Anda di halaman 1dari 21

MAKALAH II

MERASAKAN PHENYLTHIOCARBAMIDE (PTC): SEBUAH INTEGRASI BARU PADA LABORATORIUM GENETIKA DENGAN PENDEKATAN GENETIKA LAMA

Diangkat dari tulisan Robert B. Merritt, Lou Ann Bierwert, Barton Slatko, Michael P. Weiner, Jessica Ingram, Kristianna Sciarra, and Evan Weiner yang berjudul Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor dalam Jurnal The American Biology Teacher 70(5):e23-e28. 2008.

Oleh Endik Deni Nugroho 120341540933 Kelas C Rabu Jam ke- 56

UNIVERSITAS NEGERI MALANG PROGRAM PASCASARJANA PROGRAM STUDI PENDIDIKAN BIOLOGI April 2013

KATA PENGANTAR Variasi pada kemampuan merasakan phenylthiocarbamide (PTC) menjadi yang paling utama dipelajari pada semua sifat genetik manusia. Hal ini menyediakan pembahasan yang sangat menakjubkan pada pekerjaanya tentang polimorphisme utama untuk identifikasi dan sekuensing gen PTC dan menyediakan kebaharuan, suatu integrasi laboratorium yang melakukan investigasi sensitifitas rasa zat PTC. Pada jurnal ini pembelajaran laboratorium genetik fokus pada penggunaan teknik PCR dan RFLP untuk membandingkan genotype PTC pada masing-masing siswa. Tetapi menyarankan siswa untuk tidak hanya menggunakan kemampuannya pada teknik molekular genetika, namun juga kemampuannya dalam genetika mendelian (hukum pewarisan sifat), populasi genetik, probabilitas, dan analisis pedigree. Makalah ini berjudul Meningkatkan Kualitas Pembelajaran Biologi melalui Merasakan Phenylthiocarbamide (PTC): Sebuah Integrasi Baru Pada Laboratorium Genetika Dengan Pendekatan Genetika Lama. Pada makalah ini akan disampaikan tentang integrasi baru Phenylthiocarbamide (PTC) pada laboratorium genetik dengan pendekatan teknik genetik molekular dengan genetika klasik, dimana itu salah satu strategi yang dapat digunakan untuk mengenalkan dan membelajarkan diri siswa sendiri . Selain itu, pada makalah ini juga diulas sedikit tentang teknik PCR menggunakan peralatan dapur. Latar belakang pemilihan judul ini bukanlah hal yang asing lagi di luar negeri, bahkan informasi berkaitan dengan hal ini telah menjadi konsumsi publik. Ironinya, di Indonesia hanya kalangan tertentu saja yang mengenal dan memahami hal ini. Sebagai seorang pendidik, maka saya ingin juga memahami seperti apa cara membelajarkan genetika ini kepada peserta didik, sehingga peserta didik tidak ketinggalan informasi terkait hal ini. Akhir kata, dalam penulisan makalah ini juga masih belum sempurna oleh karena itu saran dan kritik yang membangun tetap kami nantikan demi kesempurnaan makalah ini.

DAFTAR ISI

Hal Kata Pengantar ........................................................................................ i Daftar Isi ................................................................................................. ii BAB I. Isi Jurnal ...................................................................................... 1 BAB II. Analisis Kritis Jurnal ................................................................. 10 BAB III. Keberlakuan di Indonesia ......................................................... 15 BAB IV. Saran-Saran .............................................................................. 17 Daftar Rujukan ....................................................................................... 18

ii

BAB I ISI JURNAL Dilaporkan pertama pada awal tahun 1930, variasi pada kemampuan merasakan phenylthiocarbamide (PTC) menjadi yang paling utama dipelajari pada semua sifat genetik manusia. Identifikasi gen PTC dan sejumlah publikasi terkait (Wooding et al., 2004; Kim et al., 2005; Wooding et al., 2006) menyediakan kebaharuan, suatu integrasi laboratorium yang melakukan investigasi sensitifitas rasa zat PTC. Laboratorium genetik fokus pada penggunaan teknik PCR dan RFLP untuk membandingkan genotype PTC pada masing-masing siswa. Tetapi getting there is half the fun and, in this case, getting there menyarankan siswa untuk tidak hanya menggunakan kemampuannya pada teknik molekular genetika, namun juga kemampuannya dalam genetika mendelian (hukum pewarisan sifat), populasi genetik, probabilitas, dan analisis pedigree. Lainnya, half the fun, pada kasus ini membandingkan antara fenotipe dan genotipe PTC, murid akan belajar tentang diri mereka sendiri.

Pewarisan Sifat Mendelian Kemampuan untuk merasakan PTC sering digunakan sebagai contoh pembelajaran di kelas tentang pewarisan sifat Mendelian sederhana yang dikendalikan oleh alel dominan perasa (T) dan alel resesif non-perasa (t). Pembelajaran Ini adalah contoh yang populer dilakukan karena siswa senang belajar sesuatu yang tidak terduga yang berkaitan dengan diri mereka sendiri dan tidak pernah gagal untuk takjub bahwa suatu kertas dapat menghasilkan respon rasa yang kuat sekitar 70% dari kelas yang benar-benar merasakan dengan yang lain. Seperti yang sering terjadi, genetika ini "sifat Mendelian sederhana" tidak cukup mudah. Misalnya, heterozigot perasa sebenarnya sedikit kurang peka terhadap kemampuannya dalam merasakan PTC bila dibandingkan dengan homozigot perasa, tetapi tingkat dominasi adalah sedemikian rupa sehingga kelas masih akan memiliki distribusi bimodal fenotipe. Dalam banyak kasus studi perasa PTC berakhir hanya dengan menentukan fenotipe individu dan menghitung frekuensi fenotipik kelas.

Perhitungan frekuensi A l e l sebagai sebuah latihan Probabilitas Setiap siswa mempunyai kemampuan dasar genetika populasi, mereka dapat memulainya dengan perhitungan fenotip PTC dan menggunakan perhitungan kalkulasi frekuensi dari alel perasa (T) dan non-perasa (t) di kelas. Sifat yang terdiri atas alel resesif, kalkulasi ini membutuhkan asumsi keseimbangan frekuensi genotip Hardy-Weinberg (p2 TT, 2pq Tt, q2 tt), dimana p adalah frekuensi alel T dan q adalah frekuensi alel t. Frekuensi dari alel resesif (non-perasa) adalah akar kuadrat dari frekuensi fenotipe resesif. Jika kelas terdiri atas 70% perasa dan 30% non-perasa, q akan sama dengan 0.55 dan p akan sama dengan (1-q) atau 0.45. Kalkulasi ini menyediakan kesempatan pada siswa untuk mengingat hukum keseimbangan Hardy-Weinberg, seperti monohibrid dan hibrid pada pewarisan mendelian. Peran dari penjumlahan adalah jika ada dua atau lebih cara yang eksklusif untuk mencapai hasil yang sama, kemungkinan hasil yang merupakan jumlah dari probabilitas yang memisahkannya, yaitu zigot Tt yang didapatkan dari telur T atau telur t, maka kemungkinan untuk zigot Tt adalah 2pq. Siswa harus bersemangat membangun lebih rumit kotak Punnett (dihibrid, trihibrid, dll), tetapi didorong untuk menurunkan rasio ini dari aplikasi sederhana dari aturan produk:

Membandingkan Genotip PTC Non-perasa (tt) mengetahui genotipe mereka karena mereka mempunyai resesif homozigot untuk mengekspresikan fenotipe mereka. Hal seperti ini tidak terjadi pada alel perasa (T-), dan perasa di kelas akan penasaran tentang apakah mereka homozigot (TT) atau heterozigot (Tt). Sampai saat ini sudah ada dua pendekatan untuk menjawab pertanyaan ini: satu yang melibatkan penggunaan frekuensi kelas alel untuk menghitung probabilitas kondisional yang perasa di kelas tersebut baik homozigot atau heterozigot, dan lain yang menambah analisis silsilah untuk penentuan probabilitas genotipe. Probabilitas kondisional dihitung dengan membagi kemungkinan hasil dari kondisi yang terjadi. Hipotesis dikelas

adalah, perasa bisa menghitung probabilitas bahwa dia adalah homozigot dengan membagi frekuensi perasa homozigot (f[TT]) dengan frekuensi perasa (f [T-]) atau (0.45)2/0.70. Oleh karena itu kemungkinan bahwa perasa adalah homozigot adalah 0,29 dan probabilitas perasa bersifat heterozigot adalah 0,71. Di sini sekali lagi adalah kesempatan untuk merujuk kembali ke pewarisan Mendelian silang hasil monohibrid dimana ia diharapkan 1/3 dari dominan F2 untuk berkembang biak benar karena (1/4) / (3/4) = 1/3. Data silsilah dapat memberikan wawasan tambahan ke dalam genotipe siswa perasa. Jika seorang siswa perasa memiliki orangtua non-perasa, dia harus heterozigot yang (kemungkinan TT = 0). Jika siswa perasa memiliki dua orang tua perasa dan setidaknya satu saudara non-perasa, kemungkinan homozigositas adalah 1/3 (sekali lagi, probabilitas bersyarat). Jika siswa perasa memiliki dua orang tua perasa, tidak ada saudara non-perasa, dan tidak ada informasi mengenai kakek-nenek, kemungkinan homozigositas dapat dihitung dengan menggunakan probabilitas kondisional yang perasa adalah homozigot (0,29) atau heterozigot (0.71) diperkirakan di atas menggunakan data populasi kelas. Probabilitas bahwa siswa perasa adalah homozigot dalam hal ini akan menjadi jumlah probabilitas perkawinan TTxTT (0,292) kali 1.0 (kemungkinan progeni TT dari persilangan ini) atau 0,084 ditambah kemungkinan perkawinan TTxTt (2 0,29 0,71) kali 1/2 (kemungkinan progeni TT dari persilangan ini) atau 0,206 ditambah kemungkinan perkawinan TtxTt (0,712) kali 1/3 (kemungkinan keturunan TT antara progeni T dari persilangan ini) atau 0,168. Oleh karena itu, kemungkinan bahwa seorang siswa perasa adalah homozigot (mengingat data kelas asli) adalah 0,46. Sementara polimorfisme PTC memberikan kesempatan yang menarik bagi siswa untuk menggunakan keahlian mereka dalam analisis silsilah, harus diingat bahwa pengumpulan data aktual silsilah membawa risiko mengungkapkan informasi sensitif. Bahkan dengan data pedigree, lebih dari setengah dari siswa perasa di kelas akan pasti genotipe PTC mereka akan dibiarkan dengan probabilitas heterozigositas dibandingkan homozigositas.

Dengan identifikasi dan urutan gen PTC, ketidakpastian yang sekarang ada dapat dihilangkan. Sekarang memungkinkan untuk menggunakan analisis amplifikasi sekuen polimorfik (CAPS) untuk menentukan genotipe siswa dengan menggunakan gen PTC pada lengan panjang kromosom 7 (7q35-Q36). Urutan sekuen gen ini, terutama yang menunjukkan variasi dalam kemampuan untuk merasakan PTC. Dua alel utama atau haplotipe (dan dalam beberapa kasus, atau beberapa alel yang jarang) ditemukan paling banyak pada populasi manusia. Haplotype (variasi baru) dari perasa dan non-perasa menunjukkan perbedaan yang ditunjukkan oleh tiga nukleotida polimorfisme tunggal (SNP) yang ditampilkan dengan warna merah tebal pada Gambar 4. Urutan sekuen tersebut menunjukkan bahwa dari alel non-perasa yang umum dengan basa G pada posisi nukleotida 145 (G145), T pada posisi 785 (T785) dan A pada posisi 886 (A886). Alel nonperasa menghasilkan polipeptida dengan alanin pada posisi asam amino 49, valin pada disebut posisi 262, dan isoleusin pada posisi 296, dan

sebagai alel AVI. Alel perasa yang paling umum memiliki

C145, C785, dan G886, menghasilkan polipeptida dengan 49 proline, 262 alanine, dan 296 valine, dan disebut sebagai alel PAV.

SNP pada posisi 785 memiliki kepentingan tertentu dalam genotyping karena urutan sekuen perasa di wilayah ini membentuk suatu situs restriksi Fnu4H1 saat mengganti C785 dengan T785 dimana dalam alel nonperasa akan menghilangkan situs restriksi ini.

Merrit et al., 2008 Gambar1. Sekuen Gen PTC

Ada dua situs restriksi dari Fnu4H1 (yang ditampilkan dalam warna merah gelap pada Gambar 2) dalam gen PTC, namun primer (ditampilkan dalam warna hijau dan biru pada Gambar 1) secara khusus dirancang untuk mengikat daerah pengapit dua (PCR) situs polimorfik Penggunaan 303 Fnu4H1 primer basa sementara dalam tidak reaksi termasuk polimerase dapat

lainnya.

tersebut

menghasilkan

nukleotida.

Setiap

siswa

memperoleh fragmen gen ini dengan mengisolasi DNA dari sel pipi. Amplifikasi PCR kemudian diikuti dengan restriksi menggunakan enzim digest

Fnu4H1. Setelah separasi elektroforesis, homozigot non-perasa masih terlihat


5

hanya 303 basa nukleotida pada gel elektroforesis, sedangkan homozigot perasa terlihat adanya dua fragmen pendek (239bp dan 65bp) dan heterozigot perasa menunjukkan tiga fragmen panjang. Analisis CAPS ini memungkinkan siswa untuk menerapkan pengetahuan mereka tentang struktur DNA dan replikasi, kode genetik, PCR, restriksi endonuklease, dan elektroforesis.
1 2 3 4 5 6 7 8 9 M 10

Gambar 2. Cleaved amplified polymorphic sequence (CAPS) Gel. Sumuran 1,4,6 dan, 9 adalah perasa heterozigot; sumuran 2,3, dan 8 adalah non-perasa homozigot; sumuran 5 adalah perasa homozigot, sumuran 7 kosong, M adalah ladder. Non-perasa hanya memiliki fragmen 303 bp, perasa homozigot 238 dan 64bp fragmen. Heterozigot perasa memiliki semua tiga fragmen. Fragmen 64 bp yang samar akibat proses difusi.

Evolusi molekuler, seleksi keseimbangan, dan Gen PTC Akhirnya, tinjauan literatur yang baru terkait gen PTC dapat memberikan wawasan ke siswa tentang bagaimana hubungan evolusi terurai. Kim et al. (2003) menetapkan bahwa PAV (alel perasa) adalah nenek moyang manusia karena memiliki kesamaan pada tiga asam amino (prolin, alanin, dan valin) terjadi pada posisi yang sama dari produk gen PTC simpanse, gorila dataran rendah, orangutan, monyet tua dan monyet baru dunia. Dua pengamatan telah menyatakan bahwa Alel PTC dipelihara dalam populasi manusia dengan cara seleksi keseimbangan, terjadinya variasi polimorfisme dan fakta bahwa simpanse menunjukkan variasi fenotipik yang sama. Wooding et al. (2006) menunjukkan bahwa sesungguhnya gen yang sama terutama bertanggung jawab untuk variasi dalam sensitivitas rasa PTC pada kedua spesies, hasil alel simpanse non-perasa dari mutasi pada kodon start (ATG menjadi AGG) sehingga terjemahan yang dimulai dengan metionin pada asam amino ke-97 (lihat M warna biru, pada Gambar 1) dalam rantai polipeptida
6

perasa. Penulis yang sama juga memberikan bukti bahwa produk gen simpanse yang dipotong menunjukkan gen tersebut tidak berfungsi. Alel PAV dan AVI menjelaskan lebih dari 90% dari variasi dalam gen PTC, total lima haplotype tambahan telah diidentifikasi, dengan keanekaragaman alel terbesar di sub Sahara Afrika. Identifikasi dan urutan sekuen dari gen PTC harus menstimulasi minat baru favorit tua dari kedua antropolog dan genetika, dan memberikan kesempatan di laboratorium untuk melakukan integrasi untuk siswa menjadi ahli dibidangnya. Cara kerja analisis CAPS CAPS kepanjangan dari Cleaved amplified polymorphic sequence. Proses yang dilakukan adalah sebagai berikut:
1.

Isolasi DNA total dari sel pipi, caranya adalah Mengorek bagian dalam dari sel pipi dengan sebuah lingkaran plastik steril (Fisher Scientific), kemudian menambahkan 200 l dari 5% buffer Chelex (Biologi Carolina) dituangkan pada 1,5 ml microsentrifuge tube. Setelah itu ditambahkan 2 l dari 10 mg Proteinase K (membantu proses lisis sel) pada tube dan diinkubasi selama 1530 menit pada suhu 56oC, kemudian di vortex selama 10 detik. Tahap selanjutnya adalah sentrifugasi dengan kecepatan tinggi selama 20 detik, kemudian dipanaskan selama 8 menit, dilanjutkan vortex selama 10 detik dan sentrifugasi pada kecepatan tinggi selama 2-3 menit.

2.

PCR (Amplifikasi gen PTC) dilakukan dengan menggunakan primer spesifik yaitu: Primer Foward 5AACTGGCAGAATAAAGATCTCAATTTAT3

dan primer reverse 5AACACAAACCATCACCCCTATTTT3. Cocktail yang digunakan dalam proses PCR adalah 32.5ul ddH2O, 0.5ul 10mM dNTPs, 3ul 25mM MgCl2, 5ul 10X PCR Gold Buffer, 1ul Forward Primer (10uM), 1ul Reverse Primer (10uM)dan 0.5ul AmpliTaq Gold Polymerase. Setelah bahan lengkap (50 ul) kemudian dimasukkan pada mesin PCR dengan siklus 42 siklus (siklus pertama untuk denaturasi pada suhu 95 C selama 10 minutes annealing pada suhu 55 C selama 5 detik), dilanjutkan 40 siklus (denaturasi pada suhu 95 C selama 90 detik, annealing pada suhu 55 C for 45 detik, dilanjutkan 1 siklus pemanjangan pada suhu 72 C selama 10 menit.

3.

Pemotongan dengan menggunakan enzim restriksi endonuklease Fnu4H1. Komposisi buffer yang digunakan adalah 6 ul ddH2O, 3ul 10X NEB RE Buffer #4 (NEB = New England Biolabs, Inc.) dan menambahkan 1ul Fnu4H1 Restriction Endonuclease (NEB). Reaksi Pemotongan dengan menggunakan master mix seharusnya dicampur dengan lembut, cepat disentrifugasi, dan dibagikan sebanyak 10ul alikuot ke tabung microfuge 1.5ml. Setiap siswa kemudian menambahkan 20ul selanjutnya diinkubasi pada suhu 37C semalaman. dari hasil PCRnya,

4.

Elektroforesis hasil pemotongan dengan enzim restriksi menggunakan agarosa gel 3%. (3 gram SeaKem LE Agarose dari Aplikasi BioWhittaker Molekuler per 100 ml) dengan buffer LB dari Cepat Lebih Baik Media LLC. Biarkan gel hingga dingin dan menghapus sisir. Setiap siswa akan menambah 15ul dari enzim (setengah isi tabung enzim) ke 3ul 5X Blue Juice dye (American Bioanalytical) dan memuat seluruh 18ul ke dalam sumur pada gel. Electrophorese gel pada 300 volt selama 30 menit.

PCR manual dengan menggunakan alat dapur sederhana Melalui eksperimen, kami telah menentukan bahwa PCR manual menggunakan peralatan dapur dapat digunakan untuk amplifikasi DNA bucal swab. Meskipun pengguna PCR manual ini memakan waktu lama, mudah dan dapat menggantikan peralatan mahal. Tube PCR akan dipindah-pindah pada tabung aluminium yang terdiri atas penahan panas yang cocok (air atau pasir). Biaya untuk tiga hot plate, tiga panci, tiga termometer, dan timer dapur adalah sekitar $ 50. Meskipun sedikit menambah biaya keseluruhan, termometer digital yang direkomendasikan dan dapat dibeli di toko-toko elektronik kebanyakan atau hewan peliharaan. Kadar pasir halus (dari jenis yang digunakan di taman bermain anak-anak) dipanaskan sampai tiga suhu yang digunakan dalam PCR (Gambar 2). Dalam pengaturan suhu, kami menemukan bahwa itu adalah penting untuk mengaduk pasir secara menyeluruh untuk mendapatkan bahkan pemanasan. Seperti sink panas, pasir lebih berguna daripada air karena mempertahankan panas untuk jangka waktu yang lama. Namun, kerugian untuk menggunakan pasir, bukan air, adalah bahwa jika pasir terlalu panas (yang mudah dilakukan karena

pasir memanaskan agak cepat), sulit untuk membawa suhu turun secara tepat waktu. Suhu dari hot plate biasanya dapat distabilkan dalam waktu sekitar 15 menit. Biarkan suhu tetap stabil selama kurang lebih 20 menit. Reaksi harus dilapisi dengan minyak mineral (untuk mencegah kondensasi reactionmix di bagian atas tabung) dan dalam keadaan tertutup rapat. Waktu dan suhu tetap konsisten dengan yang sebelumnya dijelaskan untuk otomatis termal siklus berbasis PCR, tetapi jumlah siklus mungkin perlu ditingkatkan. Selembar kertas (lihat Gambar 3) yang dapat diperiksa off digunakan untuk melacak jumlah siklus (catatan bahwa suhu pada lembar sampel berbeda dari yang disarankan untuk PTC-PCR).

Gambar 3. Pedoman PCR. (Top) Manual PCR set-up menggunakan panci aluminium, hot plate, termometer, dan baik pasir atau air. (Bawah) Sebuah versi sederhana dari blok suhu yang digunakan untuk merekam siklus dan suhu yang sesuai mereka di seluruh panduan PCR. Setiap kotak itu diperiksa-off untuk memastikan bahwa langkah yang benar dari setiap siklus sedang dilakukan dalam urutan yang benar.

BAB II ANALISIS KRITIS JURNAL

Pada

artikel siswa

tersebut tentang

dibahas variasi

tentang pada

cara

mengenalkan

dan

membelajarkan

kemampuan

merasakan

phenylthiocarbamide (PTC) menjadi dipelajari pada semua sifat genetik manusia. Seperti kita ketahui bahwa materi genetika merupakan materi yang sulit dimengerti oleh sebagian besar siswa sekolah menengah maupun sampai perguruan tinggi. Hal ini disebabkan karena beberapa masalah yaitu cara penyampaian materi, metode, penggunaan media dan susahnya memadukan beberapa materi dengan satu objek atau dengan nama lain mengintegrasikan suatu pembelajaran. Dalam artikel ini menjelaskan pembelajaran di laboratorium genetik fokus pada penggunaan teknik PCR dan RFLP untuk membandingkan genotype PTC pada masing-masing siswa. Di laboratorium ini memiliki slogan pembelajaran yaitu getting there is half the fun and, in this case, getting there menyarankan siswa untuk tidak hanya menggunakan kemampuannya pada teknik molekular genetika, namun juga kemampuannya dalam genetika mendelian (hukum pewarisan sifat), populasi genetik, probabilitas, dan analisis pedigree. Lainnya, half the fun, pada kasus ini membandingkan antara fenotipe dan genotipe PTC, murid akan belajar tentang diri mereka sendiri. Hal ini memperlihatkan suatu pembelajaran yang mengintegasikan genetika modern dengan genetika lama dengan suatu konsep merasakan phenylthiocarbamide (PTC). Saya akan menjelaskan tentang asal mula phenylthiocarbamide (PTC) yang menjadi bahan pembelajaran di jurnal ini.

Sejarah senyawa PTC (Phenylthiocarbamide) Pada tahun 1931, seorang ahli kimia bernama Arthur Fox menuangkan beberapa bubuk PTC ke dalam botol, tanpa disengaja bubuk tersebut tertuang air, siswa yang duduk disebelah percobaan tersebut menyatakan bahwa debu dari PTC tersebut terasa pahit. Fox tidak merasakan apa-apa sama sekali. Beliau penasaran bagaimana setiap siswa bisa merasakan bahan kimia yang berbeda-beda. Hasilnya

10

sama, Fox meminta teman-teman dan keluarganya mencoba rasa bahan kimia tersebut, kemudian digambarkan lagi bagaimana rasanya. Beberapa orang merasakan hal yang berbeda, beberapa merasakan sangat pahit, dan yang lain merasakan sedikit pahit (Learning Genetic Laboratory, online).

Learning Genetic Laboratory, Online Gambar 4. A. Siswa yang tidak dapat merasakan PTC; B. Siswa yang dapat merasakan PTC Rasio antara perasa dan tidak perasa antara populasi, setiap kelompok memiliki beberapa perasa dan tidak perasa. Rata-rata, 75% orang dapat merasakan PTC, sedangkan 25% tidak bisa.

Penemuan Gen pengendali Rasa PTC (PTC gene atau TAS2R38) Segera setelah penemuannya, para ahli genetika menentukan bahwa ada komponen pewarisan yang mempengaruhi bagaimana kita dapat merasakan PTC. Sekarang, kita mengetahui bahwa kemampuan untuk merasakan PTC (atau tidak dapat merasakannya) diatur oleh sebuah gen tunggal yang mengkode reseptor rasa pada lidah. Gen ini adalah gen PTC atau TAS2R38, yang ditemukan pada tahun 2003. Ada dua bentuk umum (alel) dari gen PTC, dan setidaknya lima bentuk yang jarang dijumpai. Salah satu bentuk umum adalah alel perasa, dan lainnya adalah alel tidak-perasa (non-perasa). Masing-masing alel mengkode protein

reseptor untuk rasa pahit dengan bentuk yang sedikit berbeda. Bentuk protein reseptor ini menentukan seberapa kuat dapat mengikat zat PTC. Semua orang memiliki dua salinan dari setiap gen, kombinasi dari varian gen rasa pahit yang dapat menentukan apakah seseorang nantinya menemukan PTC sangat pahit, rasa agak pahit, atau tanpa sama sekali.

11

PTC singkatan dari phenylthiocarbamide, dikenal juga sebagai phenylthiourea, struktur kimia PTC meneyrupai alkaloid beracun yang ditemukan di beberapa tanaman beracun.

Learning Genetic Laboratory, Online Gambar 5. A. struktur kimia PTC, B. Proses respon PTC oleh resptor rasa pada lidah

Gen ini mengkode tujuh-transmembran reseptor G protein berpasangan yang mengontrol kemampuan untuk merasakan glucosinolates, kelompok rasa senyawa pahit yang ditemukan dari tanaman Brassica sp. Senyawa sintetik phenylthiocarbamide (PTC) dan 6-n-propylthiouracil (PROP) telah diidentifikasi sebagai ligan untuk reseptor ini dan telah digunakan untuk menguji keragaman genetik dari gen ini (NCBI, online). Meskipun bentuk alel dari beberapa gen ini telah diidentifikasi di seluruh dunia, ada dua bentuk umum alel dominan yaitu: alel perasa dan non-perasa yang ditemukan di luar Afrika. Alel ini berbeda di tiga posisi nukleotida yang mengakibatkan perubahan asam amino pada protein (A49P, A262V, dan V296I) dengan kombinasi asam amino PAV yang

12

diidentifikasi dari varian pengecap (AVI dan diidentifikasi dari varian non-perasa) (NCBI, Online).
Chromosome 7 - NC_000007.13

NCBI, Online Gambar 6. Gen TAS2R38 (gen PTC) terdapat di Lengan panjang kromosom 7

Menurut saya pembehasan sangat bagus karena dalam jurnal ini dijelaskan siswa belajar tentang dirinya sendiri dengan mengaitkan kemampuan merasakan PTC yang dihubungkan dengan konsep genetika mendelian (hukum pewarisan sifat), populasi genetik, probabilitas, dan analisis pedigree. Kemampuan untuk merasakan PTC sering digunakan sebagai contoh pembelajaran di kelas tentang pewarisan sifat Mendelian sederhana yang dikendalikan oleh alel dominan perasa (T) dan alel resesif non-perasa (t). Pembelajaran ini adalah contoh yang populer dilakukan karena siswa senang belajar sesuatu yang tidak terduga yang berkaitan dengan diri mereka sendiri dan tidak pernah gagal untuk takjub bahwa suatu kertas dapat menghasilkan respon rasa yang kuat sekitar 70% dari kelas yang benar-benar merasakan dengan yang lain. Di jurnal ini juga menjelaskan Setiap murid mempunyai kemampuan dasar genetika populasi, guru sangat kreatif dalam memanfaatkan pembelajaran ini, terlihat dimana guru membelajarkan sifat yang terdiri atas alel resesif, kalkulasi ini membutuhkan asumsi keseimbangan frekuensi genotip Hardy-Weinberg. Didalam jurnal ini juga bagaimana seorang guru mengemas pembelajaran genetika dengan sangat baik, terlihat ketika guru menghubungkan

mengintegrasikan beberapa materi dengan pendekatan integrasi baru laboratorium diantara materi tersebut yaitu evolusi molekuler, seleksi keseimbangan, dan Gen PTC. Disini peran seorang guru untuk berinovasi dan berkreativitas, seperti

diketahui untuk menyampaikan materi genetika susah-susah gampang. Seorang harus mempunyai strategi pembelajaran pemecahan masalah bisa dilaksanakan melalui pendekatan pembelajaran, dimana suatu cara yang dilakukan oleh guru agar materi yang ditampilkan dapat beradaptasi dengan para siswa. Selain itu
13

dapat juga dilakukan dengan menggunakan metode pembelajaran yaitu dengan cara menyajikan materi yang masih bersifat luas (umum) dan saling terkait. Dalam jurnal ini yang membuat saya suka yaitu pada saat pembahasan menggunakan PCR manual dengan peralatan dapur dapat digunakan untuk

amplifikasi DNA. Ini merupakan suatu kreativitas seorang guru dan pemahaman konsep yang matang dalam menyelesaikan masalah, meskipun pengguna PCR manual ini memakan waktu lama, mudah dan dapat menggantikan peralatan mahal. Jadi tidak ada alasan seorang guru tidak membelajarkan siswanya dengan efektif dan untuk mencapai pembelajaran yang bermakna. Seorang guru harus menghadirkan suatu pembelajaran pemecahan masalah dapat efektif dan sesuai dengan tujuan, diperlukan beberapa faktor pendukung yaitu: perencanaan, waktu, sumber belajar-media, pengelolaan kelas serta teknologi. Perencanaan waktu harus efektif dan disesuaikan dengan kemampuan dan proses berpikir siswa. Guru setidaknya mampu memperkirakan seberapa banyak waktu yang dibutuhkan siswa dalam menyelesaikan beberapa soal. Guru perlu menyiapkan alat-alat peraga manipulatif untuk siswa dalam membantu memahami dan memecahkan masalah.

14

BAB III KEBERLAKUANNYA DI INDONESIA Hasil refleksi diri terhadap pelaksanaan pembelajaran SD sampai kuliah dan praktikum genetika dan penelitian-penelitian genetika yang selama ini dilakukan menunjukkan bahwa dalam pembelajaran Genetika masih bersifat textbook oriented. Akibatnya, kita miskin dengan contoh-contoh fenomena genetik yang berada di sekitar kita. Pembelajaran yang bersifat textbook oriented menempatkan contoh-contoh fenomena genetik yang diambil sesuai dengan yang ada di buku, yang kadang-kadang tidak dijumpai di tempat kita. Pembelajaran Genetika masih didominansi dengan penggunaan metode ceramah, sehingga hanya terjadi transfer pengetahuan (transfer of knowledge) dari dosen ke mahasiswa. Pembelajaran belum banyak menggunakan multimetode, multimedia, multi sumber belajar maupun multi modul pembelajaran sebagai bagian dari pemberian layanan yang memperhatikan ragam belajar mahasiswa. Akibatnya, respon, inisiatif maupun interaksi antara dosen/ guru dengan mahasiswa/siswa dalam pembelajaran masih sangat rendah. Siswa/Mahasiswa hanya melakukan kegiatan sesuai dengan petunjuk yang diberikan tanpa melakukan pengembangan lebih lanjut. Selama ini pembelajaran genetika pada materi mendelian (hukum pewarisan sifat), populasi genetik, probabilitas, dan analisis pedigree diajarkan secara terpisah baik di tingkat sekolah menengah sampai perguruan tinggi. Di Indonesia belum banyak mengaplikasikan pendekatan integrasi genetika modern dengan genetika klasik / lama. Apalagi penggunaan PTC dalam penerapan pembelajaran genetika, selama ini saya belum mendengar bahkan belum pernah mencoba. Dalam pembelajaran genetika selama ini hanya menggunakan media pelemparan koin, dadu, percobaan Mendel dll, sehingga siswa / mahasiswa kurang efektif dan tidak memberi kesempatan siswa / mahasiswa mengenal diri sendiri. Seharusnya pembelajaran genetika bisa menjadi pembelajaran terpadu merupakan salah satu model implementasi kurikulum yang dianjurkan untuk diaplikasikan pada semua jenjang pendidikan.

15

Di Indonesia pembelajaran terpadu meliputi pembelajaran yang terpadu dalam satu disiplin ilmu, terpadu antara mata pelajaran. Pembelajaran terpadu merupakan suatu pendekatan dalam pembelajaran yang secara sengaja mengaitkan beberapa aspek baik dalam intra mata pelajaran maupun antar mata pelajaran. pembelajaran itu akan lebih aktif dan efektif apabila guru dapat menghubungkan atau mengintegrasikan antara pelaksanaan pembelajaran di sekolah dengan yang ditemukan dilapangan. Guru memiliki tugas untuk mengintegrasikan materi pembelajaran dengan pembelajaran di lingkungan siswa atau diri sendiri. Satu lagi dalam pembelajaran genetika molekular, seorang guru d Indonesia jarang menggunakan alternatif alat-alat yang tidak terjangkau dalam pembelajaran atau yang tidak tersedia dalam pembelajaran. Seperti ditunjukan oleh pembahasan jurnal diatas, guru menggunakan perkakas dapur untuk PCR manual dengan peralatan dapur dapat digunakan untuk amplifikasi DNA, meskipun pengguna PCR manual ini memakan waktu lama, mudah dan dapat menggantikan peralatan mahal. Jadi hal itu membutuhkan kreatifitas seorang guru dan tidak ada alasan seorang guru tidak membelajarkan siswanya dengan efektif untuk mencapai pembelajaran yang bermakna sesuai tujuan pendidikan nasional. Tetapi hal itu tidak menutup kemungkinan bisa diaplikasikan di Indonesia untuk pembelajaran genetika molekular kedepanya. Hal tersebut membutuhkan inovasi, kreatifitas dan ketekunan seorang guru dan perangkat pendidik lainnya untuk menghadirkan pembelajaran yang bermakna.

16

BAB IV SARAN-SARAN

Setelah

melakukan kajian terhadap

jurnal,

maka

penulis

dapat

mengemukakan saran-saran yang mungkin dapat dilakukan dan diterapkan dalam kelas bagi pendidik maupun calon pendidik sebagai berikut. 1) Seorang tenaga pendidik hendaknya selalu melakukan pembaharuan informasi terkait dengan perkembangan ilmu pengetahuan, dengan demikian seorang guru dapat menyampaikan informasi terbaru kepada siswanya. 2) Perlunya pengenalan sebuah Integrasi baru pada pembelajaran laboratorium genetika molekuler dengan pendekatan genetika lama. 3) Pendidik/calon pendidik hendaknya lebih kreatif dalam mengemas

pembelajaran genetika agar mampu memotivasi siswa dalam mempelajari konsep-konsep penting dengan mempelajari diri sendiri. 4) calon pendidik harus mengembangkan pembelajaran biologi khususnya genetika menjadi lebih yang bermakna, dengan menumbuhkan sikap ilmiah siswa dalam menemukan informasi tentang diri sendiri, dengan

menggabungkan konsep modern dengan konsep yang lama.

17

DAFTAR RUJUKAN

Guo, S. & Reed, D.R. (2001). The genetics of phenylthiocarbamide perception. Annals of Human Biology, 28, 111-142. Kim, U., Jorgenson, E., Coon, H., Leppart, M., Risch, N. & Drayna, Kim, U., Wooding, S., Ricci, D., Jorde, L.B. & Drayna, D. (2005). Worldwide haplotype diversity and coding sequence variation at human taste receptor loci. Human Mutation, 26(3), 199-204. Merritt, R., Bierwort, L., Slatko, B., Weiner, M., Weiner, E., Ingram, J. and Sciarra, K. (2008). Tasting Phenylthiocarbamide (PTC): A New Lab With an Old Flavor. Am. Biol. Teacher, 70:4. Wooding, S. (2006). Phenylthiocarbamide: A 75-Year Adventure in Genetics and Natural Selection. Genetics 172 (4): 2015-2023. Wooding, S., Bufe, B., Grassi, C., Howard, M.T., Stone, A.C., Vazquez, M., Dunn, D.M., Meyerhof, W., Weiss, R.B. & Bamshad, M.J. (2006). Independent evolution of bitter-taste sensitivity in humans and chimpanzees. Nature, 440, 930-934.

18