncer cervical en el mundo eran positivos en las pruebas que identificaban el ADN del virus del papiloma humano (VPH). Hoy se conocen unas cien cepas o serotipos del VPH, de las cuales solo unas 23 pueden afectar a las mucosas cervicales y, de estas, 13 son oncognicas. Los serotipos de alto riesgo son los 6, 11, 16, 18, 31 y 35, que ocasionan cerca del 90 % de todos los cnceres de crvix (3). En el Per, las cepas ms frecuentes son la 16, 18, 31 y 52 (4). Sin embargo, no todas las mujeres infectadas con el VPH derivarn en cncer cervical, pues en el 90 % de casos las infecciones desaparecen sin necesidad de tratamiento. La infeccin persistente con cepas oncognicas de VPH es una condicin necesaria pero no suficiente para la produccin de cncer de cuello uterino. Adems, deben asociarse factores de riesgo tales como el inicio precoz de las relaciones sexuales, la alta frecuencia de estas relaciones, el nmero elevado de parejas sexuales, la pobre higiene genital, el alto consumo de alcohol y drogas, la presencia concomitante de otras enfermedades de transmisin sexual, entre otros (2). La Administracin de Drogas y Medicamentes de Estados Unidos (FDA por sus siglas en ingls) aprob el 2006 una vacuna producida por Merck & Co., Inc. (Merck) denominada Gardasil, para prevenir la infeccin por las cepas 6, 11, 16 y 18 del VPH, cuya eficacia se estima en un 80 %. Otra vacuna, Cervarix, producida por GlaxoSmithKline (GSK) tambin fue aprobada por la FDA en el 2009 y protege contra dos tipos de cepas del VPH, la
1 a

16 y 18, que producen alrededor del 70 % de los cnceres de cuello uterino (4). En el 2009, ambas vacunas fueron recomendadas por la OMS para su uso generalizado en nias adolescentes y ya se comercializan en ms de cien pases, incluyendo el Per (1). El 28 de enero de 2011 se publica el nuevo esquema de vacunacin peruano, donde se incluye la vacuna contra el VPH a nias de 10 aos. Al respecto, es importante hacer algunas precisiones: El costo de la vacuna bivalente adquirida por el fondo rotatorio de la OMS oscila entre USD 14 a 17. Siendo entonces la vacuna contra el VPH ms costosa y de menor eficacia en el esquema de vacunacin peruano (80 % frente al 95-99 % de las otras vacunas). Un reciente estudio de costo-utilidad llevado a cabo por Gutirrez (4) concluye que: La estrategia de tamizaje con Papanicolaou es ms costo-til que la vacunacin contra el VPH, aunque las coberturas actuales solo llegan al 31 %. Tambin hace la observacin de que el costo anual de vacunacin insume el 10 % del presupuesto total asignado por el Ministerio de Economa y Finanzas en el 2010 a la estrategia sanitaria de inmunizaciones. Basado en diferentes modelos de evaluacin econmica, la OMS refiere que para que la vacunacin se incorpore en los esquemas regulares de los pases de ingresos medios o bajos, es necesario que su costo por cada nia vacunada (incluyendo los costos del programa) sea inferior a USD 25 (1). La vacuna no proporciona proteccin completa contra otros tipos de VPH, algunos de los cuales causan cncer cervical. Por lo tanto, entre el 20 al 30 % (segn el tipo de vacuna) de los casos de cncer cervical y el 10 % de los casos de verrugas genitales no se prevendrn (5); tampoco previene contra otras enfermedades de transmisin sexual ni trata la infeccin por VPH o el cncer cervical. La OMS recomienda que la introduccin de la vacuna contra el VPH, deba hacerse dentro de un enfoque integral para controlar el cncer cervical. Es decir que las mujeres sexualmente activas (vacunadas o no), deben seguir hacindose exmenes selectivos de deteccin de lesiones premalignas (Papanicolau, colposcopia, despistaje de VPH) (1). Igualmente, es importante que se acompae de una adecuada consejera para evitar las enfermedades de transmisin sexual como: una relacin mutuamente mongama a largo plazo; evitar conductas sexuales riesgosas; usar preservativo, aunque es menos seguro

Instituto Cunto. Lima, Per. Mdico cirujano, Magster en Salud Pblica

Recibido: 19-09-11

Aprobado: 04-10-11

688

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

para el VPH, ya que no protege las partes no cubiertas (5). Por ltimo, aparte del alto costo, debemos tener en consideracin algunas cuestiones todava no resueltas con relacin a estas vacunas como el tiempo de duracin de la proteccin; si es necesario o no administrar un refuerzo; sus efectos en la conducta sexual, sobre todo de los jvenes y sus efectos adversos poscomercializacin. Hasta junio del presente ao, el Sistema de Reporte de Efectos Adversos de las Vacunas de EE.UU. (VAERS por sus siglas en ingls) haba informado 18 727 efectos adversos posteriores a la vacunacin con Gardasil, de los cuales 8 % fueron considerados serios. Entre estos se describe al sndrome de Guillain Barre; cogulos en pulmones, corazn y piernas y muerte (68 casos), aunque ninguno de estos eventos serios se ha demostrado que sean atribuibles a la vacuna (6). En conclusin, dado que es la vacuna ms costosa y con menos eficacia relativa en el esquema de vacunacin peruano, es recomendable que se aplique de manera selectiva en las escuelas ubicadas en zonas de alta prevalencia de cncer de cuello uterino, acompaada de una adecuada informacin a las nias y a sus padres sobre los beneficios y riesgos y de no descuidar las otras medidas para prevenir el cncer de crvix.

INVESTIGACIN DE EXCELENCIA EN ALTURA: A CINCUENTA AOS DE LA FUNDACIN DEL INSTITUTO DE INVESTIGACIONES DE LA ALTURA DE LA UNIVERSIDAD PERUANA CAYETANO HEREDIA
EXCELLENCE RESEARCH IN ALTITUDE: FIFTY YEARS AFTER THE FOUNDATION OF THE INSTITUTO DE INVESTIGACIONES DE LA ALTURA OF THE UNIVERSIDAD PERUANA CAYETANO HEREDIA Gustavo F. Gonzales1,a,b, Roger Guerra-Garca2,a

Sr. Editor. La Universidad de Ciencias Mdicas y Biolgicas (hoy Universidad Peruana Cayetano Heredia) se cre por Decreto Supremo el 22 de septiembre de 1961 y la primera unidad que entr en funcionamiento fue el Instituto de Investigaciones de la Altura (IIA). Este ao, el IIA cumple 50 aos y es importante resaltar su contribucin a la salud pblica del pas. En el IIA se investiga la fisiologa, la patologa y la epidemiologa del hombre andino, as como de diversas especies animales y botnicas. Cuatro libros (1-4) y un artculo de revisin (5) cubren de manera amplia estos temas. Aqu destacaremos seis contribuciones que por su relevancia han sido reconocidas internacionalmente. Eritrocitosis excesiva. En los ltimos aos los trabajos en el IIA han contribuido en el conocimiento de la etiopatogenia del mal de montaa crnico (MMC) y al esfuerzo internacional para conseguir un consenso para los criterios diagnsticos de dicho mal. Destaca tambin la colaboracin entre investigadores del IIA y grupos extranjeros, en la bsqueda de alternativas mdicas para el tratamiento del MMC, como el uso de la acetazolamida y los inhibidores de la enzima convertidora de angiotensina. Patogenia de la hipertensin pulmonar hipxica. La American Thoracic Society (ATS) otorg el Premio Robert F. Grover 2008 a dos investigadores del IIA por sus sobresalientes contribuciones al estudio de
1

Conflictos de inters

El autor declara no tener conflictos de inters en la publicacin de esta carta.

REFERENCIAS BIBLIOGRFICAS
1. World Health Organization. Strengthening cervical cancer prevention and control. Report of the GAVIUNFPAWHO meeting1. Geneva, Switzerland. December 2009. 2. Saona P. Cncer de crvix y papiloma virus humano (PVH). Lima: Sociedad Peruana de Obstetricia y Ginecologa; c2006-2010. 3. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189(1):12-9. 4. Gutirrez A. Costo utilidad de la vacuna contra el virus del papiloma humano en mujeres peruanas. Rev Peru Med Exp Salud Publica. 2011;28(3):416-25. 5. Pomfret T, Gagnon J, Gilchrist A. Quadrivalent human papillomavirus (HPV) vaccine: a review of safety, efficacy, and pharmacoeconomics. J Clin Pharm Ther. 2011;36(1):1-9. 6. Centers for Disease Control and Prevention. Reports of Health Concerns Following HPV Vaccination. Atlanta, GA: CDC; c2011. Correspondencia: Wilfredo Gutirrez Direccin: Av Lima 270, Block 31 Dpto 503, Barranco Telfono: (+51) 989723100 Correo electrnico: gutierrw@gmail.com

Instituto de Investigaciones de la Altura, Facultad de Ciencias y Filosofa, Universidad Peruana Cayetano Heredia. Lima, Per. Instituto de Investigaciones de la Altura, Facultad de Medicina Alberto Hurtado, Universidad Peruana Cayetano Heredia. Lima, Per. Doctor en Medicina; b Doctor en Ciencias

Recibido: 07-09-10

Aprobado: 23-11-11

689

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

los efectos de la hipoxia y las grandes alturas sobre la circulacin pulmonar. Se destaca el trabajo de estos investigadores peruanos por la demostracin pionera de la existencia de hipertensin pulmonar en los nativos de los Andes y los hallazgos histolgicos que muestran el engrosamiento de las paredes arteriales pulmonares como la causa de esta elevada presin. Bocio endmico. En la dcada de 1960 la deficiencia de yodo en el Per era un problema de salud pblica con dramtico efecto en el ser humano, principalmente por el dao cerebral. En 1983, como consecuencia de las investigaciones desarrolladas en el IIA, se crea el Programa para el control de los desrdenes por deficiencia de yodo, gracias a ello a partir de 1998, ms de 90 % de los hogares consumen sal yodada, lo cual disminuy la prevalencia de bocio previniendo el dao cerebral en 600 000 recin nacidos cada ao (6). Contaminacin de interiores. Ms de dos millones de viviendas en el Per usan combustible de biomasa (generalmente lea, pero en la puna se emplea una mezcla de ichu con excretas de animales denominada champa). En los ltimos diez aos en el IIA se ha demostrado que en la altura el uso de combustible de biomasa potencia el efecto de la hipoxia ambiental afectando la salud de adultos, nios y del feto. El uso de biomasa aumenta el monxido de carbono que a su vez incrementa la carboxihemoglobina que impide al oxgeno unirse a la hemoglobina y, por lo tanto, generando ms hipoxia. Los resultados de estos estudios indican la necesidad de reanalizar toda la informacin obtenida en la altura. Salud materno-perinatal. En las zonas alto-andinas se observan las tasas ms altas de mortalidad fetal tarda, mortalidad perinatal y neonatal, y mortalidad materna. Estudios iniciales en la dcada de 1960 demuestran que en la altura es ms prevalente el pequeo para edad gestacional que el parto pretrmino (2). Investigaciones recientes demuestran que la hemoglobina materna >14,5 g/dL es negativa para la madre como para el feto, y que el valor ptimo de hemoglobina para el mejor crecimiento del feto es de 10 g/dL y que en la altura no es necesario corregir el punto de corte de la hemoglobina para definir anemia materna. Rol de la Endocrinologa en la adaptacin a la altura. En 1968 en el IIA se demuestra que la testosterona, una hormona eritropoytica, mostraba una menor excrecin urinaria en la altura y que esto se deba a mayor actividad bioandrognica. As, la eritrocitosis excesiva sera causada, en parte, por la mayor concentracin plasmtica/srica de testosterona, en varones y mujeres.

Sumado a estos seis importantes trabajos vale mencionar que los investigadores del IIA vienen desarrollando proyectos con la maca, planta que crece exclusivamente en los Andes centrales del Per, en la que se ha demostrado diferentes propiedades biolgicas para cada variedad de maca (roja, negra y amarilla) (3). Finalmente, sealamos que el IIA es un ejemplo de institucin que conserva de sus fundadores el espritu de vocacin de servicio y entrega a la sociedad; ello ha hecho que la investigacin sobre altura se haya mantenido durante 50 aos de vida institucional; que la altura, como un laboratorio natural, sirva para desarrollar investigacin que ayude a resolver los problemas de salud de la poblacin y que genere conocimiento para entender los mecanismos que permiten que la vida se mantenga en condiciones de hipoxia. Hoy en un pas donde 9 millones de personas viven en la altura se justifica la necesidad de un instituto de investigaciones de calidad.

Conflictos de inters

El Dr. Gonzales y el Dr. Guerra-Garca han sido directores del Instituto de Investigaciones de la Altura de la Universidad Peruana Cayetano Heredia.

Referencias Bibliogrficas
1. Monge C-C, Len-Velarde F. El Reto fisiolgico de vivir en los Andes. Lima: IFEA-UPCH; 2003. 2. Gonzales GF. Reproduccin humana en la altura. Lima: IIA y CONCYTEC; 1993. 3. Gonzales GF. Maca de la Tradicin a la Ciencia. Lima: UPCH-Concytec; 2006. 4. Berros J. Contribucin al Conocimiento Biomdico del Habitante de las Grandes Alturas del Per; Lima: Universidad Peruana Unin; 2003. 5. Monge C, Len-Velarde F. Physiological adaptation to high altitude: oxygen transport in mammals and birds. Physiol Rev. 1991;71(4):1135-72. 6. Pretell EA, Higa AM. Eliminacin sostenida de los desrdenes por deficiencia de yodo en Per: 25 aos de experiencia. Acta md peruana. 2008;25:128-134. Correspondencia: Gustavo F. Gonzales Instituto de Investigaciones de la Altura Universidad Peruana Cayetano Heredia Direccin: Av. Honorio Delgado 430, Lima 31, Per. Telfono: (511) 3190000 anexo 2535 Correo electrnico: gustavo.gonzales@upch.pe

690

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

APORTE DE LAS SOCIEDADES ESTUDIANTILES EN LA PUBLICACIN CIENTFICA EN SCIELO-PER, 2009 2010


CONTRIBUTION OF THE SOCIETIES OF MEDICAL STUDENTS TO SCIENTIFIC PUBLICATIONS IN SCIELO-PERU, 2009-2010 lvaro Taype-Rondn1,2,a, Yasmn Lajo-Aurazo1,2,a, Rodrigo Gutirrez-Brown1,a, Natalia ZamalloaMasas1,a, Michelle Saldaa-Gonzales1,a
Sr. Editor. Se sugiere que promover la investigacin entre los alumnos de pregrado de medicina es una estrategia para aumentar la investigacin en salud. Sin embargo, son pocas las investigaciones que los estudiantes publican y existe recelo por parte de otros investigadores para citar dichas publicaciones (1). Los estudiantes de medicina, interesados en mejorar su calidad en investigacin, fundaron en 1992 la Sociedad Cientfica Mdico Estudiantil Peruana (SOCIMEP), que al ao 2011 rene a 30 sociedades cientficas de estudiantes de medicina (SOCEM), que tienen como objetivo el incentivar la investigacin biomdica desde el pregrado. Realizando el seguimiento de indicadores de la produccin cientfica de los estudiantes de medicina y de las SOCEM, es que cuantificamos los artculos publicados con participacin estudiantil entre el 2009 y 2010 en las revistas mdicas indizadas en SciELO-Per (cinco revistas en octubre de 2011). Para ello, consideramos como estudiantes a los autores que especificaron en su filiacin ser alumno de medicina, estudiante de medicina, interno de medicina, o a aquellos autores que hayan mencionado pertenecer a una SOCEM y no hayan especificado su grado acadmico. Revisamos 588 publicaciones en las cinco revistas y encontramos 258 artculos de investigacin (artculos originales y comunicaciones cortas), 69 casos clnicos, 62 cartas al editor, 199 revisiones y artculos especiales. Si solo consideramos las 389 publicaciones originales (sin contar las revisiones ni artculos especiales), 50

(12,9 %) publicaciones tuvieron aporte estudiantil. Estas corresponden a 30 artculos de investigacin, 11 casos clnicos, y 9 cartas al editor; publicadas por estudiantes de 15 facultades de medicina del Per. De las 50 publicaciones estudiantiles, 21 (42,0 %) tuvieron participacin de estudiantes que pertenecen a una SOCEM. Las SOCEM participantes corresponden a 12 facultades de medicina, como se aprecia en la Tabla 1. Un estudio bibliomtrico que mostr la participacin estudiantil peruana entre 1997 a 2005 en cuatro revistas indizadas en SciELO-Per, determin un 4,5 % de participacin estudiantil en todas las publicaciones originales (2). Esto sugiere un incremento en el aporte estudiantil en las publicaciones biomdicas en los ltimos aos, al haberse incrementado de 4,5 a 12,9 %. Al revisar la procedencia universitaria, fueron 15 las facultades de medicina que registraron al menos una publicacin con participacin estudiantil; sin embargo, esta Tabla 1. Artculos con participacin de estudiantes de medicina en revistas mdicas indizadas en SciELOPer, 2009-2010.
Participacin Participacin estudiantil de SOCEM N (%)* N (%)* Univ. Peruana Cayetano Heredia Univ. Nacional Mayor de San Marcos Univ. Nacional Jos Faustino Snchez Carrin Univ. Nacional San Luis Gonzaga de Ica Univ. Nacional de Piura Univ. San Martin de Porres Univ. Nacional Federico Villarreal Univ. Privada Antenor Orrego Univ. Ricardo Palma Univ. Nacional Jorge Basadre Grohmann Univ. Nacional del Altiplano Univ. Nacional San Agustn Univ. Peruana de Ciencias Aplicadas Univ. Nacional Pedro Ruiz Gallo Univ. Peruana Los Andes TOTAL 17 (34,0) 12 (24,0) 5 (10,0) 4 (8,0) 3 (6,0) 3 (6,0) 2 (4,0) 2 (4,0) 2 (4,0) 2 (4,0) 1 (2,0) 1 (2,0) 1 (2,0) 1 (2,0) 1 (2,0) 50 (100) 4 (19,0) 4 (19,0) 5 (23,8) 4 (18,2) 3 (14,3) 1 (4,8) 2 (9,5) 1 (4,8) 0 (0,0) 0 (0,0) 1 (4,8) 1 (4,8) 1 (4,8) 1 (4,8) 0 (0,0) 21 (100)

Sociedad Cientfica de Estudiantes de Medicina de la Universidad de San Martin de Porres, Facultad de Medicina Humana, Universidad de San Martin de Porres. Lima, Per. 2 Sociedad Cientfica Mdico Estudiantil Peruana. Per. a Estudiante de medicina
1

Recibido: 15-10-11

Aprobado: 26-10-11

* La suma es mayor al 100%, debido a que se registraron cinco artculos colaborativos (realizados por estudiantes de dos o ms facultades de medicina), los cuales fueron considerados como publicaciones para cada una de las facultades participantes. SOCEM: sociedades cientficas de estudiantes de medicina. Univ.: Universidad

691

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

provino principalmente de dos: la Universidad Peruana Cayetano Heredia (UPCH) con 17 publicaciones, y la Universidad Nacional Mayor de San Marcos (UNMSM), con 12; ambas contribuyen con el 58 % de la publicacin estudiantil en el periodo de estudio. Es conocido que estas universidades tienen una cultura de publicacin (3), y son las nicas que tienen revistas cientficas indizadas en SciELOPer. De esta manera, 8 de los 12 artculos estudiantiles de la UNMSM, y 8 de los 17 artculos estudiantiles de la UPCH han sido publicados en las revistas cientficas de dichas facultades. Aunque es probable que sus estudiantes tambin cuenten con publicaciones en revistas extranjeras, como ha sido descrito anteriormente (4). De otro lado, la participacin de las SOCEM se ha incrementado. Entre julio de 2006 y junio de 2007 solo dos de las 23 sociedades cientficas que eran miembros de la SOCIMEP tuvieron al menos una publicacin en una revista cientfica indizada (5); mientras que para el periodo 2009-2010, son 12 de 30 las SOCEM que participaron en el 42,0 % de las publicaciones con participacin estudiantil. Adems encontramos que en 8 de las 15 facultades de medicina con publicacin estudiantil, todas estas publicaciones tuvieron participacin de las SOCEM. Por ello, es posible que de no existir las SOCEM, estas facultades no tendran ninguna publicacin con participacin estudiantil. Entonces, podemos sugerir que las SOCEM estn contribuyendo en promover la investigacin y la publicacin entre los alumnos de pregrado, aunque ello amerita ms estudios. Cabe resaltar que los miembros de una SOCEM pueden no sealar que pertenecen a ellas al publicar, por lo que el nmero de publicaciones de las SOCEM podra ser subestimado. El incremento en la participacin estudiantil en la publicacin biomdica podra deberse a que las universidades y las SOCEM estn estimulando a los estudiantes para que investiguen y publiquen sus trabajos mediante cursos de bioestadstica, metodologa de la investigacin, redaccin cientfica entre otros temas afines. Asimismo, gracias al desarrollo de los medios de comunicacin, los estudiantes pueden contactar ms fcilmente con investigadores experimentados, que pueden guiarlos o apoyarlos hasta el trmino de sus investigaciones. En conclusin, durante el periodo 2009-2010 los estudiantes de medicina han participado del 12,9 % de las publicaciones originales en revistas biomdicas indizadas en SciELO-Per. El 42,0 % de estas publicaciones sealan en su filiacin a alguna SOCEM, lo cual sugiere el aporte de estas sociedades en la publicacin estudiantil. Sin embargo, solo 15 Facultades de Medicina han tenido participacin estudiantil en las publicaciones en este periodo, aunque fue mayoritaria de dos universidades

(UPCH y UNMSM). Se aprecia un incremento en la participacin estudiantil, pero esta no es homognea, por lo que quedan pendientes varias actividades para incentivar la investigacin desde el pregrado.

REFERENCIAS BIBLIOGRFICAS
1. Aslam F, Shakir M, Qayyum MA. Why medical students are crucial to the future of research in South Asia. PLoS Medicine. 2005;2(11):e322. 2. Huaman C, Chvez-Solis P, Mayta-Tristn P. Aporte estudiantil en la publicacin de artculos cientficos en revistas mdicas indizadas en Scielo-Per, 1997 2005. An Fac med. 2008;69(1):42-5. 3. Huaman C, Mayta-Tristn P. Produccin cientfica peruana en medicina y redes de colaboracin, anlisis del science citation index 2000-2009. Rev Peru Med Exp Salud Publica. 2010;27(3):315-25. 4. Arriola-Quiroz I, Curioso W, Cruz-Encarnacion M, Gayoso O. Characteristics and publication patterns of theses from a Peruvian medical school. Health Info Libr J. 2010;27(2):148-54. 5. Huaman C, Chvez-Sols P, Domnguez-Haro W, Solano-Aldana M. Produccin cientfica estudiantil: anlisis y expectativas. Rev Peru Med Exp Salud Publica. 2007;24(4):444-6. Correspondencia: lvaro Taype Rondn Direccin: Calle 22 N 159, Dpto 102, San Borja. Lima, Per. Telfonos: (511) 1226 5586 - 998929945 Correo electrnico: alvaro_athos@hotmail.com

EXISTE UN ESPACIO PARA LA INVESTIGACIN DURANTE EL RESIDENTADO MDICO EN PER?


IS THERE A SPACE FOR RESEARCH DURING THE MEDICAL RESIDENCY IN PERU? Luis Figueroa1,a
Sr. Editor. La investigacin, en especial la dirigida a brindar informacin para lograr cambios positivos en las decisiones sanitarias nacionales, es de fundamental importancia, ejemplo de ello es que en la actualidad existen estudios aplicados como base de polticas
Facultad de Medicina, Universidad Peruana Cayetano Heredia. Lima, Per. a Mdico Cirujano
1

Recibido: 13-05-11

Aprobado: 26-10-11

692

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

pblicas (1). Adems, la investigacin crea profundos cambios en las personas que la ejecutan, como la generacin de criterio, la formacin de hbito y cultura de investigacin, el aumento de la participacin en actividades acadmicas, entre otros (2). Se puede estimular la formacin en investigacin cientfica en varias etapas de la carrera mdica, como el pregrado, la especializacin mdica y el posgrado. Durante la especializacin mdica, es decir el residentado mdico en Per, varias universidades y sedes hospitalarias enfocan el estimulo a la investigacin de dos maneras: la primera, con sesiones paralelas a las actividades asistenciales, por ejemplo, la clase de Anlisis de datos en la metodologa tradicional a un residente que probablemente no logre su objetivo, puesto que el residente est pensando en sus pacientes, en las actividades clnicas, los procedimientos a realizar, la visita mdica del da siguiente, entre otras actividades. La segunda manera es incluida en las actividades acadmicas y se refiere a las revista de revistas (journal clubs) como parte de su entrenamiento en la lectura crtica de resultados de investigacin (3). As transcurre el residentado mdico para muchos y, finalmente, en los ltimos meses se presentan diversas interrogantes con relacin al trmino de la tesis, que en algn momento debieron planificar para obtener la titulacin de especialistas. Ante ello, varios residentes hacer investigaciones rapidamente y cumplen as con los requisitos universitarios; lamentablemente esto se ve reflejado en una baja calidad de dichos estudios, que luego no llegan a publicarse. Una alternativa coherente, similar al desarrollo de otras competencias, es involucrarse en un espacio principalmente prctico, en el cual los facilitadores se dediquen en el turno laboral a la investigacin e incluyan el entrenamiento a los residentes como parte de sus actividades habituales. Esto implica la gestin y disposicin de recursos para el desarrollo de estos espacios por parte de las instituciones que investigan; de esta manera, el mdico residente inhala e interioriza los procesos de la investigacin que se ve reflejada en la publicacin de trabajos (4). Existen experiencias exitosas como la de Croacia donde se ve que los factores asociados a la publicacin cientfica del estudiante es la produccin cientfica y la evaluacin positiva que realiza el mentor, adems de la publicacin en revistas indexadas en el pregrado por parte del estudiante, lo cual ilustra el rol del entorno acadmico sobre la probabilidad de las publicaciones futuras (5). Por lo tanto, la investigacin permite desarrollar el espritu crtico del estudiante y ser fuente de estmulo continuo

para el aprendizaje. Esto, a su vez, genera desarrollo en el mbito de la medicina basada en la evidencia (con enfoque centrado en la persona), genera mejora continua en nuestras auditorias y mejora la seguridad del paciente en nuestras intervenciones. La dificultad en la formacin de residentes en el rea de investigacin con deficiencia de publicaciones cientficas, es un problema que requiere de una solucin holstica que debe iniciar por el compromiso de las instituciones involucradas en la formacin del mdico residente. En conclusin, conviene evaluar la posibilidad de incluir rotaciones de los mdicos residentes en espacios donde existan investigadores productivos que puedan servir de mentores para que los futuros especialistas incorporen la investigacin dentro de su estilo de vida.

REFERENCIAS BIBLIOGRFICAS
1. Surez V, Zavala R, Ureta JM, Hijar G, Lucero J, Pachas P. Efecto del levonorgestrel como anticonceptivo oral de emergencia en la ovulacin, el endometrio y los espermatozoides. Rev Peru Med Exp Salud Publica. 2010;27(2):222-30. 2. Gutirrez C; Mayta P. Publicacin desde el Pre Grado en Latinoamrica: importancia, limitaciones y alternativas de solucin. CIMEL. 2003,8(1):54-60. 3. Alguire PC. A Review of Journal Clubs in Postgraduate Medical Education. J Gen Intern Med. 1998; 13(5):347-53. 4. Manjarin M, Cutri A, Noguerol E, Torres F, Ossorio F, Ferrero F. Enseanza de la investigacin con un sistema de tutores durante la residencia de pediatra. Arch Argent Pediatr. 2007;105(4):333-41. 5. Polaek O, Koli I, Buneta Z, ike N, Peina M. Scientific Production of Research Fellows at the Zagreb University School of Medicine, Croatia. Croat Med J. 2006;47:776-82.

Correspondencia: Dr. Luis Figueroa Direccin: Av. Brasil 1032, Brea. Lima, Per. Telfono: (511) 650-0745 Correo electrnico: luisjoeldoc@yahoo.it

693

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

MIGRACIN DE MDICOS PERUANOS A ESPAA, 2005-2009


MIGRATION OF PERUVAN PHYSICIANS TO SPAIN, 2005-2009
Diego A. Bernardini-Zambrini1,2,a, Jos Francisco Garca Gutierrez1,3,a, Percy Mayta-Tristn4,b Sr. Editor. La migracin de profesionales de la salud es un fenmeno que se ha dado siempre y que ahora, al poder ser cuantificado e incluido en la agenda de la poltica sanitaria actual, ha cobrado mayor relevancia. En el caso especial de los mdicos, este flujo migratorio suele ser unidireccional, esto significa migrar desde un lugar con menor desarrollo socioeconmico a uno donde las condiciones son mejores (1). Esta situacin genera un desafo para los sistemas de salud, ya que el reto es llevar a los profesionales de salud a los lugares con mayor necesidad (2). En los ltimos aos ha cobrado relevancia el efecto llamada que ha tenido para algunos pases de Amrica Latina el sistema de salud espaol a travs del programa de formacin MIR Mdico Interno Residente para la especializacin mdica. Por otro lado, Espaa es el principal pas de destino migratorio de los futuros mdicos peruanos (3); sin embargo, el nmero total de mdicos peruanos que han emigrado a Espaa al programa MIR no ha sido cuantificado. Por ello, analizamos la participacin de mdicos provenientes de Per en el sistema MIR espaol durante el periodo comprendido entre los aos 2005 - 2009. Se revis la informacin pblica que dispone el Ministerio

de Sanidad, Poltica Social e Igualdad de Espaa para el periodo de estudio. Per es el pas que ms mdicos extranjeros aport a las pruebas de seleccin MIR desde el ao 2001 al 2009 con un total de 3090 graduados en condicin de optar a una plaza, seguido por Colombia con 2622, Republica Dominicana 1106 y Mxico 905. De este total, 2866 (92,8 %) correspondieron al periodo 2005 2009, evidencindose un incremento ao a ao de postulantes y electores (Tabla 1). Un aspecto importante relacionado con las especialidades elegidas es que dos de cada cinco mdicos peruanos eligieron una plaza de medicina familiar, proporcin que ha ido disminuyendo; por otro lado, el ndice de personas que consiguen una plaza en relacin con el total de postulantes ha ido decayendo. Estas cifras indican que Per es el principal pas donante de mdicos al sistema de especializacin espaol. Lo primero que se observa es que esta fuga de cerebros se ha dado de manera continua en los ltimos diez aos, con un mayor incremento en el ltimo quinquenio, situacin similar a la de Republica Dominicana y Mxico. Este hallazgo sobre la predisposicin a migrar en profesionales peruanos estara asociado con distintos motivos, pero la motivacin primaria sera econmica (3), dada la inequidad remunerativa existente en el sistema de salud peruano (4). En el flujo de migracin de un pas a otro, el efecto de filtro lo establece el pas receptor, a travs de la regulacin segn sus necesidades. Por lo cual es importante considerar que el flujo de salida se mantendr constante mientras las condiciones en el mercado receptor sean favorables; en todo caso, una regulacin ms estrecha har que quienes puedan optar a esas plazas sean

Tabla 1. Evolucin de la participacin de mdicos graduados en Per en el examen MIR de Espaa, 2005-2009.
Ao 2005 2006 2007 2008 2009 Examen MIR Admitidos 340 578 940 978 1140 Electores 252 455 596 701 862 Asignados 169 243 335 422 403 ndice asignados / postulantes 0,497 0,420 0,356 0,413 0,354 Especialidad Medicina Familiar N (%) 81 (47,9) 116 (47,7) 146 (43,6) 188 (44,6) 148 (36,7)

MIR: mdico interno residente. Organizacin Panamericana de la Salud. Washington DC, EE.UU. Facultad de Medicina, Universidad de Buenos Aires. Buenos Aires, Argentina. 3 Escuela Andaluza de Salud Pblica. Granada, Espaa. 4 Escuela de Medicina, Universidad Peruana de Ciencias Aplicadas. Lima, Per. a Mdico, Doctor en Medicina; b Mdico salubrista
1 2

Recibido: 29-08-11

Aprobado: 14-09-11

694

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

quienes estn mejor preparados, es decir, dadas las condiciones actuales y las proyecciones establecidas, consideramos que seguir existiendo este flujo migratorio de mdicos peruanos al sistema de especializacin MIR espaol. El segundo punto por considerar es lo que sucede con este mdico extranjero, cuando termina su formacin en el sistema espaol, existen tres opciones: (a) se integra al sistema de salud espaol, (b) retorna a su pas de origen o (c) migra a un pas distinto. Espaa tiene un sistema nacional de salud descentralizado con larga tradicin en atencin primaria y es un pilar del estado de bienestar, por lo que la medicina pblica es la primera opcin de todo mdico especializado y, en particular, para los egresados de medicina familiar. El orientarse a la medicina privada es una opcin que est ms relacionada con retornar a su pas o migrar a otro, que trabajar de esa forma en Espaa. No tenemos datos sobre cuantos de los mdicos peruanos formados en el MIR han retornado a su pas, no se han encontrado polticas desde el Estado para incentivar su retorno, por lo que suponemos que aquellos que lo hacen seran principalmente para ejercer en la prctica privada. Otra opcin, sera la de utilizar a Espaa como pas de capacitacin y trnsito para luego poder migrar a un pas que garantice mejores condiciones y con tradicin ms slida en su sistema de salud como podran ser Alemania o el Reino Unido (como lo podran hacer algunos futuros mdicos espaoles) (5); sin embargo, no existen estudios al respecto y futuras investigaciones deberan abordar el tema. En conclusin, evidenciamos un flujo continuo y en crecimiento de mdicos graduados en Per que se insertan en el sistema de formacin especializada de Espaa (MIR), se requieren estudios que evidencien cul es el futuro laboral de estos mdicos, si es que se insertan al sistema de salud espaol, retornan al Per o migran a otros pases, para luego poder analizar las consecuencias de esta situacin para ambos sistemas de salud.

REFERENCIAS BIBLIOGRFICAS
1. Stillwell B, Diallo K, Zurn P, Vujicic M, Adams O, Dal Poz M. Migration of health-care workers from developing countries: strategic approaches to its management. Bull World Health Organ. 2004;82(8):595-600. 2. World Health Organization. Increasing access to health workers in remote and rural areas through improved retention. Global policy recommendations. Geneva: WHO; 2011. 3. Mayta-Tristn P, Dulanto-Pizzorni A. Prevalencia y factores asociados con la intencin de emigracin en internos de medicina de una universidad pblica, Lima 2007. Rev Peru Med Exp Salud Publica. 2008; 25(3): 274-8. 4. Pardo K, Andia M, Rodriguez A, Perez W, Moscoso B. Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social, 2009. Rev Peru Med Exp Salud Publica. 2011;28(2):342-51. 5. Bernardini-Zambrini D, Barengo N, Bardach A, Hanna M, Nuez JM. Migrar o no migrar? Qu pasar com nuestra prxima generacin de mdicos? Estudio sobre causas y motivos de estudiantes avanzados de medicina de 11 universidades de Espaa. Aten Primaria. 2011;43(5):222-6. Correspondencia: Diego Bernardini Zambrini Direccin: 525 Twenty third street, NW, Washington DC 20037 Telfono: 001-202-974-3767 Correo electrnico: bernardd@paho.org

POLIOMIELITIS PARALTICA CAUSADA POR LA VACUNA ORAL SABIN: TIEMPO DE CAMBIAR DE VACUNA?
PARALITIC POLIOMYELITIS CAUSED BY THE ORAL SABIN VACCINE: TIME FOR A VACCINE CHANGE? Wilfredo Gutirrez1,a
Sr. Editor. En mayo de 1985 la Oroganizacin Panamericana de la Salud-OPS emprende la estrategia de interrupcin de la transmisin del virus salvaje de la polio en el continente americano. Ya para esa poca, 22 de los 36 pases del continente estaban libres de poliovirus salvaje autctono, comenzando por las Islas Caymn en 1958 y Cuba y Guyana en 1962. En agosto de 1991 se detecta el ltimo caso en Per (Pichanaqui, Junn), que a su vez fue el ltimo en toda Amrica, por lo que en septiembre de
1 a

Fuente de financiamiento
Autofinanciado.

Conflictos de inters

Los autores declaran no tener conflictos de inters en la publicacin de este artculo. Las opiniones y juicios vertidos en este escrito, corresponden a la opinin de sus propios autores y no representa la posicin de las instituciones a la que pertenecen.

Instituto Cunto. Lima, Per. Mdico cirujano, Magster en Salud Pblica

Recibido: 12-10-10

Aprobado: 27-10-10

695

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

1994, la OPS declara lograda la meta de interrupcin de la transmisin del virus salvaje de la polio en todo el continente americano (1). Desde entonces, a la fecha, no se ha detectado en la regin polio paraltica por el virus salvaje. Transcurridos 20 aos de este memorable hecho, los pases de Amrica se ven confrontados a la situacin paradjica de que la vacuna oral para la polio usada hasta ahora en la mayor parte de ellos para erradicar dicha enfermedad, por ser un virus vivo atenuado, tiene un riesgo de producir poliomielitis que es indistinguible de la producida por el virus salvaje. Este riesgo, segn diferentes estudios, va de un caso de polio por cada 750 000 dosis de vacuna oral; a un caso por 2,2 millones de dosis (2,3), sobre todo despus de la primera dosis. Ante esta situacin, pases como Canad, Estados Unidos, Mxico, Venezuela y Costa Rica, optaron por cambiar la vacuna oral con virus atenuado (OPV o Sabin) por la vacuna parenteral de virus inactivado o muerto (IPV o Sachs) en su esquema regular de vacunacin. Igual ha ocurrido en la mayora de pases desarrollados de Europa y Asia, y en algunos pases subdesarrollados como Egipto, Sudfrica, Arabia Saudita, Kuwait, Catar, Oman, Emiratos rabes Unidos y Barein. Con ello se ha disminuido drsticamente los casos de polio relacionada con la vacuna. En los pases en vas de desarrollo, donde todava se tiene coberturas de vacunacin inferiores al 95 %, con el fin de mantener la inmunidad humoral y local a nivel intestinal, mantienen el esquema de las dos primeras dosis con IPV seguido de dos dosis de OPV. Con ello se mantienen altos niveles de anticuerpos circulantes contra el virus de la polio salvaje y se aprovecha el efecto beneficioso de la diseminacin del virus de la vacuna oral a nios susceptibles, previniendo la entrada del virus salvaje existente todava en algunos pases del mundo (4). En el mbito nacional, en el 2003, en Moquegua se notific el primer caso de poliomielitis paraltica causada por el virus de la vacuna. En el 2010 se identific un caso en Lima procedente de Villa El Salvador y en el 2011 se produjeron tres casos en Lima: uno en San Juan de Miraflores, otro en Santa Anita y un tercero en el Callao. Todos los casos padecan de alguna inmunodeficiencia (5). Tomando en cuenta la poblacin de menores de un ao proyectada por el Instituto Nacional de Estadstica e Informtica-INEI para cada ao y asumiendo que todos los nios han sido vacunados con tres dosis, se obtienen las tasas de casos de polio relacionados a la vacuna. Para el 2003 esta relacin fue de un caso por 1 612 591 dosis; para el 2010 fue de un caso por cada 1 741 200 dosis y, para el 2011, de un caso por cada 589 273 dosis. Segn el Ministerio de Salud, desde el ao 1995 hasta el 2010, las coberturas de vacunacin antipoliomieltica,

105 100 95 90 85 80 75 93 99 97 96 96 93 90 95 95 91 85 95 96 98 92 92

Figura 1. Per: cobertura de antipolio 3, aos 1993 al 2010.


Fuente: WHO. Peru reported immunization coverage. 22 July 2011. Disponible en: http://www.who.int/vaccines/globalsummary/immunization/ countryprofileresult.cfm?C=per

se han mantenido encima del 90 %, (a excepcin del ao 2005), habiendo llegado al 99 % y 98 % respectivamente en los aos 1996 y 2008 (Figura 1). La OPS plantea que En el escenario globalizado de hoy, representa un riesgo para ocurrencia de brotes si no se garantiza niveles de coberturas de vacunacin (nacionales y por municipios) superiores a 95 % en los pases sin transmisin de polio (6). Sin embargo, ante el incremento de casos de polio paraltica relacionada con la vacuna oral en nuestro pas, se puede sugerir que nuestras autoridades de salud evalen la posibilidad de sustituir la vacuna oral (OPV) por la parenteral de virus inactivado (IPV), que no tiene este riesgo. El costo de esta vacuna adquirida dentro del fondo rotatorio de la OMS es de USD 5,5 por dosis, que en dosis combinada con las vacunas para la difteria, tos ferina, ttanos, hepatitis B, haemophilus influenzae (hexavalente) llegara a costar alrededor de USD 8, por debajo del costo de la vacuna para el virus del papiloma humano que es efectiva contra dos cepas y cuesta USD 14 la vacuna (7). La vacuna hexavalente podra ser sustituida por la pentavalente, aprovechando que en la vacuna antipolio las coberturas son superiores al 90%. De no hacer este cambio, con la estrategia actual de vacunacin regular, ms dos o tres campaas masivas anuales y los barridos al detectar casos de parlisis flcida aguda, se corre el riesgo de que estos casos se incrementen y la poblacin pierda confianza en las vacunas, lo que puede derivar en brotes de otras enfermedades inmunoprevenibles.

Referencias Bibliogrficas
1. Organizacin Panamericana de la Salud. La certificacin de la erradicacin del poliovirus salvaje del continente americano. Boletn Epidemiolgico. 1994;15(4):1-3.

696

95 19 96 19 97 19 98 19 99 20 00 20 01 20 02 20 03 20 04 20 05 20 06 20 07 20 08 20 09 20 10

19

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

2. Zimmerman R, Spann S. Poliovirus vaccine options. Am Fam Physician. 1999;59(1):113-8, 125-6. 3. Andrus J, Strebel P, de Quadros C, Oliv J. Risk of vaccine-associated paralytic poliomyelitis in Latin America, 1989-91. Bull World Health Organ. 1995;73(1):33-40. 4. Organizacin Mundial de la Salud. Polio vaccines and routine polio immunization in the pre-eradication era. position paper, Draft 2 Mar 2010, external review. Meeting of the Strategic Advisory Group of Experts on Immunization (SAGE). Geneva, WHO. April 2010. 5. Ministerio de Salud del Per, Direccin General de Epidemiologa. Informe sobre situacin de la poliomielitis en el Per, 2011. Lima: Minsa; 2011. 6. Organizacin Panamericana de la Salud. Alerta Epidemiolgica, 20 de octubre del 2010. Washington, DC: OPS; 2010. 7. Organizacin Panamericana de la Salud. Programa Ampliado de Inmunizaciones. Precio de las vacunas para el 2011. Enmienda III, 27-6-2011. Washington, DC: OPS; 2011. Correspondencia: Wilfredo Gutirrez Peafiel Direccin: Av Lima 270, Block 31 Dpto 503, Barranco Telfono: (51) 989723100 Correo electrnico: gutierrw@gmail.com

peruana durante el ao 2004 (4). El hecho de que esto no se refleje en las estadsticas mencionadas, sugiere una baja deteccin y subregistro en el diagnstico. En pases desarrollados hasta el 69% de los pacientes con depresin no son reconocidos por sus mdicos tratantes en centros de atencin primaria (5), lo cual podra estar replicndose en nuestro medio. El probable subregistro o falta de diagnstico en atencin primaria es importante, pues un diagnstico y tratamiento oportuno mejoraran el pronstico en los desrdenes depresivos. La creciente atencin hacia las consecuencias de los desrdenes mentales, especialmente los trastornos depresivos, parece haber tenido poco efecto en la sensibilizacin de los mdicos y dems personal de atencin primaria hacia una mejor atencin. El manejo oportuno de estos trastornos en el nivel primario de atencin, brindara un beneficio costo-efectividad, ms aun cuando se ha descrito que la intervencin de un psiquiatra no resulta ms eficaz que el manejo dado por un mdico general (6). Conclumos que es de inters en salud pblica la mejora de la deteccin, registro y tratamiento de desrdenes depresivos en los primeros niveles de atencin.

Conflictos de inters

SUBREGISTRO DE TRASTORNOS DEPRESIVOS


UNDER REPORTING OF DEPRESSIVE DISORDERS
Paulo Ruiz-Grosso1,a, Jorge Osada1,a, Wolfgang Hoppe1,b, Bruno Pedraz1,b, Johann Vega-Dienstmaier1,2,c Sr. Editor. Segn la Norma Tcnica de Salud 021-2004 del Ministerio de Salud, el mdico de un puesto de salud debe tratar trastornos depresivos que no requieran manejo especializado. Sin embargo, al analizar los ltimos reportes disponibles en las pginas web de las Direcciones de Salud II (Lima Sur) y V (Lima Ciudad) nos percatamos de que los trastornos depresivos no aparecen entre las causas ms frecuentes de morbilidad (1,2). Evidencia cientfica actual sostiene que la prevalencia de estos trastornos es importante en la poblacin peruana (6,6%), ms aun al considerar su implicancia en la discapacidad individual (3). Se ha estimado 231820 aos de vida saludables perdidos en la poblacin
Grupo de Trabajo en Salud Mental, Universidad Peruana Cayetano Heredia. Lima, Per. 2 Hospital Nacional Cayetano Heredia. Lima, Per. a Mdico Epidemilogo; b Estudiante de Medicina; c Mdico-Psiquiatra
1

Los autores declaran no tener conflictos de inters en la publicacin de la presente carta.

Referencias Bibliogrficas
1. Ministerio de Salud del Per, Direccin de Salud Lima II. Morbilidad General por Grupos de Enfermedad. Lima: MINSA; 2011. 2. Ministerio de Salud del Per, Direccin de Salud Lima V. Primeras 20 Causas de Mortalidad General. Lima: MINSA; 2011. 3. Saavedra J. Estudio Epidemiologico en Salud Mental 2002: Informe General. Lima: Instituto Nacional Honorio Delgado - Hideyo Noguchi; 2002. 4. Mitchell AJ, Vaze A, Rao S. Clinical diagnosis of depression in primary care: a meta-analysis. Lancet. 2009;374(9690):609-19. 5. Barbui C, Tansella M. Identification and management of depression in primary care settings. A meta-review of evidence. Epidemiol Psichiatr Soc. 2006;15(4):276-83. 6. Cape J, Whittington C, Bower P. What is the role of consultation-liaison psychiatry in the management of depression in primary care? A systematic review and meta-analysis. Gen Hosp Psychiatry. 2010;32(3):246-54.

Recibido: 18-08-10

Aprobado: 24-08-11

Correspondencia: Paulo Jorge Martin Ruiz-Grosso Direccin: Ca. Ortiz de Zevallos 124, Urbanizacin San Antonio. Miraflores, Lima 18, Per. Telfono: (511) 2427516 Correo electrnico: paulo.ruiz@upch.pe

697

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

NECESIDAD DE EVALUAR LAS GUAS CLNICAS PERUANAS DE TRATAMIENTO PARA TRASTORNOS MENTALES
THE NEED FOR EVALUATING THE PERUVIAN CLINICAL GUIDELINES FOR TREATMENT OF MENTAL DISORDERS Juan Antonio Glvez-Buccollini1,2,3,a, Fabin Fiestas3,4,b
Sr. Editor. La Organizacin Panamericana de la Salud (OPS) estima que el 90 % de los problemas neuropsiquitricos pueden ser atendidos en el nivel primario de atencin (1). Esta estimacin es relevante para varios pases como el Per, donde este tipo de problemas constituyen la primera causa de prdidas por discapacidad y muerte prematura, y el nmero de psiquiatras es reducido y mal distribuido a travs de sus regiones. As, la participacin de mdicos no psiquiatras en la deteccin y tratamiento de estos problemas, representa una solucin a este desventajoso escenario. Sin embargo, es frecuente que los mdicos no psiquiatras tengan dificultades en reconocer los sntomas, establecer un diagnstico e iniciar un tratamiento adecuado para los problemas de salud mental (2). Esta situacin lleva a que muchos de los pacientes que logran acceder a los servicios de salud -lo que es ya un enorme desafo- consigan ayuda mdica muy limitada para estos problemas. Uno de los pasos iniciales que se deben dar si se quiere implementar y desarrollar un sistema comunitario de salud mental, es contar con guas clnicas de tratamiento (GCT). Esto es porque las GCT -si son construidas a travs de un estricto proceso cientfico y pasan por un proceso de concertacin con actores locales de amplia experiencia en el rea- entregan informacin concreta, contextualizada y basada en la mejor evidencia cientfica disponible. Con las GCT, los mdicos no especialistas podran identificar y tratar satisfactoriamente trastornos mentales, as como derivar a cuidado especializado aquellos casos que as lo requieran (3).

El Ministerio de Salud del Per (MINSA) reconoce la importancia de las GCT. Por lo cual, public entre el 2006 y el 2008, GCT para depresin, psicosis, violencia basada en gnero y para problemas relacionados con el uso de sustancias psicoactivas (http://www.minsa.gob. pe/portada/est_san/saludmental.htm). Sin embargo, estas guas necesitan una revisin crtica con relacin a sus recomendaciones. Mencionaremos aqu solo algunas observaciones a la GCT de depresin (4), por ser uno de los problemas de salud mental ms frecuentes y de tratamiento ms accesible en el nivel primario de atencin. Por ejemplo, en esta gua se recomiendan dos esquemas principales de tratamiento que pueden ser usados en el nivel de atencin primaria. El primer esquema incluye fluoxetina, 20 mg, con la posibilidad de aumentar a 40 mg diarios si no hay repuesta con la dosis inicial. El segundo esquema incluye una prueba teraputica de sertralina, 50 mg (4). Si el paciente no responde al esquema iniciado, el siguiente paso es referirlo a un tratamiento especializado. Sin embargo, un ensayo teraputico completo significa usar la medicacin a dosis mxima (o mxima tolerable) por un tiempo establecido (5). Entonces, si seguimos el esquema propuesto por la actual GCT, se estara refiriendo al paciente de forma precoz al especialista sin establecer con claridad si realmente el paciente no respondi al tratamiento o si la dosis fue insuficiente, particularmente si hubo una respuesta parcial. Debido a que en muchas partes del Per los servicios especializados en salud mental no existen o son muy limitados, una referencia precoz al especialista no sera lo ms idneo desde la perspectiva de la salud pblica. De otro lado, la discusin que la GCT hace sobre efectos adversos e interacciones de los antidepresivos es limitada. Por ejemplo, no se menciona los potenciales efectos adversos en la funcin sexual a pesar de ser un problema prevalente, especialmente con los ISRS (26-80 %), lo que puede afectar significativamente la adherencia al tratamiento y la calidad de vida. Asimismo, la GCT menciona que los ISRS no disminuyen el umbral convulsivo a pesar de que la evidencia muestra que estos medicamentos s lo hacen, aunque en menor medida que los antidepresivos tricclicos (ATC) (6). Ms adelante, la actual GCT considera el uso de la combinacin de ATC y los inhibidores de la monoaminoxidasa (IMAO) en los casos de depresin refractaria al tratamiento. Si bien existen informes del uso de IMAO en combinacin con algunos ATC, no existen ensayos clnicos doble ciego randomizados que confirmen seguridad y eficacia. Por lo cual, la recomendacin estndar es no combinar ATC con

Harvard South Shore Psychiatry Residency Training Program, Harvard Medical School. Boston, EEUU. 2 Veterans Affairs Boston Healthcare System. Boston, EEUU. 3 Red para la Accin y Avance de la Salud Mental y Psiquiatra (Red AVANSE-PSI). Lima, Per. 4 Unidad de Anlisis y Generacin de Evidencias en Salud Pblica, Instituto Nacional de Salud. Lima, Per. a Mdico Cirujano; b Mdico Epidemilogo
1

Recibido: 04-11-11

Aprobado: 09-11-11

698

Rev Peru Med Exp Salud Publica. 2011;28(4):688-99.

Cartas al editor

IMAO (6). En concordancia, la gua de depresin de la OMS tampoco incluye esta recomendacin. De hecho, existe evidencia que la combinacin ATC-IMAO puede resultar en graves complicaciones (Ej. el sndrome serotoninrgico) que pueden llevar a la muerte. Por lo cual, se debe considerar revisar la idoneidad de incluir esta recomendacin en una GCT. En la seccin de complicaciones de la GCT se menciona que el 15 % de los pacientes con depresin termina suicidndose. Sin embargo, no se discute cmo realizar una adecuada evaluacin del riesgo suicida siendo esta parte esencial en cualquier evaluacin de salud mental. Adems, si bien se seala inicialmente que el diagnstico de depresin es clnico, en la seccin de ayuda diagnstica se mencionan como exmenes tiles al SPECT y la prueba de supresin de dexametasona. Estos procedimientos pueden ser informativos y tiles en el rea de investigacin, pero no tienen ninguna relevancia o aplicacin estandarizada en la prctica clnica. De esta manera, se podra eventualmente inducir a un malgasto de los escasos recursos con que los pacientes y el sistema de salud cuentan en nuestro pas. Todo lo expuesto nos obliga a recomendar una revisin y actualizacin urgente de las GCT peruanas para trastornos mentales. Estas GCT deben ser construidas usando los procesos cientficos ms rigurosos y ser adaptadas o contextualizadas a las circunstancias especficas asistenciales y de disponibilidad de recursos en salud que tiene nuestro pas. El MINSA, en coordinacin con las instituciones especializadas en metodologas de revisiones sistemticas y guas clnicas (como el Instituto Nacional de Salud), e instituciones especializadas en salud mental, (como el Instituto

Nacional de Salud Mental, DEVIDA, entre otras) deben iniciar estas acciones, las cuales, de llevarse a cabo, lograrn hacer ms accesible un cuidado de calidad y estandarizado en salud mental a toda la poblacin.

Conflictos de inters

Los autores declaran no tener conflicto de intereses.

REFERENCIAS BIBLIOGRFICAS
1. Organizacin Panamemericana de la Salud. Marco de Referencia para la implementacin de la Estrategia Regional de Salud Mental. Washington DC, EE.UU.: OPS; 2011. 2. Wittchen HU, Hfler M, Meister W. Prevalence and recognition of depressive syndromes in German primary care settings: poorly recognized and treated? Int Clin Psychopharmacol. 2001;16(3):121-35. 3. Zeiss AM, Karlin BE. Integrating mental health and primary care services in the Department of Veterans Affairs health care system. J Clin Psychol Med Settings. 2008;15(1):73-8. 4. Ministerio de Salud del Per. Gua de Prctica Clnica en Depresin. Lima: Ministerio de Salud; 2008. 5. Sadock BJ, Sadock VA. Kaplan & Sadocks Synopsis of Psychiatry: Behavioral Science/Clinical Psychiatry. 9th ed. Philadelphia: Lippincott Williams and Wilkins; 2003. 6. Haddad PM, Dursun S. Neurological complications of psychiatric drugs: Clinical features and management. Hum Psychopharmacol Clin Exp. 2008;23(Suppl1):15-26.

Correspondencia: Juan Antonio Glvez-Buccollini Abanto Clinical Fellow in Psychiatry, Harvard Medical School. Boston MA, EE.UU. Telfono: (508) 857-7906 Correo electrnico: Juan_Galvez-Buccollini@hms.harvard.edu

Visite los contenidos de la revista en:

www.ins.gob.pe/rpmesp

699

Rev Peru Med Exp Salud Publica. 2011;28(4):700-4.

revisores

REVISORES DEL AO 2011


El Comit Editor de la Revista Peruana de Medicina Experimental y Salud Pblica (RPMESP) agradece a cada uno de los destacados profesionales, expertos en sus respectivas reas, quienes han colaborado de forma desinteresada y con celeridad en la revisin de los manuscritos que les fueron enviados para su evaluacin. Cuando llega un artculo a la RPMESP, el Comit Editor evala la pertinencia de su publicacin, que no tenga conflictos ticos y que su calidad sea la adecuada; luego, decide enviarlo a dos o ms revisores en el caso de artculos originales (incluyendo originales breves) y uno o ms en reportes de casos, revisiones, simposios, entre otros. Para seleccionar a los revisores realizamos una bsqueda de investigadores que hayan publicado artculos similares en revistas de alto impacto; esta bsqueda se inicia identificando artculos parecidos, en MedLine o SCOPUS, escritos en espaol para luego contactarnos va correo electrnico con el autor y realizar el proceso de revisin on-line. Este mecanismo de seleccin de revisores ha permitido un trabajo ms rpido y de mayor calidad, con participacin de investigadores extranjeros y nacionales de amplia trayectoria.

Agapito, Juan Instituto Peruano de Energa Nuclear, Lima, Per. Aguilar-Salinas, Carlos A. Instituto Nacional de Nutricin Salvador Zubirn, Mxico D.F., Mxico. Aguirre-Acevedo, Daniel Camilo Instituto de Investigaciones Mdicas, Universidad de Antioquia, Medelln, Colombia. Alva, Isaac Facultad de Salud Pblica y Administracin, Universidad Peruana Cayetano Heredia, Lima, Per. Alvarado Menacho, Sergio Facultad de Odontologa, Universidad Nacional Mayor de San Marcos, Lima, Per. lvarez-Falcon, Pedro Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Apolaya Segura, Moiss Departamento de Redes de Servicios de Salud, Direccin de Salud de las Fuerzas Armadas del Per, Lima, Per. Aqueveque, Pedro Facultad Ingeniera Agrcola, Universidad de Concepcin, Chilln, Chile. Arbail Hugo Servicio de Endocrinologa, Hospital Dos de Mayo, Lima, Per. Arias Stella, Javier Academia Nacional de Medicina, Lima, Per. Arroyo Acevedo, Jorge Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Astete Cornejo, Jonh Centro Nacional de Salud Ocupacional y Proteccin del Ambiente para la Salud, Instituto Nacional de Salud, Lima, Per. Barengo, Noel Fundacin para la Prevencin y el Control de las Enfermedades Crnicas No Transmisibles en Amrica Latina (FunPRECAL), Buenos Aires, Argentina. Bernabe-Ortiz, Antonio Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Bernab, Eduardo Institute of Dentistry, Barts and The London Queen Mary, University of London, England. Blanco, Sal Instituto de Medio Ambiente, Recursos Naturales y Biodiversidad, Universidad de Len, Len, Espaa. Blmel, Juan Enrique Laboratorio Hospital Barros Luco, Universidad de Chile, Santiago de Chile, Chile. Bolaos-Daz, Rafael Unidad de Anlisis y Generacin de Evidencias en Salud Pblica, Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Borracci, Ral A. Facultad de Ciencias Biomdicas, Universidad Austral, Buenos Aires, Argentina. Burstein Alva, Zuo Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Bustamante, Beatriz Laboratorio de Micologa, Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Per. Cabezas, Csar Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Cabrera, Pedro Instituto Nacional de Salud, Lima, Per. Cabrera Champe, Rufino Direccin General de Epidemiologa, Ministerio de Salud, Lima, Per. Cceres, Carlos F. Facultad de Salud Pblica y Administracin, Universidad Peruana Cayetano Heredia, Lima, Per. Campos Navarro, Roberto Facultad de Medicina, Universidad Nacional Autnoma de Mxico, Mxico D.F., Mxico. Crcamo, Daniel Facultad de Medicina, Universidad del Desarrollo, Santiago de Chile, Chile.

700

Rev Peru Med Exp Salud Publica. 2011;28(4):700-4.

Revisores

Hospital de Emergencias Peditricas, Lima, Per. Hospital Regional de Loreto Felipe Arriola Iglesias, Loreto, Per. Departamento de Psiquiatra Biolgica, Instituto Nacional de Salud Mental Honorio Delgado - Hideyo Noguchi, Lima, Per. Castro Salas, Manuel Facultad de Medicina, Universidad de Concepcin, Concepcin, Chile. Celis, Tania Hospital Nacional Hiplito Unanue, Lima, Per. Chicaiza, Wilson Departamento de Docencia Mdica e Investigacin, Hospital Vozandes Quito, Quito, Ecuador. Clarimon, Jordi Laboratorio Alzheimer, Hospital de la Santa Cruz y San Pablo, Barcelona, Espaa. Collins, Jaime A. Departamento de Medicina Interna, Hospital Guillermo Almenara, EsSalud, Lima, Per. Cornejo, Marco Hospital Beln, Trujillo, Per. Costa-Cruz, Julia Mara Instituto de Ciencias Biomdicas, Universidad Federal de Uberlandia, Minas Gerais, Brasil. Cremonte, Mariana Facultad de Psicologa, Universidad Nacional de Mar del Plata, Buenos Aires, Argentina. Crisante, Maruja Direccin de Acceso y Uso de Medicamentos, Direccin General de Medicamentos, Insumos y Drogas, Ministerio de Salud, Lima, Per. Cristancho, Edgar Departamento de Biologa, Facultad de Ciencias, Universidad Nacional de Colombia, Bogot, Colombia. Cruces Lpez, Fabiola Departamento de Botnica, Universidad de Concepcin, Concepcin, Chile. Curioso, Walter H. Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Daz Guzmn, Jaime Servicio de Neurologa, Hospital Universitario Doce de Octubre, Madrid, Espaa. Daz Vlez, Cristian Hospital Almanzor Aguinaga Asenjo, Chiclayo, Per. Daz-Camacho, Sylvia P. Facultad de Ciencias Qumico Biolgicas, Universidad Autnoma de Sinaloa, Culiacn, Mxico. Donaires, Luis Fernando Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Escalante, Giovanni Gestin y Desarrollo de Recursos Humanos en Salud, OPS/OMS, Lima, Per. Espinoza Culup, Abraham Omar Laboratorio de Microbiologa Molecular y Biotecnologa, Facultad de Ciencias Biolgicas Universidad Nacional Mayor de San Marcos, Lima, Per. Espinoza Gonzlez, Ricardo Facultad de Medicina, Universidad de Los Andes, Santiago de Chile, Chile. Fernndez-Prada, Mara Departamento de Medicina Preventiva y Salud Pblica, Universidad de Granada, Granada, Espaa. Fiestas, Fabin Laboratorios de Investigacin y Desarrollo, Facultad de Ciencias y Filosofa, Universidad Peruana Cayetano Heredia, Lima, Per. Fresn, Ana Departamento de Epidemiologa Clnica, Instituto Nacional de Psiquiatra Ramn de la Fuente, Mxico D.F., Mxico. Galn-Puchades, M. Teresa Departamento de Parasitologa, Facultad de Farmacia, Universidad de Valencia, Valencia, Espaa. Galarza Prez, Marco A. Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Gallo, Carla Laboratorios de Investigacin y Desarrollo, Facultad de Ciencias y Filosofa, Universidad Peruana Cayetano Heredia, Lima, Per. Galvo Freire , Tas Universidade Federal do Amazonas (UFAM), Manaus, Amazonas, Brasil. Gamboa, Ral Clnica San Felipe, Lima, Per. Garca, Coralith Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Per. Garca, Patricia Facultad de Salud Pblica y Administracin, Universidad Peruana Cayetano Heredia, Lima, Per. Garca-Huidobro, Diego Departamento de Medicina Familiar, Pontificia Universidad Catlica de Chile, Santiago de Chile, Chile. Garza-Ramos, Ulises Instituto Nacional de Salud Pblica, Cuernavaca, Morelos, Mxico. Ghannem, Hassen University Hospital Farhat Hached, Sousse, Tnez. Gianella, Camila Educacin en Derechos Humanos con aplicacin en Salud, Lima, Per. Gonzlez Rengifo, Gustavo F. Facultad de Ciencias y Filosofa, Universidad Peruana Cayetano Heredia, Lima, Per.

Carreazo, Yhuri Casapa, Martn Castillo, Aitor

701

Rev Peru Med Exp Salud Publica. 2011;28(4):700-4.

Revisores

Grande, Miguel Grijalva, Carlos G.

Centro Nacional de Control de Calidad, Instituto Nacional de Salud, Lima, Per. Division of Pharmacoepidemiology, Department of Preventive Medicine, Vanderbilt University School of Medicine, Nashville, Tennessee, USA. Guerreros, Alfredo Unidad de Investigacin, Clnica Internacional, Lima, Per. Guilln Oneeglio, Alfredo Facultad de Tecnologa Mdica, Universidad Nacional Federico Villarreal, Lima, Per. Guio, Heinner Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Gutirrez, Alfonso Unidad de Anlisis y Generacin de Evidencias en Salud Pblica, Instituto Nacional de Salud, Lima, Per. Gutirrez Villafuerte, Csar Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Gutirrez Hernndez, Pedro R. Universidad de La Laguna, Tenerife, Islas Canarias, Espaa. Haro-Garca, Luis Universidad Nacional Autnoma de Mxico, Mxico D.F., Mxico. Henostroza Haro, Gilberto Facultad de Odontologa, Universidad Peruana Cayetano Heredia, Lima, Per. Hernndez, Adrin V Cleveland Clinic Cleveland, Ohio, USA. Herrera Vidal, Csar Consultor nacional de TB MDR, Hospital Santa Rosa, Lima, Per. Hijar, Gisely Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Hodgins, Steve Maternal and Child Health Integrated Program-MCHIP, Washington, USA. Huamn Saavedra, Jorge Departamento de Ciencias Bsicas, Universidad Nacional de Trujillo, Trujillo, Per. Huamanchumo, Roberto Servicio de Reumatologa, Hospital Nacional Cayetano Heredia, Lima, Per. Huaman, Charles Instituto Nacional de Salud, Lima, Per. Huayanay, Leandro Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Jimnez Rivero, Gladys Departamento de Manejo de Datos y Estadstica, Centro Nacional Coordinador de Ensayos Clnicos, La Habana, Cuba. Juan Garca, Francisco J Servicio de Medicina Fsica y Rehabilitacin, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, Espaa. Jurez Garca, Marcela Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Kantor, Isabel N. de WHO TB Consultant Panel, Buenos Aires, Argentina. Lacoma, Alicia Hospital Universitari Germans Trias i Pujol. Barcelona, Espaa. Laguna-Torres, V. Alberto U.S. Naval Medical Research Unit Six (NAMRU-6). Lima, Per. Lama Valdivia, Jaime Servicio de Geriatra, Hospital Nacional Hiplito Unanue, Lima, Per. Lama, Javier Department of Global Health, University of Washington, Washington, USA. Larrateguy, Luis Dario Servicio de Tisioneumonologa, Hospital San Martn, Paran, Argentina. Lanata, Claudio F. Instituto de Investigacin Nutricional, Lima, Per. Llosa, Luca Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Lpez, Mariana C. Divisin Endocrinologa, Hospital de Clnicas Jos de San Martn, Buenos Aires, Argentina. Lorenzo, Vctor Servicio de Nefrologa, Hospital Universitario de Canarias, Tenerife, Espaa. Maco Flores, Vicente Beth Israel Medical Center, Albert Einstein College of Medicine, New York, USA. Mlaga, Germn Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Maldonado, Luis A. Instituto de Ciencias del Mar y Limnologa, Universidad Nacional Autnoma de Mxico, Mxico D.F., Mxico. Marcos, Luis A. Infectious Diseases Division, Washington University, St. Louis, USA. Martnez, Miguel ngel Hospital General de Requena, Valencia, Espaa. Martnez-Urtaza, Jaime Instituto de Acuicultura, Universidad de Santiago de Compostela. Santiago de Compostela, Espaa. Mayta-Tristn, Percy Escuela de Medicina, Universidad Peruana de Ciencias Aplicadas, Lima, Per. Mndez R., Jairo A. Instituto Nacional de Salud, Bogot, Colombia. Mendoza Ticona, Alberto Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Mendoza Fox, Carlos Hospital Hiplito Unanue, Lima, Per. Mezones-Holgun, Edward Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Minaya, Gabriela Oficina General de Investigacin y Transferencia Tecnolgica, Instituto Nacional de Salud, Lima, Per. Mira Solves, Jos J. Departamento de Psicologa de la Salud, Universidad Miguel Hernndez, Elche, Alicante, Espaa. Miranda, J. Jaime Universidad Peruana Cayetano Heredia, Lima, Per.

702

Rev Peru Med Exp Salud Publica. 2011;28(4):700-4.

Revisores

Miranda-Esquivel, Daniel Rafael Laboratorio de Sistemtica y Biogeografa, Universidad Industrial de Santander, Bucaramanga, Colombia. Miyahira Arakaki, Juan Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Montalvo, Ana Margarita Departamento de Parasitologa, Instituto Pedro Kour, La Habana, Cuba. Morabia, Alfredo Queens College, City University of New York, New York, USA. Morales Ruan, Mara del Carmen Centro de Investigacin en Nutricin y Salud, Instituto Nacional de Salud Pblica, Cuernavaca, Morelos, Mxico. Moreno Mrquez, Gorka Departamento Sociologa I, Universidad del Pas Vasco, Leioa, Espaa. Morrison, Amy U.S. Naval Medical Research Unit Six (NAMRU-6). Lima, Per. Murillo, Juan Pablo Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Navarro, Armando Departamento de Salud Pblica, Universidad Nacional Autnoma de Mxico, Mxico D.F., Mxico. Nez, Mirta Centro Nacional de Informacin Ciencias Mdicas, La Habana, Cuba. Ochoa, Theresa Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Per. Ortiz Hernndez, Luis Departamento de Atencin a la Salud, Universidad Autnoma Metropolitana, Xochimilco, Mxico. Osada, Jorge Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Osanai, Mario Consejo Regional de Medicina de Rio Grande do Sul, Brasil. Oscanoa, Teodoro Servicio de Medicina 4, Geriatra, Hospital Guillermo Almenara, EsSalud, Lima, Per. ORyan G., Miguel Facultad de Medicina, Universidad de Chile, Santiago de Chile, Chile. Pachas, Paul Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Pacheco, Alejandro Hospital Clnico de la Universidad de Chile, Santiago de Chile, Chile. Paz-Soldn, Valerie Tulane School of Public Health and Tropical Medicine, Tulane University, New Orleans, USA. Perales, Alberto Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Prez Chada, Daniel Servicio de Neumonologa, Hospital Universitario Austral, Buenos Aires, Argentina. Prez Durillo, Francisco Centro de Salud de Bailn, Jan, Espaa. Prez-Cuevas, Ricardo Unidad de Investigacin Epidemiolgica y en Servicios de Salud, Centro Mdico Nacional Siglo XXI, Mxico D.F., Mxico. Pinto Valdivia, Miguel Servicio de Endocrinologa, Hospital Nacional Cayetano Heredia, Lima, Per. Piscoya, Alejandro Escuela de Medicina, Universidad Peruana de Ciencias Aplicadas, Lima, Per. Prisco Palma-Nicols, Jos Universidad Nacional Autnoma de Mxico, Mxico D.F., Mxico. Puche, Emilio Facultad Medicina, Universidad de Granada, Granada Espaa. Puebla, Sergio Facultad de Medicina, Universidad de La Frontera, Temuco, Chile. Quintana, Manuel Servicio de Urgencias, Hospital Universitario La Paz, Madrid, Espaa. Quispe, Antonio U.S. Naval Medical Research Unit Six (NAMRU-6). Lima, Per. Ramos Jimnez, Javier Hospital Universitario Dr. Jos Eleuterio Gonzlez, Universidad Autnoma de Nuevo Len, Nuevo Len, Mxico. Rey de Castro, Jorge Universidad Peruana Cayetano Heredia, Lima, Per. Reyes-Garca, Victoria Universitat Autnoma de Barcelona, Barcelona, Espaa. Ros, Jorge de los Clnica San Felipe, Lima, Per. Rivas, Marta Instituto Nacional de Enfermedades Infecciosas, ANLIS Dr. Carlos G. Malbrn, Buenos Aires, Argentina. Rodrguez lvarez, Elena Departamento de Enfermera, Universidad del Pas Vasco, Leioa, Espaa. Rodrguez-Morales, Alfonso Facultad de Medicina, Universidad Central de Venezuela, Caracas, Venezuela. Rodrguez-Saldaa, Joel Centro de Diabetes de Pachuca, Pachuca, Hidalgo, Mxico. Rojas Armas, Juan Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Rosell De Almeida, Gustavo Prevencin y Control de la Transmisin Vertical del VIH, Ministerio de Salud, Lima, Per. Ruiz Grosso, Paulo Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Salaverry Garca, Oswaldo Centro Nacional de Salud Intercultural, Instituto Nacional de Salud. Lima, Per. Salazar Lindo, Eduardo Facultad de Medicina, Universidad Peruana Cayetano Heredia, Lima, Per. Samanez, Iris Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Per.

703

Rev Peru Med Exp Salud Publica. 2011;28(4):700-4.

Revisores

Snchez, Hugo

Unidad de Salud Pblica Nutricin y Envejecimiento Saludable, Universidad de Chile, Santiago de Chile, Chile. Snchez-Moreno, Manuel Instituto de Biotecnologa, Facultad de Ciencias, Universidad de Granada, Granada, Espaa. Sandoval Vegas, Miguel Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Seas, Carlos Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Per. Segura Cardona, ngela Mara Facultad de Medicina, Universidad CES, Medelln, Colombia. Shin, Sonya Infectious Diseases, Brigham and Womens Hospital, Boston, USA. Sogi, Cecilia Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Solari Zerpa, Lely Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per. Solis Cndor, Risof R. Superintendencia Nacional de Aseguramiento en Salud, Ministerio de Salud, Lima, Per. Soto Tarazona, Alonso Facultad de Medicina, Universidad Ricardo Palma, Lima, Per. Surez, Guillermo Pedro Center for Health Services, Management Sciences for Health, Arlington, VA USA. Takano, Juan Departamento de Patologa, Policlnico Peruano Japons, Lima, Per. Tolentino, Marcus Departamento de Ciencia y Tecnologa, Ministerio de Salud de Brasil, Brasilia, Brasil. Tolivia, Jorge Facultad de Biologa y Medicina, Universidad de Oviedo, Oviedo, Espaa. Torres, Elfi Hospital Nacional Hiplito Unanue, Lima, Per. Valds Prado, Iris Divisin de Vacunas, Centro de Ingeniera Gentica y Biotecnologa (CIGB), La Habana, Cuba. Valds Garca, Patricio Facultad de Medicina, Universidad de la Frontera, Temuco, Chile. Valenzuela, Germn Escuela de Postgrado, Universidad Nacional Mayor de San Marcos, Lima, Per. Varela Pinedo, Luis Vicerrector de Investigacin, Universidad Peruana Cayetano Heredia, Lima, Per. Vargas Herrera, Javier Instituto Nacional de Salud, Lima, Per. Vsquez, Humberto Departamento de Apoyo al Diagnstico y al Tratamiento, Hospital Emergencias Grau, EsSalud, Lima, Per. Vsquez Martnez, Francisco Instituto de Salud Pblica, Universidad Veracruzana, Xalapa, Mxico. Vega Briceo, Luis Escuela de Medicina, Pontificia Universidad Catlica de Chile, Santiago, Chile. Vega-Dienstmaier, Johann Universidad Peruana Cayetano Heredia, Lima, Per. Vega-Briceo, Luis Enrique Hospital Padre Hurtado, Santiago de Chile, Chile. Verdonck, Tina Department of Microbiology, Institute of Tropical Medicine, Antwerp, Belgium. Vildsola, Herman Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Villena Chvez, Jaime Servicio de Endocrinologa, Hospital Nacional Cayetano Heredia, Lima, Per. Vioque, Jess Departamento de Salud Pblica, Facultad de Medicina, Universidad Miguel Hernndez, Alicante, Espaa. Viscor, Gins Faculta de Biologa, Universidad de Barcelona, Barcelona, Espaa. Whittembury, lvaro Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Woolcott, Orison O. Department of Biomedical Sciences, Cedars-Sinai Diabetes and Obesity Research Institute, Los Angeles, USA. Zrate, Eduardo Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Per. Zetola, Nicola Division of Infectious Diseases, Department of Medicine, University of California, San Francisco, USA. Zurita, Susana Laboratorio de Micologa, Centro Nacional de Salud Pblica, Instituto Nacional de Salud, Lima, Per.

704

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndices del volumen 28

NDICE DE TEMAS: VOLUMEN 28 (1, 2, 3 Y 4) AO 2011 [ISSUE INDEX: VOLUME 28 (1, 2, 3 AND 4) YEAR 2011]
ABANCAY Esporotricosis en pacientes que acuden a un centro mdico de referencia en Abancay, Per. (508-12) Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) ABUSO DE ALCOHOL Factores predictores de uso problemtico de alcohol en personas atendidas en una sala de emergencia. (54-61) ACCIDENTES Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. (639-42) ACCIDENTE EREBROVASCULAR Registro de pacientes con accidente cerebro vascular como causante de hospitalizacin en un hospital pblico del Per, 2000-2009. (623-7) ACLIMATACIN Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) ADAPTACIN FISIOLGICA Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) ADHESIN BACTERIANA Patrones de adherencia de cepas de Escherichia coli difusamente adherente (DAEC) provenientes de nios con y sin diarrea. (21-8) ADICCIN Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) ADMINISTRACIN DEL PERSONAL DE SALUD Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) ADOLESCENTE Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) ADULTO MAYOR Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) Uso de medicamentos en adultos mayores no institucionalizados. (643-7) ADULTOS MAYORES DBILES Diagnstico de problemas relacionados con medicamentos en adultos mayores al momento de ser hospitalizados. (256-63) AGENDA DE INVESTIGACIN EN SALUD Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) AGENTES ANTIBACTERIANOS Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea. (648-56) ALCOHOLISMO Salud mental en mdicos que realizan el servicio rural, urbano-marginal en salud en el Per: Un estudio de lnea base. (277-81) ALELOS Polimorfismo gentico de la apolipoprotena E en una poblacin peruana. (589-94) ALTITUD Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) AMRICA LATINA Evaluaciones econmicas de tecnologas sanitarias: una perspectiva global para su aplicacin en Amrica Latina. (535-9) ANLISIS COSTO-BENEFICIO Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) ANLISIS COSTO-EFICIENCIA Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) ANCIANO Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) ANEMIA Diferencias entre la hemoglobina observada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) ANSIEDAD Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) ANTIBIOSIS Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) AOS AJUSTADOS A CALIDAD DE VIDA Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) APNEA DEL SUEO OBSTRUCTIVA Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo. (595-601) APOLIPOPROTENA A-I Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) APOLIPOPROTENAS B Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) APOLIPOPROTENAS E Polimorfismo gentico de la apolipoprotena E en una poblacin peruana. (589-94)

705

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

REAS DE ESPECIALIDAD Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) ATENCIN DE EMERGENCIA Factores predictores de uso problemtico de alcohol en personas atendidas en una sala de emergencia. (54-61) BEBIDAS ALCOHLICAS Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) BIBLIOMETRA Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) BIOTICA Retos de la biotica en la medicina del siglo XXI. (657-63) tica e investigacin. (664-9) tica y medicina: la experiencia del Colegio Mdico del Per. (670-5) BIOPSIA Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) BRASIL Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) BROTES Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) BROTES DE ENFERMEDADES Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) CALIDAD DE VIDA Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) CAMPYLOBACTER Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7)

CHOQUE CARDIOGNICO Miocarditis fulminante y enfermedad diarreica aguda por Coxsackie virus B6. (145-8) CONSENSO Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) CONTRATOS Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51) CONTROL DE VECTORES Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36) COSTO UTILIDAD Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) COSTOS DE ATENCIN MDICA Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7) COSTOS Y ANLISIS DE COSTO Costo-utilidad de la vacuna contra el virus de papiloma humano en mujeres peruanas. (416-25) Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7) CRISIS EPILPTICAS Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) CROMOBLASTOMICOSIS Cromomicosis: reporte de un caso incapacitante. (552-5) CROMOMICOSIS Cromomicosis: reporte de un caso incapacitante. (552-5)

CUESTIONARIO Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7) CUESTIONARIOS Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) DEMENCIA Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) DENGUE Circulacin de un linaje diferente del virus dengue 2 genotipo Amrica/Asia en la regin amaznica de Per, 2010. (72-7) Caractersticas clnicas de pacientes internados en el Hospital de Apoyo de Iquitos Csar Garayar Garca durante la epidemia de dengue, enero febrero de 2011. (78-82) Dengue neonatal en el Per: Reporte de un caso. (140-4) DENGUE GRAVE Caractersticas clnicas de pacientes internados en el Hospital de Apoyo de Iquitos Csar Garayar Garca durante la epidemia de dengue, enero febrero de 2011. (78-82) DEPRESIN Salud mental en mdicos que realizan el servicio rural, urbano-marginal en salud en el Per: Un estudio de lnea base. (277-81) Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) DERECHOS HUMANOS tica e investigacin. (664-9) tica y medicina: la experiencia del Colegio Mdico del Per. (670-5) DESIGUALDADES EN LA SALUD Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) DESNUTRICIN Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21)

706

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

DIABETES MELLITUS TIPO 2 Asociacin de la neuropata autonmica cardiovascular y el intervalo QT prolongado con la morbimortalidad cardiovascular en pacientes con diabetes mellitus tipo 2. (83-6) DIAGNSTICO Diagnstico de problemas relacionados con medicamentos en adultos mayores al momento de ser hospitalizados. (256-63) Anlisis de costos de los mtodos rpidos para diagnstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiolgicos del Per. (426-31) DIARREA Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) Patrones de adherencia de cepas de Escherichia coli difusamente adherente (DAEC) provenientes de nios con y sin diarrea. (21-8) Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7) DISFUNCIN ERCTIL Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) DISTRIBUCIN DE MDICOS Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) ECONOMA DE LA SALUD Anlisis de costos de los mtodos rpidos para diagnstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiolgicos del Per. (426-31) Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7) Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) ECONOMA FARMACUTICA El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7)

EDUCACIN DE PREGRADO EN MEDICINA Correlacin y concordancia entre el examen nacional de medicina y el promedio ponderado universitario: anlisis de la experiencia peruana en el periodo 2007 2009. (62-71) EDUCACIN MDICA Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194-201) ELECTROFORESIS EN GEL DE CAMPO PULSADO Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) EMBARAZO Dengue neonatal en el Per: Reporte de un caso. (140-4) Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) ENCEFALITIS Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) ENCEFALOPATAS Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) ENCUESTAS NUTRICIONALES Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) ENFERMEDAD DE ALZHEIMER Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) ENFERMEDAD DE GRAVES Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) ENFERMEDADES CARDIOVASCULARES Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55)

ENFERMEDADES ENDMICAS Identificacin de especies de Leishmania en pacientes y flebotominos en reas de transmisin en una regin del Per. (446-53) ENFERMEDADES TRANSMITIDAS POR ALIMENTOS Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) ENSAYO CLNICO Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. (676-81) ENTEROCOCCUS FAECALIS Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) ENTEROVIRUS Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) EPIDEMIAS Reporte histrico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de clera en el Per 1991. (136-9) EPIDEMIOLOGA Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7) Registro de pacientes con accidente cerebro vascular como causante de hospitalizacin en un hospital pblico del Per, 2000-2009. (623-7) EPIDEMIOLOGA AMBIENTAL Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15) EPIDEMIOLOGA DESCRIPTIVA Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) EQUIDAD Oferta y demanda de mdicos especialistas en los establecimientos de salud del Ministerio de Salud: brechas a nivel nacional, por regiones y tipo de especialidad. (177-85) ERITROCITOSIS Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91)

707

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

ERITROPOYESIS Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) ESCHERICHIA COLI Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea. (648-56) ESCHERICHIA COLI DE ADHERENCIA DIFUSA Patrones de adherencia de cepas de Escherichia coli difusamente adherente (DAEC) provenientes de nios con y sin diarrea. (21-8) ESCUELAS Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) ESPONDILITIS Espondilitis tuberculosa en adultos: revisin de una serie de casos en un hospital de tercer nivel, Lima-Per. (282-7) ESPOROTRICOSIS Esporotricosis en pacientes que acuden a un centro mdico de referencia en Abancay, Per. (508-12) ESTRATEGIAS NACIONALES Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) ESTRS LABORAL Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) ESTUDIANTES Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) ESTUDIANTES DE MEDICINA Nivel de conocimientos sobre emergencias mdicas en estudiantes de medicina de universidades peruanas. (202-9) ESTUDIANTES DEL REA DE LA SALUD Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194201)

ESTUDIOS DE EVALUACIN COMO ASUNTO Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) ESTUDIOS DE VALIDACIN Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7) ESTUDIOS EPIDEMIOLGICOS Seroprevalencia de leptospirosis en Puente Piedra, Lima en el ao 2006. (273-6) ESTUDIOS RETROSPECTIVOS Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) ESTUDIOS SEROEPIDEMIOLGICOS Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) TICA Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. (676-81) TICA MDICA Retos de la biotica en la medicina del siglo XXI. (657-63) tica e investigacin. (664-9) tica y medicina: la experiencia del Colegio Mdico del Per. (670-5) ETIOLOGA Lesiones medulares no traumticas: etiologa, demografa y clnica. (633-8) EVALUACIN DE INVESTIGACIN EN SALUD Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) Evaluaciones econmicas de tecnologas sanitarias: una perspectiva global para su aplicacin en Amrica Latina. (535-9) Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) EVALUACIN DE MEDICAMENTOS Diagnstico de problemas relacionados con medicamentos en adultos mayo-

res al momento de ser hospitalizados. (256-63) EVALUACIN ECONMICA Evaluaciones econmicas de tecnologas sanitarias: una perspectiva global para su aplicacin en Amrica Latina. (535-9) EVALUACIN EDUCACIONAL Correlacin y concordancia entre el examen nacional de medicina y el promedio ponderado universitario: anlisis de la experiencia peruana en el periodo 2007 2009. (62-71) EVALUACIN EN SALUD Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) FASCIOLA HEPATICA Estandarizacin de la tcnica de Western blot para el diagnstico de la fasciolosis humana utilizando antigenos de excrecin-secrecin de Fasciola heptica. (454-61) FASCIOLIASIS Estandarizacin de la tcnica de Western blot para el diagnstico de la fasciolosis humana utilizando antigenos de excrecin-secrecin de Fasciola heptica. (454-61) FENMENO DE EL NIO Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15) FRACTURAS DE CADERA Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) FRECUENCIA DE LOS GENES Polimorfismo gentico de la apolipoprotena E en una poblacin peruana. (589-94) GENOTIPO Circulacin de un linaje diferente del virus dengue 2 genotipo Amrica/Asia en la regin amaznica de Per, 2010. (72-7) GRUPOS PROFESIONALES Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51) GRUPOS VULNERABLES Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7)

708

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

GUA DE PRCTICA CLNICA Resultados de la aplicacin de tres guas nacionales para prevenir la transmisin vertical del VIH en el Instituto Nacional Materno Perinatal. Lima, Per. (492-6) GUAS DE PRCTICA MDICA Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per. (617-22) HELICOBACTER PYLORI Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) HEMATOCRITO Diferencias entre la hemoglobina observada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) HEMODILISIS Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) HEMOGLOBINAS Diferencias entre la hemoglobina observada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) HEPATITIS B Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) HEPATITIS C Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) HIPERCOLESTEROLEMIA Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia. (628-32) HIPERLIPOPROTEINEMIAS Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia. (628-32)

HIPERTENSIN Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) HIPERTIROIDISMO Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) HOSPITALES Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194-201) HOSPITALIZACIN Registro de pacientes con accidente cerebro vascular como causante de hospitalizacin en un hospital pblico del Per, 2000-2009. (623-7) HTLV-1 Transmisin vertical de HTLV-1 en el Per. (101-8) NDICE INTERNACIONAL DE FUNCIN ERCTIL Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) INFECCIONES POR CAMPYLOBACTER Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7) INFECCIONES POR COXSACKIEVIRUS Miocarditis fulminante y enfermedad diarreica aguda por Coxsackie virus B6. (145-8) INFECCIONES POR VIH Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7) INFECCIONES POR VIH Resultados de la aplicacin de tres guas nacionales para prevenir la transmisin vertical del VIH en el Instituto Nacional Materno Perinatal. Lima, Per. (492-6) INFORMES DE CASOS Cromomicosis: reporte de un caso incapacitante. (552-5) INMUNIZACIN Costo-utilidad de la vacuna contra el virus de papiloma humano en mujeres peruanas. (416-25)

INTERFERONES Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) INTERNET Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) INVESTIGACIN Estrategias para aumentar el impacto de la investigacin sobre recursos humanos para la salud en la elaboracin de polticas. (323-6) INVESTIGACIN TRASLACIONAL La investigacin traslacional y su aporte para la toma de decisiones en polticas de salud. (288-97) LACTANTE Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) LEGISLACIN COMO ASUNTO Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. (676-81) LEISHMANIASIS Identificacin de especies de Leishmania en pacientes y flebotominos en reas de transmisin en una regin del Per. (446-53) LEISHMANIASIS CUTNEA Identificacin de especies de Leishmania en pacientes y flebotominos en reas de transmisin en una regin del Per. (446-53) LEPTOSPIROSIS Seroprevalencia de leptospirosis en Puente Piedra, Lima en el ao 2006. (273-6) LESIONES DE LA MDULA ESPINAL Lesiones medulares no traumticas: etiologa, demografa y clnica. (633-8) MAL DE POTT Espondilitis tuberculosa en adultos: revisin de una serie de casos en un hospital de tercer nivel, Lima-Per. (282-7) MALARIA Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36)

709

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

MALOCLUSIN Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) MEDICINA Retos de la biotica en la medicina del siglo XXI. (657-63) MDICOS Oferta y demanda de mdicos especialistas en los establecimientos de salud del Ministerio de Salud: brechas a nivel nacional, por regiones y tipo de especialidad. (177-85) Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) Salud mental en mdicos que realizan el servicio rural, urbano-marginal en salud en el Per: Un estudio de lnea base. (277-81) MEJORAMIENTO DE LA CALIDAD tica y medicina: la experiencia del Colegio Mdico del Per. (670-5) MENINGITIS Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) METANLISIS COMO ASUNTO Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) METODOLOGA El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7) MICOSIS Cromomicosis: reporte de un caso incapacitante. (552-5) MIGRACIN INTERNA Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) MIGRACIN RURAL-URBANA Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) MIOCARDIOPATAS El aumento de la expresin del ARNm de la enzima convertidora de angiotensina

I homloga (ECA-2) inducido por atorvastatina se asocia a menor fibrosis e hipertrofia ventricular izquierda en un modelo de cardiomiopata diabtica. (264-72) MIOCARDITIS Miocarditis fulminante y enfermedad diarreica aguda por Coxsackie virus B6. (145-8) MOSQUITEROS TRATADOS CON INSECTICIDA Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36) MUESTREO Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) NANOMEDICINA Retos de la biotica en la medicina del siglo XXI. (657-63) NEOPLASIAS DEL CUELLO UTERINO Costo-utilidad de la vacuna contra el virus de papiloma humano en mujeres peruanas. (416-25) NEUMONA Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. (610-6) NEUROLGICO Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) NEUROPATAS DIABTICAS Asociacin de la neuropata autonmica cardiovascular y el intervalo QT prolongado con la morbimortalidad cardiovascular en pacientes con diabetes mellitus tipo 2. (83-6) NIO Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) Patrones de adherencia de cepas de Escherichia coli difusamente adherente (DAEC) provenientes de nios con y sin diarrea. (21-8) Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9)

Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. (610-6) Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. (639-42) Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) OBESIDAD Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo. (595-601) OBJETIVOS DE DESARROLLO DEL MILENIO Abordando la crisis de los Recursos Humanos para la Salud: hasta dnde hemos llegado? Qu podemos esperar lograr al 2015? (327-36) ORGANIZACIN MUNDIAL DE LA SALUD Abordando la crisis de los Recursos Humanos para la Salud: hasta dnde hemos llegado? Qu podemos esperar lograr al 2015? (327-36) PASES EN DESARROLLO Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) PARTICIPACIN CIUDADANA Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) PATOLOGA CLNICA Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) PERROS Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. (639-42) PERSONAL DE SALUD Alianza mundial en pro del personal sanitario: aumentando el impulso para

710

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

el desarrollo de personal de la salud. (298-307) Superando el obstculo de la implementacin: poniendo en accin las herramientas para la promocin de recursos humanos en salud. (316-22) PERSONAL MILITAR Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7) PER PER Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) Correlacin y concordancia entre el examen nacional de medicina y el promedio ponderado universitario: anlisis de la experiencia peruana en el periodo 2007 2009. (62-71) Circulacin de un linaje diferente del virus dengue 2 genotipo Amrica/Asia en la regin amaznica de Per, 2010. (72-7) Caractersticas clnicas de pacientes internados en el Hospital de Apoyo de Iquitos Csar Garayar Garca durante la epidemia de dengue, enero febrero de 2011. (78-82) Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) Transmisin vertical de HTLV-1 en el Per. (101-8) Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) Reporte histrico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de clera en el Per 1991. (136-9) Dengue neonatal en el Per: Reporte de un caso. (140-4) Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194-201) Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el

Per 2007-2010. (222-7) Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36) Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) Seroprevalencia de leptospirosis en Puente Piedra, Lima en el ao 2006. (273-6) Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51) Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) Plansalud: Plan sectorial concertado y descentralizado para el desarrollo de capacidades en salud, Per 2010 2014. (362-71) Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) Anlisis de costos de los mtodos rpidos para diagnstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiolgicos del Per. (426-31) Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) Identificacin de especies de Leishmania en pacientes y flebotominos en reas de transmisin en una regin del Per. (446-53) Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo. (595-601)

PLUKENETIA VOLBILIS L. Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia. (628-32) POBLACIN INDGENA Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) PODER JUDICIAL Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) POLISOMNOGRAFA Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo. (595-601) POLTICA DE SALUD Oferta y demanda de mdicos especialistas en los establecimientos de salud del Ministerio de Salud: brechas a nivel nacional, por regiones y tipo de especialidad. (177-85) Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194201) La investigacin traslacional y su aporte para la toma de decisiones en polticas de salud. (288-97) Alianza mundial en pro del personal sanitario: aumentando el impulso para el desarrollo de personal de la salud. (298-307) Superando el obstculo de la implementacin: poniendo en accin las herramientas para la promocin de recursos humanos en salud. (316-22) Plansalud: Plan sectorial concertado y descentralizado para el desarrollo de capacidades en salud, Per 2010 2014. (362-71) PORTALES DE ACCESO A REVISTAS CIENTFICAS Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) PRCTICA CLNICA BASADA EN LA EVIDENCIA Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) PREDICCIN Factores predictores de uso problemtico de alcohol en personas atendidas en una sala de emergencia. (54-61)

711

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

PREESCOLAR Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) PRESCRIPCIONES DE MEDICAMENTOS Diagnstico de problemas relacionados con medicamentos en adultos mayores al momento de ser hospitalizados. (256-63) Uso de medicamentos en adultos mayores no institucionalizados. (643-7) PREVALENCIA Lesiones medulares no traumticas: etiologa, demografa y clnica. (633-8) PREVENCIN DE ENFERMEDADES TRANSMISIBLES Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36) PRIMEROS AUXILIOS Nivel de conocimientos sobre emergencias mdicas en estudiantes de medicina de universidades peruanas. (202-9) PRIORIDADES EN SALUD Estrategias para aumentar el impacto de la investigacin sobre recursos humanos para la salud en la elaboracin de polticas. (323-6) PUBLICACIONES CIENTFICAS Y TCNICAS Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) REACCIN EN CADENA DE LA POLIMERASA DE TRANSCRIPTASA INVERSA El aumento de la expresin del ARNm de la enzima convertidora de angiotensina I homloga (ECA-2) inducido por atorvastatina se asocia a menor fibrosis e hipertrofia ventricular izquierda en un modelo de cardiomiopata diabtica. (264-72) REACCIN EN CADENA DE LA POLIMERASA Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per. (602-9) RECIN NACIDO Dengue neonatal en el Per: Reporte de un caso. (140-4)

RECURSOS HUMANOS Oferta y demanda de mdicos especialistas en los establecimientos de salud del Ministerio de Salud: brechas a nivel nacional, por regiones y tipo de especialidad. (177-85) Alianza mundial en pro del personal sanitario: aumentando el impulso para el desarrollo de personal de la salud. (298-307) Superando el obstculo de la implementacin: poniendo en accin las herramientas para la promocin de recursos humanos en salud. (316-22) Estrategias para aumentar el impacto de la investigacin sobre recursos humanos para la salud en la elaboracin de polticas. (323-6) Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51) Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) Plansalud: Plan sectorial concertado y descentralizado para el desarrollo de capacidades en salud, Per 2010 2014. (362-71) RECURSOS HUMANOS EN SALUD Abordando la crisis de los Recursos Humanos para la Salud: hasta dnde hemos llegado? Qu podemos esperar lograr al 2015? (327-36) Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) RESISTENCIA BACTERIANA A ANTIBITICOS Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea. (648-56) RESULTADO DEL EMBARAZO Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) REVISIONES Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) SALARIOS Y BENEFICIOS Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51)

SALUD BUCAL Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) SALUD MENTAL Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) SALUD PBLICA La investigacin traslacional y su aporte para la toma de decisiones en polticas de salud. (288-97) Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) Plansalud: Plan sectorial concertado y descentralizado para el desarrollo de capacidades en salud, Per 2010 2014. (362-71) SEDIMENTOS MARINOS Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) SEGURO SOCIAL Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per. (617-22) SENSIBILIDAD Y ESPECIFICIDAD Estandarizacin de la tcnica de Western blot para el diagnstico de la fasciolosis humana utilizando antigenos de excrecin-secrecin de Fasciola heptica. (454-61) SENSIBILIDAD Y ESPECIFICIDAD Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) SEROPREVALENCIA Seroprevalencia de leptospirosis en Puente Piedra, Lima en el ao 2006. (273-6) SERVICIOS RURALES DE SALUD Salud mental en mdicos que realizan el servicio rural, urbano-marginal en salud en el Per: Un estudio de lnea base. (277-81) SESGO DE PUBLICACIN Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. (676-81) SEXO INSEGURO Construccin preliminar de un cuestionario sobre conocimientos en VIH/

712

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

SIDA en excombatientes de Colombia. (503-7) SNDROME DE INMUNODEFICIENCIA ADQUIRIDA Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) SNDROME DE QT PROLONGADO Asociacin de la neuropata autonmica cardiovascular y el intervalo QT prolongado con la morbimortalidad cardiovascular en pacientes con diabetes mellitus tipo 2. (83-6) SISTEMA DE JUSTICIA Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) SISTEMA RENINA-ANGIOTENSINA El aumento de la expresin del ARNm de la enzima convertidora de angiotensina I homloga (ECA-2) inducido por atorvastatina se asocia a menor fibrosis e hipertrofia ventricular izquierda en un modelo de cardiomiopata diabtica. (264-72) SISTEMA NICO DE SALUD Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) SISTEMAS DE SALUD Alianza mundial en pro del personal sanitario: aumentando el impulso para el desarrollo de personal de la salud. (298-307) SOBREPESO Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) SPOROTHRIX SCHENCKII Esporotricosis en pacientes que acuden a un centro mdico de referencia en Abancay, Per. (508-12) STAPHYLOCOCCUS AUREUS Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) SUBTIPO H1N1 DEL VIRUS DE LA INFLUENZA A Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. (610-6)

TABAQUISMO Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) TCNICAS DE DIAGNSTICO Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) TCNICAS DE DIAGNSTICO DEL SISTEMA DIGESTIVO Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) TCNICAS DE ESTIMACIN Diferencias entre la hemoglobina observada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) TCNICOS MEDIOS EN SALUD Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) TEORA DE SISTEMAS Estrategias para aumentar el impacto de la investigacin sobre recursos humanos para la salud en la elaboracin de polticas. (323-6) TESTOSTERONA Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) TIROIDITIS Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) TOMA DE DECISIONES La investigacin traslacional y su aporte para la toma de decisiones en polticas de salud. (288-97) Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) TRANSFUSIN DE COMPONENTES SANGUNEOS Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per. (617-22)

TRANSMISIN VERTICAL Transmisin vertical de HTLV-1 en el Per. (101-8) TRANSMISIN VERTICAL DE ENFERMEDAD INFECCIOSA Dengue neonatal en el Per: Reporte de un caso. (140-4) Resultados de la aplicacin de tres guas nacionales para prevenir la transmisin vertical del VIH en el Instituto Nacional Materno Perinatal. Lima, Per. (492-6) TRANSTORNOS POR EXCESIVA SOMNOLENCIA Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo. (595-601) TRASPLANTE RENAL Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) TRASTORNO DEPRESIVO Salud mental en mdicos que realizan el servicio rural, urbano-marginal en salud en el Per: Un estudio de lnea base. (277-81) TUBERCULOSIS Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) TUBERCULOSIS ESPINAL Espondilitis tuberculosa en adultos: revisin de una serie de casos en un hospital de tercer nivel, Lima-Per. (282-7) TUBERCULOSIS FRMACO-RESISTENTE Anlisis de costos de los mtodos rpidos para diagnstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiolgicos del Per. (426-31) TUBERCULOSIS RESISTENTE A MLTIPLES MEDICAMENTOS Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) URGENCIAS MDICAS Nivel de conocimientos sobre emergencias mdicas en estudiantes de medicina de universidades peruanas. (202-9) UTILIZACIN DE MEDICAMENTOS Uso de medicamentos en adultos mayores no institucionalizados. (643-7)

713

Rev Peru Med Exp Salud Publica. 2011;28(4):705-14.

ndice de materias

VACUNAS ANTIRRBICAS Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. (639-42) VACUNAS CONTRA PAPILOMAVIRUS Costo-utilidad de la vacuna contra el virus de papiloma humano en mujeres peruanas. (416-25) VENEZUELA Diferencias entre la hemoglobina ob servada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) VIBRIO CHOLERAE 01 Reporte histrico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de clera en el Per 1991. (136-9) VIBRIO CHOLERAE Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15)

VIBRIO PARAHAEMOLYTICUS Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15) VIBRIOSIS Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15) VIGILANCIA EPIDEMIOLGICA Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) VIRULENCIA Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) VIRUS DE LA INFLUENZA Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. (610-6) VIRUS DEL DENGUE Caractersticas clnicas de pacientes internados en el Hospital de Apoyo de

Iquitos Csar Garayar Garca durante la epidemia de dengue, enero febrero de 2011. (78-82) VIRUS LINFOTRPICO T HUMANO TIPO 1 Transmisin vertical de HTLV-1 en el Per. (101-8) WESTERN BLOT Estandarizacin de la tcnica de Western blot para el diagnstico de la fasciolosis humana utilizando antigenos de excrecin-secrecin de Fasciola heptica. (454-61) ZIDOVUDINA Resultados de la aplicacin de tres guas nacionales para prevenir la transmisin vertical del VIH en el Instituto Nacional Materno Perinatal. Lima, Per. (492-6) ZONAS RURALES Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) ZOONOSIS Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7)

Visite los contenidos de la revista en:

www.ins.gob.pe/rpmesp

714

Rev Peru Med Exp Salud Publica. 2011;28(4):715-19.

ndices del volumen 28

NDICE DE AUTORES: VOLUMEN 28 (1, 2, 3 y 4) AO 2011 [AUTHOR INDEX: VOLUME 28 (1, 2, 3 and 4) 2011 YEAR]
A
Acosta O: ver Marca V Acua-Gonzlez Y: ver Rosas-Aguirre A Adam T: Estrategias para aumentar el impacto de la investigacin sobre recursos humanos para la salud en la elaboracin de polticas. (323-6) Afzal M: Alianza mundial en pro del personal sanitario: aumentando el impulso para el desarrollo de personal de la salud. (298-307) Aguilar C: El aumento de la expresin del ARNm de la enzima convertidora de angiotensina I homloga (ECA-2) inducido por atorvastatina se asocia a menor fibrosis e hipertrofia ventricular izquierda en un modelo de cardiomiopata diabtica. (264-72) Aguilar-Ancori E: ver Ramrez-Soto M Alarcn J: Transmisin vertical de HTLV-1 en el Per. (101-8) Alarcn J: ver Caballero P Albano-Ramos C: ver Flores-Torres J Alberto Perales: Estrs, ansiedad y depresin en magistrados de Lima, Per. (581-8) Alfaro-Mantilla J: ver Zavala S Aliaga-Del Castillo A: Maloclusiones en nios y adolescentes de caseros y comunidades nativas de la Amazona de Ucayali, Per. (87-91) Aliaga-Del Castillo R: ver Aliaga-Del Castillo A Alva J: Oferta y demanda de campos de prctica clnica para la formacin de pregrado de estudiantes de ciencias de la salud en el Per, 2005-2009. (194201) Alvarado-Vsquez E: ver Curioso WH lvarez C: ver Garca P lvarez C: ver Mamani E lvarez-Daz JA: Retos de la biotica en la medicina del siglo XXI. (657-63) Andia M: ver Pardo K Anicama R: ver Torres J Aponte J: ver Len J Arrasco J: ver Garca P Arria-Bohorquez M: ver Flores-Torres J Arroyo-Hernndez CH: ver Torres J Ascencios L: ver Solari L Ascencios-Oyarce C: ver Meja CR Augustovski F: ver Garay OU Ayala N: ver Len J

B
Bailn H: ver Zamudio M Barahona L: ver Perales A Barletta F: ver Espinoza IO Barletta F: ver Ochoa TJ Barletta F: ver Riveros M Barzola-Cordero V: Experiencia del Ministerio de Salud en la implementacin de las brigadas de mdicos especialistas en las zonas de Aseguramiento Universal en Per, 2009-2010. (352-61) Bauer JL: ver Mosquito S Bjar V: ver Zerpa R Beltrn-Ale G: ver Castaeda-Guarderas A Bendez L: ver Custodio N Berbes-Fernndez D: ver Segura-Cardona A Bernab-Ortiz A: ver Mrquez-Montero G Bernardini-Zambrini DA: Migracin de mdicos peruanos a Espaa, 20052009. (694-5) Bolaos-Daz R: Los estudios de sntesis como base para las evaluaciones econmicas en salud: necesidad de la valoracin de su calidad. (528-34) Bravo N: Oscar Grados Bazalar (1929 2008). (149-51) Bravo N: Reporte histrico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de clera en el Per 1991. (136-9) Brown A: Trabajadores de salud de nivel intermedio: un recurso prometedor. (308-15) Burstein Z: Germn Battistini Moore (1916-2010). (385-7) Burstein Z: Presentacin pblica de la versin actual y resea histrica de la Revista Peruana de Medicina Experimental y Salud Pblica. (9-12) Bustamante I: ver Fiestas F

C
Caballero P: Anlisis bibliomtrico de la produccin cientfica sobre VIH/SIDA en el Per 1985 2010. (470-6) Cabello M: ver Riveros M Cabezas C: ver Caballero P Cabezas C: ver Curisinche M

Cabezas C: ver Durand S Cabezas C: ver Garca P Cabezas C: ver Mamani E Cabieses B: La investigacin traslacional y su aporte para la toma de decisiones en polticas de salud. (288-97) Calampa C: ver Mamani E Caldern-Anyosa R: ver Curioso WH Campos J: ver Zamudio M Campos K: ver Platts-Mills JA Campos-Snchez M: Diseo del Monitoreo Nacional de Indicadores Nutricionales (MONIN), Per 2007-2010. (210-21) CamposSnchez M: ver Pajuelo-Ramrez J Candela-Herrera J: ver Miranda-Choque E Cas M: ver Regueiro M Caporale JE: ver Garay OU Cardona-Arango D: ver Segura-Cardona A Carrillo C: ver Gonzales GF Casas M: ver Curisinche M Casma-Bustamante R: ver CastaedaGuarderas A Castaeda-Guarderas A: Registro de pacientes con accidente cerebro vascular como causante de hospitalizacin en un hospital pblico del Per, 20002009. (623-7) Castilla T: ver Curisinche M Castillo E: ver Solari L Castillo M: Espondilitis tuberculosa en adultos: revisin de una serie de casos en un hospital de tercer nivel, LimaPer. (282-7) Castillo V: ver Ruiz N Castillo-Portilla M: ver Loza C Castillo-Riquelme M: ver Espinoza M Catacora M: ver Galn-Rodas E Chvez C: ver Durand S Chue H: ver Perales A Coaquira-Condori E: ver Lam-Figueroa N Colina F: ver Ruiz N Cometto G: ver Afzal M Cometto G: ver Brown A Contreras C: ver Ochoa TJ Contreras C: ver Riveros M Contreras-Pulache H: ver Lam-Figueroa N Crdova O: Identificacin de especies de Leishmania en pacientes y flebotominos en reas de transmisin en una regin del Per. (446-53) Cornejo-Olivas M: ver Marca V Cuadra D: ver Len J Cuervo LG: ver Reveiz L

715

Rev Peru Med Exp Salud Publica. 2011;28(4):715-19.

ndice de autores

Cumbi A: ver Brown A Curioso WH: Usando twitter para promover la educacin continua y la investigacin en salud en el Per. (163-4) Curisinche M: Proceso de construccin de la agenda nacional de investigacin sobre Recursos Humanos en Salud (RHUS) en el Per, 2011-2014. (372-81) Custodio N: Validacin de la prueba de dibujo del reloj versin de Manos como prueba de cribado para detectar demencia en una poblacin adulta mayor de Lima, Per. (29-34) Cuzco M: ver Barzola-Cordero V

atendidos en un hospital de Lima, Per. (602-9) Espinoza M: Evaluaciones econmicas de tecnologas sanitarias: una perspectiva global para su aplicacin en Amrica Latina. (535-9) Espinoza M: ver Caballero P Espinoza M: ver Ruiz N Espinoza MA: ver Cabieses B

F
Falcn N: ver Morales C Farfn-Ramos S: ver Miranda-Choque E Farina HO: ver Regueiro M Fernndez A: ver Miranda-Choque E Frnandez C: ver Morales C Fernndez H: Campylobacter y campylobacteriosis: una mirada desde Amrica del Sur. (121-7) Fiestas F: Factores predictores de uso problemtico de alcohol en personas atendidas en una sala de emergencia. (54-61) Fiestas F: ver Galn-Rodas E Fiestas F: ver Glvez-Buccollini JA Fiestas V: Caractersticas clnicas de pacientes internados en el Hospital de Apoyo de Iquitos Csar Garayar Garca durante la epidemia de dengue, enero febrero de 2011. (78-82) Fiestas V: ver Durand S Fiestas V: ver Sihuincha M Figueroa D: ver Mamani E Figueroa L: Existe un espacio para la investigacin durante el residentado mdico en Per? (692-3) Figueroa L: ver Vsquez H Flores-Paredes W: Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per. (617-22) Flores-Torres J: Diferencias entre la hemoglobina observada y estimada por hematocrito y su importancia en el diagnstico de anemia en poblacin costera venezolana: anlisis del segundo estudio nacional de crecimiento y desarrollo humano (SENACREDH). (47-53) Franco L: ver Mamani E

D
Davelois K: ver Escalante H Dayrit MM: Abordando la crisis de los Recursos Humanos para la Salud: hasta dnde hemos llegado? Qu podemos esperar lograr al 2015? (327-36) De la Cruz C: ver Castillo M De Pinho H: ver Brown A Del Castillo-Mendoza C: ver Aliaga-Del Castillo A Delgado O: ver Rodriguez-Morales AJ Daz E: ver Escalante H Daz J: ver Miranda-Choque E Daz-Vlez C: ver Galn-Rodas E Dolea C: ver Dayrit MM Donaires F: ver Fiestas V Donaires F: ver Garca P Dreesch N: ver Dayrit MM Durand D: ver Ochoa TJ Durand D: ver Riveros M Durand S: Impacto de la epidemia de dengue con un nuevo linaje del DENV2 Genotipo Americano-Asitico en la demanda de servicios del hospital de Apoyo de Iquitos Csar Garayar Garca. (157-9) Durand S: ver Fiestas V Durand S: ver Sihuincha M

E
Echegaray C: ver Barzola-Cordero V Echeverra-Ortega M: ver Flores-Torres J Echeverri-Catao L: ver Rodriguez-Morales AJ Elas-Barrera C: ver Pereyra-Elas R Equipo MONIN: ver Campos-Snchez M Equipo Tcnico de la DGGDRH: ver Huamn-Angulo L Escalante G: ver Curisinche M Escalante H: Estandarizacin de la tcnica de Western blot para el diagnstico de la fasciolosis humana utilizando antigenos de excrecin-secrecin de Fasciola heptica. (454-61) Espinoza IO: Infecciones del sistema nervioso central por enterovirus en nios

G
Galn-Rodas E: Intencin en la modalidad de titulacin de internos de medicina en el Per 2010. (390-91) Galn-Rodas E: Salud mental en mdicos que realizan el servicio rural, urbanomarginal en salud en el Per: Un estudio de lnea base. (277-81) Galn-Rodas E: ver Maguia C Gallo C: ver Fiestas F Glvez-Buccollini J: ver Galn-Rodas E

Glvez-Buccollini JA: Necesidad de evaluar las guas clnicas peruanas de tratamiento para trastornos mentales. (698-9) Garay A: ver Guerrero C Garay OU: El anlisis de impacto presupuestario en salud: puesta al da con un modelo de abordaje genrico (540-7) Garca A: ver Custodio N Garca Gutierrez JF: ver Bernardini-Zambrini DA Garca M: ver Fiestas V Garca M: ver Mamani E Garca M: ver Sihuincha M Garca M: ver Silva H Garca P: Confirmacin etiolgica de los dos primeros casos de hantavirosis humana en el Per. (566-7) Garca PJ: Profesionales de la salud para el nuevo siglo: transformando la educacin para fortalecer los sistemas de salud en un mundo interdependiente. (337-41) Garca PJ: Repensando la educacin de los profesionales de salud del siglo XXI: cambios y acciones en un mundo global. (398-9) Garca R: ver Solrzano S Garca S: ver Garay OU Garmendia F: Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia. (628-32) Gasco M: ver Gonzales GF Gatti M: ver Mamani E Gatti M: ver Sihuincha M Gaviln RG: Factores ambientales vinculados con la aparicin y dispersin de las epidemias de Vibrio en Amrica del Sur. (109-15) Gayoso O: ver Mlaga G Ghaffar A: ver Adam T Gilman RH: ver Mrquez-Montero G Gmez E: ver Crdova O Gmez J: ver Fiestas V Gonzales GF: Hemoglobina materna en el Per: diferencias regionales y su asociacin con resultados adversos perinatales. (484-91) Gonzales GF: Hemoglobina y testosterona: importancia en la aclimatacin y adaptacin a la altura. (92-100) Gonzales GF: Investigacin de excelencia en altura: a cincuenta aos de la fundacin del Instituto de Investigaciones de la Altura de la Universidad Peruana Cayetano Heredia. (689-90) Gonzalez J: ver Ruiz N Gotuzzo E: ver Platts-Mills JA Grupo de Estudio ACG Espaa: ver Sicras-Mainar A Guerra-Garca R: ver Gonzales GF Guerrero C: Larvas de Strongyloides spp. en lechugas obtenidas en mercados de Lima. (159-160)

716

Rev Peru Med Exp Salud Publica. 2011;28(4):715-19.

ndice de autores

Guerrero M: ver Len J Guerrero-Padilla D: ver Galn-Rodas E Guilln A: Enfermedad diarreica: un problema recurrente de salud pblica. (7-8) Guilln A: Retos y Problemas en el diagnstico microbiolgico en diarrea. (116-20) Guilln A: ver Bravo N Guilln A: ver Bravo N Guilln A: ver Guerrero C Guilln D: ver Espinoza IO Guo H: ver Mamani E Gutirrez C: ver Caballero P Gutirrez C: ver Huaman C Gutirrez C: ver Lam-Figueroa N Gutierrez S: ver Vsquez H Gutirrez W: La desnutricin en la niez en el Per: factores condicionantes y tendencia. (396-7) Gutirrez W: La vacuna contra el virus del papiloma humano: algunas precisiones. (688-9) Gutirrez W: Poliomielitis paraltica causada por la vacuna oral Sabin: tiempo de cambiar de vacuna? (695-7) Gutirrez-Aguado A: Costo-utilidad de la vacuna contra el virus de papiloma humano en mujeres peruanas. (416-25) Gutirrez-Aguado A: ver Bolaos-Daz R Gutirrez-Aguado A: ver Solari L Gutirrez-Brown R: ver Taype-Rondn A Guzmn-Guzmn M: ver Rosas-Aguirre A

J
Jara C: ver Escalante H Jave O: ver Solari L

K
Kamwendo F: ver Brown A Kato H: ver Crdova O Ke Y: ver Garca PJ Kelley P: ver Garca PJ Kistnasamy B: ver Garca PJ Kolevic L: ver Miranda-Choque E Kuroki-Garca C: ver Quintana-Gonzales A

L
Lajo-Aurazo Y: ver Taype-Rondn A Lam-Figueroa N: Adiccin a internet: desarrollo y validacin de un instrumento en escolares adolescentes de Lima, Per. (462-9) LaRochelle P: ver Platts-Mills JA Lazo MA: ver Mlaga G Leal U: ver Ruiz N Lehmann U: ver Brown A Len J: Estudio de actinomicetos marinos aislados de la costa central del Per y su actividad antibacteriana frente a Staphylococcus aureus meticilina resistentes y Enterococcus faecalis vancomicina resistentes. (237-46) Liendo-Lucano L: ver Huamn-Angulo L Lira D: ver Custodio N Llamosas E: ver Barzola-Cordero V Lluque A: ver Ochoa TJ Lluque A: ver Riveros M Loret de Mola C: ver Mrquez-Montero G Loza C: Principios bsicos y alcances metodolgicos de las evaluaciones econmicas en salud. (518-27) Loza C: ver Zegarra L Loza-Concha RE: Costo-utilidad del trasplante renal frente a la hemodilisis, en el tratamiento de la insuficiencia renal crnica terminal en un hospital peruano. (432-9) Lucero J: ver Curisinche M Lucho J: ver Guilln A

H
Hashiguchi Y: ver Crdova O Hernndez H: ver Morales C Hernndez R: ver Espinoza IO Hernndez-Crdova G: ver Solrzano S Hernndez-Gamas A: ver Quevedo-Tejero E Hernndez-Ortega H: ver Quevedo-Tejero E Herrera AL: ver Garca P Hidalgo G: ver Flores-Torres J Hinostroza-Camposano R: ver Lam-Figueroa N Hinostroza-Camposano W: ver Lam-Figueroa N Hinostroza-Camposano W: ver Lam-Figueroa N Hoppe W: ver Ruiz-Grosso P HRH Exchange of the Global Health Workforce Alliance: ver Brown A Huamn-Angulo L: Plansalud: Plan sectorial concertado y descentralizado para el desarrollo de capacidades en salud, Per 2010 2014. (362-71) Huaman C: Correlacin y concordancia entre el examen nacional de medicina y el promedio ponderado universitario: anlisis de la experiencia peruana en el periodo 2007 2009. (62-71) Huayanay L: ver Loza C Huerta D: ver Marca V Huichi-Atamari M: ver Ramrez-Soto M

M
Mac Mullen M: ver Garay OU Magan C: ver Caballero P Maguia C: Situacin de la salud en el Per: la agenda pendiente. (569-70) Mlaga G: Miocarditis fulminante y enfermedad diarreica aguda por Coxsackie virus B6. (145-8) Mlaga G: ver Bolaos-Daz R Mlaga G: ver Castaeda-Guarderas A

Mlaga G: ver Castillo M Mamani E: Circulacin de un linaje diferente del virus dengue 2 genotipo Amrica/Asia en la regin amaznica de Per, 2010. (72-7) Mamani E: ver Fiestas V Mamani E: ver Garca P Marca V: Polimorfismo gentico de la apolipoprotena E en una poblacin peruana. (589-94) Mrquez-Montero G: Calidad de vida vinculada a salud en poblacin migrante rural-urbana y poblacin urbana en Lima, Per. (35-41) Martnez-Romero M: ver Quintana-Gonzales A Martinez-Urtaza J: ver Gaviln RG Martnez-Urtaza J: ver Zamudio M Mattos-Vela M: ver Aliaga-Del Castillo A Mayta-Tristn P: Proyeccin de trabajo en el interior del pas y factores asociados en mdicos recin colegiados de Lima, Per 2010. (186-93) Mayta-Tristn P: ver Bernardini-Zambrini DA Mazzetti P: ver Marca V Mazzoti G: ver Fiestas F McCaffery JA: Superando el obstculo de la implementacin: poniendo en accin las herramientas para la promocin de recursos humanos en salud. (316-22) McCourt W: ver Brown A McPake B: ver Brown A Medina MP: ver Espinoza IO Meja CR: Nivel de conocimientos sobre emergencias mdicas en estudiantes de medicina de universidades peruanas. (202-9) Mejia CR: ver Galn-Rodas E Mejia CR: ver Mayta-Tristn P Meleis A: ver Garca PJ Mendoza A: tica y medicina: la experiencia del Colegio Mdico del Per. (670-5) Mendoza-Ticona A: ver Silva H Mendy N: ver Regueiro M Mercado EH: ver Ochoa TJ Mercado EH: ver Riveros M Merino S: ver Mamani E Meza A: ver Zamudio M Mezones-Holgun E: Las evaluaciones econmicas en salud: hacia un acercamiento entre la academia y la poltica. (410-3) Mezones-Holgun E: ver Bolaos-Daz R Mezones-Holgun E: ver Huaman C Mezones-Holgun E: ver Mayta-Tristn P Minaya: ver Sandoval A Miranda JJ: ver Mrquez-Montero G Miranda-Choque E: Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per. (610-6) Miranda-Cuadros M: ver Campos-Snchez M Miranda-Cuadros M: ver Pajuelo-Ramrez J Montano S: ver Alarcn J

717

Rev Peru Med Exp Salud Publica. 2011;28(4):715-19.

ndice de autores

Montesinos R: ver Custodio N Morales C: Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009. (639-42) Morales-Soto N: ver Pereyra-Elas R Moras-Ventocilla C: ver Meja CR Moreno-Gutierrez D: ver Rosas-Aguirre A Mori-Quispe E: ver Lam-Figueroa N Moscoso B: ver Alva J Moscoso B: ver Pardo K Moscoso B: ver Zevallos L Mosquito S: Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea. (648-56) Mosquito S: ver Espinoza IO Mosquito S: ver Ochoa TJ Mosquito S: ver Riveros M Munayco CV: ver Torres J Murasaki RT: ver Reveiz L

N
Nagel P: ver Regueiro M Navarro-Artieda R: ver Sicras-Mainar A Naylor D: ver Garca PJ Nizama-Valladolid M: ver Lam-Figueroa N Nuez-Vergara M: ver Huamn-Angulo L

O
Ochoa TJ: Frecuencia y patotipos de Escherichia coli diarrognica en nios peruanos con y sin diarrea. (13-20) Ochoa TJ: ver Espinoza IO Ochoa TJ: ver Mosquito S Ochoa TJ: ver Riveros M Ordez C: ver Fiestas F Ordez-Molina J: ver Segura-Cardona A Ortega O: ver Marca V Ortiz P: ver Escalante H Osada J: Investigacin: de pasatiempo a trabajo. (394) Osada J: ver Galn-Rodas E Osada J: ver Ruiz-Grosso P Oscanoa TJ: Diagnstico de problemas relacionados con medicamentos en adultos mayores al momento de ser hospitalizados. (256-63)

Pariyo G: ver Brown A Pastor R: ver Alva J Pastor R: ver Zevallos L Pedraz B: ver Ruiz-Grosso P Perales A: tica, biotica y medicina. (578-80) Peralta F: ver Barzola-Cordero V Percy S: ver Garca P Pereyra-Elas R: Vulnerabilidad ssmica hospitalaria: experiencias del Hospital Regional de Ica a cuatro aos del desastre. (395-6) Prez V: ver Zegarra L Prez W: ver Pardo K Pezo-Ochoa J: Esporotricosis en pacientes que acuden a un centro mdico de referencia en Abancay, Per. (508-12) Pezo-Ochoa J: ver Ramrez-Soto M Pichn-Riviere A: ver Garay OU Pinto JL: Tiroiditis autoinmune inducida por interfern en pacientes con infeccin por virus de la hepatitis C. Reporte de caso. (382-4) Pinto ME: ver Pinto JL Platts-Mills JA: Seroprevalencia de leptospirosis en Puente Piedra, Lima en el ao 2006. (273-6) Ponce J: ver Fiestas F Ponce M: ver Osada J Posso M: ver Mayta-Tristn P Prada A: ver Ochoa TJ Prados-Torres A: ver Sicras-Mainar A

Q
Quevedo-Tejero E: Fractura de cadera en adultos mayores: prevalencia y costos en dos hospitales. Tabasco, Mxico, 2009. (440-5) Quezada-Osoria C: ver Meja CR Quintana-Gonzales A: Lesiones medulares no traumticas: etiologa, demografa y clnica. (633-8) Quinto-Porras K: ver Meja CR Quispe AM: ver Loza-Concha RE Quispe N: ver Solari L

R
Ramalho L: ver Reveiz L Ramrez C: ver Miranda-Choque E Ramrez-Soto M: Seroprevalencia de hepatitis viral B en estudiantes universitarios en Abancay, Per. (513-7) Reddy S: ver Garca PJ Regueiro M: Uso de medicamentos en adultos mayores no institucionalizados. (643-7) Rengifo D: ver Silva H Reveiz L: Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe. (676-81) Rey de Castro J: Diferencias clnicas y polisomnogrficas entre obesos y no

P
Pablos-Mendez A: ver Garca PJ Padilla A: ver Perales A Pajuelo-Ramrez J: Prevalencia de sobrepeso y obesidad en nios menores de cinco aos en el Per 2007-2010. (222-7) Pando R: ver Garmendia F Pardo K: Remuneraciones, beneficios e incentivos laborales percibidos por trabajadores del sector salud en el Per: anlisis comparativo entre el Ministerio de Salud y la Seguridad Social. (342-51)

obesos con sndrome de apneas-hipopneas del sueo. (595-601) Ricaldi JN: ver Platts-Mills JA Ricaldi-Sueldo R: ver Campos-Snchez M Riega-Lopez P: ver Mayta-Tristn P Rivera FP: ver Ochoa TJ Rivera FP: ver Riveros M Riveros M: Patrones de adherencia de cepas de Escherichia coli difusamente adherente (DAEC) provenientes de nios con y sin diarrea. (21-8) Riveros M: ver Ochoa TJ Rodriguez A: ver Pardo K Rodrguez H: ver Durand S Rodrguez H: ver Escalante H Rodrguez H: ver Garca P Rodrguez L: ver Silva H Rodrguez- Morales AJ: Cambio climtico, precipitaciones, sociedad y desastres en Amrica Latina: relaciones y necesidades. (165-6) Rodrguez-Delfn L: ver Aguilar C Rodriguez-Ferrucci H: ver Rosas-Aguirre A Rodriguez-Morales AJ: Necesidad de consenso en el diagnstico de la toxocariasis humana: implicancias en la salud pblica latinoamericana. (161-2) Rodrguez-Morales AJ: ver Flores-Torres J Rojas JL: ver Loza C Rojas R: ver Len J Rojas R: ver Zerpa R Rojas-Mezarina L: ver Mayta-Tristn P Roman F: ver Alarcn J Roman F: ver Caballero P Ronceros G: ver Garmendia F Rosales-Mayor E: ver Rey de Castro J Rosas-Aguirre A: Posesin, retencin y uso de mosquiteros tratados con insecticidas de larga duracin luego de un ao de su distribucin en Loreto, Per. (228-36) Rosell G: ver Caballero P Rosskam E: ver Afzal M Ruiz J: ver Mosquito S Ruiz J: ver Ochoa TJ Ruiz JC: ver Silva H Ruiz N: Factores de riesgo cardiovascular y perfil apolipoprotico en un grupo de adultos atendidos en un centro pblico de salud del estado Carabobo, Venezuela. (247-55) Ruiz-Grosso P: Subregistro de trastornos depresivos. (697) Ruiz-Grosso P: ver Castaeda-Guarderas A Ruz-Torrejn A: ver Sicras-Mainar A

S
Saenz C: ver Reveiz L Salas S: ver Vsquez H Salaverry O: Cayetano Heredia (17971861). (556-9) Salaverry O: Recursos humanos en salud: una mirada al interior del Per. (388-9)

718

Rev Peru Med Exp Salud Publica. 2011;28(4):715-19.

ndice de autores

Saldaa-Gonzales M: ver Taype-Rondn A Samalvides F: ver Castillo M Snchez-Abanto J: ver Pajuelo-Ramrez J Sanders D: ver Brown A Sandoval A: Leishmaniosis tegumentaria, una mirada a una enfermedad tropical desatendida. (560-3) Sandoval J: Transmisin Vertical o Circunstancial? (162) Sanz R: ver Flores-Torres J Sardn V: ver Torres J Scrimshaw S: ver Garca PJ Sebastin JL: ver Caballero P Segura ER: ver Miranda-Choque E Segura-Cardona A: Construccin preliminar de un cuestionario sobre conocimientos en VIH/SIDA en excombatientes de Colombia. (503-7) Sepulveda J: ver Garca PJ Serwadda : ver Garca PJ Sheikh M: ver Afzal M Sicras-Mainar A: Estimacin de la comorbilidad crnica sobre el costo sanitario en pacientes ancianos con trastornos neurolgicos. (564-5) Sihuincha M: Niveles de clulas CD4 en pacientes hospitalizados con diagnstico de dengue en el Hospital de Apoyo de Iquitos Csar Garayar Garca. (156-7) Sihuincha M: ver Durand S Sihuincha M: ver Fiestas V Silva H: Dengue neonatal en el Per: Reporte de un caso. (140-4) Smeeth L: ver Mrquez-Montero G Solari L: Anlisis de costos de los mtodos rpidos para diagnstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiolgicos del Per. (426-31) Solrzano S: Cromomicosis: reporte de un caso incapacitante. (552-5) Soto A: Evaluacin de intervenciones sanitarias y sociales: midiendo los resultados para orientar la toma de decisiones. (414-5) Soto A: Recursos Humanos en Salud. (173-4) Soto MG: ver Torres J Sotomayor-Espichan R: ver QuintanaGonzales A Stiglich ML: ver Espinoza IO Surez C: ver Solari L Surez V: ver Solari L

T
Talledo L: ver Galn-Rodas E Tapia V: ver Gonzales GF Taype-Rondn A: Aporte de las sociedades estudiantiles en la publicacin cientfica en Scielo-Per, 2009 2010. (691-2) Ticse R: Asociacin de la neuropata autonmica cardiovascular y el intervalo QT prolongado con la morbimortalidad cardiovascular en pacientes con diabetes mellitus tipo 2. (83-6) Tolentino M: Evaluacin de tecnologas sanitarias: la experiencia en el Ministerio de Salud de Brasil. (548-51) Toms G: ver Len J Torrejn : ver Lam-Figueroa N Torrejn C: ver Durand S Torres J: Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Per (497-502) Torres N: ver Mlaga G

Vela-Velsquez C: Comparacin entre las biopsias gstricas sin fijar 24 horas frente a la biopsia convencional para el diagnstico de Helicobacter pylori en un hospital de referencia de Per. (42-6) Ventura F: ver Aguilar C Verastegui G: ver Alva J Vilela-Sangay A: ver Castillo M Villena JE: ver Ticse R Vinetz JM: ver Platts-Mills JA

Y
Yagui M: La agenda nacional de investigacin en recursos humanos en salud: generando evidencias para mejorar las competencias en el sector salud. (175-6) Yagui M: ver Caballero P Yagui M: ver Curisinche M Yale G: ver Solari L

Z U
Ugarte C: ver Espinoza IO Zamalloa-Masas N: ver Taype-Rondn A Zamudio M: Experiencias en la vigilancia epidemiolgica de agentes patgenos transmitidos por alimentos a travs de electroforesis en campo pulsado (PFGE) en el Per. (128-35) Zarate V: ver Espinoza M Zavala S: tica e investigacin. (664-9) Zavala-Gonzlez M: ver Quevedo-Tejero E Zegarra L: Validacin psicomtrica del instrumento ndice internacional de funcin erctil en pacientes con disfuncin erctil en Per. (477-83) Zelada H: ver Castillo M Zerpa R: Agentes de infecciones por hongos dimrficos y Cryptococcus neoformans. (685-7) Zerpa R: Agentes etiolgicos de diarrea: bacterias y parsitos importantes en nios y adultos. (152-5) Zevallos L: Oferta y demanda de mdicos especialistas en los establecimientos de salud del Ministerio de Salud: brechas a nivel nacional, por regiones y tipo de especialidad. (177-85) Zumaeta P: El amauta PEDRO ORTIZ CABANILLAS (1933-2011). (682-4) Zunt JR: ver Alarcn J Zurayk H: ver Garca PJ

V
Valencia E: ver Solari L Valencia P: ver Mamani E Vargas F: ver Crdova O Vargas J: ver Yagui M Vargas-Pacherrez D: ver Rosas-Aguirre A Vsquez H: Retos para las nuevas regulaciones de productos farmacuticos en el Per. (567-9) Vsquez V: ver Durand S Vega-Dienstmaier J: ver Galn-Rodas E Vega-Dienstmaier J: ver Ruiz-Grosso P Vega-Galds F: ver Galn-Rodas E Vela E: ver Silva H Velsquez A: Por qu las intervenciones efectivas de supervivencia infantil no llegan a los que ms necesitan? (392-3) Velsquez C: Resultados de la aplicacin de tres guas nacionales para prevenir la transmisin vertical del VIH en el Instituto Nacional Materno Perinatal. Lima, Per. (492-6) Velasquez E: ver Alva J

719

Rev Peru Med Exp Salud Publica. 2011; 28(2): 720-23.

normas para los autores

INSTRUCCIONES PARA LA PRESENTACIN DE ARTCULOS A LA REVISTA PERUANA DE MEDICINA EXPERIMENTAL Y SALUD PBLICA
La Revista Peruana de Medicina Experimental y Salud Pblica (RPMESP) rgano oficial de difusin cientfica del Instituto Nacional de Salud (INS), Lima, Per; es una publicacin de periodicidad trimestral y sus artculos son arbitrados, tiene como objetivo la publicacin de la produccin cientfica en el contexto biomdico-social, especialmente los aportes prcticos, con el fin de contribuir a mejorar la situacin de salud del pas y de la regin, adems, propicia el intercambio con entidades similares en el pas y en el extranjero, a fin de promover el avance y la aplicacin de la investigacin y la experiencia cientfica en salud. Primera pgina. Debe incluir el ttulo en espaol e ingls, un ttulo corto de hasta 60 caracteres, los nombres de los autores como desean que aparezcan en el artculo, la filiacin institucional, ciudad y pas, profesin y grado acadmico, as como el correo electrnico de todos los autores. La fuente de financiamiento y declaracin de conflictos de inters. As mismo, se debe indicar quien es el autor corresponsal, indicando su direccin, telfono y correo electrnico. En caso el estudio haya sido presentado como resumen a un congreso o es parte de una tesis debe precisarlo con la cita correspondiente. Textos interiores. Deben de atenderse los siguientes aspectos: Escritos a doble espacio en letra arial 12, en formato A4 con mrgenes de 3 cm.; Debe incluir el ttulo del artculo pero no debe contener datos de los autores; Cada seccin empieza en una nueva pgina, enumerndose de modo consecutiva; Los textos debern ser redactados en el programa Word para Windows XP o Vista, las figuras y tablas pueden ir insertadas al final del texto con sus respectivas leyendas; Las tablas deben tener slo lneas horizontales para separar el encabezado del cuerpo de la tabla, en ningn caso deben incluirse lneas verticales; Las figuras (grficos estadsticos) deben ser remitidos en MS-Excel o formato tif o jpg, las imgenes y mapas deben ser grabados en formato TIFF o JPG a una resolucin mayor de 600 dpi o 300 pixeles, si bien pueden ser incluidos en las ltimas pginas del texto del artculo, deben ser adicionalmente enviadas en el programa original; Se consideran figuras a los dibujos, mapas, fotografas o grficos ordenados con nmeros arbigos; las leyendas de microfotografas debern indicar tambin el aumento y el mtodo de coloracin. Los mapas tambin deben tener una escala. El nmero de tablas y figuras depende del tipo de artculo enviado. El Comit Editor de la revista se reserva el derecho de limitar el nmero de stas. Las referencias bibliogrficas sern nicamente las que han sido citadas en el texto, se ordenarn correlativamente segn su aparicin y se redactar siguiendo las normas del Uniform Requirements for

NORMAS GENERALES
Todo artculo presentado a la RPMESP debe ser escrito en espaol, tratar de temas de inters en salud pblica y no haber sido publicados previamente, ni enviados simultneamente a otras revistas cientficas, los cuales pueden pertenecer a una de las siguientes categoras: Editorial; Artculos Originales; Originales Breves; Artculos de Revisin; Seccin Especial; Simposio; Personalidades Destacadas de la Salud Pblica en el Per; Reporte de Casos; Galera Fotogrfica; Cartas al Editor. DOCUMENTACIN OBLIGATORIA. Esta informacin es de cumplimiento obligatorio para cualquier artculo presentado a la RPMESP, la omisin de los mismos se traducir en un rechazado automtico. Carta de Presentacin. Debe ser firmada por el autor corresponsal, precisando el tipo de artculo remitido. Autorizacin de publicacin. Debe ser firmada por todos los autores, consignando cual fue su contribucin en la elaboracin del artculo segn la codificacin propia de la RPMESP.

720

Rev Peru Med Exp Salud Publica. 2011; 28(2): 720-23.

Normas para los autores

Manuscripts Submitted to Biomedical Journals del Comit Internacional de Editores de Revistas Mdicas, en su versin actualizada de octubre de 2008. Los autores debern ser resaltados en negrita; en el caso de existir ms de seis autores, deber agregarse et. al. separado por una coma. Asimismo, el ttulo de la referencia deber de consignar un hipervnculo direccionado al sitio web donde se pueda tener acceso a la referencia, siempre que exista la versin electrnica correspondiente. Algunos ejemplos a tener en cuenta en la redaccin de esta seccin, puede encontrarse en www.ins.gob.pe/rpmesp: Artculos de revistas: Palomino M, Villaseca P, Crdenas F, Ancca J, Pinto M. Eficacia y residualidad de dos insecticidas piretroides contra Triatoma infestans en tres tipos de vivienda. Evaluacin de campo en Arequipa, Per. Rev Peru Med Exp Salud Publica. 2008; 25(1): 9-16. Troyes L, Fuentes L, Troyes M, Canelo L, Garca M, Anaya E, et al. Etiologa del sndrome febril agudo en la provincia de Jan, Per 2004-2005. Rev Peru Med Exp Salud Publica. 2006; 23(1): 5-11. Libro: Acha P, Szyfres B. Zoonosis y enfermedades transmisibles comunes al hombre y los animales. 3a ed. Washington DC: Organizacin Panamericana de la Salud; 2003. Captulo de libro: Farmer J. Enterobacteriaceae: introduction and identification. En: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. 7th ed. Washington DC: American Society for Microbiology; 1999. p. 442 -58. Tesis: Pesce H. La epidemiologa de la lepra en el Per. [Tesis Doctoral]. Lima: Facultad de Medicina, Universidad Nacional Mayor de San Marcos; 1961. Pgina web: Brasil, Ministrio da Sade. Sistema de Informaes sobre Oramentos Pblicos em Sade [pgina de Internet]. Braslia: Ministrio da Sade; 2009. [Citado: Mayo 2009] Disponible en: http://portal.saude.gov.br/portal/se/area.cfm?id_ area=572

NORMAS ESPECFICAS POR TIPO DE ARTCULO


EDITORIALES. Son a solicitud del Comit Editor de la RPMESP. ARTCULOS ORIGINALES. Slo son productos de investigacin, los cuales debern estar redactados hasta en 3500 palabras (sin contar resumen, referencias, tablas y figuras), segn el siguiente esquema: Resumen: En espaol e ingls. No debe contener ms de 250 palabras. Este resumen es estructurado, debiendo incluir de manera concisa: Objetivos, Materiales y mtodos, Resultados y Conclusiones.

Palabras clave (key words): De tres hasta siete, las cuales deben basarse en descriptores en ciencias de la salud (DeCS) de BIREME y los Medical Subject Headings(MesH) de la National Library of Medicine en ingls. Introduccin: Exposicin breve (menor al 25% de la extensin del artculo) de la situacin actual del problema, antecedentes, justificacin y objetivo del estudio. Materiales y mtodos: Se describe la metodologa usada de tal forma que permita la reproduccin del estudio y la evaluacin de la calidad de la informacin por los lectores y revisores. Se debe describir el tipo y diseo de la investigacin, las caractersticas de la poblacin y forma de seleccin de la muestra cuando sea necesario. En algunos casos, es conveniente describir el rea de estudio. Cuando se usen plantas medicinales, describir los procedimientos de recoleccin e identificacin. Precisar la forma cmo se midieron o definieron las variables de inters. Detallar los procedimientos realizados, si han sido previamente descritos, hacer la cita correspondiente. Mencionar los procedimientos estadsticos empleados. Detallar los aspectos ticos involucrados en su realizacin, como la aprobacin por un Comit de tica Institucional, el uso de consentimiento informado, entre otras. Resultados: La presentacin de los hallazgos, debe ser en forma clara, sin opiniones ni interpretaciones, salvo, en las de alcance estadstico. Se pueden complementar hasta con ocho tablas o figuras, las cuales no deben repetir la informacin presentada en el texto. Discusin: Se interpretan los resultados, comparndolos con los hallazgos de otros autores, exponiendo las sugerencias, postulados o conclusiones a las que

721

Rev Peru Med Exp Salud Publica. 2011; 28(2): 720-23.

Normas para los autores

llegue el autor. Debe incluirse las limitaciones y sesgos del estudio. Agradecimientos: Cuando corresponda, debe mencionarse en forma especfica a quin y por qu tipo de apoyo en la investigacin se realiza el agradecimiento. Conflictos de inters: Debe mencionarse si existe algn conflicto de inters. Referencias bibliogrficas: En nmero no mayor de 30 referencias. ORIGINALES BREVES Estos artculos son resultados de investigacin, pueden incluirse tambin reporte de brotes o avances preliminares de investigaciones que por su importancia requieren una rpida publicacin, estos debern estar redactados hasta en 2000 palabras (sin contar resumen, referencias, tablas y figuras). El resumen en espaol e ingls es no estructurado y tiene un lmite de 150 palabras con tres a cinco palabras clave. Contiene una introduccin, posteriormente la seccin denominada El Estudio- referido a materiales y mtodos -, luego hallazgos centrado en los resultados pudindose incluir hasta cuatro tablas o figuras, discusin y no ms de 15 referencias bibliogrficas. ARTCULOS DE REVISIN Puede ser a solicitud del Comit Editor o por iniciativa de los autores, quienes deben ser expertos en su rea, deben incluir una exploracin exhaustiva, objetiva y sistematizada de la informacin actual sobre un determinado tema de inters en salud pblica. La estructura del artculo queda a criterio del autor, deber estar redactados hasta en 5000 palabras (sin contar resumen, referencias, tablas y figuras), sin contar las tablas o figuras que no sern ms de diez. Debe incluir un resumen en espaol e ingls, no estructurado, con un lmite de 150 palabras, con tres a cinco palabras clave. Podrn utilizar hasta 150 referencias bibliogrficas. SIMPOSIO Son escritos a solicitud del Comit Editor para un tpico en particular que ser desarrollado en un nmero especfico de la revista, pueden incluir opiniones u ensayos sobre el tema elegido. La estructura del artculo queda a criterio del autor, deber estar redactados hasta en 4000 palabras (sin contar resumen, referencias, tablas y figuras). Debe contener un resumen en espaol e ingls, no estructurado, con un lmite de 150 palabras, con tres a cinco palabras clave. Podrn utilizar hasta 100 referencias bibliogrficas.

PERSONALIDADES DESTACADAS DE LA SALUD PBLICA EN EL PER En esta seccin se publican los homenajes a las personas que han contribuido con la salud pblica en el Per, abarcan una nota biogrfica destacando las principales acciones en la vida acadmica, profesional y cientfica del personaje, resaltando su contribucin en el rea, as como una fotografa. No requiere resumen y puede tener o no referencias bibliogrficas, su extensin es de hasta 1800 palabras. SECCIN ESPECIAL Se incluirn los artculos que no se ajusten a otras secciones de la revista, los cuales incluyen ensayos, opiniones, sistematizaciones y experiencias que sean de inters para la salud pblica. La estructura del artculo queda a criterio del autor, los cuales debern estar redactados hasta en 3000 palabras, sin contar resumen, referencias, tablas y figuras), las tablas o figuras no sern ms de ocho. Debe incluir un resumen en espaol e ingls, no estructurado, con un lmite de 150 palabras, con tres a cinco palabras clave. Podrn utilizar hasta 50 referencias bibliogrficas. REPORTE DE CASOS Los casos presentados deben ser de enfermedades o situaciones de inters en salud pblica, estos debern estar redactados hasta en 2000 palabras (sin contar resumen, referencias, tablas y figuras). El resumen en espaol e ingls es no estructurado y tiene un lmite de 150 palabras con tres a cinco palabras clave. Contiene una introduccin, una seccin denominada reporte de caso y una discusin en la que se resalta el aporte o enseanza del artculo. Puede incluirse hasta cuatro tablas o figuras y no ms de 15 referencias bibliogrficas. GALERA FOTOGRFICA Se puede enviar fotos de inters sobre un tema de salud en particular, acompaado de un breve comentario del tema y una explicacin del origen de las ilustraciones presentadas (hasta 800 palabras). Adems, las fotos debern acompaarse de una leyenda explicativa. El Comit Editor se reserva el derecho de limitar el nmero de ilustraciones. CARTAS AL EDITOR Esta seccin est abierta para todos los lectores de la RPMESP, a la que pueden enviar sus preguntas, comentarios o crticas a los artculos que hayan sido publicados en los ltimos nmeros, teniendo

722

Rev Peru Med Exp Salud Publica. 2011; 28(2): 720-23.

Normas para los autores

en cuenta la posibilidad de que los autores aludidos puedan responder. Podr aceptarse la comunicacin de investigaciones preliminares o de intervenciones en brotes que no hayan sido publicados ni sometidos a publicacin en otra revista; as como, algunos comentarios sobre problemas de salud pblica, tica y educacin mdica. La extensin mxima aceptable es de 1000 palabras (sin contar referencias, tablas o figuras), con un mximo de seis referencias bibliogrficas (incluyendo la referencia del artculo que la motiv, (cuando sea el caso) y una tabla o figura.

en la mayora de los casos, se cuenta con el apoyo de pares expertos en bioestadstica y epidemiologa que se centrarn en los aspectos metodolgicos de los estudios. (Ficha de evaluacin para artculos originales) El tiempo promedio de respuesta entre la recepcin del artculo y la decisin del comit editor vara entre dos a seis meses, dependiendo de la celeridad de nuestros revisores y la respuesta de los autores. Nuestra tasa de rechazo anual es del 30%. Los artculos de revisin, artculos de simposio, artculos de seccin especial y reportes de casos son evaluados por uno o ms revisores. Las editoriales, cartas al editor, personalidades destacadas de la salud pblica y artculos solicitados por la Revista (no incluyen los mencionados en los tems previos), son evaluados slo por el Comit Editor, salvo casos en que por acuerdo se requiera la participacin de un par externo. Para conocer a los revisores de la RPMESP, puede consultarse el ltimo nmero de cada volumen, donde se publica la relacin de las personas que contribuyeron con nosotros en ese ao. En los siguientes enlaces, tiene acceso a los revisores de los aos2008,2007,2006y2005. Se recomienda a los autores tener en cuenta los siguientes aspectos para el seguimiento de sus artculos enviados a la RPMESP: Realizar un acuse de recibo ante cada comunicacin. El autor/a principal del artculo tiene el derecho de consultarnos en cualquier momento sobre los avances de la revisin de su artculo, para ello debe considerar los tiempos de revisin que le sern comunicados al recibir su artculo; La respuesta de las observaciones deben darse dentro de las tres semanas del envo del archivo, en caso de requerir mayor tiempo debe comunicarlo previamente; En caso de que no se tenga una respuesta en las ocho semanas de enviada la comunicacin con las observaciones, el artculo ser rechazado; Ante cualquier duda, puede consultar con nosotros al correo electrnico revmedex@ins.gob.pe o llamando al +51 +1 617-6200 anexo 2122.

ENVO DE ARTCULOS
La presentacin de artculos puede realizarse en forma impresa remitindose un original y una copia de toda la documentacin as como los archivos electrnicos en un CD, al Instituto Nacional de Salud sito en Cpac Yupanqui 1400, Lima 11, Per, dirigidas al Director de la Revista Peruana de Medicina Experimental y Salud Pblica o por correo electrnico a revmedex@ins.gob. pe, los formatos electrnicos se encuentran disponibles en http://www.ins.gob.pe/rpmesp/documentos.asp.

TICA EN PUBLICACIN
En caso sea detectada alguna falta contra la tica en publicacin durante el proceso de revisin o despus de su publicacin (si es que fuera el caso); la Revista tomar las medidas que establece el Committe on Publication Ethics (www.publicationethics.org.uk), que puede incluir el rechazo o retractacin del artculo, la prohibicin de publicacin de prximos artculos de todos los autores en la RPMESP, la notificacin a otras revistas de SciELO Per, as como, la comunicacin a las autoridades respectivas (institucin de origen, institucin que financi el estudio, colegios profesionales, comits de tica).

PROCESO DE REVISIN
La RPMESP usa el sistema de revisin por pares para garantizar la calidad de los artculos que publica. Los artculos originales y originales breves, son evaluados por dos o ms revisores, quienes son seleccionados de acuerdo a su experiencia en la temtica respectiva, basados fundamentalmente en indicadores de publicacin. Asimismo,

723

Contenido
tica y medicina 578, 657, 664, 670 Apolipoprotena E 589 Sindrome apnea-hipopnea 595 Enterovirus 602 Adultos mayores 643 Estrs, ansiedad y depresin 581 Influenza AH1N1 610 Prescripcin inadecuada 617 Accidente cerebro vascular 623 Sacha inchi 628 Mordedura canina 639 Resistencia antibitica 648 Ensayos clnicos 676 Lesiones medulares 633

revista peruana de medicina experimental y salud pblica volumen 28 nmero 4 octubre - diciembre 2011
Editorial tica, biotica y medicina............................................................................................................................................................................................. 578 Artculos de Investigacin Estrs, ansiedad y depresin en magistrados de Lima, Per...................................................................................................................................... 581 Polimorfismo gentico de la apolipoprotena E en una poblacin peruana.................................................................................................................. 589 Diferencias clnicas y polisomnogrficas entre obesos y no obesos con sndrome de apneas-hipopneas del sueo................................................. 595 Infecciones del sistema nervioso central por enterovirus en nios atendidos en un hospital de Lima, Per............................................................... 602 Nios hospitalizados con neumona por Influenza AH1N1/2009 pandmico en un hospital de referencia de Per.................................................... 610 Prescripcin inadecuada de transfusin sangunea en un hospital de referencia de Lima, Per................................................................................ 617 Registro de pacientes con accidente cerebro vascular en un hospital pblico del Per, 2000-2009........................................................................... 623 Efecto del aceite de sacha inchi (Plukenetia volbilis L) sobre el perfil lipdico en pacientes con hiperlipoproteinemia.............................................. 628 Lesiones medulares no traumticas: etiologa, demografa y clnica........................................................................................................................... 633 Accidentes por mordedura canina, casos registrados en un hospital de nios de Lima, Per 1995 2009............................................................... 639 Uso de medicamentos en adultos mayores no institucionalizados.............................................................................................................................. 643 Revisin Mecanismos moleculares de resistencia antibitica en Escherichia coli asociada a diarrea....................................................................................... 648

Simposio: tica, biotica y medicina Retos de la biotica en la medicina del siglo XXI......................................................................................................................................................... 657 tica e investigacin..................................................................................................................................................................................................... 664 tica y medicina: la experiencia del Colegio Mdico del Per..................................................................................................................................... 670

Seccin Especial Avances y retos en el registro de ensayos clnicos en Amrica Latina y el Caribe...................................................................................................... 676

Personalidades Destacadas de la Salud Pblica en el Per El amauta Pedro Ortiz Cabanillas (1933-2011)............................................................................................................................................................ 682

Galera Fotogrfica Agentes de infecciones por hongos dimrficos y Cryptococcus neoformans............................................................................................................... 685

Cartas al editor La vacuna contra el virus del papiloma humano: algunas precisiones......................................................................................................................... 688 Investigacin de excelencia en altura: a cincuenta aos de la fundacin del Instituto de Investigaciones de la Altura de la Universidad Peruana Cayetano Heredia.......................................................................................................................................................................................... 689 Aporte de las sociedades estudiantiles en la publicacin cientfica en Scielo-Per, 2009 2010............................................................................... 691 Existe un espacio para la investigacin durante el residentado mdico en Per?..................................................................................................... 692 Migracin de mdicos peruanos a Espaa, 2005-2009............................................................................................................................................... 694 Poliomielitis paraltica causada por la vacuna oral Sabin: tiempo de cambiar de vacuna?....................................................................................... 695 Subregistro de trastornos depresivos........................................................................................................................................................................... 697 Necesidad de evaluar las guas clnicas peruanas de tratamiento para trastornos mentales...................................................................................... 698

Revisin por Pares Relacin de revisores del ao 2011.............................................................................................................................................................................. 700 ndice de materias........................................................................................................................................................................................................ 705 ndice de autores.......................................................................................................................................................................................................... 715 Instrucciones para los autores...................................................................................................................................................................................... 720

Revista indizada en: Instituto Nacional de Salud Calle Cpac Yupanqui 1400, Lima 11, Per Telf.: (511) 617 6200 anexo 2122 - Fax: (511) 471-0179 Correo electrnico: revmedex@ins.gob.pe Pgina web: www.ins.gob.pe/rpmesp