Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
Introduction
Staphylococcus aureus is one of the most common human pathogens, being responsible for a wide variety of infections, many of which can be life-threatening. Besides its pathogenic potential, this bacterium also shows many different mechanisms of resistance towards antibiotics. Several of these mechanisms are well known, and have been characterized: resistance to b-lactam antibiotics mediated by PBP2a, encoded by the mecA gene, or resistance to uoroquinolones resulting from mutations
in either topoisomerase IV or gyrase genes.1 On the other hand, antibiotic resistance based on efux systems capable of extruding the drug or other noxious agents from the cell is less well characterized for these bacteria. To date, more than 10 efux pumps (EPs) have been described for S. aureus.2 Most of these pumps belong to the major facilitator superfamily, namely the chromosomally encoded NorA, NorB, NorC, MdeA and SdrM as well as the plasmid-encoded QacA/B pumps.3 8 Other types of pumps have also been described for S. aureus such as MepA, a member of
.....................................................................................................................................................................................................................................................................................................................................................................................................................................
*Correspondence address. Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa, Rua da Junqueira 96, 1349-008 Lisbon, Portugal. Tel: 351-21-3652652; Fax: 351-21-3632105; E-mail: lamaral@ihmt.unl.pt
.....................................................................................................................................................................................................................................................................................................................................................................................................................................
504
# The Author 2008. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org
Growth conditions
Cultures were grown in tryptic soy broth (TSB) or agar (TSA) (Oxoid Ltd, Basingstoke, UK) at 378C. When necessary, the strain ATCC 25923EtBr was grown in a medium supplemented with 50 mg/L of ethidium bromide. For determination of the MICs of the agents employed in this study, cultures were grown in a Mueller Hinton broth (MHB), and for Kirby Bauer antibiotic susceptibility assays, in Mueller Hinton agar, at 378C.
Antibiotics
Antibiotics in powder form were purchased from different sources, as follows: nalidixic acid, erythromycin, tetracycline, rifampicin and chloramphenicol were purchased from Sigma-Aldrich (St Louis, USA); noroxacin was purchased from ICN Biomedicals Inc. (OH, USA) and ciprooxacin from Fluka Chemie GmbH (Buchs, Switzerland). KirbyBauer discs containing nalidixic acid (30 mg), noroxacin (10 mg), ciprooxacin (5 mg), tetracycline (30 mg), oxacillin (1 mg), gentamicin (10 mg), cefotaxime (30 mg), penicillin (10 U) and fusidic acid (10 mg) were acquired from Oxoid Ltd.
505
Couto et al.
Preparation of chromosomal DNA
Genomic DNA was extracted with the QIAamp DNA minikit (QIAGEN, Hilden, Germany), with an additional step of 30 min digestion with lysostaphin (Sigma) (200 mg/L) prior to extraction.
RNA extraction
Total RNA was extracted from the parent ATCC 25923 strain unexposed to ethidium bromide and the ATCC 25923EtBr strain grown in TSB supplemented with 50 mg/L of ethidium bromide with the Rneasy Mini Kit (QIAGEN), as per the manufacturers instructions. Before extraction of total RNA, the cultures were treated with an RNAprotect bacterial reagent (QIAGEN). The extracted RNA was treated with RNAse-free DNAse (QIAGEN) for 2 h at room temperature and re-puried using the same kit.
Macrorestriction analysis
Cultures were typed by pulsed-eld gel electrophoresis (PFGE) analysis, using well-established protocols. Briey, agarose discs containing intact chromosomal DNA were prepared as described previously23 and restricted with SmaI, according to the manufacturers recommendations (New England Biolabs, Ipswich, MA, USA). Restriction fragments were then resolved by PFGE, which was carried out in a contour-clamped homogeneous electric eld (CHEF) apparatus (CHEF-DRII, Bio-Rad, Hercules, CA, USA), as described previously.23
Size (bp) 628 285 620 246 449 213 216 718 198 677 155 103 492 339 394
Reference 45 24 46; this work this work this work this work this work this work this work this work 6 this work 47 48 this work
GCTGCATTTATGACAATGTTTG AATCCCACCTACTAAAGCAG ATAAGTACTGAAGTTATTGGAAGT TTCCGAAAATGTTTAACGAAACTA TTCACCAAGCCATCAAAAAG CTTGCCTTTCTCCAGCAATA TCGTCTTAGCGTTCGGTTTA TCCAGTAACCATCGGCAATA TGTTAAGTCTTGGTCATCTGCA AGCAGCAACAAGTAACCCTAAA AGCGCGTTGTCTATCTTTCC GCAGGTGGTCTTGCTGATAA AATGGGTTCTAAGCGACCAA ATACCTGAAGCAACGCCAAC ATGTTGCTGCTGCTCTGTTC TCAACTGTCAAACGATCACG TGCTGCTGCTCTGTTCTTTA GCGAAGTTTCCATAATGTGC AACGCGATACCAACCATTC TTAGCACCAGCTATTGGACCT GTTTATGCGATTCGAATGGTTGGT AATTAATGCAGCTGTTCCGATAGA GCAGTCGAGCATTTAATGGA ACGTTGTTGCAACTGTGTAAGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG TGCCAGATGTTCGTGATGGT TGGAATGAAAGAAACTGTCTC TCGTGCATTGCCAGATGTTCG TCGAGCAGGTAAGACTGACGG
Primers used in the qRTPCR experiments are indicated by the RT label. Fw, forward primer; Rv, reverse primer. For norB, norC and sepA, the same set of primers was used for both PCR and qRTPCR.
506
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
Results
Adaptation to ethidium bromide
The parent ATCC 25923 strain, susceptible to 6.25 mg/L ethidium bromide, was serially cultured in stepwise increases of ethidium bromide beginning with 5 mg/L ethidium bromide. After 82 days, the resistance of this strain to ethidium bromide was raised from an MIC of 6.25 to 200 mg/L and this ethidium bromide-adapted culture was designated as ATCC 25923EtBr.
Contamination control
The parent ATCC 25923 and its adapted ethidiumbromide-resistant progeny, ATCC 25923EtBr, were typed by PFGE analysis. Since the SmaI macrorestriction patterns of both the parental and the ethidium bromide-adapted cultures were identical (data not shown), one can rule out any contaminant being introduced during the process by which the parent strain became resistant to ethidium bromide.
507
Couto et al.
Table 2. MICs of biocides and antibiotics in the presence and absence of EPIs MIC (mg/L) in the presence of inhibitor Drug EtBr TPP DC DAPI PT BAC CHX CTAB RD BER CIP NOR Culture ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr no inhibitor 6.25 200 (32 ) 12.5 100 (8 ) 6.25 50 (8 ) 3 12.5 (4 ) 50 200 (4 ) 0.75 3 (4 ) 0.375 0.75 (2 ) 0.75 3 (4 ) 500 1000 (2 ) 200 . 800 (4 ) 0.25 1 (4 ) 0.5 2 (4 ) TZ 0.75 25 1.5 6.25 1.5 12.5 0.75 1.5 12.5 50 0.18 0.375 0.02 0.375 0.09 0.375 125 62.5 100 400 0.125 0.25 0.125 0.25 CPZ 0.75 12.5 3 6.25 1.5 12.5 1.5 1.5 6.25 50 0.09 0.75 0.09 0.375 0.09 0.375 125 62.5 100 400 0.125 0.25 0.125 0.25 VER 3 100 6.25 50 3 25 1.5 6.25 12.5 100 0.18 1.5 0.09 0.375 0.18 1.5 250 250 50 800 0.125 0.25 0.25 0.5 CCCP 1.5 200 12.5 100 3 25 1.5 12.5 50 200 0.75 1.5 0.375 0.75 0.75 3 500 1000 200 800 0.25 1 0.25 2 RES 1.5 100 3 50 0.75 12.5 0.75 3 12.5 100 0.09 0.75 0.02 0.375 0.09 0.75 250 500 50 800 0.125 0.25 0.25 0.5
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
Values in bold type correspond to a decrease of 4-fold or higher on the MIC values in comparison to the ones in the absence of inhibitor. Values in parentheses indicate the MIC increment relative to the one of the original culture. The concentration of each EPI used is dened in the Materials and methods section. EtBr, ethidium bromide; TPP, tetraphenylphosphonium bromide; DC, dequalinium chloride; DAPI, 40 ,6-diamidino-2-phenylindole dihydrochloride; PT, pentamidine; BAC, benzalkonium chloride; CHX, chlorhexidine; CTAB, cetyltrimethylammonium bromide; RD, rhodamine; BER, berberine; NOR, noroxacin; CIP, ciprooxacin; CCCP, carbonyl cyanide m-chlorophenylhydrazone; TZ, thioridazine; CPZ, chlorpromazine; VER, verapamil; RES, reserpine. Additional antibiotics tested included nalidixic acid, tetracycline, erythromycin, chloramphenicol and rifampin, with no alteration in the MICs between the two cultures. The effect of ouabain in the MICs was also tested for EtBr, TPP, DC, DAPI and PT, with no observable effect.
ATCC 25923EtBr, are summarized in Table 2. Briey, the MICs against the ethidium bromide-adapted strain have all increased, especially those of the biocides TPP and dequalinium, for which an 8-fold increase is evident.
Susceptibility to antibiotics
Kirby Bauer assays. The antibiotic susceptibility of the two cultures against different classes of antibiotics was rst screened by Kirby Bauer assays. Whereas the initial parent strain was susceptible to all antibiotics, the adapted strain showed evidence of decreased susceptibility to noroxacin, ciprooxacin and nalidixic acid (with zones of inhibition of 27, 28 and 14 mm for ATCC 25923 and 19, 21 and 11 mm for ATCC 25923EtBr, respectively). However, the diameters of the zones of inhibition for ATCC 25923EtBr still fall within the susceptibility range. MIC determination. The MIC of each antibiotic against the parental and ethidium bromide-adapted strains is shown in Table 2. According to the Kirby Bauer antibiotic disc assay, the
ethidium bromide-adapted strain was 4-fold more resistant than its parental strain to noroxacin and ciprooxacin. No alteration was observed in the MIC of nalidixic acid or any of the other antibiotics tested. For ciprooxacin, the MIC obtained for ATCC 25923EtBr (1 mg/L) equals the breakpoint for distinguishing susceptibility from intermediate resistance, according to the CLSI breakpoint values. However, measured against EUCAST breakpoint values, the MIC of ciprooxacin for this strain would correspond to resistance, thus further illustrating the development of an MDR phenotype in this strain.28
508
Genetic analysis
The two cultures were evaluated for: (i) the presence of mutations in the chromosome generally associated with
Figure 1. Evaluation of efux activity of ATCC 25923 original (left) and ATCC 25923EtBr (right) cultures by the ethidium bromide agar screening method. Cultures were swabbed in TSA plates containing increasing concentrations of ethidium bromide. Following overnight incubation at 37C (upper panels) and after transfer to 4C for 16 h (lower panels) uorescence was detected under UV light.
509
Couto et al.
(a)
Relative fluorescence
(b)
Relative fluorescence
Time (min) No EPI 15 mg/L CPZ 5 mg/L CPZ 25 mg/L CPZ 10 mg/L CPZ No EPI 15 mg/L CPZ
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
10 mg/L TZ
Time (min) No EPI 60 mg/L RES 20 mg/L RES 100 mg/L RES 40 mg/L RES No EPI 60 mg/L RES
Figure 2. Evaluation of ethidium bromide efux activity by the semi-automated screening method for ATCC 25923 (a) and ATCC 25923EtBr (b). Assays were run at 37C, in the presence of glucose, with or without the most active EPIs. The data presented were normalized against the conditions of accumulation (no efux), and the relative uorescence was determined. CPZ, chlorpromazine; TZ, thioridazine; RES, reserpine.
uoroquinolones, and the site of the assigned transcription initiation (Figure 3).32,33
Discussion
The results of this study show that continuous and prolonged exposure of the S. aureus strain ATCC 25923 to increasing concentrations of ethidium bromide results in an impressive increase in resistance to this agent. In parallel, resistance to uoroquinolones as well as to other known EP substrates is also augmented, in particular, to the biocides tetraphenylphosphonium and
dequalinium. The larger increase in resistance to ethidium bromide compared with that observed for the other NorA substrates may be explained by a greater capacity of NorA to extrude ethidium bromide, inasmuch as this pump has been described as conferring only low-level resistance to uoroquinolones.12 However, this difference may also result from increased cell adaptation to ethidium bromide during the 82 day selection with this drug, whereas challenge by the other drugs tested only occurred during the 18 h period of the susceptibility assay. One may further hypothesize that cellular factors other than the pump itself may also play a role, namely the involvement of sensor systems that are specically activated by each class of
510
ATCC25923_norApromoter ATCC25923EtBr_norApromoter
-35
ATCC25923_norApromoter ATCC25923EtBr_norApromoter
-10
ATCC25923_norApromoter ATCC25923EtBr_norApromoter
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
SD
ATCC25923_norApromoter ATCC25923EtBr_norApromoter
NorA
GATTTAAGAATGACATGGAGAAAAAAGAGGTGAGCATATGAATAAACAGA 250 ---------ATGACATGGAGAAAAAAGAGGTGAGCATATGAATAAACAGA 180 ***************************************** TTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTA 300 TTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTA 230 **************************************************
ATCC25923_norApromoter ATCC25923EtBr_norApromoter
Figure 3. Alignment of the norA promoter sequences in ATCC 25923 and ATCC 25923EtBr. The consensus sequences 2 10, 2 35 and Shine-Dalgarno (SD) for ATCC 25923 are indicated, as well as the initiation codon. The asterisk marks the nucleotide (T) of the qB mutation. The cardinal marks the site of transcription initiation assigned for ATCC 25923.
substrate recognized by MDR EPs, such as NorA. Recently, we have documented such interplay between EP activity, their regulation and altered cell permeability to antibiotics in Escherichia coli.34 The demonstration that the ethidium bromide-resistant strain has a more active, energy-dependent, efux system was provided by the agar assay as well as by the semi-automated uorometric method. The latter protocol has been recently developed in our laboratory and allows the assaying of efux activity by a simple and reproducible procedure, which is here applied for the rst time to Gram-positive bacteria. The extrusion of ethidium bromide from S. aureus cells has been associated with the EPs NorA, NorB, MdeA, MepA, SepA and SdrM, whose genes are localized in the chromosome.4,6,7,9,10,13 Other S. aureus pumps that are plasmid-encoded have also been linked to ethidium bromide extrusion, namely QacA/B, Smr, QacG, QacED1 and QacH.11,35 38 Since no plasmids were detected in this work, we studied the expression of the genes coding for the other, chromosomally located, ethidium bromide-extruding pumps, except SdrM, due to its low extruding capacity for this substrate.7 NorC was also included in our study because of its high homology with NorB, which also extrudes ethidium bromide, and because others have suggested that the two pumps act in a concerted manner.5,39 In the case of ATCC 25923EtBr, qRTPCR allowed us to correlate the higher efux activity of these cells with an increased expression of the gene that codes for NorA. Many alterations have been described for the promoter region of norA, including single base pair mutations such as the qB mutation, as well as deletions and insertions32,39 42 that have been related to an increased transcription of norA and/or increased stability of the mRNA molecule.33,39,42 In our study, a 70 bp deletion was detected in the promoter region of ATCC 25923EtBr. DeMarco et al. 39 have previously described a 15 bp deletion in this same region, which the authors propose to be
associated with alterations in the half-life of the norA mRNA. In the case of ATCC 25923EtBr, this 70 bp deletion contains the adenine residue, which is normally situated 7 bp downstream of the 10 sequence, to which the transcription start is assigned. The specic assignment of the new norA transcription start in ATCC 25923EtBr strain and its relation to the increased expression of this gene would require additional studies. Additional sequencing of the QRDRs of grlA and gyrA for both ATCC 25923 and ATCC 25923EtBr revealed none of the mutations most commonly associated with uoroquinolone resistance in S. aureus, namely the mutations D79V, S80F, S80Y, S81P and E84K in GrlA; or S84L, S85P or E88K in GyrA, thus further supporting the suggestion that the decreased susceptibility towards uoroquinolones of the ethidium bromide-adapted culture results from its extrusion from the cells.29 31 However, one cannot exclude the possibility that other chromosomal mutations may have occurred during the adaptation process, which may contribute to the increased phenotypic resistance of ATCC 25923EtBr. Efux-based resistance can be reversed or reduced by agents that are known to inhibit the activity of EPs of MDR bacteria.22 Among the several inhibitors tested, the phenothiazines as well as reserpine, all of which have been described as inhibitors of NorA, were the ones showing the highest effect in reducing the MICs of several drugs against ATCC 25923EtBr.13,16,32 On the other hand, verapamil was less efcient in reducing ethidium bromide-induced resistance towards some of the drugs, and neither ouabain nor CCCP altered the susceptibility of the ethidium bromide-adapted strain to any of the agents employed. Since several S. aureus EPs, including NorA, use the proton motive force to promote the transport of their substrates, we were expecting to observe some effect of CCCP, as noted by others, in assays of uoroquinolone accumulation by S. aureus.3,32,43 However, the CCCP concentrations used in those studies (100 mM) were far greater than the one used here
511
Couto et al.
(0.88 mM). Concentrations of CCCP of 100 mM have been recently shown to produce signicant killing of bacteria.27 Ng et al. 32 noted that when working with 1 mM CCCP, reversal of noroxacin accumulation by S. aureus cells corresponded to only 6% 10% of that observed with 100 mM CCCP. The fact that thioridazine, chlorpromazine and reserpine also had some effect on the MICs for the original ATCC 25923 culture towards the same drugs suggests basal intrinsic efux activity, in accordance with that reported by Kaatz and Seo,43 who described low-level expression of NorA in an S. aureus strain not exposed to any drug. This low-level expression may account for the slight decrease in uorescence observable in the uorometric assay for the parental strain, after 18 min incubation in the absence of EPIs (Figure 2a). While this paper was in review, a report by Garvey and Piddock44 was published describing the selection of efuxmediated MDR Streptococcus pneumoniae after exposure to reserpine. Their observations conrm the results in this study that demonstrate the potential for non-antibiotic efux substrates to select for MDR in S. aureus. Since this MDR phenotype was correlated at the genetic level with overexpression of NorA, we infer that, among the several ethidium bromide chromosomally encoded EPs, this is the one that cells use as a rst-line response to extrude this noxious agent. A recent study revealed that among S. aureus clinical isolates showing increased expression of EPs, the majority over-expressed a single EP gene, which for most cases was norA, whereas the remaining strains overexpressed two or more genes, most commonly norB and norC.39 These ndings support the hypothesis made here of the eventual key role played by NorA in multidrug efux by S. aureus. S. aureus ATCC 25923 has several efux systems, of which at least one is expressed at basal levels, and when these cells are challenged with increasing concentrations of a noxious agent that is a substrate of these efux systems, the cells respond by increasing its efux and survive, provided that the initial concentration of the agent is sufciently low. This process may mirror the one that eventually takes place when a patient is infected with a bacterium and is given an antibiotic whose nal concentration is below the one necessary to effectively kill the microorganism. By activating and/or over-expressing the cellular systems of drug efux, the bacteria may be able to survive nonlethal concentrations of the drugs and become refractory to therapy.
Transparency declarations
None to declare.
References
1. Lowy FD. Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest 2003; 111: 126573. 2. Poole K. Efux pumps as antimicrobial resistance mechanisms. Ann Med 2007; 39: 16276. 3. Yoshida H, Bogaki M, Nakamura S et al. Nucleotide sequence and characterization of the Staphylococcus aureus norA gene, which confers resistance to quinolones. J Bacteriol 1990; 172: 69429. 4. Truong-Bolduc QC, Dunman PM, Strahilevitz J et al. MgrA is a multiple regulator of two new efux pumps in Staphylococcus aureus. J Bacteriol 2005; 187: 2395405. 5. Truong-Bolduc QC, Strahilevitz J, Hooper DC. NorC a new efux pump regulated by MgrA of Staphylococcus aureus. Antimicrob Agents Chemother 2006; 50: 11047. 6. Huang J, OToole P, Shen W et al. Novel chromosomally encoded multidrug efux transporter MdeA in Staphylococcus aureus. Antimicrob Agents Chemother 2004; 48: 90917. 7. Yamada Y, Hideka K, Shiota S et al. Gene cloning and characterization of SdrM, a chromosomally-encoded multidrug efux pump, from Staphylococcus aureus. Biol Pharm Bull 2006; 29: 5546. 8. Tennent JM, Lyon BR, Gillespie MT et al. Cloning and expression of Staphylococcus aureus plasmid-mediated quaternary ammonium resistance in Escherichia coli. Antimicrob Agents Chemother 1985; 27: 79 83. 9. Kaatz GW, McAleese F, Seo SM. Multidrug resistance in Staphylococcus aureus due to overexpression of a novel multidrug and toxin extrusion (MATE) transport protein. Antimicrob Agents Chemother 2005; 49: 185764. 10. Narui K, Noguchi N, Wakasugi K et al. Cloning and characterization of a novel chromosomal drug efux gene in Staphylococcus aureus. Biol Pharm Bull 2002; 25: 15336. 11. Paulsen IT, Brown MH, Dunstan SJ et al. Molecular characterization of the staphylococcal multidrug resistance export protein QacC. J Bacteriol 1995; 177: 282733. 12. Kaatz GW, Seo SM, Ruble CA. Efux-mediated uoroquinolones resistance in Staphylococcus aureus. Antimicrob Agents Chemother 1993; 37: 108694. 13. Neyfakh AA, Borsch CM, Kaatz GW. Fluoroquinolone resistance protein NorA of Staphylococcus aureus is a multidrug efux transporter. Antimicrob Agents Chemother 1993; 37: 1289. 14. Kristiansen MM, Leandro C, Ordway D et al. Phenothiazines alter resistance of methicillin-resistant strains of Staphylococcus aureus (MRSA) to oxacillin in vitro. Int J Antimicrob Agents 2003; 22: 2503. 15. Kristiansen MM, Leandro C, Ordway D et al. Thioridazine reduces resistance of methicillin-resistant Staphylococcus aureus by inhibiting a reserpine-sensitive efux pump. In Vivo 2006; 20: 3616. 16. Kaatz GW, Mougdal VV, Seo SM et al. Phenothiazines and thioxanthenes inhibit multidrug efux pump activity in Staphylococcus aureus. Antimicrob Agents Chemother 2003; 47: 71926. 17. Viveiros M, Portugal I, Bettencourt R et al. Isoniazid-induced transient high-level resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2002; 46: 280410. 18. Viveiros M, Jesus A, Brito M et al. Inducement and reversal of tetracycline resistance in Escherichia coli K-12 and expression of proton gradient-dependent multidrug efux pump genes. Antimicrob Agents Chemother 2005; 49: 357882.
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
Acknowledgements
We acknowledge the assistance of Clara Leandro in the preparation of the ethidium bromide-adapted culture. The authors nia de Lencastre (Laboratory of are also grateful to Herm Molecular Genetics, ITQB/UNL) for access to PFGE facilities.
Funding
This work was partially funded by Project Ref. Proc. 61056, o Calouste Gulbenkian (Portugal). M. M. was supfrom Fundac a o para a ported by grant SFRH/BD/14319/2003 from Fundac a ncia e a Tecnologia (FCT, Portugal). Cie
512
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012
513