INTRODUCTION

Soybean [Glycine max (L.) Merr.] is an important summer crop in Egypt. The
crop has high seed protein content ranged from 30 to 35% and about 29% seed oil
content. The crop area was about 100,000 feddan in 1991, but it has reduced to be
17,000 feddan only in 2006. The crop usually attacks by several leaf-feeding insects,
amongst, cotton leaf worm (Spodoptera littoralis, Boisd) is considering the main leaf
feeding insect. Cotton leaf worm causes extensive defoliation in plant leaves of
susceptible varieties, which affect photosynthesis processes and hence reduce yield.
The farmers still prefer to grow susceptible varieties such as Clark, Giza 82 and Giza
22. Hence, insect infection still exists in soybean fields and insecticides still widely
used.

Advances in biotechnology can facilitate the development of insect-resistant

soybean cultivars by means of gene transformation. Successful use of gene transfer
requires that the gene for insect resistant is identified, isolated and then reconstructed
for expression in relevant organ of the new host. In addition, gene transfer procedures
and appropriate tissue culture methods must be developed for each target species to
regenerate fertile, transgenic plants. The first transgenic plants with resistance to
insects contained genes for insecticidal proteins called 8-endotoxins from the soil
microorganisms, Bacillus thuringiensis (Bt). Bt protected cotton, potato, and corn
were introduced to the market place in 1996. Despite the fact that biotechnology offers
good option for genetic enhancement of crop plants, little in vitro work has been done
in soybean in Egypt. In the first reports of soybean transformation, two different
methods were applied. The first one, was Agrobacterium mediated transformation
cotyledonary nodes, while the second, was partial bombardment of shoot meristems.
Soybean transformation reports following these initial works have been limited and
transformation efficiency for soybean has remained low. Later transformation
efficiency has been improved.

Molecular marker generally refer to assays that allow the detection of sequence
differences between two or different individuals. It contain three level isozymes or
other protein based, DNA based and RNA based. Molecular markers are useful tools
for developing detailed linkage maps of species that previously were very poorly
mapped. These maps have obvious utility for the identification of markers linked to
genes of agronomic or insect resistance importance. Beyond this practical utility,
molecular markers and molecular maps can provide detailed information regarding.
The potential benefits of using markers linked to genes of interest in breeding
programmes have been identified for many decades. Random amplified polymorphic
DNA (RAPD) markers were first described in 1990. The analysis for RAPD markers
is quick and simple, although results are sensitive to laboratory conditions. Restriction
Fragment Length Polymorphisms (RFLPs) are markers detected by treating DNA with
restriction enzymes (enzymes that cut DNA at a specific sequence). RFLPs were the
first molecular markers to be widely used. Their use is, however, time-consuming and
expensive and simpler marker systems have subsequently been developed.

The purposes of this study aimed to:

(1) Describe field performance of 14 soybean genotypes susceptible/

moderate resistance/resistance to cotton leaf worm, and study the
related genetic parameters.
(2) Initiate and maintain callus organogenesis cultures of soybean.
The differences among soybean genotypes in callus formation
were also evaluated.
(3) Performed a system for soybean transformation and regeneration
using immature embryos and cotyledonary nods.
(4) Use of DNA markers in particular to their use in molecular
characterization for genetic improvement of cotton leaf worm in
soybean.

2
 CHAPTER (I)
FIELD PERFORMANCE AND VARIATIONS OF
SOYBEAN GENOTYPES
INTRODUCTION
Soybean [Glycine max (L.) Merr.] is an important summer crop in Egypt. The
crop has high seed protein content ranged from 30 to 35% and about 29% seed oil
content. The crop area was about 100,000 feddan in 1991, but it has declined sharply
during last decade and reached 50,000 feddan in 1998, then reduced to be 30,000
feddan only in 2004. The main reason behind this reduction is the competition from
other summer crops as corn, rice and cotton. In addition, soybean has higher
production cost and lower net return comparing with corn. Another important reason is
the insect infestation. The crop usually attacks by several leaf-feeding insects,
amongst, cotton leaf worm (Spodoptera littoralis, Boisd) is considering the main leaf
feeding insect. Cotton leaf worm causes extensive defoliation in plant leaves of
susceptible varieties, which affect photosynthesis processes and hence reduce yield.
Management of insect control is important in increasing soybean production. Several
cotton leaf worm resistant soybean varieties have been released at Agricultural
Research Center in Egypt.

The inheritance of resistance to cotton leaf worm (Spodoptera littoralis, Boisd) in

soybean, based on the three main criteria; hairiness, leaf area consumed and
defoliation, was studied. High to moderate values of broad sense heritability for the
three characters, with high expected genetic advance from selection for defoliation
were obtained. Study the genetic features of characters related to insect resistance
could help for selection soybean varieties resistant to cotton leaf worm.
The aim of this study was to describe field performance of 14 soybean genotypes,
and study the genetic parameters for their characters. In addition, investigation of
interrelationships among all studied characters with resistant-related characters was
made to facilitate the indirect selection for resistant varieties.

3
 REVIEW OF LITERATURE

Agronomic traits and their Correlations:

Jagdish et al. (2000) evaluated 16 F2s and their 14 parents to assess genetic
variability and selection parameters for seed yield in soybean. Significant differences
among parents and F2s were recorded for all the studied characters. The estimate of
genotypic coefficient of variation and phenotypic coefficient of variation were
comparatively high for biological yield, seed yield/plant, pods/plant and plant height.
All the characters exhibited high estimates of heritability. Seed yield/plant, biological
yield, pods/ plant and plant height showed high heritability with high genetic advance
as a percentage of mean. Significant positive correlation and high magnitude of
correlated response along with relative selection efficiency for biological yield, pods
/plant, seeds/pod and 100-seed weight showed that these are major yield component in
early generation of soybean.

Jain and Ramgiry (2000) studied field investigation of 56 soybean genotypes

which showed significant variation for all 12 yield components. High phenotypic and
genotypic coefficient of variability were recorded for seed yield/plant, followed by
plant weight, plant height and moderate coefficient of variability for 100-seed weight,
No. of seed/pod, pod bearing nodes and days to flowering. High heritability estimates
accompanied by high genetic advance as a percentage of mean were noticed for seed
yield, plant height and pods/plant. These traits were found major yield contributing
traits in soybean.

Kulvir et al. (2000) studied the relationships among soybean traits. The results
indicated positive correlation of No. of pods/plant, grains/pod and harvest index with
seed yield. Straw yield was positively correlated to pod bearing, branches/plant and
biological yield. Biological yield was positively correlated to 100-seed weight, pod
bearing branches/ plant but was negatively correlated with harvest index. Plant height,
dry matter and leaf area were positively correlated to biological and straw yields but
negatively correlated to No. of seed yield. Harvest index showed negative correlation
with almost all the characters under study except grains/pod.

Suh-Sugkee et al. (2000) reported soybean (Glycine max) cultivars with

smaller leaf area and lanceolate leaf shape have shown better light distribution through
their canopy and a higher photosynthetic rate than those with larger leaf area and oval
leaf shape. However, very little information has been published about leaf
characteristics in relation to yield potential and inheritance, which would assist
breeding efforts to develop new cultivars with optimum leaf area and leaf shape. Gene
action and heritability for leaf area, leaf shape and other reproductive characteristics
were studied in a diallel cross involving nine parents with large, medium and small
leaf area. Most progenies from crosses among parents with different leaf areas had
larger mean leaf area, longer flowering and later maturity than the parents, suggesting
transgressive segregation for these traits. General combining ability (GCA) and
specific combining ability (SCA) for leaf area and leaf shape were significant. Ratios
of GCA to SCA were 0.96 for leaf shape and 0.89 for leaf area, indicating that GCA
effects were more important than SCA effects. Genetic gain for leaf area and shape
may be possible via selection. Narrow-sense heritability estimated on the basis of

4
variance components was 43.4% for leaf area, 63.2% for leaf shape, and 29.1% for
maturity, which were lower than values for days to flowering and flowering period
due to large error variances (sigma superscript 2E) caused by field environmental
factors.

Ayub-Khan et al. (2000) estimated heritability and simple correlation among

yield determining components in 86 diverse maturity genotypes of soybean in
Pakistan. The heritability value ranged from 29.37% for No. of seeds/pod to 98.98%
for maturity. Seed yield were positively and significantly correlated with all characters
except pod height. Path coefficient analysis revealed that No. of pods/plant had the
direct effect on seed yield followed by 100 seed weight. The No. of Pods/plant
affected seed yield negatively via indirect effects of plant height, pod height and
seeds/pod.

Raut et al. (2001) evaluated 30 genotypes of soybean, sown in India, for

correlation and path coefficient analyses. Data were recorded for 10 characters, i.e.
days to 50% flowering, days to maturity, plant height, number of branches/plant,
number of clusters/ plant, number of pods/ plant, 100-seed weight, oil content, harvest
index and seed yield/ plant. Seed yield showed positive significant association with
number of clusters/plant, number of pods/plant, 100-seed weight, oil content and
harvest index, both at genotypic and phenotypic levels. Path analysis indicated that
100-seed weight exhibited the maximum positive direct effect on seed yield, followed
by number of clusters/plant, days to maturity and number of pods/plant.

Sudaric et al. (2002) estimated the efficiency and reliability of soybean yield
components as selection criteria for grain yield and to evaluate the agronomic value of
14 domestic cultivars (from maturity groups 0 to II) as potential parents for further
genetic improvement of grain yield. Mean values, coefficient of variation and broad-
sense heritability were calculated for grain yield and the following yield components:
plant height (cm), numbers of fertile nodes, pods and seeds/plant, seed weight/ plant
(g), harvest index (%) and 1000-seed weight (g). Path-coefficient analysis was used to
determine the contribution of the yield components to total grain yield. Seed weight
and number of seeds/plant had the lowest variability, the highest heritability and the
highest positive direct effect on grain yield. Among the tested cultivars, Ika had the
highest mean for both yield components. The obtained results suggested that the
indirect selection for higher soybean grain yield using seed weight and number of
seeds/ plant was more efficient and more reliable than selection using the other yield
components. Among the tested cultivars, Ika appeared to be the most suitable as a
parent in future hybridizations to achieve further genetic advance in soybean grain
yield.

Antarlina et al. (2002) investigated the physical, chemical and processing

characteristics of 14 Indonesian soybean cultivars. The 100-grain weight of Indonesian
cultivars ranged from 6.1 to 15.9 g, with a mean of 10.6+or-2.8 g (mean + or-SD). The
100 grain weights of two soybean genotypes imported from USA were 15.8 and 14.8
g. The Indonesian soybean samples contained 42.0+or-1.4% proteins and 18.6+or-
1.2% lipids (on dry matter bases), while the imported samples contained 36.8 and
36.0% proteins and 21.7 and 21.4% lipids.

Chettri et al. (2003) evaluated 18 elite soybean genotypes for correlation of

agronomic traits in India. Results showed that grain yield was significantly correlated
with days to maturity and number of grains/pod at the genotypic level. Days to

5
maturity and number of grains/pod were also correlated. Days to maturity was
significantly correlated with plant height and days to 50% flowering at the phenotypic
and genotypic levels. The number of days to 50% flowering was positively and
significantly correlated with days to 50% flowering but negatively with number of
pods/plant and 100-grain weight at the genotypic level. The 100-grain weight did not
show any correlation with grain yield. Path coefficient estimates showed that the
number of grains/pod, days to maturity, number of pods/plant and plant height
positively affected grain yield.

Bangar et al.(2003) studied the correlation among component characters and

yield of 16 soybean genotypes. The values of phenotypic coefficient of variation
(PCV) were higher than genotypic coefficient of variation (GCV). The GCV and PCV
estimates were highest for branch number/plant and plant height among the characters.
The GCV and PCV were of moderate magnitude for the pod number /plant, 100-seed
weight (g) and seed yield/ plant (g). Days to 50% flowering and days to maturity had
very low GCV and PCV estimates. The differences between GCV and PCV
magnitudes were very high for 100-seed weight (12.94) and pod number/plant (10.30).
Among the characters, days to maturity (97.80%), branch number/plant (91.39%) and
plant height (60.82%) showed the highest magnitude of heritability. Genetic advance
was high for branch number/plant, plant height and seed yield. The regression of seed
yield on seed weight, plant height and pod number/plant was positive and highly
significant. However, the regression coefficients of branch number/plant were
negative. Correlation coefficients indicated that the seed was positively and
significantly correlated with 100-seed weight and followed by days to maturity, plant
height and days to 50% flowering. Days to maturity, plant height, pod number/ plant
and 100-seed weight among themselves were positively significant.

Alghamdi (2004) evaluated 5 soybean genotypes (Giza 35, Crawford, Giza 82,
Clark and Giza 111) in six sowing dates (25th of February, March, April, May, June
and July) in Saudi Arabia. The response of seed weight and seed yield varied from
genotype to another across different environmental conditions. Giza 111 and Clark
had high mean performance and phenotypic stability and they could be grown over a
wide range of environments. Giza 111 and Clark had the highest, while Giza 82 and
Giza 35 had the lowest, mean values over all environments and poorly adapted. The
results suggested that to maximize seed yield potential, genotypes which have a
consistently high yield performance across diverse growing environments should be
selected, and more than one year of evaluation.

Mukhekar et al. (2004) path analysis and correlation studies were carried out
using 65 genotypes of soybean. Seed yield was significantly and positively associated
with the number of pods/ plant, days to 50% flowering, mean internodal length, plant
height, days to maturity and the number of branches/ plant. Pod length had significant
and negative correlation with the seed yield. Pods/ plant had the highest direct as well
as final contribution to the seed yield and can be considered as most reliable yield
indicator in soybean.

Sudaric et al. (2004) conducted to evaluate genetic advance in yield

components, grain yield and grain quality of soybean throughout analysis of
agronomic values of new domestic elite breeding soybean lines in comparison with
commercial cultivars. The reliability of the grain quantity traits as selection criteria in
soybean breeding on grain yield was also determined. The investigations were carried
out in Osijek, Croatia, from 2001 to 2003 and involved 31 domestic soybean

6
genotypes. Mean values, broad-sense heritability, genetic gain and relative genetic
gain from selection were calculated for grain yield components, grain yield, protein
and oil content in grain. The results of quantitative genetic analysis indicated progress
through breeding in grain quantity and quality traits that will contribute to further
improving and increasing soybean production in the region. Likewise, recent breeding
materials represent good genetic basis for future hybridizations aimed at advancing the
quantity and quality of grain yield in soybean genetically. Grain yield components
were determined as more reliable criteria for selection of superior genotypes than
grain yield/se due to higher heritability (61.87-82.31%) and better progress in
selection (10.63-22.78%). Grain quality traits had medium heritability (60.04-65.89%)
and better progress in selection (6.95-8.94%) compared to grain yield that had less
heritability (29.87%), and the relative genetic gain from selection was 0.43%.

Mello et al. (2004) evaluated the effects of selection for high protein on seed
physiological quality and grain yield of soybean in Brazil. Four populations of BC1F4
and 4 of F4, each from a cross between a commercial variety and a line bearing high
protein seeds were used. The high protein content selection has a tendency to affect
negatively the seed physiological quality. Estimates of correlation coefficients
between protein content and grain yield were mostly negative but varied among
populations. It is possible to obtain lines with high protein content, keeping the grain
yield and the seed physiological quality of their respective recurrent progenitors.

Turkec (2005) estimated the relationships between seed yield and some yield
components as well as the direct and indirect effects of these characters on seed yield
in soybean. Seed yield was significantly and positively correlated with pods/ plant and
with branches/plant. The highest positive correlation was found between seed yield
and pods/plant. Path coefficient analysis indicated that pods/ plant expressed the
highest positive direct effect, followed by 100-seed weight, on seed yield.

Jyoti and Tyagi (2005) evaluated 31 soybean genotypes in India. The

parameters studied included: days to 50% flowering, plant height, number of primary
branches/plant, pod length, pod width, days to maturity, biological yield, 100-seed
weight, seed yield/plant and harvest index. Results showed high genetic coefficient of
variation and heritability along with high genetic gain for the following traits:
biological yield/plant, 100-seed weight and plant height. These traits also showed
significant and positive association with seed yield/plant. Biological yield/plant
showed high and direct positive effect on seed yield.

Oh et al. (2005) released a new soybean cultivar Bosug in Korea. Bosug has a
semi determinate growth habit, purple flower, grayish brown pubescence, brown
hilum, and rhomboidal leaflet shape. The maturity date of Bosug is 4 days earlier than
the control cultivar, Pungsan. It has a good seed quality and high isoflavone
(3.891micro g/g) and amino acid contents (396 mg/g) for soybean sprout. It has a 100-
seed weight of 8.6 g and exhibits resistance to lodging and soybean mosaic virus. The
average yield of Bosug was 2.62 t/ha the old cultivated.

Liu et al. (2005) investigated the dynamics of dry matter accumulation, Leaf
area index (LAI) and, leaf area duration (LAD) during the reproductive period for the
high-yielding 16 genotypes. Majority of the seed yield and components were
positioned in the middle and upper part of the plant. Both pod number and seed
number were higher in high-yield genotypes in each group. Higher accumulation of
dry matter, higher LAI and LAD during reproductive stages were found to be closely

7
related to high-yield genotypes in each group. No relationship was found between
harvest index (HI) and seed yield.

Cotton leaf worm (Spodoptera littorallis):

El-Dakroury (1979) carried out laboratory tests on the development of

Spodoptera littoralis (Boisd.) on two Egyptian cotton strains, Bahtim-110 (free of
gossypol) and Bahtim-101 (hairy) and two wild species, G. klotzschanum and G.
thurberi, while, the Egyptian variety Menoufi was used for comparison. He found that
the highest larval mortality, the longest larval period, the lowest percentage of
pupation and emergence, highest Pupal weight, the lowest number of eggs and
hatchability were recorded when the newly hatched larvae of the cotton leaf worm
were reared on the leaves of Bahtim-101 and G. klotzschanum. In contrast, the best
overall results were obtained when the larvae were reared on Bahtim-101, where most
of larvae reached the pupal stage early and gave the heaviest pupae resulting in moths
which deposited the highest average number of eggs and the best hatchability. He
suggested that this result may be due to Bahtim-101 which is free of gossypol, and its
leaves are soft and contain the highest amount of protein. On the other hand, Bahtim-
101 and G. klotzschanum are more hairy especially on the lower surface of the leaf. It
was found that significantly negative correlation exists between the larvae which
reached the Pupal stage and the average number of hairs/cm2 (-0.97).

Nassib et al. (1985) described the major production constraints. Irrigated

soybean in Egypt the main constraints are, nodulation and N fixation, stand
establishment, and research/extension work on varietal improvement are discussed.
Problems with Spodoptera littoralis, Tetranychus telarius [T. urticae] and Etiella
zinckenella are considered.

Khalil (1988) the major constraints faced by Egyptian soybean producers are
germination/emergence problems largely as a result of soil capping, non-adoption of
seed inoculation despite lack of Rhizobium japonicum in Egyptian soils and lack of
resistance to leaf-feeding insects, e.g. cotton leaf worm (Spodoptera littoralis), in early
maturing cv. Changes taking place during seed development and maturation and
factors affecting seed quality such as field environment, seed-borne diseases and
cultural practices are discussed.

Croxford et al. (1989) studied leaves of soybean and cotton mechanically

damaged with a single hole and offered to larvae of the noctuid Spodoptera littoralis
in laboratory bioassays at intervals of between 0 and 7 days after injury. The
subsequent within-leaf grazing patterns of damage and undamaged areas were
compared using an image-analysing computer, and estimations were made by eye of
percentage areas grazed at 3 spatial scales. Reduction in palatability of damaged areas
of both plant species was detected at time intervals ranging from 0 to 7 days after
injury. This effect was strongest for the longer time intervals and the effect became
weaker with increasing distance from the site of damage.

Afifi (1990) conducted field studies in Egypt during 1986 and 1987 to
determine the relative distribution of egg-masses and larvae of Spodoptera littoralis in
soybean fields. On average, 95.5% of egg masses were laid on the lower surface of
leaves with 4.5% laid on the upper surface. The larval population consisted of 1st- and

8
2nd-instar larvae (59-62%), 3rd- and 4th-instar larvae (27-28%) and 5th- and 6th-
instar larvae (12-15%).

Awadallah et al. (1990) tested soybean genotypes in the laboratory for their
resistance to Spodoptera littoralis. Plants descended from the hybrid H2 were the most
resistant. The cultivar Celest was resistant and the cultivar Crawford was of
intermediate resistance. Other hybrids were less resistant.

Rizk et al. (1991a) collected eggs of Spodoptera littoralis from the field in
Egypt and reared for 3 generations in the laboratory on soybean, cotton, grapes or
sweet potato. The esterase activity in individuals from each of the colonies was
investigated and compared to that of a laboratory strain. The most specific esterase
activity was recorded in the tissues of larvae reared on soybean and the least in the
laboratory strain, followed by those reared on sweet potato. The larvae reared on sweet
potato were the most susceptible of the non-laboratory strains to deltamethrin,
alphamethrin [alpha-cypermethrin], cypermethrin, flucythrinate and cyhalothri]n.

Rizk et al. (1991b) investigated the effect of food plants on the biology and
susceptibility to insecticides (deltamethrin, cypermethrin, alphamethrin [alpha-
cypermethrin], flucythrinate and cyhalothrin) of Spodoptera littoralis in the
laboratory. Larvae were reared on cotton, soybean, grapes and sweet potato for 3
generations. The different food plants affected the development periods, pupation,
emergence, number of eggs laid and longevity of the insect. Larvae reared on sweet
potato were the most susceptible to the synthetic pyrethroids.

Salama et al. (1995) in a study carried out in Egypt, an area of 50 feddans [1

feddan = 0.42 ha] cultivated with soybean was treated with Bacillus thuringiensis
(B.t.) baits against Agrotis ypsilon [A. ipsilon] and 70 feddans were sprayed with B.t.
spray against Spodoptera littoralis. When B.T. baits were used, the percentage
mortality of A. ypsilon reached 96.1-96.4 compared with 97.4-98.0 when using
Hostathion [triazophos] baits. When B.T. was applied to larvae of S. littoralis, 88.3%
mortality was obtained. This increased to 97.3% after a second application. On the
other hand, percentage mortality reached 96.8 when Lannate [methomyl] was applied
once. The average yield was 1.54 t/feddan when B.T. was applied twice against S.
littoralis and 1.42 t/feddan when B.T. was applied once. Areas treated with methomyl
gave yields of 1.44 t/feddan, while in the untreated area; the yield was comparatively
low at 0.83 t/Fadden.

Ojo and Ariyo (1999) studied Inheritance of resistance to defoliation in

soybean (Glycine max) caused by a noctuid moth Spodoptera littoralis in a cross
between a susceptible cultivar TGx 526-02D from IITA and a plant introduction PI
171444. Seeds were planted in pots in the screen house and on establishment of insect
cultures, fully matured leaves of the parent plants, the F1, F2 and F3 generations were
fed to the third stage larvae without restriction. Larvae mortality was observed daily
and weight gains were recorded at the prepupal stage. Pupal weight and length of
pupal period were also recorded. Mortality level was high among larvae fed on the
leaves of PI 171444. Gain in body weight was significantly smaller in larvae that fed
on the leaves of PI 171444 than those on TGx 526-02D. All larvae that fed on the
leaves of the susceptible parent survived to their pupal stage and produced normal
adult insects. The mean weight gain of larvae that fed on F1 plants was intermediate
between those of the parents suggesting an incomplete dominance gene action. F3 and
F2 populations showed a considerably wider distribution of larval weight gains

9
compared with F1. Significant difference between the mean weight gain of larvae that
fed on leaves of F1 and F2 was also observed. There was no significant difference
between the mean weight gain of larvae that fed on the leaves of F1 and F3
populations. Chi superscript 2 analysis of F2 and F3 populations gave a good fit to the
1 resistant: 2 segregating: 1 susceptible ratio expected for incomplete dominance at a
single locus. Broad-sense heritability estimates of 46.80 and 58.44% for F2 and F3
populations, respectively, showed that resistance to defoliation in soybean, as
indicated by larval weight gain, is reasonably heritable.

Sun and Gai (1999) studied the resistance of 6 soybean varieties (the resistant
varieties Wujiangqingdou-3, Tongshanbopihuangdoujia and Gantai-2-2, and the
susceptible varieties Wan82-178, Shandongdadou and Morsoy) to Prodenia litura
[Spodoptera litura] under laboratory conditions. There were significant differences
between the levels of leaf consumption, but not of Oviposition antixenosis, of S. litura
on the resistant and susceptible varieties. Following feeding of S. litura larvae on
resistant varieties, larval leaf consumption, and larval and pupal body weight
decreased, while mortality and the duration of development of larvae alone increased.
On the basis of these results, it is concluded that the resistance of soybean to P. litura
is mainly antibiotic.

Mizutani et al. (2001) selected Kyukei 279 is a soybean [Glycine max]

breeding line that detected through laboratory tests to be resistant to the common
cutworm, S. litura. The field densities of S. litura larvae and three major species of
stink bugs (Riptortus clavatus, Piezodorus hybneri and Megacopta punctatissimum)
attacking soybeans were compared among Kyukei 279 and two other soybean
cultivars (Soudendaizu, resistant to S. litura; Fukuyutaka, susceptible) [date and
location not given]. Kyukei 279 was intermediately resistant to S. litura in the field,
because the density of S. litura larvae on it was apparently lower than that on
Fukuyutaka and larger than that on Soudendaizu. The abundance of stink bugs on the
three soybean lines depended on the species of bug, and no line was notably freer of
bugs. However, percentages of soybean injured mainly by soybean stink bugs were
significantly lower in Kyukei 279 and Soudendaizu than in Fukuyutaka. In addition,
yields of Kyukei 279 and Soudendaizu were much higher than that of Fukuyutaka,
Thus, Kyukei 279 was considered to have tolerance to soybean stink bugs.

10
 MATRIALS AND METHODS
Fourteen exotic and Egyptian soybean genotypes [Glycine max (L.) Merr.]
selected from the germplasm collection of Soybean Breeding Program at ARC were used
in this study. The genotypes included resistant and susceptible genotypes as indicated in
Table (1). Two experiments were carried out at Giza research station, ARC, at Giza
Governorate in the two successive summer seasons 2003 and 2004. Planting take place
on 25 may in both seasons. In each experiment a randomized complete block design,
with 3 replicates and 7.2m2 plot size (4 ridges, 3 m long and 0.60 m wide, with

Table 1: Origin, pedigree and main characteristics of 14 tested soybean genotypes.

Name Origin Pedigree Maturity Resistance to Flower
groups no. leaf cotton color
warm*
Calland USA CL 253 (Blackhawk Harsoy x Kent) IV MS purple
Clark USA Lincoln (2) x Richland IV MS purple
Corsoy-79 USA Corsoy x Lee 68 II S white
Crawford USA - III S purple
Forrest USA Dyer X Bragg V MR white
Giza 21 Egypt Crawford x Celeste IV R purple
Giza 22 Egypt Crawford x Forrest III R purple
Giza 35 Egypt Crowford x Celect III R purple
Giza 82 Egypt Crowford x Maplebrasto II R purple
Giza 83 Egypt Crowford x Celect III R white
Giza 111 Egypt Crowford x Celect IV R purple
Hutcheson USA - VI S purple
Lakoto USA USA Selection from MBB80- 133 II S purple
L86K-73 L73-4673 X L73-0132 I R white
* R: resistant, S: susceptible, MS: moderately susceptible.

33 plants /m2) was used. Fertilizer, irrigation and all agronomic practices were applied as
recommended.
In all experimental plots the following characters were recorded on 10 randomly
selected competitive plants: plant height (cm), number of branches/plant, first pod height
(cm), number of pods/plant, number of seeds/plant and seed yield/plant. The following
characters: days to 50% flowering, days to 90% maturity, maturity period (days to 90%
maturity - days to 50% flowering) and 100-seed weight were recorded on the plot basis.
At harvest, soybean plants in the central 3 m2 in each experimental plot were pulled by
hand (the remaining plot area was discarded to avoid border effect), placed in cotton
sacks, air dried, weighed, then threshed by hand and clean seeds weighed. Seed protein
content was estimated by using the micro Kjhldahl method, where total protein was
determined as total nitrogen in the seed. Percentage of seed protein content was
calculated by multiplying the total sample-nitrogen by 6.25 according to the method of
A.O.A.C., 1990). The total seed-oil (lipids) content was estimated by the method
described in A.O.A.C. (1990), and then the percentage of seed oil content was calculated.
Evaluation of the tested genotypes for their resistance to leaf cotton warm infection
was made in both under field conditions and under laboratory conditions. In the field
experiments under natural insect infection, the evaluation was done using a visual rating
scale as a percent of leaf defoliation levels suggested by Smith and Brim (1979) and
applied in soybean at ARC in Egypt by Habeeb (1988) and Lutfallah et al. (1998). In
this scale, the average of three readings/each plant in every experimental plot (every 7
days) started at two weeks after flowering were recorded. The following levels of leaflet
area consumed by insect were used: (1) 1-10% (resistant); (2) 11-20%; (3) 21-30%
(intermediate); (4) 31-40%; (5) 41-50% (susceptible) and (6) >50% (highly susceptible).
In laboratory evaluation, a survival technique was used (Meisner and Moshe, 1983).

11
In this experiment 10 young larvae (1-8 days old) were placed in a Petry dish and
allowed to feed on fresh soybean leaflets collected from the upper third of a plant taken
randomly from each field experimental plot in each replicate. Other experiment was also
made using similar procedures but with adult larvae (9-17 days old). The first laboratory
experiment called survival 1 and the second laboratory experiment called survival 2. In
both experiments, number of survival and died larvae was counted after 3 days, and
percentage of survival number of larvae was estimated. The large number of survival
indicated high susceptibility to the insect infection.
The analysis of variance of field experiments was made for each season separately,
and then a combined analysis of variance was performed for the two seasons (Gomez
and Gomez, 1984). For laboratory experiments, the analysis of variance was made for
each of experiment (survival 1 and survival 2) separately. Simple correlation
coefficients among all studied characters were performed. The variance components
and coefficients of variation were estimated by the formulae suggested by Burton
(1952). The broad sense heritability and genetic advance were estimated using the
formulae suggested by Allard (1960).

12
 RESULTS AND DISCUSSION
The single analysis of variance for each season showed that significant differences
among genotypes were existed for all studied characters. The combined analysis of
variance indicated significant differences among genotypes for all characters, while
the season had significant effects on plant height, no. of pods/plant, no. of seeds/plant,
seed yield/plant and harvest index. The genotype x season interaction effect was
significant in days to 50% flowering, days to 90% maturity, maturity period, plant
height, seed yield/plant and 100-seed weight.

Seasonal effects:
The data showed that number of pods/plant, no. of seeds/plant, seed yield/plant
and harvest index had higher values in the first season than in the second season
(Table 4 and 5). For example, seed yield/plant increased from 67.14 g in the second
season to 71.82 g in the first season. These data reveal that the growth conditions at
Giza were more favorable in the first season than in the second season. The average
maximum and minimum air temperatures in the first season (May-October) were
33.85 and 19.88 oC respectively, while the corresponding temperatures in the second
season were slightly warmer and recorded 33.93 and 20.96oC. Moreover, the soil
temperature during the same period was relatively cool in the first season (24.7 oC)
comparing with the second season (30.6oC). It seems that the temperature in the first
season was more favorable for soybean growth and hence increased the yield and yield
components. The importance of seasonal conditions on various plant characters was
reported previously by Hamdi et al. (1991) in lentil.

Performance of genotypes:
Phenological characters:
The performance of genotypes for phenological characters (days to flowering,
days to maturity and maturity period) and morphological characters (plant height, first
pod height and no. of branches/plant in 2003 and 2004 seasons are presented in Tables
(2 and 3). The average days to 50% flowering for all genotypes were 36.98 and 37.27
days with ranges of 31.49 and 31-48.7, in the first and the second seasons, respectively
(Table 2 and 3). Similar trend was observed for days to maturity and maturity period,
where most genotypes were matured earlier in the first season than in the second
season. The earliest genotypes in flowering, maturity and maturity period were L86K-
73 and Giza 82. These genotypes could be exploited as a source of earliness in
soybean breeding program. Most early-flowered genotypes were also earlier in
maturity and had also short duration in maturity. It seems that there are strong
relations between these three characters as confirmed by the highly significant
correlation between them. The correlation coefficient between time to flowering and
maturity is (r = 0.913**), between flowering and maturity period is (r = 0.782**) and
between days to maturity and maturity period is (r = 0.968**), (Table, 8).

Morphological characters:
Plant height exhibited wide ranges of 61- 89 cm in the first season and 63 –
89.31cm in the second season, with averages of 67.29 and 72.19 cm, in both seasons
respectively (Tables, 2 and 3). The tallest genotypes were Giza 111 (89 cm) in the first
season and Lakota (89.31 cm) and Calland (89.10 cm) in the second season. If not
subjected to lodging, tall plants are preferred, since they have more bud bearing nodes
with the potential for higher seed yield and are also suitable for mechanical harvesting.
The average plant height obtained in the present study is within the range of those
found by Zayed (1998) in Egypt. Number of branches/plant ranged from 1.33 to 4.00
and from 1.70 to 3.50 in the first and the second seasons, respectively. In previous
13
studies, the range of number of branches/plant was 3.71 – 10.25 (Habeeb, 1988). The
genotype Lakota had low first pod height, reflecting more bud bearing nodes than
other genotypes.

Seed yield and yield component characters:

The overall means of seed yield/plant were 71.82 and 67.14 g in the first and the
second seasons, respectively, with ranges of 40.19 - 96.75 and 26.80 – 94.90 g/plant in
corresponding seasons, respectively. The genotype Giza 111 gave significantly higher
seed yield than Crawford (Tables 4 and 5). In 2003 and 2004 its seed yield/plant was
96.75 and 94.90 g, respectively, that out yielded the check variety Crawford by 6.6
and 91.3%. This genotype can be exploited in soybean breeding program. Giza 111
also showed the highest no. of seeds/plant in both seasons, and ranked the fourth
highest genotype in biological yield/plant and the third highest in harvest index
(Tables 4 and 5). The range of numbers of pods and seeds/plant obtained in this study
were similar to those reported by Zayed (1998).

Degree of resistant for soybean genotypes and related characters:

The results of the evaluation of the genotypes for their resistance to leaf cotton
warm infection under field and laboratory conditions, in addition to seed oil and
protein contents, leaf area, and number of leaf-hairs are presented in Table (6). Narrow
range (22.35 – 26.10%) of seed oil content was found, while wide range of seed
protein (22.70 – 57.93%) was obtained in this study. The average leaf area was ranged
from 18.12 cm2 for L86K-73 to 70.24 cm2 for Giza 21, with an average of 48.27 cm2.
The number of leaf-hairs was showed the widest range (41for Calland to 173.33 hairs
for Giza 83) among these characters. To determine the relations among these
characters, correlation coefficients were made among them. No significant differences
have been found among seed oil and protein contents, at one side, and survival (1) and
(2) on the other side. High significant and negative correlation was observed between
number of leaf-hairs and survival (1) and (2). The correlation coefficients among leaf-
hairs and survival (1) and (2) were r = -0.678** and -0.630**, respectively, indicating
that dense leaf-hairs is related with high resistant level. Similar finding was reported
by El-Dakroury (1979) in cotton. The strong positive correlation between survival 1
and 2 (r = 0.891**) obtained indicated that one test only, either in young or adult stage
of leaf-worm would be enough for screening.
Genetic parameters of the studied characters:
Estimates of phenotypic, genotypic variances, heritability and genetic advance for
most studied characters are presented in Table (7). The highest magnitude of
phenotypic variance was observed for biological yield/plant, number of leaf-hairs and
leaf area, indicating the possibility for selection for these traits. High heritability
estimates were found also in these characters in addition to seed yield/plant, which
ranged from 97.99 - 99.80%. The expected genetic advance was high for leaf area
(61.88%), seeds/plant (56.94%) and harvest index (30.93%). Johanson et al. (1955)
stated that heritability estimates together with genetic advance are more important than
heritability alone to predict the resulting effect of selecting the best individuals.
Therefore, pronounced progress should be expected from selection between genotypes
for seeds/plant, harvest index and leaf area. However, since number of hairs had high
estimates of heritability and P.C.V value, selection for this character would be useful
as indirect selection for insect resistant.

14
Table 2: Average of phenological and morphological characters for 14 soybean
genotypes evaluated under field conditions at Giza research station in 2003
season.
Days to Days to Maturity Plant height 1st Pod Number
Genotypes flowering maturity period (cm) height of branches
(day) (cm)
L86K-73 31.00 97.00 66.00 61.00 6.00 1.33
Corsay-79 34.00 114.00 80.00 64.00 5.00 2.00
Giza21 37.00 122.00 85.00 70.00 6.00 3.33
Forrest 48.00 135.00 87.00 66.00 7.00 4.00
Hutcheson 49.00 138.00 89.00 `67.00 7.00 2.70
Calland 39.00 123.00 84.00 69.00 7.00 2.00
Lakota 32.33 98.00 66.00 68.00 5.00 2.70
Giza111 39.00 117.00 79.00 89.00 6.33 2.70
Giza83 33. 00 108. 00 75.00 69.00 6.00 3.00
Clark 38.00 122.00 84.00 66.00 5.33 3.33
Giza22 38.00 111.00 72.00 71.00 6.00 3.00
Giza35 34.00 107.00 73.00 69.00 6.00 3.00
Giza82 31.00 98.00 67.00 67.00 7.00 2.00
Crawford 38.00 120.00 82.00 72.00 5.00 3.33
Average 36.98 113.74 76.71 67.29 5.98 2.69
L.S.D.5% 1.820 2.381 2.309 1.728 1.317 1.191

Table 3: Average of phenological and morphological characters for 14 soybean

genotypes evaluated under field conditions at Giza research station in 2004
season.
Days to Days to Maturity Plant 1st Pod Number
Genotypes flowering maturity period height height of branches
(day) (cm) (cm)
L86K-73 31.00 90.00 59.00 63.41 4.50 2.19
Corsay-79 35.00 116.00 81.00 66.25 5.10 1.70
Giza21 36.70 122.00 85.00 71.81 5.50 2.61
Forrest 46.00 133.00 87.00 63.97 6.05 3.03
Hutcheson 48.70 137.00 88.00 63.00 5.20 3.50
Calland 39.00 122.00 83.00 89.10 5.64 2.54
Lakota 33.70 98.00 64.33 89.31 4.70 2.64
Giza111 38.33 116.00 77.70 86.50 6.13 2.90
Giza83 33. 00 107. 00 74.00 68.25 4.50 2.80
Clark 38.70 121.00 82.33 68.83 4.19 2.90
Giza22 37.00 110.00 72.00 71.13 6.10 3.22
Giza35 34.00 109.00 75.00 69.98 5.54 2.90
Giza82 33.70 98.00 64.33 70.03 6.74 3.10
Crawford 37.00 119.00 82.00 68.66 4.28 3.40
Average 37.27 114.14 76.81 72.19 5.29 2.81
L.S.D.5% 1.395 1.662 1.852 4.84 0.898 0.794

15
Table 4: yield component characters for 14 soybean genotypes evaluated under
field conditions at Giza research station in 2003 season.
Genotype No. of No. of No. of 100- seed Seed yield/ Biological Harvest
Seeds/ Pods/ Seed/ weight Plant Yield/plant index
Plant Plant Pod (g) (g) (g) (%)
L86K-73 306.00 183.00 1.70 13.13 40.19 103.433 38.91
Corsay-79 325.00 201.00 1.63 14.80 48.10 116.300 41.35
Giza21 440.00 247.00 1.80 15.23 67.01 136.83 48.97
Forrest 612.00 269.00 2.30 14.90 91.16 317.400 28.72
Hutcheson 600.00 264.00 2.30 15.10 90.67 310.400 29.20
Calland 588.00 252.00 1.90 15.70 92.40 300.30 30.77
Lakota 335.00 200.00 2.20 15.20 50.92 120.700 42.19
Giza111 590.00 241.00 2.23 16.40 96.75 253.20 38.12
Giza83 490.00 238.00 1.83 16.30 80.62 222.97 36.16
Clark 480.00 273.00 1.93 14.60 70.10 205.57 34.10
Giza22 430.00 212.00 1.87 16.00 68.79 203.57 34.07
Giza35 420.00 245.00 1.73 16.10 67.62 201.27 33.60
Giza82 325.00 180.00 1.80 15.50 50.40 125.40 40.17
Crawford 560.00 220.00 2.60 16.20 90.73 193.33 46.95
Average 464.38 230.36 1.98 15.37 71.82 200.76 37.38
L.S.D.5% 16.30 3.10 0.313 0.209 2.70 4.95 1.003

Table 5: yield component characters for 14 soybean genotypes evaluated under

field conditions at Giza research station in 2004 season.
Genotype No. of No. of No. of 100- seed Seed yield/ Biological Harvest
Seeds/ Pods/ Seed/ weight Plant Yield/plant index
Plant Plant Pod (g) (g) (g) (%)

L86K-73 201.40 131.70 1.50 13.00 26.80 104.00 25.54

Corsay-79 305.70 192.33 1.60 15.50 47.10 117.33 40.29
Giza21 373.90 227.33 1.63 18.80 61.65 137.70 44.81
Forrest 545.05 253.33 2.13 15.83 85.90 318.70 27.02
Hutcheson 536.27 245.70 2.20 15.77 84.38 310.70 27.16
Calland 502.90 232.00 2.13 17.06 85.20 303.33 28.18
Lakota 297.20 186.00 1.60 16.00 47.40 124.33 38.22
Giza111 545.20 231.33 2.40 17.50 94.90 252.00 37.70
Giza83 426.40 221.33 1.93 17.70 75.00 211.70 35.45
Clark 409.70 251.33 1.63 15.90 64.52 205.33 31.56
Giza22 377.80 203.33 1.93 1750 65.98 204.70 32.25
Giza35 378.00 231.70 1.60 17.01 64.10 205.33 31.190
Giza82 291.430 170.00 1.70 16.40 47.60 127.63 37.270
Crawford 548.00 217.33 2.50 16.40 49.60 195.00 45.99
Average 409.96 213.93 1.89 16.47 67.14 201.26 34.48
L.S.D.5% 73.74 26.10 0.174 2.02 7.40 9.90 6.017

16
Table 6: Average of seed oil content, seed protein content, leaf area, number of
hairs, and level of resistance as survival 1 and 2 and field scale characters
for 14 soybean genotypes evaluated under field conditions at Giza research
station in 2004 season.
Genotype Oil Content Protein Leaf area Number Level of resistance
(%) content (cm2) of hairs
(%) Surv1 Surv 2 Field
%
L86K-73 22.35 49.58 18.12 99.67 0.33 2.00 10
Corsay-79 25.83 51.92 26.57 50.00 7.70 7.33 20
Giza21 24.63 37.69 70.24 112.00 1.33 2.67 20
Forrest 23.67 22.70 48.95 103.00 1.00 2.67 30
Hutcheson 26.10 31.24 46.20 58.00 8.33 7.67 30
Calland 23.43 36.40 34.03 41.00 5.00 6.67 30
Lakota 24.30 51.90 53.23 48.00 7.70 9.00 15
Giza111 23.27 38.58 38.10 70.67 1.33 2.33 20
Giza83 24.10 57.93 33.71 173.33 2.33 3.67 10
Clark 22.81 56.61 61.23 41.33 8.00 8.00 30
Giza22 23.45 46.90 54.15 82.00 2.00 2.33 30
Giza35 23.43 55.49 68.32 138.33 0.70 2.33 20
Giza82 24.71 41.21 59.51 99.67 1.00 2.33 15
Crawford 24.27 39.19 63.39 61.33 7.70 9.67 35
Average 24.02 43.62 48.27 84.17 3.88 4.91 22.5
L.S.D.5% 0.088 0.515 19.66 27.69 1.77 1.76 3.68

Table 7: Genetic and phenotypic variances, broad sense heritability, Genetic

(GCV) and phenotypic (PCV) Coefficients variation and genetic advance for all
studied characters.

Character Genetic Phenotypic Heritability G.C.V P.C.V Genetic

variance variance (%) advances
Broad Sense (%)
Flowering 24.50 26.41 92.8 13.3 13.8 26.50
Maturity 165.60 193.10 85.76 11.29 12.20 21.56
Maturity period 66.81 85.58 78.10 10.65 12.05 19.39
No. of branches 0.265 0.444 59.70 18.72 25.28 29.80
Plant height 8.603 63.58 13.53 0.042 11.43 3.19
First pod height 0.421 0.730 57.64 11.51 15.16 0.21
Pods/plant 1005.31 1104.33 91.03 14.27 14.96 28.05
Seeds/plant 12409.15 12896.24 96.22 25.48 25.98 5.15
Seeds/pod 0.074 0.1053 70.28 14.04 16.75 24.29
Seed yield/plant 375.11 382.81 97.99 27.88 28.16 56.94
100-seeds weight 0.899 1.419 63.35 0.060 0.075 9.76
Biologic. Yield/pl. 5472.82 5483.30 99.8 36.8 36.8 0.76
Harvest index 35.51 43.32 81.97 16.59 18.32 30.93
No. of hairs 1452.41 1458.90 99.55 30.29 30.50 7.87
Leaf area 213.53 216.80 98.49 30.29 30.50 61.88

17
 CHAPTER (II)
TISSUE CULTURE ORGANOGENESIS
INTRODUCTION

Soybean (Glycine max (L.) Merr.) is important oil and poultry feed crop in Egypt.
The crop has been mainly grown in the Nile valley and the Delta since 1972. The growing
area has declined from 100,000 feddan in 1991 to less than 38,000 feddan in 2004. The
reduction in the area is due to high production cost and lower net return comparing with
corn, the main competitor summer crop to soybean. The crop production faces several
constraints. Insect infestation during vegetative growth stage by feeding insects such as
cottons leaf worm (Spodopetra littoralis, Boisd.) and green cotton leaf worm (Spodopetra
exigua Hubner) usually causes dramatic yield losses. The seed yield reduction in soybean
due to infection by cotton leaf worm in Egypt ranged from 36.6% to 42.7%.

Therefore, insecticides are extensively used in soybean fields, which rising production
cost, causing accumulation of undesirable residues and increasing environmental pollution.
The use of host-plant resistance is necessarily to solve most of those problems. Despite
several cotton leaves worm-resistant soybean varieties have been released such as Giza 21,
Giza 35, Giza 83 and Giza 111 the farmers still prefer to grow susceptible varieties such as
Clark, Giza 82 and Giza 22. Hence, insect infection still exists in soybean fields and
insecticides still widely used.

Advances in biotechnology can facilitate the development of insect-resistant soybean

cultivars by means of gene transformation. Successful use of gene transfer requires that the
gene for insect resistant is identified, isolated and then reconstructed for expression in relevant
organ of the new host. In addition, gene transfer procedures and appropriate tissue culture
methods must be developed for each target species to regenerate fertile, transgenic plants.

The first transgenic plants with resistance to insects contained genes for insecticidal
proteins called 8-endotoxins from the soil microorganisms, Bacillus thuringiensis (Bt). Bt
protected cotton, potato, and corn were introduced to the market place in 1996. They
succeeded to regenerate plants from callus, driven from immature embryos. To obtain callus
organogenesis or somatic embryogenesis is depending on the composition of the medium.
Organogenesis resulted when embryos were plated on Murashige and Skoog, 1962 (MS)
medium, which contained high concentration of micronutrients. This technique has been used
successfully to perform callus and plant regeneration from callus in soybean. Despite the fact
that biotechnology offers good option for genetic enhancement of crop plants, little in vitro
work has been done in soybean in Egypt.
Prior to gene transfer, responding soybean genotypes to organogenesis in tissue
culture technique needed to identify. The aim of this study was to initiate and maintain callus
organogenesis cultures of soybean. The differences among soybean genotypes in callus
formation were also evaluated.
 REVIEW OF LITERATURE

Barwale et al. (1986) used the callus derived from immature embryos; regeneration of
viable plants was obtained in soybean (Glycine max (L.) Merr. ). Depending on the
composition of the medium, regeneration occurred via embryogenesis or via organogenesis.
Embryogenesis resulted when embryos were plated on Murashige and Skoog (MS) medium
containing 43uM NAA. In his work with the cultivar Williams 82, the addition of 5.0 uM
thiamine HCl increased embryogenesis from 33% to 58% of embryos plated. Addition of 30
uM Nicotinic acid to the MS medium enhanced embryogenesis Further to
76%.Organogensises was obtained when medium containing 13.3 uM 6-benzylamino purine,
.02 uM NAA and four times the normal concentration of MS minor salts was used histological
studies theses culture confirmed the organogenic and embryogenic nature of the culture, by
demonstrating the formation of shoot buds and somatic embryos respectively. Similar
responses were obtained in all54 genotypes tested in manner. The culture retained the ability
to regenerate complete plants for leas 12 menthes and at 12-15 subcultures. Seed have been
obtained from several regenerated plants and when grown in the field theses produced normal
appear in fertile plants.

Parrott et al. (1989) found that the genotypes had a large effect on the ability of immature
embryo soybean cotyledons undergo auxin stimulated somatic embryogenesis.

Widholm et al. (1990) evaluated nineteen genotypes that had low and high level of Fe
efficiency in the laboratory and 5 field locations. Friable callus was induced from epicotyls
section, weighed and placed on modified MS media, on low NAA (0.02mgNAA and 50 um
Fe EDTA in control media) Callus growth was rated as a lack of growth compared to
respective controls.

Yue et al. (1990) cultured immature embryos 6 to13, 14, to 21, 22 to 28, days after
pollination 13 accessions of 8 Glycine species showed that beast callus and root formation
from members of the subgenus G. Soja which included G. max, G. graceless gave better callus
formation, organogenic and plantlet regeneration than G. max.

Yang et al. (1990) compared various explants for organogenesis and plant regeneration in
soybean (Glycine max Merr.). Young cotyledons produced organic calli, from which a
deventituties buds and shoots were produced by culture in vitro. Flowering and pod
development were observed on regenerated shoots even in vitro, but the recovery of plants
was very inefficient. Histological studies revealed weak connection of the regenerated bud
primodia with differentiated tissues recovery in this culture system. Plant regeneration could
also take place on plumule of young embryo explants. The regeneration process started with
the enlargement of the plumule followed bud the production of the adventitious buds.
Adventitious buds regenerated much more readily from cotyledonary nodes and some from
the plumules in mature embryo explants. An improved culture protocol for efficient plant
regeneration in soybean culturing explants from immature embryos and acclimatizing
regenerated plants at the early stage is proposed.

Zhou et al.(1990) published the ability to induced organogenesis from immature embryos
of soybean Glycine max using medium containing 3 ppm 6-benzylamino purine , 0.05ppm a
naphthalene acetic acid and 3to 4 the concentration of MS minor salts. Both increasing and
decreasing concentration of 6-benzylamino purine reduced the frequency of organogenesis.

20
The best length of immature embryo for 5 to 6 mm. genotypic variation in the frequency of
organogenesis was noted.

Amer (1992) demonstrated the modifications of the culture media were made to stimulate
the growth of shoots formed by organogenic soybean (Glycine max (L.) Merr.) The result
revealed the best alterations for stimulating organogenic shoots were found to be a decrease in
the MS mineral salts content to one half with supplements of 0.203mgL-1 (1uM) indolbutric
acids.

Widholm et al.(1993) Found that deficiencies of B and Zn had a greatest effect on callus
weight, while Mn had only a slight effect. Despite this, significant differences in callus weight
reduction were observed on the three different media. The results indicated that genotypic
variation for response to B, Zn and Mn deficiency is present in soybeans at cellular level.

Settu and Kumari (1998) found the plant regeneration was studied in cotyledon explants
taken from in vitro-grown soybean cv. Co.1 seedlings. Callus induction and proliferation was
best on MS medium containing 2 mg NAA + 0.5 mg BAP [benzyladenine] L-1. Shoot bud
formation was maximum in MS medium with 0.5 mg NAA + 3 mg BAPL-1. Regenerated
shoots developed roots when transferred to MS medium containing 2 mg IBA + 2 mg kinetin.

Dan-YingHui and Reichert (1998) compared of hypocotyl sections of 13 soybean

genotypes representing maturity groups IV-VI for organogenic responses on media
supplemented with 5.0 or 10.0µM benzyladenine (BA) or 2.5 UM BA + 1.0 UM NAA, and
under continuous darkness or a 16-h photoperiod. All genotypes responded by producing
adventitious shoots on the acropetal end of the hypocotyl explants, confirming genotype-
independence of shoot initiation. Media containing 5.0 or 10.0 UM BA induced the greatest
numbers of shoots. Light conditions had no effect over the first 4 weeks. Histological studies
confirmed the adventitious nature of the shoots by indicative formation of meristematic zones
and shoot primordia from parenchymatous tissues of the central pith and plumular trace
regions of the hypocotyl. Incompletely excised cotyledonary buds also contributed to shoot
initiation. Cv. Centennial, Epps and Lyon gave the greatest individual responses. Among
cultivars across all treatments, the regeneration potential (percentage of explants producing
meristem-like structures or shoot primordia) 4 weeks after initiation ranged from 47 to 75%.
Four weeks later, regenerative ability (number of shoots produced per responding explant) and
regeneration efficiency (number of shoots produced per explant plated) were 1.4-7.1 and 1.0-
5.0, respectively. The optimized protocol included initiation on a medium containing 5.0 UM
BA for 4 weeks, then transfer onto a shoot elongation medium (0.36 UM BA) for 4 weeks.
For 11 genotypes, 66-100% of excised shoots produced roots after 4 weeks on media
containing 12.5-29.2 uM IBA. Of 109 plantlets transplanted to soil, 94% survived and no
sterility was observed on those mature enough to flower.

Kosturkova (2000) this paper reviews the research on the induction of somatic
embryogenesis, organogenesis, and plant regeneration of soybean in tissue cultures. Different
factors affecting the process of morphogenesis, such as genotype, plant growth regulators,
nutrients and light, are discussed.

Roy and Maloo (2001) evaluated a six-parent soybean diallel for four in vitro callus
growth and quality parameters. Significant genotypic variation was observed for fresh and dry
weight of callus colonies and callus protein content. These traits appeared to be predominantly
under the control of additive gene effects as evidenced by the higher magnitude and

21
significance of general combining ability compared to specific combining ability mean
squares. Average midparent heterosis was non-significant for the callus growth traits but
significant and low for callus protein content. Results in general indicated the scope of
selection for superior in vitro callus response in soybean.

Tomlin et al. (2002) assessed seventeen breeding lines of soybean, Glycine max, and cv.
Jack, from relative maturity groups 0.3-7.5 for their ability to undergo somatic embryogenesis.
The goal of this study was to determine which lines had high embryogenic capacity. We also
sought to understand the relationship between relative maturity and embryogenesis. Embryos
from immature cotyledons were initiated on solid MS medium with varying levels of 2, 4-
dichlorophenoxyacetic acid (2,4-D). Qualitative and quantitative measures of initiation,
proliferation, differentiation, and maturation were recorded. The breeding lines differed
significantly with respect to percent induction, number of embryos induced, and quality of
induced embryos. After 1 month of proliferation, two early maturing lines, the control, Jack,
and NK-5, had the best overall performance. High percent response of proliferating embryos
was positively associated with lower maturity groups. Relatively high concentrations of 2,4-D
(compared with that used in proliferating medium, e.g., 226 UM; 50 mg l-1) in the initiating
medium reduced numbers of embryo clusters per cotyledon initiated and percent initiation,
and the concentration of 2,4-D affected the proliferation of somatic embryos in a breeding
line-dependent manner. The breeding lines differed significantly in the time to produce mature
somatic embryos. There was a positive correlation between immature embryo quality and
number of differentiated somatic embryos produced.

Yoshida (2002) reported a new system for simple and efficient shoot regeneration of
soybean (Glycine max cultivars Ohsuzu, Kosuzu, Suzukari, Suzuyutaka, Tachiyutaka and NT-
98-236) is using the hypocotyl of mature seeds. Two transverses of 1-mm sections of the
hypocotyl were cut from mature seeds: sections containing a cotyledonary node and sections 1
to 2 mm from the cotyledonary node. The effects of thidiazuron (TDZ) concentrations, plating
methods, and genotypic differences were examined. Shoots were formed from cotyledonary
node ends in all conditions examined. Meanwhile, shoots were formed from the ends of
hypocotyl sections on B5 media containing TDZ. The optimal TDZ concentration for
organogenesis was 2-10 UM. The efficiency of organogenesis varied with the method of
plating of explants. The ends of the hypocotyl sections in contact with the media only
produced adventitious shoots. Adventitious shoots were formed effectively by placing
explants on the media oriented so that the hypocotyl axes were perpendicular to the surface of
the media. The efficiency of organogenesis differed with the position of the hypocotyl ends. It
was important to use the ends that were 1 mm from the cotyledonary nodes. Genotypic
differences were observed in the organogenesis of the hypocotyl ends.

Manoj and Sharad (2003) obtained somatic embryo induction from hypocotyl explants
of 11 soybean genotypes (Bragg, JS 72-280, JS 72-44, JS 75-46, JS 80-21, JS 90-41, JS 335,
MACS 13, NRC 2, Punjab 1 and PK 472) cultured in Murashige and Skoog's medium
supplemented with 30 mg BAP [benzyladenine] + 0.5 mg NAA L-1 (medium A), 1.0 mg BAP
+ 1.0 mg NAA L-1 (medium B), or 0.5 mg BAP + 0.2 mg IAA L-1 (medium C). Callus
proliferation was initially observed on the second week after inoculation. The formation of
embryoid-like structures was also observed during this period. In a few cases, both
embryogenesis and organogenesis were evident on the same callus. Callus induction,
morphogenic callus formation and shoot induction significantly varied with the medium and
genotype. Medium A was superior in terms of overall callus initiation (87.43%) and shoot
induction (35.31%). Medium A and medium B resulted in the greatest formation of

22
morphogenic calluses. Among the genotypes, JS 80-21, JS 335 and JS 90-41 were the most
responsive to in vitro culture. JS 80-21 (89.73%), MACS 13 (88.86%), JS 90-41 (85.41%) and
JS 75-46 (84.42%) exhibited the greatest callus formation. The greatest proportion of calluses
resulting in morphogenesis was observed in JS 335 (56.86%), JS 90-41 (54.03%), JS 80-21
(49.40%) and MACS 13 (48.79%). The interaction between genotype and culture medium was
also significant. Regeneration was most pronounced in JS 90-41 cultured in medium A, JS 80-
21 and Bragg cultured in medium B, and NRC 2 cultured in medium C.

Smolov and Oleinikova (2003) studied the role of light during exogenous assimilation of
nitrate (the only source of nitrogen) by the callus cells of soybean (Glycine max). The nitrate
consumed and assimilated by the photosynthetic (mixotrophic) and nonphotosynthetic cells
(heterotrophic and chlorophyll-containing cells cultivated in the light in the same medium
complemented with diuron) was quantified. The assimilated nitrate was quantified at the final
stage of the growth cycle as the difference between the amount of nitrogen consumed from the
medium and the amount of endogenous nitrate in the cells. Comparison of the assimilated
nitrate quantities per accumulated dry biomass between the photosynthetic and
nonphotosynthetic cells demonstrated that nearly 30% of nitrate is assimilated with the
involvement of photosynthesis in a mixotrophic culture when nitrate is the only source of
nitrogen.

Sairam et al. (2003) developed an efficient protocol for callus induction and plant
regeneration in three elite soybean cultivars (Williams 82, Loda and Newton). The technique
is most novel in that the shoot buds developed from the nodal callus. Callus induction and
subsequent shoot bud differentiation were achieved from the proximal end of cotyledonary
explants on modified Murashige and Skoog (MS) media containing 2.26 UM 2,4-
dichlorophenoxy-acetic acid (2,4-D) and 8.8 UM benzyladenine (BAP), respectively. Varying
the carbon source optimized the regeneration system further. Among the various carbon
sources tested, sorbitol was found to be the best for callus induction and maltose for plant
regeneration.

Reichert et al. (2003) classified in the US, soybean genotypes into maturity groups (MG;
total of 13) that represent areas of adaptation generally correlated with latitude bands. To
determine if one regeneration procedure could regenerate representatives from diverse areas of
adaptation, 18 soybean genotypes representing nine MG were compared for organogenic
adventitious regeneration and plant formation from hypocotyl explants following the
procedure previously tested on representatives from only three MG. Responding explants
were those capable of producing shoots on the acropetal end of the explant from either the
outer edge plus central region or the central region only. This enabled determination of the
contribution of cotyledonary nodal tissue (outer edge) to shoot regeneration and by
discounting those explants; it also enabled estimates of true adventitious regeneration. All 18
genotypes were capable of producing meristemoids/shoots solely from the central region with
responses ranging from 28.5 to 64.3% after 4 weeks in culture. All genotypes were also
capable of producing elongated shoots that could be successfully rooted. No morphological
differences were noted among regenerants, or between them and seed-initiated plants. All
regenerants produced viable seed which germinated and produced morphologically normal
plants. This study confirmed the genotype- and MG-independent nature of this hypocotyl-
based organogenic regeneration procedure and provided conservative estimates for responses
that were truly/solely adventitious in nature.

23
 Kim et al. (2004a) established an efficient acclimation system for regenerated plantlets of
soybean; we used various media with hydroponic nutrient solutions before regenerants were
transplanted into soil. The hydroponic nutrient solution was essential for the survival of the
plantlets. The vermiculite with nutrient solution at pH 5.5 was found to be the best medium
with 97-100% survival rate and better growth of regenerants plantlets. Regenerated grew best
in the following order of solutions: Yoshida solution, modified Yoshida solution, Soy I, Soy
II, and MS medium. However, Soy I solution (EC 2.9 mS/cm), developed by the Honam
Agricultural Research Institute proved to be the most effective for acclimation in terms of the
time required for vigorous growth and economical use of chemicals.

Kim et al. (2004b) studied a successful, efficient system for multiple shoot induction and
plant regeneration of soybean (Glycine max) was established. Four soybean genotypes were
compared for organogenic responses on various media cultured under light conditions. The
adventitious shoots (98%, 2.6 shoots per cotyledon) directly from one-day-old cotyledon after
germination induced by the hormone treatment and its efficiency were higher than any other
conditions. The optimum medium for the induction of multiple shoots from cotyledon in
Pungsannamulkong (shoot formation rate, 98%), Lx 16 (83%) and Ilpumgeomjeongkong
(63%) was the MS medium supplemented with 2 mg BAP [benzyladenine]/l, but for
Alchankong (75%), it was the MS medium supplemented with 1 mg zeatin and 1 mg IAA/l,
3% sucrose and 4% Phytagel. Higher root induction (88%) was observed from the shoots
placed on rooting medium (hormone-free MS basal). Plantlets were transferred onto the same
medium supplemented with 1% activated charcoal for further development. With this
treatment, regenerated plantlets were obtained within 7-8 weeks (shoot induction for 4 weeks,
rooting and shoot elongation for 3-4 weeks).

Manoj and Sharad (2004) cultured leaf discs excised from 7- to 10-day-old seedlings of
soybean cultivars Bragg, JS 72-280, JS 72-44, JS-75-46, JS 80-21, JS-90-41, JS 335, MACS
13, NRC 2, Panjab 1 and PK 472 in Murashige and Skoog's (MS) medium supplemented with
30.0 mg 2,4-D, 10 mg PCPA [p-chlorophenoxyacetic acid] + 0.5 mg BA [benzyladenine]
(MS10PB) or 3.0 mg PCPA + 0.5 mg BA/litre for callus initiation. All callus types were
transferred into an MS medium without growth regulators for the germination of somatic
embryos. The MS medium for plantlet regeneration was modified with 0.4 mg BA and 0.5 mg
NAA, and 20 g sucrose/litre. In the absence of rhizogenesis, the shoots were transferred into
an MS medium containing 1.0 mg IBA and 15.0 g sucrose/litre. Callus initiation, evident on
the second week of incubation, was greatest in JS 90-41 (84.34%), MS10PB medium
(75.56%), and MACS 13 cultured in MS10PB (89.04%). The highest percentage of
morphogenic calluses was recorded for JS 90-41 (41.76%), MACS 13 (39.05%) and JS 75-46
(36.82%); MS10PB medium (36.67%); and MACS 13 cultured in MS10PB (50.67%). Most of
the calluses produced plantlets after prolonged culture in the induction media. The number of
shoot-forming calluses significantly varied with the cultivar and culture medium. The highest
percentages of shoot-forming calluses were registered for JS 90-41 (25.11%) and MACS 13
(22.18%), and in MS10PB medium (19.21%). Plantlet regeneration was greatest in JS 90-41
(18.0%) cultured in MS10PB. This medium was also optimum for plantlet regeneration in
other cultivars.

Manoj and Sharad (2004a) cultured Immature embryos of 11 soybean genotypes were
cultured on MS medium supplemented with different levels of growth hormones, namely 8.0
mg NAA/litre (MS8N), 2.0 mg NAA + 0.2 mg benzyladenine/litre (MS2NB) and 3.0 mg
benzyladenine + 0.5 mg NAA/litre (MS3BN). Highly significant differences were observed in
the response of genotypes, culture media and genotype x medium interactions for callus

24
initiation and plantlet regeneration. The combination of benzyladenine at high rates and NAA
at low rates was the most responsive for soybean tissue culture.

Manoj and Sharad (2004b) found high frequency of morphogenic callus induction was
attained in soybean (G. max) from immature cotyledons. Eleven soybean genotypes (JS 72-
280, JS 72-44, JS 75-46, JS 80-21, JS 90-41, JS 335, MACS 13, NRC 2, Panjab 1 and PK
472) and three media viz., MS30D (MS medium supplemented with 30 mg 2,4-D/litre),
MS3BN (MS medium supplemented with 3 mg benzyladenine/litre + 0.5 mg NAA/litre) and
MSPB (MS medium supplemented with 3 mg PCPA/litre + 2.5 mg benzyladenine/litre) were
tested for in vitro morphogenic efficiency. Morphogenesis was dependent on the genotype and
the explant inoculation medium. Plant regeneration efficiency was highest in genotype JS 90-
41 (53.35%) followed by JS 80-21 (41.0%) when in MS3BN culture medium. Phenotypically
normal plants were regenerated from the immature cotyledons explants.

Park et al. (2004) determined the best explant source, culture media and growth regulators
for the regeneration of multiple shoots from cotyledonary node and hypocotyl explants of
soybean cv. Iksannamulkong. More shoots were regenerated from cotyledonary nodes than
hypocotyl explants. Among the 5 culture media tested, MSB medium (MS with B5 vitamins)
was the most effective for obtaining more regenerated shoots. Addition of BA (2.0 mg/litre),
zeatin riboside (0.05 mg/litre) and thidiazuron (2.0 mg/litre) to the MSB medium were
effective for obtaining enough number of regenerated shoots from cotyledonary nodes. Zeatin
riboside was the most effective cytokinin, producing an average of 15.5 regenerated shoots per
cotyledonary node and giving 75% shoot regeneration. Thus, for efficient shoot regeneration
of soybean in vitro, it is recommended to plate cotyledonary nodes onto MSB medium
supplemented with zeatin riboside at 0.05 mg/litre.

Franklin et al. (2004) regenerated soybean (Glycine max cultivars PNP, Dekalb,
Sandusky, CNRR 279 and CB 277) plantlets were efficiently regenerated from mature and
immature cotyledons of five different cultivars by studying various parameters affecting
regeneration. Green organogenic nodules were induced at the proximal end, which
subsequently differentiated into shoot buds on modified Murashige and Skoog (MS) medium.
The presence of 6-benzyladenine (BAP at 13.3UM) and thidiazuron (TDZ at 0.45-22.71 UM)
in the medium exerted a synergistic effect, in that regeneration efficiency was higher than for
either cytokinin alone. The regenerated shoot buds elongated and rooted on MS medium
containing 0.29 UM gibberellic acid (GA3) and 2.69 UM alpha -naphthalene acetic acid
(NAA), respectively. Rooted plants were established in the greenhouse with 87% success and
produced viable seeds. Preliminary studies with Agrobacterium show great promise for
soybean transformation based on the regeneration protocol reported here.

Sharad et al. (2004) cultured anthers of ten genotypes of G. max on four fortified B5
media supplemented with different levels of growth hormones, i.e. B5 DBIG (2.0 mg 2,4-D
litre-1+0.5 mg IBA l-1+100.0 mg myo-inositol l-1+360.0 mg L-glutamine l-1), B5 DB (2.0
mg 2,4-D l-1+0.5 mg BA l-1), B5DK (2.0 mg 2,4-D l-1+0.5 mg kinetin l-1) and B5BKN (0.5
mg BA l-1+0.5 mg kinetin l-1+1.0 mg NAA l-1). All the media were supplemented with 90.0
g sucrose l-1 and 7.0 g agar l-1. Significant differences in the response of genotypes, culture
medium and genotype x medium interactions were observed for callus initiation, formation of
morphogenic calluses and plantlet regeneration. Genotype JS 90-41 was found superior for in
vitro androgenesis. B5DBIG exhibited higher response for androgenic callus formation and
haploid plant regeneration compared to other media.

25
 Patil et al. (2005) determined the morph types of callus in soybean (cv. Bragg) and their
potential ability in plant regeneration. In vitro-germinated seedlings (7-10 days old) from
untreated and treated (20 and 25 kR) seeds were used as sources of explants, i.e. cotyledons
and leaf segments. The explants were cultured on MS basal medium fortified with different
growth hormones such as BAP [benzyladenine], IBA, 2, 4-D and IAA in different
concentrations and combinations. To maintain the culture, subculturing was carried out in the
same media after every 2 weeks and finally subjected to different media to obtain
differentiation. The surface of the callus was noticed to be of 3 types, i.e. smooth, rough and
rough granular. The texture of the callus was either compact or friable. Varied ranges of callus
colour were observed for the explants used. The callus obtained was of embryonic, rhizogenic
and non-embryonic morph types.

Tiwari and Tripathi (2005) five separate experiments were conducted for immature
embryonic axes, immature cotyledon, mature cotyledon, and hypocotyl and leaf disc cultures
with 11 soybean genotypes. For each explant culture, at least 3 different fortifications of basal
MS medium were used. Various cultured explants initiated mainly 4 types of calluses: (a)
undifferentiated callus cultures which were cream in colour and soft friable in texture, (b)
compact, dark green in colour with few or many bead-like structures, (c) compact, dark green
with few or many dark green bead-like structures and sometimes partially covered with a thin
layer of white loose callus, and (d) mixture of creamy white and light green calluses which
were dense and glossy in texture. Culture media played an imperative role in the formation of
embryonic calluses. Hypocotyl, followed by mature cotyledon, proved to be the superior
explants for somatic embryogenesis, and mature cotyledon for plantlet regeneration.

26
 MATERIALS AND METHODS

Seven exotic and Egyptian soybean genotypes selected on the basis of their
reaction to cotton leaf worm infection, were obtained from Food Legume Research
Program, Field Crops Research Institute, ARC, Giza, Egypt (Table 9). The genotypes
were grown in the field at Giza research station in 25th May 2003 and 2004. Sowing
was done at a crop density of 33 plants/m2 in 3-meter long ridges, 60cm apart and 4
ridges per plot. Fertilizers at 30 kg P2O5/fed and 15 kg N/feddan were added to the soil
prior to planting. All agronomic practices were applied as recommended. In early pod
initiation stage, 40 young pods were collected from the plants of each genotype and
moved to the laboratory immediately.

Immature seeds were taken out from young pods and then surface sterilized by
immersion in a solution containing 30% commercial bleach Clorox with a drop of
Tween 80 (polyethylene sorbitan monooleate) for 20 min. The immature embryos
(with 0.5-10 mm long) were excised from the seeds by taking the seed coat off and
then cutting next to the hilum. The immature embryos were immersed in an
organogenesis medium (MR), which prepared according to Murshige and Skoog
(1962) and Gamborg et al (1968) and presented in Table (10).
Table 9: Origin and main characteristics of the seven-tested soybean genotypes.
Name Origin Pedigree Characteristic
L86K-73 USA L73-4673 X L73-0132 Maturity group no. I, white flower color.
Corsoy-79 USA Corsoy X Lee 68 Maturity group no. II, white flower color.
Forrest USA Dyer X Bragg Maturity group no. V, white flower color.
Hutcheson USA - Maturity group no. VI, purple flower color.
Lakota, USA Selection Maturity group no. II, purple flower color.
Giza 21 Egypt Crowford X Celect Maturity group no. IV, purple flower color.
Giza 83 Egypt Selection from MBB80-133 Maturity group no. II, purple flower color.

The immature embryos were then incubated under complete darkness at 25oC±2 for 4
weeks. After 4 weeks the percentage of callus induction was calculated as (number of
explants performed calli/total number of used explants) x 100, and callus growth rate
was measured as callus weight (g). To perform shoots, callus were put on MSR
medium (Table 2) at 25oC at day and 18oC at night with 16 h day (light source was
from cool white fluorescent lamps 80 um photons m-2s-1). The calli that did not
perform shoots during 3 weeks were sub-cultured to new MSR medium. This
procedure was repeated every 3 weeks till callus perform shoots. The callus that
performed 1-cm long shoots was transformed to glass tubes containing the hormone-
free MS medium (Murashige and Skoog, 1962) for rooting formation. When
reasonable number of roots is grown, usually after 3-4 weeks, the plantlets were
removed from glass tubes and planted in 10-cm diameter- plastic pots filled with
fumigated soil mixture of peat and sand with a ratio of 3:1. The pots were placed in
green house at Giza research station and were covered with polyethylene bags. To
maintain optimum air humidity surrounds plant. Irrigation was done with Hogland
solution (0.25) (Hogland and Arnon, 1950).

To measure the response of soybean genotypes to callus induction the following

characters were measured and calculated in 4 replicates: Number of shoots/callus,
Percentage of plantlets performed roots [(number of plantlets/total number of shoots) x
100], number of root/plantlet, length of root (cm) and diameter of root (mm). Analysis

27
of variance was made for each character and the simple correlation among all
characters was calculated (Gomez and Gomez, 1984).

Table 10: Composition of nutrient media for callus initiation (OR) and shooting
formation (MSR) as described by Murashige and Skoog (1962) and
Gamborg et al. (1968).
Components OR (Mg/l) MSR (Mg/l)
Macronutrients
NH4No3 1650.00 1650.00
KNO3 19000.00 19000.00
MgSo4.7H2O 370.00 370.00
KH2Po4 170.00 170.00
CaCl2 .2H2O 440.00 440.00

Micronutrients
KI 4X 0.830 0.830
H3Bo3 4X 6.200 6.200
MnSo4.H2O 4X 22.300 22.300
ZnSo4.7H2O 4X 10.600 10.600
NaMaO4.2H2O 4X 0.250 0.250
CoCl2.6H2O 4X 0.025 0.025
Na EDTA 4X 37.250 37.250
FeSO4.7H2O 4X 27.850 27.850

Vitamins B5
Nicotinic acids 1.00 1.00
Thiamin-HCl 10.00 10.00
Pyridoxine-HCl 1.00 1.00
Myoinsitol 100.00 100.00
Amino acids
Proline 1381.00 1381.00
Hormones
NAA 0.0372 -
BAP 2.996 0.383
IBA - 0.0406

Additions
Thiamin-HCl 1.687 -
Nicotinic acids 3.693 -
Sucrose 30000.00 30000.00
Agar 8000.00 8000.00
pH 5.8 5.8

28
 RESULTS AND DISSCUSSION

Seven exotic and Egyptian soybean genotypes were used in this study. Several
types of explants have been used in previously reported plant-regeneration studies in
soybean, but immature embryos have been successfully cultured to produce plants
(Christianson et al., 1983). Thus cultures in this study were initiated from immature
embryos at early developmental poding growth stage with length from 0.5 to 10 mm.
Sterilized immature embryos obtained from each of the tested soybean genotypes were
cultured on OR organogenesis medium. During the first week explants were enlarged,
but no calli have been observed. In the end of the second week callus began to initiate
on OR medium, which consisted of 4 times of micronutrients, Proline (1381 mg/l),
NAA (0.0372 mg/l) and BAP (2.996 mg/l). The calli obtained were vigorously
growing, fragile and had greenish color (Fig.1A). Calli obtained were subculture onto
MSR media, which consisted Proline (1381 mg/l), BAP (0.383 mg/l) and IBA (0.0406
mg/l). Within 4 weeks of culturing, shoots were produced (Fig. 1B). The newly formed
shoots growing on the shooting media were translated to rooting medium when shoot
length reached 3-5 cm. Roots were grown well (Fig. 1C) in MS medium with hormone
free. These results are in accordance with those of Ghanem (1995) on hyoscyamus,
who found that free hormone-MS medium was the best among five rooting media and
gave the best root formation. After 3-4 weeks of root formation, the plantlets were
grown enough to be transferred to pots for adaptation (Fig. 1D).

The performance of callus and plantlet characters for all tested genotypes is
presented in Table (11). Callus induction frequencies among genotypes were different
and ranged from 63% for Corsoy-79 to 79% for L86K-73, but with no significant
differences among genotypes (Table, 11). This result indicating that all tested
genotypes had almost equal responses to callus induction with culture method used in
this study. The callus growth rate ranged widely among genotypes. The genotype
L86K-73 gave the highest growth rate value of 1.18 g followed by Corsoy-79 with
0.93 g (Table, 11). The genotype L86K-73 performed also the highest number of
shoots/callus (16.25), while all other genotypes had markedly lower number of
shoots/callus, which ranged from 3.75 to 9.75. No significant differences observed
among genotypes for percentage of plantlets performed roots and diameter of roots.
The genotype L86K-73 had also the longest root of 14.25 cm and laid among the best
three genotypes performed the highest number of roots. These data indicting that the
genotype L86K-73 is the best in response to tissue culture technique in soybean.

29
 Figure 1: Illustration of Callus induction (A), Shooting stage (B),
Rooting stage(C) and Adaptation (D)

Table 11: Mean performances of callus and plantlet characters for seven
tested soybean genotypes.
Genotypes Callus Callus No. of Plantlet No. of Length Diameter
induction growth Shoot/ performed roots of root of root
(%) rate callus roots (%) (cm.) (mm)
L86K-73 79.00 1.180 16.25 20.633 6.00 14.25 2.625
Corsoy-79 63.00 0.930 8.75 26.806 7.00 11.75 1.625
Forrest 66.00 0.135 7.00 22.173 4.50 13.00 2.300
Hutcheson 67.00 0.086 3.75 36.250 3.00 11.25 2.525
Lakota 69.00 0.278 4.50 23.750 4.50 7.75 2.825
Giza21 68.00 0.118 9.75 21.023 7.00 6.75 1.950
Giza83 69.00 0.100 8.75 28.819 4.00 12.50 2.375
L.S.D 5% NS 0.247 2.209 NS 2.254 5.164 N.S.

30
Table 12: Correlation coefficients among all studied characters.
Callus No. of plantlet No. of Root Root
Character growth shoot performed roots length diameter
rate root %

Callus indication % 0.158 0.157 0.088 0.033 -0.112 -0.050

Callus growth rate 0.605** -0.083 0.467** 0.320 -0.220
No. of shoots -0.381 0.253 0.228 -0.026
Plantlet performed root 0.335 0.191 -0.259
No. of roots -0.093 -0.226
Root length 0.157
** Significant at 0.1 level of probability.

Correlation coefficients among all studied characters were calculated and presented in
Table (12). The Data showed that callus growth rate was positively and significantly
correlated with each of number of shoots/callus and number of roots. Therefore, both
characters are considering important indicator for callus growth rate, and could be used
to predict succeeding of callus growth.

31
 CHAPTER (III)
Agrobacterium Establishment Transformation System of
Soybean Using Immature Embryos and Cotyledonary Nodes

INTRODUCTION

Soybean (Glycine max (L.) Merr. 2n=40) is one of the world's leading
protein and oil crops. In Egypt soybean is important oil and feed crop and source
of protein in different forms. Soybean production faces several problems, such
as poor establishment, and damage by insects. Several technologies included
transformation and molecular characterizations are already used extensively for
plant improvement to overcome such problems. The early biotechnology
application in soybean was the transformation of the resistant gene to Round up;
herbicide, which has been widely adopted by farmers over the world.

In the first reports of soybean transformation, two different methods were

applied. Used Agrobacterium mediated transformation cotyledonary nodes,
while used partial bombardment of shoot meristems. Soybean transformation
reports following these initial works have been limited and transformation
efficiency for soybean has remained low. Later transformation efficiency has
been improved. Additionally, several methods have been used to genetically
transform plants, such as electroporation, Silicon carbide fibers, liposome
mediated transformation and vacuum infiltration of whole plants using
Agrobacterium. However, these methods have not been optimized for soybean,
and they are therefore less efficient and not widely used. In soybean, tissue
culture induced indirect organogenesis from immature embryos was successfully
used to viable soybean plantlet. The cotyledonary nodes have the ability to
produce direct organogenesis shoots in soybean. However, the production of
genetically transformed soybean plants needs broad studies. In this investigation,
a system for soybean transformation and regeneration using immature embryos
and cotyledonary nods was performed.

32
 REVIEW OF LITERATURE

Transformation by Agrobacterium (LBA4404) in immature Embryos:

Facciotti et al. (1985) successfully transferred soybean cultivar Forrest with
A. tumefaciens containing a bacterial kanamycin resistance gene linked to the 5'
portion of a soybean small subunit ribulose 1, 5-diphosphate carboxylase gene.
Comparison of light-grown versus dark-grown transformed callus demonstrated light
induction of the chimaeric gene as measured by increased levels of kanamycin
resistance. This was not unexpected as the small subunit genes are under light
regulation.

Wyndaele et al. (1985) induced 2 soybean crown gall lines by a nop+

Agrobacterium tumefaciens C58 str., max. Cytokinin (essentially glucosyl-trans-
zeatin) levels were attained in the beginning of the exponential growth phase,
followed by a drastic decrease just before the stationary phase was reached.
Quantitatively the green tumour line showed a 2-3 times higher cytokinin content
compared with the pale line. In untransformed callus very little cytokinin was
detected. Analysis of endogenous IAA levels showed no difference between the 2
lines and the untransformed callus tissue, all having a low and constant level
throughout the entire growth cycle. The relevance of the endogenous accumulation of
phytohormones in relation to the hormone autotrophic growth of transformed soybean
tissue is discussed.

Byrne et al. (1987) determinates the response of Glycine max, G. soja and G.
canescens genotypes to inoculation with different Agrobacterium strains were
assessed. Percentage visible tumour formation and tumour size varied widely among
species and genotypes. Susceptible genotypes displayed a heightened response to
nopaline strains of A. tumefaciens, relative to octopine, agropine and A. rhizogenes
strains. A nopaline strain engineered to contain a chimaeric neomycin
phosphotransferase II gene conferred kanamycin resistance on soybean tissue at
kanamycin levels as high as 300 microg /ml.

Christou et al. (1988) accelerated immature soybean embryos from

commercially important cultivars the targets of rapidly, DNA-coated, gold particles
(fired from an arc discharge gun powered by a 25 kV 2 micro F capacitor).
Protoplasts were prepared from these tissues and propagated in culture under
selection conditions for the introduced neomycin phosphotransferase II gene (fused to
a cauliflower mosaic virus promoter). Kanamycin-resistant calluses were obtained at
a rate of approximately 10-5. Enzyme assays and Southern blot hybridization
confirmed the expression of the foreign gene and its stable integration into the
soybean genome. The results show that particle acceleration can be used for the
introduction of foreign DNA into the soybean genome and are taken to indicate that
the technique may be useful in the recovery of engineered plants by transformation of
regenerable tissues.

Owens and Smigocki (1988) inoculated cotyledon explants from germinated

1-day-old soybean seedlings with single or mixed strains of A. tumefaciens. Mixed-
strain infections with the supervirulent L,L-succinamopine type strain A281

33
(pTiBo542) and strain LBA4404 carrying an octopine type virulence (vir) region and
a binary vector (pBin6) with a chimaeric gene for kanamycin detoxification gave rise
to tumours, of which 25% were both kanamycin resistant and capable of hormone-
independent growth. Single-strain inoculations with LBA4404 (pBin6) failed to give
rise to kanamycin-resistant callus. Syringaldehyde, a compound which induces vir
genes carried on the Ti plasmid, increased the number of galls incited on excised
cotyledons by the weakly virulent octopine type strain A348 (pTiA6). Similar results
were obtained with whole plants treated with this strain in the presence of the vir-
inducing compound acetosyringone. It is suggested that transformed soybean cells
can be recovered after coinfecting with a supervirulent strain or after adding a
phenolic compound to the inoculum.

Zhou and Atherly (1989) introduced binary vectors into soybean by

Agrobacterium tumefaciens-mediated transformation. After 10 days growth on B5BA
medium containing 250 ml kanamycin/litre, actively-growing callus tissue was
removed and stained with x-glcU. Calluses transformed with an intact GUS gene
showed even staining of the tissues, those transformed with pZAc1 (a vector
containing GUS under the control of the CaMV 35S promoter and including a 5.1 kb
fragment of the Ac transposable element (from maize) in the untranslated leader
region) showed staining only rarely, while those transformed with a vector containing
the Ds maize element in the untranslated leader region of GUS showed no staining.
Different-sized fragments to those of the original insertion event were obtained when
DNA from the calluses was digested with AcoRI and PstI and hybridized with
radioactive Ac DNA, providing additional proof that Ac is active in soybean calluses.

Delzer et al. (1990) excised cotyledons from 1-day-old axenic seedlings of 10

soybean genotypes and Peking, a highly susceptible Maturity Group IV cultivar
wounded and inoculated with A. tumefaciens strains C58, A208 or A281. The relative
frequency of tumor formation, an indicator of susceptibility, was greatest for strains
C58 and A208 on all genotypes tested. Peking and PI180529 were the most
susceptible. The same genotypes were evaluated for shoot organogenic tissue culture
initiation from the cotyledonary node and plant regeneration via adventitious shoot
formation. The genotypes producing the highest frequency of mature plants 30 weeks
after culture initiation were Experimental Line HHP, Evans, PI445799, Hodgson 78,
Corsoy 79 and PI180529. These may be useful genotypes for whole plant
transformation studies.

Nan et al. (1998) the Bacillus thuringiensis CryIAc gene (encoding a protein
conferring insect resistance) was introduced into the protoplasts of soybean cultivars
Heinong 35, Heinong 37, Hefeng 25 and Hefeng 35 using the PEG method.
Following screening with 30 mg/litre hygromycin and differentiation of selected
resistant calli, three regenerated plants were obtained and transplanted successfully.
PCR analysis of the DNA from the transplanted plants showed a positive reaction.
Southern blot analysis of the PCR-positive plants proved that the CryIAc gene had
integrated into the genome of these plants.

Trick and Finer (1998) successfully transferred of plant tissue using

Agrobacterium relies on several factors including bacterial infection, host recognition,
and transformation competency of the target tissue. Although soybean embryogenic
suspension cultures have been transformed via particle bombardment,

34
Agrobacterium-mediated transformation of this tissue has not been demonstrated.
This papers reports the transformation of embryogenic suspension cultures of soybean
using the 'Sonication-Assisted Agrobacterium-mediated Transformation' (SAAT)
technique. For SAAT of suspension culture tissue, 10-20 embryogenic clumps (2-4
mm in diameter) were inoculated with 1 ml of diluted (OD600nm 0.1-0.5) log phase
Agrobacterium and sonicated for 0-300 s. After 2 days of co-culture in a maintenance
medium containing 100 micro M acetosyringone, the medium was removed and
replaced with fresh maintenance medium containing 400 mg TimentinReg. /litre. Two
weeks after SAAT, the tissue was placed in maintenance medium containing 20 mg
hygromycin and 400 mg TimentinReg. /litre and the medium were replenished every
week thereafter. Transgenic clones were observed and isolated 6-8 weeks following
SAAT. When SAAT was not used, hygromycin-resistant clones were not obtained.
Southern hybridization analyses of transformed embryogenic tissue confirmed T-
DNA integration.

Wang et al. (1999) pBinLK carrying two insecticidal genes, pea lectin (P-
Lec) gene and soybean Kunitz trypsin inhibitor (SKTI) gene, was successfully
transferred into 4 upland cotton (Gossypium hirsutum) cultivars (Xinluzao-1,
Xinluzhong-2, Jihe-321 and Liao-9) via Agrobacterium-mediated transformation.
After co-cultivation of hypocotyl segments with A. tumefaciens, kanamycin-resistant
calli were screened, and somatic embryos and regenerated plants were obtained
through various media. Transgenic cotton plants harbouring two insecticidal genes
were confirmed by NPT-II ELISA, PCR and PCR Southern. The results of bioassay
demonstrated that the transgenic plants showed significant resistance to the larvae of
cotton bollworm (Heliothis armigera [Helicoverpa armigera]).

Zhang et al. (1999) described a soybean transformation procedure using the

Agrobacterium-cotyledonary node transformation system and the bar gene as the
selectable marker coupled with glufosinate as a selective agent. Cotyledonary
explants were derived from 5 day old seedlings and co-cultivated with Agrobacterium
tumefaciens for 3 days. Explants were cultured on Gamborg's B5 medium
supplemented with 1.67 mg BAP [benzyladenine] per litre and glufosinate at 3.3 mg
or 5.0 mg/litre for 4 weeks. After 4 weeks explants were subcultured to medium
containing MS major and minor salts and B5 vitamins (MS/B5) supplemented with
1.0 mg zeatin-riboside, 0.5 mg GA3 (gibberellins) and 0.1 mg IAA amended with 1.7
mg or 2.0 mg glufosinate per litre. Elongated shoots were rooted on a MS/B5 rooting
medium supplemented with 0.5 mg NAA/litre without further glufosinate selection.
Plantlets were transplanted to soil and grown to maturity and set seed in the
greenhouse. Primary transformants and their progeny were characterized by Southern
blot analysis and a leaf paint assay.

Yan et al. (2000) investigated Agrobacterium tumefaciens-mediated

transformation of soybean (Glycine max cv. Jack) using immature zygotic cotyledons
to identify important factors that affected transformation efficiency and resulted in the
production of transgenic soybean somatic embryos. The factors evaluated were initial
immature zygotic cotyledon size, Agrobacterium concentration during inoculation
and co-culture and the selection regime. These results showed that 8 to 10 mm
zygotic cotyledons exhibited a higher transformation rate, as indicated by transient
GUS gene expression, whereas the smaller zygotic cotyledons, at less than 5 mm,
died shortly after co-cultivation. However, the smaller zygotic cotyledon explants

35
were found to have a higher embryogenic potential. Analysis of Agrobacterium and
immature cotyledon explant interactions involved two Agrobacterium concentrations
for the inoculation phase and three co-culture regimes. No differences in explant
survival or somatic embryogenic potential were observed between the two
Agrobacterium concentrations tested. Analysis of co-culture regimes revealed that the
shorter co-culture times resulted in higher explant survival and higher somatic
embryo production on the explants, whereas the co-culture time of 4 days severely
reduced survival of the cotyledon explants and lowered their embryogenic potential.
Analysis of selection regimes revealed that direct placement of cotyledon explants on
medium containing hygromycin 25 mg/litre was detrimental to explant survival,
whereas medium containing 10 mg/litre gave continued growth and subsequent
somatic embryo development and plant regeneration. The overall transformation
frequency in these experiments, from initial explant to whole plant, was 0.03%. Three
fertile soybean plants were obtained during the course of these experiments.
Enzymatic GUS assays and Southern blot hybridizations confirmed the integration of
T-DNA and expression of the GUS-intron gene in the three primary transformants.
Analysis of 48 progeny revealed that three copies of the transgene were inherited as a
single Mendelian locus.

Wang et al. (2001) investigated the effects of erythromycin base, cefazolin

sodium, cefradine and 2 kinds of cefotaximes on callus induction and growth of
transformed soybeans using Agrobacterium LBA4404. The ideal concentration of
cefotaximes was recorded at 300 mg/litre using hypocotyl explants, and 500 mg/litre
using cotyledon explants. No significant differences were observed in the response of
soybean varieties in terms of rate of callus induction, although differences were
observed in terms of rate of brown callus formation. Differences in the response of
different soybean explants to kanamycin were observed; the young leaves were
sensitive while the hypocotyl explants were not. The ideal selection pressure of
kanamycin, used as a selection marker, was 50-100 mg/litre in young leaves and
cotyledons, and 100 mg/litre in hypocotyl explants.

Ronde et al. (2001) used a reproducible gene transfer technique for soybean
would be useful for improving cultivars. Several plant transformation methods are
available, but regeneration from cell culture is required, which is a problem in
soybean, as tissue culture procedures have not yet been efficiently coupled to
transformation for all its varieties. We report here a non-tissue-culture
Agrobacterium-mediated transformation of soybean seed using beta -glucuronidase as
a reporter gene. The method involves subjecting partially germinated seed to vacuum
infiltration in the presence of A. tumefaciens. This method is simple and rapid, and
transformed plants can be obtained directly at high frequency. Transformation was
confirmed using PCR and Southern hybridization analysis.

Schmidt and Parrott (2001) determined quantitative real-time polymerase

chain reaction (PCR) assays that enabled the zygosity of transgenes in soybean (G.
max) and groundnut (A. hypogaea), were designed. The two zygosity assays, based on
TaqMan technology that uses a fluorogenic probe which hybridizes to a PCR target
sequence flanked by primers, were both accurate and reproducible in the
determination of the number of transgenes present in a cell line. In the first assay, in
which TaqMan assays were performed on increasing amounts of a plasmid containing
the transgene of interest, a linear relationship between the level of fluorescence and

36
the template amount was produced. Using the resultant linear relationships as
standard curves, we were able to determine the zygosity of both soybeans segregating
for the cry1Ac transgene and that of a T1 peanut segregating for the hph transgene. In
the second assay, a relative determination of copy number (referred to as comparative
Ct) was performed on transgenic soybeans by comparing the amplification efficiency
of the transgene of interest to that of an endogenous gene in a multiplexed PCR
reaction. Both methods proved to be sufficiently sensitive to differentiate between
homozygotes and hemizygotes. These assays have numerous potential applications in
plant genetic engineering and tissue culture, including the hastening of the
identification of transgenic tissue, selecting transformation events with a low number
of transgenes and the monitoring of the transmission of transgenes in subsequent
crosses.

El-Shemy et al. (2002) introduced two plasmid vectors into soybean (Glycine
max (L.) Merr.) and azuki bean (Vigna angularis Willd. Ohwi & Ohashi) using
different transformation systems. Azuki bean epicotyl explants were prepared from
etiolated seedlings and co-cultivated with Agrobacterium tumefaciens for 2 days.
Adventitious shoots were developed from the callus of the explants on a regeneration
medium containing hygromycin, and the shoots were excised and transferred to a
rooting medium containing hygromycin at the same concentration. Rooting shoots
were transferred to soil and grown in a glass-house to produce viable seeds. PCR
analysis confirmed clearly the presence of the hpt gene in most of the azuki beans
regenerated under hygromycin selection. A soybean embryogenic suspension culture
was generated from immature cotyledons, and used for the introduction of plasmids
by particle bombardment. Hygromycin-resistant embryogenic clones were isolated
after 8 weeks of hygromycin selection, and then the green clones were matured on the
differentiation medium. After desiccation, the embryos were germinated on the
rooting medium, and the plants were transferred to soil in a glass-house. More than
50% of the regenerated soybean plants tolerant to hygromycin yielded the hpt
fragment on PCR analysis. The azuki bean transformants were obtained more rapidly
and with higher efficiency than the soybean transformant.

KO and Korban (2004) identified a characteristic phenotype of highly

embryogenic explants along with the location of embryogenesis- and transformation-
competent cells/tissues on immature cotyledons of soybean (Glycine max) under
hygromycin selection. This highly embryogenic immature cotyledon was
characterized with emergence of somatic embryos and incidence of browning/necrotic
tissues along the margins and collapsed tissues in the mid-region of an explant
incubated upwards on the selection medium. The influences of various parameters on
induction of somatic embryogenesis on immature cotyledons following
Agrobacterium tumefaciens-mediated transformation and selection were investigated.
Using cotyledon explants derived from immature embryos of 5-8 mm in length, a 1:1
(v/v; bacterial cells to liquid D40 medium) concentration of bacterial suspension and
4-week cocultivation period significantly increased the frequency of transgenic
somatic embryos. On the other hand, increasing the infection period of explants or
subjecting explants to either wounding or acetosyringone treatments did not increase
the frequency of transformation. An optimum selection regime was identified when
inoculated immature cotyledons were incubated on either 10 or 25 mg hygromycin l-1
for a 2-week period, and then maintained on selection media containing 25 mg
hygromycin l-1 in subsequent selection periods. However, somatic embryogenesis

37
was completely inhibited when inoculated immature cotyledons were incubated on a
kanamycin selection medium. These findings clearly demonstrated that the tissue
culture protocols for transformation of soybean should be established under both
Agrobacterium and selection conditions.

Wang et al. (2004) induced Somatic embryogenesis and the regenerated

plants were obtained by higher concentrations of auxins with immature cotyledon of
55 genotypes in soybean. Bivalent insect resistant genes were transformed into
immature cotyledon of soybean which have high frequency of somatic embryogenesis
via Agrobacterium-mediated. The results showed that 14 genotypes possessed high
frequency of somatic embryogenesis (more than 40%) among soybean genotypes
from Northeast area. A total of 2147 immature cotyledons of 5 different soybean
genotypes cultured in Northeast area was inoculated with LBA4404 (including
pGBI121S4ABC plasmid). A total of 17 plantlets were obtained under kanamycin
selection. A total of 12 plantlets showed positive reaction in PCR and PCR-Southern
detection. These analyses confirmed the presence of introduced BT gene in soybean.

Liu et al. (2004) reported the establishment of an efficient, in vitro, shoot

organogenesis, regeneration system for soybeans [Glycine max (L.) Merr.]. Mature
soybean seeds were soaked for 24 h, the embryonic tips were collected and cultured
on MSB5 medium supplemented with 3.5 mg l-1 N6-benzylaminopurine (BAP) for
24 h, and explants were transferred to MSB5 medium supplemented with 0.2 mg l-1
BAP and 0.2 mg l-1 indolebutyric acid. Use of embryonic tips yielded a higher
regeneration frequency (87.7%) than regeneration systems using cotyledonary nodes
(40.3%) and hypocotyl segments (56.4%) as starting materials. Regenerated
embryonic tips were inoculated with Agrobacterium tumefaciens strain EHA105,
which contains the binary vector pCAMBIA2301, and cultured for 20 h. Our results
showed that the T-DNA transfer efficiency reached up to 78.2% and the
transformation efficiency reached up to 15.8%. These data indicate that the
embryonic tip regeneration system can be used for efficient, effective Agrobacterium-
mediated transformation.

Ko et al. (2004) studied Agrobacterium tumefaciens strain KYRT1 harboring

the virulence helper plasmid pKYRT1 induces transgenic somatic embryos (SEs) at
high frequency from infected immature soybean cotyledons. KYRT1 is derived from
the highly oncogenic strain Chry5. However, pKYRT1 is not completely disarmed
and still contains an entire T-right (TR) and a portion of T-left (TL). In this report,
binary strains, each carrying fully disarmed vir helper plasmids including pKPSF2,
which is a fully disarmed version of pKYRT1, were compared to strain KYRT1 for
their ability to induce transgenic SEs on immature cotyledons of soybean. Six weeks
following cocultivation, histochemical GUS assays of cultured explants indicated that
all fully disarmed vir helper plasmids transferred their binary T-DNA, containing a
GUS-intron gene, into soybean tissues. However, none of these transformed tissues
developed SEs on medium with or without 2, 4-dichlorophenoxyactic acid (2, 4-D).
On the other hand, immature cotyledons cocultivated with strain KYRT1 exhibited
high induction of transgenic SEs, but only on medium supplemented with 2,4-D.
Derivatives of strain Chry5 harboring other vir helper plasmids did not induce
transgenic SEs under any conditions tested, thus suggesting that the chromosomal
background of KYRT1 alone was not sufficient to promote somatic embryogenesis.
PCR analysis indicated that 55% of transgenic embryogenic cultures and 29% of

38
transgenic T0 soybean plants derived by transformation using strain KYRT1
contained TR from pKYRT1 in addition to the uidA gene from the binary construct.
None of the transgenic tissues or T0 plants contained TL DNA. These results suggest
that some function coded for by TR of pKYRT1 influences somatic embryogenesis in
conjunction with exposure of the plant tissues to 2, 4-D. Since the co-transformation
frequency of the undesirable T-DNA sequences from the vir helper plasmid was
relatively low, the partially disarmed strain KYRT1 will likely be very useful for the
production of normal transgenic plants of diverse soybean cultivars.

Wang et al. (2004) reviewed the current research status on transgenic methods
and receptor systems in soybean. The major obstacles of genetic transformation in
soybean and possible approach for solving the problem are also discussed.
Cotyledonary node via Agrobacterium tumefaciens-mediated and immature cotyledon
via particle bombardment were thought to be the efficient systems of genetic
transformation. Three problems exists in genetic transformation of soybean, i.e.
further improvement of tissue culture techniques, low efficiency and difficulty of
genetic transformation and successful transformation of restricted soybean genotypes
as a receptor. The path of solving these problems needs to set a new and highly
efficient system for tissue culture in soybean. Also the number of target genes to be
transformed should be increased from single to several genes simultaneously.

Li et al. (2004) utilized either Agrobacterium-mediated transformation or

particle bombardment; they obtained transgenic soybean (Glycine max) plants
expressing the chitinase gene (chi) and the barley ribosome-inactivating protein gene
(rip). Six regenerated plants were grown to maturity and set seed. The identification
of transgenic soybean plants that co-integrated the 2 antifungal protein genes was
determined by polymerase chain reaction (PCR) and Southern blot analysis. Protein
detection from the soybean leaves demonstrated the expression of the chitinase (CHI)
and the ribosome-inactivating protein (RIP) in the 6 R0 transformants. Soybean
cotyledonary nodes were transformed using the bivalent plant expression vector
pBRC containing chi and rip both driven by the CaMV 35S double promoter.
Following vacuum (0.06 MPa) infiltration treatment of the tissue for 5 minutes,
Agrobacterium was co-cultivated with the cotyledonary nodes for 3 days on MSB
medium (MS salts and B5 vitamins; pH 5.2), and the transformation frequency
reached a maximum of 1.33%. The chi and rip genes were present in all the
transgenic plants. Co-bombardment of immature cotyledons with plasmids pBchE
(encoding chi) and pARIP (encoding rip) resulted in the greatest transformation
frequency of 0.52% with a 50% co-integration rate. Our results demonstrate the
efficient co-transformation of multiple genes in soybean.

Transformation by (LBA4404) in cotyledonary node:

Rech et al (1988) infected seedlings of G. canescens and G. clandestina with

A. rhizogenes. All accessions responded to infection, the frequency ranging from 10%
(G. clandestina G1001) to 70% (G. canescens G1340 and G1240). Limited callus
proliferation occurred at the infection site 7-16 days after inoculation, with root
emergence 2-3 days later. Cotyledon infection was less efficient in both species, with
bases (proximal regions) being more responsive than tips. Growth regulators inhibited
root growth and promoted callus formation. Shoots were produced only by G.

39
canescens G1171, from hard, green, nodular calluses. Accessions unable to regenerate
buds produced only undifferentiated friable callus. For G1171, medium containing 10
mg benzyladenine and 0.05 mg IBA/litre gave the highest frequency of shoot bud
formation with 30% of tissues responding. When transferred to B50 medium, highly
branched, plagiotrophic root systems developed. Silver nitrate-staining compounds,
which comigrated with agropine, mannopine and mannopinic acid standards, were
present in transformed roots and shoot of G1171, whereas tissues from non-
transformed control plantlets lacked opines.

Delzer et al. (1989) evaluated ten soybean lines adapted to Minnesota for their
ability to regenerate in tissue culture. All the lines produced adventitious shoots and
regenerated plants, with an overall average of 23.2 and 6.2 per cotyledonary node,
respectively, and a shoot: plant conversion frequency of 26.4%. Experimental line
HHP had the highest number of shoots (31.5) and plants (9.1) per cotyledonary node
and Hodgson 78 had the highest conversion frequency (40.8%). Agrobacterium-
mediated transformation of Hodgson 78 and Peking, a maturity group III line, was
unsuccessfully attempted.

Al-Janabi and Shoemaker (1992) cultured cotyledons of Glycine max cv.

Peking in vitro, wounded and inoculated with A. tumefaciens strain A281 containing
the binary vectors PZAC1, PZAC1/R or PZA3. They were then transferred
successively to shoot induction medium, kanamycin selection medium and rooting
medium, producing mature transformed plants in 12-14 weeks. All the regenerated
plants were fertile.

Luo et al. (1994) inoculated cotyledons from germinating seeds of cv. Peking
with virulent Agrobacterium tumefaciens strain A281:pZA7, carrying the wild-type Ti
plasmid pTiBo542 and the disarmed Ti plasmid pZA7, containing the GUS (uidA)
and NPT (nptII) genes. Tumours were produced on all inoculated explants and 82%
of these tumour lines were co-transformed by the nptII gene from pZA7 as shown by
polymerase chain reaction analysis (18 of 22 lines tested). Of these 18 lines, 11 were
also resistant to kanamycin. Of 11 lines with GUS activity, 6 were also kanamycin
resistant.

Lee and Komatsuda (1994) excised embryos of soybean genotypes Peking

501, American Jellow, Kou 502 (Masshokutou) and Bominori from immature seeds
and cultured in vitro. Explants undergoing embryogenesis or organogenesis were
cocultivated for 1 day with either EHA101/PSAOR1221 or LBA4404/PTRA415
vectors. PSAOR1221 is a binary Ti plasmid containing the beta -glucuronidase (GUS)
gene driven by the CaMV 35S promoter. PTRA415 harbours a tobacco PR1a protein
gene which is induced by stress or chemicals. Following selection on kanamycin-
containing medium and GUS assays of regenerants, transformants were only
identified from the EHA101/PSAOR1221 treatment (0-5.4% transformants via
embryogenesis and 4-12.2% via organogenesis).

Xu et al. (1997) transferred the pKT54B7C5 plasmid containing the B.t.k.

[Bacillus thuringiensis kurtosis] delta -endotoxin gene into soybean cultivars Heinong
37 and Heinong 39 by Agrobacterium tumefaciens. Adventitious buds and
regenerated plants were obtained from hypocotyls and cotyledon nodes. Successfully
transferred plasmids were detected by kanamycin and alkaloid selection. Only 30 of

40
the 81 regenerated plants survived, 3 of which developed into plants with 7 pods.
PCR and dot hybridization showed that 7 plants had been transformed. Seeds of
transformed plants were germinated and grew into plants of normal phenotype.

Zhang et al. (1999) described a soybean transformation procedure using the

Agrobacterium-cotyledonary node transformation system and the bar gene as the
selectable marker coupled with glufosinate as a selective agent. Cotyledonary
explants were derived from 5 day old seedlings and co-cultivated with Agrobacterium
tumefaciens for 3 days. Explants were cultured on Gamborg's B5 medium
supplemented with 1.67 mg BAP [benzyladenine] per litre and glufosinate at 3.3 mg
or 5.0 mg/litre for 4 weeks. After 4 weeks explants were subcultured to medium
containing MS major and minor salts and B5 vitamins (MS/B5) supplemented with
1.0 mg zeatin-riboside, 0.5 mg GA3 (gibberellins) and 0.1 mg IAA amended with 1.7
mg or 2.0 mg glufosinate per litre. Elongated shoots were rooted on a MS/B5 rooting
medium supplemented with 0.5 mg NAA/litre without further glufosinate selection.
Plantlets were transplanted to soil and grown to maturity and set seed in the
greenhouse. Primary transformants and their progeny were characterized by Southern
blot analysis and a leaf paint assay.

Donaldson and Simmonds (2000) studied response a short-season adapted

soybean (Glycine max) genotypes (maturity groups 0 and 00) were susceptible to
Agrobacterium tumefaciens in tumour-formation assays with A. tumefaciens strains
A281, C58 and ACH5. The response was bacterial-strain and plant-cultivar
dependent. In vitro Agrobacterium-mediated transformation of cotyledonary node
explants of these genotypes with A. tumefaciens EHA105/pBI121 was inefficient, but
resulted in a transgenic AC Colibri plant carrying a linked insertion of the neomycin
phosphotransferase and beta -glucuronidase (GUS) transgenes. The transgenes were
transmitted to the progeny and stable GUS expression was detected in the T7
generation. The low rate of recovery of transgenic plants from the co-cultured
cotyledonary explants was attributed to inefficient transformation of regenerable cells,
and/or poor selection or survival of such cells and not to poor susceptibility to
Agrobacterium, since, depending on the cultivar, explants were transformed at a rate
of 27-92%, but transformation events were usually restricted to non-regenerable
callus.

Xing et al. (2000) assembled a binary vector, pPTN133 that harbored two
separate T-DNAs. T-DNA one contained a bar cassette, while T-DNA two carried a
GUS cassette. The plasmid was mobilized into the Agrobacterium tumefaciens strains
EHA101. Mature soybean cotyledonary node explants were inoculated and
regenerated on medium amended with glufosinate. Transgenic soybeans were grown
to maturity in the greenhouse. Fifteen primary transformants (TO) representing 10
independent events were characterized. Seven of the 10 independent T0 events co-
expressed GUS. Progeny analysis was conducted by sowing the T1 seeds and
monitoring the expression of the GUS gene after 21 days. Individual T1 plants were
subsequently scored for herbicide tolerance by leaf painting a unifoliate leaf with a
100 mg l-1 solution of glufosinate and scoring the leaf 5 days post application.
Herbicide-sensitive and GUS-positive individuals were observed in four of the 10
independent events. Southern blot analysis confirmed the absence of the bar gene in
the GUS positive/herbicide-sensitive individuals. These results demonstrate that

41
simultaneous integration of two T-DNAs followed by their independent segregation
in progeny is a viable means to obtain soybeans that lack a selectable marker.

Olhoft et al. (2003) increased the efficiency of soybean [Glycine max (L.)
Merrill] transformation from an average of 0.7% to 16.4% by combining strategies to
enhance Agrobacterium tumefaciens-mediated T-DNA delivery into cotyledonary-
node cells with the development of a rapid, efficient selection protocol based on
hygromycin B. Wounded cotyledonary-node explants were inoculated with A.
tumefaciens carrying either a standard-binary or super-binary plasmid and co-
cultivated in the presence of mixtures of the thiol compounds, L-cysteine,
dithiothreitol, and sodium thiosulfate. Transformed shoots began elongating only 8
weeks after co-cultivation. Southern analysis confirmed integration of the T-DNA
into genomic DNA and revealed no correlation between the complexity of the
integration pattern and thiol treatment applied at co-cultivation. All T0 plants were
fertile and the majority of the lines transmitted the beta -glucuronidase (GUS)
phenotype in 3:1 or 15:1 ratios to their progenies.

Wang et al. (2003) used a soybean transformation procedure involving the use
of Agrobacterium cotyledonary node system and the bar gene as the selectable marker
coupled with glufosinate a selective agent, to study the regeneration of 15 soybean
cultivars and their susceptibility to Agrobacterium tumefaciens EHA 101.
Cotyledonary nodes from 5-6 days germinated soybean seeds were used as explants.
The explants were wounded by slicing 5-6 times, inoculated with A. tumefaciens
EHA 101. Three days after co-cultivation, the explants were washed and placed onto
a shoot initiation medium supplemented with 5 mg glufosinate/litre for selection. The
regeneration rate of the different soybean cultivars was observed after 2 weeks, and
their susceptibility to A. tumefaciens was investigated after 4 weeks by beta -
glucuronidase assay. Heinong 35, Zhongzuo 975, Hefeng 35, Zhongzuo 962 cultivars
had higher regeneration than Thorne, while William 82, PI 361066, Heinong 35 and
Zhongzuo 975 had higher transformation than Thorne. The remaining cultivars had
lower regeneration and transformation rates than the control cultivar.

Kumari et al. (2004) standardized an efficient and reproducible protocol for

Agrobacterium-mediated transformation in soybean (G. max) using the binary vector
pBI 121. Putative transgenic shoots were selected on kanamycin medium. GUS assay
was performed to confirm the presence of GUS gene from putatively transgenic
shoots. Transgenic plants were multiplied followed by successful rooting in the media
containing 1.5 mg IBA/litre. Plants with well-developed roots were successfully
hardened in plastic cups containing sand, soil and sawdust (1:1:1). Stable integration
of the transgene (uid A and npt II) was confirmed by PCR analysis. Southern blot
hybridization confirmed the presence of npt II gene in putative transformed plants.

Patil et al. (2004) studied Explants (cotyledonary node, nodal segment and
shoot tips) were obtained from 7- to 10-day-old in vitro-germinated seedlings of
soybean cv. Bragg, and from plants derived from gamma-irradiated seeds (20 and 25
kR). Multiple shoot induction was done in MS media containing BA [benzyladenine]
at 0.2, 0.4, 0.8, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0 and 5.0 mg/litre; IBA at 0.05, 0.1 and 0.5
mg/litre; and NAA at 0.1 mg/litre. Rooting was done on half MS media containing
IBA at 0.2, 0.4, 0.6 and 0.8 mg/litre, and NAA at 0.1, 0.2, 0.3, 0.4 and 0.5 mg/litre.
Subculturing was done in the same media every 2 weeks. Culture media containing

42
BA at 5 mg/litre and NAA at 0.1 mg/litre was the most effective in inducing multiple
shoots without the callus phase. The media containing MS + BA at 5 mg/litre + IBA
at 0.1 mg/litre took the least number of days to bud break, and produced the
maximum number of buds for both irradiated samples and the control. Rooting was
obtained from excised shoots regardless of the explant type on 1/2 MS media with
IBA at 0.8 and 1 mg/litre and NAA at 0.5 mg/litre. Irradiated materials took longer
time to initiate bud compared to the control. Increasing irradiation dosage resulted in
the increase in the number of days required for bud initiation. Irradiation effects were
more obvious in the explants from cotyledonary node and nodal segment than those
from shoot tips.

Zhang et al. (2004) investigated conditions affecting Agrobacterium-mediated

transformation of soybean [Glycine max (L.) Merr.], including seed vigour of explant
source, selection system, and cocultivation conditions. A negative correlation between
seed sterilization duration and seed vigour, and a positive correlation between seed
vigour and regenerability of explants were observed in the study, suggesting that use
of high vigour seed and minimum seed sterilization duration can further improve
transformation efficiency. Selection schemes using glufosinate or bialaphos as
selective agents in vitro were assessed. Glufosinate selection enhanced soybean
transformation as compared to bialaphos. The use of 6 mg L-1 glufosinate during
shoot induction and shoot elongation stages yielded higher final transformation
efficiency ranging from 2.0% to 6.3% while bialaphos at 4 to 8 mg L-1 gave 0% to
2.1% efficiency. Including cysteine and DTT during cocultivation increased the
transformation efficiency from 0.2-0.9% to 0.6-2.9%. This treatment also improved
T-DNA transfer as indicated by enhanced transient GUS expression. Shoot
regeneration and Agrobacterium infection were attained in twelve soybean cultivars
belonging to maturity groups’ I-VI. These cultivars may be amenable to genetic
transformation and may provide a valuable tool in soybean improvement programs.

Somers et al. (2004) studied soybean transformation methods based on DNA

delivery via A. tumefaciens use proliferating apical meristems, cotyledons of
immature embryos and seedling cotyledonary nodes as sources of regenerating cells
for the production transgenic plants. Improvements in T-DNA delivery, A.
tumefaciens strain, tissue culture conditions, and selection of transgenic plants have
increased the efficiency of these transformation systems. Further improvements are
required to expand the range of genotypes that can be transformed using these
procedures and to shorten the time to produce transgenic plants. Characterization of
T-DNA loci produced using the cotyledonary-node method indicate that on average
of approximately one simple locus is produced per transgenic plant indicating that A.
tumefaciens-based soybean transformation systems produce plants with a high
proportion of simple transgene loci.

Zeng et al.(2004) started that modern genetic analysis and manipulation of

soybean (Glycine max) depend heavily on an efficient and dependable transformation
process, especially in public genotypes from which expressed sequence tag (EST),
bacterial artificial chromosome and micro array data have been derived. Williams 82
is the subject of EST and functional genomics analyses. However, it has not
previously been transformed successfully using either somatic embryogenesis-based
or cotyledonary-node transformation methods, the two predominant soybean
transformation systems. An advance has recently been made in using antioxidants to

43
enhance Agrobacterium infection of soybean. Nonetheless, an undesirable effect of
using these antioxidants is the compromised recovery of transgenic soybean when
combined with the use of the herbicide glufosinate as a selective agent. Therefore, we
optimized both Agrobacterium infection and glufosinate selection in the presence of
L-cysteine for Williams 82. We have recovered transgenic lines of this genotype with
an enhanced transformation efficiency using this herbicide selection system.

Li et al. (2005) studied the factors influencing Agrobacterium tumefaciens-

mediated soybean cotyledonary node transformation to improve the transformation
frequency of soybean. The transformation frequency was different among soybean
cultivars. Jilin 35 was the highest in transformation rate, Zhonghuang 28 was the
second followed by Nannong and Tiefeng 29. There was no transformed plant in
Tiefeng 30 and Kaiyu 12. The average and the highest transformation rate were 2.16
and 6.12% for Jilin 35, and 1.9 and 3.33% for Zhonghuang 28, respectively. The
suitable seedling age was ~4 days old and the appropriate durations of infection and
co-culture with A. tumefaciens were ~30 minutes and 3 days, respectively. There was
an interaction between germination medium and shoot regeneration medium for
transformation frequency. The best combination patterns of germination medium and
shoot regeneration medium were the G2+Y1 (with transformation rate of 6.12%) and
G1+Y2 (with transformation rate of 5.26%). The screening method had a significant
effect on increasing the transformation frequency of the A. tumefaciens-mediated
transformation system. Kanamycin was used as the screening agent. A higher
transformation rate was obtained by using the screening model S1 in which the
kanamycin concentration increased gradually from 60 to 100 mg/l when subculture in
the shoot regeneration stage. It was suggested that the lower concentration of the
screening agent should be used in the earlier screening stage; the higher
concentrations increased gradually in the later stages.

44
 MATERIALS AND METHODS
The experiments of the present study were conducted at Field Crops Research
Institute (FCRI), Cell Research Study Department, Agriculture Research Center
(ARC), Giza, Egypt.
Plant material
Fourteen Egyptian and exotic soybean genotypes were used in this study (Table13).
The genotypes were provided by Food Legumes Research Department, FCRI, ARC,
Giza. The genotypes were planted in the field at Giza Agriculture Research Station
in 2005. Every genotype was planted in 10 ridges, 3 m long and 60 cm apart. A
month after flowering, 100 pods/ genotype were collected and used in this study.

Table13: Origin and main characteristics of the fourteen-tested soybean

genotypes used in this study.
NO. Genotypes Maturi Pedigree Origin Flower
ES ty Color
group
1 L86K-73 I USA White
L73-4673 X L73-0132
2 Corsoy-79 II Corsoy X Lee 68 USA White

3 Giza21 IV Crawford X Celeste Egypt Purple

4 Forrest V Dyer X Bragg USA(Purdue) White

5 Hutcheson VI - USA Purple

6 Calland IV CL253(Blackhawk USA Purple

Haorsay)X Kent
7 Lakota II Selection USA Purple
8 Giza111 IV Crawford X Celeste Egypt Purple
9 Giza83 III Crawford X Celeste Egypt White
10 Clark IV USA(Illinois Purple
Lincoln(2)X Richland

11 Giza22 III Crawford X Forrest Egypt Purple

12 Giza35 III Crawford X Celeste Egypt Purple
13 Giza82 II Crawford X Maplebrasto Egypt Purple
14 Crawford III - USA Purple

Plasmid and Agrobacterium:

Agrobacterium tumefaciens strain LBA4404 (Hoekema et al. 1983) carrying the

45
 pBI 121 binary vector contain the NPT-II as a selectable marker and GUS as a
reporter gene was provided by Ain Shams University, Faculty of Agriculture,
Department of Genetics and Cytomolecular Laboratory and used for soybean
transformation.
In vitro immature embryo cotyledonary Organanogenesies of soybean
(control):
Immature embryos were used to produce soybean plantlets according to the
method described by Nasr et al. (2005). The MS medium (Murashige and Skoog,
1962) was used to regenerate plantlets (Table 14). The OR medium was used for
callus induction, while MSR medium was used for production of shoots from callus.
The produced shoots were transformed to glass tubes containing the hormone-free
MS medium for rooting. When a reasonable number of roots is grown (usually after
3-4 weeks) the plantlets were removed from the glass tubes in to 10-cm diameter-
plastic pots filled with fumigated soil mixture of peat and sand with a ratio of 3: 1.
To maintain optimum air humidity surrounding plants, pots were covered with
polyethylene bags and then placed in the green house. Irrigation was applied using
(0.25) Hogland solution (Hogland and Arnon, 1950).
Kanamycin sensitivity:
The immature embryos (0.5-10mm in diameter) and cotyledonary nodes (2-5
days old) of soybean genotypes were tested for the sensitivity to Kanamycin
according to the method described by De-Block (1988), in order to identify the proper
Kanamycin concentration to be used in testing soybean genotypes; kanamycin
concentrations of 0, 25, 50, 75,100 and 125 mg/L were supplemented to the media
and soybean plants were allowed to grow. The proper kanamycin concentration is that
kill all tested explants of soybean genotypes. The data were recorded and statistically
analyzed according to Gomez and Gomez (1984).
Agrobacterium preparation:
Agrobacterium tumefaciens LBA4404 containing the pBI121 was plated on LB media
supplemented with Streptomycin 50 µg mL-1 and Kanamycin 30 µg mL-1 then
incubated for 3 days at 28°C. Colonies were tested for the presence of the pBI121
plasmid using Alkaline Lyses method (Sambrook and Russell, 2001). Positive
colonies were grown on liquid LB supplemented with Streptomycin 50 ugmL-1 and
Kanamycin 30 ugmL-1 for overnight at 28°C with shaking (Ausubel et al. 1994).
Production of transformed plantlet by immature embryos
In vitro immature embryos of soybean (0.5-10 mm in diameter) were excised
from the seeds and collected in sterile Petri dishes under aseptic conditions. The
immature embryos and were incubated with 30 ml of an overnight incubated
Agrobacterium tumefaciens culture for 60, 120,180 and 240 second. After incubation,
the excess of bacteria was blotted on sterile filter paper and the immature embryos
were incubated in an organogenesis medium (OR) which prepared according to
Murashige and Skoog (1962) and Gamborg (1968) for 3 days at 25 ± 1 °C in the
dark. The immature embryos were then rinsed with sterile distilled water and blotted
to dry on sterile filter paper and were planted on callus medium OR (MS salts
supplemented with B5 vitamin, NAA 0.0372 mgL-1, BA 2.996 mgL-1,100 mgL-
1
kanamycin monosulfate and 200 mgmL-1cefotaxime sodium salt). The immature
embryos were then incubated under complete darkness at 2SoC±2 for 4 weeks. Calli
from immature embryos were transferred to MSR media (MS salts supplemented with
B5 containing BA 0.383 mgL-1, IBA 0.0406 mgL-1, 100 mgL-1kanamycin
monosulfate and 200 mgL-1cefotaxime sodium salt) and incubated at 25 ± 2°C,

46
with16 h light (3000 Lux.) per day at for 4 weeks. The small shoots were taken and
placed on rooting medium and incubated till root formation.
Production of transformed plantlet from cotyledonary nodes:
In vitro cotyledonary nodes of soybean (2-5 days old) were collected from
seedling and cut in sterile Petri dishes under aseptic conditions, Then transferred to
Petri plates containing 30 ml of an overnight incubated Agrobacterium tumefaciens
culture, and incubated for 2, 4, 8 and 16 second. After incubation, the excess bacteria
was blotted on sterile filter paper and the cotyledonary nodes were incubated in an
organogenesis medium Cotl [MS salts supplemented with B5 and supplemented with
9.9 mgL-1Benzyl Adenine (BA) and 0.2 Indol butyric acids (IBA)]. Shoots from
cotyledonary nodes were transferred into regeneration medium (1.1 BA and 0.2 mgL-
1
IBA (Cot2) containing 100 mgL-1Kanamycin monosulfate and 200 mgL-1cefotaxime
sodium salt. The cultures were incubated at 25 ± 2°C, 16h lights (3000Lux) per day.
After 20-30 days (subculture/15 days), the small shoots were taken and incubated on
rooting medium (Con) supplemented with 2 mgL-1 IBA till roots production (Table
14).Acclimatization of transgenic soybean genotypes and no transgenic (control)
were carried out as follows. Plantlets (3-7 cm), which obtained from in vitro were
washed under running tap water for 1-2 minutes to remove agar traces, and soaked in
fungicide solution (2 gL-1 of Benlate) for 15-20 min, then plantlets were cultured in
plastic pots(15 cm in diameter containing a mixture of peat moss and sand at 2:1 (VI
V), and watered immediately. To keep constant high humidity (90 %), the pots were
covered with polyethylene bags which were gradually removed within one week. The
plantlets were transferred into plastic pots (23 cm in diameter) after 3 weeks for
adaptation. Irrigation by Hogland solution was applied every 10 days up to maturity
(110-120 days).
Detection of GUS gene:
A-Isolation of DNA:
Samples were collected from one month old leaves of both transgenic and non-
transgenic (control) soybean genotypes and control (non-transgenic leaves) from in
vitro cultures grown on MS medium. Isolation of DNA was performed according to
method described by Dellaporta et al. (1983).
Agarose gel preparation and DNA detection:
DNA was visualized on 1g/100 ml agarose gel on TBE buffer and stained with Ethidium
Bromide (Sambrook and Russell, 2001). DNA bands were visualized using a short UV
light source (254 nm) and photographed by gel documentation system using the
Polaroid instant image film from photo dyne.

B-PCR detection:
PCR reaction was carried out using 200 ng of DNA in the presence of 1 x PCR
buffer, 10 pmol of primer GUS 1 GGTGGGAAAGCCGTT ACAA, 10 pmol of
primer GUS2 GTTTACGCGTTGTTCCGCCA. 1.5mM of MgCI2, 10 mM of dNTPs
and 2 unites of Taq DNA polymerase. Samples were subjected to 35 cycles of PCR
with 1 min of denaturating at 94˚C, 1 min of annealing at 56 ˚C, and 2 min at 72 ˚C.
The series of cycles were preceded by 3 min initial denaturating at 94 ˚C and
followed by 3 min at 72 ˚C.
C-GUS assay:
Soybean explants derived from both transgenic and control genotypes were analyzed
using GUS assay. One ml of GUS buffer containing X-glue was added to the explants
in Petri dishes. Explants emerged in the GUS buffer were incubated at 37°C for 4-24

47
h. on a shaker (Janssen and Gardner. 1989). GUS assay were applied in explants,
shoots and plantlets. Callus, shoots and plantlets of soybean were collected from
transgenic and non transgenic genotypes for the detection of B-glucuroindase gene.
Samples were incubated with X-glue substrate and its buffer at 37°c for 4-24 h.

Table 14: Composition of nutrient media for callus initiation (OR), Shooting
formation (MSR), Cot1, Cot2and Cot3as described by Murashige and Skoog (1962)
and Gamborg et al. (1968).

Components OR (Mg/l) MSR Cot1 Cot2 Cot3

(Mg/l) (Mg/l) (Mg/l) (Mg/l)
NH4No3 1650.00 1650.00 1650.00 1650.00 1650.00
KNO3 19000.00 19000.00 19000.00 19000.00 19000.00
MgSo4.7H2O 370.00 370.00 370.00 370.00 370.00
KH2Po4 170.00 170.00 170.00 170.00 170.00
CaCl2. 2 H2O 440.00 440.00 440.00 440.00 440.00
KI 4X 0.830 0.830 0.830 0.830 0.830
H3Bo3 4X 6.200 6.200 6.200 6.200 6.200
MnSo4.H2O 4X 22.300 22.300 22.300 22.300 22.300
ZnSo4.7H2O 4X 10.600 10.600 10.600 10.600 10.600
NaMaO4.2H2O 4X 0.250 0.250 0.250 0.250 0.250
CoCl2.6H2O 4X 0.025 0.025 0.025 0.025 0.025
Na EDTA 4X 37.250 37.250 37.250 37.250 37.250
FeSO4.7H2O 4X 27.850 27.850 27.850 27.850 27.850
Nicotinic acids 1.00 1.00 1.00 1.00 1.00
Thiamin-HCl 10.00 10.00 10.00 10.00 10.00
Pyridoxine-HCl 1.00 1.00 1.00 1.00 1.00
Myo-inositol 100.00 100.00 100.00 100.00 100.00
Proline 1381.00 1381.00 - - -
NAA 0.0372 - - - -
BAP 2.996 0.383 9.9 1.1 -
IBA - 0.0406 0.2 0.2 2
Thiamin-HCl 1.687 - - - -
Nicotinic acids 3.693 - - - -
Sucrose 30000.00 30000.00 30000.00 30000.00 30000.00
Agar 8000.00 8000.00 8000.00 8000.00 8000.00
pH 5.8 5.8 5.8 5.8 5.8
Agrob.OD600nm 0.5-1.0 - 0.5-1.0 - -
kanamycin 100 100 100 100 100
cefotaximes 200 200 200 200 200
Cot1 and Cot2 for shoot production.Cot3 for roots performed.

48
 ori V traF
ColE1 ori
kilA
NPT III
tetA
IS1
NPTIII

trfA Rb
tetA

NOSp
Lb
pBI121
14.758 bp
NOSt
pBI121
nptII
Sac I

GUS
CaMV35S

NOSt

Sna BI 4173

Hin dIII
Sph I
Bam HI Pst I
Xba I
Sma I

Lb NOSt GUS CaMV35S NOSt nptII NOSp Rb

SacI BamHI HindIII

XbaI
SmaI

Fig.2: Plasmid pBI121 contained NPT II and GUS genes

49
 RESLUTS AND DISCUSSION

The immature embryos of the 14 genotypes were tested for their sensitivity to
LBA4404- pBI121. The results of evaluation for transient GUS expression are
presented in Figure (2). The results show that genotypes L86K -73 (no. 1), Giza111
(no.8) and Clark (no.11), had the highest percentage of gene expression of 6, 5 and
4%, respectively, indicating that they are the most responded to the applied technique.
Hence these three genotypes were used for transformation in immature embryos
method. Another three genotypes were chosen randomly to be used in cotyledonary
nodes method.
Agrobacterium strain and helper plasmid are the main factors affecting
transformation efficiency. In this work the vector of pBI121 in the helper strain of
LBA4404 allowed the production of several stable transformed soybean plants. The
binary vector pBI121, which has the GUS and the Kanamycin gene, as a selective
marker, were introduced into soybean genotypes L86K-73, Giza111 and Clark by
immature embryos method, and Giza35 and Giza21 and Calland by cotyledonary
nodes method.
Time of inoculation on Agrobacterium media
Ten plates for each genotype containing 10 ex-plants/plats (explants developed by
immature embryos method) were co cultivated with LBA4404-pBI121 for different
inoculation time as 60, 120, 180 and 240 seconds. The presence of transient GUS
expression was investigated after co-cultivation for 4h (over night) in MS media
supplemented with B5 vitamins and containing 100 mgL-1 kanamycin. The data
indicated that 180 sec. is the best time for incubation. No significant difference was
observed among genotypes (Table 15). Yan et al. (2000) found that the shorter co-
culture times resulted in higher explant survival and higher somatic embryo
production on the explants, whereas the co-culture time of 4 days severely reduced
survival of the cotyledon explants and reduced embryogenic potential.

50
 7

usexpressedex-plants
transf ormed ex-plant

4
ercentageof G

1
P

0
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Trans formed genoty pes

Figure 3: The percentage of GUS expression of the tested 14 soybean genotypes

(no. of genotypes as in Table (13).

Table 15: Percentage of successful immature embryos as affected by

soybean genotypes and time incubation on Agrobacterium media.

Varieties(V)
Time(T)
Mean
(Second)
L86K-73 Giza111 Clark

60 7.50 12.50 10.00 10.00

120 10.00 7.50 17.50 11.667

180 22.50 20.00 25.00 22.50

240 20.00 20.00 20.00 20.00

Mean 15.00 15.00 18.125 16.042

L.S.D.5% N.S. 14.04

The interaction of time x varieties is not significant.

51
A similar technique was used with explant developed by cotyledonary nodes. Data in
(Table 16) revealed that four seconds showed the best time for co-cultivation
cotyledonary nodes with Agrobacterium. There was no significant difference among
genotypes regarding the co cultivation time. The highest mean of successful
cotyledonary nodes (27%) was obtained using the genotype Giza35 after 4 seconds as
inculcation time. Harold et al. (1997) used 2 second for inoculation of
Agrobacterium with cotyledonary nodes. The difference in inculcation time between
studies could be attributed to the type of cotyledonary nodes used.

Table 16: Percentage of successful cotyledonary nodes as affected

by soybean genotypes and time of incubation on Agrobacterium media.

Time(T) Varieties(V) Mean

(Second) Giza35 Giza21 Calland
2 10 12.50 10.00 10.83
4 27 25.00 22.50 25.00
8 20 17.50 12.50 16.67
16 15 15.00 20.00 16.67
Mean 18.13 17.50 16.25 17.29
L.S.D.5% N.S 12.20
The interaction of time x varieties is not significant.

Kanamycin concentration:

The proper Kanamycin concentration was determined to be used in selection

procedures. Immature embryos produced from in vitro transformed soybean
genotypes were tested for their Kanamycin resistance by culturing them on callus
initiation medium containing MS basal salts and hormones supplemented with
different concentrations of Kanamycin sulfate (0, 25, 50, 75, 87.5, 100 and 125 mgL-
1
). The Kanamycin concentration of 87.5, 100 and 125 mgL-1 found to be effectively
to kill all explants, the intermediate con concentration of 100 mgL-1was chosen to be
used in selection media. Results revealed that the best Kanamycin concentration for
selection is100 mgL-1 in both immature embryos and cotyledonary nodes methods
(Figures 4 and 5). The obtained results are in agreement with those obtained by Colby
and Meredith (1990) who suggested that the Kanamycin concentration, to be used as
selectable marker ranged between 50 and 300 mg/liter in Vitis vinifera. On the other
hand, Wang et al (1999), Wang et al (2001) and Byrne et al(1987), noted that the
efficient Kanamycin concentration to used as selectable marker is l00 mgL-1, which is
accordance with the results obtained in this study.

52
 120
Giza 35 Giza 21
Calland 120 L86K-73 Giza 111 Clark

100 




Percentage of successful
 100  
 

Percentage of successful


80

80


 

60
 60
 
40 40


20
20



0 



 
 

 0   
0 25 37.5 50 62.5 75 87.5 100 125 0 25 50 75 100 125
Kanamycin Concentration (mg/1l)
Kanamycin Concentration (mg\1L)

Fig 4: Kanamycin sensitivity of soybean Fig 5: Kanamycin sensitivity of soybean

genotypes for cotyledonary nodes of genotypes for immature embryos of 100
100 explants for each different explants for each different concentration
concentration

Production of transformed plantlet by immature embryos:

The different degrees of gene expression from transit GUS gene in immature
embryos as explants are illustrated in Plate (1).Also, the transformed calli that had
transit GUS (colored) and those non-transformed (control) are also show in Plate (1).
While the Plate (2) had demonstrates stages of plantlet production by immature
embryos from (1-3). The gene transformant was made successfully, and the
percentages of successful transformed soybean genotypes are given in Table (17). The
genotypes L86K-73, Giza111 and Clark had percentages of 9.5, 10.9 and 11.6%,
respectively in transformed embryo. The mean of transformed callus for L86K-73
was (12.5%) in Kanamycin and (19.2%) in GUS expression, while it increase in
shoots to (25%). The percentage successful obtained plantlets for L86K-73 was
(10%). The date revealed that, successful callus transformed was different with
Kanamycin selection gene and GUS expression. The percentage of successful callus
was ranged from (12.50-19.17) for L86K-73, (10.00-31.25) for Gizall1 and (17.50-
33.34) for Clark. There was no significant difference between genotypes.
Factors affecting transformation efficiency in soybean investigated by Yan et
al. (2000) such as Agrobacterium concentration during inoculation and co-culture and
the selection regime, initial immature zygotic cotyledon size and the used technique
of tissue culture. Addition to Trick and Finer (1998) reported another factors
including status of bacterial infection, host recognition, and transformation
competency of the target tissue. While Ronde et al. (2001) used a reproducible gene
transfer technique for soybean, and concluded that it would be useful for improving
cultivars without using tissue culture technique. Some materials used to improve to
transformation in soybean such as acetosyringone treatments which used by KO and

Korban (2004).

53
 Table 17: Percentage of successful transformed soybean genotypes.
Varieties Successful Successful Callus Successful Successful
Immature % Shoots plantlet
embryos % %
%

Kanamycin Kanamycin GUS GUS GUS

L86K-73 9.49 12.50 19.17 25.00 10.00

Giza111 10.93 10.00 31.25 16.67 11.00

Clark 11.62 17.50 33.34 25.00 11.00

G. Mean 10.68 13.33 27.92 22.22 10.67

L.S.D.5% 4.39 14.42 45.63 27.61 7.59

b- Production of transformed plantlet by Cotyledonary nodes:

In this method shoots were directly performed from coty1edonary nodes. The
three genotypes used in this technique Giza 35, Giza 21, and Calland. The steps of
development (explant, shoot and plantlet) are shown in plate (2, a, b, c). In Kanamycin
selection, the Calland was the best genotype compared with Giza 35 and Giza 21
(Table 18). Also, the data in (Table 18) revealed that there was significant difference
between genotypes used in cotyledonary nodes. Calland was the highest in
transformation rate, with 12% successful percentage, Giza 35 followed by and then
Giza 21. Li et al. (2005) found that transformation frequency was varied among
soybean cultivars in cotyledonary nodes.
The genotypes L86K-73, Giza111, and Clark transformants were characterized
by PCR assay. The specific primers of GUS were attachments and separated in 1.8 kb
in gel electrophoresis (Fig. 6) which shows in 1, 2, and 3. The genotypes Giza 35,
Giza 21, and Calland transformants were characterized by PCR assay. The products
of PCR were separated in 1.8 kb for the six genotypes (Fig. 6).

As indicated above the two transformation methods were successfully made.

Agrobacterium mediated immature embryos and cotyledonary node
transformation. The method of cotyledonary node took shorter time than immature
embryo method. In addition the somaclonal variation in cotyledonary node is lower
than the other method. Therefore, cotyledonary node is successfully to be better than
immature embryo method. Somers et al. (2004) Studied improvements in T-DNA
delivery, A. tumefaciens strain, tissue culture conditions, and selection of transgenic
plants have increased the efficiency of these transformation systems and reported of
cotyledonary node method in approximately.

54
Table 18: Percentage successful of variance transformed
Organs of three soybean genotypes.
.
Varieties cotyledonary nodes%
(Kanamycin)

Giza35 9.00
Giza21 8.00
Calland 12.00
Mean 9.67
L.S.D.5% 3.693

55
Fig. (6): Agarose gel electrophoresis for plasmid pBI 121.
: M DNA/Ready load TM 1K Plus (marker).
No. 1-6 : pBI 121 plasmid DNA.

56
Plate 1: Illustrated immature embryo showing the results of GUS assay; control
(A), different degree of GUS expression different soybean explants (B, C, D, E, F
and G) and callus in (H) control and (I).

57
Plate 2: Immature embryo organogenesis callus induction (1), shoots in (2) and
plantlet in (3).Cotyledonary nodes (A), shoots in (B) and plantlets in (C).

58
 CHAPTER (IV)
Molecular Characterization of Soybean Genotypes
Resistant /Susceptible To Cotton Leaf Worm

INTRODUCTION

Soybean producers suffer substantial annual economic losses due

to damage from nematodes and insects. Research has identified several
the genes associated with insect resistance. With the development of
molecular markers there is a potential to facilitate the isolation and
transfer genes responsible for the pest resistance. Isozymes are a class
of proteins called enzymes, which act within a cell to change
biochemicals from one form to another, to produce energy, or for
structural purposes. An organism's DNA governs the synthesis of
proteins from amino acids. Sometimes a change in the DNA of an
enzyme gene will change the surface charge of the enzyme molecule
without affecting functionality. These charge isomers of an enzyme are
called isozymes and they are used to assay genetic variation. Molecular
markers should not be considered as normal genes, as they usually do
not have any biological effect, and instead can be thought of as constant
landmarks in the genome. They are identifiable DNA sequences, found
at specific locations of the genome, and transmitted by the standard
laws of inheritance from one generation to the next.

Plant breeders would like to predict which biparental

populations will have the largest genetic variance. If the population
genetic variance could be predicted, using coefficient of parentage or
genetic distance estimates based on molecular marker data. Breeders
could choose parents that produced segregating populations with a large
genetic variance.

They rely on a DNA assay, in contrast to morphological

markers, based on visible traits, and biochemical markers, based on
proteins produced by genes. Different kinds of molecular markers could
be used, such as RFLPs, RAPDs, AFLPs, microsatellites and SNPs.
They may differ in a variety of ways - such as their technical
requirements (e.g. whether they can be automated or require use of
radioactivity); the amount of time, money and labour needed; the
number of genetic markers that can be detected throughout the genome;
and the amount of genetic variation found at each marker in a given
population. The information provided by the markers to the breeder will
vary depending on the type of marker system used. Each one has its
advantages and disadvantages. Random amplified polymorphic DNA
(RAPD) markers were first described in 1990. They are detected using
the polymerase chain reaction (PCR), a widespread molecular biology
procedure allowing the production of multiple copies (amplification) of

59
 specific DNA sequences. The analysis for RAPD markers is quick and
simple, although results are sensitive to laboratory conditions.

Restriction Fragment Length Polymorphisms (RFLPs) are markers

detected by treating DNA with restriction enzymes (enzymes that cut DNA
at a specific sequence). For example, the EcoR1 restriction enzyme cuts
DNA whenever the base sequence GAATTC is found. Differences in the
lengths of DNA fragments will then be seen if, for example, the DNA of
one individual contains that sequence at a specific part of the genome (e.g.
tip of chromosome 3) whereas another individual has the sequence
GAATTT (which is not cut by EcoR1). RFLPs were the first molecular
markers to be widely used. Their use is, however, time-consuming and
expensive and simpler marker systems have subsequently been developed.
The aim of this investigation was molecular characterization of soybean
genotypes resistant/ susceptible to cotton leaf worm to be used in marker
selection to help soybean breeders in breeding programs; and also to study
genetic distance among the tested soybean genotypes.

60
 REVIEW OF LITURETIER

A-Diversity of soybean

1-Isozymes

Xu et al. (1999) analyzed wild soybean accessions and cultivated landraces to

reveal the extent of genetic diversity in isozyme markers, RFLP markers of
cytoplasmic DNA and RAPD markers of nuclear DNA. Greater comprehensive
genetic diversity was detected in wild than in cultivated soybean, i.e; the genetic
diversity and genetic dispersion of the wild were 180 (95.2%) and 0.2891 while those
of the cultivated were 154 (81.5%) and 0.2091. On most loci, especially isozyme loci
Idh, Aph, Idh2 and Dia, cytoplasmic DNA RFLPs cp I, cp III, mt IV a and mt IV b,
and nuclear RAPDs, OPAP4-8, OPAP5-1, OPAP9-8 and OPAP 20-8, the wild
soybean differed remarkably from the cultivated ones in allele frequency.

Yoon et al. (2000) studied the variation and geographical distribution of beta -
amylase isoenzymes by isoelectric focusing (IEF) within Korean, Chinese and
Japanese soybean landraces. The amylase of 1152 soybean accessions was separated
into low pI group isoenzymes (Sp1b) and high pI group isoenzymes (Sp1a) in pH 3-10
IEF gel. In pH 4-6.5 gel, isoelectric points were at 5.07, 5.15, 5.25, 5.40 and 5.94, and
h, j and k bands were also found. The distribution of the Sp1a allele (high pI type) was
29.3% in accessions from Korea, 10.1% in those from China, and 6.9% in Japanese
accessions. The frequency of the Sp1a allele was highest in accessions from
Kyungsang province (35%) in Korea, followed by central China (32%) and Honshu
(10%) in Japan.

Tomar and Rajput (2002) tested old and new seeds of three soybean cultivars,
Type-1, Bragg and Clark-63, for viability on the basis of appearance of peroxidase and
esterase isoenzyme markers during seed germination. Enzyme polymorphism was
determined by starch gel electrophoresis. Esterase isoenzymes were observed in old
seeds only for 92 hours of seed germination. Esterase C1 and A1 bands were observed
in germinating new seeds, where as C1 and C2 bands were observed in both old and
new seeds. Activation of esterase in old seeds may be due to degradation of fat, loss of
permeability of membrane, inhibition of respiratory enzyme and non-availability of
cofactors involved in the TCA cycle. The presence of peroxidase isoenzyme was
observed in new seeds only. Peroxidase isoenzyme bands C1, C2 and A4 were
detected at 24 hours after seed soaking, where as bands A3 and A2 were located for
the first time at 48 and 92 hours, respectively. Peroxidase activity in seeds indicated
proper activation of respiratory system leading to the accumulation of toxic
metabolites and photosynthates in the cells, resulting in normal growth. Thus, the
esterase and peroxidase isoenzymes were found to be positively and negatively
correlated, respectively, with the viability of soybean seeds. Thus, these enzymes
could be used as biochemical markers for screening seeds and cultivars for viability.

61
 Funatsuki et al. (2003) investigated the isozyme profiles of antioxidant
enzymes in cultivars and lines with different seed productivity in cool climate
conditions as a step towards understanding the physiological and genetical
mechanisms underlying chilling tolerance in soybean. While no difference in
superoxide dismutase, or catalase isozyme profiles was observed among the cultivars
and lines tested, they found polymorphism in the ascorbate peroxidase isozyme
profile; there were two types, with or without a cytosolic isoform (APX1). The
cultivars and lines lacking APX1 proved more tolerant to chilling temperatures, as
evaluated by yielding ability. The genotype-dependent deficiency of APX1 was
consistent in plants and tissues under various oxidative stress conditions including the
exposure to low-temperatures. In addition, the genetic analysis of progeny derived
from crossing between cultivars differing in the isozyme profile indicated that the
APX1 deficiency is controlled by a single recessive gene (apx1), and is inherited
independently of the genes that have previously been identified for their association
with chilling tolerance. Molecular and linkage analyses suggested that the variant gene
of the APX1-absent genotype coding for a cytosolic APX, which contained a single
nucleotide substitution and a single nucleotide deletion in the coding region, is
responsible for the genotype-dependent deficiency of APX1.

2-Protein in leaves and seeds

Mahmoud et al. (2006) evaluated the extent of the genetic change and its effects
on the seed protein composition of soybean cultivars released during the past 60 years,
representative ancestral cultivars and those derived from selective breeding were
grown in a side-by-side comparison. Total seed protein content, determined by
combustion analysis of nitrogen, revealed a decline in the protein content after decades
of selection and breeding. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
comparison of protein profiles of the soybean cultivars indicated that relative
expression of most of the seed storage proteins had not varied substantially from the
ancestral lines to the present commercial cultivars. There was noticeably less â-subunit
of â-conglycinin, a protein devoid of sulfur amino acids, in the modern cultivars
represented by Mustang, Pioneer 93B09, and Asgrow 3602. Comparison of the amino
acid profiles of soybean seed, a benchmark of the protein’s nutritional quality,
revealed that the ancestral progenitor, G. soja, was significantly higher in cysteine,
glutamic acid, histidine, and arginine than either the ancestral or the modern cultivars.
Selective breeding over the past 60 years minimally affected the overall amino acid
composition. The degree of divergence in the DNA sequence of the genes encoding
glycinin and â-conglycinin in the ancestral and modern cultivars was investigated
using Southern hybridization and the polymerase chain reaction. Even though some
restriction fragment polymorphisms could be detected, overall, the banding patterns
were remarkably similar among the ancestral cultivars and those derived from them,
suggesting a high degree of conservation of seed-storage protein genes. The results of
our study suggest that selection and breeding for yield during the past 60 years had no
major influence on the protein composition, ostensibly because of limited genetic
diversity among the parental lines.

Zarkadas et al. (2007a) determined the protein quality of 11 null and 2 tofu
soybean genotypes from their total protein content, their amino acid composition, and
their glycinin and b-conglycinin contents. There were highly significant differences (P

62
< 0.001) in their total storage proteins, and amino acid contents. Total protein among
these genotypes ranged from 33 to 37%, with arginine being the third highest amino
acid (7.4–10.9 g/100 g protein) followed by glutamic and aspartic acids. Methionine
accounted for only 1.6–2.4 g/ 100 g of protein. All genotypes contained a good balance
of essential amino acids (EAA9), ranging from 43.5 to 47.3% of the total protein,
limited only in methionine and possibly threonine and valine. Two dimensional gel
electrophoretic (2-DE) reference maps, using narrow range immobilized pH gradient
(IPG) strips, revealed unique differences in the proteome, and subunit expression of
glycinin and b-conglycinin, among these null genotypes, which can then be correlated
with their protein quality. Out of a total of 111 basic (pH 6–11), and 223 acidic (pH 4–
7) protein spots separated by 2-DE, 41 soybean storage protein spots were excised, and
identified by liquid chromatography on-line with electro spray LCQ DecaXP tandem
quadrupole time-of-flight mass spectrometry (LC/MS/MS). These methods will enable
accurate evaluation of protein quality in soybeans, based on their protein digestibility-
corrected amino acid score, assessment of the genetic variability of soybean genotypes,
and serve as very effective tools for assisting plant breeders in their selection of high
quality soybean varieties.

Zarkadas et al. (2007b) determined protein quality of commercial soybeans

varieties from their total protein content, their amino acid composition and from the
ratio of glycinin to b-conglycinin, the major seed storage protein components. In this
study 14 commercial soybean cultivars were assessed. There were significant
differences in storage protein composition (P < 0.05) and in their valine, proline and
phenylalanine contents (P < 0.01 to P < 0.001). Mean protein values among these
varieties ranged from 29.8% to 36.1%. The total amino acid nitrogen (AAN) ranged
from 89.6 to 95.1 g AA/16 g of nitrogen, corresponding to nitrogen values from 16.5
to 17.9 g AAN/100 g protein. All varieties contained a good balance of essential amino
acids (EAA9), limited only in methionine. Two-dimensional gel electrophoretic (2-
DE) separations, led to the establishment of high-resolution proteome reference maps,
enabling polypeptide chain identification and calculation of the ratio of the constituent
glycinin and b-conglycinin storage proteins of soybean. This method enables the
assessment of the genetic variability of the soybean cultivars, which can then be
correlated with their protein quality and food processing properties. These three
methods can be used as very effective tools for assisting plant breeders in their
selection of high quality soybean varieties.

3-Randomized Amplified polymorphic DNA (RAPD):

Chen et al. (1994) assayed 3 local varieties, 4 improved cultivars, 8 breeding

lines, 2 pairs of isogenic lines differing in seed coat colour and 1 wild (G. soja)
soybean accessions were for isoenzymes, restriction fragment length polymorphism
(RFLP) and random amplified polymorphic DNA (RAPD). Some 62.5% of
isoenzymes, 28.3% of RFLPs and 55.0% of RAPD primers revealed polymorphisms
(at 10, 25 and 17 polymorphic loci, respectively). In cluster analyses, the RAPD assay
revealed the most clusters but it is recommended that all 3 methods should be used to
complement each other. Each method had advantages and disadvantages. The
isoenzyme assay was the quickest but the availability of enzymes and polymorphic
loci was limited. RFLP had the most polymorphic loci but was the most time
consuming. RAPD had the advantages of sufficient polymorphic loci and minimum

63
test time but caution was needed during sample preparation and reaction parameters to
make the results reproducible.

Grant and Soliman (1999) evaluated 19 accessions using 4 sets of specific

primers and 3 sets of RAPD primers. The potential of the RAPD assays was further
increased by combining two primers in a single PCR. The fragments generated by the
two assays discriminated 10 wild species by banding profiles. The size of the
amplified DNA fragments ranged from 100 to 2100 base pairs. The resolved PCR
products yielded highly characteristic and homogeneous DNA fingerprints. The
fingerprints were useful not only for investigating genetic variability but also for
further characterizing the wild soybean species by detecting inter- and intra-specific
polymorphisms, constructing dendrograms defining the phylogenetic relationships
among these species, and identifying molecular markers for the construction of genetic
linkage maps. Furthermore, unique markers distinguishing particular species were also
identified. Thus, it is expected that PCR will have great relevance for taxonomic
studies.

Giancola et al. (2002) used the molecular markers such as random amplified
polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP) and
simple sequence repeats (SSR) as descriptors to characterize and differentiate a set of
100 soybean varieties of commercial use in Argentina was taken as a leading case
study for plant variety protection (PVP) purposes. Sixteen morphological traits were
recorded to compare pedigree relationships among varieties with information derived
from conventional descriptors and molecular markers. Analysis of 109 polymorphic
loci confirmed the rather low genetic variability of commercial soybean germplasm.
Still, genetic fingerprinting of the 100 varieties could be established. Calculated
similarity indexes were dependent on the technique, ranging from 0.262 (SSR), 0.407
(RAPD), 0.400 (AFLP) and 0.574 (morphological traits). Dendrograms generated from
morphological data matrix showed low value correlation with kinship coefficient
matrix (r=0.216). Still, they were suitable to identify and differentiate each of the 100
varieties analyzed which was not possible with RAPD or AFLP markers using
comparable numbers of polymorphic loci. SSR data showed the best fit to pedigree
information (r=0.353), while maintaining an association to morphologically based
separation. Results suggest that the four techniques describe genetic variability in
different and specific ways. A combination of SSR and morphological descriptors
show the best compromise of regarding genetic relationships and the needs of clear
classification for PVP and may help to establish minimum genetic distances for
distinctness within PVP Office definition.

Pham et al. (2003) resolved PCR amplification of total genomic DNA using 20
random primers yielded scorable amplification products. The size of amplification
producted on agarose ranged between 0.3 and 3.0 kb. Seventeen primers detected
polymorphism of all soybean accessions analyzed in the study. The reliability of
RAPD data for the classification of soybean was tested by subjecting the data to
unweighted pair group method analysis of arithmetic means (UPGMA) in order to
explore the possibility of classifying the cultivars using RAPD analysis. The
phenotypic analysis of primers revealed the presence and extent of genetic similarities
among the cultivars. The cluster analysis of RAPD data separated out the cultivars into
five distinct clusters. However RADP data separated out OMDN varieties into three
clusters. Cluster 2 included OMDN43 and OMDN29, cluster 3: OMDN34 and

64
 OMDN33, cluster 4: OMDN32, OMDN30,OMDN31. One genotype HL2 was
separated farthest apart in the phenogram. This study confirm a close relationship
between cultivars and evaluated genetic variation in 50 germplasm accessions of
soybean, provides information about amount and distribution of genetic diversity
within and among germplasm.

Kim et al. (2004) used random amplified polymorphic DNA (RAPD) utilizing
1000 operon random primers to identify markers linked to the Ti locus in 94 bulked F2
lines derived from the soybean cross Jinpumkong (with Kunitz trypsin inhibitor (KTI))
x C242 (without KTI). Four RAPD primers (OPAC12, OPAR15, OPO12 and OPC08)
were linked to the Ti locus, with OPO12 linked very closely to the gene for KTI
protein (16 cM).

4-Restriction Fragment Length Polymorphism (RFLP):

Myong et al. (2006) evaluated levels of genetic diversity of the central Chinese
accessions (n = 107) by comparing previously studied ancestors and milestone
cultivars (NAC, n = 64) in the USA. Finally, we estimated the degree of genetic
differentiation among six Chinese provinces (Anhui, Gansu, Henan, Jiangsu, Shaanxi,
and Shanxi). There was significant difference between pre-selected and random
accessions in terms of the mean number of alleles per locus (A, 2.44 vs. 2.13) and
allelic richness (2.26 vs. 2.10). However, the former (He = 0.393) maintained levels of
gene diversity or expected heterozygosity (He) similar to the latter (He = 0.394). This
is attributed to the fact that many alleles found in pre-selected accessions were present
at very low frequencies (mean effective number of alleles, Ae = 1.72). A broader range
of alleles detected in the pre-selected accessions suggests that pre-selection of
accessions screened from isozyme data may be useful for selecting germplasm
collections with a greater number of RFLP alleles. The central Chinese accessions
maintained a significantly higher level of RFLP genetic diversity than the NAC (He =
0.405, A = 2.50 for central China vs. He = 0.339, A = 2.08 for the USA). They
detected significant genetic differentiation among the six provinces (mean GST =
0.133). These results suggest that Chinese germplasm accessions from various regions
or provinces in the USDA germplasm collection could be used to enhance the genetic
diversity of US cultivars.

B-DNA markers and Quantitative Trait Loci (QTL) analysis for soybean
Diers et al. (1992) expanded soybean RFLP map and to identify quantitative
trait loci (QTL) in soybean [Glycine max (L.) Merr.] for seed protein and oil content.
The study population was formed from a cross between a G. max experimental line
(A81-356022) and a G. soja Sieb. and Zucc. Plant introduction (PI 468916). A total of
252 markers was mapped in the population, forming 31 linkage groups.Protein and oil
content were measured on seed harvested from a replicated trial of 60 F2-derived lines
in the F3 generation (F2:3 lines). Each F2:3 line was genotyped with 243 RFLP, five
isozyme, one storage protein, and three morphological markers. Significant (P < 0.01)
associations were found between the segregation of markers and seed protein and oil
content. Segregation of individual markers explained up to 43% of the total variation

65
for specific traits. All G. max alleles at significant loci for oil content were associated
with greater oil content than G. soja alleles. All G. soja alleles at significant loci for
protein content were associated with greater protein content than G. max alleles.

Hnetkovsky et al. (1996) used molecular markers to identify and locate alleles
of chromosomal segments associated with field resistance to SDS in adapted soybean
genotypes. Seventy polymorphic DNA markers were compared with SDS response
among 100 F5-F9 recombinant inbred lines derived from a cross between SDS-resistant
Forrest and SDS-susceptible Essex. SDS disease incidence (DI), disease severity (DS),
and yield were determined in replicated, FSA-infested test sites during 4 yr
encompassing five locations with recombinant inbred lines from the F5-F7 to F5-F11.
Two separate chromosomal segments identified by two RAPD markers, OO05250 and
OC01650, were found to be associated with mean SDS response across five locations
as well as within each of the five locations. These two (QTL) jointly accounted for
34% of total phenotypic variability in mean DI. OC01650 was significantly associated
with mean DS and yield and was putatively assigned to linkage group N. The
beneficial allele was derived from the resistant parent Forrest. OO05250 was not
significantly associated with mean DS or yield and was putatively assigned to linkage
group C. The beneficial allele was derived from the susceptible parent Essex.
Molecular markers can be used to define alleles of chromosomal segments conferring
resistance to SDS in several environments and may allow efficient selection of
resistant genotypes with good yield potential for FSA-infested fields.

Helms et al. (1997) developed 3 biparental soybean (Glycine max) populations

by crossing parents that were closely related, based on pedigree relationships. Three
additional biparental populations were developed by crossing parents that were
assumed to be unrelated. The genetic variance of each population was estimated for
yield, lodging, physiological maturity, and plant height. Coefficient of parentage was
calculated for each pair of parents used to develop the segregating populations.
Genetic distance was determined, based on the number of random amplified
polymorphic markers (RAPD) that were polymorphic for each pair of parents. Genetic
distance was not associated with the coefficient of parentage or the magnitude of the
genetic variance. The genetic variance pooled across the three closely related
populations was smaller than the genetic variance pooled across the three populations
derived from crossing unrelated parents for all four traits that were evaluated.

Schuster et al. (2001) identified the resistance of soybean (Glycine max) to

cyst nematode (SCN) (Heterodera glycines), one of the most destructive pathogens
affecting soybean, involves a complex genetic system. The objective of this work was
to identify and map QTLs for resistance to SCN Race 14 with the aid of molecular
markers. BC3F2:3 and F2:3 populations, both derived from an original cross between
resistant soybean cv. Hartwig and the susceptible line BR-92-31983 were screened for
resistance to SCN Race 14. Four microsatellite (Satt082, Sat_001, Satt574 and
Satt301) and four RAPD markers (OPAA-11795, OPAE-08837, OPR-07548 and
OPY-072030) were identified in the BC3F2:3 population using the bulked segregant
analysis (BSA) technique. These markers were amplified in 183 F2:3 families and
mapped to a locus that accounts for more than 40% of the resistance to SCN Race 14.
Selection efficiency based on these markers was similar to that obtained with the
conventional method. In the case of the microsatellite markers, which identify
homozygous resistant genotypes, the efficiency was even higher. This new QTL has

66
been mapped to the soybean linkage group D2 and, in conjunction with other QTLs
already identified for SCN resistance, will certainly contribute to understanding of the
genetic basis of resistance of this important disease in soybean.

James et al. (2001) noted that, there has been limited success over the past 30
yr in the development of superior soybean cultivars [Glycine max (L.) Merr] with
insect resistance. Success may be hampered by the quantitative nature of resistance and
by linkage drag from resistant plant introduction (PI) donor parents. Soybean insect
resistance quantitative trait loci (SIR QTLs) have been identified from PI 229358 and
PI 171451 by restriction fragment length polymorphism (RFLP) analysis. The
objective of this study was to tag the SIR QTLs from PI 229358 with simple sequence
repeat (SSR) markers and to determine the extent to which the SIR QTLs have been
introgressed in registered cultivars, germplasm releases, or breeding lines that have
resistance derived from this PI or from PI 171451. Marker analysis defined intervals by
5 centimorgans (cM) or less for a SIR QTL on linkage group D1b (SIR-D1b), and for
SIR-G, SIR-H, and SIR-M. SIR QTLs were tracked through pedigrees by evaluating
the inheritance of PI alleles at marker loci tightly linked to the QTLs during the
phenotypic selection for insect resistance. It was inferred that at least 13 of the 15 SIR
genotypes studied had introgressed SIR-M. PI genome introgression around SIR-M
was measured to assess linkage drag. Some genotypes exhibited a dramatic reduction
in the amount of linked PI genome, which likely occurred in response to phenotypic
selection for agronomic performance as a means of reducing linkage drag. Only a few
genotypes were inferred to possess SIR-G or SIR-H, and no genotypes possessed SIR-
D1b. The results of this study indicate that marker-assisted selection for SIR QTLs is
needed to introgress these loci into elite genetic backgrounds.

Cairo et al. (2002) identified molecular markers linked to the juvenile locus in
soybean. Soybean cultivars carrying the 'long juvenile trait' show a delayed flowering
response under short day conditions. The incorporation of this character into genotypes
of agronomic interest may allow a broader range of sowing dates and latitudes for a
single cultivar adaptation. Experiments were carried out using two pairs of near
isogenic lines (NILs), namely NIP 1 and NIP 2, which differ in the presence of the
long juvenile trait, and RAPD markers. Four hundred primers were first screened to
find polymorphism associated with the trait. Additional differences between NILs
were sought by digesting the genomic DNA with five restriction enzymes.
Polymorphic fragments detected between NILs were tested for linkage to the juvenile
locus in the corresponding F2 segregating populations. Marker bc357-HaeIII was
linked (chi 2L=46.316) to the juvenile locus with an estimated recombination
frequency of 0.13+or-0.03 in one of the genetic backgrounds studied. The fragment
was cloned, sequenced and converted into a sequence characterized amplified region
(SCAR) marker. Moreover, bc357-HaeIII was used as RFLP probe. Both SCAR and
RFLP generated markers linked to the juvenile locus in the two genetic backgrounds
analysed. Results presented in this work can be utilized for both the localization of the
gene associated with the character and for tagging the juvenile trait in soybean
breeding programmes.

Carvalho et al. (2002a) reported that, the soybean stem canker is a serious
soybean (Glycine max) disease caused by the fungi Diaporthe phaseolorum f. sp.
meridionalis/Phomopsis phaseoli f. sp. meridionalis. They have crossed the soybean

67
resistant line UFV 91-61 with the susceptible cultivar Paranaiba, and analyzed the F2
population in order to understand the genetics underlying resistance to this pathogen
(isolate CH8) and to identify molecular markers linked to it. The results indicated that
a single dominant gene controlled resistance to this isolate. RAPD analysis in the F2
population identified two DNA fragments of approximately 1,150 and 1,320 bp of
primer OPAB19 linked in the repulsion and coupling phase at 4.7 cM of the resistance
gene of line UFV 91-61. These markers will be very useful for monitoring the
introgression of this gene into soybean adapted cultivars, and open up the possibility
for a systematic search for markers linked to other resistance genes for stem canker
that could be pyramided into the same genetic background.

Carvalho et al. (2002b) identified molecular markers associated with the

resistance to race 3 of the SCN. Two microsatellites (Satt187 and Satt309) and three
RAPD markers (OPAG-05946, OPF-041038, and OPAQ-011987) were found which
explained 31.3, 28.9, 13.8, 11.4 and 9.9%, respectively, of the phenotypic resistance
variation to race 3 of the SCN. However, by multiple regression analysis, with the
elimination of markers which least contributed to an explanation of the resistance, the
most significant combination occurred with the inclusion of the markers Satt187 and
Satt309, which together explained 75.2% of the resistance. These markers were
mapped in two distinct regions. One located in the linkage group G with the markers
OPAG-05846, OPF-041038, OPAQ-011987 and Satt309 at an interval of 34.7 cM, and
another located in the group A2 with the marker Satt187. Inheritance studies have
shown those two dominant genes control resistance to SCN, in the population
analysed.

Song et al. (2004) developed 391 simple sequence repeat (SSR) markers
designed from genomic DNA libraries, 24 derived from existing GenBank genes or
ESTs, and five derived from bacterial artificial chromosome (BAC) end sequences. In
contrast to SSRs derived from EST sequences, those derived from genomic libraries
were a superior source of polymorphic markers, given that the mean number of tandem
repeats in the former was significantly less than that of the latter (P<0.01). The 420
newly developed SSRs were mapped in one or more of five soybean mapping
populations: 'Minsoy' x 'Noir 1', 'Minsoy' x 'Archer', 'Archer' x 'Noir 1', 'Clark' x
'Harosoy', and A81-356022 x PI468916. The JoinMap software package was used to
combine the five maps into an integrated genetic map spanning 2,523.6 cM of
Kosambi map distance across 20 linkage groups that contained 1,849 markers,
including 1,015 SSRs, 709 RFLPs, 73 RAPDs, 24 classical traits, six AFLPs, ten
isozymes, and 12 others. The number of new SSR markers added to each linkage
group ranged from 12 to 29. In the integrated map, the ratio of SSR marker number to
linkage group map distance did not differ among 18 of the 20 linkage groups;
however, the SSRs were not uniformly spaced over a linkage group, clusters of SSRs
with very limited recombination were frequently present. These clusters of SSRs may
be indicative of gene-rich regions of soybean, as has been suggested by a number of
recent studies, indicating the significant association of genes and SSRs. Development
of SSR markers from map-referenced BAC clones was a very effective means of
targeting markers to marker-scarce positions in the genome.

Rector et al. (2004).used 139 restriction fragment length polymorphisms

(RFLPs) were used to construct a soybean (Glycine max L. Merr.) genetic linkage map

68
and to identify quantitative trait loci (QTLs) associated with resistance to corn
earworm (Helicoverpa zea Boddie) in a population of 103 F2-derived lines from a
cross of 'Cobb' (susceptible) and PI229358 (resistant). The genetic linkage map
consisted of 128 markers which converged onto 30 linkage groups covering
approximately 1325 cM. There were 11 unlinked markers. The F2-derived lines and
the two parents were grown in the field under a plastic mesh cage. The plants were
artificially infested with corn earworm and evaluated for the amount of defoliation.
Using interval-mapping analysis for linked markers and single-factor analysis of
variance (ANOVA), markers were tested for an association with resistance. One major
and two minor QTLs for resistance were identified in this population. The PI229358
allele contributed insect resistance at all three QTLs. The major QTL is linked to the
RFLP marker A584 on linkage group (LG) 'M' of the USDA/Iowa State University
public soybean genetic map. It accounts for 37% of the total variation for resistance in
this cross. The minor QTLs are linked to the RFLP markers R249 (LG 'H') and
Bng047 (LG 'D1'). These markers explain 16% and 10% of variation, respectively.
The heritability (h2) for resistance was estimated as 64% in this population.

Roger and Walker (2005) reported that, insect resistance in soybean has been
an objective in numerous breeding programs, but efforts to develop high yielding
cultivars with insect resistance have been unsuccessful. Three Japanese plant
introductions, PIs 171451, 227687 and 229358, have been the primary sources of
insect resistance alleles, but a combination of quantitative inheritance of resistance and
poor agronomic performance has hindered progress. Linkage drag caused by co-
introgression of undesirable agronomic trait alleles linked to the resistance quantitative
trait loci (QTLs) is a persistent problem. Molecular marker studies have helped to
elucidate the numbers, effects and interactions of insect resistance QTLs in the
Japanese PIs, and markers are now being used in breeding programs to facilitate
transfer of resistance alleles while minimizing linkage drag. Molecular markers also
make it possible to evaluate QTLs independently and together in different genetic
backgrounds, and in combination with transgenes from Bacillus thuringiensis.

Junyi (2006) suggested the major gene and polygene mixed inheritance model
based on the traditional polygene inheritance model of quantitative traits. The model
was considered as a general one, while the pure major gene and pure polygene
inheritance model was a specific case of the general model. Based on the proposed
theory, the author established the segregation analysis procedure to study the genetic
system of quantitative traits of plants. At present, this procedure can be used to
evaluate the genetic effect of individual major genes (up to two to three major genes),
the collective genetic effect of polygene, and their heritability value. This paper
introduces how to establish the procedure, its main achievements, and its applications.
An example is given to illustrate the steps, methods, and effectiveness of the
procedure.

C-Pest diversity

Li et al. (1996) studied the feasibility of developing RAPD-based diagnostic

dot blot tests to separate field isolates of soybean cyst nematode (Heterodera glycines)
with different virulence to resistant cultivars of soybean. A RAPD primer was found to
separate two northern Indiana isolates of the nematode with similar virulence toward

69
resistant soybean lines from two southern Indiana isolates with different virulence
characteristics and a molecular marker probe was developed for usage with dot blots.
The study demonstrates the feasibility of developing a rapid-based test for use in
diagnosing larger groups of field isolates of nematodes that share common virulence
characteristics toward resistant cultivars.

Rector et al. (1998) used 139 restriction fragment length polymorphisms

(RFLPs) to construct a soybean (Glycine max L. Merr.) genetic linkage map and to
identify quantitative trait loci (QTLs) associated with resistance to corn earworm
(Helicoverpazea Boddie) in a population of 103 F2-derived lines from a cross of
ÔCobbÕ (susceptible) and PI229358 (resistant). The genetic linkage map consisted of
128 markers which converged onto 30 linkage groups covering approximately 1325
cM. There were 11 unlinked markers. The F2-derived lines and the two parents were
grown in the Þeld under a plastic mesh cage near Athens, Ga., in 1995. The plants
were artiÞcially infested with corn earworm and evaluated for the amount of
defoliation. Using interval-mapping analysis for linked markers and single-factor
analysis of variance (ANOVA), markers were tested for an association with resistance.
One major and two minor QTLs for resistance were identiÞed in this population. The
PI229358 allele contributed insect resistance at all three QTLs. The major QTL is
linked to the RFLP marker A584 on linkage group (LG) ÔMÕ of the USDA/Iowa
State University public soybean genetic map. It accounts for 37% of the total variation
for resistance in this cross. The minor QTLs are linked to the RFLP markers R249 (LG
ÔHÕ) and Bng047 (LG ÔD1Õ). These markers explain 16% and 10% of variation,
respectively. The heritability (h2) for resistance was estimated as 64% in this
population.

Yuan and Yang (1998) analyzed the isoenzyme patterns of 10 physiological

races of C. sojinum by PAGE. Significant differences of electrophoretic patterns were
observed. In general, the similar coefficients among 10 races were approx. 0.22-0.96.
The average coefficient of similarity was low. The results suggested that the
isoenzyme pattern of physiological races of C. sojinum were useful genetic markers
which were independent of virulence.
Yencho et al. (2000) examined how molecular markers can be used to increase
our understanding of the mechanisms of plant resistance to insects and develop insect
resistant crops. They provide a brief description of the types of molecular markers
currently being employed, and describe how they can be applied to identify and track
genes of interest in a marker-assisted breeding program. A summary of the work
reported in this field of study, with examples in which molecular markers have been
applied to increase understanding of the mechanistic and biochemical bases of
resistance in potato and maize plant/pest systems, is provided. We also describe how
molecular markers can be applied to develop more durable insect-resistant crops.
Finally, we identify key areas in molecular genetics that we believe will provide
exciting and productive research opportunities for those working to develop insect
resistant crops.

Silva et al. (2000) found an association with H. glycines eggs and cysts,
although species of Fusarium have been the most prevalent. In many areas of central
Brazil, the sudden death syndrome, caused by F. solani, has become quite frequent and
a serious pathogen of soybean (Glycine spp.). The objective of this work was to
characterize isolates of Fusarium by analysing DNA polymorphisms, using RAPD

70
molecular markers. Eleven isolates of F. solani and F. oxysporum obtained from H.
glycines eggs, five F. solani isolates from soybean plants, and four saprophytic isolates
of F. solani were grown on BDA medium. Following DNA extraction, PCR
amplification was conducted with 17 random primers, for each of the isolates. Cluster
analysis of the genetic distances obtained allowed separation of the isolates into three
groups. Group I represented both the isolates of F. solani which infect nematode eggs
and those which are saprophytic. Group II comprised only the isolates of F. solani that
cause the sudden death syndrome in soybean. Group III comprised isolates of F.
oxysporum. The study also allowed identification of bands which are specific to each
group, enabling the separation of isolates of F. solani with beneficial/neutral or
detrimental traits to soybean.

Fenille et al. (2002) found that Rhizoctonia solani causes pre- and post-
emergence damping-off, root and hypocotyl rot and foliar blight in soybean. Foliar
blight has resulted in yield losses of 31-60% in north and northeast Brazil. The aim of
this study was to characterize isolates of R. solani associated with soybean in Brazil.
Among 73 Rhizoctonia isolates examined, six were binucleate and 67 were
multinucleate. The multinucleate isolates were characterized according to hyphal
anastomosis reaction, mycelial growth rate, thiamine requirement, sclerotia
production, and RAPD molecular markers. Four isolates that caused hypocotyl rot
belonged to AG-4 and using RAPD analysis they grouped together with the HGI
subgroup. Another isolate that caused root and hypocotyl rots was thiamine
auxotrophic, grew at 35 degrees C, and belonged to AG-2-2 IIIB. All 62 isolates that
caused foliar blight belonged to AG-1 IA. RAPD analysis of R. solani AG-1 IA
soybean isolates showed high genetic similarity to a tester strain of AG-1 IA,
confirming their classification. The teleomorph of R. solani, Thanatephorus cucumeris
was produced in vitro by one AG-1 IA isolate from soybean. The AG-4 and AG-2-2
IIIB isolates caused damping-off and root and hypocotyl rots of soybean seedlings cv.
'FT-Cristalina', under greenhouse conditions. The AG-2-2 IIIB isolate caused large
lesions on the cortex tissue, that was distinct from the symptoms caused by AG-4
isolates. The AG-1 IA isolates caused foliar blight in adult soybean plants cv. 'Xingu'
under the greenhouse and also in a detached-leaf assay.

Pioli et al. (2003) collected isolates from the Diaporthe/Phomopsis (D/P)

complex in the main soybean producing area of Argentina during the 1996-97, 1997-
98, and 1998-99 growing seasons. Twenty-three morphologic characters related to
type of colonies, stroma, pycnidia and conidia, presence of perithecia, and asci length
were studied by principal component analysis (PCA). Genomic DNA were analysed
by the random amplified polymorphic DNA (RAPD) technique. From both studies, 18
isolates were identified as D/P complex and grouped in four major taxa: (i) D.
phaseolorum var. meridionalis, (ii) D. phaseolorum var. caulivora, (iii) D.
phaseolorum var. sojae, and (iv) Phomopsis longicolla. In addition to distinguishing
interspecific and intraspecific variability, molecular markers allowed the detection of
differences among isolates within the same variety. Pathogenicity was assayed in the
greenhouse, by the toothpick method, inoculating the D/P isolates to soybean
genotypes carrying different resistance genes (Rdc1, Rdc2, Rdc3, and Rdc4) against
soybean stem canker (SSC). Pathogenic analysis distinguished two main groups: (i)
the SSC-producing isolates, including D. phaseolorum var. meridionalis and D.
phaseolorum var. caulivora, and (ii) the non-SSC-producing isolates, including D.
phaseolorum var. sojae and P. longicolla. Cultivar RA-702 (susceptible control) was

71
compatible with both D. phaseolorum var. meridionalis and D. phaseolorum var.
caulivora isolates; meanwhile, Tracy-M (Rdc1 and Rdc2 genes) was incompatible with
D. phaseolorum var. meridionalis but compatible with D. phaseolorum var. caulivora
isolates. The fact that Rdc1 and Rdc2 together (as in Tracy-M) confer an almost
immune reaction to all assayed isolates of D. phaseolorum var. meridionalis but were
ineffective against the D. phaseolorum var. caulivora isolates evaluated suggests that
the virulence or avirulence genes in D. phaseolorum var. meridionalis and D.
phaseolorum var. caulivora are different. Moreover, physiological races of D.
phaseolorum var. meridionalis were detected by using differential soybean genotypes
carrying distinct single Rdc genes. As far as we know, this is the first report on the
existence of physiological races of D. phaseolorum var. meridionalis in South
America. Selective pressure due to deployment of resistant host cultivars may have
changed the frequency of the virulence or avirulence genes within the population of D.
phaseolorum var. meridionalis. On the whole, our results show that pathogenic
variability of D. phaseolorum in the core soybean-producing area of Argentina is
higher than previously recognized.

Zhu et al. (2006) utilized of native insect resistance genes can be an important
component for managing insects in soybean [Glycine max (L.) Merr.]. A major
quantitative trait locus (QTL-M) for insect resistance from PI 229358, controlling
antibiosis and antixenosis, was previously identified on linkage group (LG) M and was
found to increase the effectiveness of a Bacillus thuringiensis (Bt) transgene in
soybean. The objectives of this study were to fine-map QTL-M using recombinant
substitution lines (RSLs) identified from a ‘Benning’ backcross population, and to
evaluate the main effects and the epistatic interactions between QTL-M and other
resistance QTLs on LGs G and H using near-isogenic lines (NILs) in a Benning
genetic background. The effect of QTL-M was still detectable in the Benning NILs
when they were evaluated for resistance to corn earworm [CEW, Helicoverpa zea
(Boddie)]. The two minor resistance QTLs only provided insect resistance when QTL-
M was also present in the Benning NILs. The QTL-M was fine-mapped to an
approximately 0.52-cM region after the first round of phenotyping the RSLs for
resistance to CEW and soybean looper [SBL, Pseudoplusia includens (Walker)]. These
results should increase the feasibility of cloning QTL-M and help guide the
development of insect resistant soybean cultivars.

72
 MATERIALS AND METHODS

Leaf Izozymes native PAGE:

The isozyme variation among the 14 genotypes was studied using native
polyacrylamide gel electrophoresis for the esterase, peroxidase and malta
dehydrogenase as per the method described. Native-polyacrylamid gel electrophoresis
(Native-PAGE) was used according to Soltis and Pamela Soltis, 1990 to visualize
some isozymes as a follow:

1-Stock Solutions:
A-Extraction buffer
50mMTris-HCl buffer, pH7.5 is filtered 0.61g
100%Glycerol 5ml
14mM ß- mercaptoethanol (0.1%V/V) 100ul
H2O(d.w) up to 100ml

B-Acrylamide stock
Acrylamide 29.2g
N,N methylene bis-acrylamide 0.8g
H2O(d.w) up to 100 ml
The stock solution was filtered and kept at 4°C.

C-Tris –Borate-EDTA for isozymes, pH8.7 as a follow:

Electrode Buffer stock for running:

0.18M Tris 21.80g

0.1M boric acid 6.18g
0.004 M EDTA-Na2 salt 0.15g
H2O Up to 1000 ml
The solution kept at 4°C and diluted to3 or4 litter with distilled
water.
D-Ammonium Peroxide Sulfate solution (APS10% W/V).
This solution was prepared by dissolving 0.25g APS in2.5ml
distilled water. This solution is unstable and must be prepared fresh
before use.
E-TEMED
Used before work directly, and it is stable when kept at 4°C in a
dark bottle.

2-Gel Buffer:
This buffer was prepared by dilution of one part of electrode
buffer stock (before dilution) with three parts H2O according to Soltis
and Pamela Soltis, 1990. This solution was filtered and kept at 4°C.
3 -Extraction of isozymes:
Freshly tissue of each sample was removed. About 0.5g of each
sample was extracted with 1ml cold extraction buffer (pH 7.5). Each
sample was vortexed for 15 seconds by electric vortex and centrifuged
for 10 min at 10.000 rpm twice at 5°C.The supernatant was transferred

73
 to new eppendorf tube and kept at-20°C until use for electrophoretic
analysis.
4-Gel Preparation:
Polyacrylamide standard gel for isozymes at pH 8.7 as follows:

Stocks Gel 8% Gel 9%

Acrylamide stock 26.5 mL 30 mL
Gel buffer 25 mL 25 mL
H2O(d.w) up to 100 mL 100 mL
APS 2 mL 2 mL
TEMED 80uL 80uL

The gel was poured on the plate and 15 well comb was placed immediately
and polymerization was token about 15 min.
5- Application samples:
A volume of 80uL extract of each sample was mixed with 30uL loading
dye(bromophenol blue), then a volume of 100 uL from this mixture
applied to each well.
6-Electrophoretic Conditions:
The gel were completely covered with electrode buffer. The electrodes
were connected to power supply and adjust at 200V for two hours.
7-Isozymes assay:
The gels were stained after electrophoresis according each system and
incubated at 37°C in the dark after adding the appropriate substrate and
staining solution. The staining solutions were listed as follow:
Peroxidase:
0.04M caticol solution 25ml
H2O2 (20volume) 15 ml
Phosphate buffer pH=6(0.1MNaH2PO4 and0.01M Na2HPO4) 50ml
Ingredients were combined and poured over gel. Enzyme activity was
expressed from60-120 second after the substrate was added.
Esterase:
100mMNa-phosphate,pH6(39ml monobasic+61dibasic) 50 ml
ß-Naphthyl acetate(0.05g) dissolve in( 1aceton:1dw) 25mg
α-Naphthyl acetate(0.05g) dissolve in( 1aceton:1dw) 25 mg
Fast blue RR salt 50 mg(1ml)
(0.15g dissolve in 80ml phosphate buffer and filter) then
put the gel then added substrates.
Ingredients were combined and poured over gel, incubated at 37°C in the dark until
brown bands appeared. Rinsed and fixed in 3% acetic acid.
After staining gels were photographed and dendogram were calculated using computer
soft wear statistician.
Malate dehydrogenase (MDH)
It was detected and photographed in situ through the use of specific activity
stains according to Soltis and Pamela Soltis, 1990 as follows:

50 mM Tris-HCl, pH 8.5 50 ml
NAD 10 mg (1ml)
Malic acid 150 mg (1ml)

74
NBT or MTT 10 mg (1ml)
PMS 2 mg (0.4ml)

Malic acid was added as a neutralized (with Na OH) aqueous solution.

Ingredients were combined and poured over gel, incubated at room temperature until
blue bands.

SDS-PAGE Leaf and Seed Protein Electrophoresis:

Protein fractionation was performed on vertical slab (20 x 22 x 0.2 cm) Hoefer
E600 Amersham Pharmacia biotech according the method of Laemmli (1970) and
modified by Studier (1973). It was to study the banding patterns of the studied
cultivars including the leaf and seeds.
1-Stock Solutions:
A-Gel buffers
Resolving gel buffer (4xTris-Hcl/SDSpH8.8)

1.5M Tris- base 18.20g.

(Tris hydroxymethyl amino – methane)
SDS 0.40g
H2O (d.w.) up to 100.00
1- Tris was dissolved in 75ml H2O and shaken well magnetic stirrer.
2-pH was adjusted to 8.8 by HCl and completed up to 100 with distilled water.
3-The solution was filtrated through filter paper.
4-0.4g SDS was added and solution was stored 4C for up to one month.
Stacking gel buffer (4xTris-Hcl/SDSpH6.8)
0.5M Tris- base 6.00g
SDS 0.40g
H2O (d.w.) up to 100.00
1- Tris was dissolved in 75ml H2O and shaken well magnetic stirrer.
2-pH was adjusted to 6.8 by HCl and completed up to 100 with distilled water.
3-The solution was filtrated through filter paper.
4-0.4g SDS was added and solution was stored 4C for up to one month.
SDS Electrophoretic buffers
Glycine 43.00 g
(0.125) M Tris- base 9.00 g
(10%,W/V) SDS 3.00g
H2O (d.w.) up to 3.00L
1-SDS were dissolved in500 ml distilled water and shaken well with magnetic starrier.
2-Then, solution was completed up to 3 liters distilled water.
3-The stock solution was kept at 4°C.

Sample extraction buffers

Tris-HCl buffer, pH 7.5
(50mM) Tris-HCl pH 7.5 0.61g
(15%,V/V)Glycerol 5.0ml
(0.1%,V/V)(14mM) a- mercaptoethanol 100.00ul
H2O (d.w.) up to 100.00ml

SDS Sample buffer,2X (pH6.8)

75
 4X Tris HCl/SDS pH6.8 (0.1M) 25.0ml
(4%, W/W) SDS 4.00ml
a- mercaptoethanol 100.00ul
(0.001%W/V) Bromophenol blue 1.00ml
Glycerol 20.0ml
H2O (d.w.) up to 100.00ml

Acrylamide stock solution (30%)

Acrylamide 29.20g
N, N-methelene bis- acrylamide 0.80g
H2O (d.w.) up to 100.00ml
1- Acrylamide and bis- acrylamide were dissolved in 73ml distilled water and shaken
well with magnetic starrier.
2-Then, solution was completed up to 100 ml with distilled water.
3- The stock solution was filtered through filter paper and kept in a dark bottle at 4C
for up to one month.
Staining solution
Coomassie brilliant blue-R-250 staining solution was prepared as follows
Coomassie brilliant blue-R-250 0.50g
Methanol 40.00ml
Acetic Acid Glacial 45.00ml
H2O (d.w.) up to 500.00ml

Distaining solution (Freshly papered)

Methanol 140.00ml
Acetic Acid Glacial 40.00ml
H2O (d.w.) up to 700.00ml
Extraction of water soluble protein
Firstly,leaf
Leaf samples (0.250g) of the fourteen soybean cultivars were grounded to a
fine powder. Mixed of powder with1 ml of water soluble protein extraction buffer in a
mortar and pestle. Samples were transferred to eppendorff tubes and left in refrigerator
overnight. Then, samples were centrifuged at 12000rpm at 4C for 10min.The
supernatant containing water soluble protein were transferred to new Eppendorff tubes
and kept at deep freezer until use for electrophoretic analysis.
Secondly seeds
Firstly seeds were defatted by soaked the powder of seeds in mixture of
poterlam ether and Hexane. Change the mixture solution many times till the
supernatants changed from yellow to white. Then incubated the samples at 40C for
the72 hour vibrated the poterlam ether and Hexane. Then weighted 0.250 g and was
extracted as leaf.

Gel preparation
1-The gel was papered as shown in Table 19.

76
 Table 19: Composition of Resolving gel and stacking gel.

Stock solution Resolving gel (12%) Stacking gel (3.9%)

Acrylamide (30%) 41.76ml 3.90ml
Resolving gel buffer 36.69ml -
Stacking gel buffer - 7.50 ml
Distilled water 26.25ml 18.30ml
TEMED 100.00ul 50.00ul
APS (10%) 2.50ml 1.00ml

2- Resolving gel was immediately poured into the space between glass plates to height
of1.5 cm bellow bottom of comb (16.50X20 cm).
3-Gels was overlaid with isopropanol and left to polymerize of about 30 min..
4-Stacking gel layer was poured over the resolving gel, and15 min. to polymerize. The
comb was removed and upper buffer tank was filled with running.
Application of samples (Leaf and seed)
1- A volume of 50ul of protein samples were added to the same volume of
SDS sample buffer 2X (pH6.8) in Eppendorf tubes.
2- á- Mercaptoethanol (10ul) was added to each tube and boiled in water
bath for 10 min.
3- A volume of 50ul protein samples was applied to each well by
micropipette
4- Control wells were loaded with standard protein marker.

Electrophoretic conditions
1-lower buffer tank was filled running buffer and attached with upper tank
so that gels were completely covered.
2- The electrodes were connected to a power supply and adjusted at 100V
until the Bromophenol blue reached the bottom of the resolving gel.

Gel Staining and Destaining

1-Gels were place in plastic boxes containing 250ml staining solution a
gaited gently overnight on a shaker.
2-Gels were distained with 350ml distaining solution
3-The distaining solution was changed several times until the gel back
ground was clear.
Gel analysis
1-Gel were photographed using a35mm color film (200ASA) and scanned
with Bio-Rad
Vidodenitometer Modle620 USA, at wavelength of 577.
2-Software data analysis for Bio-Rad Model 620densimter and computer
were used as illustrated by manufacturer.
Random Amplified Polymorphic DNA (RAPD):
Stock solution for DNA work
1- 5X Tris- borate buffer (TEB) pH8.0

77
 Tris base 5.40g
Boric acids 2.75g
500 mM EDTA, pH 8.0 0.29g
H2O (d.w.) up to 100.00ml

2-Ethidium Bromide
The stock solution was prepared by dissolving 1g of ethidium bromide in 100 ml
distilled water and mix well with magnetic starrier. Transferred to a dark bottle and
stored at room temperature.

3-Sampling loading dye (5X)

500 mM NaEDTA, pH 8.0 2.00ml

Glycerol (100%) 5.00ml
Bromophenol blue (2%) 0.75ml
Xylene cyanole (2%) 0.75ml
H2O (d.w.) 1.50ml

In this study RAPD was used for the identification of markers associated with
the most sensitive and resistance fourteen soybean cultivars for cotton leaf worm
according to Williams et al. (1990)

DNA Isolation
Take leaves from soybean cultivars which were grown in ARC, Giza farm after 2-3
weeks from germination. DNA isolation was done using Dellaporta et al. (1983)
1-Weight 0.5 g leaf tissue and were ground under liquid nitrogen till were as affine
powder.
2- Then the powder was transferred to an appropriately sized tube and the liquid
nitrogen was allowed to evaporate.
RAPD assays:

Four 20 – mer arbitrary primers were used in RAPD analysis. Sequences of all
primers are illustrated in Table (1). For RAPD analysis, PCR amplifications were
carried out in a total volume 25 µl containing 2.5 µl 10 x buffer, 2 µl 25 mM MgCl2, 2
µl 2.5 mM dNTPs, 1 µl 10 pmol primer, 1 µl 50 ng of bacterial genomic DNA and 0.2
µl Taq DNA polymerase (5 units/µl) (Promega, Germany). PCR amplification was
performed in a thermal cycler (Eppendorf, Germany) programmed for one cycle at 95
°C for 5 min. Then 34 cycles were performed as follows: 30 s at 95 °C for
denaturation, 1 min at 45 °C for annealing and 2 min at 72 °C for elongation. Reaction
was then incubated at 72 °C for 10 min for final extension (Istock et al., 2001).

µl of loading dye was added prior to loading of 10 µl per gel pocket. Electrophoresis
was performed at 100 Volt with 0.5 x TBE buffer in 1.5% agarose/0.5 x TBE gels and
then the gel was stained in 0.5 µg/ml (w/v) ethidium bromide solutions and destained
in deionized water (Sambrooke et al., 1989). Finally the gel was visualized and
photographed by using gel documentation system (Alpha ImagerTM 1220, USA).
Presence and absence of RAPD bands produced from the four primers were scored
visually from resulting photographs.

78
 Table 20: Sequences of all primers used in RAPD analysis
Primer Nucleotide sequence 5\ to 3\
A1A13 CAGGCCCTTCCAGCACCCAC
A9B7 GGTGACGCAGGGGTAACGCC
A1 CGAGCCCTTCCAGCACCCAC
A7 GAAACGGGTGGTGATCGCAG

Sample preparation
PCR product 15.0 µl
Loading dye 5.0 µl
Gel preparation
Agarose 0.9 g
(1X)TEB pH 8 100.0ml
Ethidium bromide 5.0 µl
Agarose was cooked with (1X) TEB and boiled in water bath. Ethidium bromide was
added to malted gel after temperature become 55˚C. The melted gel were pureed in the
tray of mini gel apparatus and comb was removed when the gel become solid.

DATA Analysis:

The data generated from the detection of polymorphic fragments were analysed.
Specific amplification products were scored as present (1) or absent (0) for each of the
fourteen varieties with four primers. Genetic similarity between all fourteen parents
were estimated by simple matching co-efficient (Sokal and Michener , 1958).

Restriction Fragment Length Polymorphism (RFLP) For ITS:

RFLP definition: The variation(s) in the length of DNA fragments produced

by a specific restriction endonuclease from genomic DNAs of two or more individuals
of a species. Restriction fragment length polymorphism (RFLP) technology was first
developed in the1980s for use in human genetic applications and was later applied to
plants. By digesting total DNA with specific restriction enzymes, an unlimited number
of RFLPs can be generated. RFLPs are relatively small in size and are co-dominant in
nature. If two individuals differ by as little as a single nucleotide in the restriction site,
the restriction enzyme will cut the DNA of one but not the other. Restriction fragments
of different lengths are thus generated. All RFLP markers are analyzed using a
common technique. However, the analysis requires a relatively complex technique that
is time consuming and expensive. The hybridization results can be visualized by
autoradiography (if the probes are radioactively labelled), or using chemiluminesence
(if non-radioactive, enzyme-linked methods are used for probe labelling and
detection). Any of the visualization techniques will give the same results. The
visualization techniques used will depend on the laboratory conditions.

ITS definition: Eukaryotic nuclear rDNA is tandemly organized, with copy

numbers up to the order of 104 (Hillis and Dixon, 1991). Each repeat unit consists of
the genes coding the small subunit (16-18S), large subunit (23-28S), and the 5.8S

79
(Figure 1). These coding regions are separated from each other by spacers. The larger
and small are separated by the external transcribed spacer (ETS), and the intergenic
spacer (IGS). The 5.8S rDNA is embedded in the internal transcribed (ITS) region.

Different selective forces have led to the evolution of regions with varying
degrees of sequence variation (Olsen and Woese, 1993). Thus, appropriate rDNA
regions can be selected to their best corresponding variations. The large and small
subunits are one of the most highly conserved regions, and therefore, are useful at the
family level and above (Hillis and Dixon, 1991). The smallest rDNA cluster, the 5.8S
rDNA, however, is too short to contain enough phylogenetic information (Hillis and
Dixon, 1991). Due to their high variability, rDNA spacer regions have been used for
identification and determining of phylogenies of closely related species, and
populations (Hillis and Dixon, 1991). Prior to the introduction of PCR technology,
most studies focused on the intergenic spacer (IGS). This spacer consists of
subrepeats, differing in sequence and copy number (Olsen and Woese, 1993). Length
differences in the IGS are detected by Southern blot analysis (Hillis and Dixon, 1991).
Recently, PCR-based analysis of the internal transcribed spacer (ITS) has become the
method of choice to identify and analyze closely related species and populations
(Olsen and Woese, 1993).

Figure 7: Organization of the rDNA and primers proposed in the current study.

NS3 I1
18S 5.8S 25/28S

Nuclear Small rDNA Nuclear Large rDNA

ITS ITS

NS4 I2

ITS: Internal Transcribed Spacer

Direction of PCR primer (5’-3’)
Direction of PCR primer (3’-5’)

NS3 & NS4 produce a PCR product of 597 bp

I1 & I2 produce a PCR product of 602 bp

Amplification and sequencing both of 16S rRNA and 18S rRNA genes:

Approximately 350 bp from the 16S ribosomal RNA gene and 600 bp from 18S
ribosomal RNA gene were amplified using the universal primers. The detection of a
single amplicon of expected size indicates the specificity of the PCR reaction. I6S r RNA
gene was only detected in samples 1, 2 and 8 respectively. These results suggest that
bacterial association may be only present with these three fungal isolates. Ampilcons with
600 bp from 18S rRNA for the remaining seven isolates were sequenced using 377
automated sequencer and the sequence was analyzed using BLASTn Molecular identities
of these isolates are tabulated (Table 4).

Molecular relationships among the fungal isolates were investigated using

CLUSTALW (Figure 6). DNA sequence alignment showed sequence diversity ranging
from 4 to 96%. Isolate 4 and 6 are the closest isolates with 96% DNA sequence
homology. While, isolates 2, 3, 5 and 7 are the most diverged isolates. Bacterial
association with the native Egyptian fungal isolates for biodegradation of dyes will be

80
investigated on two levels. Firstly, biodegradation assay based on dual serial dilutions of
fungal isolates 1, 2 and 8 respectively with their respective bacterial isolates. Secondly,
molecular search for dyes biodegradation gene(s) in the aforementioned fungal isolates
and their respective bacterial isolates.

Agarose Gel Electrophoresis

Agarose is a galactose-based polymer, widely used in analytical and

preparative electrophoretic separation of linear nucleic acids in the size range above
100 bp. DNA applied to an agarose gel, which is exposed to an electrical field,
migrates towards the anode, since nucleic acids are negatively charged. The smaller
the molecules the faster they run through the gel matrix (Figures 4.1, 4.2, and 4.3).
Migration is inversely proportional to the log of the fragment length. In order to
determine the length of the separated fragments in the gel a molecular weight fragment
ladder control is placed in a lane alongside the experimental samples. Restricted
genomic DNA is usually separated in a 0.8 – 1.0 % gel whereas gels with a higher
concentration of agarose (2 – 3%) are needed for separation of small DNA fragments
(<500bp).
Method: Gel preparation and running
Note: Wear gloves and lab coat at all times for safety and to prevent
contamination. The buffer for gel preparation and for filling the electrophoresis tank is
0.5xTBE. Agarose powder was dissolved in buffer by slowly boiling in a microwave
or water bath. Let the agarose cool down to 60°C (just cool enough to hold). Ethidium
bromide (EthBr) was added to the gel at a concentration of 0.5 µg ml-1 before the gel
was poured (alternatively the gel can be stained after electrophoresis in water
containing EthBr). (Caution: Ethidium bromide is toxic. Gloves should be worn and
avoid inhalation.) As the agarose was cooling down prepare the gel tray by placing
tape across the ends of gel tray such that there is no leakage and so the tray will be able
to accommodate the desired thickness of the gel. Pour the agarose-EthBr mixture into
the prepared gel tray and insert combs using a comb size depending on the depth,
width, and thickness of the desired well. To avoid breaking the wells when the comb
was removed, leave 1mm between the comb teeth and the bottom of the gel tray.
Allow the gel to solidify (20-30 minutes).Remove tape and place tray in gel rig. Pour
enough 0.5x gel buffer in to the gel rig to cover the gel, and then remove combs. Load
the DNA samples, containing the lane marker bromophenol blue dye, into the wells.
Load the wells of the gel to the top. It typically takes 30 to 40 µl to fill each well. Note:
Do not over load the wells as that would definitely lead to DNA contamination. Note:
The DNA is mixed with loading buffer and dye order to facilitate the solution sinking
into the gel wells. As a single band, 10 ng DNA can still be visualized with EthBr.
Run samples into gel at 100mA for 5-10 minutes, then reduce the amperage
and run at 25 mA, constant current, until the bromophenol blue dye marker has
migrated almost to the end of the gel. Typically a long gel will be done after 14-16
hours.
NOTE: The following step is used only if the EthBr was not added as above Stain each
gel in 1 µg/ml EthBr (50 µl of 10 mg/ml EthBr in 500 ml dH2O) for 20 minutes
shaking gently.Rinse gel in ddH2O for 20 minutes, slide gel onto a UV
transilluminator and photograph. For Fotodyne PCM-10 camera with 20 x 26 cm hood
and Type 667 Polaroid film use an f8, 10 second exposure. (Caution: Wear gloves and

81
lab coat, and UV-protective full face shield or glasses when you are exposed to the UV
light of the Transilluminator)

RESTRICTION DIGESTION PROTOCOL

Restriction enzymes are produced by various bacterial strains. In these bacterial
strains they are responsible for limiting attack from certain bacteriophages. They act
by cutting (”restricting”) the phage DNA at a sequence-specific point, thereby
destroying phage activity. Sequence-specific cutting is a fundamental tool in molecular
biology. DNA fragments can be ligated back together (”recombined”) by T4 DNA
ligase. Many restriction enzymes have been cloned and are available in a commercially
pure form. They are named after their bacterial origin: e.g. EcoRI from E. coli. The
known restriction enzymes recognize four or six bases (eight in the case of ”very rare
cutters” like NotI and SfiI). Recognition sequences are almost always”palindromic”
where the first half of the sequence is reverse-complementary to the second:e.g. the
XbaI site is
5’ T C T A G A 3’
3’ A G A T C T 5’
The position of the actual cut is enzyme dependent and symmetrical on the opposite
strand:
5’ T C T A G A 3’
3’ A G A T C T 5’
leaving cohesive termini (sticky ends) at the 5’ end:
5’ T 3’
3’ A G A T C 5’
The commercially available restriction enzymes are supplied with the appropriate
restriction buffers (10 x concentrated). The enzymes are adjusted to a specific activity
per µl, usually 10 U/µl. (1 Unit is the amount of enzyme needed to cut 1 µg of lambda
DNA in one hour at 37°C).
A typical restriction digestion is performed using between 20 µl and 100 µl reaction
volume per 5 µg and more of plant DNA. For purified plasmid DNA 2 U per µg DNA
is sufficient, for plant DNA 4 U per µg should be used.For example: digestion of 5 µg
DNA in 40 µl reaction volume:
(1)Restriction buffer (10x) 4 µl . (2) DNA 1 µg/µl 5 µl.
(3) Doubled distilled H20 29 µl. (4)Enzyme (10 U/µl) 2 µl.

Incubate for at least 1 hour at 37°C. The restriction enzyme can be inactivated by
heating to 65°C for 10 minutes or by adding 1.0 µl 0.5 M EDTA.

82
 RESULTIES AND DISCUSSION

There are numerous steps in the development of any novel, desirable plant
germplasm. Plant breeding begins with the analysis and definition of problems and
weaknesses of the current germplasm, the establishment of program goals, and the
definition of specific breeding objectives. The next step is selection of germplasm that
possess the traits to meet the program goals. Here study firstly, report the
characterization of a novel leaf isozymes of soybean and examine its role in defense
responses. Secondly, studied character genotypes at leaf and seed protein profile.
Moreover, extent to DNA level. Thirdly, collected all data to calculate genotypes and
allele frequency to received molecular markers assistant.

Isozymes:
The leaf isozymes polymorphism based on PAGE electrophoreses analysis all
soybean genotypes is presented in (Plate 3, Table 21) three isozymes of soybean
genotypes. The Data in show a qualitative analysis depends on the number of obtained
bands from each tested soybean genotypes. of the different tested genotypes.

In Peroxidase isozymes analysis observed the results revealed that the

genotypes had Forrest 9 bands, Giza 111 and Corsay-79 8 bands, 7 bands for
Hutcheson, Calland, Clark and Giza 21 and 6 bands for Giza 21,Giza 83 and Lakota.
While, Giza 35 was given 5 bands, also, Crowford and L86k-73 were given 4 bands.
The data indicate that the moderately resistance and resistances genotypes to cotton
leaf worm have a highest number of bands (from 6 to 9) except Corsay -79. But the
low numbers of bands were found in resistance and susceptible genotypes.
In Esterase isozymes L86K-73 genotype gave the highest number of bands (2)
in the genotypes while all the other genotypes gave the lowest number of bands (1)
except genotypes Forrest, Hutcheson, Lakota, Giza 111 and Giza 22 gave zero bands.
In malate dehydrogenase isozyme L86K-73, Giza 111, Giza 83, Cark Giza 35 Giza 22
and Crowford genotypes gave 2 bands. While the other genotypes gave one bands.
From Table (21) Isoenzymes Peroxidase give bands as positive marker for Forrest
genotypes. Moreover, the genotypes L86K-73 and Crowford did not give any bands in
negative form which is considered band as negative markers. In the other hand, density
of bands was highest in Forrest and Clark which were resistance and moderately
resistance respectively to cotton leaf worm.
In Esterase isoenzymes only L86K-73 genotype gives 2 bands which were
consider as positive markers. High dense bands were observed in cotton leaf worm
genotypes Giza 35, Giza 21 and L86K-73. In malate dehydrogenase isozyme
genotypes L86K-73,Giza 111,Giza 83,Clark, Giza 22 and Crowford had 2 band
while, genotypes gave one band. The above results indicated that no clear trend has
been observed in isozymes analysis regarding differentiation among 14 soybean
genotypes on the basis of their resistance to cotton leaf worm. Therefore this technique
was not useful to be used in the present materials to identify genetic marker.

83
 Table 21: Total number of bands from three isozymes
to soybean genotypes.

Genotypes Isoenzymes
Peroxidase ESTRASE MDH Total
L86k-73 4 2 2 8
Corsay-79 8 1 1 10
Giza 21 6 1 1 8
Forrest 9 0 1 10
Hutcheson 7 0 1 8
Calland 7 1 1 9
Lakota 6 0 1 7
Giza 111 8 0 2 10
Giza 83 6 1 2 9
Clark 7 1 2 10
Giza 22 6 0 2 8
Giza 35 5 1 1 7
Giza 82 7 1 1 9
Crowford 4 1 2 7

84
 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Soybean leaf Peroxidase isozymes activity

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Soybean leaf Esterase isozymes activity

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Soybean leaf Malate Dehydrogenase isozymes activity

Plate 3: Isozymes leaf polymorphism based on PAGE electrophoreses
analysis the of soybean genotypes.
1 -L86K-73 , 2-Corsay-79 , 3-Giza21, 4-Forrest , 5-Hutcheson , 6-Calland, 7-Lakota, 8- Giza111,
9-Giza83, 10-Clark, 11-Giza22, 12-Giza35, 13-Giza82 and 14-Crowford.

85
Protein PAGE-SDS:

The results of SDS-PAGE for the water soluble proteins leaf in the fourteen
genotypes (Plate 4 and Table 22) revealed a total number of 8 bands with molecular
weights (MW) ranging from about 1263 to144 KDa. Data showed that all bands are
common for the fourteen soybean genotypes (monomorphic), however they differed in
density and intensity. The densitometric analysis (Table 22) of SDS-protein banding
patterns of the leaf of the studied genotypes was found to be not informative in their
work. On the other side, the results of SDS-PAGE for the water soluble proteins in
the seeds of fourteen soybean genotypes (Plate 4 and Table 23) revealed a total
number of 13 bands with molecular weights (MW) ranging from about 220.36 to 9.1
KDa. Data showed that all bands are common for the fourteen genotypes except two
bands 220.36 and 194 KDa. for Calland genotype can be considered as specific bands.
Moreover they differed in density and intensity.
Similarity index among the fourteen soybean genotypes based on protein
analysis, carried out using UPGMA computer program, is shown in Table (24). The
similarity relationships ranged between 1.000 and 0.950. The highest similarity index
(1.000) was recorded between each two of the genotypes; L86K-73,Corsay-79,Giza
21,Forrest,Hutcheson,Lakota,Giza111,Giza 83,Giza 22 ,Giza 35,Giza 82 and
Crowford. However, the lowest similarity index (0.950) was observed between
Calland and each of the thirteen genotypes. The genetic distances relationships among
the fourteen soybean genotypes based on leaves and seeds protein patterns are shown
in (Plate 4). The dendrogram confirmed the close genetic relationship among these
genotypes as appeared in Table (24) for similarity indices.

The overall results of total protein pattern obtained by SDS-PAGE did not show
clear cut in monitoring molecular markers resistance/susceptible to cotton leaf worm
of the 14 soybean genotypes. Similar results were obtained also in soybean by Eman
(2006).

86
SDS-PAGE protein banding patterns for leaves protein (water soluble) of the 14 soybean
genotypes.

SDS-PAGE protein banding patterns for seeds protein (water soluble) of the 14 soybean
genotypes.
Plate4: Protein leaf and seed polymorphism based on SDS-PAGE
electrophoreses analysis the of soybean genotypes.

1 -L86K-73 , 2-Corsay-79 , 3-Giza21, 4-Forrest , 5-Hutcheson , 6-Calland, 7-Lakota, 8- Giza111,

9-Giza83, 10-Clark, 11-Giza22, 12-Giza35, 13-Giza82 and 14-Crowford. M: Protein Marker

87
Table 22:SDS-PAGE Leaf protein profile of different genotypes in soybean.

Soybean genotypes

Band M.W

Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest
Giza21

Giza83

Giza22

Giza35
no. (Kda)

Lakota

Giza82
Clark
1 126.3 1 1 1 1 1 1 1 1 1 1 1 1 1 1
2 98.6 1 1 1 1 1 1 1 1 1 1 1 1 1 1
3 73.5 1 1 1 1 1 1 1 1 1 1 1 1 1 1
4 41.6 1 1 1 1 1 1 1 1 1 1 1 1 1 1
5 24.6 1 1 1 1 1 1 1 1 1 1 1 1 1 1
6 17.2 1 1 1 1 1 1 1 1 1 1 1 1 1 1
7 15.2 1 1 1 1 1 1 1 1 1 1 1 1 1 1
8 14.4 1 1 1 1 1 1 1 1 1 1 1 1 1 1
8 8 8 8
Total 8 8 8 8 8 8 8 8 8 8

Table 23:SDS-PAGE Seed protein profile of different genotypes in soybean.

Soybean genotypes

Band M.W
Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
no. (Kda)
Clark

1 220.36 1 1 1 1 1 0 1 1 1 1 1 1 1 1
2 194 1 1 1 1 1 0 1 1 1 1 1 1 1 1
3 109.4 1 1 1 1 1 1 1 1 1 1 1 1 1 1
4 64.6 1 1 1 1 1 1 1 1 1 1 1 1 1 1
5 52.14 1 1 1 1 1 1 1 1 1 1 1 1 1 1
6 42.1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
7 33.8 1 1 1 1 1 1 1 1 1 1 1 1 1 1
8 26.7 1 1 1 1 1 1 1 1 1 1 1 1 1 1
9 19.1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
10 15.67 1 1 1 1 1 1 1 1 1 1 1 1 1 1
11 13.4 1 1 1 1 1 1 1 1 1 1 1 1 1 1
12 11.17 1 1 1 1 1 1 1 1 1 1 1 1 1 1
13 9.1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
13 13 13 13
13 11 13 13 13 13 13 13 13 13
Total

88
 Figure 8: Dendrogram for the genetic distances relationships among the fourteen
genotypes based on Similarity indices data of Protein SDS-PAGE analysis.

Table24: Similarity indexes among the fourteen soybean genotypes based on

Leaf and Seed Protein SDS-PAGE.

Soybean
Hutcheson
Corsoy-79

genotypes
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
Clark

Corsoy-79 1.000
Giza21 1.000 1.000
Forrest 1.000 1.000 1.000
Hutcheson 1.000 1.000 1.000 1.000
Calland 0.950 0.950 0.950 0.950 0.950
Lakota 1.000 1.000 1.000 1.000 1.000 0.950
Giza111 1.000 1.000 1.000 1.000 1.000 0.950 1.000
Giza83 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000
Clark 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000 1.000
Giza22 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000 1.000 1.000
Giza35 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000 1.000 1.000 1.000
Giza82 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000 1.000 1.000 1.000 1.000
Crawford 1.000 1.000 1.000 1.000 1.000 0.950 1.000 1.000 1.000 1.000 1.000 1.000 1.000

89
Random Amplified Polymorphic DNA (RAPD):
RAPD-PCR was used to analyze the genetic diversity of the fourteen studied
soybean genotypes, and to assess their genetic relationships using similarity indices
and dendogram tree. Four arbitrary random primers were used to determine RAPD
polymorphism of the fourteen soybean genotypes (Primer OP-A 9 B 7, Primer OP-
A0 7, Primer OP-A0 7, Primer OP-A 1 and Primer OP-A 1 A13). The resulted
amplified fragments are shown in Plate (5) and their densitometric analyses are
illustrated in Tables (25-28). Banding patterns were scored as present (1) or absent
(0). All the 4 primers successfully amplified DNA fragments for all genotypes. A total
number of 62 fragments were visualized across the fourteen investigated genotypes.
The results of RAPD-PCR technique are shown as follows:-
Primer OP-A 9 B 7
The pattern produced by primer OP-A9B7 showed a maximum number of 12
DNA fragments ranging in molecular sizes (MS) between 130 to 1670 bp (Plate 3 and
Table 24). Twelve polymorphic fragments (100%) with numbers from 1 to 12 with
corresponding molecular sizes were observed in (Plate5 and Table 24). Whereas,
fragments were not observed monomorphic. Crowford genotype showed the maximum
number of (7) fragments, while the lowest one (1) appeared in Forrest genotype.

Primer OP-A0 7
Primer OP-A07 showed maximum of five DNA fragments with molecular sizes
ranged from150 to 670 bp (Plate5 and Table 25). Zero polymorphic fragments (0%)
and monomorphic (100%) with molecular sizes were seen in all genotypes.
Primer OP-A 1
Primer OP-A1 exhibited nineteen DNA fragments ranging in molecular sizes
from 50 to 1080 bp (Plate 5 and Table 26). Eleven polymorphic fragments (58 %) with
numbers 1, 2, 3, 4,8,13,14,15,16,17 and 19 with corresponding molecular sizes of
1080,1030,1020,1015, 870, 810, 430,360,320,280,230 and 50 bp were observed, while
the other four fragments were monomorphic.
Primer OP-A 1 A13
Plate (5) and Table (27) showed that primer OP-A 1 A13 gave twenty six
polymorphic fragments with molecular sizes ranging from 270 to 1007 bp. Moreover,
no monomorphic was detected among these genotypes using this primer. Crowford
genotype showed the maximum number of (14) fragments, while the lowest one (5)
appeared in L86K-73 genotype. The genotypes have specific molecular markers in
bands number seven (960bp) for Hetcheson, number fourteen (740bp) for Forrest and
number 24 (360 bp) for Giza, as appositive markers.

90
Plate5: DNA polymorphism based on RAPD-PCR analysis of the soybean
genotypes.

1 -L86K-73 , 2-Corsay-79 , 3-Giza 21, 4-Forrest , 5-Hutcheson , 6-Calland, 7-

Lakota, 8- Giza 111, 9-Giza 83, 10-Clark, 11-Giza 22, 12-Giza 35, 13-Giza 82 and
14-Crowford.

91
 The results of the amplified fragments using four 10-mer arbitrary primers for the
fourteen soybean genotypes revealed success in amplifying DNA fragments.
Polymorphism levels differed from one primer to the other, the number of total
amplified fragments (TAF) and polymorphic bands (PB) for each primer, amplified
fragments (AF) and specific markers (SM) for soybean genotypes using the 4 primers
are shown in Table (29).
Primers produced fragments number ranging from four primers. These high
levels of polymorphism served in soybean molecular markers. which can be used to
discriminate each soybean genotypes from the others. There were several specific
fragments either present in only one genotypes and absent in all others(positive
marker) or absent in only one genotype an present in all others(negative marker)
(Table 29). Could be as a follows:-
Primer OP-A9B7 showed specific fragment (520bp) as positive marker for Clark
genotype. Primer OP-A1 showed six specific fragment four of them as negative
markers three for Hutcheson genotype(430, 280 and 50 bp) and one for Lakota
genotype (810 bp) as negative marker, and also two as positive markers (360 and 320
bp) for Hutcheson. Primer OP-A1A13 showed three specific fragments as positive
markers one (960bp) for Hutcheson, one (740bp) for Forrest and one (360bp) for
Giza111. Primer OP-A7 did not showed specific fragment.
Results of cluster analysis (similarity index) based on RAPD-PCR with the four
primers using UPGMA computer analysis is shown in (Fig. 9 and Table 30). The
highest similarity value recorded was 0.885, which was observed between Forrest and
Giza 22 genotypes, while the lowest similarity value recorded was 0.606 between
Hutcheson and Giza35 genotypes. A dendrogram for the genetic relationships among
the fourteen soybean genotypes across the four primers results was carried out and is
shown in Fig. (9). The fourteen soybean genotypes were separated into two clusters;
cluster 1 included two sub cluster, The sub cluster1 were consisted from three groups
.The group 1, group 2 and group 3 were included (Forrest and Giza22);( Calland and
Giza111) and (Giza 35 and L86K-73 )respectively. While, sub cluster 2 comprised
four groups group1 were contained Clark and Giza 82, group 2 have Crowford
genotype only and the genotypes Giza21 and Giza83 were located in group 4. The
second cluster was contained Hutcheson genotype.
The dendogram reflects the performance of genotypes on the basis of their
reaction to cotton leaf worm . For example, the genotypes in sub cluster 1 (Forrest,
Giza 22, Calland, Giza 111 and L86K-73) all are resistance except Calland which is
moderately resistance (See table 28). On the other hand the most susceptible
genotypes Hetcheson is located alone in cluster 2. Therefore, PAPD-PCR technique
was useful as a tool for classification that tested soybean genotypes. PAPD-PCR
technique has been used previously to identify soybean genotypes on the basis of their
performance to insect resistance. For example, Carvalho et al. (2002b) who were
used microsatellites (Satt187 and Satt309) and three RAPD markers (OPAG-05946,
OPF-041038, and OPAQ-011987) to identified molecular markers associated with the
resistance to race 3 of the SCN. Also, James et al. (2001) noted that, there has been
limited success over the past 30 yr in the development of superior soybean genotypes
[Glycine max (L.) Merr] with insect resistance. Success may be hampered by the
quantitative nature of resistance and by linkage drag from resistant plant introduction
(PI) donor parents. Soybean insect resistance quantitative trait loci (SIR QTLs) have

92
 been identified from PI 229358 and PI 171451 by restriction fragment length
polymorphism (RFLP) analysis.

Table 25: RAPD profile of different genotypes in soybean using Primer OP-
A9B7
Soybean Varieties

Fragment MS

Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
No. (bp)

Clark
1 1640 0 1 1 0 0 0 1 0 0 1 0 0 0 1
2 1330 0 0 0 0 0 0 1 0 1 1 0 0 1 1
3 900 0 0 0 0 0 1 0 1 0 1 0 0 1 1
4 810 1 0 0 1 0 1 1 1 0 1 1 1 1 0
5 725 1 0 0 0 0 0 0 0 0 0 0 0 0 1
6 660 0 0 0 0 0 1 0 0 0 1 0 0 1 1
7 600 1 0 0 0 0 1 0 1 0 0 0 1 0 0
8 520 0 0 0 0 0 0 0 0 0 1 0 0 0 0
9 415 0 0 0 0 1 0 1 0 1 1 0 0 0 0
10 375 0 0 0 0 0 1 0 0 0 0 0 0 0 1
11 330 0 1 1 0 1 1 0 1 1 1 0 0 1 1
12 130 0 0 0 0 1 0 1 0 0 0 0 0 0 0

3 2 2 1 3 6 5 4 3 8 1 2 5 7
Total

Table 26: RAPD profile of different genotypes in soybean using Primer OP-
A7

Soybean Varieties

Fragment MS
Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota

Giza83

Giza82
Giza21

Giza22

Giza35

No. (bp)
Clark

1 670 1 1 1 1 1 1 1 1 1 1 1 1 1 1
2 550 1 1 1 1 1 1 1 1 1 1 1 1 1 1
3 370 1 1 1 1 1 1 1 1 1 1 1 1 1 1
4 300 1 1 1 1 1 1 1 1 1 1 1 1 1 1
5 150 1 1 1 1 1 1 1 1 1 1 1 1 1 1
Total 5 5 5 5 5 5 5 5 5 5
5 5 5 5

93
 Table 27: RAPD profile of different genotypes in soybean using Primer OP-A 1
Soybean Varieties

Fragment MS

Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
No. (bp)

Clark
1 1080 1 1 1 1 0 1 1 1 1 1 1 1 1 0
2 1030 0 1 0 0 0 0 1 0 0 0 1 0 1 1
3 1020 0 1 1 1 1 1 1 0 1 0 1 0 1 1
4 1015 0 0 0 0 1 0 0 0 0 0 1 0 0 0
5 1000 1 1 1 1 1 1 1 1 1 1 1 1 1 1
6 950 1 1 1 1 1 1 1 1 1 1 1 1 1 1
7 880 1 1 1 1 1 1 1 1 1 1 1 1 1 1
8 810 1 1 1 1 1 1 0 1 1 1 1 1 1 1
9 700 1 1 1 1 1 1 1 1 1 1 1 1 1 1
10 650 1 1 1 1 1 1 1 1 1 1 1 1 1 1
11 580 1 1 1 1 1 1 1 1 1 1 1 1 1 1
12 480 1 1 1 1 1 1 1 1 1 1 1 1 1 1
13 430 1 1 1 1 0 1 1 1 1 1 1 1 1 1
14 360 0 0 0 0 1 0 0 0 0 0 0 0 0 0
15 320 0 0 0 0 1 0 0 0 0 0 0 0 0 0
16 280 1 1 1 1 0 1 1 1 1 1 1 1 1 1
17 230 1 0 1 0 1 1 0 0 0 0 0 0 0 0
18 140 1 1 1 1 1 1 1 1 1 1 1 1 1 1
19 50 1 1 1 1 0 1 1 1 1 1 1 1 1 1
15 15 14 14
14 15 14 13 14 13 16 13 15 14
Total

94
Table 28: RAPD profile of different genotypes in soybean using Primer OP-A 1 A13
Soybean genotypes

Fragment MS

Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
No. (bp)

Clark
1 1007 1 0 0 0 1 0 1 1 0 1 0 1 0 1
2 1005 1 1 1 0 1 1 1 1 0 1 1 1 1 1
3 1003 0 0 0 1 1 1 1 1 1 1 1 1 1 1
4 1000 1 1 0 1 1 0 0 1 0 1 1 1 0 1
5 990 0 1 1 1 1 1 1 1 1 0 1 1 0 1
6 970 0 0 1 0 1 0 1 0 0 1 1 1 1 1
7 960 0 0 0 0 1 0 0 0 0 0 0 0 0 0
8 950 0 1 0 1 1 1 1 1 0 1 1 0 1 0
9 920 0 0 0 0 1 1 0 0 0 1 0 0 0 0
10 900 0 0 1 0 0 0 0 1 0 1 0 1 0 1
11 870 0 1 0 1 1 1 1 1 1 1 1 0 0 0
12 820 0 1 1 1 1 0 1 0 1 1 0 0 1 1
13 770 0 1 0 0 0 1 0 0 0 1 0 0 0 1
14 740 0 0 0 1 0 0 0 0 0 0 0 0 0 0
15 720 0 0 1 0 0 0 0 0 0 1 0 0 0 1
16 690 0 1 1 0 1 0 1 1 1 0 0 0 0 0
17 650 0 1 0 0 0 0 0 0 0 1 0 0 1 0
18 600 1 1 0 1 1 1 1 1 0 0 1 0 0 0
19 540 1 1 1 0 1 0 1 0 0 1 0 0 1 1
20 490 0 0 0 1 0 0 0 1 0 0 0 1 0 1
21 460 0 0 1 0 1 0 0 0 0 0 0 0 0 0
22 430 0 0 0 1 0 0 0 1 0 0 1 0 0 0
23 385 0 0 0 0 0 0 1 1 0 0 0 0 0 0
24 360 0 0 0 0 0 0 0 1 0 0 0 0 0 0
25 325 0 1 0 0 0 1 0 1 0 0 0 0 1 1
26 290 0 0 0 0 0 0 0 0 0 0 0 1 0 1

5 12 9 10 15 9 12 15 5 14 9 8 8 14
Total

95
Table 29: Number of amplified fragments and specific markers
of the fourteen soybean genotypes based on RAPD-
PCR analysis using 4 primers.

RAPD primers.
OP-A 9 B 7 OP-A 7 OP-A 1 OP-A 1A13 Total
No Genotypes AF SM AF SM AF SM AF SM AF
1 L86K-73 3 - 5 - 14 - 5 - 27
2 Corsay-79 2 - 5 - 15 - 12 - 34
3 Giza21 2 - 5 - 15 - 9 31
4 Forrest 1 - 5 - 14 - 10 (1)+ 30
5 Hutcheson 3 - 5 - 14 (3)-(2)+ 15 (1)+ 27
6 Calland 6 - 5 - 15 - 9 - 35
7 Lakota 5 - 5 - 14 (1)- 12 - 36
8 Giza111 4 - 5 - 13 - 15 (1)+ 37
9 Giza83 3 - 5 - 14 - 5 - 27
10 Clark 8 (1)+ 5 - 13 - 14 - 40
11 Giza22 1 - 5 - 16 - 9 - 31
12 Giza35 2 - 5 - 13 - 8 - 28
13 Giza82 5 - 5 - 15 - 8 - 33
14 Crowford 7 - 5 - 14 - 14 - 40
TAF 12 5 19 26 62
PB 12 0 11 26 59
TSM 1 0 6 3 10

TAF= Total amplified fragments.

PB = Polymorphic bands for each primer.
AF = Amplified fragments.
SM=Specific markers including either the presence or absence of a fragment.
P= (+) ve n= (-) ve
TSM = Total number of specific markers.

96
Figure 9: Dendrogram for the genetic distances relationships among the fourteen
genotypes based on similarity indices data of RAPD analysis.

97
 Table 30: Similarity indexes among the fourteen soybean genotypes
based on RAPD-PCR using 4 primers.

Soybean
varieties

Hutcheson
Corsoy-79
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
Clark
Corsoy-79 0.721
Giza21 0.724 0.800
Forrest 0.737 0.781 0.689
Hutcheson 0.625 0.704 0.706 0.657
Calland 0.742 0.783 0.697 0.769 0.667
Lakota 0.698 0.800 0.746 0.758 0.740 0.704
Giza111 0.750 0.761 0.676 0.806 0.649 0.806 0.740
Giza83 0.667 0.787 0.793 0.807 0.688 0.742 0.794 0.719
Clark 0.687 0.757 0.732 0.686 0.675 0.747 0.763 0.727 0.716
Giza22 0.759 0.800 0.710 0.885 0.706 0.788 0.806 0.794 0.759 0.704
Giza35 0.821 0.667 0.733 0.780 0.606 0.719 0.708 0.818 0.714 0.725 0.800
Giza82 0.700 0.806 0.750 0.730 0.629 0.794 0.783 0.714 0.767 0.822 0.781 0.710
Crawford 0.657 0.757 0.761 0.657 0.623 0.720 0.711 0.701 0.687 0.800 0.676 0.754 0.795

98
Restriction Fragment Length Polymorphism (RFLP) for ITS:

RFLP-PCR was also used to analyze the genetic diversity of the fourteen
studied soybean genotypes, and to assess their genetic relationships using similarity
indices and dendogram tree. Three restrictions enzymes were used to cut ITS PCR
products were used to determine RFLP polymorphism of the fourteen soybean
genotypes (Fig. 7). Restriction site analysis of the internal transcribed spacer (ITS)
region amplified by the polymerase chain reaction (PCR) was used for the specific
identification of fourteen genotypes. PCR amplification using primers based on
nucleotide sequences of soybean ITS regions. Digestion of the PCR products with
endonucleases BamH1,MSPI and Taq1 followed by agarose gel electrophoresis of the
digested products, yielded specific restriction profiles that enabled direct visual
identification of the genotpes analyzed.

Universal primers pair were able to successful amplify the ITS region of all
genotypes tested, providing a single (602pb) PCR product Plate (6). The patterns of the
RFLP analysis were characteristic for each genotype restriction enzyme BamH1
produced for each soybean genotypes was seen identical pattern which showed similar
one band in 285 bp. The enzyme MSPI was also used digestion of PCR products for
each soybean genotypes which give one band (870 bp) for L86K-73 and four bands
(730, 417, 275 and 65 bp) for the rest genotypes. While, Taq1 enzyme give six bands
(580, 430, 90, 70, 50 and 30 bp) in all genotypes except L86K-73 and Corsay-79
which give one band 1400 and 30bp respectively. Data in Fig 10 and table 34 showed
similarity indexes was1.000 in all genotypes except L86k-73 and Corsay give 0.182
and 0.842 respectively. The dendogram that show the genetic distance among 14
soybean genotypes is given in Fig. 10 the similarity indices of tested genotypes based
on PFLP for ITS- PCR using 3 restriction enzymes is presented in( Table 34).The data
indicating that 12 genotypes in group2 are genetically related.

Olsen and Woese, (1993) explained ribosomal DNA (rDNA) sequences have
been aligned and compared in a number of living organisms, and this approach has
provided a wealth of information about phylogenetic relationships. Studies of rDNA
sequences have been used to infer phylogenetic history across a very broad spectrum,
from studies among the basal lineages of life to relationships among closely related
species and populations. The reasons for the systematic versatility of rDNA include the
numerous rates of evolution among different regions of rDNA (both among and within
genes), the presence of many copies of most rDNA sequences per genome, and the
pattern of concerted evolution that occurs among repeated copies. These features
facilitate the analysis of rDNA by direct RNA sequencing, DNA sequencing (either by
cloning or amplification), and restriction enzyme methodologies.

99
 Plate.(6) : DNA polymorphism based on PFLP-PCR analysis of the soybean genotypes.
1 -L86K-73 2-Corsay-79 3-Giza21 4-Forrest 5-Hutcheson
6-Calland 7-Lakota 8- Giza111 9-Giza83 10-Clark
11-Giza22 12-Giza35 13-Giza82 14-Crowford.

100
 Table 31: RFLP profile of different genotypes in soybean cutting with Bam H1
Soybean Varieties

Fragment MS

Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
No. (bp)

Clark
1 285 1 1 1 1 1 1 1 1 1 1 1 1 1 1

1 1 1 1 1 1 1 1 1 1 1 1 1 1
Total

Table 32: RFLP profile of different genotypes in soybean cutting with MSPI

Soybean Varieties

Fragment MS
Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
No. (bp)

Clark
1 870 1 0 0 0 0 0 0 0 0 0 0 0 0 0
2 730 0 1 1 1 1 1 1 1 1 1 1 1 1 1
3 417 0 1 1 1 1 1 1 1 1 1 1 1 1 1
4 275 0 1 1 1 1 1 1 1 1 1 1 1 1 1
5 65 0 1 1 1 1 1 1 1 1 1 1 1 1 1

1 4 4 4 4 4 4 4 4 4 4 4 4 4
Total

Table 33: RFLP profile of different genotypes in soybean cutting with Taq1

Soybean Varieties

Fragment MS
Hutcheson
Corsoy-79

Crawford
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82

No. (bp)
Clark

1 1400 1 0 0 0 0 0 0 0 0 0 0 0 0 0
2 580 0 0 1 1 1 1 1 1 1 1 1 1 1 1
3 430 0 0 1 1 1 1 1 1 1 1 1 1 1 1
4 90 0 0 1 1 1 1 1 1 1 1 1 1 1 1
5 70 0 0 1 1 1 1 1 1 1 1 1 1 1 1
6 50 0 0 1 1 1 1 1 1 1 1 1 1 1 1
7 30 0 1 1 1 1 1 1 1 1 1 1 1 1 1
1 6 6 6 6 6 6 6 6 6 6 6 6
1
Total

101
 Figure 10: Dendrogram for the genetic distances relationships among the
fourteen genotypes based on similarity indices data of RFLP analysis.

Table 34: Similarity indices among the fourteen soybean

genotypes
based on RFLP-PCR using 3 restriction enzymes.
Soybean
Hutcheson
Corsoy-79

varieties
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
Clark

Corsoy-79 0.182
Giza21 0.143 0.842
Forrest 0.143 0.842 1.000
Hutcheson 0.143 0.842 1.000 1.000
Calland 0.143 0.842 1.000 1.000 1.000
Lakota 0.143 0.842 1.000 1.000 1.000 1.000
Giza111 0.143 0.842 1.000 1.000 1.000 1.000 1.000
Giza83 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000
Clark 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000 1.000
Giza22 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000
Giza35 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000
Giza82 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000
Crawford 0.143 0.842 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000

102
Combined data based on SDS-PAGE protein profile, RAPD and
RFLP:

Combined analysis based on protein electrophoresis, RAPD-PCR and RFLP

analyses was carried out using UPGMA computer program and shown in (Fig.11 and
Table35) The highest similarity index recorded was 0.944 between the two genotypes
L86K-73 and Hutcheson, while the lowest similarity index (0.700) was observed
between the two genotypes Forrest and Giza 22. Dendrogram for the genetic
relationships among the fourteen soybean genotypes across the three techniques results
was carried out as in Fig. (11). The fourteen soybean genotypes were separated into
three clusters; cluster one included L86K-73 while cluster 2 included Hutcheson. On
the other side the cluster three divided to two sub cluster. Within the sub cluster 1,
three groups appeared; the frist contained the two genotypes Forrest and Giza 22,
while the second group conformed from Giza111 and Giza35. Also the group three
under subcluster1 contained Calland only. Moreover, The Second sub cluster
contained consists of four groups separated in two divisions. The division one
appeared in two groups one and two. The group one has Clark and Giza82 while the
second group contained Crowford only. The second division has groups from three to
four. The group number three contained Giza 21 and Giza 83 In the other hand group
number four appeared in Corsay-79 only. However, the combined data of the three
techniques used (protein, RAPD and PFLP) produced the same cluster results as the
RAPD technique. That is to say that RAPD can be considered as a reliable technique
for studying relationships among soybean genotypes.
In the study of genetic diversity the use of protein electrophoresis, RAPD-PCR
and RFLP analyses seemed to be powerful tools and could discriminate among the
fourteen soybean genotypes. Casas et al. (1999) confirmed that both protein and
RAPD-PCR results appear to play an important role in the differentiation among
different cultivars. Moreover, Li et al. (1996) studied the feasibility of developing
RAPD-based diagnostic dot blot tests to separate field isolates of soybean cyst
nematode (Heterodera glycines) with different virulence to resistant cultivars of
soybean. Yencho et al. (2000) mentioned that molecular markers can be used to
increase our understanding of the mechanisms of plant resistance to insects and
develop insect resistant crops.

103
 Figure 11: Dendrogram for the genetic distances relationships among the fourteen
genotypes basedon similarity indices data of protein SDS-PAGE, RAPD and RFLP analysis.

Table 35: Similarity indices among the fourteen soybean genotypes based on Protein
SDS-PAGE,RAPD and RFLP-PCR using 3 restriction enzymes.
Soybean
Hutcheson

varieties
Corsoy-79
L86K-73

Giza111
Calland
Forrest

Lakota
Giza21

Giza83

Giza22

Giza35

Giza82
Clark

Corsoy-79 0.772
Giza21 0.754 0.873
Forrest 0.761 0.864 0.848
Hutcheson 0.700 0.818 0.848 0.824
Calland 0.741 0.844 0.828 0.866 0.806
Lakota 0.739 0.870 0.870 0.877 0.861 0.827
Giza111 0.767 0.848 0.833 0.901 0.812 0.881 0.861
Giza83 0.727 0.869 0.902 0.909 0.844 0.855 0.898 0.859
Clark 0.732 0.844 0.859 0.836 0.823 0.847 0.871 0.851 0.855
Giza22 0.772 0.873 0.857 0.944 0.848 0.875 0.901 0.894 0.885 0.844
Giza35 0.804 0.806 0.871 0.894 0.800 0.841 0.853 0.908 0.867 0.857 0.903
Giza82 0.741 0.875 0.875 0.866 0.806 0.877 0.887 0.851 0.887 0.905 0.891 0.857
0.715 0.844 0.874 0.821 0.794 0.832 0.843 0.837 0.840 0.889 0.830 0.872 0.891
Crawford

104
 SUMMARY

The experiments of the present study were conducted at Field Crops Research
Institute (FCRI), Cell Research Study Department, Agriculture Research Center
(ARC), Giza, Egypt during the growing seasons 2003, 2004 and 2005.Fourteen
soybean genotypes namely L86K-73, Corsay-79, Giza21, Forrest, Hutcheson, Calland,
Lakota, Giza 111,Giza 83, Clark, Giza 22, Giza 35, Giza 82 and Crowford were used
as plant materials throughout this investigation. The objectives of this study were:

(1)Describe field performance of 14 soybean genotypes susceptible/ moderate

resistance/resistance to cotton leaf worm, and study the genetic parameters.
(2)Initiate and maintain callus organogenesis cultures of soybean. The differences
among soybean genotypes in callus formation were also evaluated.
(3) Performed a system for soybean transformation and regeneration using immature
embryos and cotyledonary nods.
(4) Use of DNA markers in particular to their use in molecular characterization for
genetic improvement of cotton leaf worm in soybean

The results of this study can be summarized as follow:

1-Field Performance and Variation of Soybean Genotypes

Two experiments were carried out at Giza research station, ARC, 2003 and 2004
summer seasons. Planting take place on 25 May in both seasons. The analysis of variance
of field experiments was made for each season separately, and then a combined analysis
of variance was performed for the two seasons. For laboratory experiments, the analysis
of variance was made for each of experiment (survival 1 and survival 2) separately.
Simple correlation coefficients among all studied characters were performed. The
variance components and coefficients of variation were estimated.. The broad sense
heritability and genetic advance were estimated.

The single analysis of variance for each season showed that significant
differences among genotypes were existed for all studied characters. The combined
analysis of variance indicated significant differences among genotypes for all
characters, while the season had significant effects on plant height, no. of pods/plant,
no. of seeds/plant, seed yield/plant and harvest index. The genotype x season interaction
effect was significant in days to 50% flowering, days to 90% maturity, maturity
period, plant height, seed yield/plant and 100-seed weight.

The results of the evaluation of the genotypes for agronomic characters and their
resistance to leaf cotton warm under field and laboratory conditions, showed narrow
range (22.35 – 26.10%) of seed oil content, while wide range of seed protein (22.70 –
57.93%) was obtained in this study. The average leaf area was ranged from 18.12 cm2
for L86K-73 to 70.24 cm2 for Giza 21, with an average of 48.27 cm2. The number of
leaf-hairs was showed the widest range (41 for Calland to 173.33 hairs for Giza 83)
among these characters. To determine the relations among these characters, correlation
coefficients were made among them. No significant differences have been found

105
among seed oil and protein contents, at one side, and survival (1) and (2) on the other
side. High significant and negative correlation was observed between number of leaf-
hairs and survival (1) and (2). The correlation coefficients among leaf-hairs and
survival (1) and (2) were r = -0.678** and -0.630**, respectively, indicating that dense
leaf-hairs is related with high resistant level. Similar finding was reported by in cotton.
The strong positive correlation between survival 1 and 2 (r = 0.891**) obtained
indicated that one test only, either in young or adult stage of leaf-worm would be
enough for screening.

Estimates of phenotypic, genotypic variances, heritability and genetic advance of

the most studied characters indicated that. The highest magnitude of phenotypic
variance was observed for biological yield/plant, number of leaf-hairs and leaf area,
indicating the possibility for selection for these traits. High heritability estimates were
found also in these characters in addition to seed yield/plant, which ranged from 97.99
- 99.80%. The expected genetic advance was high for leaf area (61.88%), seeds/plant
(56.94%) and harvest index (30.93%). Therefore, pronounced progress should be
expected from selection between genotypes for seeds/plant, harvest index and leaf
area. However, since number of hairs had high estimates of heritability and P.C.V
value, selection for this character would be useful as indirect selection for insect
resistant.

2-Tissue Culture Organogenesis

Seven exotic and Egyptian soybean genotypes selected on the basis of their
reaction to cotton leaf worm infection, were obtained from Food Legume Research
Program, Field Crops Research Institute, ARC, Giza, Egypt. The performance of
callus and plantlet characters for all tested genotypes is presented in Table (11). Callus
induction frequencies among genotypes were different and ranged from 63% for
Corsoy-79 to 79% for L86K-73, but with no significant differences among genotypes.
This result indicating that all tested genotypes had almost equal responses to callus
induction with culture method used in this study. The callus growth rate ranged
widely among genotypes. The genotype L86K-73 gave the highest growth rate value
of 1.18 g followed by Corsoy-79 with 0.93 g . The genotype L86K-73 performed also
the highest number of shoots/callus (16.25), while all other genotypes had markedly
lower number of shoots/callus, which ranged from 3.75 to 9.75. No significant
differences observed among genotypes for percentage of plantlets performed roots and
diameter of roots. The genotype L86K-73 had also the longest root of 14.25 cm and
laid among the best three genotypes performed the highest number of roots. These data
indicting that the genotype L86K-73 is the best in response to tissue culture technique
in soybean. Correlation coefficients among all studied characters were calculated and
presented in . The Data showed that callus growth rate was positively and significantly
correlated with each of number of shoots/callus and number of roots. Therefore, both
characters are considering important indicator for callus growth rate, and could be used
to predict succeeding of callus growth.

106
3- Agrobacterium Establishment Transformation System Of
Soybean Using Immature Embryos and Cotyledonary Nodes

In vitro immature embryo cotyledonary Organanogenesies of soybean

(control):
Immature embryos were used to produce soybean plantlets according to the
method described. The MS medium was used to regenerate plantlets (Table 14). The
OR medium was used for callus induction, while MSR medium was used for
production of shoots from callus. The produced shoots were transformed to glass
tubes containing the hormone-free MS medium for rooting. When a reasonable
number of roots is grown (usually after 3-4 weeks) the plantlets were removed from
the glass tubes in to 10-cm diameter- plastic pots filled with fumigated soil mixture
of peat and sand with a ratio of 3: 1. To maintain optimum air humidity surrounding
plants, pots were covered with polyethylene bags and then placed in the green
house. Irrigation was applied using (0.25) Hogland solution
Kanamycin sensitivity:
The immature embryos (0.5-10mm in diameter) and cotyledonary nodes (2-5
days old) of soybean genotypes were tested for the sensitivity to Kanamycin
according to the method. in order to identify the proper Kanamycin concentration to
be used in testing soybean genotypes; kanamycin concentrations of 0, 25, 50, 75,100
and 125 mg/L. The data were recorded and statistically analyzed.
Time of inoculation on Agrobacterium media

Ten plates for each genotype containing 10 ex-plants/plats (explants developed by

immature embryos method) were co cultivated with LBA4404-pBI121 for different
inoculation time as 60, 120, 180 and 240 seconds. The presence of transient GUS
expression was investigated after co-cultivation for 4h (over night) in MS media
supplemented with B5 vitamins and containing 100 mgL-1 kanamycin. The data
indicated that 180 sec. is the best time for incubation. No significant difference was
observed among genotypes. A similar technique was used with explant developed by
cotyledonary nodes. The Data revealed that four seconds showed the best time for
co-cultivation cotyledonary nodes with Agrobacterium. There was no significant
difference among genotypes regarding the co cultivation time. The highest mean of
successful cotyledonary nodes (27%) was obtained using the genotype Giza35 after 4
seconds as inculcation time. used 2 second for inoculation of Agrobacterium with
cotyledonary nodes. The difference in inculcation time between studies could be
attributed to the type of cotyledonary nodes used.
Kanamycin concentration:

The proper Kanamycin concentration was determined to be used in selection

procedures. Immature embryos produced from in vitro transformed soybean
genotypes were tested for their Kanamycin resistance by culturing them on callus
initiation medium containing MS basal salts and hormones supplemented with
different concentrations of Kanamycin sulfate (0, 25, 50, 75, 87.5, 100 and 125 mgL-
1
). The Kanamycin concentration of 87.5, 100 and 125 mgL-1 found to be effectively
to kill all explants, the intermediate con concentration of 100 mgL-1was chosen to be
used in selection media. Results revealed that the best Kanamycin concentration for
selection is100 mgL-1 in both immature embryos and cotyledonary nodes methods

107
 (Figures 4 and 5). The obtained results are in agreement with those obtained by who
suggested that the Kanamycin concentration, to be used as selectable marker ranged
between 50 and 300 mg/liter in Vitis vinifera. On the other hand, and noted that the
efficient Kanamycin concentration to used as selectable marker is l00 mgL-1, which is
accordance with the results obtained in this study.

Production of transformed plantlet by immature embryos:

The different degrees of gene expression from transit GUS gene in immature
embryos as explants. Also, the transformed calli that had transit GUS (colored) and
those non-transformed (control). The gene transforming was made successfully, and
the percentages of successful transformed soybean genotypes . The genotypes L86K-
73, Giza111 and Clark had percentages of 9.5, 10.9 and 11.6%, respectively in
transformed embryo. The mean of transformed callus for L86K-73 was (12.5%) in
Kanamycin and (19.2%) in GUS expression, while it increase in shoots to (25%). The
percentage successful obtained plantlets for L86K-73 was (10%). The date revealed
that, successful callus transformed was different with Kanamycin selection gene and
GUS expression. The percentage of successful callus was ranged from (12.50-19.17)
for L86K-73, (10.00-31.25) for Gizall1 and (17.50-33.34) for Clark. There was no
significant difference between genotypes.
Factors affecting transformation efficiency in soybean investigated by such as
Agrobacterium concentration during inoculation and co-culture and the selection
regime, initial immature zygotic cotyledon size and the used technique of tissue
culture. Addition to host recognition reported another factors including status of
bacterial infection,, and transformation competency of the target tissue. While used a
reproducible gene transfer technique for soybean, and concluded that it would be
useful for improving cultivars without using tissue culture technique. Some materials
used to improve to transformation in soybean such as acetosyringone treatments.

b- Production of transformed plantlet by Cotyledonary nodes:

In this method shoots were directly performed from coty1edonary nodes. The
three genotypes used in this technique Giza35, Giza21, and Calland. The steps of
development (explant, shoot and plantlet) are shown in plate (2, a, b, c). In Kanamycin
selection, the Calland was the best genotype compared with Giza35 and Giza 21 .
Also, the data in revealed that there was significant difference between genotypes
used in cotyledonary nodes. Calland was the highest in transformation rate, with 12%
successful percentage, Giza 35 followed by and then Giza 21. found that
transformation frequency was varied among soybean cultivars in cotyledonary nodes.
The genotypes L86K-73, Giza111, and Clark transformants were characterized by
PCR assay. The specific primers of GUS were attachments and separated in 1.8 kb in
gel electrophoresis (Fig. 6) which shows in 1, 2, and 3. The genotypes Giza 35, Giza
21, and Calland transformants were characterized by PCR assay. The products of PCR
were separated in 1.8 kb for the six genotypes.

As indicated above the transformation was successfully made for (a) and (b)
Agrobacterium mediated immature embryos and cotyledonary node
transformation. The method of cotyledonary node took shorter time than immature

108
embryo method. In addition the somaclonal variation in cotyledonary node is lower
than the other method. Therefore, cotyledonary node is successfully to be better than
immature embryo method. Studied improvements in T-DNA delivery, A. tumefaciens
strain, tissue culture conditions, and selection of transgenic plants have increased the
efficiency of these transformation systems and reported of cotyledonary node method
in approximately.

4-Molecular Characterization of Soybean Genotypes to Resistant /Susceptible

Cotton Leaf Worm

Four molecular analysis techniques were used to characterization and

differentiate among soybean genotypes. In the first technique The isozyme variation
among the 14 genotypes was studied using native polyacrylamide gel electrophoresis
for the peroxidase, esterase and malta dehydrogenase. The results revealed that the
isoenzyme pattern of 14 genotypes gave 9 bands for Forrest, 8 bands for Giza 111 and
Corsay-79, 7 bands for Hutcheson, Calland, Clark and Giza21 an 6 bands for Giza
21,Giza 83 and Lakota. While, Giza35 was given 5 bands, also, Crowford and L86k-
73 were given 4 bands. In Esterase isozyme L86K-73 genotype gave the highest
number of bands (2) while all the other genotypes had only one band except genotypes
Forrest, Hutcheson, Lakota, Giza 111 and Giza 22 which gave zero bands. In malate
dehydrogenase isozyme L86K-73, Giza 111, Giza 83, Cark, Giza 35, Giza 22 and
Crowford genotypes gave 2 bands. While the other genotypes gave one bands. In
malate dehydrogenase isozyme genotypes L86K-73,Giza 111,Giza 83,ClarkGiza 22
and Crowford give 2 band which resistant to cotton leaf worm except Crowford
genotype did not resistant it. The other genotypes gave one band. From Isoenzymes
Peroxidase give bands as positive marker for Forrest genotypes. Moreover, the
genotypes L86K-73 and Crowford did not give any bands in negative form which were
band as negative markers for these genotypes. In the other hand, density of bands was
highest in Forrest and Clark. The accumulate data indicated that isozymes analysis did
not allow for variation among soybean genotypes of the basis of this resistance/
susceptible to cotton leaf worm.

The second technique was leaf and seed protein analysis by SDS-PAGE
Protein electrophoresis. Bands intensity was much dense in resistance genotypes.
Protein SDS -PAGE didn't show differences between the fourteen genotypes except
the intensity of bands. The results revealed the presence of eight bands of molecular
weight ranging from 1263 to 144 KD. Concerning the differences between genotypes,
it is clear from leaf protein profile that the presence and absence of bands were
assessed with (1) and (0), respectively. The overall results of total protein pattern
obtained by SDS-PAGE were not clear cut in monitoring molecular markers for the
plant insect resistance against the cotton leaf worm spodoptera littorallis (Boisd).
Similar results were obtained also in soybean. This result might be attributed to that
the study of the resistant and susceptible genotypes was done with no cotton leaf worm
infection stress. The results of SDS-PAGE for the water soluble proteins leaf in the
fourteen genotypes (Plate 4 and Table 22) revealed a total number of 8 bands with
molecular weights (MW) ranging from about 1263 to144 KDa. Data showed that all
bands are common for the fourteen soybean genotypes (monomorphic), however they
differed in density and intensity. The densitometric analysis of SDS-protein banding
patterns of the leaf of the studied genotypes was found to be not informative in their
work. On the other side, the results of SDS-PAGE for the water soluble proteins in

109
the seeds of fourteen soybean genotypes (Plate 4 and Table 23) revealed a total
number of 13 bands with molecular weights (MW) ranging from about 220.36 to 9.1
KDa. Data showed that all bands are common for the fourteen genotypes except two
bands 220.36 and 194 KDa. for Calland genotype can be considered as specific bands.
Moreover they differed in density and intensity. Similarity index among the fourteen
soybean genotypes based on protein analysis, carried out using UPGMA computer
program, is shown in Table (24). The similarity relationships ranged between 1.000
and 0.950. The highest similarity index (1.000) was recorded between each two of the
genotypes; L86K-73,Corsay-79,Giza 21,Forrest,Hutcheson,Lakota,Giza111,Giza
83,Giza 22 ,Giza 35,Giza 82 and Crowford. However, the lowest similarity index
(0.950) was observed between Calland and each of the thirteen genotypes. The genetic
distances relationships among the fourteen soybean genotypes based on leaves and
seeds protein patterns. The dendrogram confirmed the close genetic relationship
among these genotypes.

The third technique was Random Amplified Polymorphic DNA (RAPD) which
used four 10-mer arbitrary primers for the fourteen soybean genotypes. The results
showed that polymorphism levels differed from one primer to the other 30-1670 pb. ,
Primers produced high levels of polymorphism fragments number ranging from four
primers.. There were some specific fragments which can be used to discriminate each
soybean genotypes from the other.
These markers as present in following:- Primer OP-A9B7 showed specific
fragment (520bp) as positive marker for Clark genotype. Primer OP-A1 showed six
specific fragment four of them as negative markers three for Hutcheson
genotype(430,280 and 50 bp) and one for Lakota genotype (810 bp) as negative
marker, and also two as positive markers (360 and 320 bp) for Hutcheson. Primer OP-
A1A13 showed three specific fragments as positive markers one (960bp) for
Hutcheson, one (740bp) for Forrest and one (360bp) for Giza111. Primer OP-A7 did
not showed specific fragment.
The results of cluster analysis (similarity index) the highest similarity value recorded was 0.885, which was
observed between Forrest and Giza 22 genotypes, while the lowest similarity value was 0.606 between Hutcheson
and Giza35 genotypes. The dendrogram for the genetic relationships among the fourteen soybean genotypes across
the four primers indicate that the fourteen soybean genotypes were separated into two clusters; cluster 1 included
two sub cluster. The sub cluster1 were conformed from three groups .The group 1, group 2 and group 3 were
included Forrest and Giza22; Calland and Giza111 and Giza 35 and L86K-73 respectively. While, sub cluster 2
comprised four groups group1 were contained Clark and Giza 82, group 2 has Crowford genotype only and the
genotypes Giza21 and Giza83 were located in group 4. The second cluster was contained Hutcheson genotype. The
RAPD was succeeded to distinguish the 14 soybean genotypes on the basis of their resistance cotton leaf worm.
The fourth technique PFLP used The results investigated the PFLP pattern by restriction enzyme BamH1
produced for each soybean genotypes was seen identical pattern which showed similar one band in 285 bp. The
enzyme MSPI was also used digestion of PCR products for each soybean genotypes which give one band (870 bp)
for L86K-73 and four bands (730, 417, 275 and 65 bp) for the rest genotypes. While, Taq1enzymee give six bands
(580, 430, 90, 70, 50 and 30 bp) in all genotypes except L86K-73 and Corsay-79 which give one band 1400 and
30bp respectively. However this technique did not allow differentiating among genotypes on the basis of their
resistance to cotton leaf worm probably due to this narrow genetic distance. The combined dendogram was made
used the results obtained from protein RAPD and RFLP analysis. The dendogram was classified the fourteen
genotypes according to their resistance to cotton leaf worm. The genotypes Forrest, Giza 22, Giza111, Giza 35,
Calland, Clark and Giza 82were the most related and ranked in the dendogram from 1 – 7. Theses genotypes are
resistance/ moderately resistance to cotton leaf worm.

110
 REFERENCES
A.O.A.C. (1990). Official Methods of Analysis. Association of Agriculture Chemists,

Washington D.C., USA.

Afifi, F.M.L. (1990). Observations on the relative distribution of the egg-

masses and larvae of the cotton leaf-worm, Spodoptera littoralis

(Boisd). (Lepidoptera: Noctuidae), in soybean fields. Bulletin of

Faculty of Agric., Univ. of Cairo, 41 (3): 631-638.

Alghamdi, S. S. (2004). Yield stability of some soybean genotypes across divers

environments. Pakistan J. of Bio. Sci., 7 (12): 2109-2114.

Al-Janabi, S.M. and R.C. Shoemaker (1992). A rapid method of regeneration and

Agrobacterium-mediated transformation of soybean. Soybean Genetics Newsletter.

19: 101-107.

Allard, R.W. (1960). Principal of plant breeding. Wiley and Sons, New York, pp 485.

Amer, I. M.(1992). Improved plant regeneration from organogenic soybean cultures.

Egyptian J. of Agro.,17 (1/2)89-98.

Antarlina,-S-S;J.S. Utomo; E. Ginting and S. Nikkuni (2002). Evaluation of Indonesian

soybean varieties for the processing and improvement of fermented foods, Part I.

Evaluation of Indonesian soybean varieties for food processing JIRCAS Working

Report. (24): 58-68.

Ausubel,F.M.,Brent,R.,Kingston,R.E.,Moore,D.D.,Seidman,J.G.,Smith,J.A.,Struhl,K.

(1994).Current Protocols in Molecular Biology. Wiley, New York.

Awadallah, W.H.; A.F. Lutfallah; Eglal M. Abd Elmonem; M.F. El-Metwally and M.Z.

Hassan (1990). Evaluation of some soybean genotypes for their resistance to the

111
 cotton leaf worm Spdopetra littoralis (Boisd.). Agric. Res. Rev., Egypt 68 (1): 121-

126.

Ayub-Khan; Mir-Hatam and Amjad-Khan(2000). Heritability and

interrelationship among yield determining components of soybean

varieties. Pakistan Journal of Agric. Research, 16(1): 5-8.

Bangar,-N-D;G.D. Mukhekar;D.B. Ladand D.G. Mukhekar (2003). Genetic variability,

correlation and regression studies in soybean. Journal of Maharashtra Agricultural

Univ., 28(3): 320-321.

Barawale, U.B.; H. R Kerns and J.M. Widholm (1986). Plant regeneration from callus

cultures of several soybean genotypes via embryogenesis and organogenesis.

Planta, 167:473-481.

Bartun, G.W. (1952). Quantitative inheritance in grasses. Proc. VI. Int. Grassland Cong.,

1:222-283.

Byrne,M.C.; R.E. McDonnell; M. S. Wright; M.G. Carnes, (1987). Plant Cell Tissue and

Organ Culture. 8(1): 3-15.

Carvalho, V. de. P.; R. V. Abdelnoor; A. M. R. Almeida;C. A. A. Arias and R. A. de. S.

Kiihl (2002). Molecular markers linked to the resistance to race 3 of the soybean

cyst nematode Heterodera glycines. Crop Breeding and Applied Biotechnology.

2(1): 77-83.

Carvalho,.G.A.; T. Sediyama; A.L.A. Marin; E.G. Barros and M.A. Moreira (2002).

Identification of RAPD markers linked to a soybean stem canker resistance gene.

Fitopatologia Brasileira, 27(5): 474-478.

112
Casas, A.M., E. Igartua, G. Balaguer and M.A. Moreno (1999). Genetic

diversity of Prunus rootstocks analyzed by RAPD markers.

Euphytica, 110: 139-149.

Chen, L.F.O.; W. C. Yun ; H.Y. Kou and M. H. Chen (1994) Polymorphic distinction of

soybean by molecular markers. Soybean Genetics Newsletter, 21: 70-75.

Chettri, M.; S.Mondal and R. Nath (2003) Studies on correlation and path

analysis in soybean (Glycine max, L. Merrill.) in the Darjeeling

hills. J. of Hill-Res., 16(2): 101-103.

Christianson, M.L.; D.A warnick and P.S. Carlson (1983). A Morphogenetically

component soybean suspension culture. Sci., 222: 632-634.

Christou, P.; D.E. McCabe and W.F. Swain (1988). Stable transformation of soybean

callus by Delzer DNA-coated gold particles. Plant Phys., 87(3): 671-674.

Colby and Meredith (1990). Kanamycin sensitivity of cultured tissue of Vitis. Plant Cell Rep.,

9: 237-240.

Croxford, A.C.; P.J. Edwards and S. D. Wratten (1989) Temporal and

spatial variation in palatability of soybean and cotton leaves

following wounding. Oecologia, 79(4): 520-525.

Dan-YingHui and N-A- Reichert (1998) Organogenic regeneration of soybean from

hypocotyl explants. In Vitro Cellular and Develop. Biology Plant, 34(1): 14-21.

De-Block, M.(1988). Genotype independent leaf disc transformation of potato (Solanum

tuberosum) using Agrobacterium tumefaciens. Theor. and Appl. Gene., 76: 767-774.

Dellaporta, S. L.; J. Wood and J.P. Hicks (1983). A plant DNA minipreperation.Version III

.Plant Molecular Biology Report, 1:19-21.

113
Delzer,B.W.; D.A. Somers and J.H. Orf (1990). Agrobacterium tumefaciens susceptibility

and plant regeneration of 10 soybean genotypes in maturity groups 00 to II. Crop

Sci., 30(2): 320-322.

Diers , B.W. ;P. Keim; W. R. Fehr and R. C. Shoemaker(1992). RFLP analysis of

soybean seed protein and oil content. Theor. Appl. Genet. 83: 608 – 612.

Donaldson,P.A. and D.H. Simmonds (2000). Susceptibility to Agrobacterium tumefaciens

and cotyledonary node transformation in short-season soybean. Plant Cell Reports.

19(5): 478-484.

El-Dakroury, F. (1979). Studies on the important cotton insects. Ph. D. Thesis Fac. Agric.

Kafr El-Sheikh, Tanta Univ..

El-Shemy,H.A.; Mutasim-Khalafalla; K. Wakasa and M. Ishimoto (2002).

Reproducible transformation in two grain legumes soybean and azuki bean - using

different systems. Cellular and Molecular Biology Letters. 7(2B): 709-719.

Eman, Ibrahim, A. (2006). Molecular genetic characterization studies of some soybean

cultivars. M.Sc. Thesis, Fac. Agric. Ain Ahams Univ., Cairo, Egypt.

Facciotti,-D; J.K. O'-Neal; S. Lee and C.K. Showmaker (1985). Light-inducible

expression of a chimeric gene in soybean tissue transformed with Agrobacterium.

Bio/Technology. 3(3): 241-246.

Feinberg, A. P. and B. Vogelstein, (1983). A technique for radiolabelling DNA restriction

endonuclease fragments to a high specific activity. Anal. Biochem., 132: 6-13.

Fenille, R.C.; N. L. de. Souza and E.E. Kuramae (2002). Characterization of Rhizoctonia

solani associated with soybean in Brazil. European Journal of Plant Pathology,

108(8): 783-792.

114
Funatsuki, H.; H. Kurosaki; T. Murakami; S. Matsuba; K. Kawaguchi; S. Yumoto and

Y. Sato (2003). Deficiency of a cytosolic ascorbate peroxidase associated with

chilling tolerance in soybean. Theoretical and Applied Genetics, 106(3): 494-502.

Gamborg, O. L.; R. A. Miller and K. Ojima (1968). Nutrient requirements of suspension

cultures of soybean root cells. Exp. Cell Res. 50:151-158.

Ghanem, S. A. (1995). In vitro propagation of Hyoscyamus. Bull. Fac. Agric. Univ. Cairo

46: 103-112.

Giancola, S.; S. M. Poltri; P. Lacaze and H. E. Hopp (2002). Feasibility of integration of

molecular markers and morphological descriptors in a real case study of a plant

variety protection system for soybean. Euphytica, 127(1): 95-113.

Gomez, K.A. and A.A. Gomez (1984). Statistical Procedures of Agricultural research. 2nd

edition. John Wiley & Sons, New York.

Grant, T. N. and K. M. Soliman (1999). Detection of polymorphic DNA and taxonomic

relationships among 10 wild perennial soybean species using specific and arbitrary

nucleotide primers. Biologia Plantarum, 42 (1): 25-37.

Habbeb, B.M. (1988). Genetical studies on soybean (Glycine max (L) Merril). Ph.D. Thesis,

Fac. Agric. Minufiya Univ., Shebin El Kom, Egypt.

Hamdi, A.; A.M. Khattab and M.K. El-Warki (1991). Genotype x environment interaction

and stability analysis for seed yield of lentil. Fayoum J. Agric. Res. & Dev., 5(2):1-

12.

Harold N. Trick; R.D. Dinkins;E. R Santarem; R. Di V. Samoylov; C. A. Meurer; D.R.

Walker; W. A. Parrott ;J.J. Finer and G.B. Collins(1997). Recent advances in

soybean transformation. Plant Tissue Culture and Biotechnology (3)1: 9-25.

115
Helms, T.; J. Orf; G. Vallad and P. McClean (1997). Genetic variance, coefficient of

parentage, and genetic distance of six soybean populations. Theoretical and

Applied Genetics, 94(1): 20-26.

Hillis, D. M., and M. T. Dixon (1991). Ribosomal DNA: Molecular

evolution and phylogenetic inference. Quart. Rev. Biol. 66: 411–

453.

Hoagland, D.R. and D. I. Arnon (1950). The water-culture method for growing plants

without Soil. California Agric. Exp. Sta. Bull. No. 347.

Hoekema, A.;P.R. Hirch; P.J.J. Hooykaasand and R.A. Shilperoort (1983). Nature,

(303) 179-180.

Istock, C. A., Ferguson, N., Istock, N. L. & Duncan, K. E. (2001). Org.

Div. Evol.

1, 179–191.

Jagdish S.; R.P. Parmar; and H.S. Yadav (2000). Assessment of genetic variability and

selection parameters in early generation of soybean. Advances in Plant Sciences.

13(1): 227-232.

Jain,P. K. and S. R. Ramgiry (2000). Genetic variability of metric traits in

Indian germplasm of soybean (Glycine max (L.) Merrill). Advances

in Plant Sciences, 13(1): 127-131.

James, M. Narvel; D. R. Walker; Brian G. Rector; John N. All; W. A. Parrott and H.

R. Boerma (2001). A Retrospective DNA Marker Assessment of the Development

of Insect Resistant Soybean. Crop Sci., 41:1931-1939.

Janssen, B. J. and R. C. Gardner. (1989). Localized transient expression of GUS in leaf

discs following co-cultivation with Agrobacterium. Plant Molecular Biology, 14:

61-72.

116
Johanson, H.W.;H.F. Robinson and R.E. Comstock (1955). Estimation of genetic and

environmental variability in soybeans. Agronomy J., 47:314-318. Exp. Agric. 29:9-

19.

Junyi, G. (2006). Segregation Analysis on Genetic System of Quantitative Traits in Plants.

Front. Biol. China 1: 85–92.

Jyoti-Sethi and S. D.Tyagi (2005). Direct and indirect contribution of

different traits towards maximization of grain yield in soybean.

Advances in Plant Sciences, 18(1): 331-335.

Khalil, S. A.(1988). Constraints in production of soybean. Quality seed

production, 108-116.

Kim-Young Jin; Park-TaeIl; Kim-HyunSoon; Park-HoKi; Chon-Sang Uk and Yun-

Song Joong. (2004a). Factors affecting organogenesis from mature cotyledon

explants and regeneration in soybean. Journal of Plant Biotechnology, 6(1): 39-43.

Kim-Young Jin; Park-TaeIl; Kim-HyunSoon; Suh-SugKee; Kim-HagSin and Yun-

Song Joong(2004b). Effective acclimation system for in vitro regenerated plantlets

of soybean. Journal of Plant Biotechnology, 6(2): 107-111.

Ko, T.S.; S.M. Lee; S.K. Farrand and S.S. Korban (2004a). A partially disarmed vir

helper plasmid, pKYRT1, in conjunction with 2,4-dichlorophenoxyactic acid

promotes emergence of regenerable transgenic somatic embryos from immature

cotyledons of soybean. Planta, 218(4): 536-541.

Ko, T .S. and S.S. Korban (2004b). Enhancing the frequency of somatic embryogenesis

following Agrobacterium-mediated transformation of immature cotyledons of

soybean [Glycine max (L.) Merrill.]. In Vitro Cellular and Developmental Biology

Plant. 40(6): 552-558.

117
Kosturkova,G.(2000). Development of in vitro regeneration systems of soybean tissue

cultures. Rasteniev"dni-Nauki, 37(8): 580-586.

Kulvir-Singh; Sarbjeet-Singh and D. S. Kler (2000). Correlation and

regression studies among various growth and yield parameters of

soybean (Glycine max (L.) Merrill) under Punjab conditions. Crop

Research Hisar, 19(2): 287-297.

Kumari, B.D.R.; A. Settu and G. Sujatha (2004). Agrobacterium-mediated genetic

transformation in soybean (Glycine max (L.) Merr.). Plant-Cell-Biotechnology-

and-Molecular Biology, 5(3/4): 165-168.

Laemmli, U.K.(1970).Cleavage of structural Proteins during the assembly of the heat of

bacteriophage T4. Nature, 227:680-685.

Lee, W. B. and T. Komatsuda (1994). Binary vector mediated transformation of soybean.

Soybean Genetics Newsletter, 21: 87-91.

Li, H.Y.; Y.M. Zhu; Q. Chen; R.L. Conner; X.D. Ding; J. Li and B.B. Zhang (2004).

Production of transgenic soybean plants with two antifungal protein genes via

Agrobacterium and particle bombardment. Biologia- Plantarum, 48(3): 367-374.

Li, J. ; J. Faghihi; J.M. Ferris and V. R. Ferris (1996). The use of RAPD amplified DNA

as markers for virulence characteristics in soybean cyst nematode. Fundamental

and Applied Nematology, 19(2): 143-150.

Li-GuiLan; Qiao Ya Ke; Yang Shao Hui; Jin Zhao Xia and Li Ming Gang (2005).

Study of the Agrobacterium-mediated transformation systems of soybean

cotyledonary node. Acta Agronomica Sinica, 31 (2): 170-176.

Liu Hai Kun; Yang Chao and Wei Zhi Ming (2004). Efficient Agrobacterium

tumefaciens-mediated transformation of soybeans using an embryonic tip

regeneration system. Planta, 219 (6): 1042-1049.

118
Liu XiaoBing, Wang GuangHua, Jin Jian, Herbert, S. J. and Zhang QiuYing (2005).

Yield components, dry matter, LAI and LAD of soybeans in Northeast China. Field

Crops Research, 93 (1) 85-93.

Luo, G; A. Hepburn and J. Widholm (1994). A simple procedure for the expression of -

119 - genes in transgenic soybean callus tissue. Plant Cell Reports, 13 (11): 632-

636.

Lutfallah, A.F.; Kh. A. Alassily; M.A. El-Nagar; M.S. Ali; M..M. Khewa and E.A.H.

Sherief (2003). Effect of simulated infestation levels caused by leaf feeding larvae on

soybean plant traits and crop yield. Egypt. J. Appl. Sc., 18 (11B): 607-620.

Lutfallah, A.F.; M.Z. Hassan; K. A. Mewafy, Safia T. Abdalla and Kh. A. Alassily (1998).

Studies on soybean genotypes resistant to the cotton leaf worm, Spodoptera littoralis

(Boisd), (Lepidopetera: Noctuidae). Annals of Agric. Sc. Moshtohor, 36(3): 1851-

1860.

Mahmoud, Z.H. (1984). Soybean oil and meal, the focus for production and research in Egypt.

In: Singh S.R., K.O. Rochieand and K.E. Dasniell (eds.). Soybean for tropics. John

Wiley & Sons, New York.

Manoj-Tripathi and Sharad-Tiwari (2003). Epigenesis and high-frequency plant

regeneration from hypocotyl explants of soybean (Glycine max L. Merrill). Plant

Cell Biotechnology and Molecular Biology, 4(1/2): 23-32.

Manoj-Tripathi and Sharad-Tiwari(2004). Morphogenesis and plantlet regeneration from

soybean (Glycine max L. Merrill) leaf discs influenced by genotypes and plant

growth regulators. Legume Research, 27(2): 88-93.

Manoj-Tripathi and Sharad-Tiwari(2004a). Effect of genotype and culture medium on

callus proliferation and morphogenesis of immature embryonic axes of soybean

119
 (Glycine max L. Merr). Plant Cell Biotechnology and Molecular Biology, 5(1/2): 1-

6.

Manoj-Tripathi and Sharad-Tiwari(2004b). Plant regeneration from immature cotyledon

derived cultures of soybean (Glycine max L. Merr). Plant Cell Biotechnology and

Molecular Biology, 5(3/4): 121-128.

Mansour; A. A. M. (2004). Transfer of valuable gene(s) from different organisms to some

economic plants. Ph. D. Thesis. Department of Genetics, Faculty of Agriculture,

Ain Shams Univ..

Meisner, J. M. Z. and E.B. Moshe (1983). Laboratory evaluation of the response of

Spodoptera littoralis (Boisd) to select cotton genotypes. Zeitschrift fur Angewandte

Entomologic, 95 (5): 467-470. (C. F. Rev. App. Ent., 71 (11): 7571, 1983).

Mello-Filho, O.L.de; C.S. Sediyama; M.A. Moreira; M.S. Reis; G.A. Massoni; and

N.D. Piovesan (2004). Grain yield and seed quality of soybean selected for high

protein content. Pesquisa Agropecuaria Brasileira, 39(5): 445-450.

Mizutani, N.; T. Wada and M. Takahashi (2001). The resistance of the soybean

breeding line Kyukei 279 to the common cutworm, Spodoptera litura, and

soybean stink bugs. Kyushu Plant Protection Research, 47: 87-90.

Mukhekar, G. D.; N.D. Bangar and D. B. Lad (2004). Character association and path

coefficient analysis in soybean (Glycine max (L.) Merill). Journal of Maharashtra

Agric. Univ., 29(3): 256-258.

Murashige, T. and F. Skoog (1962). A revised medium for rapid growth of bioassays with

tobacco tissue culture 15 (2): 175-182.

120
Myong Gi CHUNG; Mi Yoon CHUNG; April D. C. JOHNSON and Reid G. PALMER

(2006). Restriction fragment length polymorphisms in the USDA soybean

germplasm from central China. Botanical Studies, 47: 13-21.

Nan Xiang Ri; Liu Wen Ping; Liu Li Yan; Lu Xiao Bo; He Yun Xia and Wei-

ZhiMing(1998). PEG-mediated transformation and regeneration of soybean

protoplasts with Bacillus thuringiensis CryIAc gene. Soybean Science, 17(4): 326-

330.

Nasr, M. I.; K.A. EI-Halafawy; A. Hamdi ; E. A. EI-Absawy, and E. M. Zayed (2005).

Tissue culture organogenesis in soybean . J. Agric. Sci. Mansoura Univ., 30

(9):521 0-5208.

Nassib, A.M.; K. G. Cassman; M.Z. Hassan; M. H. El-Sherbeeny and S.T.

Abdalla (1985). Irrigated soybean production in Egypt. Soybean in tropical and

subtropical cropping systems, 429-434.

Oh-YoungJin; Kim-KyongHo; Suh-SugKee; Park-HoKi; Lee-MiJa; Kim-HagSin;

Kim-YoungJin; Kim-SooDong and L.S.Hee(2005). A new soybean cultivar for

sprout with small seed size, disease resistance and high yield, "Bosug. Korean

Journal of Breeding, 37(2): 109-110.

Olhoft, P.M.; L.E. Flagel; C.M. Donovan and D.A. Somers (2003). Efficient soybean

transformation using hygromycin B selection in the cotyledonary node method.

Planta, 216(5): 723-735.

Ojo, D.K. and O.J. Ariyo (1999). Inheritance of resistance to the soybean

defoliator (Spodoptera littoralis) (Boisd). Journal of Genetics and

Breeding, 53(1): 25-30.

Olsen G. and C. Woese (1993).Ribosomal RNA: a key to phylogeny. FASEB J.

Jan;7(1):113-23.

121
Owens, L.D. and C. A. Smigocki, (1988). Transformation of soybean cells using mixed

strains of Agrobacterium tumefaciens and phenolic compounds. Plant Physiology.

88(3): 570-573.

Park-HongJae; Kwon-TaekRyoun; Kim-KyungHwan; Kim-TaeSan; Park-YongHwan

and Kim-YongHwan(2004). Effects of explant source, media and growth

regulators on shoot regeneration of soybean (Glycine max (L.) Merr.) in vitro.

Korean Journal of Breeding, 36(2): 71-75.

Parrott, W.A.; L. M. Hoffman; D.F. Hildebrand; E.G. Williams and G.

B. Collins (1989). Recovery of primary transformants of soybean.

Plant Cell Reports, 7(8): 615-617.

Patil, S. R.; Maya-Kumari and Sripriya-Balachandran(2005). Study on

callus morphology in soybean. Journal of Soils and Crops, 15 (1):

54-56.

Patil S., Mayakumari, Meena Wankhade and Renuka Naik (2004).

Studies on in vitro regeneration and irradiation effect on soybean

cultivar "Bragg". Journal of Soils and Crops, 14 (2) 365-370

Pham Thi Be Tu, Nguyen Thi Lang and Bui Chi Buu(2003). Soybean

Genetic Diversity Analysis. Omonrice, 11: 138-142.

Pioli R. N., Eligio N. Morandi, María C. Martínez, Florencia Lucca,

Alejandro Tozzini, Vilma Bisaro, and H. Esteban Hopp(2003).

Morphologic, Molecular, and Pathogenic Characterization of

Diaporthe phaseolorum Variability in the Core soybean Producing

Area of Argentina. Phytopathology, 93, 2: 136-146.

122
Raut,-P-B; N.N.Kolte; T.H. Rathod ;R.S. Shivankar and V.N. Patil (2001). Correlation

and path coefficient analysis of yield and it's component in soybean (Glycine max

(L.) Merr.). Annals of Plant Physiology, 15(1): 58-62.

Rech, E.L.; T.J. Golds; M.R. Davey and N. Hammatt (1988). Hairy root induction in

perennial Glycine species, with regeneration of transformed plantlets in G.

canescens. regeneration from soybean Glycine max (L.) Merr. Hypocotyls Plant.

Soybean Genetics Newsletter, 15: 53-55.

Rector ,B. G.; J. N. All; W. A. Parrott and H. R. Boerma (1998).Identification of

molecular markers linked to quantitative trait loci for soybean resistance to corn

earworm. Theor. Appl. Genet., 96: 786-790.

Rector, B. G.; J. N. All; W. A. Parrott and H. R. Boerma (2004). Identification of

molecular markers linked to quantitative trait loci for soybean resistance to corn

earworm. Theor. and Appl. Genet., (19) 786-790.

Reichert, N. A.; M. M. Young and A. L. Woods (2003). Adventitious

organogenic regeneration from soybean genotypes representing nine

maturity groups. Plant Cell, Tissue and Organ Culture, 75(3): 273-

277.

Rizk, G. A.; S. M. Hussein and H.F.H. Hafez (1991a) Esterase activity in

larval tissue homogenates of Spodoptera littoralis (Boisd) reared on

different host plants. Bulletin of the Entomological Society of

Egypt, Economic Series, 1988-1989 publ 1991; (17): 37-45.

Rizk, G. A.; S. M. Hussein and H.F.H. Hafez (1991b) Studies on biotic

potential of the cotton leafworm, Spodoptera littoralis (Boisd.);

with special reference to the effect of host plants on larval

susceptibility to synthetic pyrethroids. Bulletin of the

123
 Entomological Society of Egypt, Economic Series,1988-1989 publ

1991; (17): 47-55.

Robertson, J.A.; W.H. Marison and D. Burdick (1973). Chemical evaluation of oil from

field storage damaged soybean. J. American oil chemistry Society, 50:443.

Roger Boerma H. and David R. Walker(2005). Discovery and utilization of QTLs for

insect resistance in soybean. Genetica, 123 (1-2) : 181-189.

Ronde, J.A.de; W.A .Cress; Mescht and A van der (2001). Agrobacterium-mediated

transformation of soybean (Glycine max) seed with the beta -glucuronidase marker

gene. South African Journal of Science, 97 (9/10): 421-424.

Roy,-P-K and S-R- Maloo (2001). Diallel study on some in vitro callus traits of soybean

[Glycine max (L.) Merrill]. Journal of Genetics and Breeding, 55(4): 357-362.

Sairam,-R-V;G- Franklin; R- Hassel; B- Smith; K- Meeker; N- Kashikar; M- Parani;

D- Al-Abed; S- Ismail;K- Berry and S-L- Goldman (2003). A study on the

effect of genotypes, plant growth regulators and sugars in promoting plant

regeneration via organogenesis from soybean cotyledonary nodal callus. Plant Cell

Tissue and Organ Culture,75(1): 79-85.

Salama, H.S.; F.N. Zaki; S. Salem and M. Ragaei, (1995). The use of

Bacillus thuringiensis to control two lepidopterous insect pests

(Agrotis ypsilon and Spodoptera littoralis). Anzeiger-fur-

Schadlingskunde,-Pflanzenschutz,-Umweltschutz, 68(1): 15-17.

Sambrook, J. and D. W. Russell (2001). Molecular Cloning A Laboratory Manual 3rd

edition. Cold Spring Harbor, New York.

Sambrook, J.; E. F. Fritsch and T. Maniatis. (1989). Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

124
Santarem,E. A. , B. Pelissier and J.J. Finer (1998). Effect of ex-plant orientation, pH,

solidifying agent and wounding of ination of soybean somatic embryos. In Vitro

Cellular and Developmental Biology Plant, 36(6): 456-463.

Schmidt, M. A. and W. A. Parrott (2001). Quantitative detection of transgenes in soybean

(Glycine max (L.) Merrill) and peanut (Arachis hypogaea L.) by real-time

polymerase chain reaction. Plant Cell Reports, 20(5): 422-428.

Schroeder, H.E.; J.E. Barton; L.M. Tabe; L. Molvig; J.E. Grant; M. Jones and T.J.V.

Higgins (2000). Gene technology for improved weed, insect and disease control

and for seed protein quality. In: Knight R.(ed.). Linking Research and Marketing

opportunities for Pulses in the 21st Century, 389-396. Kluwer Academic

Publishers.

Schuster, I.; R. V. Abdelnoor; S. R. R. Marin; V. P. Carvalho; R. A. S. Kiihl; J. F. V.

Silva; C. S. Sediyama; E. G. Barros and M. A. Moreira (2001). Identification of

a new major QTL associated with resistance to soybean cyst nematode (Heterodera

glycines). Theor. and Appl. Gene., 102(1): 91-96.

Settu,A. and B. D. R. Kumari (1998). Plant regeneration from cotyledonary explants of

soybean (Glycine max (L.) Merr). Advances in Plant Sciences. 11(1): 193-197.

Shalini Bajpai; Aparna Sharma and Munishwar Nath Gupta(2005). Removal and

recovery of antinutritional factors from soybean flour . Food Chemistry,

Volume 89, Issue 4, March 2005, Pages 497-501.

Sharad-Tiwari; Prem-Shanker and Manoj-Tripathi (2004). Effects of

genotype and culture medium on in vitro androgenesis in soybean

(Glycine max Merr.). Indian Journal of Biotechnology, 3(3): 441-

444.

125
Silva, J.F.V.; R.V. Abdelnoor; C.L. Costa and G.S.Baia (2000). RAPD analysis of

Fusarium spp. isolates parasitic on Heterodera glycines eggs or soybean plants.

Fitopatologia Brasileira,. 25(3): 491-496.

Smith, C.M. and C. A. Brim (1979). Resistance to mexican bean beetle and corn earworm in

soybean genotype as dreived from PI 227687. Crop Sci., 19 (3): 313-314.

Smolov, A. P. and T. A. Oleinikova (2003). Light and nitrate utilization

by soybean callus cells. Biology Bulletin of the Russian Academy

of Sci., 30(6): 558-561.

Sokal, R. R. and Michener, M. A. (1958). Statistical method for evaluating

systematic relationship. Univ.Kansas. Sci. Bull., 28, 1409-1438.

Soltis, D. E. and Pamela, S. Soltis (1990). Isozymes in plant biology. Dioscorides Press,

Portland, Oregon pp.259.

Somers, D. A.; P. M. Olhoft and T.S. Ko (2004). Progress in soybean transformation

using Agrobacterium. Proceedings-VII - W orld-Soybean- Research-Conference, -

IV Intemational-Soybean- Processing-and - Utilization-Conference, - III -

Congresso- Brasileirode-Soj a - Brazilian-Soybean-Congress, - F oz-do- Iguassu, -

PR, - Brazil.

Song,Q.J.; L. F. Marek; R.C.Shoemaker; K.G. Lark; V.C.Concibido; X. Delannay; J.

E. Specht and P.B. Cregan (2004). A new integrated genetic linkage map of the

soybean. Theor. and Appl. Gene., 109(1): 122-128.

Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated

by gel electrophoresis. J. Mol. Biol. 98: 503. supports. Anal. Biochem., 138: 267-

284.

Studier, W. E. (1973). Genetic analysis of non-essential bacteriophage T7 genes. J. Mol.

Biol., 79:227-236.

126
Sudaric, A.; M. Vrataric and T.Duvnjak (2002). Quantitative genetic

analysis of yield components and grain yield for soybean cultivars.

Agriculture Scientific and Professional Rev., 8(2): 11-15.

Sudaric, A.; M. Vrataric; R. Sudar and T.Duvnjak (2004). Genetic

advance in yield components, grain yield and grain quality of

soybean OS-lines .Sjemenarstvo, 21(3/4): 115-125.

Suh-SugKee; Cho-YoungKoo; Park-HoKi and R. A. Scott (2000). Gene

action and heritability of leaf and reproductive characteristics in

soybean. Breeding Science. 50(1): 45-51.

Sun-ZuDong and Gai-JunYi (1999). a preliminary study on the

mechanism of resistance of soyabean varieties to the cotton

leafworm Prodenia litura (Fabricius). Acta Phytophylacica Sinica.

26(4): 329-332.

Tiwari,S. and M. K. Tripathi (2005). Comparison of morphogenic ability of callus types

induced from different explants of soybean (Glycine max L. Merril). Legume

Research. 28(2): 115-118.

Tomar, N.S. and Rajput B.S. (2002). Esterase and peroxidase isozyme markers in seed

inviability of soybean. Bhartiya-Krishi-Anusandhan-Patrika. 17(2/3): 87-93.

Tomlin, E. S.; S.R. Branch; D. Chamberlain; H. Gabe; M. S. Wright and C. N. Jr.

Stewart (2002) Screening of soybean, Glycine max (L.) Merrill, lines for somatic

embryo induction and maturation capability from immature cotyledons. In-Vitro-

Cellular-and-Developmental-Biology-Plant. 38(6): 543-548.

Trick, H.N. and J.J. Finer (1998). Sonication-assisted Agrobacterium-mediated

transformation of soybean (Glycine max (L.) Merrill) embryogenic suspension

culture tissue. Plant-Cell-Reports. 17(6/7): 482-488.

127
Turkec, A. (2005). Correlation and path analysis of yield components in soybean varieties.

Turkish Journal of Field Crops. 10(1): 43-48.

Walker, R. D.; James M. Narvel; H. R. Boerma; John N. All and W. A. Parrott

(2004). A QTL that enhances and broadens Bt insect resistance in soybean. Theor.

Appl. Genet., 109: 1051–1057

Wang Ping; Wu Ying; Ji Jing; Wang Gang and Yang QingKai (2001). Effect of

antibiotics on induction of callus and callus growth in soybean. Hereditas Beijing,

23(4): 321-324.

Wang Wei; Zhu Zhen; Gao YueFeng; Shi Chun Lin; Chen Wan Xin; Guo Zhong Chen

and Li Xiang Hui(1999). Obtaining a transgenic upland cotton harboring two

insecticidal genes. Acta Botanica Sinica. 41(4): 384-388.

Wang, L; T. Clemente; Wang Lian Zheng; S.S. Sun and Huang Qi Man(2003).

Regeneration study of soybean cultivars and their susceptibility to Agrobacterium

tumifaciens EHA 101. Acta Agronomica Sinica. 2003; 29(5): 664-669.

Wang, P.; Wang Gang; Ji Jing and Wu Ying(2004). Research progress on system of

transgene in soybean. Hereditas-Beijing. 26(6): 969-976.

Wang-Ping; Wang-Gang; Ji Jing; Zeng-FangTing; Huang BinCheng; Cao Jiang and

Wu-Ying(2004). Studies of somatic embryogenesis and genetic transformation by

Agrobacterium-mediated in soybean. Hereditas-Beijing. 26(5): 695-700.

Widholm, J. M.; P.A. Stephens and C.D. Nickell (1990). Iron deficiency chlorosis

evaluation of soybean with tissue culture. Theoretical and Applied Genetics.80

417-420.

Widholm, J.M.; M.J. Graham; D.L. Meavner and C.D. Nickell (1993). Responses of

soybean genotypes to boron, zinc and manganese deficiency in tissue culture. Plant

and Soil. 150:307-310.

128
Williams,J. G. K.;A. R. Kubelik;K. J. Livak;J. A. Rafalski and S. V. Tingey(1990).

DNA polymorphisms amplified by arbitrary primers are useful as genetic marakers.

Nucleic Acid Research, 18:6531-6535.

Wyndaele, R.; H.Van. Onckelen; J. Christiansen; P. Rudelsheim; R. Hermans and

J.de. Greef (1985). Dynamics of endogenous IAA and cytokinins during the

growth cycle of soybean crown gall and untransformed callus. Plant and Cell

Physiology. 26(6): 1147-1154.

Xing Ai Qiu; Zhang Zhang Yuan; S. Sato; P. Staswick and T. Clemente (2000). The

use of the two T-DNA binary system to derive marker-free transgenic soybeans.

Xu Xiang Ling; Gao Jing; Liu Wei Hua and Li Ji Lin (1997). Studies on transferring the

B.t. k-delta endotoxin gene into soybeans with Ti-plasmid primaril. Soybean

Science. 1997; 16(1): 6-11.

Xu-DongHe; Gao-Zhong; Gai-JunYi; Zhang-ZhiYong; Chen-ShouYi; H. Fukushi; S.

Kitajima; J. Abe and Y. Shimamoto (1999). Genetic diversity and evolutionary

tendency detected by isoenzyme, RFLP and RAPD markers in wild and cultivated

soyabeans in China. Scientia-Agricultura-Sinica. 32(6): 16-22.

Yaklich, R. W.; B. Vinyard; M. Camp and S. Douglass(2002). Analysis of Seed Protein

and Oil from Soybean Northern and Southern Region Uniform Tests. Crop Sci.

42:1504–1515.

Yan, B.; M.S.S. Reddy; G.B. Collins and R. D. Dinkins (2000). Agrobacterium

tumefaciens-mediated transformation of soybean [Glycine max (L.) Merrill.] using

immature zygotic cotyledon explants. Plant Cell Reports. 19(11): 1090-1097.

Yang, Y. S.; K. Wada and Y. Futsuhara(1990). Comparative studies of organogenesis and

plant regeneration in various soybean explants. Plant Science Limerick. 72(1)101-

108.

129
Yencho G.C.; M.B. Cohen and P.F. Byrne (2000). Applications of Tagging and Mapping

Insect Resistance Loci in Plants. Annual Review of Entomology Vol. 45: 393-422.

Yoon-MunSup; Ahn-JongWoong; Kang-JungHoon; Baek-HyungJin; Park-NamKyu

and Rho-YoungDeok(2000). Genotypic and geographical variations of beta -

amylase isozyme in soybean land races by isoelectric focusing (IEF). Korean

Journal-of-Crop Science. 45(2): 139-142.

Yoshida,-T (2002). Adventitious shoot formation from hypocotyl sections of mature

soybean seeds. Breeding Sci., 52(1): 1-8.

Yuan-FengJie and Yang-QingKai(1998). Isozyme patterns of physiological races of

Cercosporidium sojinum. Acta Phytopathologica Sinica, 28(1): 39-42.

Yue, S. X.; B. L. Liu; D. Z. Mao;X. B. Li; N. B. Hu; J. H. Fu.; L.C. Li and L.H.

Zhu(1990). A genetic analysis of progines of atrazine resistant transgenic soybean

plant. Acta Botinca Sinica, 32:343-349.

Zarkadas G .C.; Christine Gagnon ; V. Poysa; Shahrokh Khanizadeh ;Elroy R.

Cober ; Victoria Chang and Stephen Gleddie (2007a). Protein quality and

identification of the storage protein subunits of tofu and null soybean genotypes,

using amino acid analysis, one and two-dimensional gel electrophoresis, and

tandem mass spectrometry. Food Research International, 40 111–128.

Zarkadas G.C.;Christine Gagnon;Stephen Gleddie; Shahrokh Khanizadeh;Elroy R.

Cober and Ron J.D. Guillemette(2007b). Assessment of the protein quality of

fourteen soybean [Glycine max (L.) Merr.] cultivars using amino acid analysis and

two-dimensional electrophoresis. Food Research International 40 129–146.

Zayed, M. E. (1998). Estimation of genetic variance of soybean. M. Sc. Thesis, Fac. Agric.,

Minufiya Univ., Shebin El Kom, Egypt.

Zeng, P.; D. A. Vadnais; Z. Zhang and J. C. Polacco (2004). Refined glufosinate

130
 selection in Agrobacterium-mediated transformation of soybean [Glycine max (1.)

Merrill]. Plant Cell Reports. 22(7): 478-482.

Zhang-Zhan Yuan; Xing Ai Qiu; P. Staswick and T. E. Clemente (1999). The use of

glufosinate as a selective agent in Agrobacterium-mediated transformation of

soybean. Plant Cell Tissue and Organ Culture, 56(1): 37-46.

Zhang, Z. Y., Banerjee, A. K., Shou, H. X., Wang, K., Paz, M. M., Guo, Z. B(2004).

Assessment of conditions affecting Agrobacterium-mediated soybean

transformation using the cotyledonary node explant. Euphytica, Vol. 136 (2) 167-

179.

Zhou, J. H. and G. A. Atherly (1989). Insertion of the transposable element Ac into

soybean by transformation. Soybean Genetics Newsletter,16: 124-126.

Zhou, S.; G. Yin; B. Lei; Z. He; C. Lu; K. Zhang and H. Qian (1990). Plant regeneration

from immature embryo culture of soybean via organogenesis. Soybean

Science.9:285-291.

Zhu S., D. R. Walker, H. R. Boerma, J. N. All and W. A. Parrott(2006).

Fine Mapping of a Major Insect Resistance QTL in Soybean and its

Interaction with Minor Resistance QTLs. Crop Sci., 46:1094-1099

131
 ‫ﺍﻟﻤﻠﺨﺺ ﺍﻟﻌﺮﺑﻰ‬
‫أ ه ا را  ث ا   ا  – "! ث درا ا  – '&آ‪ $‬ا ‪#‬ث‬
‫ا ‪$‬را*  )‪$‬ة‪,/ .‬ل ‪,-‬ث 'ا! ‪ 2005 ،2004 ،2003 +‬و ا‪ 67 '8‬ه‬
‫ا را ‪&> 14‬آ= ورا‪7 <' 6-‬ل ا ;? وه‪ ، L86k-73 6‬آر‪$C ،79-6‬ة‪، 21‬‬
‫‪$C‬ة‪$C ،22‬ة ‪$C ،82‬ة ‪$C ،83‬ة ‪$C ، 35‬ة ‪7 ،111‬ر‪ ،‬آ‪ ،H,‬آ‪,‬رك‪F ،‬آ>‪،E‬‬
‫ه‪"J8‬ن‪ ،‬آ&او‪7‬رد‪.‬‬

‫إ ارا
 ‪:‬‬

‫>! أداء و>‪ <? #‬ا ‪&8‬اآ= ا را‪+ -‬ل ا ;? ا  و' وا ‪ K8‬ا  و' وا " ‬ ‫‪-1‬‬
‫ ودة ورق ا ‪ O' <K‬درا ا   ت ا را‪.-‬‬
‫>‪ <?R‬ودرا ا ‪ R‬س وإ‪ 8H‬ج ا ‪ > #T‬ت '< ا ‪ ?&K‬ا ‪&S #‬ة ‪ <?R8‬ا‪ P*Q‬ء‪ ،‬ودرا‬ ‫‪-2‬‬
‫ا‪ 7,8/F‬ت ' < ا ‪&8‬اآ= ا را‪+ -‬ل ا ;? ‪.‬‬
‫أداء ‪ ]H‬م ا ‪8‬ل ا را‪ 6-‬وإ‪ 8H‬ج ا ‪ > #T‬ت '< زرا* ا )‪ <T‬ا ‪ XY H &Z‬وا  ا ‪.+‬‬ ‫‪-3‬‬
‫ا ‪ ^8‬ا )‪&8 6_?$‬اآ= ا را‪+ -‬ل ا ;? ا  و' وا ‪ K8‬ا  و'‬ ‫‪-4‬‬
‫وا "  ودة ورق ا ‪.<K‬‬

‫و ا    ‪:‬‬

‫أو ‪ :‬أداء و‪ * +‬ا)اآ' ا"را& ‪"%‬ل ا‪: "#‬‬

‫• أ‪ K' `7 <8&)> ?&C‬ث ا )‪$‬ة – '&آ‪ $‬ا ‪#‬ث ا ‪$‬را* '‪،2003 6‬‬
‫‪ 2004‬وآ ن ' د ا ‪$‬ا* ه ‪ ,R ? ' 25‬ا <‪ .‬و>! > ا ‪6* !' R <? #8‬‬
‫‪a‬ة ‪ .‬أ'  ‪ )8 #"T‬رب ا  ا   ودة ورق ا ‪ 7 <K‬أ‪&C‬ى > ا ‪<? #8‬‬
‫ ;‪ Survival 1 68+‬و ‪ Survival 2‬ا ‪* < ' #"T‬د ا & ت ا  وا ‪ 8‬ودة‬
‫ورق ا ‪ -,-  <K‬أ? م ‪#> ،<+8' <?&* `7‬أ '< ا ) ا‪Q‬ول ‪ 68a‬ا ) ا ‪d e‬‬
‫)‪ (Survival 1‬و'< ا ) ا &ا‪ 68a O‬ا " دس )‪ .(Survival 2‬وإر>‪ +‬ع *د ا & ت‬
‫ا  ?‪ 6T‬أن ا ‪&8‬آ= ا را‪6-‬‬

‫‪132‬‬
ERROR: syntaxerror
OFFENDING COMMAND: --nostringval--

STACK:
945
12810
12