Anda di halaman 1dari 18

REFERAT HAND FOOT AND MOUTH DISEASE

DISEDIAKAN OLEH : NOR AZLYZA BINTI AHMAD MOIN 030.08.291

PEMBIMBING: dr. DANIEL EFFENDI Sp. A

KEPANITERAAN KLINIK ILMU KESEHATAN ANAK RSUD BUDHI ASIH PERIODE 26 AUGUSTUS 2 NOVEMBER 2013 FAKULTAS KEDOKTERAN UNIVERSITAS TRISAKTI JAKARTA 2013

KATA PENGANTAR Puji dan syukur penulis panjatkan kepada Tuhan Yang Maha Esa atas berkat dan rahmatNya sehingga penulis dapat menyelesaikan tugas referat yang berjudul HAND FOOT AND MOUTH DISEASE ini. Referat ini disusun dalam rangka memenuhi salah satu tugas kepaniteraan klinik bagian ilmu penyakit anak Fakultas Kedokteran Trisakti di Rumah Sakit Umum Daerah Budhi Asih periode 26 Augustus 2 november 2013. Penulis juga mengucapkan terima kasih kepada dr. Daniel Effendi Sp A selaku pembimbing dalam penyusunan referat ini. Tidak dilupakan kepada teman-teman dan semua pihak yang ikut membantu dalam penyelesaian referat ini. Penulis menyedari referat ini masih jauh dari sempurna sehingga penulis mengharapkan saran dan kritik yang membangun untuk referat ini dapat bermanfaat bagi yang membacanya.

BAB 1 PENDAHULUAN KTM (Kaki tangan dan Mulut) atau dahulu serimg disebut Flu Singapura sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM ). Mengapa disebut flu singapura karena pertengahan September tahun 2000 lalu, penyakit tangan, kaki dan mulut pernah merebak di Singapura. Pemerintah Singapura bahkan sampai menganjurkan agar seluruh restoran siap saji, kolam renang, dan tempat bermain anak-anak ditutup sementara setelah tiga anak diberitakan meninggal karena diduga terkena penyakit tersebut. Sebanyak 440 taman kanak-kanak (TK) dan 557 pusat perawatan anak diliburkan. Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.(1) Wabah KTM cenderung terjadi setiap 3 tahun di Amerika Serikat. Kejadian HFMD di seluruh dunia dilaporkan. Pola musiman terjadi di daerah beriklim sedang, dengan kejadian puncak pada akhir musim panas dan awal musim gugur. Infeksi KTM lebih berat pada bayi dan anak dibandingkan orang dewasa, tetapi umumnya, penyakit ini memiliki manifestasi ringan.(1) Tidak ada predileksi ras untuk penyakit infeksi ini. Rasio penderita laki-laki dan perempuan adalah 1:1. Sebagian besar kasus tangan-kaki-dan-mulut penyakit mempengaruhi anak-anak muda dari 10 tahun, meskipun kasus pada orang dewasa dilaporkan.(1)

BAB II PEMBAHASAN A. DEFINISI Hand Foot and Mouth Disease (HFMD) atau infeksi Kaki, Tangan dan Mulut ( KTM ) adalah penyakit virus akut yang muncul sebagai erupsi vesikular di mulut. Infeksi ini juga dapat melibatkan tangan, kaki, pantat, dan atau alat kelamin. Coxsackie virus Tipe 16 (CV A16) adalah virus penyebab yang terlibat dalam sebagian besar kasus infeksi KTM, tetapi penyakit ini juga terkait dengan coxsackie virus A5, A7, A9 A10, B2, dan strain B5. Enterovirus 71 (EV-71) juga menyebabkan wabah HFMD dengan keterlibatan neurologis terkait di wilayah Pasifik barat. Coxsackie virus adalah subkelompok dari enterovirus dan merupakan anggota dari keluarga Picornaviridae. Keluarga ini terdiri dari kecil, tidak memiliki amplop, beruntai tunggal virus RNA.(1) Infeksi KTM adalah penyakit berjangkit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (bahasa Spanyol Pico:kecil), Genus Enterovirus (non Polio). Di dalam Genus Enterovirus terdiri dari virus Coxsackie A,

virus Coxsackie B, Echovirus dan Enterovirus. Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.(1) Penyakit KTM sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum yang menyerang anak-anak usia 2 minggu sampai 5 tahun (kadang sampai 10 tahun). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, air liur, tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang-barang yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain enterovirus lainnya.(1)

B. EPIDEMIOLOGI Pada tahun 1997, 31 anak meninggal dalam suatu wabah di Malaysia pada negara bagian Sarawak. Pada tahun 1998, ada suatu wabah di Taiwan, terutama yang memengaruhi anak-anak, tercatat bahwa 405 sakit parah dan 78 meninggal. Jumlah kasus yang diperkirakan epidemi telah mencapai 1,5 juta. Pada tahun 2006, 7 orang tewas dalam sebuah wabah di Kuching, Sarawak. Pada tahun 2006, setelah pecahnya Chikungunya di selatan dan beberapa bagian barat India, kasus KTM dilaporkan. Wabah di Cina dimulai pada bulan Maret di Fuyang, Anhui, mengakibatkan terinfeksi 25.000, dan 42 meninggal. Wabah serupa dilaporkan di Singapura (lebih dari 2.600 kasus sebagai 20 April 2008), Vietnam (2,300 kasus, 11 meninggal), Mongolia (1,600 kasus), dan Brunei (1053 kasus antara bulan Juni sampai Agustus 2008). 17 anak meninggal dalam suatu wabah di selama bulan Maret dan April 2009 di Provinsi Shandong, China timur dan 18 anak-anak meninggal di Provinsi Henan. Sembuh dari 115.000 kasus yang dilaporkan di Cina dari Januari hingga April, 773 itu parah dan 50 orang fatal.(2) Pada tahun 2009, di Indonesia, di mana penyakit ini sering disebut flu Singapura, penyakit ini dilaporkan dari Jakarta bahwa delapan anak-anak tertular. Pada akhir April, lembaga-lembaga kesehatan peringatan pusat kesehatan masyarakat Jakarta mendukung langkah-langkah pencegahan, termasuk penggunaan termal scanner di bandara untuk menghindari perjalanan ke Singapura.(2)

a. Host PTKM sering di masukkan dalam golongan nonpolio enteroviruses. Manusia adalah satusatunya yang di kenal menjadi reservoir virus ini, artinya belum pernah di laporkan reservoir lain dari burung atau binatang yang lain. Virus seperti enterovirus memang pernah di isolasi dari anjing dan hewan, tetapi tidak ada bukti bahwa virus tersebut menular dari hewan ke manusia. Di luar tubuh manusia virus ini dapat hidup di limbah air kotor dan dapat bertahan hidup sampai 6 bulan.(3)

b. Cara Penularan

Sampai sekarang yang di ketahui adalah penularan fecal oral. Melihat hasil kultur juga positif dari bahan yang di ambil dari usapan tenggorok, maka kemungkinan besar juga dapat di tularkan lewat droplet infection atau oral-oral dari satu orang ke orang lain. Ada yang mengatakan faktor pembawa seperti kecoa dan lalat.(3) c. Jenis kelamin Laki-laki lebih banyak terkena PTKM. Tetapi hal ini masih memerlukan penelitian lebih lanjut.(3) d. Umur Lebih muda umur individu lebih peka terhadap PTKM. Bayi lebih peka terhadap PTKM daripada orang dewasa. Gejala klinik juga lebih nyata. Umur kepekaan ada yang mengambil batas 5 tahun.(3) e. Imunitas individu Pada individu yang ada gangguan imunitas misalnya imunodefisiensi pasca cangkok sumsum tulang, bayi, akan lebih peka terhadap PTKM. Hal ini yang menjadi dasar pemberian immunoglobulin pada bayi di kamar bayi rumah sakit yang di ada wabah PTKM.(3) f. Musim Di negara 4 musim, penyakit ini terjadi pada musim panas. Para klinis perlu menanyakan dan mengetahui tentang pengaruh musim pada anamnesis pasien. Di luar musim panas kemungkinan PTKM kecil. Berbeda dengan daerah tropis(Indonesia) kemungkinan PTKM dapat terjadi wabah sepanjang tahun. Pengaruh ini berhubungan dengan ketersediaan air sebagai tempat hidup virus di luar tubuh manusia. Pada musim dingin air diluar jadi es, pada musim panas banyak air yang dapat untuk hidup enterovirus.(3) g. Wabah enterivirus h. Jenis virus Penyebab PTKM bermacam-macam enteroviruses. Pertama kali PTKM di duga hanya dari virus coxsackie. Tetapi beberapa wabah menunjukkan bahwa enteroviruses juga menyebabkan PTKM.(3) C. ETIOLOGI HFMD atau dikenal juga dengan sebutan PTKM merupakan penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam family Picornaviridae, genus Enterovirus, terutama virus Coxsackie Grup A, khususnya tipe A16. Di dalam famili Picornaviridae, terbagi menjadi genus

Enterovirus dan Rhinovirus. Di dalam genus Enterovirus, terdiri dari Poliovirus, tipe 1-3 Coxsackievirus kelompok A, tipe 1-24 (tidak ada tipe 23) Coxsackievirus kelompok B, tipe 1-6 Echovirus, tipe 1-34 (tidak ada tipe 10 dan tipe 28) dan Enterovirus, tipe 68-71. Enterovirus adalah penghuni sementara saluran pencernaan manusia dan dapat diisolasi dari tenggorokan atau usus bawah. Enterovirus yang bersifat sitopatogenik (Poliovirus, Echovirus, dan beberapa Coxsackie virus), pertumbuhannya dapat segera terjadi pada suhu 36oC sampai 37oC dalam biakan primer sel ginjal manusia dan monyet. Coxsackie virus yang termasuk dalam genus Enterovirus, terbagi menjadi kelompok A dan B. Coxsackie virus kelompok A serotipe tertentu menyebabkan penyakit herpangina Penyakit Tangan, Kaki, dan Mulut (PTKM) dan konjungtivitas hemoragik akut. Coxsackie virus kelompok B dapat menyebabkan penyakit pleurodinia, miokarditis, perikarditis, dan meningoensefalitis. Penyebab HFMD yang paling sering pada pasien rawat jalan adalah Coxsackie virus A16, sedangkan yang memerlukan perawatan karena keadaannya lebih berat atau timbul komplikasi sampai menyebabkan pasien meninggal disebabkan oleh Enterovirus 71.(3) Coxsackie virus A16 memiliki ukuran partikel 27nm, virion RNA messenger, 31% RNA di virion, bersifat stabil dalam pH asam (pH 3,0-5,0) selama 1-3 jam, komposisi RNA: A=30%, U=24%, G=23%, C=23% memiliki berat jenis apung kira-kira 1,34 gram /ml dalam CsCl. Virus ini sangat infektif pada mencit yang baru lahir, yaitu dapat menyebabkan miositis yang meluas dalam otot-otot lurik mencit yang baru lahir sehingga mengakibatkan kelumpuhan lemas tanpa gejala-gejala lain. Sifat antigen dari Coxsackie virus yaitu sekurang-kurangnya sekarang dikenal 29 tipe imunologik Coxsackie virus yang berlainan, 23 tipe terdaftar dalam kelompok A (termasuk Coxsackie virus A16) dan 6 tipe terdaftar dalam kelompok B.(3)

Gambar 1 : Struktur virus coxsackie(4)

D.PATOGENESIS Selama masa epidemik, virus menyebar dengan sangat cepat dari satu anak ke anak yang lain atau dari ibu kepada janin yang dikandungnya. Virus menular melalui kontak langsung dengan sekresi hidung dan mulut, tinja, maupun virus yang terhisap dari udara. Implantasi dari virus di dalam bukal dan mukosa ileum segera diikuti dengan penyebaran menuju nodus-nodus limfatik selama 24 jam. Setelah itu segera timbul reaksi berupa bintik merah yang kemudian membentuk lepuhan kecil mirip dengan cacar air di bagian mulut, telapak tangan, dan telapak kaki. Selama 7 hari kemudian kadar antibodi penetral akan mencapai puncak dan virus tereliminasi.(5)

E. GEJALA KLINIK Gejala awal HFMD sangat mirip dengan penyakit flu. Hari pertama dan kedua ditandai dengan demam tidak terlalu tinggi, kemudian nyeri telan, tidak mau makan dan minum. Pada bayi, para orang tua membawa anaknya ke dokter karena demam, tidak mau netek (minum) dan ngeces (ngiler, keluar liur).(5)

Selanjutnya mulai muncul bintik berair (vesikel) yang mudah pecah di dalam rongga mulut, kadang menimbulkan ulkus mirip dengan stomatitis aftosa ( sariawan ), diikuti dengan timbulnya bintik berair di telapak tangan dan kaki. Gejala ini biasanya muncul pada hari ketiga.(5)

Bintik berair adakalanya menyebar ke badan, terutama paha, bokong, perut, lengan dan wajah. Bentuk vesikel mirip dengan Cacar Air, bedanya pada HFMD lebih lunak dan lebih cepat pecah. Karenanya para orang tua biasanya menduga Cacar air. Pada lepuhan yang lebih besar, mirip dengan impetigo.(5)

Selanjutnya, keluhan akan berangsur mereda dan sembuh dalam 7-10 hari.(5)

Pada HFMD yang berat (disebabkan EV 17) perlu dirawat di Rumah Sakit. Adapun gejalagejala HFMD berat antara lain: demam tinggi hinga lebih dari 39 Celsius, nadi cepat, frekensi napas cepat dan sesak, terjadinya gangguan neurologis, kejang, serta penurunan kesadaran.(5) Sebelumnya sekitar 50% 90% enterovirus tidak menimbulkan gejala. Sebagian hanya menimbulkan demam yang tak spesifik. Jadi spektrum infeksi virus coxsackie dan enterovirus. Seperti berikut: (5) Tabel 1 : spektrum infeksi virus coxsackie dan enterovirus(6) Asimptomatik 50% - 90% undifferentiated 10% Gejala klasik 10% Gejala berat 10%

1. Undifferentiated - Demam 1 2hari - Meriang atau tidak enak badan - Muncul merah di mulut mungkin tidak ada lalu sembuh

2. Gejala Klasik - Masa inkubasi PTKM 4 6 hari

- Coxsackie virus A 16 adah penyebab utama - Masa demam 1 2 hari enanthem dan eksanthem (90%) - Rasa sakit di tenggorokan 67% - Rasa lelah 61%

3. Gejala berat : - Demam - Sariawan - Rash di tangan dalam bentuk papula vesikuler - Tachycardia - Sianosis - Paru-paru krepitasi - Takipnoe - Distress respirasi Cara penularan HFMD terjadi melalui 3 jalan: (6) 1. Kontak langsung dengan penderita melalui cairan lepuhan yang keluar dari bintik berair dikulit penderita. Selama lepuhan kulit masih mengeluarkan cairan, penderita dapatmenularkan virus kepada orang-orang ( terutama anak ) di sekitarnya. 2. Melalui percikan butiran ludah (droplet) dan pernapasan. 3. Jalur oro-fecal melalui tangan, mainan dan sesuatu yang tercemar oleh faeces penderita kemudian masuk ke dalam mulut. Kita tahu bahwa anak pada umumnya suka memasukkantangan ke dalam mulut saat memegang apapun yang ada di sekitarnya.

Gambar 2 : Gejala klinis yang terlihat di tangan, kaki dan mulut(6) F. DIAGNOSIS ANAMNESIS Penderita akan mengalami demam yang tidak terlalu tinggi sekitar 2 hingga 3 hari yang disertai dengan faringitis. Terjadi ulcus dimulut seperti sariawan terasa nyeri sehingga sulit untuk menelan. Selain itu penderita juga akan mengaku timbul lepuh kemerahan yang kecil dan rata, tidak gatal di telapak tangan dan kaki.(7) PEMERIKSAAN FISIK Pada daerah mulut didapatkan ulcus yang tampak seperti sariawan, biasanya didaerah lidah, gusi ataupun mukosa pipi sebelah dalam. Bersamaan dengan itu timbul ruam atau vesikel, papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang ruam juga didapatkan di bagian bokong.(7) LABORATORIUM Secara umum, tidak diperlukan pemeriksaan laboratorium klinik secara spesifik, karena data umumnya sebagai berikut : (7) - Jumlah leukosit 4000 16.000/L. - Terkadang ditunjukkan suatu limfosit tipe asing.

- Virus dapat diisolasi dari cairan vesikel dan permukaan mukosa, sampel tinja, dibiakkan di atas media virus. - Antibodi khas cepat menghilang dan timbul hanya dalam waktu singkat. Bahan pemeriksaan yang dapat diambil dari tubuh dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak. Spesimen dibawa dengan Hanks Virus Transport. Isolasi virus dencara biakan sel dengan suckling mouse inoculation. Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.(7) Pemeriksaan laboratorium yang diperlukan untuk penelitian klinis. Deteksi Virus Immuno histochemistry (in situ) dengan Imunofluoresensi antibodi (indirek) Isolasi dan identifikasi virus. Pada sel Vero RD, L BUji netralisasi terhadap intersekting pool. sAntisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum. Deteksi RNA, RT-PCR Primer : 5 CTACTTTGGGTGTCCGTGTT 35 GGGAACTTCGATTACCATCC/ Partial DNA sekuensing (PCR Product). Serodiagnosis Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji ELISA sedang dikembangkan. Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.(7) G. TATALAKSANA Pada kondisi penderita dengan kekebalan dan kondisi tubuh cukup baik, biasanya tidak diperlukan pengobatan khusus. Peningkatan kekebalan tubuh penderita dilakukan dengan pemberian konsumsi makanan dan cairan dalam jumlah banyak dan dengan kualitas gizi yang tinggi, serta diberikan tambahan vitamin dan mineral jika perlu. Jika didapati terjadinya gejala superinfeksi akibat bakteri maka diperlukan antibiotika atau diberikan antibiotika dosis rendah sebagai pencegahan.(8) Secara umum, untuk menekan gejala dan rasa sakit akibat timbulnya luka di mulut dan untuk menurunkan panas dan demam, digunakan obat-obatan golongan analgetika dan antipiretika. Dari aspek farmakoterapi, hal penting untuk diperhatikan dalam pengobatan penyakit KTM adalah bahwa beberapa golongan obat dapat menimbulkan sindroma Steven-

Johnson yang menunjukkan gejala mirip dengan penyakit KTM dan dapat memperparah ulser. Golongan obat tersebut adalah : barbiturat, karbamazepin, diflusinal, hidantoin, ibuprofen, penisilin, fenoftalein, fenilbutazon, propranolol, kuinin, salisilat, sulfonamida, sulfonilurea, sulindac, dan tiazida.(8) Antiseptik oral digunakan untuk mencegah terjadinya infeksi akibat jamur atau bakteri. Beberapa golongan antasida dan pelapis mukosa lambung juga digunakan untuk mengatasi ulkus di saluran cerna dan lambung. Berikut adalah daftar obat-obatan yang bisa digunakan untuk mengatasi Penyakit Kaki Tangan dan Mulut secara simptomatik.(8) Medikamentosa 1. Antipiretika : digunakan untuk menurunkan demam, misalnya : asetaminofen. Perlu diperhatikan bahwa penggunaan golongan NSAID (Non Steroidal Anti Inflammatory Drugs) dapat menimbulkan gejala sindrom Stenven-Johnson yang menunjukkan gejala mirip dengan penyakit ini dan dapat memperparah ulser sehingga disarankan untuk digunakan dengan golongan antasida, atau jika ada dipilih golongan antipiretika/analgetika yang lain.(8) 2. Antiseptika : berbagai bentuk sediaan kumur, seperti betadine dan tablet hisap seperti SP troches, FG troches.(8) 3. Antibiotika : lokal atau sistemik, digunakan untuk mencegah atau mengatasi infeksi karena mikroba pada ulser di mulut dan kulit neosporin (lokal), klindamisin dan eritromisin.(8) 4. Bahan anestetika lokal untuk mengurangi rasa sakit di daerah mulut.(8) 5. Antihistamin: Inhibisi antihistamin pada reseptor H1 menyebabkan kontriksi bronkus, sekresi mukosa, kontraksi otot halus, edema, hipotensi, depresi sususan saraf pusat, dan aritmia jantung.(8) 6. Golongan Antasida dan Antiulser digunakan untuk mengatasi gastritis, ulser di mulut dan saluran cerna. Biasanya digunakan untuk kumur, namun jika didiagnosis ada luka di saluran gastrointestinal maka antasida ditelan.(8)

Non medikamentosa: - Virus masih dapat berada di dalam tinja penderita hingga 1 bulan. - Isolasi pasien sebenarnya tidak diperlukan, namun perlu istirahat untuk pemulihan dan pencegahan penularan lebih luas.

- Selalu mencuci tangan dengan benar untuk mengurangi resiko penularan. - Jangan memecah vesikel. - Mencegah kontak dengan cairan mulut dan pernafasan antara penderita dengan anggota keluarga yang lain. - Meningkatkan kekebalan tubuh dengan sebisa mungkin makan makanan bergizi, sayur-sayuran berkuah, jus buah, segera setelah rasa nyeri di mulut berkurang. - Mencegah dehidrasi dengan memasukkan cairan, untuk mengurangi rasa sakit sebisa mungkin cairan yang isotonis dan isohidris (tidak terasa asam/terlalu manis).

H. KOMPLIKASI Meski sangat jarang, dalam keadaan daya tahan tubuh yang sangat rendah atau immunocomprimized dapat terjadi komplikasi yang berbahaya dan mengancam jiwa. Komplikasi yang dapat terjadi adalah Meningitis atau infeksi otak (aseptic meningitis, meningitis serosa/non bakterial) atau Encephalitis ( infeksi otak bulbar ). Komplikasi yang sangat jarang lainnya adalah myocarditis atau gangguan jantung (Coxsackie Virus Carditis) dan gangguan persarafan pericarditiso Paralisis akut flaksid.(8) Infeksi enterovirus juga dapat menyebabkan miokarditis, pneumonia, meningoensefalitis, dan bahkan kematian. Infeksi ini jarang terjadi berulang dalam waktu dekat. Meski secara umum infeksi ini ringan namun, sebuah wabah besar infeksi KTM disebabkan oleh Enterovirus 71 di Taiwan dilaporkan terjadi angka kematian tinggi sekitar 19,3% pada kasus berat. kematian disebabka karena akibat perdarahan paru. Selama wabah ini, angka kematian yang tertinggi pada anak-anak muda dari 3 tahun. Sedangkan kasus infeksi KTM di Singapura pernah dilaporkan telah merenggut 7 korban jiwa, sebagian besar dari pneumonitis interstisial atau ensefalitis batang otak. Infeksi KTM adalah penyakit ringan namun dalam keadaan temuan fisik yang tidak biasa, peningkatan jumlah sel darah putih, dan muntah dan tidak adanya ulkus oral atau luka sariawan di mulut mungkin menandakan pasien dengan risiko tinggi hasil yang dapat berakibat fatal. Dalam salah satu penelitian terhadap wabah infeksi KTM yang disebabkan oleh Enterovirus 71 di Sarawak, Malaysia dilaporkan terdapat 3 faktor risiko klinis untuk membantu mendeteksi anak-anak berisiko untuk komplikasi neurologis. Total durasi demam selama 3 hari

atau lebih, ketinggian puncak suhu lebih besar atau sama dengan 38,5C, dan riwayat kelemahan tubuh secara umum terkait dengan pleositosis cairan serebrospinal.(8) Infeksi KTM bila terkena pada ibu hamil pada trimester pertama dapat mengakibatkan aborsi spontan atau hambatan pertumbuhan dalam kandungan.(8) Beberapa penyakit yang juga disebabkan karena virus sejenis ini adalah: (8) 1. Vesicular stomatitis dengan exanthem (KTM) Cox A 16, EV 71 (Penyakit ini) 2. Vesicular Pharyngitis (Herpangina) EV 703. Acute Lymphonodular Pharyngitis Cox A 10 I. PENCEGAHAN Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Penularan sering terjadi ditempat yang padat seperti sekolah, asrama dan pesantren. Kebersihan dan sanitasi lingkungan dan perorangan harus diperhatikan misalnya kebiasaan mencuci tangan, disinfeksi peralatan makanan, mainan dan handuk. Umumnya pasien tidak perlu untuk diisolasi tetapi hanya perlu menjaga kebersihan perorangan. Namun penyakit ini masih belum dapat dicegah dengan vaksinasi.(8)

BAB III KESIMPULAN Penyakit PKTM adalah penyakit yang disebabkan oleh virus coxsackie A16 dan enterovirus 71. Pencegahan utama yang dilakukan adalah pemutusan rantai penularan penyakit dengan mencegah kontak dari satu penderita ke penderita yang lain. Pengobatan secara simptomatik terutama dilakukan untuk menekan rasa nyeri di mulut, mempercepat penyembuhan ulser di mulut, penekan demam, dan pencegahan infeksi skunder. Golongan obat yang bisa diberikan adalah antipiretik, antasida, antihistamin non steroid, analgetik, dan antiseptik. Di samping itu bisa diberikan vitamin dan mineral tambahan bagi penderita untuk membantu meningkatkan kekebalan tubuh.

DAFTAR PUSTAKA 1. Notes from the Field: Severe Hand, Foot, and Mouth Disease Associated with Coxsackievirus A6 Alabama, Connecticut, California, and Nevada, November 2011 February 2012, access on 30 september 2013, available at

http://www.cdc.gov/mmwr/preview/mmwrhtml/mm6112a5.htm 2. Hand foot and mouth disease, access on 29 september 2013, available at http://www.cdc.gov/hand-foot-mouth/ 3. N. Ilma, Penyakit Taki, Tangan dan Mulut dan Pengobatannya 4. Dedicated to Enhancing The Quality of Child Care, access on 1 september 2013, available on www.ucsfchildcarehealth.org 5. Severe hand, foot and mouth disease killed Cambodian children, access on 29 september 2013, available at http://www.wpro.who.int/emerging_diseases/en/index.html 6. Departemen of Dermatology Univ. Iowa College of Medicine, access on 29 september 2013, available at http://tray.dermatology.uiowa.edu/Coxsack01.html 7. Hand-Foot-and-Mouth Disease (Coxsackie Virus A16), access on 30 september 2013, available at www.ucsfchildcarehealth.org 8. Pengobatan penyakit tangan kaki dan mulut, access on 30 september 2013, available at http://www.news-medical.net/health/treatment-of-hand-foot-and-mouth-disease(Indonesian).aspx

Anda mungkin juga menyukai