Mol Breeding (2008) 22:555563 DOI 10.

1007/s11032-008-9198-y

Identication, characterisation and mapping of simple sequence repeat (SSR) markers from raspberry root and bud ESTs
M. Woodhead S. McCallum K. Smith L. Cardle L. Mazzitelli J. Graham

Received: 6 February 2008 / Accepted: 6 June 2008 / Published online: 20 June 2008 Springer Science+Business Media B.V. 2008

Abstract Raspberry breeding is a long, slow process in this highly heterozygous out-breeder. Selections for complex traits like fruit quality are broad-based and few simple methodologies and resources are available for glasshouse and eld screening for key pest and disease resistances. Additionally, the timescale for selection of favourable agronomic traits requires data from different seasons and environmental locations before any breeder selection can proceed to nished cultivar. Genetic linkage mapping offers the possibility of a more knowledge-based approach to breeding through linking favourable traits to markers and candidate genes on genetic linkage maps. To further increase the usefulness of existing maps, a set of 25 polymorphic SSRs derived from expressed sequences (EST-SSRs) have been developed in red raspberry (Rubus idaeus). Two different types of expressed sequences were targeted. One type was derived from a root cDNA library as a rst step in assessing sequences which may be involved in root vigour and root rot disease resistance and the second type were ESTs from a gene discovery project examining bud dormancy release and seasonality. The SSRs detect between 2 and 4 alleles per locus and were assigned to linkage groups on the existing Glen

Moy 9 Latham map following genotyping of 188 progeny and examined for association with previously mapped QTL. The loci were also tested on a diverse range of Rubus species to determine transferability and usefulness for germplasm diversity studies and the introgression of favourable alleles. Keywords Expressed sequence tags Rubus idaeus Simple sequence repeats Raspberry EST-SSRs QTL

Abbreviations AFLP Amplied fragment length polymorphism cDNA Complementary DNA library EST Expressed sequence tag RAPD Randomly amplied polymorphic DNA QTL Quantitative trait locus SSR Simple sequence repeat

Introduction Raspberries belong to the diverse genus Rubus, the commercially important raspberries being the European red raspberry, R. idaeus L. subsp. idaeus, the North American red raspberry R. idaeus subsp. strigosus Michx and the black raspberry (R. occidentalis L.). Raspberries are grown in many parts of the world and are an important high-value horticultural

M. Woodhead S. McCallum K. Smith L. Cardle L. Mazzitelli J. Graham (&) Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK e-mail: Julie.Graham@scri.ac.uk

123

556

Mol Breeding (2008) 22:555563

industry in many European countries providing employment directly in agriculture, and indirectly in food processing and confectionary. There is currently heightened interest focused on raspberry as major sources of antioxidants, such as anthocyanins, catechins, avonols, avones and ascorbic acid, compounds that may protect against a wide variety of human diseases, particularly cardiovascular disease and epithelial (but not hormone-related) cancers (Deighton et al. 2000; Moyer et al. 2002; Stewart et al. 2007). Raspberry breeding is a long slow process in this highly heterozygous out-breeder. Phenotypic selection has limitations especially when interest is focused on more complex physiological traits. In raspberry selection for traits such as fruit quality are very broad-based and few resources or methodologies exist for glasshouse and eld screening for pest and disease resistance. Additionally, the timescale for selection of favourable agronomic traits such as root or plant vigour and the timing and duration of fruiting season, require data from different seasons and environments before any breeder selection can proceed. Progress in any breeding programme is based on the amount of genetic variability available and the effectiveness of the selection and evaluation of the trait in question. A more accurate way of assessing genetic variability and trait selection would be at the genetic level. Markers can be used to assess allele diversity across a range of germplasm, or markers can be examined for linkage to the trait or QTL underlying more complex traits. A prerequisite for genotypic selection is the establishment of associations between the traits of interest and genetic markers and requires markers and linkage maps to allow this to proceed effectively. Several genetic linkage maps have been constructed in raspberry using RAPD, AFLP and SSR markers (Graham et al. 2004; 2006; Sargent et al. 2007; Pattison et al. 2007). However, dominant RAPD and AFLP markers are less transferable between genetic maps than highly polymorphic, codominant SSR markers. Furthermore, when SSRs are derived from expressed sequence tags rather than anonymous DNA, they become gene-specic, making them very useful for the construction and comparison of genetic maps and QTL analysis. EST-SSRs have been described for a number of cultivated Rosaceae species including strawberry (Bassil et al. 2006; Keniry et al. 2006; Lewers et al. 2005) and raspberry

(Graham et al. 2006). Although some EST-SSRs may be transferable across the Rosaceae (Stafne et al. 2005), a large number of markers are required for crop improvement through marker assisted selection (MAS) and need to be identied from the species of interest. Often databases of ESTs derived from gene discovery projects can be mined for SSRs (Jung et al. 2005) but sometimes the construction and sequencing of specic cDNA libraries may be required. This work aimed to identify EST-SSRs from two sources; a root cDNA library and a bud library as a starting point for mapping ESTs which may have effects on root and plant vigour, disease resistance and the timing of bud break leading to the manipulation of fruiting season. Association of ESTs with map locations of QTL for key traits in the raspberry breeding programme were determined.

Materials and methods Plant material and DNA isolation DNA was extracted from young raspberry leaves from two cultivars, Glen Moy (R. idaeus) and Latham (R. strigosus) and 188 progeny derived from a cross between these two parents using a CTAB/chloroform method as described in Graham et al. (2004). DNA samples were also prepared from leaves from a further eight Rubus accessions in order to assess the cross-transferability of the loci developed across a wide range of germplasm. Material was chosen across the main raspberry and blackberry species, a hybrid berry used in breeding and an ornamental species of no pomological value as shown in Table 1. SSR identication Root cDNA library construction For RNA extraction, Latham (R. strigosus) raspberry plants were grown in pots containing a high sand to soil ratio with liquid feed for 4 weeks. Plants were carefully harvested to prevent root damage, washed in sterile H2O to remove all sand/soil and the roots harvested and immediately frozen in liquid nitrogen. Total RNA was extracted and used to

123

Mol Breeding (2008) 22:555563 Table 1 Rubus species used for primer transferability Accession name Glen Moy Latham R. macraei R. coreanus R. leucodermis Tayberry R. fructicosus R. grabowski R. mesogaeus R. geoides Species R. idaeus R. strigosus R. macraei R. coreanus R. leucodermis R. idaeus 9 R. fructicosus R. fructicosus R. grabowski R. mesogaeus R. geoides Common name European red raspberry North American red raspberry Tropical raspberry Raspberry Black raspberry Hybridberry Blackberry Blackberry Himalayan black raspberry Ornamental Subgenera Idaeobatus Idaeobatus Idaeobatus Idaeobatus Idaeobatus

557

Rubus 9 Ideobatus hybrid Rubus Rubus Rubus Comaropsis

construct a cDNA library in the pSport 1 vector (Invitrogen Corporation, Carlsbad, CA) following the method detailed by Woodhead et al. (2003). Single transformed colonies were identied, picked into 19 9 384-well plates and used for plasmid preparation and sequencing. Sequencing (10 ll reactions) was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), with M13 forward and reverse primers (50 -GTAAAACGACGGCCAG and 50 CAGGAAACAGCTATGAC respectively) using 25 sequencing cycles of 96C for 10 s, 50C for 5 s and 60C for 4 min on a GeneAmp 9700 PCR System thermocycler (Applied Biosystems). Sequences were analysed using a 3730 DNA Analyzer (Applied Biosystems). DNA sequences were quality scored using the Phred software (http://www.phrap.com) and then searched against the non-redundant nucleotide databases at NCBI (http://www.ncbi.nlm.nih.gov) using the BLAST algorithm (Altschul et al. 1990). SSRs were identied using Sputnik as described by Woodhead et al. (2003). EST-SSR mining from the meristematic bud library In raspberry, 380 ESTs from meristematic bud tissue (cv. Glen Ample (R. idaeus)) that are differentially expressed during dormancy phase transition (Mazzitelli et al. 2007) were sequenced using the universal M13 forward and reverse primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) as described above. Sequences were analysed on a 3730 DNA Analyzer (Applied

Biosystems) and sequence data were analysed and mined for SSRs as described above. SSR primer design and testing Primers were designed to SSRs using Primer3 (Rozen and Skaletsky 1998) and were tested on Latham, Glen Moy and ten selected progeny. Each 20 ll PCR reaction contained 20 ng DNA, 0.5 lM each primer, 200 lM dNTPs, 1 9 Taq buffer and 0.5 U Taq polymerse (Roche). Amplicon conditions were: 5 min at 95C; 35 cycles of 60 s at 94C, 60 s at 55C, and 60 s at 72C, followed by 8 min at 72C on a GeneAmp 9700 PCR System (Applied Biosystems) thermocycler. Products were analysed on 2% (w/v) agarose to assess polymorphism. ESTs from the meristematic bud dormancy cDNA libraries (Mazzitelli et al. 2007) were similarly screened for polymorphic SSRs, using a touchdown PCR performed on a GeneAmp 9700 PCR System (Applied Biosystems) as follows: 5 min at 94C; 7 cycles of 30 s at 94C, 30 s at 65C, and 30 s at 72C decreasing to 58C at 1C per cycle, followed by 25 cycles of 30 s at 94C, 30 s at 58C and 30 s at 72C, followed by 7 min at 72C (Woodhead et al. 2003). Genetic mapping For polymorphic loci, one primer was uorescently end-labelled with FAM or HEX and used to genotype 188 individuals of the Glen Moy 9 Latham mapping population (Graham et al. 2004) using a 3730 DNA Analyzer (Applied Biosystems) with

123

558

Mol Breeding (2008) 22:555563

ROX350 (Applied Biosystems) used as an internal size standard. Allele sizes were determined using GENEMAPPER (Applied Biosystems). JoinMap V 2.0 (Stam and Van Ooijen 1995) was used to construct the linkage map for population type CP (Cross pollinator). Linkage groups were separated at a LOD score of 7.0 and map distances were calculated using the Kosambi mapping function as described previously (Graham et al. 2004, 2006).

Results and discussion SSR identication EST-SSR markers are currently poorly represented on the raspberry genetic linkage maps (Graham et al. 2004, 2006; Sargent et al. 2007; Pattison et al. 2007). To date only 8 EST-SSRs have been mapped in raspberry (Graham et al. 2006). However, a number of QTLs for major traits including disease resistance and fruit quality in raspberry have been mapped across seasons and environments (Graham et al. 2006; Rusu et al. 2006, Tierney and McCallum, data not shown, Zait and Mozzim, personal communication) and candidate gene sequences and ESTs that are associated with the QTLs are being sought. A total of 4608 Latham root cDNA clones were sequenced giving 1438 singletons and 503 contiguous sequences; 335 SSRs (C12 bp) were identied from these 1941 sequences. Primers were designed to 50 randomly selected SSRs, 21 loci were polymorphic and could be mapped in this population. Analysis of the 380 dormancy phase transitionrelated ESTs gave 30 sequences containing SSRs C12 bp. From these 30 sequences ve were suitable for primer design and four of these SSRs were polymorphic and could be mapped in this population. Summary details of the 25 Rubus EST-SSR markers are given in Table 2. Homologies for 21 of the ESTs were found in the sequence databases; four show no homology to other sequences. Of the 21 that share homology to sequences in the databases, 14 (66%) showed greatest similarity to other Rosaceae sequences and the best matches are indicated (Table 2). Of the 17 root-derived ESTs (designated ERubLR) only one sequence shows homology to a root-related EST (ERubLR_SQ05_3_E02). The majority of the remaining sequences were similar to

fruit-derived (7) and petal-derived (3) ESTs and others were similar to ESTs or protein sequences from pollen, leaf, seed or vegetative material or were unknown (Table 2). This suggests that most of the genes identied here may have general roles in plant growth and development, rather than being only related to root function. The four meristematic bud ESTs also showed homology to sequences from different tissues including petals, fruit and leaves (Table 2). The SSRs amplied reliably, gave clear electropherogram proles that were easily scored and detected between 2 and 4 alleles in this mapping population. The putative locations of the SSRs within the sequences was determined, with the majority (10/ 25) unknown, 8/25 present in the 30 -untranslated regions, 6/25 in the coding sequence and only one in the 50 -untranslated region (Table 2). As more database sequences become available it may be possible to identify the unknowns more easily. Genetic mapping Of the 25 ESTs, two loci were homozygous for each parent and could not be mapped in this population but the remaining 23 markers were mapped to their respective linkage groups (Table 2) using Joinmap. The markers span six of the seven Rubus linkage groups (Fig. 1) but no root-related EST-SSRs were placed in Linkage Group 6, known to be one of two linkage groups associated with root growth and morphology (data not shown). Associations of these new EST-SSR markers with QTL for phenotypic traits of interest (Ahmad 2004; Graham et al. 2006; Graham and Jennings 2008; Rusu et al. 2006; Tierney, personal communication; Zait, personal communication; Mozzim, personal communication) were examined. Fourteen of the new EST-SSR markers have been assigned to linkage groups and linked to markers previously associated with QTL for developmental traits such as bud break, fruit development as well as fruit quality traits and disease resistance characteristics (Fig. 1). Cross transferability The EST-SSRs were transferable to some extent in 10 diverse Rubus species with ve EST-SSRs amplifying only in R. idaeus and R. strigosus (Table 3). In

123

Table 2 Characteristics of the EST-SSRs identied in Rubus idaeus Forward (F) and reverse (R) primer sequences (50 30 ) Allele sizes (bp) in Latham 9 Glen Moy 242,248 9 242 Possibly CDS 30 -UTR 30 -UTR Malus 9 domestica leaf cDNA 6e-77 (DR994811) 347/413 (84%) Glycine max seed coat cationic 6e-21 peroxidase 2 (AAC83463.1) 48/56 (85%) 2e-29 Prunus armeniaca fruit EST (CV050893.1) 105/117 (89%) Fragaria 9 ananassa whole plant secretory peroxidase-like cDNA(CO817499) 294/332 (88%) Unknown Oryza sativa protein (NP001059068.1) 20/28 (71%) 7e-05 1 Putative location of SSR Homology, accession number and identity E-value Linkage group

Locus and Genbank accession number

Repeat motif

ERubLR_SQ07_3_C07 EX567279 F ATGGCTTGTAGGTTTCACTC R CATTTGCTCAAACGATTATG F TTGAGAACCATGCCTACATATCTT 242,249 9 242 R GCTGGAAATGGATTGAATGG F CACTAGGTCGATCAAGAAGC R CTGCCATAGAAACAAACGAC 208,214 9 208 CDS/30 UTR 50 -UTR 170,180 9 170

(ACC)4

RubPara_SQ008_D04

(AT)9

1 2

Mol Breeding (2008) 22:555563

EX567296

ERubLR_SQ07_4_E09

(CTAG)4

EX567281

ERubLR_SQ01_F09

EX567285 F CATGGAAAACCATGCATCATA R GCTTTGTCCAAAAGTGCTGT 296,305 9 296

(GCA)5 F GGCATACCCAAGACGTTCTC (CAAAA)2 R GTCTTTGGTGGTGCTTGAGG

RubPara_SQ007_O09 EX567295

(CATA)4 (CTAG)3

4e-90

ERubLR_SQ07_4_D05 R ACGAATTGATTTCATCAACC F GAGGAGAAGATTGTGAATCG R ACACACCTCCCAGACATAAC F CCACTTTATTTGATTTATTCCATCC 198,202 9 202 R ACGGACAAAAGTGGGTATGC F CCTCTACACCACCCCATCAG R CGTCATCGTCATCTCTCTCG F GTTCGTCATCGTCATCTCTC R AGAAAACCAAACCCCTCTAC F TGGCAATCAACCACTCTGTG R CAAACTGACAAACGCTCTTCC F CACTGCAAGGTGTCGTTTGT R ATAGCTCCGGCAATCCATC 217,233 9 238 234 9 234,236 190,198 9 198 205,215 9 215 240,248 9 242,248

(AGC)7

F CTTCTTTCCAACCGATTTC

233,244 9 233,236

Unknown No hits CDS 1e-126

3 3

EX567280

ERubLR_SQ07_1_E10

(GAA)6

EX567277

Rosa hybrid cv. petal EST (CF349335.1) 320/365 (87%) CDS CDS CDS Prunus armeniaca fruit EST (CB823353) 41/44 (93%)

ERubLR_SQ01_P18

EX567291

(TG)7 (TAGC)3

1e-07 Rosa chinensis petal EST 7e-41 (BI977827.1) 177/207 (85%) Unknown Rosa chinensis petal EST (BI977263) 395/498 (80%) 30 -UTR Vitis berry isoavone reductase-like protein (CAI56335) 45/49 (91%) 30 -UTR Rosa chinensis petal GASTlike cDNA (BI978016) 179/202 (88%) 1e-119 1e-19

3 4 4 4

ERubLR_SQ01_B06 EX567284

(AGCG)4

ERubLR_SQ19_3_G09

(GCTC)4

EX567283

ERubLR_SQ07_2_H02

(CTAG)4

EX567278

RubEndo_SQ004_N23

(TA)14

3e-54

EX567294

559

123

560

Table 2 continued Forward (F) and reverse (R) primer sequences (50 30 ) Allele sizes (bp) in Latham 9 Glen Moy Homology, accession number and identity E-value 204,215 9 207,210 3e-12 5 Putative location of SSR Linkage group

123
F GTTTGCTTCCTTTCGTAGTC R TATACTAATGGCCACCTTGG F GCAGGAGTTGGACGAGTAG R TTTCCAGATCAAACAAGACC F GTCACACAAGGCTACCAAG R ATTGAACTGGTCAACAATGC F TCTTTTGCGGTGGCTACAAG 217,221 9 221 202,203 9 202 CDS R CAACCCGAAGTCTACAACAGC F AGGTGAGGTGGGAGATGATG R ATCCTCGGTTCCTCCAAAAT F TTACGAACACCCATTAATTTAAGTC R AATCCTGAGACCGACGAGTG F CTCCGCAGACATTCCTTCTC R GCTTCAGGAAGCTCGATCAC F GCACCCTAATCTCCATGACC 198,200 9 200 182,187 9 187 R CCGCTGTAGTTCCTGTAGGC F CTATTGCAAGGATACCAAGC R GTTGCAACATGACAATTCC 30 -UTR 7 218,220 9 218 234,242 9 234,242 CDS 205,207 9 205,207 Unknown No hits Poncirus trifoliata root EST (CX640069) 81/95 (85%) 1e-10 194,198 9 194 30 -UTR Vitis pollen specic protein (ABC86745.1) 61/100 (100%) Unknown Unknown V. vinifera protein (CAO63589.1) 44/106 (41%) 2e-10 5 5 5 5 Unknown Fragaria 9 ananassa red fruit 5e-12 cDNA (CO380688) 56/60 (93%) Malus 9 domestica fruit EST 9e-34 (CV084067) 145/167 (86%) 4e-11 Unknown No hits 5 7 7 Unknown Fragaria vesca seedling EST (DY674776) 56/62 (88%) F GCTTCAGGAAGCTCGATCAC R TCACCTAAGCACCTAATTAAGGAAG F GATTCAAATCCAGTAGACCAGTACC 230,232 9 230 R CATTGAGACCCACCTCTTGG F CGTACTGGGTTTTCTTCCTTG R GCTACTCCAGCAGCAAGCAG F TCAGCTCCCAACCTATTTAC R CTCCTCGCCTCTATCGTTAC 162 9 159 217 9 267 30 -UTR 7 Malus 9 domestica fruit Mal d 2e-42 1-like gene (AAS00047) 82/ 114 (71%) Unknown Medicago truncatula DNA (CU424435) 31/37 (83%) CDS 1.6 Prunus persica fruit EST 1e-105 (DY650612) 308/345 (89%) 198,200 9 198 Malus 9 domestica fruit 6e-21 xyloglucan endotransglycosylase (AAN07898.1) 47/75 (62%) Unknown No hits 7 NM NM

Locus and Genbank accession number

Repeat motif

ERubLR_SQ19_1_A05

(GAA)11

EX567282

ERubLR_SQ06_2_E01

(AT)6

EX567276

ERubLR_SQ05_3_E02

(GGT)4

EX567273 ERubLR_SQ01_I20

(TA)9

EX567288

RubPara_SQ005_K23

(AG)6

EX567297

ERubLR_SQ01_M20

(ATA)5

EX567289

ERubLR_SQ02_B19

(GC)7

EX567293 ERubLR_SQ01_G16

(TC)8

EX567286

ERubLR_SQ05_3_H01

(TA)5

EX567274

ERubLR_SQ01_I08

(GC)7

EX567287

ERubLR_SQ01_N03

(AT)5

EX567290

ERubLR_SQ02_B23

(AG)5

EX567292

ERubLR_SQ05_4_E09

EX567275

(GGA)6 (GGC)5

Mol Breeding (2008) 22:555563

NM: not mapped, parents both homozygous

Mol Breeding (2008) 22:555563

LG 1
0.0 RUB137a
-23.6 0.0 5.0 8.4 14.0 18.6 19.9 24.8 42.0 44.8 48.9 49.6 54.1 57.4 62.2 62.4 65.1 68.9 72.5 73.5 75.8 76.1 78.3 78.7 81.3 81.5 83.4 84.3 86.1 87.5 89.0 90.3 91.5 94.4 98.7 101.4 102.7 103.0 104.3 105.2 106.7 110.4 110.8 113.3 118.6

561
LG 2
E41M39-97 E41M42-122 E40M55-98 Rubnebp2O23 P13M95-298R P12M58-182 P14M60-91 E41M61-187 P12M58-258 P12M58-282 P13M60-245R E40M61-159 P13M40-348 E40M50-244 P12M121-198 RUB56a P13M40-167 P14M61-207 FRUITC1 P12M121-194 P14M39-173 E40M61-106 Rub284a E40M61-163 RUB107a RUB59b E40M50-231 P14M39-167 RUBr76b P13M60-474R GeneH ERubLRSQ01F09 RUB194h P12M50-158 P13M60-197R P13M61-167 P13M39-279R RUB4a RubparaSQ007009 ERubLRSQ074E09 RUB6a RUB251a P13M60-385R RUB270a E41M60-157

LG 3
0 7 8 10 12 13 14 15 16 17 18 24 29 32 33 42 46 49 51 52 54 56 57 58 60 61 62 63 65 66 68 71 72 73 74 75 78 81 85 87 88 89 100 109 117 125 128 134 141 145 157 E41M60-184 P13M39-177R ERubLRSQ01P18 ERubLRSQ071E10 P14M61-121 RUB22a P13M40-335 FRUITE8 Developmental P13M39-195R Stages P14M39-97 RubnebH15 RUB20a P13M58-112 P13M55-98 LEAF86 P13M95-137R P12M121-186 RUB160a P12M31-155 Rub242a Rub17a ERubLRSQ074D05 Disease Resistance E40M55-175 E41M31-153 E41M31-147 P14M61-92 RUB19a E40M43-370 P12M61-131 RUB2a2 Rub2a1 E41M42-337 P12M61-199 P13M95-214R P14M61-124 E41M31-160 E41M60-175 E41M31-167 E40M43-128 RUB228a P13M60-223R E40M43-95 E41M40-136 E41M60-135 P14M39-301 E41M58-171 P14M60-131 P14M60-129 E41M39-138 RUB223a Rub120a Rub238h RUB259f Rub259b P13M40-203

LG 4
0.0 ERubLRSQ072H02
Quality

15.7 20.7 34.3 47.1 51.5 54.5 57.7 59.0 64.3 68.5 78.0 82.0 85.1 86.5 87.6 91.3 93.6 96.7 99.3 100.5 101.1 102.2 108.4 110.1 115.2 133.4

RUB124a RubparaSQ008D04 E40M60-106 E40M60-125 P13M40-131 P13M58-86 E40M43-116 Rubnebp4c8b P12M58-360 E40M43-268 RUB47a P12M95-95 P12M31-171 Rubnebp4c8a E41M60-315 RUB262b E41M39-125 RUB166b P13M60-117 RUB119a RUB256e P14M39-196 Rub232b RUB243a Rub244a ERubLRSQ073C07

Fruit Quality

25.6

RUB49a

Developmental Stage

65.5 97.0 100.8 103.2 103.8 110.1 125.9 130.6 133.2 136.1 137.4 141.1 145.7 146.6 149.9 150.0 150.7 153.2 156.2 156.5 160.1 161.3 165.3 167.3 171.4 177.9 183.7

E41M41-185 RUB167aR RubendoSQ004N23 ERubLRSQ01B06 ERubLRSQ193G09 FRUITG7 Rub212a P13M58-288 P12M58-330 Rub110a LEAF107 RubnebH24 E41M41-132 FRUITE4 P12M31-200 E40M43-300 P12M61-165 RUB153a P13M60-172R P13M55-259 P13M40-239 Rub236b P14M39-98 RUB126b Rub278b P14M61-97 RUB57a

Quality

LG 5
0 11 15 17 20 21 25 26 30 33 34 35 36 40 42 45 50 53 55 56 57 60 62 64 66 68 69 70 73 75 78 81 84 88 91 P13M60-321R RubparaSQ005K23 P13M60-199R E40M58-249 RUB25a P13M40-249 P13M95-193R P12M121-169 Disease RubnebAo9b ERubLRSQ191A05 Resistance E40M43-112 ERubLRSQ053E02 P13M95-287R Fruit Size P13M95-294R RUB45c Rub222e RUB117b P13M58-242 Rub5a ERubLRSQ01M20 Quality E40M50-251 P13M95-195 P14M61-223 RUB275a E40M58-119 P13M40-115 P13M40-114 P14M60-110 P12M61-137 P12M31-103 P13M95-191R RUB268b P13M55-280 RUB35a P12M61-330 RUB98d RUB289a ERubLRSQ062E01 Quality E41M41-129 0.0 6.5 8.4 9.8 10.7 12.1 12.7 13.6 14.2 14.8 15.5 15.8 16.7 18.2 20.9 22.9 26.4 31.7 34.9 44.2 54.7 68.6 78.4 80.6 83.1 85.6 87.4 88.7 93.6 97.0 106.0 117.7

LG 6
P13M40-85 LEAF97 LEAF102 P13M39-109R P14M61-164 P14M61-156 RUB118b E40M43-82 E41M31-156 P12M55-177 E41M40-315 P14M39-383 E40M43-205 P13M60-158R P13M58-230 P13M61-258 P14M61-238 E41M39-155 P13M58-265 P13M40-129 E41M42-248 Rubnebp419 P14M61-217 E40M61-277 P13M95-117R P14M39-418 RUB43a RUB1b RUB123a E40M50-167 P13M40-187 P14M39-232 0.0 7.1 14.4

LG 7
P12M61-235 ERubLRSQ053H01 Rub265a

25.6

P12M121-435

35.9 43.1

P13M40-118 ERubLRSQ01N03

62.8 69.8 71.0 73.5 82.6

RUB26a ERubLRSQ01I20 ERubLRSQ01G16 E41M40-235 ERubLRSQ01108 Quality

Fig. 1 Latham 9 Glen Moy linkage map with position of EST-SSRs and the QTL associated with them

two of these ve loci the SSR was located in the 30 untranslated region yet six other EST-SSR loci also contained repeat motifs in this region (Table 2) and cross-amplication was between 80 and 100% successful across the species tested (Table 3). The level of transferability of these markers may prove useful for future genetic diversity and population genetics studies in raspberry and related species, as well as in future raspberry breeding programmes. The enrichment of genetic maps with EST-SSR loci that are associated with potentially functional

genes may help to associate candidate genes with mapped traits and allow greater comparisons between genetic maps. As the Rubus QTL become more closely associated with functional sequences on maps it will be possible to utilise these and other candidate gene markers being developed to identify corresponding BACs and link the genetic and physical maps for Rubus. Additionally, the use of transferable EST-SSR loci may help identify alleles in novel germplasm for traits of interest for incorporation into breeding programmes.

123

562

Table 3 Transferability of the 25 EST-SSR loci in 10 Rubus species R. fructicosus R. geoides R. grabowski R. idaeus R. lacustre R. macraei R. mesogaeus R. coreanus R. strigosus

123
236/242/248 240/242 162/166 213/216/222 305 229/236 198 188/196 201/205/215 233/237 203/213 202/204/210 211/214 221 221/226 242 196 162/166/168/ 170 160 166/168 198 196 191/198 218 187 198 230 267 170 204/212/219 200 234 234 234/242 200 221/226 202 217/221 221 221 217 212 234 198/204 196 162/166 205/207 211/214 214 194 214 207/210 202/204 207/210 204 251/257 245 238 238 204 214 217/219 202 234 160 230/237 234/237 234/236 228/237 203/215 205/213 215 205/215 215 188/198 188/194/198 198 188/198 188/198 202 202 202 198 202 198 196/198 203/215 227/234 238 210/215 211/214 221 212 198/206 204 166/168 233/236 246/248 236 250 233/236 242/248 236/240 246/252 233/244 248/250 233/242 230/238 305 305 296 300 305 305 227 238 213 214 208/214 222/225 208 200/208 210 208 159 162/166 159 162/166 159 166/168 162 242/249 242 242 237 237 237 237 242 234/242 242 242 234/242 228 242,248 242/249 162 208/214 296/305 233/244 240/248 198/202 190/198 205/215 234 217/233 204/215 194/198 205/207 217/221 202/203 234/242 218/220 198/200 182/187 198/200 230/232 217 170/180

Locus

Eubatus 9 Ideobatus hybrid

ERubLR_SQ07_3_C07

236/242

RubPara_SQ008_D04

237/242/249

ERubLR_SQ05_4_E09

159/162

ERubLR_SQ01_F09

210

RubPara_SQ007_O09

305

ERubLR_SQ07_4_D05 ERubLR_SQ07_1_E10

233/236 250

ERubLR_SQ01_P18

198

ERubLR_SQ01_B06

188/194/198

ERubLR_SQ19_3_G09

211/215/219

ERubLR_SQ07_2_H02

230/237

RubEndo_SQ004_N23

245

ERubLR_SQ19_1_A05

198/210

ERubLR_SQ06_2_E01

214

ERubLR_SQ05_3_E02

ERubLR_SQ01_I20

217/219

RubPara_SQ005_K23

221

ERubLR_SQ01_M20

234

ERubLR_SQ02_B19

ERubLR_SQ01_G16

198

ERubLR_SQ05_3_H01

ERubLR_SQ01_I08 ERubLR_SQ01_N03

196

ERubLR_SQ02__B23

ERubLR_SQ07_4_E09

160/162

Mol Breeding (2008) 22:555563

Allele size; , no amplication

Mol Breeding (2008) 22:555563 Acknowledgements This work was funded by RERAD, DEFRA and HDC through Horticulture Link. We thank C. Booth and M. Macauley for sequencing and genotyping assistance.

563 sequence repeat (SSR) markers and their utility with strawberry, blackberry and red and black raspberry. J Am Soc Hortic Sci 130:102115 Mazzitelli L, Hancock RD, Haupt S et al (2007) Co-ordinated gene expression during phases of dormancy release in raspberry (Rubus idaeus L.) buds. J Exp Bot 58:1035 1045. doi:10.1093/jxb/erl266 Moyer RA, Hummer KE, Finn CE et al (2002) Anthocyanins, phenolics, and antioxidant capacity in diverse small fruits: Vaccinium, Rubus, and Ribes. J Agric Food Chem 50:519525. doi:10.1021/jf011062r Pattison JA, Samuelian SK, Weber CA (2007) Inheritance of Phytophthora root rot resistance in red raspberry determined by generation means and molecular linkage analysis. Theor Appl Genet 115:225236. doi:10.1007/s00122007-0558-5 Rozen S, Skaletsky HJ (1998) Primer 3. Code available at http:/www.genome.wi.mit.edu/genome_software/other/ primer 3.html/ Rusu AR, Paml D, Graham J (2006) Mapping resistance of red raspberry (Rubus idaeus subsp. idaeus) to virus diseasesleaf spot (RSLV) and vein chlorosis (RVCV) on the genetic linkage map. Ser Zootehnie Biotehnologii 62:318321 Sargent DJ, Fernandez-Fernandez F, Rys A et al (2007) Mapping of A1 conferring resistance to the aphid Amphorophora idaei and dw (dwarng habit) in red raspberry (Rubus ideaus) using AFLP and microsatellite markers. BMC Plant Biol 7:15. doi:10.1186/1471-2229-7-15 Stafne ET, Clark JR, Weber CA et al (2005) Simple sequence repeat markers for genetic mapping of raspberry and blackberry. J Am Soc Hortic Sci 130:722728 Stam P, Van Ooijen JW (1995) JoinmapTM version 2.0: software for the calculation of genetic linkage maps. CPRODLO Wageningen Stewart D, McDougall GJ, Sungurtas J et al (2007) Metabolomic approach to identifying bioactive compounds in berries: Advances toward fruit nutritional enhancement. Mol Nutr Food Res 51:645651. doi:10.1002/mnfr. 200700056 Woodhead M, Russell J, Squirrell J et al (2003) Development of EST-SSRs from the alpine lady-fern, Athyrium distentifolium. Mol Ecol Notes 3:287290. doi:10.1046/ j.1471-8286.2003.00427.x

References
Ahmad N (2004) Identication and mapping of phenotypic traits for fruit quality in red raspberry. MSc Thesis. University of Strathclyde Altschul SF, Gish W, Miller W et al (1990) Basic local alignment search tool. Mol Biol 215:403410 Bassil NV, Gunn M, Folta K, Lewers K (2006) Microsatellite markers for Fragaria from Strawberry Festival ESTs. Mol Ecol Notes 6:473476. doi:10.1111/j.1471-8286.2006. 01278.x Deighton N, Brennan R, Finn C, Davies HV (2000) Antioxidant properties of domesticated and wild Rubus species. J Sci Food Agric 80:13071313. doi:10.1002/1097-0010 (200007)80:9\1307::AID-JSFA638[3.0.CO;2-P Graham J, Jennings SN (2008) Raspberry breeding. In: Jain SM, Priyadarshan M (eds) Breeding tree crops. IBH & Science Publication Inc, Oxford Graham J, Smith K, MacKenzie K et al (2004) The construction of a genetic linkage map of red raspberry (Rubus idaeus subsp. idaeus) based on AFLPs, genomic-SSR and EST-SSR markers. Theor Appl Genet 109:740749. doi: 10.1007/s00122-004-1687-8 Graham J, Smith K, Tierney I et al (2006) Mapping gene H controlling cane pubescence in raspberry and its association with resistance to cane botrytis and spur blight, rust and cane spot. Theor Appl Genet 112:818831. doi: 10.1007/s00122-005-0184-z Jung S, Abbott A, Jesudurai C et al (2005) Frequency, type distribution and annotation of simple sequence repeats in Rosaceae ESTs. Funct Integr Genomics 5:136143. doi: 10.1007/s10142-005-0139-0 Keniry A, Hopkins CJ, Jewell E et al (2006) Identication and characterisation of simple sequence repeat (SSR) markers from Fragaria 9 ananassa expressed sequences. Mol Ecol Notes 6:319322. doi:10.1111/j.1471-8286.2005.01215.x Lewers KS, Styan SMN, Hokanson SC, Bassil NV (2005) Strawberry GenBank-derived and genomic simple

123