Name (Please Print):______________________________________________ Student ID number: _________________________________

Signature: ______________________________________________ Chemistry 4304 First Midterm Examination September 21, 2012

All answers should be written on this exam. Clearly indicate your answers in the spaces provided; if we have to guess as to what or where your answer is, it's wrong. Where applicable, outline the logic or principle you used to arrive at your answer, as partial credit may be awarded for correct approaches. Work pages are provided at the end of the exam; if you need more ask. Make sure your name is on each page of the examination; the management is not responsible for lost pages. Your signature above is your assurance that you have worked independently without help from anyone besides the professor for CHM4304 or any other outside source such as notes or electronic devices. You are strongly advised to read the exam through completely before you begin.

-1-

This exam is composed of 4 questions and 6 pages plus one scrap page. 1. (24 points) a) Please draw the pentapeptide HAPPY showing all atoms and bonds. You will not be graded on stereochemistry but are expect to draw the most favored conformation of the amide bond.

b) What is the net charge of the peptide HAPPY at pH 1? c) For membrane proteins with a water filled center the hydrophobic residues are on the outside or inside. Please circle answer. d) Please draw the hydrogen bonding pattern of the backbone of a hexapeptide in an alpha helical configuration. The hexapeptide should be drawn in a linear fashion, although it is part of an alpha helix, and the side chains should be indicated as R.

-2-

2. (32 points) a) Know your limits. Which two amino acids are indistinguishable in peptide sequencing using the tandem mass spectrometry method described in Chapter 3 and why (one sentence of 10 words or less)?

b) Its on the bag. Suppose that you precipitate a protein with 1 M ammonium sulfate and that you wish to reduce the concentration of the ammonium sulfate. You take 1 mL of your sample and dialyze it twice against 100 mL of buffer each time. At the end of the second dialysis what is the concentration of ammonium sulfate in your sample?

c) Please specify the most common protein chemistry technique that uses each of the following reagents. : Reagent CNBr Urea mercptoethanol Trypsin 6 N HCl Ninhydrin Dicyclohexylcarbodiimide Phenyl isothiocyanate Nitrocellulose membrane Technique

d) Do large or small proteins move faster on a gel filtration column? Please circle your answer. e) Do large or small proteins move faster during SDS PAGE? Please circle your answer.

-3-

f) 4. You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3,
4, 5, and - galactosidase), and your goal is to obtain purified -galactosidase. Some characteristics of these proteins are shown in the table below: Protein 1 2 3 4 5 B-gal Concentration of ammonium sulfate (AS) required for precipitation (%) 45 80 65 20 30 45 Molecular Weight (kDa) 38 22 4 75 55 115 Isoelectric point (pI) 3.7 4.8 5.3 6.8 9.5 8.2

You decide to use ion exchange chromatography to further purify -galactosidase away from other proteins in your sample. You first run an anion exchange column equilibrated using column buffer with a pH of 7.0. i) What charge does the matrix of a cation exchange column have? _________ ii) What is the most common functional group on a cation exchange resin used for protein purification? Please draw structure.

iii) Which of the above proteins would stick to the resin? __________________

iv) State how you would elute a protein bound to a cation exchange column (five words or less).

-4-

3 (26 points) a) What did Chargaff discover that helped Watson and Crick determine the structure of DNA (one sentence)?

b) What are the three main forms of DNA? Please circle the one found most commonly in vivo. i) ii) iii) c) What do DNA polymerases need that RNA polymerases do not, assuming DNA and RNA are the same?

d) What amino acid sequence would the following DNA code for? Please remember the start codon. The template strand is as follows: 5 CTATACGTCGGTACCTTGCATCCCACCAGGGAGCGA-3

e) How is the mRNA modified after transcription in eukaryotes but before splicing? i) ii)

-5-

4. (18 points) a) The following sequence of DNA ATTGCTCGACTGGACCTCACTGACACGATCGCATCCTTCGACTCGT was mixed with an unknown primer of length 15 bp, ddC, the four NTPs and DNA polymerase. The resulting mixture of DNA fragments were separated to provide fragments of lengths 20, 21, 25 and 29 bp amongst others (other fragments were observed but are not indicated). Indicate below the sequence of the 15 bp primer from 5 to 3? _________________________________________ b) Please draw the structure of 2, 3-dideoxyadenosine-5-triphosphate?

c) EcoR1 is a restriction endonuclease with a 6 bp recognition sequence. If EcoR1 cuts the following piece of DNA what is its likely recognition sequence. Only one strand of double stranded DNA is indicated. Please underline the recognition sequence. ATGCGAATTCGTTCGTGCTAAGGCTAGCCGCTA

-6-

-7-