Biochimica et Biophysica Acta 1828 (2013) 23702378

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbamem

Surfactin production enhances the level of cardiolipin in the cytoplasmic membrane of Bacillus subtilis
Gabriela Seydlov a,, Radovan Fier a, Radomr abala b, Petr Kozlk b, Jaroslava Svobodov a,, Miroslav Ptek c
a b c

Department of Genetics and Microbiology, Faculty of Science, Charles University in Prague, Vinin 5, 128 44 Prague 2, Czech Republic Department of Analytical Chemistry, Faculty of Science, Charles University in Prague, Hlavova 8, 128 40 Prague 2, Czech Republic Institute of Microbiology v.v.i., Academy of Sciences of the Czech Republic, Vdesk 1083, 142 20 Prague 4, Czech Republic

a r t i c l e

i n f o

a b s t r a c t
Surfactin is a cyclic lipopeptide antibiotic that disturbs the integrity of the cytoplasmic membrane. In this study, the role of membrane lipids in the adaptation and possible surfactin tolerance of the surfactin producer Bacillus subtilis ATCC 21332 was investigated. During a 1-day cultivation, the phospholipids of the cell membrane were analyzed at the selected time points, which covered both the early and late stationary phases of growth, when surfactin concentration in the medium gradually rose from 2 to 84 moll 1. During this time period, the phospholipid composition of the surfactin producer's membrane (Sf+) was compared to that of its non-producing mutant (Sf). Substantial modications of the polar head group region in response to the presence of surfactin were found, while the fatty acid content remained unaffected. Simultaneously with surfactin production, a progressive accumulation up to 22% of the stress phospholipid cardiolipin was determined in the Sf+ membrane, whereas the proportion of phosphatidylethanolamine remained constant. At 24 h, cardiolipin was found to be the second major phospholipid of the membrane. In parallel, the Laurdan generalized polarization reported an increasing rigidity of the lipid bilayer. We concluded that an enhanced level of cardiolipin is responsible for the membrane rigidication that hinders the uidizing effect of surfactin. At the same time cardiolipin, due to its negative charge, may also prevent the surfactin-membrane interaction or surfactin pore formation activity. 2013 Elsevier B.V. All rights reserved.

Article history: Received 1 March 2013 Received in revised form 21 June 2013 Accepted 28 June 2013 Available online 8 July 2013 Keywords: Surfactin Bacillus subtilis Membrane Phospholipid Cardiolipin

1. Introduction Surfactin is a lipopeptide antibiotic produced by Bacillus subtilis. It is formed of a cyclic heptapeptide interlinked with a -hydroxy fatty acid comprising 1216 carbon atoms. Surfactin interacts with the membrane and disturbs its integrity [1]. This effect can explain a wide range of surfactin biological activities such as antibacterial [24], antiviral [5], antifungal [6], antimycoplasma [7], antiparasitic [8] and anti-tumor [9]. Surfactin as a powerful biosurfactant stimulates biolm formation by its producer strains [10,11]; however, inhibits the biolm formation of pathogenic bacteria [12,13]. The high demand for new chemotherapeutics driven by the increasing drug resistance of pathogens has drawn attention to antibiotic lipopeptides that represent potential new antimicrobial agents. A number of systematic in vitro studies were therefore devoted to uncovering the molecular mechanism of surfactin-induced membrane

Corresponding authors at: Department of Genetics and Microbiology, Faculty of Science, Charles University in Prague, Vinin 5, 128 44 Prague 2, Czech Republic. Tel.: +420 221 951 738; fax: +420 221 951 724. E-mail addresses: seydlova@natur.cuni.cz (G. Seydlov), jarsvob@natur.cuni.cz (J. Svobodov). 0005-2736/$ see front matter 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bbamem.2013.06.032

destabilization [1418]. It was found that surfactin interacts with the lipid membrane in three different ways: (i) it acts as a mobile cation carrier [19,20], (ii) forms cationic channels [21,22], and (iii) destroys the membrane via a detergent effect [16]. Membrane leakage was observed at a surfactin concentration of 2 moll 1 [23], i.e. far below its critical micelle concentration (CMC), which ranges from 9 to 50 moll 1, depending on the experimental conditions [2426]. Channel formation, membrane lysis or solubilization of the membrane to micelles has been observed above the CMC of surfactin [21,22,27,28]. Although the molecular mechanism of these complex lipopeptide-membrane interactions has been intensively studied, it is not yet fully understood [22,28]. Several studies on model membranes demonstrate the impact of the lipid composition on surfactin-membrane interaction and its penetration into the bilayer. Both the polar heads and fatty acid chains play a role in the formation of complexes of surfactin with phospholipids [29,30]. Fatty acids with shorter chains, which have a similar length to the surfactin hydrocarbon chains, interact better with surfactin than fatty acids with longer chains like stearic acid [31]. The polar head group composition profoundly affects the behavior of surfactin at the phospholipidwater interface and its miscibility with phospholipids. Both the electrostatic properties [30] and the volume of the phospholipid head groups modulate these

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

2371

surfactinphospholipid interactions [29,32]. Phosphatidylethanolamine (PE) promotes surfactin stabilization in the model bilayer; presumably the inverted cone molecular shape of surfactin complements cone-shaped PE [27,31]. With dipalmitoylphosphatidylserine (DPPS), surfactin decreases the electrostatic repulsions between the negatively-charged head groups of DPPS, which results in DPPSsurfactin stability in a monolayer [29]. Similarly, the presence of cations that neutralize membrane surface negative charges facilitates the penetration of surfactin into the lipid bilayer [33]. All antibiotic-producing bacteria ensure their self-resistance by coding for various means of self-defense mechanisms. At the same time, the systematic use of antibiotics selects resistant variants of the susceptible target pathogens. As for the resistance mechanism, the antibiotic-producing strains are the most convenient source of information [34]. Surprisingly, almost no research has been focused on the nature of the surfactin resistance of the surfactin producer. It is most likely the cytoplasmic membrane which is targeted by surfactin both from the cytoplasmic and extracellular side that is the site of self-resistance against surfactin. In Bacilli, resistance to antimicrobial compounds is mediated by the genes controlled by the extracytoplasmic function sigma factor w [35]. Nevertheless, none of these resistance genes were proven to be engaged in surfactin resistance. The only gene plausibly involved in surfactin resistance is swrC [36,37]. It codes for the proton-dependent multidrug efux pump belonging to the RND family and contributes to the secretion of surfactin. However, surfactin production was observed even in a swrC-decient strains that persistently survived at concentrations higher than 10 mmoll 1 [37]. This nding suggests the existence of other additional mechanisms that participate in the surfactin self-resistance of the producer. In this study, we investigated the modications of the membrane lipid moiety induced by surfactin during its production in order to estimate the role of phospholipids in the membrane adaptation resulting in surfactin tolerance. These changes were further correlated with uidity of the cytoplasmic membrane estimated by means of Laurdan generalized polarization. 2. Materials and methods 2.1. Bacterial strains and growth conditions Bacterial strains used in this study were B. subtilis ATCC 21332 (sfp+) (wild type, American Type Culture Collection) and B. subtilis strain 0164 (sfp0) constructed in this work (see Section 2.3). B. subtilis strains were grown aerobically (120 rpm) in nutrient broth (1 g Lab-Lemco powder, 2 g Bacto yeast extract, 5 g Bactopepton, 5 g NaCl per liter) at 30 C. Culture growth was monitored turbidimetrically at 420 nm. The culture was inoculated with the overnight inoculum, diluted in the morning with fresh medium and grown to the exponential phase (OD420 of 0.5 to 0.6). Finally, the cells were used to inoculate the particular cultivation. After 3 h, bacterial cultures were harvested by rapid ltration through a Synpor no. 5 lter (Pragochema, Czech Republic). In the stationary phase of growth, the cells were harvested by centrifugation (4300 g, 15 min, 4 C). The number of viable vegetative cells (CFU) was counted by plating diluted cultures on nutrient agar. In parallel, thermoresistant spores were counted after heat inactivation of the culture (70 C, 15 min) and estimated as CFU. 2.2. Transformation of B. subtilis A total of 10 ml of pre-transformation medium (0.2% (NH4)2SO4, 1.4% K2HPO4, 0.6% KH2PO4, 0.1% sodium citrate, 0.02% MgSO4, 0.5% glucose, 5% tryptophane, 0.02% casamino acids, 75 mmoll 1 CaCl2 and 2 mmoll 1 MnSO4) was inoculated with a single colony and grown at 37 C until the culture reached the stationary phase of growth. The culture was diluted 10-fold in fresh transformation

medium (0.2% (NH4)2SO4, 1.4% K2HPO4, 0.6% KH2PO4, 0.1% sodium citrate, 0.02% MgSO4, 0.3% glucose, 0.0005% casamino acids). 0.2 g of plasmid DNA and 1 ml of warm transformation medium were added to 100 l of the diluted culture, and the tubes were incubated with shaking at 37 C for 1 h. The tubes were centrifuged for 3 min at 13,000 g, the pellet was resuspended in 300 l of LB medium and the cells were plated on LB agar with chloramphenicol (5 gml 1). 2.3. Construction of the sfp0 (Sf) strain Surfactin is produced by nonribosomal synthesis by the surfactin synthetase complex coded by the srfA operon [38] and sfp gene. The srfA operon is also found in the chromosome of non-producing strains such as B. subtilis 168. However, the sfp gene, which is essential for surfactin synthesis, carries a frameshift mutation in B. subtilis 168 yielding a non-functional protein [39]. An isogenic strain defective surfactin synthesis (sfp0 mutant) based on the parental strain B. subtilis ATCC 21332 was constructed as follows. An internal fragment covering 784 bp of the sfp gene carrying the frameshift mutation was amplied by PCR using B. subtilis 168 genomic DNA as a template and the primers sfpF1 (TAGAATTCTTGTGGAAGTATGATAGGAT) and sfpR1 (GAGAATTCAAGATATT GAGCGAGGTG). The amplied fragment was cloned in the EcoRI site of the vector pK19cat [40]. The resulting plasmid pK19cat-sfp0 was used to transform the B. subtilis ATCC 21332 strain. The clones with an abolished ability to produce surfactin were identied by examination on blood agar according to the absence of erythrocyte lysis. The presence of the frameshift mutation within the sfp gene in the chromosome of these clones was veried by sequencing. The parental B. subtilis ATCC 21332 strain and its surfactin non-producing derivative are here designated the Sf+ and Sf strain, respectively. 2.4. Surfactin analysis Samples of the culture were mixed with methanol (1:1, v/v) and centrifuged at 10 000 g for 10 min to remove the cell biomass. Surfactin concentration was determined in the cell-free supernatants by reverse-phase C18 HPLC using a HPLC Agilent 1200Agilent 6460 Triple Quadrupole MS system equipped with a Zorbax Eclipse XDB-C18 column (5 m, Agilent Technologies). The mobile phase consisted of (a) 0.1% formic acid in acetonitrile and (b) aqueous 0.1% formic acid at a ratio of a/b 20%:80% (v/v) and the mobile phase ow rate used for the analysis was 1 ml/min. Sample size was 50 l. Five surfactin isoforms (C12C16 surfactin and sodium adduct ions) were detected at m/z 994.6 and 1016.6, m/z 1008.6 and 1030.6, m/z 1022.6 and 1044.6, m/z 1036.6 and 1058.6, m/z 1050.6 and 1072.6, respectively. Commercial surfactin (Sigma) served as a standard. The data were analyzed by Agilent MassHunter Workstation Data Acquisition and Agilent MassHunter Data Analyses. 2.5. Membrane isolation Cytoplasmic membranes were isolated using enzyme digestion, which enables the membrane fraction to be puried from spore contamination [41]. The cells were incubated with lysozyme at the cultivation temperature of the initial culture (30 C) for 30 min with exponential cells or for 60 min with stationary cells. The cell lysate was centrifuged for 10 min at 3000 g and 4 C to remove the crude cell debris and spores, which remained unaffected by lysozyme. The cell-free supernatant was then centrifuged (25 000 g, 25 min, 4 C) to separate the membrane vesicles from the cytoplasmic fraction. The membrane sediment was used directly for lipid extraction or resuspended in phosphate buffer (100 mmoll 1, pH 6.6) and stored at 80 C. Pierce BCA Protein Assay (Pierce Biotechnology) was used for protein determination.

2372

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

2.6. Phospholipid extraction and analysis Membrane phospholipids (PLs) were extracted from B. subtilis membrane preparations with hexane-isopropanol (3:2, v/v) mixture [42]. After evaporation of the solvent in vaccuo at 40 C, the PLs were dissolved in chloroform, ltered through glass ber lters (Whatman) and concentrated under a stream of nitrogen. The lipid samples were stored at 80 C and used for polar head group or fatty acid analysis. Six PL classes phosphatidylglycerol (PG), phosphatidylethanolamine (PE), phosphatidylserine (PS), cardiolipin (CL), lysylphosphatidylglycerol (lysylPG), and phosphatidic acid (PA) were separated by thin-layer chromatography (TLC, silica gel 60 G plates; Merck) in chloroform-methanolwater (65:25:4, v/v/v) as the mobile phase, collected from the plates and then quantied spectrophotometrically, as described by Rouser et al. [43]. The average S.D. of results from three independent experiments is presented. 2.7. Fatty acid analysis Membrane lipids were transesteried to fatty acid methyl esters by incubation in sodium methoxide at room temperature [44]. After neutralization by the addition of methanolic HCl, the fatty acid methyl esters (FAMEs) were extracted three times with 200 l of pentane and dried under the ow of nitrogen. Methyl esters were dissolved in 100 l of heptane and analyzed by gas chromatographymass spectrometry (GCMS) (Shimadzu GC17A QP5050A gas chromatographmass spectrometer) in a DB-35 column (Agilent Technologies; 32 m by 0.25 mm, lm thickness 1 m). Electron impact spectra were obtained at 70 eV of electron energy. The following operating conditions were used: injection temperature of 250 C and initial oven temperature of 50 C, rising at 7.5 C/min to 250 C, and isothermally for 20 min at 250 C. The FAMEs were identied with the aid of FAMEs standards (Sigma) and the identity was conrmed using the NIST Mass Spectral Library (2006). The average S.D. of results from three independent experiments is presented below. The percentage of each FA was calculated by the ratio of peak area/sum of total identied peak areas. 2.8. Laurdan generalized polarization Laurdan generalized polarization ( GP) measurements were carried out using a confocal microscope (Leica TCS SP2). 2Dimethylamino-6-lauroylnaphthalene (Laurdan, Molecular Probes) was added to the membrane samples (protein concentration of 75 gml 1) in a phosphate buffer (100 mmoll 1, pH 7) from a DMSO solution to give a nal probe concentration of 10 6 moll 1. After incubation in the dark at 41 C for 45 min, the pelleted membranes were placed on a coverslip and GP was measured under the confocal microscope at 25 C using 405-nm diode laser for excitation. Emission intensities of blue uorescence (415460 nm) and green uorescence (460540 nm) were acquired simultaneously into two separated channels using HCX PL APO CS 63.0 1.40 oil objective, 512 512 pixel format with 400 Hz scan speed, 4 line averaging and 12-bit picture depth. High voltage of both photomultiplier tubes was kept constant at 600 V. The intensity of recorded uorescence was modied only by laser power. Approximately 50 uorescence photographs were collected for each sample and processed using ImageJ software (http://rsbweb.nih.gov/ij/, http://www.uhnresearch.ca/facilities/wcif/) as follows: separated, green and blue channels were corrected by subtraction of background intensities (about 10%) deduced from autouorescence of unlabeled samples. GP was calculated on a pixel by pixel basis from the blue and green channel intensities GP = (Iblue Igreen) / (Iblue + Igreen). The image areas containing membranes were selected by intensity thresholding

and mean values of GP were calculated for each image. The graph shows average GP value for all analyzed images S.D. 2.9. Statistics Student's t test was used to establish differences between two mean values of PL and FA levels, GP and growth parameters. P values of b 0.05 were considered signicant. 3. Results 3.1. Growth of Sf+ and Sf B. subtilis strains and surfactin production In antibiotic-producing cells, the self-resistance mechanisms are activated simultaneously with the biosynthesis of antibiotics. The expression of the defense systems subsequently increases as the production progresses. In order to characterize the adaptation mechanisms during surfactin production, the growth characteristics of the wild-type surfactin producer (B. subtilis ATCC 21332, Sf+) and its non-producing mutant (B. subtilis 0164, Sf) were examined during a 1-day cultivation in parallel with the determination of surfactin concentration in the growth medium. As shown in Fig. 1, the doubling times of the surfactin producer and its non-producing mutant were both T = 37 2 min. Both cultures entered the stationary phase of growth (t0) after 4 h of cultivation at log2 (OD420 1000) = 10.1 0.1. These data indicated that the sfp0 mutation resulting in the Sf phenotype did not affect the growth of the non-producing strain in the exponential phase. However within the stationary phase of growth, while surfactin was accumulating in the cultivation medium, wild-type B. subtilis ATCC 21332 exhibited a slightly but reproducibly higher viability than the Sf strain. After 24 h of cultivation (t20), the cell biomass of the Sf+ and Sf strains reached log2 (OD420 1000) 12.5 0.1 and 12.2 0.2 (P b 0.009), respectively. The slight difference in the growth capacity of the two strains also resulted in different total vegetative cell counts, which at t20 reached 4.3 0.2 108 ml 1 (Sf+) and 3.7 0.1 108 ml 1 (Sf) (P b 0.006), respectively. The proportion of thermoresistant spores was almost the same value in both cultures, 27% (Sf+) and 26% (Sf), respectively. Based on the course of the growth curves of the two strains, the time points for sampling and determining the surfactin concentration in the cultivation medium were chosen. As documented in Table 1, the presence of surfactin at a concentration of 2.2 mgl 1 was rst detected after 4.5 h of cultivation (t0.5), i.e. as early as 30 min after entry into the stationary phase, and it gradually accumulated up to 87 mgl 1 after 24 h (t20). Four surfactin isoforms with a fatty acid chain length of 13 to 16 carbon atoms were identied. The C15-surfactin isoform was found to be the predominant constituent, whereas there were only traces of the C16 isoform. The relative proportions of the surfactin isoforms remained stable over the whole cultivation period. No surfactin was detected in the culture broth of the Sf strain. The capacity of the cells to produce surfactin during the increasing nutritional stress of the stationary phase is illustrated by the amount of surfactin produced per vegetative cell (Table 1). Surfactin production steadily rose throughout the early stationary phase of growth (t0t3). During this period, the amount of surfactin rose from 0.02 to 0.17 pg per cell and reached 0.21 pg per cell at t20. The data presented above allowed us to select a time-scale for the subsequent membrane analyses of cells adapted to their own toxic product which covered the whole range of cultivation stages and surfactin concentrations. These were as follows: t 1, when the culture grew exponentially and surfactin was not yet synthetized. At about t0.5 the surfactin synthesis was initiated and progressed further (t1.5). We supposed that during this period, the defense mechanism

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

2373

3.2. Membrane phospholipid proles The polar head groups of membrane phospholipids can profoundly modify the surfactinmembrane interaction. To estimate the role of the membrane surface in cell protection against surfactin, the changes in PL composition were monitored in the producing cells throughout the 24-h cultivation. A parallel analysis of the Sf mutant provided data on the PL modications that were induced during the stationary phase of growth merely by increasing nutritional and energy depletion, without the effect of surfactin. A detailed analysis of the PL proles of the Sf+ strain showed that the adaptive response of the cells to surfactin accumulation in the culture medium developed gradually. In the exponential phase of growth (t 1) in the absence of surfactin, the composition of membrane PLs (Table 2) of the two B. subtilis strains was nearly identical. Phosphatidylglycerol, a principal lipid component of the membrane, amounted to approximately 40% of the total. This barrel-shaped phospholipid that stabilizes the lamellar phase of membrane bilayer predominated until t20, when the heavy stress of the late stationary growth was combined with the rising concentration of surfactin in the producer strain. At this point, a drop in the PG content from 38 to 16% was observed in the Sf+ strain, while the PG level was reduced to a lesser extent (28%) in the Sf strain. This 12% difference suggested the involvement of PG in the adaptive response of the surfactin producer, as its decrease correlated with the enhanced level of CL, which is synthesized from two PG molecules. Remarkably, in the Sf+ strain the CL content gradually increased throughout the stationary phase of growth and peaked at t20 when the surfactin stress culminated. The proportion of CL in the membrane increased from 13 to 22% (P b 0.01) at t20. Cardiolipin was the second most abundant PL in the membrane of the Sf+ strain in the nal stage of CL cultivation. In contrast, in the Sf strain the proportion of CL was maintained at a constant level until t20, when it fell to as little as 8%. This opposite tendency indicated that the increase in CL content, similarly to the decrease of PG, was a specic response of the cell to surfactin. During surfactin production the proportion of phosphatidylethanolamine, another major representative of B. subtilis membrane PL, was maintained at a constant level of 22% until t3 in the Sf+ strain and at t20 the PE content decreased to 11%. In contrast, in the Sf strain the amount of PE rose to 30% at t3 and then fell to 16% at t20. Thus, the PE content in the membrane of the Sf+ strain was held under control during surfactin production. The level of the other aminophospholipid, phosphatidylserine, remained stable throughout the whole cultivation, including t20. At t20, the polar head group composition of the membrane samples changed sharply, probably as a consequence of the continuing presence of the antimicrobial concentration of surfactin combined with the deep nutritional exhaustion of the late stationary phase. Accordingly, the biosynthesis of PL was strictly reduced and the content of PA, i.e. the common precursor of PL, dramatically rose from trace levels to 36 and 32% (P b 0.009) in the Sf+ and Sf strain, respectively. In fact, the fall in the proportions of PG + PE in the membranes of the two strains

Fig. 1. Growth of B. subtilis ATCC 21332 (A) and 0164 (B) strains during 1-day cultivation. Cultures were grown in nutrient broth at 30 C with shaking. Total bacterial counts were assessed by plating on agar medium and expressed as colony forming units (CFU). The proportion of thermoresistant spores in the samples was determined by colony counts after exposure to a temperature of 70 C for 15 min. The time point of entry into the stationary phase of growth is designated as t0. The data represent the means and standard deviations from ve (growth) or three (CFU) independent experiments.

against the deleterious effect of surfactin was also being induced. Finally, at t3 and t20, the surfactin concentration was high enough to be harmful to the producing cells and the resistance response should therefore have been fully expressed. Since only growing vegetative cells produce surfactin, the spores present in the culture were separated prior to each analysis in order to exclude biochemical contamination of the membranes (see Section 2.5).

Table 1 Concentration of surfactin in culture broth of B. subtilis ATCC 21332 during 1-day cultivation. Time point in stationary phase Surfactin isoforms (mgl 1)a C13 t 1 t0.5 t1.5 t3 t20 0.0 0.2 0.8 3.7 8.9 0.0 0.0 0.1 0.2 C14 0.0 0.5 0.9 4.3 8.1 0.0 0.0 0.2 0.2 C15 0.0 1.4 0.0 10.6 0.1 34.5 0.9 69.1 0.2 C16 0.0 0.1 0.2 0.6 1.1 0.0 0.0 0.0 0.0 0.0 2.2 0.0 12.5 0.1 43.1 1.1 87.2 0.2 0.0 0.02 0.08 0.17 0.21 0.00 0.00 0.01 0.01 Total Surfactin (pg) per vegetative cellb

Surfactin concentration in the cultivation medium was measured by LC/MS as described in Section 2.4. The data represent the means S.D. from three independent measurements performed in duplicate. a Surfactin isoform with fatty acid chain length of 13, 14, 15 and 16 carbon atoms, respectively. b Surfactin production in time expressed as the amount of surfactin (in pg) produced per B. subtilis ATCC 21332 vegetative cell (CFU) during the stationary growth phase.

2374

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

Table 2 Phospholipid composition of B. subtilis cytoplasmic membrane. Time (h) % of total phospholipid content (mean S.D.) t 1 Strain LysylPG PS PG PE CL PA ATCC 21332 3.3 10.8 42.6 25.7 13.4 4.2 0.3 1.0 0.6 1.5 0.7 0.5 0164 2.8 11.1 43.5 25.1 13.8 3.8 0.6 1.1 0.4 1.1 1.2 0.8 t0.5 ATCC 21332 7.6 13.2 37.2 22.1 12.8 7.2 1.1 0.0 0.7 1.8 0.7 1.2 0164 5.6 13.3 38.7 21.4 13.3 7.8 1.3 1.3 1.4 0.7 0.0 1.1 t1.5 ATCC 21332 5.3 11.5 39.5 21.7 17.9 4.2 1.0 1.0 0.6 1.1 1.3 0.8 0164 4.5 11.8 43.3 26.5 13.6 3.2 0.5 1.1 1.7 1.2 1.0 0.7 t3 ATCC 21332 3.4 14.0 37.9 22.2 19.7 3.0 0.6 0.8 1.4 1.1 0.7 0.1 0164 5.5 11.6 36.0 29.9 14.1 2.9 0.4 0.8 0.6 1.6 0.7 0.2 t20 ATCC 21332 2.8 13.9 16.1 11.0 21.9 35.6 0.6 0.3 1.3 1.2 0.5 0.5 0164 1.5 13.5 28.3 16.4 8.4 31.9 0.1 0.7 1.6 0.8 1.1 1.3

Values represent means S.D. from three determinations. LysylPGlysylphosphatidylglycerol, PSphosphatidylserin, PGphosphatidylglycerol, PEphosphatidylethanolamine, CLcardiolipin, PAphoshatidic acid.

accompanied by the drop in CL in the Sf strain was quantitatively replaced with PA. Nevertheless, despite the energy depletion and ongoing surfactin production, the pathway leading to CL was still active in the surfactin-producing cells and CL was the second most abundant membrane PL at the end of the cultivation. This fact indicates its importance in the membrane bilayer of the Sf+ strain.

3.3. Membrane fatty acid composition Phospholipid analyses revealed specic modications in the polar head groups of membrane phospholipids in the surfactin producer, suggesting the impact of the membrane surface composition on the cell protection against surfactin. Similarly to PL head groups, the fatty acids of the membrane, particularly the aliphatic chain length of phospholipids, can also strongly inuence the surfactinmembrane interactions. Therefore, the FA proles in the different stages of surfactin production in the Sf+ strain were compared with its non-producing counterpart at the same cultivation time points (Table 3). At t 1, similarly to the polar head group of PL, the FA composition of both strains was the same with almost 90% proportion of the branched-chain FAs. Of these, anteiso- and iso-branching FA accounted for 60% and 30%, respectively. This distribution of FA in the cytoplasmic membrane was almost unchanged in both strains until t3. The late stationary phase (t20) was accompanied by alterations in four major FAs in the membrane. These were branched-chain FAs with aliphatic chain lengths of 15 and 17 carbon atoms. The proportion of high-melting rigidizing iso-series increased with a corresponding decrease in low melting anteiso-branched-chain FAs (Fig. 2). At t20, the
Table 3 Fatty acid composition of B. subtilis cytoplasmic membrane. FA Tm (C) % of total t 1 ATCC 21332 i-14:0 14:0 i-15:0 a-15:0 15:0 i-16:0 16:1 16:0 i-17:0 a-17:0 17:0 18:1 18:0 53 54 52 23 53 62 0.5 63 60 37 61 5 71 1.4 0.1 0.6 0.1 13.0 0.5 42.0 1.0 0.2 0.0 6.2 0.1 1.2 0.1 5.2 0.8 9.3 0.7 16.7 1.4 0 1.8 0.2 2.1 0.8 0164 2.4 0.1 0.7 0.0 12.3 0.4 38.3 0.5 0 9.9 0.1 1.7 0.4 7.2 0.1 9.4 0.3 14.6 0.8 0.3 0.2 1.4 0.3 1.7 0.1 t0.5 ATCC 21332 1.0 0.4 15.3 41.7 0.1 4.5 1.4 3.9 11.0 17.2 0.2 1.1 1.9 0.1 0.0 1.1 0.7 0.1 0.3 0.2 0.4 0.7 0.7 0.2 0.8 0.5 0164 1.4 0.1 0.3 0.4 13.4 1.1 41.9 0.1 0 6.5 0.2 3.4 0.2 3.9 0.2 9.9 0.1 16.2 1.2 0 0 3.1 0.2 t1.5

total iso-branched-chain FAs rose from 36 to 47% in the Sf+ strain, whereas the content of these FAs rose from 39 to 56% of the total in the Sf strain. In the surfactin producer, the decline in the overall level of anteiso-branched-chain FAs was caused by an 8% drop in the content of a-15:0 to 33% and by an increase in the proportion of i-15:0 from 17 to 24%. In the surfactin non-producing mutant the observed changes were more profound, as the proportion of a-15:0 fell to 28% and i-15:0 rose to 30%. These changes led to a slight prevalence of the iso-branching pattern in the Sf strain and anteiso-branched chain FAs in the Sf+ strain. To a large extent these shifts in FA composition reected the general late stationary phase stress, as a similar response was observed in both B. subtilis strains irrespective of the surfactin production. GCMS analyses revealed no substantial differences between the surfactin producing and non-producing B. subtilis strain in terms of the presence of acyl chain length proles, the proportion of straight saturated or unsaturated FAs. In contrast to the polar head groups of membrane PL, the FA composition in the surfactin producer developed in a similar manner as in its non-producing counterpart, and the slight differences in the levels of iso-FAs are unlikely to be due to the adaptation to surfactin.

3.4. Fluidity of the cytoplasmic membrane The uidity of cytoplasmic membranes isolated from the Sf+ and Sf strains was measured by means of Laurdan generalized polarization. The uorescent membrane probe Laurdan incorporates at the hydrophilichydrophobic interface of the phospholipid bilayer. It is known to be sensitive to the polarity of the environment, exhibiting

t3 0164 0.8 0.0 0.4 0.2 15.1 1.6 39.5 0.5 0 5.0 0.2 1.2 0.3 4.8 0.4 11.3 0.1 17.7 0.1 0 0.9 0.3 3.4 0.3 ATCC 21332 0.9 0.2 0.2 0.1 16.9 0.5 40.8 1.9 0.1 0.1 4.0 0.4 1.2 0.8 3.2 0.2 14.3 0.1 17.0 0.8 0 0.4 0.1 1.0 0.1 0164 1.2 0.0 0.2 0.0 19.8 0.7 39.7 0.4 0 5.3 0.4 1.1 0.0 2.8 0.0 13.1 0.6 15.6 0.4 0 0.5 0.2 0.8 0.0

t20 ATCC 21332 1.6 0.1 0.4 0.3 24.0 0.6 32.7 1.4 0 6.6 1.2 1.0 1.0 4.6 2.0 14.6 1.4 11.7 1.9 0 1.0 1.4 1.8 0.8 0164 1.3 0.1 30.2 27.5 2.1 5.4 0.5 2.0 18.3 9.9 1.6 0.2 0.8 0.1 0.0 0.8 0.9 0.8 0.3 0.2 0.2 1.2 0.4 0.7 0.1 0.6

ATCC 21332 0.8 0.0 0.3 0.0 15.3 1.6 40.5 0.6 0 4.0 0.1 1.2 0.0 3.9 0.9 11.1 0.0 17.2 0.5 2.3 0.0 1.0 0.2 2.4 0.9

Ratios Iso/anteiso Branched/straight

0.5 0.0 7.8 0.8

0.5 0.0 6.6 0.7

0.5 0.0 9.9 1.6

0.5 0.0 8.3 0.5

0.5 0.0 8.0 0.9

0.6 0.0 8.4 0.5

0.6 0.1 16.9 1.1

0.7 0.0 17.6 0.8

1.1 0.0 14.6 1.4

1.5 0.0 16.2 1.4

Values represent means S.D. from three determinations. Iso and Anteiso stand for the respective branching pattern for iso- and anteiso-branched fatty acids, respectively.

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

2375

the cytoplasmic membrane rigidity signicantly increased concomitantly with the accumulation of surfactin. 4. Discussion The aim of this study was to investigate the role of membrane lipids in adaptation of B. subtilis ATCC 21332 to its own toxic product surfactin. Surfactin is synthesized in cytoplasm and is transported through the membrane by an unknown mechanism. This implies that it can interact with the membrane both from the cytoplasmic and extracellular side. However, surfactin clearly did not impair its producer, since the multiplication of bacteria continued in the culture in parallel with surfactin accumulation for almost 20 h. Within this period the cell number increased almost vefold while the surfactin concentration increased from 2 to 84 moll 1. Furthermore, the most potent C15 surfactin isoform [17] was also the most abundant one, amounting to 80% of the surfactin present. Surprisingly, during the production period, the Sf+ culture grew even faster than the control Sf population. This stimulatory effect of surfactin could probably stem from its quorum-sensing role which includes the triggering of cannibalism, as observed recently during the biolm development of B. subtilis [45]. The producer cells survived long-term exposure to surfactin concentrations that can perturb the barrier properties in model membranes [23,28]. This is even more striking when we consider that the minimum inhibitory concentrations of surfactin determined for Salmonella enteritidis, Proteus vulgaris, Enterobacter cloacae, Bacillus pumilus and Escherichia coli are all within the range 630 moll 1 [3,4,46]. These data suggested that bacteria producing surfactin are equipped with an efcient self-protective mechanism. In searching for this mechanism, our primary attention was focused on membrane phospholipids, which are a well-documented surfactin target [16,29,33]. The interaction of surfactin with membrane PLs is hypothesized to initiate as the insertion of individual surfactin molecules. This step does not highly disorganize the PL bilayer, however after the insertion of several other surfactin molecules in the membrane, pores can be formed and the mixed micelles of surfactin with PLs could lead to bilayer solubilization [17,22,32]. This model was also supported by the study of Nazari et al. [47] where surfactin was thought to segregate within the membrane into surfactin-rich clusters that disrupted the membrane locally. In our study, the amount of surfactin molecules in the medium per B. subtilis cell of the Sf+ strain ranged from 1.1 107 at t0.5 to 1.2 108 at t20. Therefore, during 1-day cultivation, we should also expect all of the above-mentioned modes of surfactin action in the cells of the surfactin producer, which however obviously resisted the adverse effect of surfactin. In the membrane of the surfactin producer, two specic features found in the polar head group composition indicated their possible role in the tolerance to surfactin. First, cardiolipin was the only PL to progressively accumulate over the whole 24-h cultivation (Table 2). At t20, the CL concentration reached 22% of the total and CL became the second most abundant PL. The signicance of this preferential synthesis was underlined by the parallel decline of CL content down to 8% in the Sf strain in the same time point. Second, in contrast to CL, the level of PE was maintained strictly constant in the producer's membrane, perhaps due to PE having a stabilizing effect on surfactin in the membrane [31]. This might be unfavorable as surfactin can aggregate in the membrane [47] and tilts the acyl chains of lipids [48]. On the other hand, in the non-producing strain the proportion of PE steadily increased, which is typical of the stationary phase of growth of B. subtilis [49]. In contrast to the polar head groups of membrane PL, almost no changes in the fatty acid composition were found. The observed tendency of the lower content of iso-branched-chain FAs in the Sf+ strain (Fig. 3) was unlikely to be due to an adaptive response to

Fig. 2. Proportions of iso- (circles) and anteiso-branched FAs (squares) in B. subtilis cytoplasmic membrane during 24-h cultivation. The time point of entry into the stationary phase of growth is designated as t0. The data represent averages and S.D.

a 50 nm red shift in emission spectrum over the gel to liquid-crystalline phase transition. Laurdan spectral shifts are usually quantied in the form of generalized polarization (GP), which is inversely proportional to membrane uidity (see Section 2.8). We used this technique in order to nd how the changes in the composition of the polar head groups of membrane PLs changed the respective biophysical characteristics of membranes isolated from B. subtilis. From the data in Fig. 3, it is apparent that in the exponential phase of growth (t 1) cytoplasmic membranes derived from both B. subtilis strains showed the same values of Laurdan GP in line with the same PL composition. As the PL prole remained almost unchanged at t0.5, the same GP values were also obtained in the early stationary phase, and this tendency continued until t1.5 despite the subsequent changes in the polar head group composition. However, at t3 and t20, i.e. the time points, at which major changes in lipid composition of the Sf+ strain were detected, GP values increased from about 0.02 to 0.02 (P b 0.02) and 0.06 (P b 0.002), respectively. The increasing GP parameter of the Sf+ membranes thus indicated a substantial rigidization of the membrane of the surfactin producer compared to the Sf strain. At t20, this trend was much more profound than at t3. On the other hand, the membrane uidity of the Sf strain remained almost unchanged despite the observed PL modications. This indicates that

Fig. 3. GP parameter during different cultivation periods measured in B. subtilis ATCC 21332 (full symbols) and 0164 (open symbols) membranes. The time point of entry into the stationary phase of growth is designated as t0. The data represent averages and S.D.

2376

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

surfactin. As an explanation of this effect we suggest a competition for leucine and valine between branched-chain FA synthesis and biosynthesis of surfactin. Leu and Val are precursors of iso-branched-chain FAs [50], whereas surfactin contains 4 Leu and 1 Val residues in its heptapeptide cycle [51]. Such a weak adaptive response at the level of FAs found in the surfactin producer was also published in the recent study on B. subtilis resistance to lipopeptide daptomycin, where the major determinant of DapR was the composition of the polar head groups [52]. Cardiolipin is an unusual anionic lipid carrying four acyl chains and two phosphatidyl moieties. Its molecule consists of a large hydrophobic region and strongly charged relatively small polar head group, which imply that CL favors negative curvature and forms both lamellar and inverted non-lamellar lipid phases [53]. At the same time, the mobility and conformational exibility of CL should be severely restricted [54], which probably enhances the structural rigidity of CL-containing membranes [55]. In bacteria, CL is regarded as a stress phospholipid [56]. Enhanced levels of it were observed in different bacteria in response to various adverse conditions such as high salinity [5759], alkaline pH [60] or the presence of chloramphenicol and tetracycline [61]. CL also specically interacts with key protein components of the cell cycle [62,63]. Together with PE, it is involved in forming a mosaic of microdomains in polar and septal membranes, i.e. in regions of increased membrane curvature [64,65]. Recently, a coordinated regulation of CL and PE levels was discovered in the inner mitochondrial membrane of yeast cells [66]. Different roles of increased CL content in the membrane of surfactin producer could be thus hypothesized. Since CL is an anionic phospholipid bearing two negative charges, elevated concentration of CL may increase the net negative charge of the membrane [62]. As the peptide cycle of surfactin also bears two negative charges, an electrostatic repulsion could hinder the interaction of surfactin with the phospholipid head groups [67]. The opposite coulombic mechanism is involved in the action of cationic antimicrobial peptides, which preferentially bind to negatively charged phospholipid membranes and thus increase their permeability [68]. Consequently, resistance of cells to these peptides is mediated by enhancing the net positive charge [69]. This mechanism has also been described in B. subtilis resistant to positively charged lipopeptide daptomycin, where reduced level of anionic phospholipid PG reduced the net negative surface charge and weakened the interaction with daptomycin [52]. Another possible mechanism of the membrane protection against surfactin can be deduced from the rigidizing effect of CL [55] on the membrane. In vitro surfactin induces uidization of the phospholipid bilayer [27]. Therefore, it could be expected that an adaptation strategy of the surfactin producer would include the increase of the rigidity of its membrane. When we observed the parallel control of CL and PE during surfactin production, we decided to study the changes in the uidity of the upper layer of the membrane as a primary target of the interaction with surfactin. A membrane uorescence probe Laurdan was used for this. Both the uorescent moiety of Laurdan and surfactin are located at the glycerol backbone of the PL head groups [25,70]. It has been shown that the Laurdan uorescence spectrum is sensitive to the polarity [71] and phase state of the phospholipid bilayers [72]. From t1.5 onwards, our results showed an increase in the general polarization (GP) of Laurdan during surfactin production, which documented an intense progressive increase in rigidity of the membrane (Fig. 3). This kinetics followed the development of the polar head group, which reected the response to the gradually rising surfactin stress in the producer cells. The Laurdan GP data were also conrmed by steady-state uorescence anisotropy, rss, using TMA-DPH and DPH probe molecules that monitor the polar [73] and hydrophobic [74] regions of the lipid bilayer. The resulting values of rss TMA-DPH and rss DPH were signicantly higher in the membranes of the Sf+ strain than those determined in the Sf membranes, and indicated a higher rigidity of the producer membranes, both in the polar

head and aliphatic chain bilayer moieties (data not shown). On the other hand, the observed decrease of membrane uidity was apparently not high enough to impair cell growth as the number of viable cells increased and surfactin production progressed throughout the stationary phase of the Sf+ strain cultivation. At t20, the key lipid component that contributed to the substantial rise of the rigidity in producer membrane was most likely CL, along with a severe decrease in PG, which is one of the PLs that has a uidizing effect [75]. Accumulation of PA, the common precursor of PLs up to one third of the total suggested an imbalance in PA de novo synthesis and its conversion into other lipid species [76] in the membranes of both strains, perhaps as a consequence of the energy depletion of cells. This notion was supported by the substantial exhaustion of the PG pool for direct CL synthesis, which surprisingly remained active in the Sf+ cells despite the double surfactin and nutritional stress at t20 and indicated the specic need for this PL. The presence of the CL head group in the lipid membrane can result in an increase in the order and tighter packing even in lipid acyl chains [77]. Hence, the increase in rss DPH in the PL aliphatic chain region that we observed in the Sf+ strain can also be ascribed to CL, although the FA composition only exhibited minor alterations. The rigidizing effect of CL on the membrane bilayer has been documented both in computational simulations and in experimental studies of model membranes using a wide variety of techniques [7780]. The presence of CL in the membrane may also enhance the order of the lipid bilayer [81]. The accumulation of CL with the concomitant decrease in the proportion of PE is crucial for the long-term adaptation of Pseudomonas putida to the presence of toluene. These parallel changes in CL and PE lead to increased cell membrane rigidity and should be regarded as physical mechanisms that prevent solvent penetration [82,83]. Thus, increased CL content might be a general cell response due to membrane adjustment [57]. From this point of view, the rigidization of the membrane bilayer brought about by CL can be considered not only as a side-effect of surfactin repulsion but also as a compensatory response of the cell preventing uidization [27,84], disorder of its barrier properties and solubilization [18] caused by surfactin. Finally, one more function of CL in the adaptation of B. subtilis ATCC 21332 to surfactin could be assumed from the complementary shapes of CL and surfactin molecules. The cone-shaped CL can result in the formation of aggregates with negative spontaneous curvature [55,85] which can counteract the positive curvature stress introduced by the inverted cone shape of surfactin [17,27]. CL was recently considered to force inverse cone-shaped lipids away from pores, thus stabilizing the bilayer [85,86]. An analogous CL mode of action against surfactin pore expansion and rupture could be proposed as an additional mechanism increasing the membrane resistance of surfactin producer. Despite systematic experimental effort being focused on CL, its unique physical and chemical characteristics in cell membranes are not well understood [55]. Moreover, a novel role of CL as a specic regulator of fundamental processes occurring at biomembranes has emerged. P. putida defective in CL synthesis exhibited a compromised functioning of the RND efux pumps that were involved in antibiotic and solvent resistance [61]. In mitochondria, the CL molecule can disrupt the supramolecular complex of the voltage-dependent anion channel that plays a central role in apoptosis [87]. In this study, both the changes in the phospholipid composition and physical properties of the membrane showed that an adaptive response was induced during surfactin production in B. subtilis ATCC 21332. We conclude that in this process, the enhanced level of cardiolipin was the key factor which possibly brought about the membrane protection. Our preliminary data obtained with model membranes show that the presence of cardiolipin increases membrane stability after surfactin challenge (data not shown). However, the precise mechanism of the effect of cardiolipin on

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378

2377

protection against surfactin and its role in the dynamic organization of the cytoplasmic membrane of the surfactin producer remains to be elucidated. Acknowledgements This work was supported by grants 13-18051P and P207/12/ P890 from the Czech Science Foundation, by Institutional Research Project RVO61388971 of Institute of Microbiology and SVV project 2013-267215. The authors thank Ivo Konopsek for critical reading of the manuscript. References
[1] A.W. Bernheim, L.S. Avigad, Nature and properties of a cytolytic agent produced by Bacillus subtilis, J. Gen. Microbiol. 61 (1970) 361366. [2] P.A.V. Fernandes, I.R. de Arruda, A.F.A.B. dos Santos, A.A. de Araujo, A.M.S. Maior, E.A. Ximenes, Antimicrobial activity of surfactants produced by Bacillus subtilis R14 against multidrug-resistant bacteria, Braz. J. Microbiol. 38 (2007) 704709. [3] X.Q. Huang, X.P. Gao, L.Y. Zheng, G.Z. Hao, Optimization of sterilization of Salmonella enteritidis in meat by surfactin and iturin using a response surface method, Int. J. Pept. Res. Ther. 15 (2009) 6167. [4] P. Das, S. Mukherjee, R. Sen, Antimicrobial potential of a lipopeptide biosurfactant derived from a marine Bacillus circulans, J. Appl. Microbiol. 104 (2008) 16751684. [5] D. Vollenbroich, M. Ozel, J. Vater, R.M. Kamp, G. Pauli, Mechanism of inactivation of enveloped viruses by the biosurfactant surfactin from Bacillus subtilis, Biologicals 25 (1997) 289297. [6] P.I. Kim, J. Ryu, Y.H. Kim, Y.T. Chi, Production of biosurfactant lipopeptides iturin A, fengycin and surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides, J. Microbiol. Biotechnol. 20 (2010) 138145. [7] M.H. Hwang, M.H. Kim, E. Gebru, B.Y. Jung, S.P. Lee, S.C. Park, Killing rate curve and combination effects of surfactin C produced from Bacillus subtilis complex BC1212 against pathogenic Mycoplasma hyopneumoniae, World J. Microbiol. Biotechnol. 24 (2008) 22772282. [8] I. Geetha, A.M. Manonmani, K.P. Paily, Identi cation and characterization of a mosquito pupicidal metabolite of a Bacillus subtilis subsp. subtilis strain, Appl. Microbiol. Biotechnol. 86 (2010) 1737 1744. [9] X.H. Cao, A.H. Wang, C.L. Wang, D.Z. Mao, M.F. Lu, Y.Q. Cui, R.Z. Jiao, Surfactin induces apoptosis in human breast cancer MCF-7 cells through a ROS/JNK-mediated mitochondrial/caspase pathway, Chem. Biol. Interact. 183 (2010) 357362. [10] D. Lopez, H. Vlamakis, R. Losick, R. Kolter, Paracrine signaling in a bacterium, Genes Dev. 23 (2009) 16311638. [11] D. Lopez, M.A. Fischbach, F. Chu, R. Losick, R. Kolter, Structurally diverse natural products that cause potassium leakage trigger multicellularity in Bacillus subtilis, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 280285. [12] M. Nitschke, L.V. Araujo, S.G. Costa, R.C. Pires, A.E. Zeraik, A.C. Fernandes, D.M. Freire, J. Contiero, Surfactin reduces the adhesion of food-borne pathogenic bacteria to solid surfaces, Lett. Appl. Microbiol. 49 (2009) 241247. [13] F. Rivardo, R.J. Turner, G. Allegrone, H. Ceri, M.G. Martinotti, Anti-adhesion activity of two biosurfactants produced by Bacillus spp. prevents biolm formation of human bacterial pathogens, Appl. Microbiol. Biotechnol. 83 (2009) 541553. [14] R. Maget-Dana, M. Ptak, Interfacial properties of surfactin, J. Colloid Interface Sci. 153 (1992) 285291. [15] Y. Ishigami, M. Osman, H. Nakahara, Y. Sano, R. Ishiguro, M. Matsumoto, Signicance of beta-sheet formation for micellization and surface-adsorption of surfactin, Colloids Surf. B Biointerfaces 4 (1995) 341348. [16] H. Heerklotz, J. Seelig, Detergent-like action of the antibiotic peptide surfactin on lipid membranes, Biophys. J. 81 (2001) 15471554. [17] M. Deleu, O. Boufoux, H. Razandralambo, M. Paquot, C. Hbid, P. Thonart, P. Jacques, R. Brasseur, Interaction of surfactin with membranes: a computational approach, Langmuir 19 (2003) 33773385. [18] M. Deleu, J. Lorent, L. Lins, R. Brasseur, N. Braun, K. El Kirat, T. Nylander, Y.F. Dufrne, M.-P. Mingeot-Leclercq, Effects of surfactin on membrane models displaying lipid phase separation, Biochim. Biophys. Acta-Biomembr. 1828 (2013) 801815. [19] L. Thimon, F. Peypoux, J. Wallach, G. Michel, Ionophorous and sequestering properties of surfactin, a biosurfactant from Bacillus subtilis, Colloids Surf. B Biointerfaces 1 (1993) 5762. [20] C. Djugnat, O. Diat, T. Zemb, Surfactin self-assembles into direct and reverse aggregates in equilibrium and performs selective metal cation extraction, Chemphyschem 12 (2011) 21382144. [21] J.D. Sheppard, C. Jumarie, D.G. Cooper, R. Laprade, Ionic channels induced by surfactin in planar lipid bilayer membranes, Biochim. Biophys. Acta 1064 (1991) 1323. [22] O.S. Ostroumova, V.V. Malev, M.G. Ilin, L.V. Schagina, Surfactin activity depends on the membrane dipole potential, Langmuir 26 (2010) 1509215097. [23] H. Heerklotz, J. Seelig, Leakage and lysis of lipid membranes induced by the lipopeptide surfactin, Eur. Biophys. J. 36 (2007) 305314. [24] M. Morikawa, Y. Hirata, T. Imanaka, A study on the structurefunction relationship of lipopeptide biosurfactants, Biochim. Biophys. Acta-Biomembr. 1488 (2000) 211218. [25] H.H. Shen, R.K. Thomas, P. Taylor, The location of the biosurfactant surfactin in phospholipid bilayers supported on silica using neutron reectometry, Langmuir 26 (2010) 320327.

[26] A. Zou, J. Liu, V.M. Garamus, Y. Yang, R. Willumeit, B. Mu, Micellization activity of the natural lipopeptide [Glu1, Asp5] surfactin-C15 in aqueous solution, J. Phys. Chem. B 114 (2010) 27122718. [27] C. Carrillo, J.A. Teruel, F.J. Aranda, A. Ortiz, Molecular mechanism of membrane permeabilization by the peptide antibiotic surfactin, Biochim. Biophys. Acta 1611 (2003) 9197. [28] H.H. Shen, R.K. Thomas, J. Penfold, G. Fragneto, Destruction and solubilization of supported phospholipid bilayers on silica by the biosurfactant surfactin, Langmuir 26 (2010) 73347342. [29] O. Boufoux, A. Berquand, M. Eeman, M. Paquot, Y.F. Dufrene, R. Brasseur, M. Deleu, Molecular organization of surfactinphospholipid monolayers: effect of phospholipid chain length and polar head, Biochim. Biophys. Acta 1768 (2007) 17581768. [30] S. Buchoux, J. Lai-Kee-Him, M. Garnier, P. Tsan, F. Besson, A. Brisson, E.J. Dufourc, Surfactin-triggered small vesicle formation of negatively charged membranes: a novel membrane-lysis mechanism, Biophys. J. 95 (2008) 38403849. [31] A. Grau, J.C. Gomez Fernandez, F. Peypoux, A. Ortiz, A study on the interactions of surfactin with phospholipid vesicles, Biochim. Biophys. Acta-Biomembr. 1418 (1999) 307319. [32] G. Francius, S. Dufour, M. Deleu, M. Papot, M.P. Mingeot-Leclercq, Y.F. Dufrene, Nanoscale membrane activity of surfactins: Inuence of geometry, charge and hydrophobicity, Biochim. Biophys. Acta-Biomembr. 1778 (2008) 20582068. [33] M. Eeman, A. Berquand, Y.F. Dufrene, M. Paquot, S. Dufour, M. Deleu, Penetration of surfactin into phospholipid monolayers: nanoscale interfacial organization, Langmuir 22 (2006) 1133711345. [34] D.A. Hopwood, How do antibiotic-producing bacteria ensure their self-resistance before antibiotic biosynthesis incapacitates them? Mol. Microbiol. 63 (2007) 937940. [35] B.G. Butcher, J.D. Helmann, Identication of Bacillus subtilis sigma(W)-dependent genes that provide intrinsic resistance to antimicrobial compounds produced by Bacilli, Mol. Microbiol. 60 (2006) 765782. [36] D.B. Kearns, F. Chu, R. Rudner, R. Losick, Genes governing swarming in Bacillus subtilis and evidence for a phase variation mechanism controlling surface motility, Mol. Microbiol. 52 (2004) 357369. [37] K. Tsuge, Y. Ohata, M. Shoda, Gene yerP, involved in surfactin self-resistance in Bacillus subtilis, Antimicrob. Agents Chemother. 45 (2001) 35663573. [38] P. Cosmina, F. Rodriguez, F. de Ferra, G. Grandi, M. Perego, G. Venema, D. van Sinderen, Sequence and analysis of the genetic locus responsible for surfactin synthesis in Bacillus subtilis, Mol. Microbiol. 8 (1993) 821831. [39] M.M. Nakano, N. Corbell, J. Besson, P. Zuber, Isolation and characterization of sfp: a gene that functions in the production of the lipopeptide biosurfactant, surfactin, in Bacillus subtilis, Mol. Gen. Genet. 232 (1992) 313321. [40] R.D. Pridmore, New and versatile cloning vectors with kanamycin-resistance marker, Gene 56 (1987) 309312. [41] G. Seydlova, J. Svobodova, Rapid and effective method for the separation of Bacillus subtilis vegetative cells and spores, Folia Microbiol. 57 (2012) 455457. [42] A. Hara, N. Radin, Lipid extraction of tissues with a low-toxicity solvent, Anal. Biochem. 90 (1978) 420426. [43] G. Rouser, S. Fleische, A. Yamamoto, Two dimensional thin layer chromatographic separation of polar lipids and determination of phospholipids by phosphorus analysis of spots, Lipids 5 (1970) 494496. [44] R.L. Glass, Alcoholysis, saponication and preparation of fatty acid methyl esters, Lipids 6 (1971) 919925. [45] D. Lopez, H. Vlamakis, R. Losick, R. Kolter, Cannibalism enhances biolm development in Bacillus subtilis, Mol. Microbiol. 74 (2009) 609618. [46] X. Huang, Z. Wei, G. Zhao, X. Gao, S. Yang, Y. Cui, Optimization of sterilization of Escherichia coli in milk by surfactin and fengycin using a response surface method, Curr. Microbiol. 56 (2008) 376381. [47] M. Nazari, M. Kurdi, H. Heerklotz, Classifying surfactants with respect to their effect on lipid membrane order, Biophys. J. 102 (2012) 498506. [48] H. Heerklotz, T. Wieprecht, J. Seelig, Membrane perturbation by the lipopeptide surfactin and detergents as studied by deuterium, J. Phys. Chem. B 108 (2004) 49094915. [49] J.A.F. Op den Kamp, I. Redai, L.L. Van Deene, Phospholipid composition of Bacillus subtilis, J. Bacteriol. 99 (1969) 298303. [50] T. Kaneda, Biosynthesis of branched-chain fatty acids. V. Microbial strereospecic synthesis of D-12-methyltetradecanoic and D-14-methylhexadecanoicacids, Biochim. Biophys. Acta 125 (1966) 4354. [51] F. Peypoux, J.M. Bonmatin, J. Wallach, Recent trends in the biochemistry of surfactin, Appl. Microbiol. Biotechnol. 51 (1999) 553563. [52] A.B. Hachmann, E. Sevim, A. Gaballa, D.L. Popham, H. Antelmann, J.D. Helmann, Reduction in membrane phosphatidylglycerol content leads to daptomycin resistance in Bacillus subtilis, Antimicrob. Agents Chemother. 55 (2011) 43264337. [53] M. Dahlberg, Polymorphic phase behavior of cardiolipin derivatives studied by coarse-grained molecular dynamics, J. Phys. Chem. B 111 (2007) 71947200. [54] P.R. Allegrini, G. Pluschke, J. Seelig, Cardiolipin conformation and dynamics in bilayer membranes as seen by deuterium magnetic resonance, Biochemistry 23 (1984) 64526458. [55] R. Lewis, R.N. McElhaney, The physicochemical properties of cardiolipin bilayers and cardiolipin-containing lipid membranes, Biochim. Biophys. Acta-Biomembr. 1788 (2009) 20692079. [56] A. Petersohn, M. Brigulla, S. Haas, J.D. Hoheisel, U. Volker, M. Hecker, Global analysis of the general stress response of Bacillus subtilis , J. Bacteriol. 183 (2001) 5617 5631. [57] C.S. Lpez, A.F. Alice, H. Heras, E.A. Rivas, C. Snchez-Rivas, Role of anionic phospholipids in the adaptation of Bacillus subtilis to high salinity, Microbiology 152 (2006) 605616.

2378

G. Seydlov et al. / Biochimica et Biophysica Acta 1828 (2013) 23702378 [72] T. Parasassi, G. De Stasio, G. Ravagnan, R.M. Rusch, E. Gratton, Quantitation of lipid phases in phospholipid vesicles by the generalized polarization of Laurdan uorescence, Biophys. J. 60 (1991) 179 189. [73] V. Borenstain, Y. Barenholz, Characterization of liposomes and other lipid assemblies by multiprobe uorescence polarization, Chem. Phys. Lipids 64 (1993) 117 127. [74] M. Adler, T.R. Tritton, Fluorescence depolarization measurements on oriented membranes, Biophys. J. 53 (1988) 9891005. [75] P. Garidel, A. Blume, Miscibility of phosphatidylethanolaminephosphatidylglycerol mixtures as a function of pH and acyl chain length, Eur. Biophys. J. 28 (2000) 629638. [76] K. Athenstaedt, G. Daum, Phosphatidic acid, a key intermediate in lipid metabolism, Eur. J. Biochem. 266 (1999) 116. [77] F. Etienne, Y. Roche, P. Peretti, S. Bernard, Cardiolipin packing ability studied by grazing incidence X-ray diffraction, Chem. Phys. Lipids 152 (2008) 1323. [78] M. Dahlberg, A. Maliniak, Molecular dynamics simulations of cardiolipin bilayers, J. Phys. Chem. B 112 (2008) 1165511663. [79] T. Rog, H. Martinez-Seara, N. Munck, M. Oresic, M. Karttunen, I. Vattulainen, Role of cardiolipins in the inner mitochondrial membrane: insight gained through atom-scale simulations, J. Phys. Chem. B 113 (2009) 34133422. [80] E.V. Brink-van der Laan, J.A. Killian, B. de Kruijff, Nonbilayer lipids affect peripheral and integral membrane proteins via changes in the lateral pressure prole, Biochim. Biophys. Acta-Biomembr. 1666 (2004) 275288. [81] F.L. Hoch, Cardiolipins and biomembrane function, Biochim. Biophys. Acta 1113 (1992) 71133. [82] J.L. Ramos, E. Duque, J.J. RodriguezHerva, P. Godoy, A. Haidour, F. Reyes, A. FernandezBarrero, Mechanisms for solvent tolerance in bacteria, J. Biol. Chem. 272 (1997) 38873890. [83] P. Bernal, A. Segura, J.L. Ramos, Compensatory role of the cis-trans-isomerase and cardiolipin synthase in the membrane uidity of Pseudomonas putida DOT-T1E, Environ. Microbiol. 9 (2007) 16581664. [84] R. Brasseur, N. Braun, K. El Kirat, M. Deleu, M.P. Mingeot-Leclercq, Y.F. Dufrene, The biologically important surfactin lipopeptide induces nanoripples in supported lipid bilayers, Langmuir 23 (2007) 97699772. [85] M. Dahlberg, A. Maliniak, Mechanical properties of coarse-grained bilayers formed by cardiolipin and zwitterionic lipids, J. Chem. Theory Comput. 6 (2010) 1638 1649. [86] J. Wohlert, W.K. den Otter, O. Edholm, W.J. Briels, Free energy of a trans-membrane pore calculated from atomistic molecular dynamics simulations, J. Chem. Phys. 124 (2006) 154905. [87] V. Betaneli, E.P. Petrov, P. Schwille, The role of lipids in VDAC oligomerization, Biophys. J. 102 (2012) 523531.

[58] L. Catucci, N. Depalo, V.M.T. Lattanzio, A. Agostiano, A. Corcelli, Neosynthesis of cardiolipin in Rhodobacter sphaeroides under osmotic stress, Biochemistry 43 (2004) 1506615072. [59] M. Tsai, R.L. Ohniwa, Y. Kato, S.L. Takeshita, T. Ohta, S. Saito, H. Hayashi, K. Morikawa, Staphylococcus aureus requires cardiolipin for survival under conditions of high salinity, BMC Microbiol. 11 (2011) 13. [60] M.S. Muntyan, I.V. Popova, D.A. Bloch, E.V. Skripnikova, V.S. Ustiyan, Energetics of alkalophilic representatives of the genus Bacillus, Biochem. Mosc. 70 (2005) 137142. [61] P. Bernal, J. Munoz-Rojas, A. Hurtado, J.L. Ramos, A. Segura, A Pseudomonas putida cardiolipin synthesis mutant exhibits increased sensitivity to drugs related to transport functionality, Environ. Microbiol. 9 (2007) 11351145. [62] F. Kawai, M. Shoda, R. Harashima, Y. Sadaie, H. Hara, K. Matsumoto, Cardiolipin domains in Bacillus subtilis Marburg membranes, J. Bacteriol. 186 (2004) 14751483. [63] K. Sekimizu, A. Kornberg, Cardiolipin activation of DnaA protein, the initiation protein of replication of Escherichia coli , J. Biol. Chem. 263 (1988) 7131 7135. [64] A. Nishibori, J. Kusaka, H. Hara, M. Umeda, K. Matsumoto, Phosphatidylethanolamine domains and localization of phospholipid synthases in Bacillus subtilis membranes, J. Bacteriol. 187 (2005) 21632174. [65] E. Mileykovskaya, W. Dowhan, Cardiolipin membrane domains in prokaryotes and eukaryotes, Biochim. Biophys. Acta-Biomembr. 1788 (2009) 20842091. [66] C. Osman, M. Haag, C. Potting, J. Rodenfels, P.V. Dip, F.T. Wieland, B. Brugger, B. Westermann, T. Langer, The genetic interactome of prohibitins: coordinated control of cardiolipin and phosphatidylethanolamine by conserved regulators in mitochondria, J. Cell Biol. 184 (2009) 583 596. [67] R. Maget-Dana, M. Ptak, Interactions of surfactin with membrane models, Biophys. J. 68 (1995) 19371943. [68] N. Papo, Y. Shai, Can we predict biological activity of antimicrobial peptides from their interactions with model phospholipid membranes? Peptides 24 (2003) 16931703. [69] M. Kovacs, A. Halfmann, I. Fedtke, M. Heintz, A. Peschel, W. Vollmer, R. Hakenbeck, R. Bruckner, A functional dlt operon, encoding proteins required for incorporation of D-alanine in teichoic acids in gram-positive bacteria, confers resistance to cationic antimicrobial peptides in Streptococcus pneumoniae, J. Bacteriol. 188 (2006) 57975805. [70] P.L.G. Chong, P.T.T. Wong, Interactions of Laurdan with phosphatidylcholine liposomesa high-pressure FTIR study, Biochim. Biophys. Acta 1149 (1993) 260266. [71] T. Parasassi, M. Distefano, M. Loiero, G. Ravagnan, E. Gratton, Inuence of cholesterol on phospholipid bilayers phase domains as detected by Laurdan uorescence, Biophys. J. 66 (1994) 120132.